Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

Science.gov (United States)

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

Molecular nature of alpha-globin genes in the Saudi population

Directory of Open Access Journals (Sweden)

J. Francis Borgio

2015-11-01

Full Text Available Alpha-thalassemia (α-thal is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal. Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis.

S1 nuclease analysis of α-globin gene expression in preleukemic patients with acquired hemoglobin H disease after transfer to mouse erythroleukemia cells

International Nuclear Information System (INIS)

Helder, J.; Deisseroth, A.

1987-01-01

The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients

Fate of a redundant gamma-globin gene in the atelid clade of New World monkeys: implications concerning fetal globin gene expression.

Science.gov (United States)

Meireles, C M; Schneider, M P; Sampaio, M I; Schneider, H; Slightom, J L; Chiu, C H; Neiswanger, K; Gumucio, D L; Czelusniak, J; Goodman, M

1995-01-01

Conclusive evidence was provided that gamma 1, the upstream of the two linked simian gamma-globin loci (5'-gamma 1-gamma 2-3'), is a pseudogene in a major group of New World monkeys. Sequence analysis of PCR-amplified genomic fragments of predicted sizes revealed that all extant genera of the platyrrhine family Atelidae [Lagothrix (woolly monkeys), Brachyteles (woolly spider monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys)] share a large deletion that removed most of exon 2, all of intron 2 and exon 3, and much of the 3' flanking sequence of gamma 1. The fact that two functional gamma-globin genes were not present in early ancestors of the Atelidae (and that gamma 1 was the dispensible gene) suggests that for much or even all of their evolution, platyrrhines have had gamma 2 as the primary fetally expressed gamma-globin gene, in contrast to catarrhines (e.g., humans and chimpanzees) that have gamma 1 as the primary fetally expressed gamma-globin gene. Results from promoter sequences further suggest that all three platyrrhine families (Atelidae, Cebidae, and Pitheciidae) have gamma 2 rather than gamma 1 as their primary fetally expressed gamma-globin gene. The implications of this suggestion were explored in terms of how gene redundancy, regulatory mutations, and distance of each gamma-globin gene from the locus control region were possibly involved in the acquisition and maintenance of fetal, rather than embryonic, expression. Images Fig. 2 PMID:7535927

Asynchronous DNA replication within the human β-globin gene locus

International Nuclear Information System (INIS)

Epner, E.; Forrester, W.C.; Groudine, M.

1988-01-01

The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks

the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

International Nuclear Information System (INIS)

Abass, M.M.E.

2004-01-01

β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

Science.gov (United States)

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

Science.gov (United States)

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing

Nonsense mutations in the human β-globin gene affect mRNA metabolism

International Nuclear Information System (INIS)

Baserga, S.J.; Benz, E.J. Jr.

1988-01-01

A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

Beta thalassemia - a review

Directory of Open Access Journals (Sweden)

R Jha

2014-09-01

Full Text Available Thalassemia is a globin gene disorder that results in a diminished rate of synthesis of one or more of the globin chains. About 1.5% of the global population (80 to 90 million people are carriers of beta Thalassemia. More than 200 mutations are described in beta thalassemia. However not all mutations are common in different ethnic groups. The only effective way to reduce burden of thalassemia is to prevent birth of homozygotes. Diagnosis of beta thalassemia can be done by fetal DNA analysis for molecular defects of beta thalassemia or by fetal blood analysis. Hematopoietic stem cell transplantation is the only available curative approach for Thalassemia. Many patients with thalassemia in underdeveloped nations die in childhood or adolescence. Programs that provide acceptable care, including transfusion of safe blood and supportive therapy including chelation must be established.DOI: http://dx.doi.org/10.3126/jpn.v4i8.11609 Journal of Pathology of Nepal; Vol.4,No. 8 (2014 663-671

Studies of globin gene expression in differentiating erythroid cells

International Nuclear Information System (INIS)

Sullivan, T.D.

1985-01-01

The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

Increased expression of alpha- and beta-globin mRNAs at the pituitary following exposure to estrogen during the critical period of neonatal sex differentiation in the rat

DEFF Research Database (Denmark)

Leffers, H; Navarro, V M; Nielsen, John E

2006-01-01

Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element in the neuroe......Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element......, we screened for differentially expressed genes at the pituitary and hypothalamus of rats after neonatal exposure to estradiol benzoate. Our analyses identified persistent up-regulation of alpha- and beta-globin mRNAs at the pituitary following neonatal estrogenization. This finding was confirmed...... by combination of RT-PCR analyses and in situ hybridization. Induction of alpha- and beta-globin mRNA expression at the pituitary by neonatal exposure to estrogen was demonstrated as dose-dependent and it was persistently detected up to puberty. In contrast, durable up-regulation of alpha- and beta-globin genes...

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

Science.gov (United States)

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Importance of globin gene order for correct developmental expression.

NARCIS (Netherlands)

O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)

1991-01-01

textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the

Deletion of a region that is a candidate for the difference between the deletion forms of hereditary persistence of fetal hemoglobin and deltabeta-thalassemia affects beta- but not gamma-globin gene expression.

NARCIS (Netherlands)

R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)

1999-01-01

textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch

Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

OpenAIRE

Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

1981-01-01

Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...

Genome scan identifies a locus affecting gamma-globin expression in human beta-cluster YAC transgenic mice

Energy Technology Data Exchange (ETDEWEB)

Lin, S.D.; Cooper, P.; Fung, J.; Weier, H.U.G.; Rubin, E.M.

2000-03-01

Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression of human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.

Regulated expression of genes inserted at the human chromosomal β-globin locus by homologous recombination

International Nuclear Information System (INIS)

Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.

1988-01-01

The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation

High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

Science.gov (United States)

Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

2018-01-02

Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

Distinctive patterns of evolution of the δ-globin gene (HBD in primates.

Directory of Open Access Journals (Sweden)

Ana Moleirinho

Full Text Available In most vertebrates, hemoglobin (Hb is a heterotetramer composed of two dissimilar globin chains, which change during development according to the patterns of expression of α- and β-globin family members. In placental mammals, the β-globin cluster includes three early-expressed genes, ε(HBE-γ(HBG-ψβ(HBBP1, and the late expressed genes, δ (HBD and β (HBB. While HBB encodes the major adult β-globin chain, HBD is weakly expressed or totally silent. Paradoxically, in human populations HBD shows high levels of conservation typical of genes under strong evolutionary constraints, possibly due to a regulatory role in the fetal-to-adult switch unique of Anthropoid primates. In this study, we have performed a comprehensive phylogenetic and comparative analysis of the two adult β-like globin genes in a set of diverse mammalian taxa, focusing on the evolution and functional divergence of HBD in primates. Our analysis revealed that anthropoids are an exception to a general pattern of concerted evolution in placental mammals, showing a high level of sequence conservation at HBD, less frequent and shorter gene conversion events. Moreover, this lineage is unique in the retention of a functional GATA-1 motif, known to be involved in the control of the developmental expression of the β-like globin genes. We further show that not only the mode but also the rate of evolution of the δ-globin gene in higher primates are strictly associated with the fetal/adult β-cluster developmental switch. To gain further insight into the possible functional constraints that have been shaping the evolutionary history of HBD in primates, we calculated dN/dS (ω ratios under alternative models of gene evolution. Although our results indicate that HBD might have experienced different selective pressures throughout primate evolution, as shown by different ω values between apes and Old World Monkeys + New World Monkeys (0.06 versus 0.43, respectively, these estimates

Effect ALPHA Globalin Gene Deletion and GAMMA Globin Gene -158 (C/T) Polymorphism in BETA- Thalassaemic Patients

International Nuclear Information System (INIS)

EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.

2008-01-01

The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

Science.gov (United States)

Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

2006-10-01

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

International Nuclear Information System (INIS)

Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

1988-01-01

The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies

Directory of Open Access Journals (Sweden)

Rita de Cassia Mousinho-Ribeiro

2003-01-01

Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.

Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.

Science.gov (United States)

Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S

1999-09-01

Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.

Compensatory increase in alpha 1-globin gene expression in individuals heterozygous for the alpha-thalassemia-2 deletion.

OpenAIRE

Liebhaber, S A; Cash, F E; Main, D M

1985-01-01

alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...

Search for antisense copies of beta-globin mRNA in anemic mouse spleen

Directory of Open Access Journals (Sweden)

Taylor John M

2001-03-01

Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

Science.gov (United States)

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Análise dos haplótipos do gene da betaS-globina no Ceará Analysis of betaS-globin gene haplotypes in Ceará, Brazil

Directory of Open Access Journals (Sweden)

Gentil Claudino de Galiza Neto

2005-10-01

Full Text Available No presente trabalho abordam-se vários aspectos relacionados à natureza molecular da anemia falciforme (AF, desordem hematológica de caráter hereditário. A descoberta do polimorfismo do DNA no grupamento do gene betaS, originando diferentes haplótipos da doença, permitiu ampliar o conhecimento em torno da heterogeneidade clínica observada nos pacientes falcêmicos nas mais diversas regiões do mundo. Analisaram-se os diferentes haplótipos e seus parâmetros hematológicos, presentes em um grupo de 22 pacientes naturais e procedentes do estado do Ceará. A distribuição das freqüências dos haplótipos encontrados foi de 55,9% para Benin; 41,2% para República Centro-Africana (CAR; e de 2,9% para o haplótipo Senegal. Esses dados, em comparação com os demais estudos realizados no Brasil, mostram associação entre os seus valores para um alfa de 5% (p The present work deals with numerous aspects related to the molecular nature of sickle cell anemia. The discovery of the DNA polymorphism in the betas-globin gene cluster, gave origin to different haplotypes of the disease, making possible to enlarge the knowledge about the clinical heterogenity observed on the patients with sickle cell disease, in the various regions of the world. The different haplotypes and its hematological parameters were analysed in a group of 22 patients born in the State of Ceará, northeast of Brazil. The distribution found in the haplotypes frequency was of 55.9% for the Benin, of 41.2% for the CAR, and of 2.9% for Senegal haplotype. The data, compared to the others works done in Brazil, show relations among their values to alpha of 5% (p < 0,05. The results make possible a full understanding of the pathophisiology of the illness and of its clinical complexity in our State, as well as it allows a better knowledge of the sickle cell disease in our country.

In vivo protein-DNA interactions at the β-globin gene locus

International Nuclear Information System (INIS)

Tohru Ikuta; Yuet Wai Kan

1991-01-01

The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

Science.gov (United States)

Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

2018-01-01

The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

Activation of Fetal γ-globin Gene Expression via Direct Protein Delivery of Synthetic Zinc-finger DNA-Binding Domains

Directory of Open Access Journals (Sweden)

Mir A Hossain

2016-01-01

Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.

Chicken globin gene transcription is cell lineage specific during the time of the switch

International Nuclear Information System (INIS)

Lois, R.; Martinson, H.G.

1989-01-01

Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia.

Science.gov (United States)

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-12-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.

Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

International Nuclear Information System (INIS)

Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

1987-01-01

The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

Repair of full-thickness articular cartilage defects by cultured mesenchymal stem cells transfected with the transforming growth factor {beta}{sub 1} gene

Energy Technology Data Exchange (ETDEWEB)

Guo Xiaodong [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Zheng Qixin [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Yang Shuhua [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Shao Zengwu [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Yuan Quan [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Pan Zhengqi [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Tang Shuo [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Liu Kai [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Quan Daping [Institute of Polymer Science, School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)

2006-12-15

Articular cartilage repair remains a clinical and scientific challenge with increasing interest focused on the combined techniques of gene transfer and tissue engineering. Transforming growth factor beta 1 (TGF-{beta}{sub 1}) is a multifunctional molecule that plays a central role in promotion of cartilage repair, and inhibition of inflammatory and alloreactive immune response. Cell mediated gene therapy can allow a sustained expression of TGF-{beta}{sub 1} that may circumvent difficulties associated with growth factor delivery. The objective of this study was to investigate whether TGF-{beta}{sub 1} gene modified mesenchymal stem cells (MSCs) could enhance the repair of full-thickness articular cartilage defects in allogeneic rabbits. The pcDNA{sub 3}-TGF-{beta}{sub 1} gene transfected MSCs were seeded onto biodegradable poly-L-lysine coated polylactide (PLA) biomimetic scaffolds in vitro and allografted into full-thickness articular cartilage defects in 18 New Zealand rabbits. The pcDNA{sub 3} gene transfected MSCs/biomimetic scaffold composites and the cell-free scaffolds were taken as control groups I and II, respectively. The follow-up times were 2, 4, 12 and 24 weeks. Macroscopical, histological and ultrastructural studies were performed. In vitro SEM studies found that abundant cartilaginous matrices were generated and completely covered the interconnected pores of the scaffolds two weeks post-seeding in the experimental groups. In vivo, the quality of regenerated tissue improved over time with hyaline cartilage filling the chondral region and a mixture of trabecular and compact bone filling the subchondral region at 24 weeks post-implantation. Joint repair in the experimental groups was better than that of either control group I or II, with respect to: (1) synthesis of hyaline cartilage specific extracellular matrix at the upper portion of the defect; (2) reconstitution of the subchondral bone at the lower portion of the defect and (3) inhibition of

A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

Science.gov (United States)

Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

2016-01-01

We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

Synthetic review on the different anthropological aspects of ...

African Journals Online (AJOL)

Hemoglobinopathies are a group of hereditary hemolytic anemia characterized by qualitative (sickle cell disease) or quantitative (thalassemia) defects in the alpha or beta-globin chain synthesis. Homozygotes or compound heterozygotes for the mutated alpha or beta-globin genes can cause severe anemia at an early age.

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

Science.gov (United States)

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

NARCIS (Netherlands)

Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)

2018-01-01

textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of

Cellular promoters incorporated into the adenovirus genome: effects of viral regulatory elements on transcription rates and cell specificity of albumin and beta-globin promoters.

OpenAIRE

Babiss, L E; Friedman, J M; Darnell, J E

1986-01-01

In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...

Anaesthesia for a patient with beta thalassaemia major

African Journals Online (AJOL)

Creative Commons License [CC BY-NC-ND 4.0] ... monitoring and management instituted. The first arterial blood ... thalassaemia is a defect of the beta globin chains of the ... Decreased supply due to anaemia, chronic infections and frequent ...

A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

Science.gov (United States)

Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

2018-01-01

Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

Science.gov (United States)

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Dominant control region of the human β- like globin gene cluster

NARCIS (Netherlands)

Blom van Assendelft, Margaretha van

1989-01-01

The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work

Thalassemia

Science.gov (United States)

Mediterranean anemia; Cooley anemia; Beta thalassemia; Alpha thalassemia ... alpha globin protein are missing or changed (mutated). Beta thalassemia occurs when similar gene defects affect production of ...

A phylogenomic profile of globins

Directory of Open Access Journals (Sweden)

Dewilde Sylvia

2006-04-01

Full Text Available Abstract Background Globins occur in all three kingdoms of life: they can be classified into single-domain globins and chimeric globins. The latter comprise the flavohemoglobins with a C-terminal FAD-binding domain and the gene-regulating globin coupled sensors, with variable C-terminal domains. The single-domain globins encompass sequences related to chimeric globins and «truncated» hemoglobins with a 2-over-2 instead of the canonical 3-over-3 α-helical fold. Results A census of globins in 26 archaeal, 245 bacterial and 49 eukaryote genomes was carried out. Only ~25% of archaea have globins, including globin coupled sensors, related single domain globins and 2-over-2 globins. From one to seven globins per genome were found in ~65% of the bacterial genomes: the presence and number of globins are positively correlated with genome size. Globins appear to be mostly absent in Bacteroidetes/Chlorobi, Chlamydia, Lactobacillales, Mollicutes, Rickettsiales, Pastorellales and Spirochaetes. Single domain globins occur in metazoans and flavohemoglobins are found in fungi, diplomonads and mycetozoans. Although red algae have single domain globins, including 2-over-2 globins, the green algae and ciliates have only 2-over-2 globins. Plants have symbiotic and nonsymbiotic single domain hemoglobins and 2-over-2 hemoglobins. Over 90% of eukaryotes have globins: the nematode Caenorhabditis has the most putative globins, ~33. No globins occur in the parasitic, unicellular eukaryotes such as Encephalitozoon, Entamoeba, Plasmodium and Trypanosoma. Conclusion Although Bacteria have all three types of globins, Archaeado not have flavohemoglobins and Eukaryotes lack globin coupled sensors. Since the hemoglobins in organisms other than animals are enzymes or sensors, it is likely that the evolution of an oxygen transport function accompanied the emergence of multicellular animals.

Chromosome 11-linked determinant controls fetal globin expression and the fetal-to-adult globin switch

International Nuclear Information System (INIS)

Melis, M.; Demopulos, G.; Najfeld, V.; Zhang, J.W.; Brice, M.; Papayannopoulou, T.; Stamatoyannopoulos, G.

1987-01-01

Hybrids formed by fusing mouse erythroleukemia (MEL) cells with human fetal erythroid cells produce human fetal globin, but they switch to adult globin production as culture time advances. To obtain information on the chromosomal assignment of the elements that control γ-to-β switching, the authors analyzed the chromosomal composition of hybrids producing exclusively or predominantly human fetal globin and hybrids producing only adult human globin. No human chromosome was consistently present in hybrids expressing fetal globin and consistently absent in hybrids expressing adult globin. Subcloning experiments demonstrated identical chromosomal compositions in subclones displaying the fetal globin program and those that had switched to expression of the adult globin program. These data indicate that retention of only one human chromosome -- i.e., chromosome 11 -- is sufficient for expression of human fetal globin and the subsequent γ-to-β switch. The results suggest that the γ-to-β switch is controlled either cis to the β-globin locus of by a trans-acting mechanism, the genes of which reside on human chromosome 11

Association of Xmn I Polymorphism and Hemoglobin E Haplotypes on Postnatal Gamma Globin Gene Expression in Homozygous Hemoglobin E

Directory of Open Access Journals (Sweden)

Supachai Ekwattanakit

2012-01-01

Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.

An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

International Nuclear Information System (INIS)

Evans, T.; Reitman, M.; Felsenfeld, G.

1988-01-01

The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.

Directory of Open Access Journals (Sweden)

Mohammed Alanazi

Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

Science.gov (United States)

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

Geographical distribution of β-globin gene mutations in Syria.

Science.gov (United States)

Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

2018-04-11

Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

Science.gov (United States)

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

Co-inheritance of the rare β hemoglobin variants Hb Yaounde, Hb Görwihl and Hb City of Hope with other alterations in globin genes: impact in genetic counseling.

Science.gov (United States)

Vinciguerra, Margherita; Passarello, Cristina; Leto, Filippo; Cassarà, Filippo; Cannata, Monica; Maggio, Aurelio; Giambona, Antonino

2015-04-01

Nearly 1183 different molecular defects of the globin genes leading to hemoglobin variants have been identified (http://globin.bx.psu.edu) over the past decades. The purpose of this study was to report three cases, never described in the literature, of co-inheritance of three β hemoglobin variants with other alterations in globin genes and to evaluate the clinical significance to conduct an appropriate genetic counseling. We report the molecular study performed in three probands and their families, sampling during the screening program conducted at the Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at Villa Sofia-Cervello Hospital in Palermo, Italy. This work allowed us to describe the co-inheritance of three rare β hemoglobin variants with other alterations in globin genes: the β hemoglobin variant Hb Yaounde [β134(H12)Val>Ala], found for the first time in combination with ααα(anti3.7) arrangement, and the β hemoglobin variants Hb Görwihl [β5(A2)Pro>Ala] and Hb City of Hope [β69(E13)Gly>Ser], found both in association with β(0) -thalassemia. The present work emphasizes the importance of a careful evaluation of the hematological data, especially in cases of atypical hematological parameters, to carry out an adequate and complete molecular study and to formulate an appropriate genetic counseling for couples at risk. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.

Science.gov (United States)

Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi

Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.

Brain alpha- and beta-globin expression after intracerebral hemorrhage

OpenAIRE

He, Yangdong; Hua, Ya; Lee, Jin-Yul; Liu, Wenquan; Keep, Richard F; Wang, Michael M.; Xi, Guohua

2010-01-01

Our recent study has demonstrated that hemoglobin (Hb) is present in cerebral neurons and neuronal Hb is inducible after cerebral ischemia. In the present study, we examined the effects of intracerebral hemorrhage (ICH) on the mRNA levels of the α-globin (HbA) and the β-globin (HbB) components of Hb and Hb protein in the brain in vivo and in vitro. In vivo, male Sprague-Dawley rats received either a needle insertion (sham) or an infusion of autologous whole blood into the basal ganglia and we...

Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

International Nuclear Information System (INIS)

Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

2004-01-01

The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

Science.gov (United States)

Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

2018-03-01

There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

Rare and unexpected beta thalassemic mutations in Qazvin ...

African Journals Online (AJOL)

About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTAcontaining venous ...

Rare and unexpected beta thalassemic mutations in Qazvin ...

African Journals Online (AJOL)

STORAGESEVER

2010-01-04

Jan 4, 2010 ... About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTA-.

Current and future alternative therapies for beta-thalassemia major

Directory of Open Access Journals (Sweden)

Edouard de Dreuzy

2016-02-01

Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Renal tubular dysfunction nephrocalcinosis in a patient with BetaThalassemia Minor

International Nuclear Information System (INIS)

Prabahar, M.R.; Jain, M.; Chandrasekaran, V.; Indumathi, E.; Soundrarajan, P.

2008-01-01

Thalassemia is a hereditary anemia resulting from defect in hemoglobinproduction. Beta thalassemia is due to impaired production. Beta thalassemiais due to impaired production of beta globin chains, leading to a relativeexcess of alpha globin chains. The term beta thalassemia minor is used todescribe heterozygotes, who carry one normal beta globin and one betathalassemic allele. The vast majority of these patients are asymptomatic.However, a variety of renal tubular abnormalities including hypercaliuria,hypomagnesemia with renal magnesium wasting, decreased tubular absorption ofphosphorous, hypouricemia with renal uric acid wasting, renal glycosuria andtubular proteinuria have been described even in patients with betathalassemia minor. We here in report a 24-year old patient who was found tohave thalassemia minor and nephrocalcinosis with evidence of renal tubulardysfunction. Investigations revealed normal renal function, hypercalciuria,reduced tubular reabsorption of phosphorous, hypomagnesemia and renalmagnesium wasting. Screening for aminoaciduria was found to be negative. Anacid loading test revealed normal urinary acidification. Ultrasonogram of theabdomen revealed nephrocalcinosis and splenomegaly. Detailed work up foranemia showed normal white cell and platelet count while peripheral smearshowed microcytic hypochromic anemia with few target cells. Hemoglobinelectrophoresis revealed hemoglobin A of 92%, hemoglobin A2 of 6.2% andhemoglobin F of 1.8% consistent with beta thalassemia minor. Her parentalscreening was normal. A diagnosis of beta thalassemia minor with renaltubular dysfunction was made and the patient was started on thiazidediuretics to reduce hypercalciuria and advised regular follow-up. (author)

NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

Directory of Open Access Journals (Sweden)

Xingguo Zhu

Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

Science.gov (United States)

Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

2010-05-16

Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

Same β-globin gene mutation is present on nine different β-thalassemia chromosomes in a Sardinian population

International Nuclear Information System (INIS)

Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

1987-01-01

The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

Directory of Open Access Journals (Sweden)

Elza Miyuki Kimura

2015-04-01

Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.

Frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism in patients with homozygous/compound heterozygous beta thalassaemia.

Science.gov (United States)

Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila

2015-03-01

Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

Science.gov (United States)

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

Science.gov (United States)

Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

2012-01-01

Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

A Dual Reporter Mouse Model of the Human β-Globin Locus: Applications and Limitations

NARCIS (Netherlands)

P. Papadopoulos (Petros); L. Gutiérrez (Laura); R. van der Linden (Reinier); J. Kong-a-San (John); A. Maas (Alex); D.D. Drabek (Dubravka); G.P. Patrinos (George); J.N.J. Philipsen (Sjaak); F.G. Grosveld (Frank)

2012-01-01

textabstractThe human β-globin locus contains the β-like globin genes (i.e. fetal γ-globin and adult β-globin), which heterotetramerize with α-globin subunits to form fetal or adult hemoglobin. Thalassemia is one of the commonest inherited disorders in the world, which results in quantitative

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Directory of Open Access Journals (Sweden)

Giulia Breveglieri

2015-01-01

Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Science.gov (United States)

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Electron irradiation-induced defects in {beta}-SiC

Energy Technology Data Exchange (ETDEWEB)

Oshima, Ryuichiro [Osaka Prefectural Univ., Sakai (Japan). Reseach Inst. for Advanced Science and Technology

1996-04-01

To add information of point defects in cubic crystal SiC, polycrystal {beta}-SiC on the market was used as sample and irradiated by neutron and electron. In situ observation of neutron and electron irradiation-induced defects in {beta}-SiC were carried out by ultra high-voltage electronic microscope (UHVEM) and ordinary electronic microscope. The obtained results show that the electron irradiation-induced secondary defects are micro defects less than 20 nm at about 1273K, the density of defects is from 2x10{sup 17} to 1x10{sup 18}/cc, the secondary defects may be hole type at high temperature and the preexistant defects control nuclear formation of irradiation-induced defects, effective sink. (S.Y.)

Regeneration of hyaline cartilage by cell-mediated gene therapy using transforming growth factor beta 1-producing fibroblasts.

Science.gov (United States)

Lee, K H; Song, S U; Hwang, T S; Yi, Y; Oh, I S; Lee, J Y; Choi, K B; Choi, M S; Kim, S J

2001-09-20

Transforming growth factor beta (TGF-beta) has been considered as a candidate for gene therapy of orthopedic diseases. The possible application of cell-mediated TGF-beta gene therapy as a new treatment regimen for degenerative arthritis was investigated. In this study, fibroblasts expressing active TGF-beta 1 were injected into the knee joints of rabbits with artificially made cartilage defects to evaluate the feasibility of this therapy for orthopedic diseases. Two to 3 weeks after the injection there was evidence of cartilage regeneration, and at 4 to 6 weeks the cartilage defect was completely filled with newly grown hyaline cartilage. Histological analyses of the regenerated cartilage suggested that it was well integrated with the adjacent normal cartilage at the sides of the defect and that the newly formed tissue was indeed hyaline cartilage. Our findings suggest that cell-mediated TGF-beta 1 gene therapy may be a novel treatment for orthopedic diseases in which hyaline cartilage damage has occurred.

Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

African Journals Online (AJOL)

Thalassemia is an inherited blood disorder which is divided into two groups: alpha and beta. HBA1 and HBA2 are the two genes associated with alpha thalassemia. The aim of this study is to investigate abnormal hemoglobin variants of alpha globin gene in healthy abnormal hemoglobin carrying individuals with intact beta ...

Characterization of histone H3K27 modifications in the β-globin locus

International Nuclear Information System (INIS)

Kim, Yea Woon; Kim, AeRi

2011-01-01

Research highlights: → The β-globin locus control region is hyperacetylated and monomethylated at histone H3K27. → Highly transcribed globin genes are marked by H3K27ac, but H3K27me2 is remarkable at silent globin genes in erythroid K562 cells. → Association of PRC2 subunits is comparable with H3K27me3 pattern. → Modifications of histone H3K27 are established in an enhancer-dependent manner. -- Abstract: Histone H3K27 is acetylated or methylated in the environment of nuclear chromatin. Here, to characterize the modification pattern of H3K27 in locus control region (LCR) and to understand the correlation of various H3K27 modifications with transcriptional activity of genes, we analyzed the human β-globin locus using the ChIP assay. The LCR of the human β-globin locus was enriched by H3K27ac and H3K27me1 in erythroid K562 cells. The highly transcribed globin genes were hyperacetylated at H3K27, but the repressed globin genes were highly dimethylated at this lysine in these cells. However, in non-erythroid 293FT cells, the β-globin locus was marked by a high level of H3K27me3. EZH2 and SUZ12, subunits of polycomb repressive complex 2, were comparably detected with the H3K27me3 pattern in K562 and 293FT cells. In addition, H3K27ac, H3K27me1 and H3K27me3 were established in an enhancer-dependent manner in a model minichromosomal locus containing an enhancer and its target gene. Taken together, these results show that H3K27 modifications have distinctive correlations with the chromatin state or transcription level of genes and are influenced by an enhancer.

Chromatin loops, gene positioning, and gene expression

NARCIS (Netherlands)

Holwerda, S.; de Laat, W.

2012-01-01

Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

Science.gov (United States)

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

Molecular analysis of the human β-globin locus activation region

International Nuclear Information System (INIS)

Forrester, W.C.; Novak, U.; Gelinas, R.; Groudine, M.

1989-01-01

Recently, DNA sequences containing four erythroid-specific DNase I hypersensitive sites within 20 kilobases 5' of the human ε-globin gene have been identified as an important cis-acting regulatory element, the locus activation region (LAR). Subfragments of the LAR, containing either all or only the two 5' or two 3' hypersensitive sites were linked to the human β-globin gene and analyzed for their effect on globin gene expression in stably transformed mouse erythroleukemia (MEL) cells. Constructs containing all four of the hypersensitive sites increase β-gobin mRNA levels 8- to 13-fold, while constructs with only the 5' or 3' sites increase globin expression to a lesser extent. No effect was seen when the constructs were assayed in 3T3 fibroblasts. All of the LAR derivatives form hypersensitive sites at the corresponding sequence position in MEL cells prior to and after induction of MEL cell differentiation. However, in 3T3 fibroblasts only the hypersensitive site corresponding to the previously described erythroid-specific -10.9 site was formed

Gene Therapy Approaches to Hemoglobinopathies.

Science.gov (United States)

Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio

2017-10-01

Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.

Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

Directory of Open Access Journals (Sweden)

Jorge S.B.

2003-01-01

Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

Future prospects for treatment of hemoglobinopathies.

OpenAIRE

Stamatoyannopoulos, J A

1992-01-01

Strategies for the treatment of sickle cell anemia and beta-thalassemia are founded on the knowledge that these disorders result from structural or functional defects in an adult gene for which an intact fetal counterpart exists. During the past decade, several pharmacologic agents have been investigated for their potential to ameliorate sickle cell anemia and beta-thalassemia by increasing the synthesis of fetal hemoglobin in adults. Progress in understanding globin gene regulation is now be...

Double heterozygocity for hemoglobin C and beta thalassemia dominant: A rare case of thalassemia intermedia

Directory of Open Access Journals (Sweden)

Alexandra Agapidou

2018-01-01

Full Text Available Beta thalassemia dominant results from mutations in the β globin chain gene resulting in the production of elongated, highly unstable beta globin chains. Several such mutations have been described and in a heterozygous state they may confer a phenotype more severe than that of β thalassemia trait and lead to a clinical syndrome of thalassemia intermedia and its associated complications such as extramedullary hemopoiesis, bone disease, endocrinopathies and iron overload even in the absence of transfusion. In this report we present a case of double heterozygocity for HbC and β thalassemia dominant leading to a series of complications that were treated successfully once the correct diagnosis was made.

The human ankyrin 1 promoter insulator sustains gene expression in a β-globin lentiviral vector in hematopoietic stem cells

Directory of Open Access Journals (Sweden)

Zulema Romero

Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

Science.gov (United States)

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

Science.gov (United States)

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

NARCIS (Netherlands)

A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

1996-01-01

textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

Science.gov (United States)

Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

2017-12-01

High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

Science.gov (United States)

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Genetic relationships among native americans based on b-globin gene cluster haplotype frequencies

OpenAIRE

Mousinho-Ribeiro Rita de Cassia; Pante-de-Sousa Gabriella; Santos Eduardo José Melo dos; Guerreiro João Farias

2003-01-01

The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village), Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13) had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - -) was the most common in all groups studied, with frequencies varying from 70% to 100%, followed...

Differentiation of the mRNA transcripts originating from the alpha 1- and alpha 2-globin loci in normals and alpha-thalassemics.

OpenAIRE

Liebhaber, S A; Kan, Y W

1981-01-01

The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...

Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

African Journals Online (AJOL)

Dilay Ciglidag Dungul

carrying individuals with intact beta globin gene. DNA was extracted from peripheral blood sam- ples of seven healthy carrier individuals who have abnormal hemoglobin variants and 16 control individuals from Turkey. Complete coding and intronic sequences of HBA1 and HBA2 genes were amplified by polymerase chain ...

A membrane-bound vertebrate globin.

Directory of Open Access Journals (Sweden)

Miriam Blank

Full Text Available The family of vertebrate globins includes hemoglobin, myoglobin, and other O(2-binding proteins of yet unclear functions. Among these, globin X is restricted to fish and amphibians. Zebrafish (Danio rerio globin X is expressed at low levels in neurons of the central nervous system and appears to be associated with the sensory system. The protein harbors a unique N-terminal extension with putative N-myristoylation and S-palmitoylation sites, suggesting membrane-association. Intracellular localization and transport of globin X was studied in 3T3 cells employing green fluorescence protein fusion constructs. Both myristoylation and palmitoylation sites are required for correct targeting and membrane localization of globin X. To the best of our knowledge, this is the first time that a vertebrate globin has been identified as component of the cell membrane. Globin X has a hexacoordinate binding scheme and displays cooperative O(2 binding with a variable affinity (P(50∼1.3-12.5 torr, depending on buffer conditions. A respiratory function of globin X is unlikely, but analogous to some prokaryotic membrane-globins it may either protect the lipids in cell membrane from oxidation or may act as a redox-sensing or signaling protein.

[Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

Science.gov (United States)

Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

2002-08-01

To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV /=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were

Infusion of Autologous Retrodifferentiated Stem Cells into Patients with Beta-Thalassemia

Directory of Open Access Journals (Sweden)

Ilham Saleh Abuljadayel

2006-01-01

Full Text Available Beta-thalassemia is a genetic, red blood cell disorder affecting the beta-globin chain of the adult hemoglobin gene. This results in excess accumulation of unpaired alpha-chain gene products leading to reduced red blood cell life span and the development of severe anemia. Current treatment of this disease involves regular blood transfusion and adjunct chelation therapy to lower blood transfusion–induced iron overload. Fetal hemoglobin switching agents have been proposed to treat genetic blood disorders, such as sickle cell anemia and beta-thalassemia, in an effort to compensate for the dysfunctional form of the beta-globin chain in adult hemoglobin. The rationale behind this approach is to pair the excess normal alpha-globin chain with the alternative fetal gamma-chain to promote red blood cell survival and ameliorate the anemia. Reprogramming of differentiation in intact, mature, adult white blood cells in response to inclusion of monoclonal antibody CR3/43 has been described. This form of retrograde development has been termed “retrodifferentiation”, with the ability to re-express a variety of stem cell markers in a heterogeneous population of white blood cells. This form of reprogramming, or reontogeny, to a more pluripotent stem cell state ought to recapitulate early hematopoiesis and facilitate expression of a fetal and/or adult program of hemoglobin synthesis or regeneration on infusion and subsequent redifferentiation. Herein, the outcome of infusion of autologous retrodifferentiated stem cells (RSC into 21 patients with beta-thalassemia is described. Over 6 months, Infusion of 3-h autologous RSC subjected to hematopoietic-conducive conditions into patients with beta-thalassemia reduced mean blood transfusion requirement, increased mean fetal hemoglobin synthesis, and significantly lowered mean serum ferritin. This was always accompanied by an increase in mean corpuscular volume (MCV, mean corpuscular hemoglobin (MCH, and mean

Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

International Nuclear Information System (INIS)

Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

1990-08-01

The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction

Directory of Open Access Journals (Sweden)

Čokić Vladan P.

2014-01-01

Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053

The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.

Science.gov (United States)

Burgers, P M; Kornberg, A; Sakakibara, Y

1981-09-01

An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.

Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

Science.gov (United States)

Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

1995-01-01

Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

Comparison of different methods for erythroid differentiation in the K562 cell line.

Science.gov (United States)

Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

2016-08-01

To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

Conservation of the primary structure, organization, and function of the human and mouse β-globin locus-activating regions

International Nuclear Information System (INIS)

Moon, A.M.; Ley, T.J.

1990-01-01

DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

Science.gov (United States)

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

Bone regeneration of calvarial defect using marine calcareous-derived beta-tricalcium phosphate macrospheres

Directory of Open Access Journals (Sweden)

Joshua Chou

2014-02-01

Full Text Available The aim of this study was to examine the bone regeneration properties of beta-tricalcium phosphate hydrothermally converted from foraminifera carbonate exoskeleton in the repair of rat calvarial defect. These natural materials possess unique interconnected porous network with uniform pore size distribution, which can be potentially advantageous. In total, 20 adult male Wistar rats received full-thickness calvarial defect with a diameter of 5 mm. The rate of newly formed bone was measured radiologically by X-ray and micro-computed tomography and by histologic examination. After 2 weeks, the beta-tricalcium phosphate group exhibited full closure of the defect site, while control group remained unrestored at the end of the 6-week experimentation. It was observed that the newly regenerated bone thickened over the course of the experiment in the beta-tricalcium phosphate group. No soft tissue reaction was observed around the beta-tricalcium phosphate implant and the rats remained healthy. These results showed that repair of the calvarial defect can be achieved by biomimetic beta-tricalcium phosphate macrospheres, which hold potential for application as bone grafts for bone augmentation surgeries.

Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

Energy Technology Data Exchange (ETDEWEB)

Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

1995-12-01

T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

β-Globin gene sequencing of hemoglobin Austin revises the historically reported electrophoretic migration pattern.

Science.gov (United States)

Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F

2014-06-01

Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

Science.gov (United States)

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

Effects of concomitant use of fibroblast growth factor (FGF)-2 with beta-tricalcium phosphate ({beta}-TCP) on the beagle dog 1-wall periodontal defect model

Energy Technology Data Exchange (ETDEWEB)

Anzai, Jun, E-mail: anzai_jun@kaken.co.jp [Pharmacology Department, Central Research Laboratories, Kaken Pharmaceutical Co., Ltd., 14, Shinomiya, Minamigawara-cho, Yamashina-ku, Kyoto 607-8042 (Japan); Department of Periodontology, Osaka University Graduate School of Dentistry, 1-8 Yamadaoka, Suita, Osaka 565-0871 (Japan); Kitamura, Masahiro, E-mail: kitamura@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, 1-8 Yamadaoka, Suita, Osaka 565-0871 (Japan); Nozaki, Takenori, E-mail: tnozaki@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, 1-8 Yamadaoka, Suita, Osaka 565-0871 (Japan); Nagayasu, Toshie, E-mail: nagayasu_toshie@kaken.co.jp [Pharmacology Department, Central Research Laboratories, Kaken Pharmaceutical Co., Ltd., 14, Shinomiya, Minamigawara-cho, Yamashina-ku, Kyoto 607-8042 (Japan); Terashima, Akio, E-mail: terashima_akio@kaken.co.jp [Pharmacology Department, Central Research Laboratories, Kaken Pharmaceutical Co., Ltd., 14, Shinomiya, Minamigawara-cho, Yamashina-ku, Kyoto 607-8042 (Japan); Asano, Taiji, E-mail: asano_taiji@kaken.co.jp [Pharmacology Department, Central Research Laboratories, Kaken Pharmaceutical Co., Ltd., 14, Shinomiya, Minamigawara-cho, Yamashina-ku, Kyoto 607-8042 (Japan); Murakami, Shinya, E-mail: ipshinya@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, 1-8 Yamadaoka, Suita, Osaka 565-0871 (Japan)

2010-12-17

Research highlights: {yields} Concomitant use of FGF-2 and {beta}-TCP (an osteo-conductive scaffold) significantly promotes periodontal regeneration in the severe periodontitis model (1-wall defect model) of beagle dog. {yields} FGF-2 enhanced new bone formation via {beta}-TCP at the defects. {yields} In particular, FGF-2 dramatically regenerated new periodontal ligament and cementum formations at the defects, that is one of the most important healing outcomes during the process of periodontal regeneration. {yields} Epithelial downgrowth (undesirable wound healing) was decreased by administration of FGF-2. {yields} This manuscript indicates for the first time that concomitant use of FGF-2 and {beta}-TCP is efficacious in regenerating periodontal tissue following severe destruction of the tissue by progression of periodontitis. -- Abstract: The effects of concomitant use of fibroblast growth factor-2 (FGF-2) and beta-tricalcium phosphate ({beta}-TCP) on periodontal regeneration were investigated in the beagle dog 1-wall periodontal defect model. One-wall periodontal defects were created in the mesial portion of both sides of the mandibular first molars, and 0.3% FGF-2 plus {beta}-TCP or {beta}-TCP alone was administered. Radiographic evaluation was performed at 0, 3, and 6 weeks. At 6 weeks, the periodontium with the defect site was removed and histologically analyzed. Radiographic findings showed that co-administration of FGF-2 significantly increased bone mineral contents of the defect sites compared with {beta}-TCP alone. Histologic analysis revealed that the length of the regenerated periodontal ligament, the cementum, distance to the junctional epithelium, new bone height, and area of newly formed bone were significantly increased in the FGF-2 group. No abnormal inflammatory response or ankylosis was observed in either group. These findings indicate the efficacy of concomitant use of FGF-2 and {beta}-TCP as an osteoconductive material for periodontal

Variation in RNA-Seq transcriptome profiles of peripheral whole blood from healthy individuals with and without globin depletion.

Directory of Open Access Journals (Sweden)

Heesun Shin

Full Text Available BACKGROUND: The molecular profile of circulating blood can reflect physiological and pathological events occurring in other tissues and organs of the body and delivers a comprehensive view of the status of the immune system. Blood has been useful in studying the pathobiology of many diseases. It is accessible and easily collected making it ideally suited to the development of diagnostic biomarker tests. The blood transcriptome has a high complement of globin RNA that could potentially saturate next-generation sequencing platforms, masking lower abundance transcripts. Methods to deplete globin mRNA are available, but their effect has not been comprehensively studied in peripheral whole blood RNA-Seq data. In this study we aimed to assess technical variability associated with globin depletion in addition to assessing general technical variability in RNA-Seq from whole blood derived samples. RESULTS: We compared technical and biological replicates having undergone globin depletion or not and found that the experimental globin depletion protocol employed removed approximately 80% of globin transcripts, improved the correlation of technical replicates, allowed for reliable detection of thousands of additional transcripts and generally increased transcript abundance measures. Differential expression analysis revealed thousands of genes significantly up-regulated as a result of globin depletion. In addition, globin depletion resulted in the down-regulation of genes involved in both iron and zinc metal ion bonding. CONCLUSIONS: Globin depletion appears to meaningfully improve the quality of peripheral whole blood RNA-Seq data, and may improve our ability to detect true biological variation. Some concerns remain, however. Key amongst them the significant reduction in RNA yields following globin depletion. More generally, our investigation of technical and biological variation with and without globin depletion finds that high-throughput sequencing by RNA

Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

Science.gov (United States)

Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

2002-05-01

In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

Allele specific hybridization using oligonucleotide probes of very high specific activity: Discrimination of the human β/sup A/ and β/sup S/-globin genes

International Nuclear Information System (INIS)

Studencki, A.B.; Wallace, R.B.

1984-01-01

The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence

Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system.

Science.gov (United States)

Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang

2015-05-01

The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.

HS5 of the human β-globin Locus Control Region: a developmental stage-specific border in erythroid cells.

NARCIS (Netherlands)

A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)

2003-01-01

textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in

Proinsulin maturation disorder is a contributor to the defect of subsequent conversion to insulin in {beta}-cells

Energy Technology Data Exchange (ETDEWEB)

Wang, Jie, E-mail: jie.wang2@osumc.edu [Division of Endocrinology, Diabetes and Metabolism, Department of Internal Medicine, The Ohio State University, Columbus, OH (United States); Osei, Kwame [Division of Endocrinology, Diabetes and Metabolism, Department of Internal Medicine, The Ohio State University, Columbus, OH (United States)

2011-07-22

Highlights: {yields} Primary proinsulin maturation disorder is inherent in Ins2{sup +/Akita} islets/{beta}-cells. {yields} A consequence is the inefficient conversion of proinsulin to insulin. {yields} Post-translational defects occur as well in the involved PC1/3 and PC2 convertases. {yields} Proinsulin maturation chaos results in defects in the following conversion process. {yields} A link of the proinsulin maturation disorder and hyperproinsulinemia is suggested. -- Abstract: Disproportionate hyperproinsulinemia is an indicator of {beta}-cell dysfunction in diabetes and the basis underlying this abnormality remains obscure. Recently, we have found proinsulin is an aggregation-prone molecule inherent with a low relative folding rate and maintains a homeostatic balance of natively and plentiful non-natively folded states (i.e., proinsulin homeostasis, PIHO) in normal {beta}-cells as a result of the integration of maturation and disposal processes. PIHO is susceptible to environmental and genetic influences. Perturbation of PIHO produces a number of toxic consequences with known association to {beta}-cell failure in diabetes. To explore whether the perturbation of PIHO has a link to disproportionate hyperproinsulinemia, we investigated proinsulin conversion and the involved prohormone convertase 1/3 (PC1/3) and 2 (PC2) in mouse Ins2{sup +/Akita} islets/{beta}-cells that preserve a primary PIHO disorder due to a mutation (C96Y) in the insulin 2 (Ins2) gene. Our metabolic-labeling studies found an increased ratio of proinsulin to insulin in the cellular or released proteins of Ins2{sup +/Akita} islets. Histological, metabolic-labeling, and RT-PCR analyses revealed decreases of the PC1/3 and PC2 immunoreactivities in the {beta}-cells of Ins2{sup +/Akita} islets in spite of no declines of these two convertases at the transcriptional and translational levels. Immunoblot analyses in cloned Ins2{sup +/Akita} {beta}-cells further confirmed the increased ratio of proinsulin

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

Science.gov (United States)

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

Directory of Open Access Journals (Sweden)

Jackie A Pallister

Full Text Available BACKGROUND: The cane toad, Bufo (Chaunus marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. METHODOLOGY/PRINCIPAL FINDINGS: The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs, developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin and genetic (adult globin mRNA levels measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. CONCLUSIONS/SIGNIFICANCE: While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

Science.gov (United States)

Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

2011-01-25

The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

Science.gov (United States)

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

Science.gov (United States)

Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

2007-05-01

We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

Investigation of benzo(a)pyrene-globin adducts

Energy Technology Data Exchange (ETDEWEB)

Wallin, H; Jeffre, A M; Santella, R M

1987-05-01

The nature of the adducts formed between benzo(a)pyrene (BP) and globin were investigated in animals treated with (/sup 3/H)BP. Modification levels on globin were determined by radioactivity measurements. Since BP tetraols can be released from benzo(a)pyrene diol epoxide modified protein and DNA by acid treatment, globin samples were treated with acid, released tetraols separated by HPLC and quantitated by scintillation counting. In addition, acid released material was measured in competitive enzyme linked immunosorbent assay (ELISA) using antibodies which recognize BP tetraols. Both measurements indicate that only 2% of bound radioactivity could be released as free BP tetraols. These studies indicate that benzo(a)pyrene diol epoxide may not be the major metabolite of BP involved in globin binding. (author). 14 refs.

Human β-globin locus control region: Analysis of the 5' DNase I hypersensitive site HS 2 in transgenic mice

International Nuclear Information System (INIS)

Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.

1991-01-01

The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained

Gene expression analysis of interferon-beta treatment in multiple sclerosis

DEFF Research Database (Denmark)

Sellebjerg, F.; Datta, P.; Larsen, J.

2008-01-01

by treatment with IFN-beta. We use DNA microarrays to study gene expression in 10 multiple sclerosis (MS) patients who began de novo treatment with IFN-beta. After the first injection of IFN-beta, the expression of 74 out of 3428 genes changed at least two-fold and statistically significantly (after Bonferroni......Treatment with interferon-beta (IFN-beta) induces the expression of hundreds of genes in blood mononuclear cells, and the expression of several genes has been proposed as a marker of the effect of treatment with IFN-beta. However, to date no molecules have been identified that are stably induced...

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Evolutionary and functional properties of a two-locus β-globin polymorphism in Indian house mice

DEFF Research Database (Denmark)

Runck, Amy M; Weber, Roy E.; Fago, Angela

2010-01-01

exceeded neutral expectations, and reconstructed haplotype networks for both β-globin paralogs revealed extensive allele sharing with several other closely related species of Mus. However, despite this suggestive evidence for balancing selection, O2-equilibrium curves revealed no discernible functional......Electrophoretic surveys of hemoglobin (Hb) polymorphism in house mice from South Asia and the Middle East have revealed that two alternative β-globin haplotypes, Hbbd and Hbbp, are often present at intermediate frequencies in geographically disparate populations. Both haplotypes harbor two......) are distinguished by two amino acid substitutions. To investigate the possible adaptive significance of the Hbbd/Hbbp polymorphism we conducted a population genetic analysis of the duplicated β-globin genes of Indian house mice (Mus castaneus) in conjunction with experimental studies of Hb function in inbred...

Effects of transforming growth factor-beta1 and vascular endothelial growth factor 165 gene transfer on Achilles tendon healing.

Science.gov (United States)

Hou, Yu; Mao, ZeBin; Wei, XueLei; Lin, Lin; Chen, LianXu; Wang, HaiJun; Fu, Xin; Zhang, JiYing; Yu, Changlong

2009-07-01

Repaired Achilles tendons typically take weeks before they are strong enough to handle physiological loads. Gene therapy is a promising treatment for Achilles tendon defects. The aim of the present study was to evaluate the histological/biomechanical effects of Transforming growth factor-beta1 (TGF-beta1) and vascular endothelial growth factor 165 (VEGF(165)) gene transfer on Achilles tendon healing in rabbits. Bone Marrow-Derived Mesenchymal Stem Cells (BMSCs) were transduced with adenovirus carrying human TGF-beta1 cDNA (Ad-TGF-beta1), human VEGF(165) cDNA (Ad-VEGF(165)), or both (PIRES-TGF-beta1/VEGF(165)) Viruses, no cDNA (Ad-GFP), and the BMSCs without gene transfer and the intact tendon were used as control. BMSCs were surgically implanted into the experimentally injured Achilles tendons. TGF-beta1 distribution, cellularity, nuclear aspect ratio, nuclear orientation angle, vascular number, collagen synthesis, and biomechanical features were measured at 1, 2, 4, and 8 weeks after surgery. The TGF-beta1 and TGF beta 1/VEGF(165) co-expression groups exhibited improved parameters compared with other groups, while the VEGF(165) expression group had a negative impact. In the co-expression group, the angiogenesis effects of VEGF(165) were diminished by TGF-beta1, while the collagen synthesis effects of TGF-beta1 were unaltered by VEGF(165). Thus treatment with TGF-beta1 cDNA-transduced BMSCs grafts is a promising therapy for acceleration and improvement of tendon healing, leading to quicker recovery and improved biomechanical properties of Achilles tendons.

Bone regeneration with active angiogenesis by basic fibroblast growth factor gene transfected mesenchymal stem cells seeded on porous beta-TCP ceramic scaffolds.

Science.gov (United States)

Guo, Xiaodong; Zheng, Qixin; Kulbatski, Iris; Yuan, Quan; Yang, Shuhua; Shao, Zengwu; Wang, Hong; Xiao, Baojun; Pan, Zhengqi; Tang, Shuo

2006-09-01

Large segmental bone defect repair remains a clinical and scientific challenge with increasing interest focused on combining gene transfer with tissue engineering techniques. Basic fibroblast growth factor (bFGF) is one of the most prominent osteogenic growth factors that has the potential to accelerate bone healing by promoting the proliferation and differentiation of mesenchymal stem cells (MSCs) and the regeneration of capillary vasculature. However, the short biological half-lives of growth factors may impose severe restraints on their clinical usefulness. Gene-based delivery systems provide a better way of achieving a sustained high concentration of growth factors locally in the defect and delivering a more biologically active product than that achieved by exogenous application of recombinant proteins. The objective of this experimental study was to investigate whether the bFGF gene modified MSCs could enhance the repair of large segmental bone defects. The pcDNA3-bFGF gene transfected MSCs were seeded on biodegradable porous beta tricalcium phosphate (beta-TCP) ceramics and allografted into the 15 mm critical-sized segmental bone defects in the radius of 18 New Zealand White rabbits. The pcDNA3 vector gene transfected MSCs were taken as the control. The follow-up times were 2, 4, 6, 8, 10 and 12 weeks. Scanning electron microscopic, roentgenographic, histologic and immunohistological studies were used to assess angiogenesis and bone regeneration. In vitro, the proliferation and differentiation of bFGF gene transfected MSCs were more active than that of the control groups. In vivo, significantly more new bone formation accompanied by abundant active capillary regeneration was observed in pores of the ceramics loaded with bFGF gene transfected MSCs, compared with control groups. Transfer of gene encoding bFGF to MSCs increases their osteogenic properties by enhancing capillary regeneration, thus providing a rich blood supply for new bone formation. This new b

Bone regeneration with active angiogenesis by basic fibroblast growth factor gene transfected mesenchymal stem cells seeded on porous {beta}-TCP ceramic scaffolds

Energy Technology Data Exchange (ETDEWEB)

Guo Xiaodong [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China); Zheng Qixin [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China); Kulbatski, Iris [Division of Cellular and Molecular Biology, Toronto Western Research Institute, University of Toronto, Toronto, Ontario M5T 2S8 (Canada); Yuan Quan [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China); Yang Shuhua [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China); Shao Zengwu [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China); Wang Hong [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China); Xiao Baojun [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China); Pan Zhengqi [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China); Tang Shuo [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1277 Jiefang Avenue, Wuhan 430022 (China)

2006-09-15

Large segmental bone defect repair remains a clinical and scientific challenge with increasing interest focused on combining gene transfer with tissue engineering techniques. Basic fibroblast growth factor (bFGF) is one of the most prominent osteogenic growth factors that has the potential to accelerate bone healing by promoting the proliferation and differentiation of mesenchymal stem cells (MSCs) and the regeneration of capillary vasculature. However, the short biological half-lives of growth factors may impose severe restraints on their clinical usefulness. Gene-based delivery systems provide a better way of achieving a sustained high concentration of growth factors locally in the defect and delivering a more biologically active product than that achieved by exogenous application of recombinant proteins. The objective of this experimental study was to investigate whether the bFGF gene modified MSCs could enhance the repair of large segmental bone defects. The pcDNA3-bFGF gene transfected MSCs were seeded on biodegradable porous {beta} tricalcium phosphate ({beta}-TCP) ceramics and allografted into the 15 mm critical-sized segmental bone defects in the radius of 18 New Zealand White rabbits. The pcDNA3 vector gene transfected MSCs were taken as the control. The follow-up times were 2, 4, 6, 8, 10 and 12 weeks. Scanning electron microscopic, roentgenographic, histologic and immunohistological studies were used to assess angiogenesis and bone regeneration. In vitro, the proliferation and differentiation of bFGF gene transfected MSCs were more active than that of the control groups. In vivo, significantly more new bone formation accompanied by abundant active capillary regeneration was observed in pores of the ceramics loaded with bFGF gene transfected MSCs, compared with control groups. Transfer of gene encoding bFGF to MSCs increases their osteogenic properties by enhancing capillary regeneration, thus providing a rich blood supply for new bone formation. This new

beta. -Amyloid gene dosage in Alzheimer's disease

Energy Technology Data Exchange (ETDEWEB)

Murdoch, G H; Manuelidis, L; Kim, J H; Manuelidis, E E

1988-01-11

The 4-5 kd amyloid ..beta..-peptide is a major constituent of the characteristic amyloid plaque of Alzheimer's disease. It has been reported that some cases of sporatic Alzheimer's disease are associated with at least a partial duplication of chromosome 21 containing the gene corresponding to the 695 residue precursor of this peptide. To contribute to an understanding of the frequency to such a duplication event in the overall Alzheimer's population, the authors have determined the gene dosage of the ..beta..-amyloid gene in this collection of cases. All cases had a clinical diagnosis of Alzheimer's confirmed neuropathologically. Each Alzheimer's case had an apparent normal diploid ..beta..-amyloid gene dosage, while control Down's cases had the expected triploid dosage. Thus partial duplication of chromosome 21 may be a rare finding in Alzheimer's disease. Similar conclusions were just reported in several studies of the Harvard Alzheimer collection.

Multiple splicing defects in an intronic false exon.

Science.gov (United States)

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

Science.gov (United States)

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

Science.gov (United States)

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

NARCIS (Netherlands)

Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

2001-01-01

Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

Directory of Open Access Journals (Sweden)

2006-02-01

Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

Oxygen Association-Dissociation and Stability Analysis on Mouse Hemoglobins with Mutant α- and β-Globins

Science.gov (United States)

D'Surney, S. J.; Popp, R. A.

1992-01-01

Oxygen association-dissociation and hemoglobin stability analysis were performed on mouse hemoglobins with amino acid substitutions in an α-globin (α89, His to Leu) and a β-globin (β59, Lys to Ile). The variant α-globin, designated chain 5(m) in the Hba(g2) haplotype, had a high oxygen affinity and was stable. The variant β-globin, (β(s2)) of the Hbb(s2) haplotype, also had an elevated oxygen affinity and in addition was moderately unstable in 19% isopropanol. Hemoglobins from the expected nine (Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) X Hba(a)/Hba(a);Hbb(s2)/Hbb(s2)) F(2) genotypes can be grouped into five classes of P(50) values characterized by strict additivity and dependency on mutant globin gene dosage; physiologically, both globin variants gave indistinguishable effects on oxygen affinity. The hemoglobin of normal mice (Hba(a)/Hba(a);Hbb(s)/Hbb(s)) had a P(50) = 40 mm Hg and the hemoglobin of Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) F(2) mice had a P(50) = 25 mm Hg (human P(50) = 26 mm Hg). Peripheral blood from Hba(g2)/Hba(g2);Hbb(s)/Hbb(s), Hba(a)/Hba(a);Hbb(s2)/Hbb(s2) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice exhibited normal hematological values except for a slightly higher hematocrit for Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice, slightly elevated red cell counts for mice of the three mutant genotypes, and significantly lower values for the mean corpuscular volume and mean corpuscular hemoglobin for Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice. PMID:1427042

Clusters of conserved beta cell marker genes for assessment of beta cell phenotype

DEFF Research Database (Denmark)

Martens, Geert A; Jiang, Lei; Hellemans, Karine H

2011-01-01

The aim of this study was to establish a gene expression blueprint of pancreatic beta cells conserved from rodents to humans and to evaluate its applicability to assess shifts in the beta cell differentiated state. Genome-wide mRNA expression profiles of isolated beta cells were compared to those...... of a large panel of other tissue and cell types, and transcripts with beta cell-abundant and -selective expression were identified. Iteration of this analysis in mouse, rat and human tissues generated a panel of conserved beta cell biomarkers. This panel was then used to compare isolated versus laser capture...... microdissected beta cells, monitor adaptations of the beta cell phenotype to fasting, and retrieve possible conserved transcriptional regulators....

Characterization of beta-thalassemia mutations in patients from the state of Rio Grande do Norte, Brazil

Directory of Open Access Journals (Sweden)

Zama Messala Luna da Silveira

2011-01-01

Full Text Available 35 unrelated individuals were studied for characterization as either heterozygous or homozygous for beta-thalassemia. Molecular analysis was done by PCR/RFLP to detect the mutations most commonly associated with beta-thalassemia (β0IVS-I-1, β+IVS-I-6, and β039. In the patients who showed none of these mutations, the beta-globin genes were sequenced. Of the 31 heterozygous patients, 13 (41.9% had the β+IVS-I-6 mutation, 15 (48.4% the β0IVS-I-1 mutation, 2 (6.5% the β+IVS-I-110 mutation and 1 (3.2% the β+IVS-I-5 mutation. IVS-I-6 was detected in the four homozygotes. The mutation in codon 39, often found in previous studies in Brazil, was not detected in the present case. This is the first study aiming at identifying mutations that determine beta-thalassemia in the state of Rio Grande do Norte.

BENIGN EPITHELIAL NEOPLASIA ASSOCIATED WITH BETA-HUMAN PAPILLOMA VIRUS

Directory of Open Access Journals (Sweden)

V. A. Molochkov

2014-01-01

Full Text Available Aim: To study an association between acrochordon and human papilloma virus (HPV using quantitative analysis of viral desoxyribonucleic acid (DNA; to detect different phenotypes of beta-HPV. Materials and methods: We examined 52  patients (22 immuno-suppressed patients and 30 immunocompetent subjects in the Dermatovenereology and Dermato-Oncology Department and Chronic Dialysis and Kidney Transplantation Department of the Moscow Regional Research and Clinical Institute (MONIKI. Control group included 49 healthy donors. Burr biopsy samples (micro-samples of acrochordon and intact skin (apper arm were collected in sterile conditions. After sample procession and DNA isolation using DNK-sorb-C kit (Central Research Institute for Epidemiology – CRIE, polymerase chain reaction for HPV was performed with real-time fluorescent hybridization detection. For DNA amplification and detection we used RotorGene 3000 analyzer (Corbett Research, Australia. In the beta-HPV assay, recombinant plasmids were used as positive controls and control human beta-globin gene fragments (CRIE. 4 oligo-nucleotide systems (group-specific primers and probes were used for the detection of beta-HPV DNA. Results: Preliminary data indicated that acrochordons of open and covered skin regions were common in renal transplant recipients. Beta-HPV DNA was more frequent in acrochordons and intact skin (64% and 54% of renal transplant recipients compared to healthy donors (47%. 57% of renal transplant recipients demonstrated mixed infection in acrochordons. Conclusion: HPV DNA was frequently detected in acrochordons and intact skin of renal transplant recipients. In immunocompetent patients prevalence of HPV DNA in acrochordons was significantly higher compared to intact skin.

Clusters of conserved beta cell marker genes for assessment of beta cell phenotype

DEFF Research Database (Denmark)

Martens, Geert A; Jiang, Lei; Hellemans, Karine H

2011-01-01

The aim of this study was to establish a gene expression blueprint of pancreatic beta cells conserved from rodents to humans and to evaluate its applicability to assess shifts in the beta cell differentiated state. Genome-wide mRNA expression profiles of isolated beta cells were compared to those...... of a large panel of other tissue and cell types, and transcripts with beta cell-abundant and -selective expression were identified. Iteration of this analysis in mouse, rat and human tissues generated a panel of conserved beta cell biomarkers. This panel was then used to compare isolated versus laser capture...

alpha-thalassemia, HbS, and beta-globin gene cluster haplotypes in two Afro-Uruguayan sub-populations from northern and southern Uruguay

Directory of Open Access Journals (Sweden)

Julio A. da Luz

2006-01-01

Full Text Available Hemoglobinopathies are the most common monogenic disorders worldwide; however, they have never been systematically studied from a genetic perspective in Uruguay. In this study, we determined the frequencies of hemoglobin variants in Afro-Uruguayans. A sample of 52 healthy unrelated Afro-Uruguayans from the northern (N = 28 and southern (N = 24 regions of the country was analyzed. Eight individuals (15.4% were heterozygous for -alpha3,7thalassemia; seven of them (29.2% were originally from the southern region, whereas one of them (3.6% was from the northern region; the differences between both regions were statistically significant (p = 0.016 +/-0.003. The only structural mutation detected was betaS, which is typical of African populations. Four individuals (10% were heterozygous for betaS, three of them (13.6% from the South, and one (5.6% from the North. The betaS haplotypes were analyzed in eight individuals: two were homozygous betaS/betaS, two were heterozygous betaS/betathal, and four were heterozygous betaS/betaª. This haplotype distribution (60% Bantu, 20% Benin, and 20% Bantu A2 is in agreement with historical records reporting a predominantly Bantu origin for the enslaved Africans brought to Uruguay. Even though this is a preliminary study, due to the small sample size, our results are suggestive of a relatively high incidence of hemoglobinopathies in the Afro-Uruguayan population.

Factor IX gene haplotypes in Amerindians.

Science.gov (United States)

Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

1997-02-01

We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

Interação entre Hb C [beta6(A3Glu>Lys] e IVS II-654 (C>T beta-talassemia no Brasil Hb C [beta6(A3Glu>Lys] and IVS II - 654 (C>T beta thalassemia interaction in Brazil

Directory of Open Access Journals (Sweden)

Claudia R. Bonini-Domingos

2003-06-01

Full Text Available Thalassemias are a heterogeneous group of inherited disorders characterized by a microcytic hypochromic anemia and an imbalance in the synthesis of the globin-chains. Hb C is the second most frequently variant of hemoglobin found in Brazil. The laboratory diagnosis of hemoglobinopathies, including thalassemias, is growing in importance, particularly because of an increasing requirement for neonatal diagnosis of abnormal hemoglobins. Screening tests were carried out using alkaline and acid electrophoresis, globin-chain analysis by cellulose acetate in alkaline pH, isoelectric focusing and HPLC. The molecular characterization was made by PCR-ASO for Hb C and beta thalassemia mutants. Large-scale screening and discriminative methodologies must provide information about the hemoglobin polymorphisms in Brazilian population. HPLC is a powerful tool in these cases. Molecular characterization is important to genetic counseling and clinical management, in particular for the Brazilian population that have an intense racial admixture, with great variability of hemoglobins. In this paper an association between Hb C and beta thalassemia (IVS-II-654 in a black family from Brazil was described.

Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

Energy Technology Data Exchange (ETDEWEB)

Ross, J

1976-09-15

In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.

NARCIS (Netherlands)

M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis

1992-01-01

textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin

Evaluation of the BeTha gene 1 kit for the qualitative detection of the eight most common Mediterranean beta-thalassemia mutations.

Science.gov (United States)

Ugozzoli, L A; Lowery, J D; Reyes, A A; Lin, C I; Re, A; Locati, F; Galanello, R; Macioni, L; Maggio, A; Giambona, A; Loutradi, A; Boussiou, M; Wallace, R B

1998-11-01

We describe the evaluation of the Bio-Rad BeTha Gene 1 kit (Bio-Rad Laboratories, Hercules, CA), a DNA-probe assay designed for the qualitative determination of the eight most common Mediterranean beta-thalassemia mutations. The kit utilizes the principle of allele-specific oligonucleotide (ASO) hybridization. Following sample preparation and in vitro DNA amplification by the polymerase chain reaction (PCR), an allele-specific detection of the amplified products by a nonradioactive enzymatic assay is performed. Genomic DNA is prepared from an individual's whole blood with a DNA purification matrix. In a second step, the beta-globin gene is amplified in a multiplex PCR reaction containing four 5' biotinylated oligonucleotide primers. In a final step, an aliquot of the PCR reaction is first chemically denatured and then captured in two eight-well strips of a 96-well enzyme-linked immunosorbent assay (ELISA) plate by hybridization to an immobilized ASO probe. Each DNA sequence at each of the eight mutation sites is represented by one normal and one mutant ASO. During this capture/hybridization step, which is performed at 37 degrees C, only perfectly matched PCR products will be captured by an ASO. Subsequently, the allele-specific captured biotin-labeled PCR products are detected by a colorimetric enzymatic reaction. The system permits the detection of 16 beta-thalassemia alleles using a high-throughput format that can be automated easily. A clinical feasibility study was performed to evaluate the functionality (method comparison study, assay validity using samples previously collected and stored at various temperatures for different periods of time, interference on kit performance, and assay validity for prenatal diagnosis) and the usability (ease of use, sample throughput) of the kit. The analysis of 110 samples previously studied with reference methods showed 100% clinical sensitivity and specificity. We demonstrate here that the procedure not only increases the

Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

OpenAIRE

Najmaddin Saki; Akbar Dorgalaleh; Zahra Kashani Khatib; Shaban Alizadeh; Fakher Rahim; Hamid Galehdari; Bijan Kaikhaei; Mohammad Pedram; Ali Dehghani Fard

2013-01-01

Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was pe...

Spectrin interactions with globin chains in the presence of ...

Indian Academy of Sciences (India)

PRAKASH KUMAR

chains, respectively. The fluorescence-binding data, on the other hand, revealed a larger number of about 80 globin chains binding to spectrin. Cross-linked aggregates of haemoglobin/globin and spectrin have been found under different pathophysiological conditions, e.g. in senescent red blood cells, under oxidative.

EFFECT OF CIS ACTING POTENTIAL REGULATORS IN THE ß GLOBIN GENE CLUSTER ON THE PRODUCTION OF HBF IN THALASSEMIA PATIENTS

Directory of Open Access Journals (Sweden)

Anita Nadkarni

2013-02-01

Full Text Available The clinical presentation of   b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and  several polymorphisms located in the promoters of  g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of  the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF  in  b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.

Effects of ultrasound on Transforming Growth Factor-beta genes in bone cells

Directory of Open Access Journals (Sweden)

J Harle

2005-12-01

Full Text Available Therapeutic ultrasound (US is a widely used form of biophysical stimulation that is increasingly applied to promote fracture healing. Transforming growth factor-beta (TGF-beta, which is encoded by three related but different genes, is known to play a major part in bone growth and repair. However, the effects of US on the expression of the TGF-beta genes and the physical acoustic mechanisms involved in initiating changes in gene expression in vitro, are not yet known. The present study demonstrates that US had a differential effect on these TGF-beta isoforms in a human osteoblast cell line, with the highest dose eliciting the most pronounced up-regulation of both TGF-beta1 and TGF-beta3 at 1 hour after treatment and thereafter declining. In contrast, US had no effect on TGF-beta2 expression. Fluid streaming rather than thermal effects or cavitation was found to be the most likely explanation for the gene responses observed in vitro.

Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

Science.gov (United States)

Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

1997-05-01

The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

Science.gov (United States)

Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

1996-09-01

To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

CTCF-mediated transcriptional regulation through cell type-specific chromosome organization in the β-globin locus

OpenAIRE

Junier, Ivan; Dale, Ryan K.; Hou, Chunhui; Képès, François; Dean, Ann

2012-01-01

International audience; The principles underlying the architectural landscape of chromatin beyond the nucleosome level in living cells remains largely unknown despite its potential to play a role in mammalian gene regulation. We investigated the three-dimensional folding of a 1 Mbp region of human chromosome 11 containing the β-globin genes by integrating looping interactions of the CCCTC-binding insulator protein CTCF determined comprehensively by chromosome conformation capture (3C) into a ...

Biochemical and molecular investigations on qualitative and quantitative Hb polymorphism in the river buffalo (Bubalus bubalis L. population reared in Southern Italy

Directory of Open Access Journals (Sweden)

Mario Iorio

2004-01-01

Full Text Available On 398 river buffalo samples, randomly collected in distinct breeding areas of the Campania region, high-resolution analytical systems were used to identify both qualitative and quantitative variations of the Hb phenotype. Polyacrylamide gel isoelectric focusing and HPLC were used to determine the ratio between HBA1 and HBA2 globin chains; restriction endonuclease analysis was performed to assess whether quantitative variations in Hb bands were related to an unusual number of a-globin genes. In the two buffalo subpopulations, allele frequencies of the alpha and beta globin systems were calculated, and F statistics (FIS, FIT and FST were estimated as parameters of genetic diversity. The results suggest that: i as shown by RFLP analysis, only a couple of associated a globin genes account for the quantitative variations recorded at the phenotypic level; ii as expected, in the a globin gene system (HBA, the frequency of haplotype B (HBA-B largely exceeded that of haplotype A (HBA-A (95.1% vs 4.9%; iii the frequency of the usual allele at the beta locus is 0.6, as opposed to 0.4 of the slow variant; iiii the most significant component of variation of the genetic system of hemoglobin is between individuals within the same location.

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

Energy Technology Data Exchange (ETDEWEB)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. We have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.

Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

Science.gov (United States)

Van Doorslaer, Sabine; Cuypers, Bert

2018-02-01

At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

X-ray scattering signatures of {beta}-thalassemia

Energy Technology Data Exchange (ETDEWEB)

Desouky, Omar S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt); Elshemey, Wael M. [Biophysics Department, Faculty of Science, Cairo University (Egypt)], E-mail: waelelshemey@yahoo.com; Selim, Nabila S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt)

2009-08-11

X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm{sup -1}, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; {beta}-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of {beta}-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm{sup -1}, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

Hemoglobina C em homozigose e interação com talassemia beta Homozygous hemoglobin C and its interaction with beta thalassemia

Directory of Open Access Journals (Sweden)

Ivan L. Angulo

2009-01-01

Full Text Available A hemoglobina C (Hb C é originária do oeste da África e é detectada por migração lenta na eletroforese alcalina em acetato de celulose. Consiste na mutação do gene da globina beta no códon 6 (GAG-AAG, resultando na substituição do sexto aminoácido da cadeia beta da hemoglobina humana, o ácido glutâmico, pelo aminoácido lisina. A cromatografia de alto desempenho (HPLC separa completamente as frações C e A2, permitindo caracterizar a presença da interação com talassemia beta. Esta entidade (Hb CC, em homozigoze é considerada benigna em relação à doença falciforme, já que a falcização não faz parte de sua fisiopatologia. A raridade do diagnóstico C homozigoto e C talassemia beta nos pacientes portadores de hemoglobinopatias nos alertou para a necessidade de se conhecer melhor e estudar aspectos clínicos e hematológicos dos casos dessa mutação em homozigose e na interação com a talassemia beta no ambulatório de anemias do Centro Regional de Hematologia e Hemoterapia de Ribeirão Preto, SP, Brasil.Hemoglobin C (Hb C originated in the west of Africa and is detected by alkaline electrophoresis by slow migration in cellulose acetate. It consists of a mutation of the beta globin gene in codon 6 (GAG-AAG, resulting in a substitution of glutamic acid, the sixth amino acid of the beta string of the human hemoglobin, for lysine. High performance chromatography (HPLC separates the C and A2 fractions completely, allowing the characterization of the presence of interactions with thalassemia beta. This entity (Hb CC is considered benign in respect to sickle cell disease, as sickle cells are not part of its physiopathology. The rarity of the diagnosis of homozygous C and beta thalassemia in patients with hemoglobinopathies showed the necessity of studying clinical and hematologic aspects of the cases of this mutation in homozygosis carriers and the interaction with beta thalassemia in the anemias clinic of the Regional Blood

Ins1 Cre knock-in mice for beta cell-specific gene recombination

OpenAIRE

Thorens Bernard; Tarussio David; Maestro Miguel Angel; Maestro Miguel Angel; Rovira Meritxell; Rovira Meritxell; Heikkilä Eija; Ferrer Jorge; Ferrer Jorge; Ferrer Jorge

2013-01-01

Aims/hypothesis Pancreatic beta cells play a central role in the control of glucose homeostasis by secreting insulin to stimulate glucose uptake by peripheral tissues. Understanding the molecular mechanisms that control beta cell function and plasticity has critical implications for the pathophysiology and therapy of major forms of diabetes. Selective gene inactivation in pancreatic beta cells, using the Cre-lox system, is a powerful approach to assess the role of particular genes in beta cel...

Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

Directory of Open Access Journals (Sweden)

Takahashi Takashi

2007-04-01

Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.

Science.gov (United States)

Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M

2014-04-16

The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.

Structural analysis of the 5' flanking region of the β-globin gene in African sickle cell anemia patients: Further evidence for three origins of the sickle cell mutation in Africa

International Nuclear Information System (INIS)

Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.

1988-01-01

Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa

Disulfiram generates a stable N,N-diethylcarbamoyl adduct on Cys-125 of rat hemoglobin beta-chains in vivo

DEFF Research Database (Denmark)

Erve, J C; Jensen, Ole Nørregaard; Valentine, H S

2000-01-01

residues each. MALDI-TOF MS analysis of two new globin species from DSF-treated rats collected by HPLC revealed increments of 99 Da above the mass of the unmodified chains (beta-2 and beta-3). In a separate experiment, the globin mixture was digested for 2 h with Glu-C and reanalyzed by MALDI-TOF MS....... Results showed a peptide at m/z 2716.3 having a mass 99 Da higher than a known Cys-containing peptide. Subsequently, the Glu-C digest was analyzed using Q-TOF tandem MS, enabling observation of the +4 charge state of the peptide with m/z 2716.3. This peptide was fragmented to produce y-sequence ions...

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

Science.gov (United States)

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

Size Polymorphism in Alleles of the Myoglobin Gene from Biomphalaria Mollusks

Directory of Open Access Journals (Sweden)

Marcelo M. Santoro

2010-10-01

Full Text Available Introns are common among all eukaryotes, while only a limited number of introns are found in prokaryotes. Globin and globin-like proteins are widely distributed in nature, being found even in prokaryotes and a wide range of patterns of intron-exon have been reported in several eukaryotic globin genes. Globin genes in invertebrates show considerable variation in the positions of introns; globins can be found without introns, with only one intron or with three introns in different positions. In this work we analyzed the introns in the myoglobin gene from Biomphalaria glabrata, B. straminea and B. tenagophila. In the Biomphalaria genus, the myoglobin gene has three introns; these were amplified by PCR and analyzed by PCR-RFLP. Results showed that the size (number or nucleotides and the nucleotide sequence of the coding gene of the myoglobin are variable in the three species. We observed the presence of size polymorphisms in intron 2 and 3; this characterizes a homozygous/heterozygous profile and it indicates the existence of two alleles which are different in size in each species of Biomphalaria. This polymorphism could be explored for specific identification of Biomphalaria individuals.

Role of novel and rare nucleotide substitutions of the β-globin gene

Directory of Open Access Journals (Sweden)

Margherita Vinciguerra

2012-11-01

Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序，旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段：1）血液及血红蛋白数据；2）珠蛋白基因分子分析以及家族遗传研究（如有可能）。 自2003年以来，我们已对这类病例进行DNA序列分析：传统的分子方法无法给出完整的诊断响应，尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。 �

Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues

International Nuclear Information System (INIS)

Shakin, S.H.; Liebhaber, S.A.

1987-01-01

The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation

Interleukin-1beta gene polymorphisms in Taiwanese patients with gout.

Science.gov (United States)

Chen, Man-Ling; Huang, Chung-Ming; Tsai, Chang-Hai; Tsai, Fuu-Jen

2005-04-01

The purpose of this study was to examine whether interleukin-1 beta (IL-1beta) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1beta promoter and IL-1beta exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1beta promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1beta promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, chi(2)=12.52, OR 7.14, 95%CI 0.012-0.22). There was also a significant difference in the genotype of IL-1beta exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1beta promoter and IL-1beta exon 5 are not related to gout patients in central Taiwan.

Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

Science.gov (United States)

Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

2015-12-01

Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

Science.gov (United States)

Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

2018-03-01

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia

International Nuclear Information System (INIS)

Kamel, S.A.L.M.

2004-01-01

β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University

Hemoglobin genetics: recent contributions of GWAS and gene editing

Science.gov (United States)

Smith, Elenoe C.; Orkin, Stuart H.

2016-01-01

The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

Science.gov (United States)

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Tumor-produced, active Interleukin-1 {beta} regulates gene expression in carcinoma-associated fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Dudas, Jozsef, E-mail: Jozsef.Dudas@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Fullar, Alexandra, E-mail: fullarsz@gmail.com [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); 1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Bitsche, Mario, E-mail: Mario.Bitsche@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Schartinger, Volker, E-mail: Volker.Schartinger@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Kovalszky, Ilona, E-mail: koval@korb1.sote.hu [1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Sprinzl, Georg Mathias, E-mail: Georg.Sprinzl@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Riechelmann, Herbert, E-mail: Herbert.Riechelmann@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria)

2011-09-10

Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the

Molecular identification of TEM-116 beta-lactamase gene in isolates ...

African Journals Online (AJOL)

Purpose: Purpose: To determine TEM-116 beta-lactamase gene prevalence in drug-resistant Pseudomonas aeruginosa isolates from Pakistan. Methods: Sequence analysis of TEM beta-lactamase isolates and their antibiotic susceptibility patterns were carried out. Quantitative bacteriostatic concentrations for commonly ...

Candidate gene association study in type 2 diabetes indicates a role for genes involved in beta-cell function as well as insulin action.

Directory of Open Access Journals (Sweden)

Inês Barroso

2003-10-01

Full Text Available Type 2 diabetes is an increasingly common, serious metabolic disorder with a substantial inherited component. It is characterised by defects in both insulin secretion and action. Progress in identification of specific genetic variants predisposing to the disease has been limited. To complement ongoing positional cloning efforts, we have undertaken a large-scale candidate gene association study. We examined 152 SNPs in 71 candidate genes for association with diabetes status and related phenotypes in 2,134 Caucasians in a case-control study and an independent quantitative trait (QT cohort in the United Kingdom. Polymorphisms in five of 15 genes (33% encoding molecules known to primarily influence pancreatic beta-cell function-ABCC8 (sulphonylurea receptor, KCNJ11 (KIR6.2, SLC2A2 (GLUT2, HNF4A (HNF4alpha, and INS (insulin-significantly altered disease risk, and in three genes, the risk allele, haplotype, or both had a biologically consistent effect on a relevant physiological trait in the QT study. We examined 35 genes predicted to have their major influence on insulin action, and three (9%-INSR, PIK3R1, and SOS1-showed significant associations with diabetes. These results confirm the genetic complexity of Type 2 diabetes and provide evidence that common variants in genes influencing pancreatic beta-cell function may make a significant contribution to the inherited component of this disease. This study additionally demonstrates that the systematic examination of panels of biological candidate genes in large, well-characterised populations can be an effective complement to positional cloning approaches. The absence of large single-gene effects and the detection of multiple small effects accentuate the need for the study of larger populations in order to reliably identify the size of effect we now expect for complex diseases.

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

Energy Technology Data Exchange (ETDEWEB)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

Science.gov (United States)

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

[Perissodactyla: the primary structure of hemoglobins from the lowland tapir (Tapirus terrestris): glutamic acid in position 2 of the beta chains].

Science.gov (United States)

Mazur, G; Braunitzer, G

1984-09-01

The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.

Thalassemia and related hemoglobinopathies.

Science.gov (United States)

Sarnaik, Sharada A

2005-04-01

Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

Science.gov (United States)

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

Science.gov (United States)

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

Regional and temporal differences in gene expression of LH(BETA)T(AG) retinoblastoma tumors.

Science.gov (United States)

Houston, Samuel K; Pina, Yolanda; Clarke, Jennifer; Koru-Sengul, Tulay; Scott, William K; Nathanson, Lubov; Schefler, Amy C; Murray, Timothy G

2011-07-23

The purpose of this study was to evaluate by microarray the hypothesis that LH(BETA)T(AG) retinoblastoma tumors exhibit regional and temporal variations in gene expression. LH(BETA)T(AG) mice aged 12, 16, and 20 weeks were euthanatized (n = 9). Specimens were taken from five tumor areas (apex, anterior lateral, center, base, and posterior lateral). Samples were hybridized to gene microarrays. The data were preprocessed and analyzed, and genes with a P 2.5 were considered to be differentially expressed. Differentially expressed genes were analyzed for overlap with known networks by using pathway analysis tools. There were significant temporal (P regional differences in gene expression for LH(BETA)T(AG) retinoblastoma tumors. At P 2.5, there were significant changes in gene expression of 190 genes apically, 84 genes anterolaterally, 126 genes posteriorly, 56 genes centrally, and 134 genes at the base. Differentially expressed genes overlapped with known networks, with significant involvement in regulation of cellular proliferation and growth, response to oxygen levels and hypoxia, regulation of cellular processes, cellular signaling cascades, and angiogenesis. There are significant temporal and regional variations in the LH(BETA)T(AG) retinoblastoma model. Differentially expressed genes overlap with key pathways that may play pivotal roles in murine retinoblastoma development. These findings suggest the mechanisms involved in tumor growth and progression in murine retinoblastoma tumors and identify pathways for analysis at a functional level, to determine significance in human retinoblastoma. Microarray analysis of LH(BETA)T(AG) retinal tumors showed significant regional and temporal variations in gene expression, including dysregulation of genes involved in hypoxic responses and angiogenesis.

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

Science.gov (United States)

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

A practical platform for blood biomarker study by using global gene expression profiling of peripheral whole blood.

Directory of Open Access Journals (Sweden)

Ze Tian

Full Text Available Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study.We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal.We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study.

Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein

International Nuclear Information System (INIS)

Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.

1988-01-01

In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes

Testes and brain gene expression in precocious male and adult maturing Atlantic salmon (Salmo salar

Directory of Open Access Journals (Sweden)

Houeix Benoit

2010-03-01

Full Text Available Abstract Background The male Atlantic salmon generally matures in fresh water upon returning after one or several years at sea. Some fast-growing male parr develop an alternative life strategy where they sexually mature before migrating to the oceans. These so called 'precocious' parr or 'sneakers' can successfully fertilise adult female eggs and so perpetuate their line. We have used a custom-built cDNA microarray to investigate gene expression changes occurring in the salmon gonad and brain associated with precocious maturation. The microarray has been populated with genes selected specifically for involvement in sexual maturation (precocious and adult and in the parr-smolt transformation. Results Immature and mature parr collected from a hatchery-reared stock in January were significantly different in weight, length and condition factor. Changes in brain expression were small - never more than 2-fold on the microarray, and down-regulation of genes was much more pronounced than up-regulation. Significantly changing genes included isotocin, vasotocin, cathepsin D, anamorsin and apolipoprotein E. Much greater changes in expression were seen in the testes. Among those genes in the testis with the most significant changes in expression were anti-Mullerian hormone, collagen 1A, and zinc finger protein (Zic1, which were down-regulated in precocity and apolipoproteins E and C-1, lipoprotein lipase and anti-leukoproteinase precursor which were up-regulated in precocity. Expression changes of several genes were confirmed in individual fish by quantitative PCR and several genes (anti-Mullerian hormone, collagen 1A, beta-globin and guanine nucleotide binding protein (G protein beta polypeptide 2-like 1 (GNB2L1 were also examined in adult maturing testes. Down-regulation of anti-Mullerian hormone was judged to be greater than 160-fold for precocious males and greater than 230-fold for November adult testes in comparison to July testes by this method. For

Recent trends in the gene therapy of β-thalassemia

Science.gov (United States)

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

Science.gov (United States)

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

2014-05-13

Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

In silico identification of NF-kappaB-regulated genes in pancreatic beta-cells

Directory of Open Access Journals (Sweden)

Eizirik Decio L

2007-02-01

Full Text Available Abstract Background Pancreatic beta-cells are the target of an autoimmune attack in type 1 diabetes mellitus (T1DM. This is mediated in part by cytokines, such as interleukin (IL-1β and interferon (IFN-γ. These cytokines modify the expression of hundreds of genes, leading to beta-cell dysfunction and death by apoptosis. Several of these cytokine-induced genes are potentially regulated by the IL-1β-activated transcription factor (TF nuclear factor (NF-κB, and previous studies by our group have shown that cytokine-induced NF-κB activation is pro-apoptotic in beta-cells. To identify NF-κB-regulated gene networks in beta-cells we presently used a discriminant analysis-based approach to predict NF-κB responding genes on the basis of putative regulatory elements. Results The performance of linear and quadratic discriminant analysis (LDA, QDA in identifying NF-κB-responding genes was examined on a dataset of 240 positive and negative examples of NF-κB regulation, using stratified cross-validation with an internal leave-one-out cross-validation (LOOCV loop for automated feature selection and noise reduction. LDA performed slightly better than QDA, achieving 61% sensitivity, 91% specificity and 87% positive predictive value, and allowing the identification of 231, 251 and 580 NF-κB putative target genes in insulin-producing INS-1E cells, primary rat beta-cells and human pancreatic islets, respectively. Predicted NF-κB targets had a significant enrichment in genes regulated by cytokines (IL-1β or IL-1β + IFN-γ and double stranded RNA (dsRNA, as compared to genes not regulated by these NF-κB-dependent stimuli. We increased the confidence of the predictions by selecting only evolutionary stable genes, i.e. genes with homologs predicted as NF-κB targets in rat, mouse, human and chimpanzee. Conclusion The present in silico analysis allowed us to identify novel regulatory targets of NF-κB using a supervised classification method based on

Deletion of Nhlh2 results in a defective torpor response and reduced Beta adrenergic receptor expression in adipose tissue.

Directory of Open Access Journals (Sweden)

Umesh D Wankhade

2010-08-01

Full Text Available Mice with a targeted deletion of the basic helix-loop-helix transcription factor, Nescient Helix-Loop-Helix 2 (Nhlh2, display adult-onset obesity with significant increases in their fat depots, abnormal responses to cold exposure, and reduced spontaneous physical activity levels. These phenotypes, accompanied by the hypothalamic expression of Nhlh2, make the Nhlh2 knockout (N2KO mouse a useful model to study the role of central nervous system (CNS control on peripheral tissue such as adipose tissue.Differences in body temperature and serum analysis of leptin were performed in fasted and ad lib fed wild-type (WT and N2KO mice. Histological analysis of white (WAT and brown adipose tissue (BAT was performed. Gene and protein level expression of inflammatory and metabolic markers were compared between the two genotypes.We report significant differences in serum leptin levels and body temperature in N2KO mice compared with WT mice exposed to a 24-hour fast, suggestive of a defect in both white (WAT and brown adipose tissue (BAT function. As compared to WT mice, N2KO mice showed increased serum IL-6 protein and WAT IL-6 mRNA levels. This was accompanied by slight elevations of mRNA for several macrophage markers, including expression of macrophage specific protein F4/80 in adipose, suggestive of macrophage infiltration of WAT in the mutant animals. The mRNAs for beta3-adrenergic receptors (beta3-AR, beta2-AR and uncoupling proteins were significantly reduced in WAT and BAT from N2KO mice compared with WT mice.These studies implicate Nhlh2 in the central control of WAT and BAT function, with lack of Nhlh2 leading to adipose inflammation and altered gene expression, impaired leptin response to fasting, all suggestive of a deficient torpor response in mutant animals.

Beta1 integrins regulate chondrocyte rotation, G1 progression, and cytokinesis

DEFF Research Database (Denmark)

Aszodi, Attila; Hunziker, Ernst B; Brakebusch, Cord

2003-01-01

Beta1 integrins are highly expressed on chondrocytes, where they mediate adhesion to cartilage matrix proteins. To assess the functions of beta1 integrin during skeletogenesis, we inactivated the beta1 integrin gene in chondrocytes. We show here that these mutant mice develop a chondrodysplasia...... of various severity. beta1-deficient chondrocytes had an abnormal shape and failed to arrange into columns in the growth plate. This is caused by a lack of motility, which is in turn caused by a loss of adhesion to collagen type II, reduced binding to and impaired spreading on fibronectin, and an abnormal F......-actin organization. In addition, mutant chondrocytes show decreased proliferation caused by a defect in G1/S transition and cytokinesis. The G1/S defect is, at least partially, caused by overexpression of Fgfr3, nuclear translocation of Stat1/Stat5a, and up-regulation of the cell cycle inhibitors p16 and p21...

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

Science.gov (United States)

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

Beta-thalassaemia trait: haematological parameters

International Nuclear Information System (INIS)

Yousafzai, Y.M.; Khan, S.; Raziq, F.

2010-01-01

Thalassaemia syndromes are a group of hereditary disorders characterised by a genetic deficiency in the synthesis of --globin genes. The objective of this study was to determine the haematological features -thalassaemia trait (BTT), and to determine the sensitivity of Mean Corpuscular Volume (MCV), Mean Corpuscular Haemoglobin (MCH) and -thalassaemia trait. Methods: A descriptive study was conducted in Hayatabad Medical Complex, Peshawar from May 2009 to May 2010 with 203 subjects having BTT. Blood samples were collected in EDTA anti-coagulated tubes. RBC indices were taken as part of complete blood count (CBC) by haematology analyser, and Haemoglobin (Hb) electrophoresis was done to determine the HbA2 percentage. The data was collected and analyzed on statistical software for demographic details, RBC indices and HBA2 levels. Results: Out of 203 patients, 92 (45%) were males and 111 (55%) were females. Most patients tested were in the 15-45 year age group. One-hundred-sixty (79%) patients had anaemia. MCV was lower than 76 fl in all the cases. Mean MCV was 59.1 fl. MCH was low, the mean MCH being 19.3 g/dl. MCH <26 gave sensitivity of 99% in detecting BTT. We calculated MI for these cases and found out that it was <12 in 75% of cases and <15 in 197 (97%). Conclusion: Beta-thalassaemia traits present with a microcytic hypochromic blood picture, detected on simple haematology analysers as low MCV and MCH and MI which provide a beta- thalassaemia trait. (author)

An N-myristoylated globin with a redox-sensing function that regulates the defecation cycle in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Lesley Tilleman

Full Text Available Globins occur in all kingdoms of life where they fulfill a wide variety of functions. In the past they used to be primarily characterized as oxygen transport/storage proteins, but since the discovery of new members of the globin family like neuroglobin and cytoglobin, more diverse and complex functions have been assigned to this heterogeneous family. Here we propose a function for a membrane-bound globin of C. elegans, GLB-26. This globin was predicted to be myristoylated at its N-terminus, a post-translational modification only recently described in the globin family. In vivo, this globin is found in the membrane of the head mesodermal cell and in the tail stomato-intestinal and anal depressor muscle cells. Since GLB-26 is almost directly oxidized when exposed to oxygen, we postulate a possible function as electron transfer protein. Phenotypical studies show that GLB-26 takes part in regulating the length of the defecation cycle in C. elegans under oxidative stress conditions.

Beta-thalassemia

Directory of Open Access Journals (Sweden)

Origa Raffaella

2010-05-01

, deletions in the beta globin gene on chromosome 11, leading to reduced (beta+ or absent (beta0 synthesis of the beta chains of hemoglobin (Hb. Transmission is autosomal recessive; however, dominant mutations have also been reported. Diagnosis of thalassemia is based on hematologic and molecular genetic testing. Differential diagnosis is usually straightforward but may include genetic sideroblastic anemias, congenital dyserythropoietic anemias, and other conditions with high levels of HbF (such as juvenile myelomonocytic leukemia and aplastic anemia. Genetic counseling is recommended and prenatal diagnosis may be offered. Treatment of thalassemia major includes regular RBC transfusions, iron chelation and management of secondary complications of iron overload. In some circumstances, spleen removal may be required. Bone marrow transplantation remains the only definitive cure currently available. Individuals with thalassemia intermedia may require splenectomy, folic acid supplementation, treatment of extramedullary erythropoietic masses and leg ulcers, prevention and therapy of thromboembolic events. Prognosis for individuals with beta-thalassemia has improved substantially in the last 20 years following recent medical advances in transfusion, iron chelation and bone marrow transplantation therapy. However, cardiac disease remains the main cause of death in patients with iron overload.

Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence

International Nuclear Information System (INIS)

Xiao Yi; Huang Yanzhao

2004-01-01

DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB

Oxygen binding properties of non-mammalian nerve globins

DEFF Research Database (Denmark)

Hundahl, Christian; Fago, Angela; Dewilde, Sylvia

2006-01-01

Oxygen-binding globins occur in the nervous systems of both invertebrates and vertebrates. While the function of invertebrate nerve haemoglobins as oxygen stores that extend neural excitability under hypoxia has been convincingly demonstrated, the physiological role of vertebrate neuroglobins...... is less well understood. Here we provide a detailed analysis of the oxygenation characteristics of nerve haemoglobins from an annelid (Aphrodite aculeata), a nemertean (Cerebratulus lacteus) and a bivalve (Spisula solidissima) and of neuroglobin from zebrafish (Danio rerio). The functional differences...... have been related to haem coordination: the haem is pentacoordinate (as in human haemoglobin and myoglobin) in A. aculeata and C. lacteus nerve haemoglobins and hexacoordinate in S. solidissima nerve haemoglobin and D. rerio neuroglobin. Whereas pentacoordinate nerve globins lacked Bohr effects at all...

alpha-Globin genes: thalassemic and structural alterations in a Brazilian population

Directory of Open Access Journals (Sweden)

M.R.S.C. Wenning

2000-09-01

Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.

A Novel High-Content Immunofluorescence Assay as a Tool to Identify at the Single Cell Level γ-Globin Inducing Compounds.

Directory of Open Access Journals (Sweden)

Marta Durlak

Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.

[Clinical management of beta-thalassaemia].

Science.gov (United States)

Thuret, Isabelle

2014-10-01

Beta-thalassemia syndromes are autosomal recessive disorders related to the inability to produce beta-globin chains. Thalassemia major is by definition a transfusion dependent anemia and iron overload is the leading cause of death and morbidity. Beta-thalassemia is rarely encountered in France where patients mainly originated from Mediterranean countries and South East Asia. Recently, two major advances have substantially improved the disease management: oral iron chelation therapy and the introduction of cardiac MRI for monitoring cardiac iron. Hematopoietic stem cell transplantation remains, in clinical practice, the only curative approach and is proposed to children having an HLA-identical sibling. Diagnosis of thalassemia trait is important in order to propose genetic counseling to couples at risk. Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Clinical severity increases with age with a more severe anemia, thrombotic complications and extra-medullary hematopoiesis. Iron overload, optimally monitored with liver MRI, occurs in adult patients and is related to increased iron hyper-absorption.

Heme and erythropoieis: more than a structural role.

Science.gov (United States)

Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela

2014-06-01

Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own synthesis and regulates the expression of several erythroid-specific genes. Heme is synthesized in developing erythroid progenitors by the stage of proerythroblast, through a series of eight enzymatic reactions divided between mitochondria and cytosol. Defects of heme synthesis in the erythroid lineage result in sideroblastic anemias, characterized by microcytic anemia associated to mitochondrial iron overload, or in erythropoietic porphyrias, characterized by porphyrin deposition in erythroid cells. Here, we focus on the heme biosynthetic pathway and on human erythroid disorders due to defective heme synthesis. The regulatory role of heme during erythroid differentiation is discussed as well as the heme-mediated regulatory mechanisms that allow the orchestration of the adaptive cell response to heme deficiency. Copyright© Ferrata Storti Foundation.

[Toxic effect of trichloroethylene on liver cells with CYP3A4 gene defect].

Science.gov (United States)

Liao, R Y; Liu, S

2016-06-20

To investigate the toxic effect of trichloroethylene on liver cells with CYP3A4 gene defect. The normal human liver cells (L02 cells) and liver cells with CYP3A4 gene defect were exposed to trichloroethylene at different doses (0.0, 0.4, 0.8, 1.6, 3.2, and 6.4 mmol/L). CCK8 assay and RT-qPCR were used to measure cell viability and changes in the expression of apoptosis genes and oncogenes. After being exposed to trichloroethylene at doses of 1.6, 3.2, and 6.4 mmol/L, the liver cells with CYP3A4 gene defect showed significantly higher cell viability than L02 cells (0.91±0.06/0.89±0.05/0.85±0.07 vs 0.80±0.04/0.73±0.06/0.67±0.07, Ptrichloroethylene groups showed significant increases in the expression of the apoptosis genes caspase-3, caspase-8, and caspase-9 (PTrichloroethylene exposure has a less effect on the expression of apoptosis genes and oncogenes in liver cells with CYP3A4 gene defect than in normal human liver cells, suggesting that CYP3A4 gene defect reduces the inductive effect of trichloroethylene on apoptosis genes and oncogenes.

Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene

DEFF Research Database (Denmark)

Efrat, S; Linde, S; Kofod, Hans

1988-01-01

Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....

Repair of full-thickness articular cartilage defects by cultured mesenchymal stem cells transfected with the transforming growth factor β1 gene

International Nuclear Information System (INIS)

Guo Xiaodong; Zheng Qixin; Yang Shuhua; Shao Zengwu; Yuan Quan; Pan Zhengqi; Tang Shuo; Liu Kai; Quan Daping

2006-01-01

Articular cartilage repair remains a clinical and scientific challenge with increasing interest focused on the combined techniques of gene transfer and tissue engineering. Transforming growth factor beta 1 (TGF-β 1 ) is a multifunctional molecule that plays a central role in promotion of cartilage repair, and inhibition of inflammatory and alloreactive immune response. Cell mediated gene therapy can allow a sustained expression of TGF-β 1 that may circumvent difficulties associated with growth factor delivery. The objective of this study was to investigate whether TGF-β 1 gene modified mesenchymal stem cells (MSCs) could enhance the repair of full-thickness articular cartilage defects in allogeneic rabbits. The pcDNA 3 -TGF-β 1 gene transfected MSCs were seeded onto biodegradable poly-L-lysine coated polylactide (PLA) biomimetic scaffolds in vitro and allografted into full-thickness articular cartilage defects in 18 New Zealand rabbits. The pcDNA 3 gene transfected MSCs/biomimetic scaffold composites and the cell-free scaffolds were taken as control groups I and II, respectively. The follow-up times were 2, 4, 12 and 24 weeks. Macroscopical, histological and ultrastructural studies were performed. In vitro SEM studies found that abundant cartilaginous matrices were generated and completely covered the interconnected pores of the scaffolds two weeks post-seeding in the experimental groups. In vivo, the quality of regenerated tissue improved over time with hyaline cartilage filling the chondral region and a mixture of trabecular and compact bone filling the subchondral region at 24 weeks post-implantation. Joint repair in the experimental groups was better than that of either control group I or II, with respect to: (1) synthesis of hyaline cartilage specific extracellular matrix at the upper portion of the defect; (2) reconstitution of the subchondral bone at the lower portion of the defect and (3) inhibition of inflammatory and alloreactive immune responses. The

Regulation of laminin beta2 chain gene expression in human cancer cell lines

DEFF Research Database (Denmark)

Durkin, M E; Nielsen, F C; Loechel, F

2001-01-01

of the human laminin beta2 chain gene generates two isoforms of the 5' untranslated region of the beta2 chain mRNA. The translational efficiencies of the two laminin beta2 chain leaders did not differ significantly, when assayed by polysome profile analysis of endogenous clone A cell beta2 chain m......RNA, transient transfection of chimeric beta2 chain leader/luciferase expression plasmids in clone A cells, and translation of in vitro synthesized RNAs in rabbit reticulocyte lysates....

Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

Directory of Open Access Journals (Sweden)

Najmaddin Saki

2013-09-01

Full Text Available Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was performed on patients with abnormal hematological findings in favor of alpha-thalassemia, beta-thalassemia or beta-hemoglobinopathies. Patients with low MCV and MCH levels and high HbA2 (>3.5 and those with low MCV and MCH and normal or low HbA2 were candidate for molecular analysis for beta and alpha thalassemia respectively. Abnormal Hb electrophoresis was diagnostic criteria for molecular analysis of beta-hemoglobinopathies.   Results: Study revealed that more than half of the patients with alpha-thalassemia affected simultaneously by beta-thalassemia and about thirty percent inherited beta-hemoglobinopathies. Among patients with beta-thalassemia, HbSCd6 (A-T was the most common mutation and in alpha-thalassemic patients α 3.7 was the commonest mutation.   Conclusion: Relatively high prevalence of co-inheritance of alfa-thalassemia with beta-thalassemia and hemoglobinopathies reflect the necessity of genetic consulting and molecular analysis in diagnosis of such conditions.

Rapid evolution of Beta-keratin genes contribute to phenotypic differences that distinguish turtles and birds from other reptiles.

Science.gov (United States)

Li, Yang I; Kong, Lesheng; Ponting, Chris P; Haerty, Wilfried

2013-01-01

Sequencing of vertebrate genomes permits changes in distinct protein families, including gene gains and losses, to be ascribed to lineage-specific phenotypes. A prominent example of this is the large-scale duplication of beta-keratin genes in the ancestors of birds, which was crucial to the subsequent evolution of their beaks, claws, and feathers. Evidence suggests that the shell of Pseudomys nelsoni contains at least 16 beta-keratins proteins, but it is unknown whether this is a complete set and whether their corresponding genes are orthologous to avian beak, claw, or feather beta-keratin genes. To address these issues and to better understand the evolution of the turtle shell at a molecular level, we surveyed the diversity of beta-keratin genes from the genome assemblies of three turtles, Chrysemys picta, Pelodiscus sinensis, and Chelonia mydas, which together represent over 160 Myr of chelonian evolution. For these three turtles, we found 200 beta-keratins, which indicate that, as for birds, a large expansion of beta-keratin genes in turtles occurred concomitantly with the evolution of a unique phenotype, namely, their plastron and carapace. Phylogenetic reconstruction of beta-keratin gene evolution suggests that separate waves of gene duplication within a single genomic location gave rise to scales, claws, and feathers in birds, and independently the scutes of the shell in turtles.

Oxidative Metabolism Genes Are Not Responsive to Oxidative Stress in Rodent Beta Cell Lines

Directory of Open Access Journals (Sweden)

Faer Morrison

2012-01-01

Full Text Available Altered expression of oxidative metabolism genes has been described in the skeletal muscle of individuals with type 2 diabetes. Pancreatic beta cells contain low levels of antioxidant enzymes and are particularly susceptible to oxidative stress. In this study, we explored the effect of hyperglycemia-induced oxidative stress on a panel of oxidative metabolism genes in a rodent beta cell line. We exposed INS-1 rodent beta cells to low (5.6 mmol/L, ambient (11 mmol/L, and high (28 mmol/L glucose conditions for 48 hours. Increases in oxidative stress were measured using the fluorescent probe dihydrorhodamine 123. We then measured the expression levels of a panel of 90 oxidative metabolism genes by real-time PCR. Elevated reactive oxygen species (ROS production was evident in INS-1 cells after 48 hours (P<0.05. TLDA analysis revealed a significant (P<0.05 upregulation of 16 of the 90 genes under hyperglycemic conditions, although these expression differences did not reflect differences in ROS. We conclude that although altered glycemia may influence the expression of some oxidative metabolism genes, this effect is probably not mediated by increased ROS production. The alterations to the expression of oxidative metabolism genes previously observed in human diabetic skeletal muscle do not appear to be mirrored in rodent pancreatic beta cells.

Pituitary resistance to thyroid hormone associated with a base mutation in the hormone-binding domain of the human 3, 5,3[prime]-triiodothyronine receptor-[beta

Energy Technology Data Exchange (ETDEWEB)

Sasaki, Shigekazu; Nakamura, Hirotoshi; Tagami, Tetsuya; Miyoshi, Yohzi; Nogimori, Tsuyoshi; Mitsuma, Terunori; Imura, Hiroo (Kyoto Univ. School of Medicine, Aichi (Japan))

1993-05-01

Point mutations in the human T[sub 3] receptor-[beta] (TR[beta]) gene causing single amino acid substitutions have been identified in several different kindred with generalized resistance to thyroid hormone. Until now, no study has been reported on the TR gene in cases of pituitary resistance (PRTH). In the present study, the authors analyzed the TR[beta] gene in a 30-yr-old Japanese female with PRTH. She exhibited clinical features of hyperthyroidism, elevated serum thyroid hormone levels accompanied by inappropriately increased secretion of TSH, mildly elevated basal metabolic rate, and increased urinary excretion of hydroxyproline. No pituitary tumor was detected. DNA fragments of exons 3-8 of the geonomic TR[beta] gene were generated by the polymerase chain reaction and analyzed by a single stranded conformation polymorphism method. Exon 7 of the patient's TR[beta] gene showed an abnormal band, suggesting the existence of mutation(s). By subcloning and sequencing the DNA, a point mutation was identified in one allele at nucleotide 1297 (C to T), which altered the 333rd amino acid, arginine, to tryptophan. Neither of her apparently normal parents had any mutations of the TR[beta] gene. In vitro translation products of the mutant TR[beta] gene showed remarkably decreased T[sub 3]-binding activity (K[sub a], 2.1 [times] 10[sup 8] M[sup [minus]1]; normal TR[beta] K[sub a], 1.1 [times] 10[sup 10] M[sup [minus]1]). Since the molecular defect detected in a patient with PRTH is similar to that seen in subjects with generalized resistance to thyroid hormone, both types of the syndrome may represent a continuous spectrum of the same etiological defect with variable tissue resistance to thyroid hormone.

Molecular cloning and analysis of zebrafish voltage-gated sodium channel beta subunit genes: implications for the evolution of electrical signaling in vertebrates

Directory of Open Access Journals (Sweden)

Zhong Tao P

2007-07-01

Full Text Available Abstract Background Action potential generation in excitable cells such as myocytes and neurons critically depends on voltage-gated sodium channels. In mammals, sodium channels exist as macromolecular complexes that include a pore-forming alpha subunit and 1 or more modulatory beta subunits. Although alpha subunit genes have been cloned from diverse metazoans including flies, jellyfish, and humans, beta subunits have not previously been identified in any non-mammalian species. To gain further insight into the evolution of electrical signaling in vertebrates, we investigated beta subunit genes in the teleost Danio rerio (zebrafish. Results We identified and cloned single zebrafish gene homologs for beta1-beta3 (zbeta1-zbeta3 and duplicate genes for beta4 (zbeta4.1, zbeta4.2. Sodium channel beta subunit loci are similarly organized in fish and mammalian genomes. Unlike their mammalian counterparts, zbeta1 and zbeta2 subunit genes display extensive alternative splicing. Zebrafish beta subunit genes and their splice variants are differentially-expressed in excitable tissues, indicating tissue-specific regulation of zbeta1-4 expression and splicing. Co-expression of the genes encoding zbeta1 and the zebrafish sodium channel alpha subunit Nav1.5 in Chinese Hamster Ovary cells increased sodium current and altered channel gating, demonstrating functional interactions between zebrafish alpha and beta subunits. Analysis of the synteny and phylogeny of mammalian, teleost, amphibian, and avian beta subunit and related genes indicated that all extant vertebrate beta subunits are orthologous, that beta2/beta4 and beta1/beta3 share common ancestry, and that beta subunits are closely related to other proteins sharing the V-type immunoglobulin domain structure. Vertebrate sodium channel beta subunit genes were not identified in the genomes of invertebrate chordates and are unrelated to known subunits of the para sodium channel in Drosophila. Conclusion The

17 beta-hydroxysteroid dehydrogenase 3 deficiency in the Mediterranean population.

Science.gov (United States)

Rosler, Ariel

2006-08-01

Eighty-five males with 17 beta-HSD3 were identified among a highly inbred Arab population in Israel and 57 studied over a period of 25 years. The founders of this defect originated in the mountainous regions of present Lebanon and Syria, but most of the families now live in Jerusalem, Hebron, the Tel-Aviv area and, in particular, in Gaza, where the frequency of affected males is estimated at 1 in 100 to 150. Affected individuals are born with ambiguity of the external genitalia and reared as females until puberty. Thereafter marked virilization occurs, leading in many cases to the spontaneous adoption of a male gender identity and role. Adults develop a male habitus with abundant body hair and beard and the phallus and testes enlarge to adult proportions. Gender reassignment in infancy was only possible when enough erectile tissue was present at birth and developed into a normal size penis with testosterone. 17 beta-HSD3 deficiency can be reliably diagnosed by endocrine evaluation and mutation analysis. In adults the defect is characterized by markedly increased concentrations of androstenedione (A) with borderline low to normal testosterone (T) levels and a high A/T ratio. 5a-dihydrotestosterone (DHT) concentrations are moderately decreased, normal or high and dehydroepiandrosterone (DHEA) levels are high. The estrogen pathway is also impaired, even though both estrone (E-1) and estradiol-17 beta (E-2) levels are high. Children have low basal levels of all androgens, but the defect may be demonstrated after prolonged stimulation with human chorionic gonadotropin (HCG). LH and FSH levels are very high after puberty and normal in childhood. 17 beta-HSD3 isozyme is encoded by the chromosome 9q22 17 beta-HSD3 gene and expressed exclusively in testes. A point mutation in exon 3, codon 80 of the 17 beta-HSD3 gene, R80Q, caused by a single base substitution from CGG ( arginine) to CAG ( glutamine) was identified in both alleles of 24 individuals from 9 extended Arab

Ribosomal protein gene knockdown causes developmental defects in zebrafish.

Directory of Open Access Journals (Sweden)

Tamayo Uechi

Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

Early Infantile Leigh-like Gene Defects Have a Poor Prognosis: Report and Review

Directory of Open Access Journals (Sweden)

Majid Alfadhel

2017-10-01

Full Text Available Solute carrier family 19 (thiamine transporter, member 3 ( SCL19A3 gene defect produces an autosomal recessive neurodegenerative disorder associated with different phenotypes and acronyms. One of the common presentations is early infantile lethal Leigh-like syndrome. We report a case of early infantile Leigh-like SLC19A3 gene defects of patients who died at 4 months of age with no response to a high dose of biotin and thiamine. In addition, we report a novel mutation that was not reported previously. Finally, we review the literature regarding early infantile Leigh-like SLC19A3 gene defects and compare the literature with our patient.

Gene expression profile altered by orthodontic tooth movement during healing of surgical alveolar defect.

Science.gov (United States)

Choi, Eun-Kyung; Lee, Jae-Hyung; Baek, Seung-Hak; Kim, Su-Jung

2017-06-01

We explored the gene expression profile altered by orthodontic tooth movement (OTM) during the healing of surgical alveolar defects in beagles. An OTM-related healing model was established where a maxillary second premolar was protracted into the critical-sized defect for 6 weeks (group DT6). As controls, natural healing models without OTM were set at 2 weeks (group D2) and at 6 weeks (group D6) after surgery. Total RNAs were extracted from dissected tissue blocks containing the regenerated defects and additionally from sound alveolar bone as a baseline (group C). mRNA profiling was performed using microarray analysis. Functional annotations of gene clusters based on differentially expressed genes among groups indicated that the gene expression profile of group DT6 had a stronger similarity to that of group D2 than to group D6. The genes participating in high woven-bone fraction in group DT6 could be identified as TNFSF11, MMP13, SPP1, and DMP1, which were verified by quantitative real-time polymerase chain reactions. We investigated at the gene level that OTM can affect the healing state of surgical defects serving as favorable matrices for OTM with defect regeneration. It would be a basis on selecting putative genes to be therapeutically applied for tissue-friendly accelerated orthodontics in the future. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

Study of the effect of HFE gene mutations on iron overload in ...

African Journals Online (AJOL)

Manal Michel Wilson

2015-03-04

Mar 4, 2015 ... The Egyptian Journal of Medical Human Genetics www.ejmhg.eg.net ... RDB, a panel of probes (n = 22) using the beta globin strip assay was used ... (20 pmol) of primer R and 5 ll (100 ng) of genomic extracted. DNA.

RFLP for the human retinoic acid receptor gene RAR-. beta

Energy Technology Data Exchange (ETDEWEB)

Datson, N A; Oostra, B A [Erasmus Univ., Rotterdam (Netherlands); van der Saag, P T [Netherlands Institute for Developmental Biology, Utrecht (Netherlands)

1989-11-11

1.4 kb Mae I fragment containing the entire RAR-{beta} ORF was cloned into the Sma I site of pTZ18U, yielding the plasmid pCOD20. Msp I digestion of genomic DNA and hybridization with the pCOD20 probe detects a two allele polymorphism with allelic fragments of 8.1 and 7.7 kb. The human RAR-{beta} gene has been localized to the p24 band of chromosome 3. Co-dominant segregation of the alleles was observed in 4 Caucasian families.

The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype

Directory of Open Access Journals (Sweden)

Türker Bilgen

2011-09-01

Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.

Isolation and characterization of BetaM protein encoded by ATP1B4 - a unique member of the Na,K-ATPase {beta}-subunit gene family

Energy Technology Data Exchange (ETDEWEB)

Pestov, Nikolay B. [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Moscow 117997 (Russian Federation); Zhao, Hao [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Basrur, Venkatesha [Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109 (United States); Modyanov, Nikolai N., E-mail: nikolai.modyanov@utoledo.edu [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States)

2011-09-09

Highlights: {yields} Structural properties of BetaM and Na,K-ATPase {beta}-subunits are sharply different. {yields} BetaM protein is concentrated in nuclear membrane of skeletal myocytes. {yields} BetaM does not associate with a Na,K-ATPase {alpha}-subunit in skeletal muscle. {yields} Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. {yields} BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a {beta}-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase {beta}-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was

Production and characterization of monoclonal antibodies against α-globin chain-containing human hemoglobins for detecting α-thalassemia disease.

Science.gov (United States)

Pakdeepak, Kanet; Pata, Supansa; Chiampanichayakul, Sawitree; Kasinrerk, Watchara; Tatu, Thanusak

2016-01-01

Monoclonal antibodies against α-globin containing human Hbs, named AMS-Alpha1 and AMS-Alpha 2, were produced by the hybridoma technique using spleen cells enriched by the newly developed B lymphocyte enrichment protocol. These two monoclonal antibodies were of IgM class, reacting to only intact form of human Hbs A, A2, E, and F, which contain α-globin chain. By the indirect ELISA, the AMS-Alpha1 and AMS-Alpha 2 quantified less amount of α-globin chain containing hemoglobins in HbH disease than the SEA-α thalassemia 1 carriers and normal individuals. It was thus anticipated that these monoclonal antibodies can be used for detecting Hb Bart's hydrops fetalis in which no α-globin chain is produced.

A crucial role of beta 1 integrins for keratinocyte migration in vitro and during cutaneous wound repair

DEFF Research Database (Denmark)

Grose, Richard; Hutter, Caroline; Bloch, Wilhelm

2002-01-01

of beta 1 integrins in keratinocytes caused a severe defect in wound healing. beta 1-null keratinocytes showed impaired migration and were more densely packed in the hyperproliferative epithelium. Surprisingly, their proliferation rate was not reduced in early wounds and even increased in late wounds....... The failure in re-epithelialisation resulted in a prolonged inflammatory response, leading to dramatic alterations in the expression of important wound-regulated genes. Ultimately, beta 1-deficient epidermis did cover the wound bed, but the epithelial architecture was abnormal. These findings demonstrate...

Dificuldades na identificação laboratorial da talassemia alfa Difficulty on laboratory identification of alpha thalassemia

Directory of Open Access Journals (Sweden)

Karlla Greick Batista Dias-Penna

2010-04-01

diagnosis is made by the visualization of Hb H through alkaline electrophoresis on cellulose acetate or by the identification of inclusion bodies stained with brilliant cresyl blue. Objective: Evaluate alpha thalassemia carriers and their respective progenitors, correlating their hematology profile and the presence of Hb H by means of standard laboratory procedures in three different samplings. Discussion and conclusion: The results show that the presence of Hb H, which is indicative of alpha thalassemia, may not be confirmed in a subsequent analysis. Iron deficiency in Hb H carriers is among the factors that may influence on the absence of Hb H in alpha thalassemia proven patients. Alpha thalassemia is associated with genetic defects involving alpha chain encoding genes, but may be also associated with a temporary imbalance of globin gene expression, alpha chain reduction or beta increase, which could explain the presence of beta chain tetramer (Hb H leading to the diagnosis of alpha thalassemia minor.

Tolerance induction to cytoplasmic beta-galactosidase by hepatic AAV gene transfer: implications for antigen presentation and immunotoxicity.

Directory of Open Access Journals (Sweden)

Ashley T Martino

2009-08-01

Full Text Available Hepatic gene transfer, in particular using adeno-associated viral (AAV vectors, has been shown to induce immune tolerance to several protein antigens. This approach has been exploited in animal models of inherited protein deficiency for systemic delivery of therapeutic proteins. Adequate levels of transgene expression in hepatocytes induce a suppressive T cell response, thereby promoting immune tolerance. This study addresses the question of whether AAV gene transfer can induce tolerance to a cytoplasmic protein.AAV-2 vector-mediated hepatic gene transfer for expression of cytoplasmic beta-galactosidase (beta-gal was performed in immune competent mice, followed by a secondary beta-gal gene transfer with E1/E3-deleted adenoviral Ad-LacZ vector to provoke a severe immunotoxic response. Transgene expression from the AAV-2 vector in approximately 2% of hepatocytes almost completely protected from inflammatory T cell responses against beta-gal, eliminated antibody formation, and significantly reduced adenovirus-induced hepatotoxicity. Consequently, approximately 10% of hepatocytes continued to express beta-gal 45 days after secondary Ad-LacZ gene transfer, a time point when control mice had lost all Ad-LacZ derived expression. Suppression of inflammatory T cell infiltration in the liver and liver damage was linked to specific transgene expression and was not seen for secondary gene transfer with Ad-GFP. A combination of adoptive transfer studies and flow cytometric analyses demonstrated induction of Treg that actively suppressed CD8(+ T cell responses to beta-gal and that was amplified in liver and spleen upon secondary Ad-LacZ gene transfer.These data demonstrate that tolerance induction by hepatic AAV gene transfer does not require systemic delivery of the transgene product and that expression of a cytoplasmic neo-antigen in few hepatocytes can induce Treg and provide long-term suppression of inflammatory responses and immunotoxicity.

Syndromes and Disorders Associated with Omphalocele (III: Single Gene Disorders, Neural Tube Defects, Diaphragmatic Defects and Others

Directory of Open Access Journals (Sweden)

Chih-Ping Chen

2007-06-01

Full Text Available Omphalocele can be associated with single gene disorders, neural tube defects, diaphragmatic defects, fetal valproate syndrome, and syndromes of unknown etiology. This article provides a comprehensive review of omphalocele-related disorders: otopalatodigital syndrome type II; Melnick–Needles syndrome; Rieger syndrome; neural tube defects; Meckel syndrome; Shprintzen–Goldberg omphalocele syndrome; lethal omphalocele-cleft palate syndrome; cerebro-costo-mandibular syndrome; fetal valproate syndrome; Marshall–Smith syndrome; fibrochondrogenesis; hydrolethalus syndrome; Fryns syndrome; omphalocele, diaphragmatic defects, radial anomalies and various internal malformations; diaphragmatic defects, limb deficiencies and ossification defects of skull; Donnai–Barrow syndrome; CHARGE syndrome; Goltz syndrome; Carpenter syndrome; Toriello–Carey syndrome; familial omphalocele; Cornelia de Lange syndrome; C syndrome; Elejalde syndrome; Malpuech syndrome; cervical ribs, Sprengel anomaly, anal atresia and urethral obstruction; hydrocephalus with associated malformations; Kennerknecht syndrome; lymphedema, atrial septal defect and facial changes; and craniosynostosis- mental retardation syndrome of Lin and Gettig. Perinatal identification of omphalocele should alert one to the possibility of omphalocele-related disorders and familial inheritance and prompt a thorough genetic counseling for these disorders.

Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

Science.gov (United States)

Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

2003-08-01

The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

[Analysis of resistant genes of beta-lactam antibiotics from Pseudomonas aeruginosa in pediatric patients].

Science.gov (United States)

Dong, Fang; Xu, Xi-wei; Song, Wen-qi; Lü, Ping; Yang, Yong-hong; Shen, Xu-zhuang

2008-11-18

To analyze the antibiotic resistance of the Pseudomonas aeruginosa (PA) isolated from pediatric patients and the resistant genes of beta-lactam antibiotics thereof. 146 PA strains were isolated from pediatric patients. Agar dilution method recommended by the Clinical and Laboratory Standards Institute was used to examine the minimum inhibitory concentrations (MICs) of 12 antimicrobial agents, including the penicillins, third and fourth genet ration cephalosporins, carbapenemase, Aztreonam, beta-lactamase inhibitors, quinolones, and aminoglycosides. PCR was used to detect the expression of the genes TEM, SHV, OXA, PER, GES, CTX-M, IMP, VIM, DHA, MIR, FOX, and oprD2. The multi-drug resistance rates against different antibiotic were high among the 146 PA strains. The rates of imipenem and meropenem resistance were 41.1% and 35.6% respectively. Among the 146 PA strains, 46 (31.5%) were positive for the MBL genotype; 38 (82.6%) carried the blaIMP gene, 8 (17.4%) carried the blaVIM gene, and 114 (78.1%) were oprD2 negative. The genes TEM, SHV, OXA, CTX-M, PER, VEB, GES, FOX, MIR, and DHA were not found in all strains. Many PA isolated from pediatric patients carry the genes IMP or VIM and losses oprD2 gene related to the expression of the outer membrane porin OprD2. The loss of the gene oprD2 is essential mechanism of beta-lactam antibiotics resistance in PA.

Surgical Treatment of Periodontal Intrabony Defects with Calcium Sulphate in Combination with Beta-Tricalcium Phosphate: Clinical Observations Two Years Post-Surgery

Directory of Open Access Journals (Sweden)

Sujith Sukumar

2011-01-01

Full Text Available The study was designed to evaluate the clinical outcome of a composite material, beta-tricalcium phosphate in combination with calcium sulphate, in the treatment of periodontal intrabony defects. The combination of these materials is believed to aid in guided tissue regeneration owing to their properties. A total of 47 teeth with intrabony defects in 26 periodontitis patients were treated with Fortoss® Vital (Biocomposites, Staffordshire, UK. Clinical parameters were evaluated which included changes in probing depth, clinical attachment level/loss and gingival recession at the baseline and 2 years postoperatively. The mean differences in measurements between the baseline and 2 years postoperatively were a reduction of 2.07±1.14 mm (p=0.000 in case of probing depth and a gain of 1.93±1.36 mm (p=0.000 in clinical attachment level; but an increase of 0.14±0.73 mm (p=0.571 in gingival recession. The study results show that the treatment with a combination of beta tricalcium phosphate and calcium sulphate led to a significantly favorable clinical improvement in periodontal intrabony defects 2 years after the surgery.

Activation of the human beta interferon gene by the adenovirus type 12 E1B gene

International Nuclear Information System (INIS)

Shiroki, K.; Toth, M.

1988-01-01

The transcription of endogenous beta interferon mRNA was activated in human embryo kidney (HEK) cells infected with adenovirus 12 (Ad12) but was activated only inefficiently or not at all in HEK cells infected with Ad5 and rc-1 (Ad5 dl312 containing the Ad12 E1A region). The analysis with Ad12 mutants showed that Ad12 E1B products, especially the 19K protein, were important for the expression of the endogenous beta interferon gene and Ad12 E1A products were not involved in the expression. The expression of exogeneously transfected pIFN-CAT (a hybrid plasmid having the human beta interferon promoter fused with the CAT gene) was activated in HEK and chicken embryo fibroblast (CEF) cells infected with either Ad12 or Ad5. The analysis of cotransfection of CEF cells with pIFN-CAT and plasmids containing fragments of Ad12 or Ad5 DNA showed that Ad12 or Ad5 E1B (possibly the 19K protein) was and E1A was not involved in the expression of the exogenous pIFN-CAT

Tissue-specific and pathogen-induced regulation of a Nicotiana plumbaginifolia beta-1,3-glucanase gene.

Science.gov (United States)

Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M

1990-01-01

The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158

Identification of novel microsatellite markers preimplantation genetic diagnosis of beta-thalassemia.

Science.gov (United States)

Chen, Min; Tan, Arnold S C; Cheah, Felicia S H; Saw, Eugene E L; Chong, Samuel S

2015-12-01

Beta (β)-thalassemia is one of the most common monogenic diseases worldwide. Affected pregnancies can be avoided through preimplantation genetic diagnosis (PGD), which commonly involves customized assays to detect the different combinations of β-globin (HBB) gene mutations present in couples, in conjunction with linkage analysis of flanking microsatellite markers. Currently, the limited number of reported closely linked markers hampers their utility in indirect linkage-based PGD for this disorder. To increase the available markers closely flanking the HBB gene, an in silico search was performed to identify all markers within 1 Mb flanking the HBB gene. Fifteen markers with potentially high polymorphism information content (PIC) and heterozygosity values were selected and optimized into a single-tube pentadecaplex PCR panel. Allele frequencies and polymorphism and heterozygosity indices of each marker were assessed in five populations. A total of 238 alleles were observed from the 15 markers. PIC was >0.7 for all markers, with expected heterozygosity and observed heterozygosity values ranging from 0.74 to 0.90 and 0.72 to 0.88, respectively. Greater than 99% of individuals were heterozygous for at least seven markers, with at least two heterozygous markers on either side of the HBB gene. The pentadecaplex marker assay also performed reliably on single cells either directly or after whole genome amplification, thus validating its use in standalone linkage-based β-thalassemia PGD or in conjunction with HBB mutation detection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

Science.gov (United States)

Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

1993-03-01

We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

EPConDB: a web resource for gene expression related to pancreatic development, beta-cell function and diabetes.

Science.gov (United States)

Mazzarelli, Joan M; Brestelli, John; Gorski, Regina K; Liu, Junmin; Manduchi, Elisabetta; Pinney, Deborah F; Schug, Jonathan; White, Peter; Kaestner, Klaus H; Stoeckert, Christian J

2007-01-01

EPConDB (http://www.cbil.upenn.edu/EPConDB) is a public web site that supports research in diabetes, pancreatic development and beta-cell function by providing information about genes expressed in cells of the pancreas. EPConDB displays expression profiles for individual genes and information about transcripts, promoter elements and transcription factor binding sites. Gene expression results are obtained from studies examining tissue expression, pancreatic development and growth, differentiation of insulin-producing cells, islet or beta-cell injury, and genetic models of impaired beta-cell function. The expression datasets are derived using different microarray platforms, including the BCBC PancChips and Affymetrix gene expression arrays. Other datasets include semi-quantitative RT-PCR and MPSS expression studies. For selected microarray studies, lists of differentially expressed genes, derived from PaGE analysis, are displayed on the site. EPConDB provides database queries and tools to examine the relationship between a gene, its transcriptional regulation, protein function and expression in pancreatic tissues.

The 3D chromatin structure of the mouse β-haemoglobin gene cluster

NARCIS (Netherlands)

M.P.C. van de Corput (Mariëtte); T.A. Knoch (Tobias); E. de Boer (Ernie); W.A. van Cappellen (Gert); M. Lesnussa (Michael); H.J.F.M.M. Eussen (Bert)

2010-01-01

textabstractHere we show a 3D DNA-FISH method to visualizes the 3D structure of the β-globin locus. Geometric size and shape measurements of the 3D rendered signals (128Kb) show that the volume of the β-globin locus decreases almost two fold upon gene activation. A decrease in length and a

Elucidation of IL-1/TGF-beta interactions in mouse chondrocyte cell line by genome-wide gene expression

DEFF Research Database (Denmark)

Takahashi, N; Rieneck, K; van der Kraan, P M

2005-01-01

To elucidate the antagonism between interleukin-1 (IL-1) and transforming growth factor-beta (TGF-beta) at the gene expression level, as IL-1 and TGF-beta are postulated to be critical mediators of cartilage degeneration/protection in rheumatic diseases....

Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

International Nuclear Information System (INIS)

Popp, R.A.; Marsh, C.L.; Skow, L.C.

1981-01-01

Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

Uterine leiomyoma is associated with a polymorphism in the interleukin 1-beta gene.

Science.gov (United States)

Pietrowski, Detlef; Thewes, Roberta; Sator, Michael; Denschlag, Dominik; Keck, Christoph; Tempfer, Clemens

2009-08-01

To investigate whether polymorphisms in the interleukin-1beta (IL-1beta) gene are associated with uterine leiomyoma. Case-control study in a collective of 131 patients and 280 controls. Genotyping of the IL-1beta-511 and IL-1beta-3954 polymorphism was performed by PCR amplification and subsequent RFLP analysis. A significant difference in the allele frequencies of the IL-1beta-511 Cbeta-511 Cbeta-3954 polymorphism. The IL-1beta-511 promoter polymorphism is related to an increased susceptibility to uterine leiomyoma, suggesting that this polymorphism does contribute to the development of this disease.

Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

Science.gov (United States)

Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

1995-01-01

Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

[Beta thalassemia major and pregnancy during adolescence: report of two cases].

Science.gov (United States)

Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura

2015-06-01

Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

Congenital Hypothyroidism Caused by a PAX8 Gene Mutation Manifested as Sodium/Iodide Symporter Gene Defect

Directory of Open Access Journals (Sweden)

Wakako Jo

2010-01-01

Full Text Available Loss-of-function mutations of the PAX8 gene are considered to mainly cause congenital hypothyroidism (CH due to thyroid hypoplasia. However, some patients with PAX8 mutation have demonstrated a normal-sized thyroid gland. Here we report a CH patient caused by a PAX8 mutation, which manifested as iodide transport defect (ITD. Hypothyroidism was detected by neonatal screening and L-thyroxine replacement was started immediately. Although 123I scintigraphy at 5 years of age showed that the thyroid gland was in the normal position and of small size, his iodide trapping was low. The ratio of the saliva/plasma radioactive iodide was low. He did not have goiter; however laboratory findings suggested that he had partial ITD. Gene analyses showed that the sodium/iodide symporter (NIS gene was normal; instead, a mutation in the PAX8 gene causing R31H substitution was identified. The present report demonstrates that individuals with defective PAX8 can have partial ITD, and thus genetic analysis is useful for differential diagnosis.

Localization of pig Na[sup +], K[sup +]-ATPase [alpha] and [beta] subunit genes to chromosome 4 by radioactive in situ hybridization

Energy Technology Data Exchange (ETDEWEB)

Lahbib-Mansais, Y.; Yerle, M.; Dalens, M.; Chevalet, C.; Gellin, J. (Centre de Recherches de Toulouse (France))

1993-01-01

Two genes coding for Na[sup +],K[sup +] -ATPase [alpha] and [beta] subunits are localized on pig chromosome 4, to the q1.6[yields]q2.3 and 1.3[yields]q2.1 regions, respectively, by radioactive in situ hybridization. According to nucleotide and amino acid sequence comparisons with different human isoforms of Na[sup +] ,K[sup +]-ATPase, these pig [alpha] and [beta] ATPase genes show strong homologies with human [alpha]1 and [beta] subunit ATPase genes, respectively. These results are discussed with respect to comparative mapping data of conserved genes in mammalian species. We showed that the pig cDNA probes encoding ATPase [alpha] and, [beta] genes reveal DNA polymorphism in Meishan an Large White pigs. 35 refs., 4 figs., 2 tabs.

Coordinate expression of heme and globin is essential for effective erythropoiesis.

Science.gov (United States)

Doty, Raymond T; Phelps, Susan R; Shadle, Christina; Sanchez-Bonilla, Marilyn; Keel, Siobán B; Abkowitz, Janis L

2015-12-01

Erythropoiesis requires rapid and extensive hemoglobin production. Heme activates globin transcription and translation; therefore, heme synthesis must precede globin synthesis. As free heme is a potent inducer of oxidative damage, its levels within cellular compartments require stringent regulation. Mice lacking the heme exporter FLVCR1 have a severe macrocytic anemia; however, the mechanisms that underlie erythropoiesis dysfunction in these animals are unclear. Here, we determined that erythropoiesis failure occurs in these animals at the CFU-E/proerythroblast stage, a point at which the transferrin receptor (CD71) is upregulated, iron is imported, and heme is synthesized--before ample globin is produced. From the CFU-E/proerythroblast (CD71(+) Ter119(-) cells) stage onward, erythroid progenitors exhibited excess heme content, increased cytoplasmic ROS, and increased apoptosis. Reducing heme synthesis in FLVCR1-defient animals via genetic and biochemical approaches improved the anemia, implying that heme excess causes, and is not just associated with, the erythroid marrow failure. Expression of the cell surface FLVCR1 isoform, but not the mitochondrial FLVCR1 isoform, restored normal rbc production, demonstrating that cellular heme export is essential. Together, these studies provide insight into how heme is regulated to allow effective erythropoiesis, show that erythropoiesis fails when heme is excessive, and emphasize the importance of evaluating Ter119(-) erythroid cells when studying erythroid marrow failure in murine models.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

Science.gov (United States)

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

Blue ghosts: a new method for isolating amber mutants defective in essential genes of Escherichia coli

DEFF Research Database (Denmark)

Brown, S; Brickman, E R; Beckwith, J

1981-01-01

We describe a technique which permits an easy screening for amber mutants defective in essential genes of Escherichia coli. Using this approach, we have isolated three amber mutants defective in the rho gene. An extension of the technique allows the detection of ochre mutants and transposon inser...

Human amyloid beta protein gene locus: HaeIII RFLP

Energy Technology Data Exchange (ETDEWEB)

Taylor, J E; Gonzalez-DeWhitt, P A; Fuller, F; Cordell, B; Frossard, P M [California Biotechnology Inc., Mountain View (USA); Tinklenberg, J R; Davies, H D; Eng, L F; Yesavage, J A [Stanford Univ. School of Medicine, Palo Alto, CA (USA)

1988-07-25

A 2.2 kb EcoRI-EcoRI fragment from the 5{prime} end of the human amyloid beta protein cDNA was isolated from a human fibroblast cDNA library and subcloned into pGEM3. HaeIII (GGCC) detects 6 invariant bands at 0.5 kb, 1.0 kb, 1.1 kb, 1.3 kb, 1.4 kb and 1.6 kb and a two-allele polymorphism with bands at either 1.9 kb or 2.1 kb. Its frequency was studied in 50 North Americans. Human amyloid beta protein gene mapped to the long arm of chromosome 21 (21q11.2-21q21) by Southern blot analysis of human-rodent somatic cell hybrids. Co-dominant segregation was observed in two families (15 individuals).

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

Science.gov (United States)

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

OpenAIRE

Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

1993-01-01

The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene d...

Hb TAYBE: clinical and morphological findings IN 43 patients.

Science.gov (United States)

Koren, Ariel; Levin, Carina; Zalman, Luci; Palmor, Haya; Filon, Dvora; Chubar, Evgeny; Resnitzky, Peretz; Bennett, Michael

2016-08-01

Hereditary sequence variants in globin genes are usually silent and are rarer in α-globin chains than β-globin chains. Some may lead to an unstable protein with a hemolytic or thalassemic phenotype. Hb Taybe is an unstable α-chain hemoglobin variant caused by the deletion of a threonine residue at codon 38 or 39 of the α1 globin gene. This deletion results in a structural abnormality that affects the α1 β2 contact and the α1 β1 interface, producing a highly unstable Hb. We describe the clinical, laboratory, and morphological characteristics of 43 patients with Hb Taybe, sixteen of whom are heterozygous, eight are homozygous, and nineteen are double heterozygous for Hb Taybe and other α-gene mutations or deletions. The clinical presentation is very variable from a mild hemolytic anemia to the need for red cell transfusion. Morphological characteristics include erythroid hyperplasia, defective hemoglobin production, and dyserythropoietic features. On electron microscopy dyserythropoiesis and cytoplasmic precipitation of globin compatible optical dense material is seen. This is the largest report of Hb Taybe patients. Previous reported cohorts are not related to these cases. We conclude that patients carrying Hb Taybe have a unique hematological and clinical phenotype distinct from other hemoglobinopathies and from congenital dyserythropoietic anemia. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

Energy Technology Data Exchange (ETDEWEB)

Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))

1988-11-01

The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

Molecular ecophysiology of Antarctic notothenioid fishes.

Science.gov (United States)

Cheng, C-H Christina; Detrich, H William

2007-12-29

the mechanistic understanding of the dynamics of AFGP gene gain and loss. In humans and most vertebrates, mutations in the alpha- or beta-globin genes or defects in globin chain synthesis are causes of severe genetic disease. Thus, the 16 species of haemoglobinless, erythrocyte-null icefishes are surprising anomalies -- in fact, they could only have evolved and thrived due to relaxed selection pressure for oxygen-binding proteins in the cold, oxygen-rich waters of the Southern Ocean. Fifteen of the sixteen icefish species have lost most of the adult alphabeta-globin locus and retain only a small 3' fragment of the alpha-globin gene. The only exception to this pattern occurs in Neopagetopsis ionah, which possesses a disrupted alphabeta-globin gene complex that probably represents a non-functional intermediate on the evolutionary pathway to near total globin gene extinction. By contrast, six of the icefish species fail to express myoglobin. The absence of myoglobin expression has occurred by several independent mutations and distinct mechanisms. Haemoprotein loss is correlated with dramatic increases in cellular mitochondrial density, heart size, blood volume and capillary bed volume. Evolution of these compensatory traits was probably facilitated by the homeostatic activity of nitric oxide, a key modulator of angiogenesis and mitochondrial biogenesis. These natural knockouts of the red blood cell lineage are an excellent genomic resource for erythroid gene discovery by comparative genomics, as illustrated for the newly described gene, bloodthirsty.

The structure of the human interferon alpha/beta receptor gene.

Science.gov (United States)

Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

1992-02-05

Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

Closely linked polymorphic marker: successful application in preimplantation genetic diagnosis for beta-thalassemia%紧密连锁的多态性位点在β地中海贫血植入前遗传学诊断中的应用

Institute of Scientific and Technical Information of China (English)

邓捷; 庄广伦; 彭文林; 周灿权; 李洁; 方丛; 李穗萍; 陈勇; 童大跃

2005-01-01

目的探讨与β珠蛋白基因紧密连锁的多态性位点 HumTH01在β地中海贫血(β地贫)植入前遗传学诊断(preimplantation genetic diagnosis,PGD)中的作用.方法对4例已出生重型β地贫患儿的、双方均为β地贫基因携带者的夫妇进行了6个周期的PGD治疗,应用多重巢式PCR同时检测β珠蛋白基因及 HumTH01基因,选择健康的胚胎移植入子宫.结果 6个周期共活检44个胚胎,获得44个卵裂球,其中41个卵裂球扩增成功,35个胚胎经PCR分析后获得明确诊断,移植了14个胚胎,获得1例临床妊娠.孕17周时经脐带血穿刺,证实为完全正常胚胎,现已出生一正常女婴.单个卵裂球平均扩增效率为89.7%,等位基因脱扣(allele drop-out, ADO)率为14.4%. HumTH01基因可以帮助检测出ADO及污染的发生.结论本研究为国内首次报道应用多重巢式PCR同时检测β珠蛋白基因及 HumTH01基因对β地贫进行植入前遗传学诊断并成功获得临床妊娠.在PGD中同时检测与β珠蛋白基因紧密连锁的多态性位点可以降低PGD中由于ADO及污染造成的误诊的风险.%Objective To evaluate the applicability of the polymorphic marker closely linked with beta-globin gene for the preimplantati on genetic diagnosis (PGD) in couples at risk of having child with beta-thalassemia. Methods Single cell multiplex nested PCR which coamplifies the beta-globin gene and the closely linked polymorphic marker, HumTHO1 gene, was applied in six clinical PGD cycles for four couples with beta-thalassemia. Results In six clinical PGD cycles, a total of 44 embryos were biopsied and 44 blastomeres were obtained. Forty-one blastomeres were amplified and thirty-five embryos were given definite diagnoses. Fourteen embryos were transferred back to the uterus of the patients and one pregnancy went on well and ended with one live healthy birth, which confirmed the results of PGD. The average amplification efficiency of single blastomere was 89.7% and

Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

Science.gov (United States)

White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

2014-08-01

The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

DEFF Research Database (Denmark)

Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

2009-01-01

BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

Effect of family counsellling on psychological distress among ...

African Journals Online (AJOL)

Background: Sickle Cell Anaemia (SCA) is a haematological disorder of red blood cells, caused by mutation in the beta globin gene. Caring for patients with the disorder poses a significant psychological burden on the sufferers, the caregivers and their families, thereby affecting their quality of life. Family counselling has ...

Role for beta-catenin and HOX transcription factors in Caenorhabditis elegans and mammalian host epithelial-pathogen interactions.

Science.gov (United States)

Irazoqui, Javier E; Ng, Aylwin; Xavier, Ramnik J; Ausubel, Frederick M

2008-11-11

We used the model nematode Caenorhabditis elegans infected with the human pathogen Staphylococcus aureus to identify components of epithelial immunity. Transcriptional profiling and reverse genetic analysis revealed that mutation of the C. elegans beta-catenin homolog bar-1 or the downstream homeobox gene egl-5 results in a defective response and hypersensitivity to S. aureus infection. Epistasis analysis showed that bar-1 and egl-5 function in parallel to previously described C. elegans immune-response pathways. Overexpression of human homologs of egl-5 modulated NF-kappaB-dependent TLR2 signaling in epithelial cells. These data suggest that beta-catenin and homeobox genes play an important and conserved role in innate immune defense.

Structure of a WW domain-containing fragment of dystrophin complexed with {beta}-dystroglycan.

Energy Technology Data Exchange (ETDEWEB)

Huang, X.; Poy, F.; Zhang, R.; Joachimiak, A.; Sudol, M.; Eck, M. J.; Biosciences Division; Dana Farber Cancer Inst.; Harvard Medical School; Mount Sinai School of Medicine

2000-08-01

Dystrophin and {beta}-dystroglycan are components of the dystrophin--glycoprotein complex (DGC), a multimolecular assembly that spans the cell membrane and links the actin cytoskeleton to the extracellular basal lamina. Defects in the dystrophin gene are the cause of Duchenne and Becker muscular dystrophies. The C-terminal region of dystrophin binds the cytoplasmic tail of {beta}-dystroglycan, in part through the interaction of its WW domain with a proline-rich motif in the tail of {beta}-dystroglycan. Here we report the crystal structure of this portion of dystrophin in complex with the proline-rich binding site in {beta}-dystroglycan. The structure shows that the dystrophin WW domain is embedded in an adjacent helical region that contains two EF-hand-like domains. The {beta}-dystroglycan peptide binds a composite surface formed by the WW domain and one of these EF-hands. Additionally, the structure reveals striking similarities in the mechanisms of proline recognition employed by WW domains and SH3 domains.

Genomic organization of the mouse peroxisome proliferator-activated receptor beta/delta gene

DEFF Research Database (Denmark)

Larsen, Leif K; Amri, Ez-Zoubir; Mandrup, Susanne

2002-01-01

Peroxisome proliferator-activated receptor (PPAR) beta/delta is ubiquitously expressed, but the level of expression differs markedly between different cell types. In order to determine the molecular mechanisms governing PPARbeta/delta gene expression, we have isolated and characterized the mouse...

Approaches to diagnose DNA mismatch repair gene defects in cancer

DEFF Research Database (Denmark)

Peña-Diaz, Javier; Rasmussen, Lene Juel

2016-01-01

development was first observed in colorectal cancer patients that carried inactivating germline mutations in MMR genes and the disease was named as hereditary non-polyposis colorectal cancer (HNPCC). Currently, a growing list of cancers is found to be MMR defective and HNPCC has been renamed Lynch syndrome...

Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

Science.gov (United States)

Groner, B; Hynes, N E

1980-01-01

The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

The chicken beta 2-microglobulin gene is located on a non-major histocompatibility complex microchromosome: a small, G+C-rich gene with X and Y boxes in the promoter

DEFF Research Database (Denmark)

Riegert, P; Andersen, R; Bumstead, N

1996-01-01

a similar genomic organization but smaller introns and higher G+C content than mammalian beta 2-microglobulin genes. The promoter region is particularly G+C-rich and contains, in addition to interferon regulatory elements, potential S/W, X, and Y boxes that were originally described for mammalian class II...... but not class I alpha or beta 2-microglobulin genes. There is a single chicken beta 2-microglobulin gene that has little polymorphism in the coding region. Restriction fragment length polymorphisms from Mhc homozygous lines, Mhc congenic lines, and backcross families, as well as in situ hybridization, show...

Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

Science.gov (United States)

Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

1993-04-01

The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

Purification, characterization and gene cloning of thermostable O-acetyl-L-serine sulfhydrylase forming {beta}-cyano-L-alanine

Energy Technology Data Exchange (ETDEWEB)

Omura, Hironori; Yoshida, Toyokazu; Nagasawa, Toru [Gifu Univ. (Japan). Dept. of Biomolecular Science; Kuroda, Masako [Ikeda Food Research Co., Ltd., Fukuyama, Hiroshima (Japan); Kobayashi, Michihiko; Shimizu, Sakayu [Kyoto Univ. (Japan). Agricultural Sciences

2003-10-01

A thermophilic and cyanide ion-tolerant bacterium, Bacillus stearothermophilus CN3 isolated from a hot spring in Japan, was found to produce thermostable {beta}-cyano-L-alanine synthase. The enzyme catalyzes the synthesis of {beta}-cyano-L-alanine from O-acetyl-L-serine and cyanide ions. The purified enzyme has a molecular mass of approximately 70 kDa and consists of two identical sub-units. It was stable in the pH range of 6.0 to 10.0 and up to 70degC. The enzyme also catalyzes the synthesis of various {beta}-substituted-L-alanine derivatives from O-acetyl-L-serine and nucleophilic reagents. The gene encoding the {beta}-cyano-L-alanine synthase was isolated from B. stearothermophilus CN3. Sequence homology analysis revealed that the {beta}-cyano-L-alanine synthase of the bacterium is O-acetyl-L-serine sulfhydrylase. A recombinant plasmid, constructed by ligation of the cloned gene and an expression vector, pKK223-3, was introduced into E. coli JM109. The transformed E. coli cells overexpressed {beta}-cyano-L-alanine synthase. Heat stable {beta}-cyano-L-alanine synthase can be applied to the synthesis of [4-{sup 11}C]L-2,4-diaminobutyric acid as a tracer for positron emission tomography. (author)

Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

Science.gov (United States)

Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

2010-09-16

The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

Recent trends in the gene therapy of β-thalassemia

Directory of Open Access Journals (Sweden)

Finotti A

2015-02-01

Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

GSK3 inactivation is involved in mitochondrial complex IV defect in transforming growth factor (TGF) {beta}1-induced senescence

Energy Technology Data Exchange (ETDEWEB)

Byun, Hae-Ok; Jung, Hyun-Jung; Seo, Yong-Hak; Lee, Young-Kyoung [Department of Biochemistry and Molecular Biology, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Department of Molecular Science and Technology, The Graduate School, Ajou University, Suwon 443-721 (Korea, Republic of); Hwang, Sung-Chul [Department of Pulmonary and Critical Care Medicine, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Seong Hwang, Eun [Department of Life Science, University of Seoul, Seoul 130-743 (Korea, Republic of); Yoon, Gyesoon, E-mail: ypeace@ajou.ac.kr [Department of Biochemistry and Molecular Biology, Ajou University School of Medicine, Suwon 443-721 (Korea, Republic of); Department of Molecular Science and Technology, The Graduate School, Ajou University, Suwon 443-721 (Korea, Republic of)

2012-09-10

Transforming growth factor {beta}1 (TGF {beta}1) induces Mv1Lu cell senescence by persistently producing mitochondrial reactive oxygen species (ROS) through decreased complex IV activity. Here, we investigated the molecular mechanism underlying the effect of TGF {beta}1 on mitochondrial complex IV activity. TGF {beta}1 progressively phosphorylated the negative regulatory sites of both glycogen synthase kinase 3 (GSK3) {alpha} and {beta}, corresponding well to the intracellular ROS generation profile. Pre-treatment of N-acetyl cysteine, an antioxidant, did not alter this GSK3 phosphorylation (inactivation), whereas pharmacological inhibition of GSK3 by SB415286 significantly increased mitochondrial ROS, implying that GSK3 phosphorylation is an upstream event of the ROS generation. GSK3 inhibition by SB415286 decreased complex IV activity and cellular O{sub 2} consumption rate and eventually induced senescence of Mv1Lu cell. Similar results were obtained with siRNA-mediated knockdown of GSK3. Moreover, we found that GSK3 not only exists in cytosol but also in mitochondria of Mv1Lu cell and the mitochondrial GSK3 binds complex IV subunit 6b which has no electron carrier and is topologically located in the mitochondrial intermembrane space. Involvement of subunit 6b in controlling complex IV activity and overall respiration rate was proved with siRNA-mediated knockdown of subunit 6b. Finally, TGF {beta}1 treatment decreased the binding of the subunit 6b to GSK3 and subunit 6b phosphorylation. Taken together, our results suggest that GSK3 inactivation is importantly involved in TGF {beta}1-induced complex IV defects through decreasing phosphorylation of the subunit 6b, thereby contributing to senescence-associated mitochondrial ROS generation.

Studies of the variability of the hepatocyte nuclear factor-1beta (HNF-1beta / TCF2) and the dimerization cofactor of HNF-1 (DcoH / PCBD) genes in relation to type 2 diabetes mellitus and beta-cell function

DEFF Research Database (Denmark)

Ek, J; Grarup, N; Urhammer, S A

2001-01-01

Mutations in the homeodomain-containing transcription factor hepatocyte nuclear factor-1beta (HNF-1beta) are known to cause a rare subtype of maturity-onset diabetes of the young (MODY5), which is associated with early-onset progressive non-diabetic renal dysfunction. To investigate whether...... mutations in HNF-1 are implicated in the pathogenesis of MODY or late-onset diabetes with and without nephropathy in Danish Caucasians we examined the HNF-1beta (TCF2) and the dimerization cofactor of HNF-1 (DCoH, PCBD) genes for mutations in 11 MODY probands, 28 type 2 diabetic patients with nephropathy...... comprising the DCoH gene revealed a previously described A-->G polymorphism located in the 3' untranslated region, which was not investigated further. In conclusion, mutations in HNF-1beta and DCoH are not a major cause of MODY or late onset type 2 diabetes in Danish Caucasian subjects....

Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

OpenAIRE

Walker, Aisha L.; Ofori-Acquah, Solomon

2016-01-01

The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

Detection of Beta-lactamase gene in the culturable bacteria isolated from agricultural, pasture and mining soils around mines in Hamedan, Iran

Directory of Open Access Journals (Sweden)

Nayereh Younessi

2017-09-01

Full Text Available Introduction: Growing evidence exists that agriculture affects antibiotic resistance in human pathogens. Beta-lactam antibiotics are the most commonly used antimicrobial agents in many countries. The abundance of beta-lactamase encoding genes can be used as an indicator of antibiotic resistance in the environment. So, to determine the beta-lactamase resistance genes, the abundance of culturable bacteria having bla-TEM genesin the soils under different land uses wasexamined. Materials and methods: 44 Gram-positive and 34 Gram-negative bacteria plated on nutrient agar were isolated from agricultural, pasture and mining soils and selected to study the presence of TEM-class gene using PCR amplification. Antibiotic sensitivity test of bla-TEM+isolateswas done adopting the Kirby-Bauer disk diffusion method and antibiotic discs used were: ampicillin, amoxicillin, vancomicin, streptomycin, tetracycline and gentamicin. Finally, five multi-drug resistant and bla-TEM+ isolates were identified using universal primers. Results: The highest level of beta-lactamase genes was observed in the Gram-positive and Gram-negative isolates from the pasture soils. In the agricultural and mining soils, a high abundance of bla-TEM+ isolateswasfound which also showed resistance to beta-lactam antibiotics. The identified multi-drug resistant and bla-TEM+ isolates were from these genera: Achromobacter, Bacillus, Brevibacillus, Aminobacter and Brevundimonas. Discussion and conclusion: The high number of bla-TEM+ bacteria in all the soils may be attributed to the other important feature of bla genes which is their capability to extrude toxic compounds like heavy metals in contaminated environments. Sensitivity of some bla-TEM+ bacteria to beta-lactam antibiotics was interesting. This result shows that bla-TEM genes confer resistance to beta-lactamase inhibitors in a different degree. Some of the identified isolates were pathogen. These pathogens in soils can transfer to plants

Detection in a Japanese population of a length polymorphism in the 5' flanking region of the human β-globin gene with denaturing gradient gel electrophoresis

International Nuclear Information System (INIS)

Takahashi, Noria; Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko

1992-10-01

An analysis of the ATTTT repeat polymorphism located approximately 1,400 base pairs upstream from the β-globin structural gene was carried out by denaturing gradient gel electrophoresis (DGGE) of RNA:DNA duplexes. Genomic or cloned DNAs were digested with restriction enzymes and hybridized with 32 P-labeled RNA probes, and resulting RNA:DNA duplexes were examined by DGGE. A difference in the number of repeat units was recognized by differences in duplex mobility on the DGGE gel. In this study of 81 unrelated Japanese from Hiroshima, a sequence heteromorphism was observed at this site. Alleles with 5 and 6 repeats of the ATTTT unit, which had already been reported, were found in polymorphic proportions. In addition, two unreported alleles, one having 7 repeats and the other having an A-to-G nucleotide substitution in the 5th repeat, were detected. Family study data showed that the segregation of these four types of variants is consistent with an autosomal codominant mode of inheritance. This study also demonstrated that DGGE of RNA:DNA duplexes is a sensitive tool for detecting variations in DNA. (author)

Variation in Gamma-Globin Expression before and after Induction with Hydroxyurea Associated with BCL11A, KLF1 and TAL1.

Directory of Open Access Journals (Sweden)

Amanda J Grieco

Full Text Available The molecular mechanisms governing γ-globin expression in a subset of fetal hemoglobin (α2γ2: HbF expressing red blood cells (F-cells and the mechanisms underlying the variability of response to hydroxyurea induced γ-globin expression in the treatment of sickle cell disease are not completely understood. Here we analyzed intra-person clonal populations of basophilic erythroblasts (baso-Es derived from bone marrow common myeloid progenitors in serum free cultures and report the level of fetal hemoglobin production in F-cells negatively correlates with expression of BCL11A, KLF1 and TAL1. We then examined the effects of hydroxyurea on these three transcription factors and conclude that a successful induction of γ-globin includes a reduction in BCL11A, KLF1 and TAL1 expression. These data suggests that expression changes in this transcription factor network modulate γ-globin expression in F-cells during steady state erythropoiesis and after induction with hydroxyurea.

Identification of morphological and molecular Aspergillus species isolated from patients based on beta-tubulin gene sequencing

Directory of Open Access Journals (Sweden)

Mahnaz Kheirkhah

2017-06-01

Full Text Available Background: Aspergillus species are opportunistic pathogens among immunocompromised patients. In terms of pathogenesis and mycotoxin production, they are in great value. The aim of the this study was to evaluate of beta-tubulin gene for identification of clinical Aspergillus species by PCR-sequencing method compared to morphological features of clinical isolates (such as conidial shape in direct microscopic examination, colony shape in culture, and physiological tests. Materials and Methods: In this study, 465 patients referred to the Shefa laboratory of Isfahan were evaluated. Morphological and molecular identification of clinical samples were performed using culture on sabouraud agar, malt extract agar, czapekdox agar, direct microscopy, and PCR-sequencing of beta tubulin gene, respectively. Sequences were analyzed in comparison with gene bank data. Results: Thirty nine out of 465 suspected cases (8.4% had aspergillosis. The most prevalent species were Aspergillus flavus (56.4%, A. oryzae (20.5%, and A. fumigatus (10.2%, respectively. Fifty nine percent of patients were females and 49% were males. Conclusion: In comparison with phenotypic tests, sequencing of beta-tubulin gene for identification of Aspergillus species is at great value. Replacement of molecular techniques with conventional tests is recommended for precise identification of microorganism for better management of infection.

Positive selection within the Schizophrenia-associated GABA(A receptor beta(2 gene.

Directory of Open Access Journals (Sweden)

Wing-Sze Lo

Full Text Available The gamma-aminobutyric acid type-A (GABA(A receptor plays a major role in inhibitory neurotransmissions. Intronic SNPs and haplotypes in GABRB2, the gene for GABA(A receptor beta(2 subunit, are associated with schizophrenia and correlated with the expression of two alternatively spliced beta(2 isoforms. In the present study, using chimpanzee as an ancestral reference, high frequencies were observed for the derived (D alleles of the four SNPs rs6556547, rs187269, rs1816071 and rs1816072 in GABRB2, suggesting the occurrence of positive selection for these derived alleles. Coalescence-based simulation showed that the population frequency spectra and the frequencies of H56, the haplotype having all four D alleles, significantly deviated from neutral-evolution expectation in various demographic models. Haplotypes containing the derived allele of rs1816072 displayed significantly less diversity compared to haplotypes containing its ancestral allele, further supporting positive selection. The variations in DD-genotype frequencies in five human populations provided a snapshot of the evolutionary history, which suggested that the positive selections of the D alleles are recent and likely ongoing. The divergence between the DD-genotype profiles of schizophrenic and control samples pointed to the schizophrenia-relevance of positive selections, with the schizophrenic samples showing weakened selections compared to the controls. These DD-genotypes were previously found to increase the expression of beta(2, especially its long isoform. Electrophysiological analysis showed that this long beta(2 isoform favored by the positive selections is more sensitive than the short isoform to the inhibition of GABA(A receptor function by energy depletion. These findings represent the first demonstration of positive selection in a schizophrenia-associated gene.

Candidate Gene Study of TRAIL and TRAIL Receptors: Association with Response to Interferon Beta Therapy in Multiple Sclerosis Patients

Science.gov (United States)

Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca

2013-01-01

TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636

Candidate gene study of TRAIL and TRAIL receptors: association with response to interferon beta therapy in multiple sclerosis patients.

Directory of Open Access Journals (Sweden)

Carlos López-Gómez

Full Text Available TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10(-4, pc = 0.048, OR = 0.30. This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A, a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS.

Semisynthetic hemoglobin A: Reconstitution of functional tetramer from semisynthetic α-globin

International Nuclear Information System (INIS)

Sahni, G.; Cho, Y.J.; Iyer, K.S.; Khan, S.A.; Seetharam, R.; Acharya, A.S.

1989-01-01

The optimal conditions for the semisynthesis of α-globin through Staphylococcus aureus V8 protease condensation of a synthetic fragment (α 1-30 ) with the complementary apo fragment (α 31-141 ) in the presence of structure-inducing organic cosolvents and the reconstitution of the functional tetramer from semisynthetic α-globin have been investigated. The protease-catalyzed ligation of the complementary apo fragments α 1-30 and α 31-141 proceeds with very high selectivity at pH 6.0 and 4 degree C in the presence of 1-propanol as the organic cosolvent. A 30% 1-propanol solution was optimal for the semisynthetic reaction, and the synthetic reaction attained an equilibrium (approximately 50%) in 72 h. The synthetic reaction proceeds smoothly over a wide pH range (pH 5-8). Besides, the semisynthetic system is flexible, and it also proceeded well if trifluoroethanol or 2-propanol was used instead of 1-propanol. However, glycerol, a versatile organic cosolvent used in all other proteosynthetic reactions reported in the literature, was not very efficient as an organic cosolvent in the present synthetic reaction. The semisynthetic α-globin prepared with 1-propanol as the organic cosolvent has been reconstituted into HbA. The semisynthetic HbA was then purified by CM-cellulose chromatography. The semisynthetic HbA is indistinguishable from native HbA, in terms of its structural and functional properties. The semisynthetic approach provides the flexibility in protein engineering studies for the incorporation of spectroscopic labels ( 13 C- and/or 15 N-labeled amino acids), noncoded amino acids, or unnatural bond functionalities, which at present is not possible with genetic approaches

Gene silencing of beta-catenin in melanoma cells retards their growth but promotes the formation of pulmonary metastasis in mice.

Science.gov (United States)

Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu

2008-11-15

Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.

The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

Science.gov (United States)

Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

2012-01-01

Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

Genetic models rule out a major role of beta cell glycogen in the control of glucose homeostasis.

Science.gov (United States)

Mir-Coll, Joan; Duran, Jordi; Slebe, Felipe; García-Rocha, Mar; Gomis, Ramon; Gasa, Rosa; Guinovart, Joan J

2016-05-01

Glycogen accumulation occurs in beta cells of diabetic patients and has been proposed to partly mediate glucotoxicity-induced beta cell dysfunction. However, the role of glycogen metabolism in beta cell function and its contribution to diabetes pathophysiology remain poorly understood. We investigated the function of beta cell glycogen by studying glucose homeostasis in mice with (1) defective glycogen synthesis in the pancreas; and (2) excessive glycogen accumulation in beta cells. Conditional deletion of the Gys1 gene and overexpression of protein targeting to glycogen (PTG) was accomplished by Cre-lox recombination using pancreas-specific Cre lines. Glucose homeostasis was assessed by determining fasting glycaemia, insulinaemia and glucose tolerance. Beta cell mass was determined by morphometry. Glycogen was detected histologically by periodic acid-Schiff's reagent staining. Isolated islets were used for the determination of glycogen and insulin content, insulin secretion, immunoblots and gene expression assays. Gys1 knockout (Gys1 (KO)) mice did not exhibit differences in glucose tolerance or basal glycaemia and insulinaemia relative to controls. Insulin secretion and gene expression in isolated islets was also indistinguishable between Gys1 (KO) and controls. Conversely, despite effective glycogen overaccumulation in islets, mice with PTG overexpression (PTG(OE)) presented similar glucose tolerance to controls. However, under fasting conditions they exhibited lower glycaemia and higher insulinaemia. Importantly, neither young nor aged PTG(OE) mice showed differences in beta cell mass relative to age-matched controls. Finally, a high-fat diet did not reveal a beta cell-autonomous phenotype in either model. Glycogen metabolism is not required for the maintenance of beta cell function. Glycogen accumulation in beta cells alone is not sufficient to trigger the dysfunction or loss of these cells, or progression to diabetes.

SIRT6-mediated transcriptional suppression of Txnip is critical for pancreatic beta cell function and survival in mice.

Science.gov (United States)

Qin, Kunhua; Zhang, Ning; Zhang, Zhao; Nipper, Michael; Zhu, Zhenxin; Leighton, Jake; Xu, Kexin; Musi, Nicolas; Wang, Pei

2018-04-01

Better understanding of how genetic and epigenetic components control beta cell differentiation and function is key to the discovery of novel therapeutic approaches to prevent beta cell dysfunction and failure in the progression of type 2 diabetes. Our goal was to elucidate the role of histone deacetylase sirtuin 6 (SIRT6) in beta cell development and homeostasis. Sirt6 endocrine progenitor cell conditional knockout and beta cell-specific knockout mice were generated using the Cre-loxP system. Mice were assayed for islet morphology, glucose tolerance, glucose-stimulated insulin secretion and susceptibility to streptozotocin. Transcriptional regulatory functions of SIRT6 in primary islets were evaluated by RNA-Seq analysis. Reverse transcription-quantitative (RT-q)PCR and immunoblot were used to verify and investigate the gene expression changes. Chromatin occupancies of SIRT6, H3K9Ac, H3K56Ac and active RNA polymerase II were evaluated by chromatin immunoprecipitation. Deletion of Sirt6 in pancreatic endocrine progenitor cells did not affect endocrine morphology, beta cell mass or insulin production but did result in glucose intolerance and defective glucose-stimulated insulin secretion in mice. Conditional deletion of Sirt6 in adult beta cells reproduced the insulin secretion defect. Loss of Sirt6 resulted in aberrant upregulation of thioredoxin-interacting protein (TXNIP) in beta cells. SIRT6 deficiency led to increased acetylation of histone H3 lysine residue at 9 (H3K9Ac), acetylation of histone H3 lysine residue at 56 (H3K56Ac) and active RNA polymerase II at the promoter region of Txnip. SIRT6-deficient beta cells exhibited a time-dependent increase in H3K9Ac, H3K56Ac and TXNIP levels. Finally, beta cell-specific SIRT6-deficient mice showed increased sensitivity to streptozotocin. Our results reveal that SIRT6 suppresses Txnip expression in beta cells via deacetylation of histone H3 and plays a critical role in maintaining beta cell function and viability

Loss of Major DNase I Hypersensitive Sites in Duplicatedglobin Gene Cluster Incompletely Silences HBB Gene Expression

Czech Academy of Sciences Publication Activity Database

Reading, N. S.; Shooter, C.; Song, J.; Miller, R.; Agarwal, A.; Láníková, Lucie; Clark, B.; Thein, S.L.; Divoký, V.; Prchal, J.T.

2016-01-01

Roč. 37, č. 11 (2016), s. 1153-1156 ISSN 1059-7794 R&D Projects: GA MŠk(CZ) LH15223 Institutional support: RVO:68378050 Keywords : globin genes * regulation * sickle cell disease * HBB duplication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.601, year: 2016

Differential fate of erythromycin and beta-lactam resistance genes from swine lagoon waste under different aquatic conditions

Energy Technology Data Exchange (ETDEWEB)

Knapp, Charles W., E-mail: charles.knapp@strath.ac.u [David Livingstone Centre for Sustainability, Department of Civil Engineering, University of Strathclyde, 50 Richmond Street, Glasgow, G1 1XN (United Kingdom); School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne, NE1 7RU (United Kingdom); Zhang, Wen; Sturm, Belinda S.M. [Department of Civil, Environmental and Architectural Engineering, University of Kansas, Lawrence, KS 66045 (United States); Graham, David W. [School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne, NE1 7RU (United Kingdom); Department of Civil, Environmental and Architectural Engineering, University of Kansas, Lawrence, KS 66045 (United States)

2010-05-15

The attenuation and fate of erythromycin-resistance-methylase (erm) and extended-spectrum beta-lactamse (bla) genes were quantified over time in aquatic systems by adding 20-L swine waste to 11,300-L outdoor mesocosms that simulated receiving water conditions below intensive agricultural operations. The units were prepared with two different light-exposure scenarios and included artificial substrates to assess gene movement into biofilms. Of eleven genes tested, only erm(B), erm(F), bla{sub SHV} and bla{sub TEM} were found in sufficient quantity for monitoring. The genes disappeared rapidly from the water column and first-order water-column disappearance coefficients were calculated. However, detected gene levels became elevated in the biofilms within 2 days, but then disappeared over time. Differences were observed between sunlight and dark treatments and among individual genes, suggesting that ecological and gene-specific factors play roles in the fate of these genes after release into the environment. Ultimately, this information will aid in generating better predictive models for gene fate. - The disappearance and fate of erythromycin-resistance-methylase and beta-lactamase genes were monitored in outdoor mesocosms under different light conditions.

Clonal expansion of T-cell receptor beta gene segment in the retrocochlear lesions of EAE mice.

Science.gov (United States)

Cheng, K C; Lee, K M; Yoo, T J

1998-01-01

It has been reported that the T cell receptor V beta 8.2 (TcrbV8.2) gene segment is predominantly expressed in encephalomyelitic T cells responding to myelin basic protein (MBP) in experimental allergic encephalomyelitis (EAE) mice. We have demonstrated retrocochlear hearing loss in EAE mice in previous studies. Administration of a monoclonal antibody specific to the T cell receptor V beta 8 (TcrbV8) subfamily prevented both this type of hearing loss and the central nerve disease. In this study, we examined the role of the TcrbV8.2 gene segment in the retrocochlear lesions of EAE mice. A clonal expression of T cell receptor beta chain gene segment (TcrbV8.2-TcrbD2-TcrbJ2.7) was identified in the retrocochlear lesions. The TcrbV8.2 gene segment appears to recombine only with TcrbJ2.1 (32.1%) and TcrbJ2.7 (67.9%) gene segments. The TcrbJ2.7 gene segment has also been previously identified as the dominant TcrbJ gene in the lymph nodes of EAE mice. Only TcrbD2, with a length of 4 amino acids, was observed recombining with these TcrbV8.2 sequences. G and C nucleotides are predominantly expressed at the N regions between the V-D and D-J junctions. This dominant TcrbV gene segment (TcrbV8.2-TcrbD2-TcrbJ2.7) observed in the retrocochlear lesions has been identified in the MBP-specific T cells from the lymph nodes of EAE mice. These results suggest that a small subset of antigen-specific T cells migrate to, and expand at, the retrocochlear lesions, which leads to hearing loss.

Gene-Gene Interactions in the Folate Metabolic Pathway and the Risk of Conotruncal Heart Defects

Directory of Open Access Journals (Sweden)

Philip J. Lupo

2010-01-01

Full Text Available Conotruncal and related heart defects (CTRD are common, complex malformations. Although there are few established risk factors, there is evidence that genetic variation in the folate metabolic pathway influences CTRD risk. This study was undertaken to assess the association between inherited (i.e., case and maternal gene-gene interactions in this pathway and the risk of CTRD. Case-parent triads (n=727, ascertained from the Children's Hospital of Philadelphia, were genotyped for ten functional variants of nine folate metabolic genes. Analyses of inherited genotypes were consistent with the previously reported association between MTHFR A1298C and CTRD (adjusted P=.02, but provided no evidence that CTRD was associated with inherited gene-gene interactions. Analyses of the maternal genotypes provided evidence of a MTHFR C677T/CBS 844ins68 interaction and CTRD risk (unadjusted P=.02. This association is consistent with the effects of this genotype combination on folate-homocysteine biochemistry but remains to be confirmed in independent study populations.

Effective gene therapy in an authentic model of Tay-Sachs-related diseases.

Science.gov (United States)

Cachón-González, M Begoña; Wang, Susan Z; Lynch, Andrew; Ziegler, Robin; Cheng, Seng H; Cox, Timothy M

2006-07-05

Tay-Sachs disease is a prototypic neurodegenerative disease. Lysosomal storage of GM2 ganglioside in Tay-Sachs and the related disorder, Sandhoff disease, is caused by deficiency of beta-hexosaminidase A, a heterodimeric protein. Tay-Sachs-related diseases (GM2 gangliosidoses) are incurable, but gene therapy has the potential for widespread correction of the underlying lysosomal defect by means of the secretion-recapture cellular pathway for enzymatic complementation. Sandhoff mice, lacking the beta-subunit of hexosaminidase, manifest many signs of classical human Tay-Sachs disease and, with an acute course, die before 20 weeks of age. We treated Sandhoff mice by stereotaxic intracranial inoculation of recombinant adeno-associated viral vectors encoding the complementing human beta-hexosaminidase alpha and beta subunit genes and elements, including an HIV tat sequence, to enhance protein expression and distribution. Animals survived for >1 year with sustained, widespread, and abundant enzyme delivery in the nervous system. Onset of the disease was delayed with preservation of motor function; inflammation and GM2 ganglioside storage in the brain and spinal cord was reduced. Gene delivery of beta-hexosaminidase A by using adeno-associated viral vectors has realistic potential for treating the human Tay-Sachs-related diseases.

Cytoskeletal actin genes function downstream of HNF-3beta in ascidian notochord development.

Science.gov (United States)

Jeffery, W R; Ewing, N; Machula, J; Olsen, C L; Swalla, B J

1998-11-01

We have examined the expression and regulation of cytoskeletal actin genes in ascidians with tailed (Molgula oculata) and tailless larvae (Molgula occulta). Four cDNA clones were isolated representing two pairs of orthologous cytoskeletal actin genes (CA1 and CA2), which encode proteins differing by five amino acids in the tailed and tailless species. The CA1 and CA2 genes are present in one or two copies, although several related genes may also be present in both species. Maternal CA1 and CA2 mRNA is present in small oocytes but transcript levels later decline, suggesting a role in early oogenesis. In the tailed species, embryonic CA1 and CA2 mRNAs first appear in the presumptive mesenchyme and muscle cells during gastrulation, subsequently accumulate in the presumptive notochord cells, and can be detected in these tissues through the tadpole stage. CA1 mRNAs accumulate initially in the same tissues in the tailless species but subsequently disappear, in concert with the arrest of notochord and tail development. In contrast, CA2 mRNAs were not detected in embryos of the tailless species. Fertilization of eggs of the tailless species with sperm of the tailed species, which restores the notochord and the tail, also results in the upregulation of CA1 and CA2 gene expression in hybrid embryos. Antisense oligodeoxynucleotide experiments suggest that CA1 and CA2 expression in the notochord, but not in the muscle cells, is dependent on prior expression of Mocc FHI, an ascidian HNF-3beta-like gene. The expression of the CA1 and CA2 genes in the notochord in the tailed species, downregulation in the tailless species, upregulation in interspecific hybrids, and dependence on HNF-3beta activity is consistent with a role of these genes in development of the ascidian notochord.

Stevioside improves pancreatic beta-cell function during glucotoxicity via regulation of acetyl-CoA carboxylase.

Science.gov (United States)

Chen, Jianguo; Jeppesen, Per Bendix; Nordentoft, Iver; Hermansen, Kjeld

2007-06-01

Chronic hyperglycemia is detrimental to pancreatic beta-cells, causing impaired insulin secretion and beta-cell turnover. The characteristic secretory defects are increased basal insulin secretion (BIS) and a selective loss of glucose-stimulated insulin secretion (GSIS). Several recent studies support the view that the acetyl-CoA carboxylase (ACC) plays a pivotal role for GSIS. We have shown that stevioside (SVS) enhances insulin secretion and ACC gene expression. Whether glucotoxicity influences ACC and whether this action can be counteracted by SVS are not known. To investigate this, we exposed isolated mouse islets as well as clonal INS-1E beta-cells for 48 h to 27 or 16.7 mM glucose, respectively. We found that 48-h exposure to high glucose impairs GSIS from mouse islets and INS-1E cells, an effect that is partly counteracted by SVS. The ACC dephosphorylation inhibitor okadaic acid (OKA, 10(-8) M), and 5-aminoimidazole-4-carboxamide-1-beta-d-ribofuranoside (AICAR, 10(-4) M), an activator of 5'-AMP protein kinase that phosphorylates ACC, eliminated the beneficial effect of SVS. 5-Tetrade-cyloxy-2-furancarboxylic acid (TOFA), the specific ACC inhibitor, blocked the effect of SVS as well. During glucotoxity, ACC gene expression, ACC protein, and phosphorylated ACC protein were increased in INS-1E beta-cells. SVS pretreatment further increased ACC gene expression with strikingly elevated ACC activity and increased glucose uptake accompanied by enhanced GSIS. Our studies show that glucose is a potent stimulator of ACC and that SVS to some extent counteracts glucotoxicity via increased ACC activity. SVS possesses the potential to alleviate negative effects of glucotoxicity in beta-cells via a unique mechanism of action.

Hb H disease resulting from the association of an αº-thalassemia allele [-(α20.5] with an unstable α-globin variant [Hb Icaria]: first report on the occurrence in Brazil

Directory of Open Access Journals (Sweden)

Elza M. Kimura

2009-01-01

Full Text Available Hb H Disease is caused by the loss or inactivation of three of the four functional a-globin genes. Patients present chronic hemolytic anemia and splenomegaly. In some cases, occasional blood transfusions are required. Deletions are the main cause of this type of thalassemia (α-thalassemia. We describe here an unusual case of Hb H disease caused by the combination of a common αº deletion [-(α20.5] with a rare point mutation (c.427T > A, thus resulting in an elongated and unstable α-globin variant, Hb Icaria, (X142K, with 31 additional amino-acid residues. Very high levels of Hb H and Hb Bart's were detected in the patient's red blood cells (14.7 and 19.0%, respectively. This is the first description of this infrequent association in the Brazilian population.

Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

Science.gov (United States)

Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

2014-12-01

Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; Pperipheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative

A defect in the thymidine kinase 2 gene causing isolated mitochondrial myopathy without mtDNA depletion.

Science.gov (United States)

Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D

2008-07-01

Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.

The roles of TGF-beta1 gene transfer on collagen formation during Achilles tendon healing.

Science.gov (United States)

Hou, Yu; Mao, ZeBing; Wei, XueLei; Lin, Lin; Chen, LianXu; Wang, HaiJun; Fu, Xin; Zhang, JiYing; Yu, ChangLong

2009-05-29

Collagen content and cross-linking are believed to be major determinants of tendon structural integrity and function. The current study aimed to investigate the effects of transforming growth factor (TGF)-beta1 on the collagen content and cross-linking of Achilles tendons, and on the histological and biomechanical changes occurring during Achilles tendon healing in rabbits. Bone marrow-derived mesenchymal stem cells (BMSCs) transfected with the TGF-beta1 gene were surgically implanted into experimentally injured Achilles tendons. Collagen proteins were identified by immunohistochemical staining and fiber bundle accumulation was revealed by Sirius red staining. Achilles tendons treated with TGF-beta1-transfected BMSCs showed higher concentrations of collagen I protein, more rapid matrix remodeling, and larger fiber bundles. Thus TGF-beta1 can promote mechanical strength in healing Achilles tendons by regulating collagen synthesis, cross-link formation, and matrix remodeling.

Asporin and transforming growth factor-beta gene expression in osteoblasts from subchondral bone and osteophytes in osteoarthritis.

Science.gov (United States)

Sakao, Kei; Takahashi, Kenji A; Arai, Yuji; Saito, Masazumi; Honjyo, Kuniaki; Hiraoka, Nobuyuki; Kishida, Tsunao; Mazda, Osam; Imanishi, Jiro; Kubo, Toshikazu

2009-11-01

To clarify the significance of subchondral bone and osteophytes in the pathology of osteoarthritis (OA), we investigated the expression of asporin (ASPN), transforming growth factor-beta1 (TGF-beta1), TGF-beta2, TGF-beta3, and runt-related transcription factor-2 (Runx2) genes involved in bone metabolism. Osteoblasts were isolated from 19 patients diagnosed with knee OA and from 4 patients diagnosed with femoral neck fracture. Osteoblast expression of mRNA encoding ASPN, TGF-beta1, TGF-beta2, TGF-beta3, and Runx2 was analyzed using real-time RT-PCR. Expression of ASPN, TGF-beta1, and TGF-beta3 mRNA in the subchondral bone and osteophytes of OA patients increased compared with that of non-OA patients. The ratio of ASPN to TGF-beta1 mRNA in patients with severe cartilage damage was higher than that in patients with mild cartilage damage. The increased ratio of ASPN mRNA to TGF-beta1 mRNA in patients with severe relative to mild cartilage damage indicates that increased ASPN mRNA expression was significantly associated with the severity of cartilage degeneration. This finding suggests that ASPN may regulate TGF-beta1-mediated factors in the development of OA, which may provide clues as to the underlying pathology of OA.

Tissue-specific methylation of human insulin gene and PCR assay for monitoring beta cell death.

Directory of Open Access Journals (Sweden)

Mohamed I Husseiny

Full Text Available The onset of metabolic dysregulation in type 1 diabetes (T1D occurs after autoimmune destruction of the majority of pancreatic insulin-producing beta cells. We previously demonstrated that the DNA encoding the insulin gene is uniquely unmethylated in these cells and then developed a methylation-specific PCR (MSP assay to identify circulating beta cell DNA in streptozotocin-treated mice prior to the rise in blood glucose. The current study extends to autoimmune non-obese diabetic (NOD mice and humans, showing in NOD mice that beta cell death occurs six weeks before the rise in blood sugar and coincides with the onset of islet infiltration by immune cells, demonstrating the utility of MSP for monitoring T1D. We previously reported unique patterns of methylation of the human insulin gene, and now extend this to other human tissues. The methylation patterns of the human insulin promoter, intron 1, exon 2, and intron 2 were determined in several normal human tissues. Similar to our previous report, the human insulin promoter was unmethylated in beta cells, but methylated in all other tissues tested. In contrast, intron 1, exon 2 and intron 2 did not exhibit any tissue-specific DNA methylation pattern. Subsequently, a human MSP assay was developed based on the methylation pattern of the insulin promoter and human islet DNA was successfully detected in circulation of T1D patients after islet transplantation therapy. Signal levels of normal controls and pre-transplant samples were shown to be similar, but increased dramatically after islet transplantation. In plasma the signal declines with time but in whole blood remains elevated for at least two weeks, indicating that association of beta cell DNA with blood cells prolongs the signal. This assay provides an effective method to monitor beta cell destruction in early T1D and in islet transplantation therapy.

Influence of the λ780nm laser light on the repair of surgical bone defects grafted or not with biphasic synthetic micro-granular hydroxylapatite+Beta-Calcium triphosphate.

Science.gov (United States)

Soares, Luiz Guilherme P; Marques, Aparecida Maria C; Guarda, Milena G; Aciole, Jouber Mateus S; dos Santos, Jean Nunes; Pinheiro, Antonio Luiz B

2014-02-05

The treatment of bone loss due to different etiologic factors is difficult and many techniques aim to improve repair, including a wide range of biomaterials and, recently, photobioengineering. This work aimed to assess, through histological analysis The aim of this study was to assess, by light microscopy, the repair of bone defects grafted or not with biphasic synthetic micro-granular Calcium hydroxyapatite (HA)+Beta-TCP associated or not with Laser phototherapy - LPT (λ780nm). Forty rats were divided into 4 groups each subdivided into 2 subgroups according to the time of sacrifice (15 and 30days). Surgical bone defects were made on femur of each animal with a trephine drill. On animals of Clot group the defect was filled only by blood clot, on Laser group the defect filled with the clot was further irradiated. On animals of Biomaterial and Laser+Biomaterial groups the defect was filled by biomaterial and the last one was further irradiated (λ780nm, 70mW, spot size∼0.4cm(2), 20J/cm(2)-session, 140J/cm(2)-treatment) in four points around the defect at 48-h intervals and repeated for 2weeks. At both 15th and 30th days following sacrifice, samples were taken and analyzed by light microscopy. Many similarities were observed histologically between groups on regards bone reabsorption and neoformation, inflammatory infiltrate and collagen deposition. The criterion degree of maturation, marked by the presence of basophilic lines, indicated that the use of LPT associated with HA+Beta TCP graft, resulted in more advanced stage of bone repair at the end of the experiment. Copyright © 2014 Elsevier B.V. All rights reserved.

Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells.

Science.gov (United States)

Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng

Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes. Copyright © 2015 Elsevier Inc. All rights reserved.

Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

Science.gov (United States)

Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

2012-07-15

Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

[Association of the tagging single nucleotide polymorphisms in transforming growth factor beta-1 gene with hypertension in the Han nationality population in Xinjiang].

Science.gov (United States)

Yang, Jian-feng; Shi, Xiao-peng; Zhao, Dan; Deng, Feng-mei; Zhong, Hua; Wang, Gang; Wang, Zhen-huan; Chen, Xiong-ying; He, Fang

2010-06-01

Essential hypertension (EH) was a complex disease resulted from the interaction of cumulative effect of multiple genetic and environment factors. The relationship between the genetic polymorphisms in the transforming growth factor-beta1 (TGF-beta1), the blood levels and EH have been investigated, but the conclusions were different. Therefore, we investigate the relationship between the tagging single nucleotide polymorphisms (tSNPs) (rs1800469, rs2241716, rs11466345, rs2241715, rs4803455) in TGF-beta1 gene, blood levels and EH in the Han nationality population in Xinjiang, to clarity the pattern of linkage disequilibrium (LD) and the feature of the structure of haplotype. Based on the case-control study,we selected 732 (365 EH patients,367 controls) Han Chinese population from the Boertonggu countryside of Shawan region in the Xinjiang Uygur Autonomous Region of China by random cluster sampling. After questionnaire and physical examination, we collected blood samples, and the blood levels of TGF-beta1 were quantified using sandwich ELISA. The polymorphisms of TGF-beta1 gene in the study groups were detected with SNaPshot system. The case-control study in a large group was carried out separately for each of the tSNP and followed up by haplotypes analyses to determine the relation between tSNPs of TGF-beta1 gene and EH in the Han population. (1) The frequencies of alleles A, G of rs11466345 of TGF-beta1 gene in EH group and control group were as follows: 69.7%, 30.3%, 74.4%, 25.6%, respectively. It was demonstrated that the G allele of the rs11466345 polymorphism occurred at a significantly higher frequency in EH patients than in healthy controls (30.3% vs. 25.6%, P 0.05). (2)Except the site of rs11466345, the other tSNPs were in strong LD, and no statistical differences were observed in haplotypes distribution in the followup study between case-control groups (P > 0.05). (3) There were no difference of TGF-beta1 levels between the different genotypes and alleles in

Response of induced bone defects in horses to collagen matrix containing the human parathyroid hormone gene.

Science.gov (United States)

Backstrom, Kristin C; Bertone, Alicia L; Wisner, Erik R; Weisbrode, Stephen E

2004-09-01

To determine whether human parathyroid hormone (hPTH) gene in collagen matrix could safely promote bone formation in diaphyseal or subchondral bones of horses. 8 clinically normal adult horses. Amount, rate, and quality of bone healing for 13 weeks were determined by use of radiography, quantitative computed tomography, and histomorphometric analysis. Diaphyseal cortex and subchondral bone defects of metacarpi were filled with hPTH(1-34) gene-activated matrix (GAM) or remained untreated. Joints were assessed on the basis of circumference, synovial fluid analysis, pain on flexion, lameness, and gross and histologic examination. Bone volume index was greater for cortical defects treated with hPTH(1-34) GAM, compared with untreated defects. Bone production in cortical defects treated with hPTH(1-34) GAM positively correlated with native bone formation in untreated defects. In contrast, less bone was detected in hPTH(1-34) GAM-treated subchondral bone defects, compared with untreated defects, and histology confirmed poorer healing and residual collagen sponge. Use of hPTH(1-34) GAM induced greater total bone, specifically periosteal bone, after 13 weeks of healing in cortical defects of horses. The hPTH(1-34) GAM impeded healing of subchondral bone but was biocompatible with joint tissues. Promotion of periosteal bone formation may be beneficial for healing of cortical fractures in horses, but the delay in onset of bone formation may negate benefits. The hPTH(1-34) GAM used in this study should not be placed in articular subchondral bone defects, but contact with articular surfaces is unlikely to cause short-term adverse effects.

A ketogenic diet rescues hippocampal memory defects in a mouse model of Kabuki syndrome.

Science.gov (United States)

Benjamin, Joel S; Pilarowski, Genay O; Carosso, Giovanni A; Zhang, Li; Huso, David L; Goff, Loyal A; Vernon, Hilary J; Hansen, Kasper D; Bjornsson, Hans T

2017-01-03

Kabuki syndrome is a Mendelian intellectual disability syndrome caused by mutations in either of two genes (KMT2D and KDM6A) involved in chromatin accessibility. We previously showed that an agent that promotes chromatin opening, the histone deacetylase inhibitor (HDACi) AR-42, ameliorates the deficiency of adult neurogenesis in the granule cell layer of the dentate gyrus and rescues hippocampal memory defects in a mouse model of Kabuki syndrome (Kmt2d +/βGeo ). Unlike a drug, a dietary intervention could be quickly transitioned to the clinic. Therefore, we have explored whether treatment with a ketogenic diet could lead to a similar rescue through increased amounts of beta-hydroxybutyrate, an endogenous HDACi. Here, we report that a ketogenic diet in Kmt2d +/βGeo mice modulates H3ac and H3K4me3 in the granule cell layer, with concomitant rescue of both the neurogenesis defect and hippocampal memory abnormalities seen in Kmt2d +/βGeo mice; similar effects on neurogenesis were observed on exogenous administration of beta-hydroxybutyrate. These data suggest that dietary modulation of epigenetic modifications through elevation of beta-hydroxybutyrate may provide a feasible strategy to treat the intellectual disability seen in Kabuki syndrome and related disorders.

Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG).

OpenAIRE

Liebhaber, S A; Coleman, M B; Adams, J G; Cash, F E; Steinberg, M H

1987-01-01

An American black woman was found to have the phenotype of moderately severe alpha-thalassemia normally associated with the loss of two to three alpha-globin genes despite an alpha-globin gene map that demonstrated the loss of only a single alpha-globin gene (-alpha/alpha alpha). Several individuals in her kindred with normal alpha-globin gene mapping studies (alpha alpha/alpha alpha) had mild alpha-thalassemia hematologic values consistent with the loss of one to two alpha-globin genes. Thes...

Novel de novo pathogenic variant in the NR2F2 gene in a boy with congenital heart defect and dysmorphic features.

Science.gov (United States)

Upadia, Jariya; Gonzales, Patrick R; Robin, Nathaniel H

2018-04-16

The NR2F2 gene plays an important role in angiogenesis and heart development. Moreover, this gene is involved in organogenesis in many other organs in mouse models. Variants in this gene have been reported in a number of patients with nonsyndromic atrioventricular septal defect, and in one patient with congenital heart defect and dysmorphic features. Here we report an 11-month-old Caucasian male with global developmental delay, dysmorphic features, coarctation of the aorta, and ventricular septal defect. He was later found to have a pathogenic mutation in the NR2F2 gene by whole exome sequencing. This is the second instance in which an NR2F2 mutation has been identified in a child with a congenital heart defect and other anomalies. This case suggests that some variants in NR2F2 may cause syndromic forms of congenital heart defect. © 2018 Wiley Periodicals, Inc.

Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

Science.gov (United States)

Chu, L Y; Rhoads, R E

1978-06-13

The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

CK2(beta)tes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster

DEFF Research Database (Denmark)

Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O

2002-01-01

An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta...... and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two...

Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

Directory of Open Access Journals (Sweden)

Aleksandra Piwko-Czuchra

Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

Analysis of bone marrow stromal cell transferred bacterial {beta}-galactosidase gene by PIXE

Energy Technology Data Exchange (ETDEWEB)

Kumakawa, Toshiro [Tokyo Metropolitan Geriatric Hospital, Tokyo (Japan). Dept. of Blood Transfusion and Hematology; Hibino, Hitoshi; Tani, Kenzaburo; Asano, Shigetaka; Futatugawa, Shouji; Sera, Kouichiro

1997-12-31

PIXE, Particle Induced X-ray Emission, is a powerful, multi-elemental analysis method which has many distinguishing features and has been used in varies research fields. Recently the method of applying baby cyclotrons for nuclear medicine to PIXE has been developed. This enables us to study biomedical phenomena from the physical point of view. Mouse bone marrow stromal cells were transferred bacterial {beta}-galactosidase gene (LacZ gene) by murine retroviral vectors. Analysis of the bone marrow stromal cells with the LacZ gene by PIXE revealed remarkable changes of intracellular trace elements compared with the normal control cells. These results indicate that gene transfer by retroviral vectors may bring about a dynamic change of intracellular circumstances of the target cell. (author)

A defect in the TUSC3 gene is associated with autosomal recessive mental retardation.

Science.gov (United States)

Garshasbi, Masoud; Hadavi, Valeh; Habibi, Haleh; Kahrizi, Kimia; Kariminejad, Roxana; Behjati, Farkhondeh; Tzschach, Andreas; Najmabadi, Hossein; Ropers, Hans Hilger; Kuss, Andreas Walter

2008-05-01

Recent studies have shown that autosomal recessive mental retardation (ARMR) is extremely heterogeneous, and there is reason to believe that the number of underlying gene defects goes into the thousands. To date, however, only four genes have been implicated in nonsyndromic ARMR (NS-ARMR): PRSS12 (neurotrypsin), CRBN (cereblon), CC2D1A, and GRIK2. As part of an ongoing systematic study aiming to identify ARMR genes, we investigated a large consanguineous family comprising seven patients with nonsyndromic ARMR in four sibships. Genome-wide SNP typing enabled us to map the relevant genetic defect to a 4.6 Mbp interval on chromosome 8. Haplotype analyses and copy-number studies led to the identification of a homozygous deletion partly removing TUSC3 (N33) in all patients. All obligate carriers of this family were heterozygous, but none of 192 unrelated healthy individuals from the same population carried this deletion. We excluded other disease-causing mutations in the coding regions of all genes within the linkage interval by sequencing; moreover, we verified the complete absence of a functional TUSC3 transcript in all patients through RT-PCR. TUSC3 is thought to encode a subunit of the endoplasmic reticulum-bound oligosaccharyltransferase complex that catalyzes a pivotal step in the protein N-glycosylation process. Our data suggest that in contrast to other genetic defects of glycosylation, inactivation of TUSC3 causes nonsyndromic MR, a conclusion that is supported by a separate report in this issue of AJHG. TUSC3 is only the fifth gene implicated in NS-ARMR and the first for which mutations have been reported in more than one family.

Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

Science.gov (United States)

Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

2009-04-01

Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

Transforming growth factor-beta stimulates wound healing and modulates extracellular matrix gene expression in pig skin. I. Excisional wound model.

Science.gov (United States)

Quaglino, D; Nanney, L B; Kennedy, R; Davidson, J M

1990-09-01

The effect of transforming growth factor-beta 1 (TGF-beta 1) on matrix gene expression has been investigated during the process of wound repair, where the formation of new connective tissue represents a critical step in restoring tissue integrity. Split-thickness excisional wounds in the pig were studied by in situ hybridization in order to obtain subjective findings on the activity and location of cells involved in matrix gene expression after the administration of recombinant TGF-beta 1. Data focus on the stimulatory role of this growth factor in granulation tissue formation, on the enhanced mRNA content of collagen types I and III, fibronectin, TGF-beta 1 itself, and on the reduction in stromelysin mRNA, suggesting that increased matrix formation measured after treatment with TGF-beta 1 is due to fibroplasia regulated by the abundance of mRNAs for several different structural, matrix proteins as well as inhibition of proteolytic phenomena elicited by metalloproteinases. These studies reveal elastin mRNA early in the repair process, and elastin mRNA expression is enhanced by administration of TGF-beta 1. Moreover, we show that TGF-beta 1 was auto-stimulating in wounds, accounting, at least in part, for the persistent effects of single doses of this multipotential cytokine.

A Survey of ABO, Rhesus (D) Antigen and Haemoglobin Genes ...

African Journals Online (AJOL)

olayemitoyin

transporting the bound oxygen throughout the body where it is used in ... the globin genes that alter the protein composition but not necessarily ... oxygen carrying capacity and hence the rate of aerobic metabolic ... to participate in the exercise.

Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells

International Nuclear Information System (INIS)

Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng

2015-01-01

Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes. - Highlights: • TLX overexpression in MIN6 cell causes significant expression changes of 225 genes. • TLX overexpression promotes MIN6 cell proliferation and decreases cell apoptosis. • TLX overexpression does not cause impairment of insulin secretion.

Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells

Energy Technology Data Exchange (ETDEWEB)

Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng, E-mail: oxyccc@163.com

2015-12-04

Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes. - Highlights: • TLX overexpression in MIN6 cell causes significant expression changes of 225 genes. • TLX overexpression promotes MIN6 cell proliferation and decreases cell apoptosis. • TLX overexpression does not cause impairment of insulin secretion.

Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

DEFF Research Database (Denmark)

Durkin, M E; Jäger, A C; Khurana, T S

1999-01-01

The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

Cytokines interleukin-1beta and tumor necrosis factor-alpha regulate different transcriptional and alternative splicing networks in primary beta-cells

DEFF Research Database (Denmark)

Ortis, Fernanda; Naamane, Najib; Flamez, Daisy

2010-01-01

by the cytokines interleukin (IL)-1beta + interferon (IFN)-gamma and tumor necrosis factor (TNF)-alpha + IFN-gamma in primary rat beta-cells. RESEARCH DESIGN AND METHODS: Fluorescence-activated cell sorter-purified rat beta-cells were exposed to IL-1beta + IFN-gamma or TNF-alpha + IFN-gamma for 6 or 24 h......-cells, with temporal differences in the number of genes modulated by IL-1beta + IFNgamma or TNF-alpha + IFN-gamma. These cytokine combinations induced differential expression of inflammatory response genes, which is related to differential induction of IFN regulatory factor-7. Both treatments decreased the expression...... of genes involved in the maintenance of beta-cell phenotype and growth/regeneration. Cytokines induced hypoxia-inducible factor-alpha, which in this context has a proapoptotic role. Cytokines also modified the expression of >20 genes involved in RNA splicing, and exon array analysis showed cytokine...

Are genetic variants in the platelet-derived growth factor [beta] gene associated with chronic pancreatitis?

Science.gov (United States)

Muddana, Venkata; Park, James; Lamb, Janette; Yadav, Dhiraj; Papachristou, Georgios I; Hawes, Robert H; Brand, Randall; Slivka, Adam; Whitcomb, David C

2010-11-01

Platelet-derived growth factor [beta] (PDGF-[beta]) is a major signal in proliferation and matrix synthesis through activated pancreatic stellate cells, leading to fibrosis of the pancreas. Recurrent acute pancreatitis (RAP) seems to predispose to chronic pancreatitis (CP) in some patients but not others. We tested the hypothesis that 2 known PDGF-[beta] polymorphisms are associated with progression from RAP to CP. We also tested the hypothesis that PDGF-[beta] polymorphisms in combination with environmental risk factors such as alcohol and smoking are associated with CP. Three hundred eighty-two patients with CP (n = 176) and RAP (n = 206) and 251 controls were evaluated. Platelet-derived growth factor [beta] polymorphisms +286 A/G (rs#1800818) seen in 5'-UTR and +1135 A/C (rs#1800817) in first intron were genotyped using single-nucleotide polymorphism polymerase chain reaction approach and confirmed by DNA sequencing. The genotypic frequencies for PDGF-[beta] polymorphisms in positions +286 and +1135 were found to be similar in controls and patients with RAP and CP. There was no difference in genotypic frequencies among RAP, CP, and controls in subjects in the alcohol and smoking subgroups. Known variations in the PDGF-[beta] gene do not have a significant effect on promoting or preventing fibrogenesis in pancreatitis. Further evaluation of this important pathway is warranted.

Molecular phylogeny of ateline new world monkeys (Platyrrhini, atelinae) based on gamma-globin gene sequences: evidence that brachyteles is the sister group of lagothrix.

Science.gov (United States)

Meireles, C M; Czelusniak, J; Schneider, M P; Muniz, J A; Brigido, M C; Ferreira, H S; Goodman, M

1999-06-01

Nucleotide sequences, each spanning approximately 7 kb of the contiguous gamma1 and gamma2 globin genomic loci, were determined for seven species representing all extant genera (Ateles, Lagothrix, Brachyteles, and Alouatta) of the New World monkey subfamily Atelinae. After aligning these seven ateline sequences with outgroup sequences from several other primate (non-ateline) genera, they were analyzed by maximum parsimony, maximum likelihood, and neighbor-joining algorithms. All three analyzes estimated the same phylogenetic relationships: [Alouatta [Ateles (Brachyteles, Lagothrix)

Molecular Properties of Globin Channels and Pores: Role of Cholesterol in Ligand Binding and Movement

Directory of Open Access Journals (Sweden)

Gene A Morrill

2016-09-01

Full Text Available ABSTRACT: Globins contain one or more cavities that control or affect such functions as ligand movement and ligand binding. Here we report that the extended globin family [cytoglobin (Cygb; neuroglobin (Ngb; myoglobin (Mb; hemoglobin (Hb subunits Hba(α and Hbb(β] contain either a transmembrane (TM helix or pore-lining region as well as internal cavities. Protein motif/domain analyses indicate that Ngb and Hbb each contain 5 cholesterol-binding (CRAC/CARC domains and 1 caveolin binding motif, whereas the Cygb dimer has 6 cholesterol-binding domains but lacks caveolin-binding motifs. Mb and Hba each exhibit 2 cholesterol-binding domains and also lack caveolin-binding motifs. The Hb αβ-tetramer contains 14 cholesterol-binding domains. Computer algorithms indicate that Cygb and Ngb cavities display multiple partitions and C-terminal pore-lining regions, whereas Mb has three major cavities plus a C-terminal pore-lining region. The Hb tetramer exhibits a large internal cavity but the subunits differ in that they contain a C-terminal TM helix (Hba and pore-lining region (Hbb. The cavities include 43 of 190 Cygb residues, 38 of 151 of Ngb residues, 55 of 154 Mb residues and 137 of 688 residues in the Hb tetramer. Each cavity complex includes 6 to 8 residues of the TM helix or pore-lining region and CRAC/CARC domains exist within all cavities. Erythrocyte Hb αβ-tetramers are largely cytosolic but also bind to a membrane anion exchange protein, band 3, which contains a large internal cavity and 12 TM helices (5 being pore-lining regions. The Hba TM helix may be the erythrocyte membrane band 3 attachment site. Band 3 contributes 4 caveolin binding motifs and 10 CRAC/CARC domains. Cholesterol binding may create lipid-disordered phases that alter globin cavities and facilitate ligand movement, permitting ion channel formation and conformational changes that orchestrate anion and ligand (O2, CO2, NO movement within the large internal cavities and

Enrichment of human hematopoietic stem/progenitor cells facilitates transduction for stem cell gene therapy.

Science.gov (United States)

Baldwin, Kismet; Urbinati, Fabrizia; Romero, Zulema; Campo-Fernandez, Beatriz; Kaufman, Michael L; Cooper, Aaron R; Masiuk, Katelyn; Hollis, Roger P; Kohn, Donald B

2015-05-01

Autologous hematopoietic stem cell (HSC) gene therapy for sickle cell disease has the potential to treat this illness without the major immunological complications associated with allogeneic transplantation. However, transduction efficiency by β-globin lentiviral vectors using CD34-enriched cell populations is suboptimal and large vector production batches may be needed for clinical trials. Transducing a cell population more enriched for HSC could greatly reduce vector needs and, potentially, increase transduction efficiency. CD34(+) /CD38(-) cells, comprising ∼1%-3% of all CD34(+) cells, were isolated from healthy cord blood CD34(+) cells by fluorescence-activated cell sorting and transduced with a lentiviral vector expressing an antisickling form of beta-globin (CCL-β(AS3) -FB). Isolated CD34(+) /CD38(-) cells were able to generate progeny over an extended period of long-term culture (LTC) compared to the CD34(+) cells and required up to 40-fold less vector for transduction compared to bulk CD34(+) preparations containing an equivalent number of CD34(+) /CD38(-) cells. Transduction of isolated CD34(+) /CD38(-) cells was comparable to CD34(+) cells measured by quantitative PCR at day 14 with reduced vector needs, and average vector copy/cell remained higher over time for LTC initiated from CD34(+) /38(-) cells. Following in vitro erythroid differentiation, HBBAS3 mRNA expression was similar in cultures derived from CD34(+) /CD38(-) cells or unfractionated CD34(+) cells. In vivo studies showed equivalent engraftment of transduced CD34(+) /CD38(-) cells when transplanted in competition with 100-fold more CD34(+) /CD38(+) cells. This work provides initial evidence for the beneficial effects from isolating human CD34(+) /CD38(-) cells to use significantly less vector and potentially improve transduction for HSC gene therapy. © 2015 AlphaMed Press.

Structural organization of the human and mouse laminin beta2 chain genes, and alternative splicing at the 5' end of the human transcript

DEFF Research Database (Denmark)

Durkin, M E; Gautam, M; Loechel, F

1996-01-01

We have determined the structural organization of the human and mouse genes that encode the laminin beta2 chain (s-laminin), an essential component of the basement membranes of the neuromuscular synapse and the kidney glomerulus. The human and mouse genes have a nearly identical exon-intron organ......We have determined the structural organization of the human and mouse genes that encode the laminin beta2 chain (s-laminin), an essential component of the basement membranes of the neuromuscular synapse and the kidney glomerulus. The human and mouse genes have a nearly identical exon...

Usage of U7 snRNA in gene therapy of hemoglobin C disorder ...

African Journals Online (AJOL)

Here, a bioinformatic analysis was performed to study the effect of co-expression between human Hb C b-globin chain gene and U7.623. The gene ontological results show that full recovery of hemoglobin function and biological process can be derived. This confirms that U7 snRNA can be a good tool for gene therapy in Hb ...

Expression of fully functional tetrameric human hemoglobin in Escherichia coli

International Nuclear Information System (INIS)

Hoffman, S.J.; Looker, D.L.; Roehrich, J.M.; Cozart, P.E.; Durfee, S.L.; Tedesco, J.L.; Stetler, G.L.

1990-01-01

Synthesis genes encoding the human α- and β-globin polypeptides have been expressed from a single operon in Escherichia coli. The α- and β-globin polypeptides associate into soluble tetramers, incorporate heme, and accumulate to >5% of the total cellular protein. Purified recombinant hemoglobin has the correct stoichiometry of α- and β-globin chains and contains a full complement of heme. Each globin chain also contains an additional methionine as an extension to the amino terminus. The recombinant hemoglobin has a C 4 reversed-phase HPLC profile essentially identical to that of human hemoglobin A 0 and comigrates with hemoglobin A 0 on SDS/PAGE. The visible spectrum and oxygen affinity are similar to that of native human hemoglobin A 0 . The authors have also expressed the α- and β-globin genes separately and found that the expression of the α-globin gene alone results in a marked decrease in the accumulation of α-globin in the cell. Separate expression of the β-globin gene results in high levels of insoluble β-globin. These observations suggest that the presence of α- and β-globin in the same cell stabilizes α-globin and aids the correct folding of β-globin. This system provides a simple method for expressing large quantities of recombinant hemoglobin and allows facile manipulation of the genes encoding hemoglobin to produce functionally altered forms of this protein

Geographical variation in the presence of genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA

DEFF Research Database (Denmark)

Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.

2002-01-01

The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...

Natural disease course and genotype-phenotype correlations in Complex I deficiency caused by nuclear gene defects

DEFF Research Database (Denmark)

Koene, S; Rodenburg, R J; van der Knaap, M S

2012-01-01

cases and 126 from literature) with mutations in nuclear genes encoding structural complex I proteins or those involved in its assembly. Complex I deficiency caused by a nuclear gene defect is usually a non-dysmorphic syndrome, characterized by severe multi-system organ involvement and a poor prognosis...

Deletion of ETS-1, a gene in the Jacobsen syndrome critical region, causes ventricular septal defects and abnormal ventricular morphology in mice

Science.gov (United States)

Ye, Maoqing; Coldren, Chris; Liang, Xingqun; Mattina, Teresa; Goldmuntz, Elizabeth; Benson, D. Woodrow; Ivy, Dunbar; Perryman, M.B.; Garrett-Sinha, Lee Ann; Grossfeld, Paul

2010-01-01

Congenital heart defects comprise the most common form of major birth defects, affecting 0.7% of all newborn infants. Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal 11q. We have previously determined that a wide spectrum of the most common congenital heart defects occur in 11q-, including an unprecedented high frequency of hypoplastic left heart syndrome (HLHS). We identified an ∼7 Mb ‘cardiac critical region’ in distal 11q that contains a putative causative gene(s) for congenital heart disease. In this study, we utilized chromosomal microarray mapping to characterize three patients with 11q- and congenital heart defects that carry interstitial deletions overlapping the 7 Mb cardiac critical region. We propose that this 1.2 Mb region of overlap harbors a gene(s) that causes at least a subset of the congenital heart defects that occur in 11q-. We demonstrate that one gene in this region, ETS-1 (a member of the ETS family of transcription factors), is expressed in the endocardium and neural crest during early mouse heart development. Gene-targeted deletion of ETS-1 in mice in a C57/B6 background causes, with high penetrance, large membranous ventricular septal defects and a bifid cardiac apex, and less frequently a non-apex-forming left ventricle (one of the hallmarks of HLHS). Our results implicate an important role for the ETS-1 transcription factor in mammalian heart development and should provide important insights into some of the most common forms of congenital heart disease. PMID:19942620

Defect in IgV gene somatic hypermutation in common variable immuno-deficiency syndrome.

Science.gov (United States)

Levy, Y; Gupta, N; Le Deist, F; Garcia, C; Fischer, A; Weill, J C; Reynaud, C A

1998-10-27

Common Variable Immuno-Deficiency (CVID) is the most common symptomatic primary antibody-deficiency syndrome, but the basic immunologic defects underlying this syndrome are not well defined. We report here that among eight patients studied (six CVID and two hypogammaglobulinemic patients with recurrent infections), there is in two CVID patients a dramatic reduction in Ig V gene somatic hypermutation with 40-75% of IgG transcripts totally devoid of mutations in the circulating memory B cell compartment. Functional assays of the T cell compartment point to an intrinsic B cell defect in the process of antibody affinity maturation in these two cases.

Localisation of Neuregulin 1-{beta}3 to different sub-nuclear structures alters gene expression

Energy Technology Data Exchange (ETDEWEB)

Wang, Ming; Trim, Carol M.; Gullick, William J., E-mail: w.j.gullick@kent.ac.uk

2011-02-15

Neuregulins are growth factors that signal via the ErbB3 and ErbB4 receptors. Here we show using immunohistochemistry that they are often expressed in the nucleus of a range of tumour types including soft tissue and breast. The Neuregulin 1 type I-{beta}3 (NRG1-{beta}3) isoform localises to two sub-nuclear compartments in animal cells, nucleoli and spliceosomes. We used NRG1-{beta}3 tagged with photoactivatable GFP and demonstrated that this re-localised from nucleoli to spliceosomes over 90 min. Tyrosine kinase activity was not required for retaining the NRG1-{beta}3 within the nucleus. Mutation of the lysines 14 and 16 or 15 and 16 together prevented nucleolar uptake while four positively charged residues were identified which were required for spliceosome uptake. Molecular modelling suggests that three of these may form a binding site. We showed using a kinome array that NRG1-{beta}3 and a mutant exclusively localising to spliceosomes increased phosphorylation and/or expression of the HER4 and HER2 receptors. Using a transcriptomic analysis the same two constructs induced expression of several messenger RNAs and we confirmed the increased expression at the protein level of the most highly induced, Heat Shock Protein 70B'. These results suggest that Neuregulin activates receptor signalling in spliceosomes leading to altered gene expression.

Delayed globin synthesis leads to excess heme and the macrocytic anemia of Diamond Blackfan anemia and del(5q) myelodysplastic syndrome.

Science.gov (United States)

Yang, Zhantao; Keel, Siobán B; Shimamura, Akiko; Liu, Li; Gerds, Aaron T; Li, Henry Y; Wood, Brent L; Scott, Bart L; Abkowitz, Janis L

2016-05-11

Diamond Blackfan anemia (DBA) and myelodysplastic syndrome (MDS) with isolated del(5q) are severe macrocytic anemias; although both are associated with impaired ribosome assembly, why the anemia occurs is not known. We cultured marrow cells from DBA (n = 3) and del(5q) MDS (n = 6) patients and determined how heme (a toxic chemical) and globin (a protein) are coordinated. We show that globin translation initiates slowly, whereas heme synthesis proceeds normally. This results in insufficient globin protein, excess heme and excess reactive oxygen species in early erythroid precursors, and CFU-E (colony-forming unit-erythroid)/proerythroblast cell death. The cells that can more rapidly and effectively export heme or can slow heme synthesis preferentially survive and appropriately mature. Consistent with these observations, treatment with 10 μM succinylacetone, a specific inhibitor of heme synthesis, improved the erythroid cell output of DBA and del(5q) MDS marrow cultures by 68 to 95% (P = 0.03 to 0.05), whereas the erythroid cell output of concurrent control marrow cultures decreased by 4 to 13%. Our studies demonstrate that erythropoiesis fails when heme exceeds globin. Our data further suggest that therapies that decrease heme synthesis (or facilitate heme export) could improve the red blood cell production of persons with DBA, del(5q) MDS, and perhaps other macrocytic anemias. Copyright © 2016, American Association for the Advancement of Science.

Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

Science.gov (United States)

Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

2014-01-01

Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

Magnetoresistive sensor for real-time single nucleotide polymorphism genotyping

DEFF Research Database (Denmark)

Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

2014-01-01

We demonstrate a magnetoresistive sensor platform that allows for the real-time detection of point mutations in DNA targets. Specifically, we detect point mutations at two sites in the human beta globin gene. For DNA detection, the present sensor technology has a detection limit of about 160p...... of magnetic beads, which enables real-time quantification of the specific binding of magnetic beads to the sensor surface under varying experimental conditions....

Chemical rescue of cleft palate and midline defects in conditional GSK-3beta mice.

Science.gov (United States)

Liu, Karen J; Arron, Joseph R; Stankunas, Kryn; Crabtree, Gerald R; Longaker, Michael T

2007-03-01

Glycogen synthase kinase-3beta (GSK-3beta) has integral roles in a variety of biological processes, including development, diabetes, and the progression of Alzheimer's disease. As such, a thorough understanding of GSK-3beta function will have a broad impact on human biology and therapeutics. Because GSK-3beta interacts with many different pathways, its specific developmental roles remain unclear. We have discovered a genetic requirement for GSK-3beta in midline development. Homozygous null mice display cleft palate, incomplete fusion of the ribs at the midline and bifid sternum as well as delayed sternal ossification. Using a chemically regulated allele of GSK-3beta (ref. 6), we have defined requirements for GSK-3beta activity during discrete temporal windows in palatogenesis and skeletogenesis. The rapamycin-dependent allele of GSK-3beta produces GSK-3beta fused to a tag, FRB* (FKBP/rapamycin binding), resulting in a rapidly destabilized chimaeric protein. In the absence of drug, GSK-3beta(FRB)*(/FRB)* mutants appear phenotypically identical to GSK-3beta-/- mutants. In the presence of drug, GSK-3betaFRB* is rapidly stabilized, restoring protein levels and activity. Using this system, mutant phenotypes were rescued by restoring endogenous GSK-3beta activity during two distinct periods in gestation. This technology provides a powerful tool for defining windows of protein function during development.

Marfan syndrome gene search intensifies following identification of basic defect

Energy Technology Data Exchange (ETDEWEB)

Randall, T.

1990-10-03

Somewhere, quite possible along chromosomes 8 and/or 15, the gene(s) for Marfan syndrome will be found. The search is intensifying following a report that faulty scaffolding in the body's connective tissue appears to be the long sought after defect behind the syndrome, and inherited disorder that has caused the premature death of young, healthy-looking individuals. Finding that something in the living masonry of the human body has proven to be a 30-year inquisition of nearly two dozen molecules that has engaged investigators worldwide. Historically, researchers have searched for a structural flaw in one of the collagen molecules to explain the cause of Marfan Syndrome. Using monoclonal antibodies, researchers have implicated microfibrils, the extracellular filaments that provide a matrix for the deposit of elastin during embryonic development.

The frequency of β-globin gene haplotypes, α-thalassemia and genetic polymorphisms of methylenetetrahydrofolate reductase, factor V Leiden and prothrombin genes in children with sickle cell disease in Rio de Janeiro, Brazil Frequência dos haplótipos da globina beta, da talassemia alfa e dos polimorfismos genéticos dos genes da metilenotetrahidrofolato redutase, do fator V Leiden e da protrombina em crianças com doença falciforme no Rio de Janeiro, Brasil

Directory of Open Access Journals (Sweden)

Isaac L. Silva Filho

2010-02-01

Full Text Available A freqüência dos haplótipos beta S e beta C do gene da globina e a prevalência de talassemia alfa e de mutações nos genes da metilenotetrahidrofolato redutase (MTHFR-C677T, do fator V de Leiden e da protrombina (G20210A foi estudada em crianças com doença falciforme do Rio de Janeiro. O haplótipo Bantu foi o mais freqüente (65,9%, 21,2% das crianças (18% heterozigotas e 3% homozigotas apresentam talassemia com mutação alfa 3.7kb, ao contrário da mutação alfa 4.2kb que não foi encontrada. Os alelos 677CT e 677TT da MTHFR foram observados em 20,2% e 4,8%, respectivamente. Os haplótipos Camarões, Árabe-Indiano e Senegal não foram detectados na amostra estudada, bem como mutações no gene do fator V de Leiden e da protrombina. Somente o haplótipo beta C CI foi observado. Esse é o primeiro estudo realizado em uma amostra proveniente do Programa de Triagem Neonatal para Hemoglobinopatias do estado do Rio de Janeiro. Apesar do Rio de Janeiro ser a segunda maior cidade brasileira e seus habitantes expressarem o elevado grau de miscigenação ocorrida no país, nossos resultados ainda coincidem com os registros históricos dos fluxos migratórios do gene beta S para o Brasil, bem como refletem a forte influência de indivíduos de origem africana na população do Rio de Janeiro.

Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

Science.gov (United States)

Apostol, I

1999-07-15

An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin

Science.gov (United States)

Offner, Susan

2010-01-01

The beta hemoglobin protein is identical in humans and chimpanzees. In this tutorial, students see that even though the proteins are identical, the genes that code for them are not. There are many more differences in the introns than in the exons, which indicates that coding regions of DNA are more highly conserved than non-coding regions.

Metalo-beta-lactamases Metallo-beta-lactamases

Directory of Open Access Journals (Sweden)

Rodrigo Elisandro Mendes

2006-04-01

Full Text Available Nos últimos anos tem sido observada maior incidência de bacilos Gram-negativos resistentes a cefalosporinas de espectro ampliado no ambiente hospitalar, ocasionando, assim, maior uso de betalactâmicos mais potentes, como os carbapenens. A utilização de carbapenens exerce maior pressão seletiva sobre a microbiota hospitalar, o que pode ocasionar aumento da resistência a esses agentes. Entre os mecanismos de resistência a carbapenens mais comumente identificados estão a produção de betalactamases, como, por exemplo, as pertencentes à classe D de Ambler e as que pertencem à classe B de Ambler, ou metalo-beta-lactamases (MbetaL. Essas últimas hidrolisam todos betalactâmicos comercialmente disponíveis, sendo a única exceção o monobactam aztreonam. Desde o início da década de 1990, novos genes que codificam MbetaLs têm sido descritos em microrganismos clinicamente importantes, como Pseudomonas spp., Acinetobacter spp. e membros da família Enterobacteriaceae. O encontro desses microrganismos não-sensíveis a carbapenens pode ser submetido a metodologias fenotípicas para detecção da produção de MbetaL com o intuito de auxiliar a Comissão de Controle de Infecção Hospitalar (CCIH e prevenir a disseminação desses determinantes de resistência, uma vez que genes que codificam MbetaLs estão contidos em estruturas genéticas que propiciam sua mobilidade de forma muito efetiva, sendo então facilmente disseminados.Increase isolation of Gram-negative bacilli resistant to broad-spectrum cephalosporin has been observed during the last few years, thus determining the use of more potent beta-lactams, such as carbapenems. The use of these antimicrobial agents may lead to the emergence of carbapenem resistant Gram-negative bacilli in the nosocomial environment. Carbapenem resistance may be due to the production of Ambler class D beta-lactamase or Ambler class B beta-lactamase, also called metallo-beta-lactamase (MbetaL. Apart from

Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

International Nuclear Information System (INIS)

Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng

2001-01-01

The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

Energy Technology Data Exchange (ETDEWEB)

Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng [National Yang Ming Univ., Taipei, Taiwan (China). Inst. of Radiological Sciences] (and others)

2001-12-01

The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

Interaction of Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1)] with Hb E [β26(B8) Glu>Lys] and α(+)-thalassemia: Molecular and Hematological Analysis.

Science.gov (United States)

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2015-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

Acetaminophen modulates the transcriptional response to recombinant interferon-beta.

Directory of Open Access Journals (Sweden)

Aaron Farnsworth

Full Text Available BACKGROUND: Recombinant interferon treatment can result in several common side effects including fever and injection-site pain. Patients are often advised to use acetaminophen or other over-the-counter pain medications as needed. Little is known regarding the transcriptional changes induced by such co-administration. METHODOLOGY/PRINCIPAL FINDINGS: We tested whether the administration of acetaminophen causes a change in the response normally induced by interferon-beta treatment. CD-1 mice were administered acetaminophen (APAP, interferon-beta (IFN-beta or a combination of IFN-beta+APAP and liver and serum samples were collected for analysis. Differential gene expression was determined using an Agilent 22 k whole mouse genome microarray. Data were analyzed by several methods including Gene Ontology term clustering and Gene Set Enrichment Analysis. We observed a significant change in the transcription profile of hepatic cells when APAP was co-administered with IFN-beta. These transcriptional changes included a marked up-regulation of genes involved in signal transduction and cell differentiation and down-regulation of genes involved in cellular metabolism, trafficking and the IkappaBK/NF-kappaB cascade. Additionally, we observed a large decrease in the expression of several IFN-induced genes including Ifit-3, Isg-15, Oasl1, Zbp1 and predicted gene EG634650 at both early and late time points. CONCLUSIONS/SIGNIFICANCE: A significant change in the transcriptional response was observed following co-administration of IFN-beta+APAP relative to IFN-beta treatment alone. These results suggest that administration of acetaminophen has the potential to modify the efficacy of IFN-beta treatment.

Pathophysiology and treatment of patients with beta-thalassemia – an update [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Eitan Fibach

2017-12-01

Full Text Available Thalassemia (thal is an autosomal recessive, hereditary, chronic hemolytic anemia due to a partial or complete deficiency in the synthesis of α-globin chains (α-thal or β-globin chains (β-thal that compose the major adult hemoglobin (α2β2. It is caused by one or more mutations in the corresponding genes. The unpaired globin chains are unstable; they precipitate intracellularly, resulting in hemolysis, premature destruction of red blood cell [RBC] precursors in the bone marrow, and a short life-span of mature RBCs in the circulation. The state of anemia is treated by frequent RBC transfusions. This therapy results in the accumulation of iron (iron overload, a condition that is exacerbated by the breakdown products of hemoglobin (heme and iron and the increased iron uptake for the chronic accelerated, but ineffective, RBC production. Iron catalyzes the generation of reactive oxygen species, which in excess are toxic, causing damage to vital organs such as the heart and liver and the endocrine system. Herein, we review recent findings regarding the pathophysiology underlying the major symptoms of β-thal and potential therapeutic modalities for the amelioration of its complications, as well as new modalities that may provide a cure for the disease.

Functional analysis of multiple carotenogenic genes from Lycium barbarum and Gentiana lutea L. for their effects on beta-carotene production in transgenic tobacco.

Science.gov (United States)

Ji, Jing; Wang, Gang; Wang, Jiehua; Wang, Ping

2009-02-01

Carotenoids are red, yellow and orange pigments, which are widely distributed in nature and are especially abundant in yellow-orange fruits and vegetables and dark green leafy vegetables. Carotenoids are essential for photosynthesis and photoprotection in plant life and also have different beneficial effects in humans and animals (van den Berg et al. 2000). For example, beta-carotene plays an essential role as the main dietary source of vitamin A. To obtain further insight into beta-carotene biosynthesis in two important economic plant species, Lycium barbarum and Gentiana lutea L., and to investigate and prioritize potential genetic engineering targets in the pathway, the effects of five carotenogenic genes from these two species, encoding proteins including geranylgeranyl diphosphate synthase, phytoene synthase and delta-carotene desaturase gene, lycopene beta-cyclase, lycopene epsilon-cyclase were functionally analyzed in transgenic tobacco (Nicotiana tabacum) plants. All transgenic tobacco plants constitutively expressing these genes showed enhanced beta-carotene contents in their leaves and flowers to different extents. The addictive effects of co-ordinate expression of double transgenes have also been investigated.

TGF-Beta Gene Polymorphisms in Food Allergic versus Non-Food Allergic Eosinophilic Esophagitis

Science.gov (United States)

2013-10-01

esophageal dysfunction (i.e. dysphagia, anorexia, early satiety, failure to thrive) in whom gastro - esophageal reflux disease has been ruled out by...W81XWH-11-1-0741 TITLE: TGF-Beta Gene Polymorphisms in Food Allergic versus Non-Food Allergic Eosinophilic Esophagitis PRINCIPAL INVESTIGATOR...versus Non-Food Allergic Eosinophilic Esophagitis 5b. GRANT NUMBER W81XWH-11-1-0741 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) David Broide MB

Beta fibrinogen gene polymorphisms are associated with plasma fibrinogen and coronary artery disease in patients with myocardial infarction. The ECTIM Study. Etude Cas-Temoins sur l'Infarctus du Myocarde.

Science.gov (United States)

Behague, I; Poirier, O; Nicaud, V; Evans, A; Arveiler, D; Luc, G; Cambou, J P; Scarabin, P Y; Bara, L; Green, F; Cambien, F

1996-02-01

Polymorphisms of the beta fibrinogen gene have been shown to affect plasma fibrinogen levels and the risk of peripheral arterial disease. We now present the results of a detailed analysis of the beta fibrinogen gene in relation to plasma fibrinogen and to the severity of coronary artery disease (CAD) in patients with myocardial infarction (MI) in the ECTIM Study. Ten polymorphisms of the beta fibrinogen gene, including five new polymorphisms identified by single-strand conformation polymorphism analysis, and one polymorphism in the 3' flanking region of the alpha fibrinogen gene were investigated in 565 patients with MI and 668 control subjects. The polymorphisms were in tight linkage disequilibrium and the genotype frequencies were similar in patients with MI and control subjects. In the multivariate analysis, only two polymorphisms, beta Hae III (P 50% stenosis was estimated by angiography and used as a criterion for severity of CAD. Presence of the less frequent allele of the beta Bcl I (P < .0003) and of other polymorphisms was positively associated with the severity of CAD. Genetic variants of the beta fibrinogen gene are associated with an increased plasma level of fibrinogen, especially in smokers. The association with CAD appears to be the consequence of an increased risk of MI in subjects with severe CAD who carry the predisposing beta fibrinogen genotypes.

Intravascular local gene transfer mediated by protein-coated metallic stent.

Science.gov (United States)

Yuan, J; Gao, R; Shi, R; Song, L; Tang, J; Li, Y; Tang, C; Meng, L; Yuan, W; Chen, Z

2001-10-01

To assess the feasibility, efficiency and selectivity of adenovirus-mediated gene transfer to local arterial wall by protein-coated metallic stent. A replication-defective recombinant adenovirus carrying the Lac Z reporter gene for nuclear-specific beta-galactosidase (Ad-beta gal) was used in this study. The coating for metallic stent was made by immersing it in a gelatin solution containing crosslinker. The coated stents were mounted on a 4.0 or 3.0 mm percutaneous transluminal coronary angioplasty (PTCA) balloon and submersed into a high-titer Ad-beta gal viral stock (2 x 10(10) pfu/ml) for 3 min, and then implanted into the carotid arteries in 4 mini-swines and into the left anterior descending branch of the coronary artery in 2 mini-swines via 8F large lumen guiding catheters. The animals were sacrificed 7 (n = 4), 14 (n = 1) and 21 (n = 1) days after implantation, respectively. The beta-galactosidase expression was assessed by X-gal staining. The results showed that the expression of transgene was detected in all animal. In 1 of carotid artery with an intact intima, the beta-gal expression was limited to endothelial cells. In vessels with denuded endothelium, gene expression was found in the sub-intima, media and adventitia. The transfection efficiency of medial smooth muscle cells was 38.6%. In 2 animals sacrificed 7 days after transfection, a microscopic examination of X-gal-stained samples did not show evidence of transfection in remote organs and arterial segments adjacent to the treated arterial site. Adenovirus-mediated arterial gene transfer to endothelial, smooth muscle cells and adventitia by protein-coated metallic stent is feasible. The transfection efficiency is higher. The coated stent may act as a good carrier of adenovirus-mediated gene transfer and have a potential to prevent restenosis following PTCA.

A polymorphism of the interleukin-1 beta gene is associated with sperm pathology in humans.

Science.gov (United States)

Bentz, Eva-Katrin; Hefler, Lukas A; Denschlag, Dominik; Pietrowski, Detlef; Buerkle, Bernd; Tempfer, Clemens B

2007-09-01

In a prospective case-control study of 127 normozoospermic and 435 non-normozoospermic Caucasian men, the genotype frequencies of a polymorphism of the interleukin-1 beta gene (IL-1beta Taq C-->T) were statistically significantly different between groups (homozygous wild-type C/C [57%], heterozygous C/T [42%], and homozygous mutant T/T [1%] vs. C/C [57%], C/T [36%], T/T [7%] for normozoospermic and non-normozoospermic men, respectively; odds ratio, 4.8; 95% confidence interval, 1.13 to 20.28). This association was restricted to men with the oligoasthenoteratozoospermia (OAT) syndrome. We conclude that the investigated polymorphism is associated with sperm pathology in Caucasians.

Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

DEFF Research Database (Denmark)

D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

2008-01-01

cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

Homologous expression of a mutated beta-tubulin gene does not confer benomyl resistance on Trichoderma virens.

Science.gov (United States)

Mukherjee, M; Hadar, R; Mukherjee, P K; Horwitz, B A

2003-01-01

To clone the beta-tubulins and to induce resistance to benzimidazoles in the biocontrol fungus Trichoderma virens through site-directed mutagenesis. Two beta-tubulin genes have been cloned using PCR amplification followed by the screening of a T. virens cDNA library. The full-length cDNA clones, coding for 445 and 446 amino acids, have been designated as T. virens tub1 and T. virens tub2. A sequence alignment of these two tubulins with tubulins from other filamentous fungi has shown the presence of some unique amino acid sequences not found in those positions in other beta-tubulins. Constitutive expression of the tub2 gene with a histidine to tyrosine substitution at position 6 (known to impart benomyl/methyl benzimadazol-2-yl carbamate resistance in other fungi), under the Pgpd promoter of Aspergillus nidulans, did not impart resistance to benomyl. The homologous expression of tub2 gene with a histidine to tyrosine mutation at position +6, which is known to impart benomyl tolerance in other fungi, does not impart resistance in T. virens. Unlike other Trichoderma spp., T. virens, has been difficult to mutate for benomyl tolerance. The present study, through site-directed mutagenesis, shows that a mutation known to impart benomyl tolerance in T. viride and other fungi does not impart resistance in this fungus. Understanding the mechanisms of this phenomenon will have a profound impact in plant-disease management, as many plant pathogenic fungi develop resistance to this group of fungicides forcing its withdrawal after a short period of use.

Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

Directory of Open Access Journals (Sweden)

Nikhil Moorchung

2013-01-01

Full Text Available Introduction: Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. Materials and Methods: 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR-based allele-specific Amplification Refractory Mutation System (ARMS. Molecular analysis for the sickle cell mutation was done by standard methods. Results: The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23% of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Discussion and Conclusion: Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

S-(3-Aminobenzanthron-2-yl)cysteine in the globin of rats as a novel type of adduct and possible biomarker of exposure to 3-nitrobenzanthrone, a potent environmental carcinogen.

Science.gov (United States)

Linhart, Igor; Hanzlíková, Iveta; Mráz, Jaroslav; Dušková, Šárka

2017-10-01

3-Nitrobenzanthrone (3-NBA), a potent environmental mutagen and carcinogen, is known to be activated in vivo to 3-benzanthronylnitrenium ion which forms both NH and C2-bound adducts with DNA and also reacts with glutathione giving rise to urinary 3-aminobenzanthron-2-ylmercapturic acid. In this study, acid hydrolysate of globin from rats dosed intraperitoneally with 3-NBA was analysed by HPLC/MS to identify a novel type of cysteine adduct, 3-aminobenzanthron-2-ylcysteine (3-ABA-Cys), confirmed using a synthesised standard. The 3-ABA-Cys levels in globin peaked after single 3-NBA doses of 1 and 2 mg/kg on day 2 to attain 0.25 and 0.49 nmol/g globin, respectively, thereafter declining slowly to 70-80% of their maximum values during 15 days. After dosing rats for three consecutive days with 1 mg 3-NBA/kg a significant cumulation of 3-ABA-Cys in globin was observed. 3-ABA-Cys was also found in the plasma hydrolysate. Herein, after dosing with 1 and 2 mg 3-NBA/kg the adduct levels peaked on day 1 at 0.15 and 0.51 nmol/ml plasma, respectively, thereafter declining rapidly to undetectable levels on day 15. In addition, sulphinamide adducts were also found in the exposed rats, measured indirectly as 3-aminobenzanthrone (3-ABA) split off from globin by mild acid hydrolysis. Levels of both types of adducts in the globin samples parallelled very well with 3-ABA/3-ABA-Cys ratio being around 1:8. In conclusion, 3-ABA-Cys is the first example of arylnitrenium-cysteine adduct in globin representing a new promising class of biomarkers to assess cumulative exposures to aromatic amines, nitroaromatics and heteroaromatic amines.

Towards a "Golden Standard" for computing globin stability: Stability and structure sensitivity of myoglobin mutants

DEFF Research Database (Denmark)

Kepp, Kasper Planeta

2015-01-01

Fast and accurate computation of protein stability is increasingly important for e.g. protein engineering and protein misfolding diseases, but no consensus methods exist for important proteins such as globins, and performance may depend on the type of structural input given. This paper reports be...

Gene therapy for sickle cell disease: An update.

Science.gov (United States)

Demirci, Selami; Uchida, Naoya; Tisdale, John F

2018-05-30

Sickle cell disease (SCD) is one of the most common life-threatening monogenic diseases affecting millions of people worldwide. Allogenic hematopietic stem cell transplantation is the only known cure for the disease with high success rates, but the limited availability of matched sibling donors and the high risk of transplantation-related side effects force the scientific community to envision additional therapies. Ex vivo gene therapy through globin gene addition has been investigated extensively and is currently being tested in clinical trials that have begun reporting encouraging data. Recent improvements in our understanding of the molecular pathways controlling mammalian erythropoiesis and globin switching offer new and exciting therapeutic options. Rapid and substantial advances in genome engineering tools, particularly CRISPR/Cas9, have raised the possibility of genetic correction in induced pluripotent stem cells as well as patient-derived hematopoietic stem and progenitor cells. However, these techniques are still in their infancy, and safety/efficacy issues remain that must be addressed before translating these promising techniques into clinical practice. Published by Elsevier Inc.

Neurotensin receptor 1 gene activation by the Tcf/beta-catenin pathway is an early event in human colonic adenomas.

Science.gov (United States)

Souazé, Frédérique; Viardot-Foucault, Véronique; Roullet, Nicolas; Toy-Miou-Leong, Mireille; Gompel, Anne; Bruyneel, Erik; Comperat, Eva; Faux, Maree C; Mareel, Marc; Rostène, William; Fléjou, Jean-François; Gespach, Christian; Forgez, Patricia

2006-04-01

Alterations in the Wnt/APC (adenomatous polyposis coli) signalling pathway, resulting in beta-catenin/T cell factor (Tcf)-dependent transcriptional gene activation, are frequently detected in familial and sporadic colon cancers. The neuropeptide neurotensin (NT) is widely distributed in the gastrointestinal tract. Its proliferative and survival effects are mediated by a G-protein coupled receptor, the NT1 receptor. NT1 receptor is not expressed in normal colon epithelial cells, but is over expressed in a number of cancer cells and tissues suggesting a link to the outgrowth of human colon cancer. Our results demonstrate that the upregulation of NT1 receptor occurring in colon cancer is the result of Wnt/APC signalling pathway activation. We first established the functionality of the Tcf response element within the NT1 receptor promoter. Consequently, we observed the activation of NT1 receptor gene by agents causing beta-catenin cytosolic accumulation, as well as a strong decline of endogenous receptor when wt-APC was restored. At the cellular level, the re-establishment of wt-APC phenotype resulted in the impaired functionality of NT1 receptor, like the breakdown in NT-induced intracellular calcium mobilization and the loss of NT pro-invasive effect. We corroborated the Wnt/APC signalling pathway on the NT1 receptor promoter activation with human colon carcinogenesis, and showed that NT1 receptor gene activation was perfectly correlated with nuclear or cytoplasmic beta-catenin localization while NT1 receptor was absent when beta-catenin was localized at the cell-cell junction in early adenomas of patients with familial adenomatous polyposis, hereditary non-polyposis colorectal cancer and loss of heterozygosity tumours. In this report we establish a novel link in vitro between the Tcf/beta-catenin pathway and NT1 receptor promoter activation.

A distant upstream promoter of the HNF-4alpha gene connects the transcription factors involved in maturity-onset diabetes of the young.

NARCIS (Netherlands)

Thomas, H.; Jaschkowitz, K.; Bulman, M.P.; Frayling, T.M.; Mitchell, S.M.; Roosen, S.; Lingott-Frieg, A.; Tack, C.J.J.; Ellard, S.; Ryffel, G.U.; Hattersley, A.T.

2001-01-01

Maturity-onset diabetes of the young (MODY) is a monogenic, autosomal dominant subtype of early-onset diabetes mellitus due to defective insulin secretion by the pancreatic beta-cell in humans. Five different genes have been identified including those encoding the tissue-specific transcription

Comparison of MicroRNAs Mediated in Reactivation of the γ-Globin in β-Thalassemia Patients, Responders and Non-Responders to Hydroxyurea.

Science.gov (United States)

Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser

2017-03-01

Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.

Genetic analysis of beta1 integrin "activation motifs" in mice

DEFF Research Database (Denmark)

Czuchra, Aleksandra; Meyer, Hannelore; Legate, Kyle R

2006-01-01

-null phenotype in vivo. Surprisingly, neither the substitution of the tyrosines with phenylalanine nor the aspartic acid with alanine resulted in an obvious defect. These data suggest that the NPXY motifs of the beta1 integrin tail are essential for beta1 integrin function, whereas tyrosine phosphorylation...

Coronin-1A links cytoskeleton dynamics to TCR alpha beta-induced cell signaling.

Directory of Open Access Journals (Sweden)

Bénédicte Mugnier

Full Text Available Actin polymerization plays a critical role in activated T lymphocytes both in regulating T cell receptor (TCR-induced immunological synapse (IS formation and signaling. Using gene targeting, we demonstrate that the hematopoietic specific, actin- and Arp2/3 complex-binding protein coronin-1A contributes to both processes. Coronin-1A-deficient mice specifically showed alterations in terminal development and the survival of alpha beta T cells, together with defects in cell activation and cytokine production following TCR triggering. The mutant T cells further displayed excessive accumulation yet reduced dynamics of F-actin and the WASP-Arp2/3 machinery at the IS, correlating with extended cell-cell contact. Cell signaling was also affected with the basal activation of the stress kinases sAPK/JNK1/2; and deficits in TCR-induced Ca2+ influx and phosphorylation and degradation of the inhibitor of NF-kappaB (I kappa B. Coronin-1A therefore links cytoskeleton plasticity with the functioning of discrete TCR signaling components. This function may be required to adjust TCR responses to selecting ligands accounting in part for the homeostasis defect that impacts alpha beta T cells in coronin-1A deficient mice, with the exclusion of other lympho/hematopoietic lineages.

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

Energy Technology Data Exchange (ETDEWEB)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

1987-10-16

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

The crtS gene of Xanthophyllomyces dendrorhous encodes a novel cytochrome-P450 hydroxylase involved in the conversion of beta-carotene into astaxanthin and other xanthophylls.

Science.gov (United States)

Alvarez, Vanessa; Rodríguez-Sáiz, Marta; de la Fuente, Juan Luis; Gudiña, Eduardo J; Godio, Ramiro P; Martín, Juan F; Barredo, José Luis

2006-04-01

The conversion of beta-carotene into xanthophylls is a subject of great scientific and industrial interest. We cloned the crtS gene involved in astaxanthin biosynthesis from two astaxanthin producing strains of Xanthophyllomyces dendrorhous: VKPM Y2410, an astaxanthin overproducing strain, and the wild type ATCC 24203. In both cases, the ORF has a length of 3166 bp, including 17 introns, and codes for a protein of 62.6 kDa with similarity to cytochrome-P450 hydroxylases. crtS gene sequences from strains VKPM Y2410, ATCC 24203, ATCC 96594, and ATCC 96815 show several nucleotide changes, but none of them causes any amino acid substitution, except a G2268 insertion in the 13th exon of ATCC 96815 which causes a change in the reading frame. A G1470 --> A change in the 5' splicing region of intron 8 was also found in ATCC 96815. Both point mutations explain astaxanthin idiotrophy and beta-carotene accumulation in ATCC 96815. Mutants accumulating precursors of the astaxanthin biosynthetic pathway were selected from the parental strain VKPM Y2410 (red) showing different colors depending on the compound accumulated. Two of them were blocked in the biosynthesis of astaxanthin, M6 (orange; 1% astaxanthin, 71 times more beta-carotene) and M7 (orange; 1% astaxanthin, 58 times more beta-carotene, 135% canthaxanthin), whereas the rest produced lower levels of astaxanthin (5-66%) than the parental strain. When the crtS gene was expressed in M7, canthaxanthin accumulation disappeared and astaxanthin production was partially restored. Moreover, astaxanthin biosynthesis was restored when X. dendrorhous ATCC 96815 was transformed with the crtS gene. The crtS gene was heterologously expressed in Mucor circinelloides conferring to this fungus an improved capacity to synthesize beta-cryptoxanthin and zeaxanthin, two hydroxylated compounds from beta-carotene. These results show that the crtS gene is involved in the conversion of beta-carotene into xanthophylls, being potentially useful to

Early peroxisome proliferator-activated receptor gamma regulated genes involved in expansion of pancreatic beta cell mass

Directory of Open Access Journals (Sweden)

Vivas Yurena

2011-12-01

Full Text Available Abstract Background The progression towards type 2 diabetes depends on the allostatic response of pancreatic beta cells to synthesise and secrete enough insulin to compensate for insulin resistance. The endocrine pancreas is a plastic tissue able to expand or regress in response to the requirements imposed by physiological and pathophysiological states associated to insulin resistance such as pregnancy, obesity or ageing, but the mechanisms mediating beta cell mass expansion in these scenarios are not well defined. We have recently shown that ob/ob mice with genetic ablation of PPARγ2, a mouse model known as the POKO mouse failed to expand its beta cell mass. This phenotype contrasted with the appropriate expansion of the beta cell mass observed in their obese littermate ob/ob mice. Thus, comparison of these models islets particularly at early ages could provide some new insights on early PPARγ dependent transcriptional responses involved in the process of beta cell mass expansion Results Here we have investigated PPARγ dependent transcriptional responses occurring during the early stages of beta cell adaptation to insulin resistance in wild type, ob/ob, PPARγ2 KO and POKO mice. We have identified genes known to regulate both the rate of proliferation and the survival signals of beta cells. Moreover we have also identified new pathways induced in ob/ob islets that remained unchanged in POKO islets, suggesting an important role for PPARγ in maintenance/activation of mechanisms essential for the continued function of the beta cell. Conclusions Our data suggest that the expansion of beta cell mass observed in ob/ob islets is associated with the activation of an immune response that fails to occur in POKO islets. We have also indentified other PPARγ dependent differentially regulated pathways including cholesterol biosynthesis, apoptosis through TGF-β signaling and decreased oxidative phosphorylation.

Beta-lactamases in Enterobacteriaceae in broilers

NARCIS (Netherlands)

Dierikx, C.M.

2013-01-01

Resistance to cephalosprins due to the production of extended spectrum beta-lactamases (ESBLs) or plasmid mediated AmpC beta-lactamases is increasingly found in infections in humans outside the hospital. The genes encoding for these beta-lactamases are located on mobile DNA (plasmids), which can be

Hb A2 Episkopi - a novel δ-globin chain variant [HBD:c.428C>T] in a family of mixed Cypriot-Lebanese descent.

Science.gov (United States)

Lederer, Carsten W; Pavlou, Eleni; Tanteles, George A; Evangelidou, Paola; Sismani, Carolina; Kolnagou, Annita; Sitarou, Maria; Christou, Soteroulla; Hadjigavriel, Michael; Kleanthous, Marina

2017-06-01

Thalassaemia is a potentially lethal inherited anaemia, caused by reduced or absent synthesis of globin chains. Measurement of the minor adult haemoglobin Hb A 2 , combining α- with δ-globin, is critical for the routine diagnosis of carrier status for α- or β-thalassaemia. Here, we aim to characterize a novel δ-globin variant, Hb A 2 Episkopi, in a single family of mixed Lebanese and Cypriot ancestry with mild hypochromic anaemia and otherwise normal globin genotype, which also presents with a coincidental 0.78-Mb sequence duplication on chromosome 1 (1q44) and developmental abnormalities. Analyses included comprehensive haematological analyses, cation-exchange high-performance liquid chromatography (CE-HPLC), cellulose acetate electrophoresis (CAE), Sanger sequencing and structure-based stability predictions for Hb A 2 Episkopi. The GCT > GTT missense mutation, underlying Hb A 2 Episkopi, HBD:c.428C > T, introduces a cd142 codon change in the mature protein, resulting in reduced normal Hb A 2 amounts and a novel, less abundant Hb A 2 variant (HGVS: HBD:p.A143V), detectable as a delayed peak by CE-HPLC. The latter was in line with structure-based stability predictions, which indicated that the substitution of a marginal, non-helical and non-interface residue, five amino acids from the δ-globin chain carboxy-terminus, was moderately destabilizing. Detection of the new variant depends on the diagnostic set-up and had failed by CAE and on an independent CE-HPLC system, which, in unfavourable circumstances, may lead to misdiagnoses of β-thalassaemia as α-thalassaemia. Given the mixed background of the affected family, the ethnic origin of the mutation is unclear, and this study thus suggests awareness for possible detection of Hb A 2 Episkopi in both the Cypriot and the Lebanese populations.

The diversity and abundance of phytase genes (beta-propeller phytases) in bacterial communities of the maize rhizosphere

NARCIS (Netherlands)

Cotta, S.R.; Cavalcante Franco Dias, A.; Seldin, L.; Andreote, F. D.; van Elsas, J. D.

The ecology of microbial communities associated with organic phosphorus (P) mineralization in soils is still understudied. Here, we assessed the abundance and diversity of bacteria harbouring genes encoding beta-propeller phytases (BPP) in the rhizosphere of traditional and transgenic maize

Adipocytokine concentrations in children with different types of beta-thalassemia.

Science.gov (United States)

Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz

2014-06-01

Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

Two cloned β thalassemia genes are associated with amber mutations at codon 39

Science.gov (United States)

Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

1981-01-01

Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

Molecular characterization of four beta-tubulin genes from dinitroaniline susceptible and resistant biotypes of Eleusine indica.

Science.gov (United States)

Yamamoto, E; Baird, W V

1999-01-01

Dinitroaniline herbicides are antimicrotubule drugs that bind to tubulins and inhibit polymerization. As a result of repeated application of dinitroaniline herbicides, resistant biotypes of goosegrass (Eleusine indica) developed in previously susceptible wild-type populations. We have previously reported that alpha-tubulin missense mutations correlate with dinitroaniline response phenotypes (Drp) (Plant Cell 10: 297-308, 1998). In order to ascertain associations of other tubulins with dinitroaniline resistance, four beta-tubulin cDNA classes (designated TUB1, TUB2, TUB3, and TUB4) were isolated from dinitroaniline-susceptible and -resistant biotypes. Sequence analysis of the four beta-tubulin cDNA classes identified no missense mutations. Identified nucleotide substitutions did not result in amino acid replacements. These results suggest that the molecular basis of dinitroaniline resistance in goosegrass differs from those of colchicine/dinitroaniline cross-resistant Chlamydomonas reinhardtii and benzimidazole-resistant fungi and yeast. Expression of the four beta-tubulins was highest in inflorescences. This is in contrast to alpha-tubulin TUA1 that is expressed predominantly in roots. Collectively, these results imply that beta-tubulin genes are not associated with dinitroaniline resistance in goosegrass. Phylogenetic analysis of the four beta-tubulins, together with three alpha-tubulins, suggests that the resistant biotype developed independently in multiple locations rather than spreading from one location.

In vitro and in vivo gene therapy with CMV vector-mediated presumed dog beta-nerve growth factor in pyridoxine-induced neuropathy dogs.

Science.gov (United States)

Chung, Jin Young; Choi, Jung Hoon; Shin, Il Seob; Choi, Eun Wha; Hwang, Cheol Yong; Lee, Sang Koo; Youn, Hwa Young

2008-12-01

Due to the therapeutic potential of gene therapy for neuronal injury, many studies of neurotrophic factors, vectors, and animal models have been performed. The presumed dog beta-nerve growth factor (pdbeta-NGF) was generated and cloned and its expression was confirmed in CHO cells. The recombinant pdbeta-NGF protein reacted with a human beta-NGF antibody and showed bioactivity in PC12 cells. The pdbeta-NGF was shown to have similar bioactivity to the dog beta-NGF. The recombinant pdbeta-NGF plasmid was administrated into the intrathecal space in the gene therapy group. Twenty-four hours after the vector inoculation, the gene therapy group and the positive control group were intoxicated with excess pyridoxine for seven days. Each morning throughout the test period, the dogs' body weight was taken and postural reaction assessments were made. Electrophysiological recordings were performed twice, once before the experiment and once after the test period. After the experimental period, histological analysis was performed. Dogs in the gene therapy group had no weight change and were normal in postural reaction assessments. Electrophysiological recordings were also normal for the gene therapy group. Histological analysis showed that neither the axons nor the myelin of the dorsal funiculus of L4 were severely damaged in the gene therapy group. In addition, the dorsal root ganglia of L4 and the peripheral nerves (sciatic nerve) did not experience severe degenerative changes in the gene therapy group. This study is the first to show the protective effect of NGF gene therapy in a dog model.

Determination of proteolytic activity using L-[4,5-3H]leucine-labelled globin as a substrate

International Nuclear Information System (INIS)

Maliopoulou, T.B.; Dionyssiou-Asteriou, A.; Loucopoulos, D.

1980-01-01

A simple and sensitive method for the assay of proteolytic enzyme activity is described. This is based on the digestion of L-[4,5- 3 H]leucine globin by proteolytic enzymes and radioactivity measurement of the trichloroacetic acid soluble cleavage products. (Auth.)

TRUNCATED OR 2/2 HEMOGLOBINS : A NEW CLASS OF GLOBINS WITH NOVEL STRUCTURE AND FUNCTION

Directory of Open Access Journals (Sweden)

Amit Kumar

2013-06-01

Full Text Available Bright red hemoglobins, the most well-known paradigm in protein science, seem to be ubiquitous in nature. With advances in modern tools and techniques, discovery of new globins at a rapid pace has expanded this family. With every discovery, new insights emerged regarding their novel structure, function and several other characteristics previously not observed for hemoglobins. Even the classical function unanimously assigned to hemoglobins – oxygen transport and storage – needed re-evaluation. The ability of this class of proteins to show responses against various gaseous ligands, even the poisonous ones, indicate that it is obviously as ancient as life. As organisms evolved, hemoglobins also evolved, and accumulated a great degree of diversity in all aspects. The classical globin fold is very unique with 3-on-3 alpha helical bundle as observed in the traditional oxygen-transport hemoglobins like myoglobin, human blood hemoglobin and leghemoglobins in plants. However, a class of the newly discovered hemoglobins, which dominate the superfamily and appears ancient in origin mostly have 2-on-2 fold, commonly termed as “truncated” hemoglobins. These hemoglobins are phylogenetically distinct from their classical counterparts and are often shorter in their polypeptide length by 20-40 residues mainly due to a lack of short A helix, D helix and F helix. However, hemoglobins with 2-on-2 fold were also later found to have polypeptide chain lengths similar in size to classical globins. Disordered pre-F helix region, conserved glycine motifs and other key residues and apolar tunnels through their protein matrix for migration of ligands are some unique characteristics features of these truncated hemoglobins. Some of these are also hexacoordinated at heme iron where an amino acid from within the protein coordinates heme iron in absence of a ligand. These hemoglobins are well known for their high affinity towards ligand and have a diverse mechanism of

Preferential repair of ionizing radiation-induced damage in the transcribed strand of an active human gene is defective in Cockayne syndrome

International Nuclear Information System (INIS)

Leadon, S.A.; Copper, P.K.

1993-01-01

Cells from patients with Cockayne syndrome (CS), which are sensitive to killing by UV although overall damage removal appears normal, are specifically defective in repair of UV damage in actively transcribe genes. Because several CS strains display cross-sensitivity to killing by ionizing radiation, the authors examined whether ionizing radiation-induced damage in active genes is preferentially repaired by normal cells and whether the radiosensitivity of CS cells can be explained by a defect in this process. They found that ionizing radiation-induced damage was repaired more rapidly in the transcriptionally active metallothionein IIA (MTIIA) gene than in the inactive MTIIB gene or in the genome overall in normal cells as a result of faster repair on the transcribed strand of MTIIA. Cells of the radiosensitive CS strain CS1AN are completely defective in this strand-selective repair of ionizing radiation-induced damage, although their overall repair rate appears normal. CS3BE cells, which are intermediate in radiosensitivity, do exhibit more rapid repair of the transcribed strand but at a reduced rate compared to normal cells. Xeroderma pigmentosum complementation group A cells, which are hypersensitive to UV light because of a defect in the nucleotide excision repair pathway but do not show increased sensitivity to ionizing radiation, preferentially repair ionizing radiation-induced damage on the transcribed strand of MTIIA. Thus, the ability to rapidly repair ionizing radiation-induced damage in actively transcribing genes correlates with cell survival. The results extend the generality of preferential repair in active genes to include damage other than bulky lesions

[Transient congenital hypothyroidism due to biallelic defects of DUOX2 gene. Two clinical cases].

Science.gov (United States)

Enacán, Rosa E; Masnata, María E; Belforte, Fiorella; Papendieck, Patricia; Olcese, María C; Siffo, Sofía; Gruñeiro-Papendieck, Laura; Targovnik, Héctor; Rivolta, Carina M; Chiesa, Ana E

2017-06-01

Congenital hypothyroidism affects 1:2000-3000 newborns detected by neonatal screening programs. Dual oxidases, DUOX1 and 2, generate hydrogen peroxide needed for the thyroid hormone synthesis. Hipotiroidismo congénito transitorio por defectos bialélicos del gen DUOX2. Dos casos clínicos Transient congenital hypothyroidism due to biallelic defects of DUOX2 gene. Two clinical cases Mutations in the DUOX2 gene have been described in transient and permanent congenital hypothyroidism. Two brothers with congenital hypothyroidism detected by neonatal screening with eutopic gland and elevated thyroglobulin are described. They were treated with levothyroxine until it could be suspended in both during childhood, assuming the picture as transient. Organification disorder was confirmed. Both patients were compounds heterozygous for a mutation in exon 9 of the paternal allele (c.1057_1058delTT, p.F353PfsX36 or p.F353fsX388) and in exon 11 of the maternal allele (c.1271T > G, p.Y425X) of DUOX2 gene. Our finding confirms that the magnitude of the defect of DUOX2 is not related to the number of inactivated alleles, suggesting compensatory mechanisms in the peroxide supply. Sociedad Argentina de Pediatría.

Genetic interactions between planar cell polarity genes cause diverse neural tube defects in mice

Directory of Open Access Journals (Sweden)

Jennifer N. Murdoch

2014-10-01

Full Text Available Neural tube defects (NTDs are among the commonest and most severe forms of developmental defect, characterized by disruption of the early embryonic events of central nervous system formation. NTDs have long been known to exhibit a strong genetic dependence, yet the identity of the genetic determinants remains largely undiscovered. Initiation of neural tube closure is disrupted in mice homozygous for mutations in planar cell polarity (PCP pathway genes, providing a strong link between NTDs and PCP signaling. Recently, missense gene variants have been identified in PCP genes in humans with NTDs, although the range of phenotypes is greater than in the mouse mutants. In addition, the sequence variants detected in affected humans are heterozygous, and can often be detected in unaffected individuals. It has been suggested that interactions between multiple heterozygous gene mutations cause the NTDs in humans. To determine the phenotypes produced in double heterozygotes, we bred mice with all three pairwise combinations of Vangl2Lp, ScribCrc and Celsr1Crsh mutations, the most intensively studied PCP mutants. The majority of double-mutant embryos had open NTDs, with the range of phenotypes including anencephaly and spina bifida, therefore reflecting the defects observed in humans. Strikingly, even on a uniform genetic background, variability in the penetrance and severity of the mutant phenotypes was observed between the different double-heterozygote combinations. Phenotypically, Celsr1Crsh;Vangl2Lp;ScribCrc triply heterozygous mutants were no more severe than doubly heterozygous or singly homozygous mutants. We propose that some of the variation between double-mutant phenotypes could be attributed to the nature of the protein disruption in each allele: whereas ScribCrc is a null mutant and produces no Scrib protein, Celsr1Crsh and Vangl2Lp homozygotes both express mutant proteins, consistent with dominant effects. The variable outcomes of these genetic

Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

Directory of Open Access Journals (Sweden)

Pizzichini Daniele

2007-03-01

Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.