WorldWideScience

Sample records for beta thalassemia limited

  1. Beta Thalassemia (For Parents)

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Beta Thalassemia KidsHealth / For Parents / Beta Thalassemia What's in this ... Symptoms Diagnosis Treatment Print en español Beta talasemia Thalassemias Thalassemias are a group of blood disorders that ...

  2. Genetics Home Reference: beta thalassemia

    Science.gov (United States)

    ... Facebook Twitter Home Health Conditions Beta thalassemia Beta thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Beta thalassemia is a blood disorder that reduces the production ...

  3. Beta thalassemia - a review

    Directory of Open Access Journals (Sweden)

    R Jha

    2014-09-01

    Full Text Available Thalassemia is a globin gene disorder that results in a diminished rate of synthesis of one or more of the globin chains. About 1.5% of the global population (80 to 90 million people are carriers of beta Thalassemia. More than 200 mutations are described in beta thalassemia. However not all mutations are common in different ethnic groups. The only effective way to reduce burden of thalassemia is to prevent birth of homozygotes. Diagnosis of beta thalassemia can be done by fetal DNA analysis for molecular defects of beta thalassemia or by fetal blood analysis. Hematopoietic stem cell transplantation is the only available curative approach for Thalassemia. Many patients with thalassemia in underdeveloped nations die in childhood or adolescence. Programs that provide acceptable care, including transfusion of safe blood and supportive therapy including chelation must be established.DOI: http://dx.doi.org/10.3126/jpn.v4i8.11609 Journal of Pathology of Nepal; Vol.4,No. 8 (2014 663-671

  4. Beta-thalassemia

    Directory of Open Access Journals (Sweden)

    Origa Raffaella

    2010-05-01

    Full Text Available Abstract Beta-thalassemias are a group of hereditary blood disorders characterized by anomalies in the synthesis of the beta chains of hemoglobin resulting in variable phenotypes ranging from severe anemia to clinically asymptomatic individuals. The total annual incidence of symptomatic individuals is estimated at 1 in 100,000 throughout the world and 1 in 10,000 people in the European Union. Three main forms have been described: thalassemia major, thalassemia intermedia and thalassemia minor. Individuals with thalassemia major usually present within the first two years of life with severe anemia, requiring regular red blood cell (RBC transfusions. Findings in untreated or poorly transfused individuals with thalassemia major, as seen in some developing countries, are growth retardation, pallor, jaundice, poor musculature, hepatosplenomegaly, leg ulcers, development of masses from extramedullary hematopoiesis, and skeletal changes that result from expansion of the bone marrow. Regular transfusion therapy leads to iron overload-related complications including endocrine complication (growth retardation, failure of sexual maturation, diabetes mellitus, and insufficiency of the parathyroid, thyroid, pituitary, and less commonly, adrenal glands, dilated myocardiopathy, liver fibrosis and cirrhosis. Patients with thalassemia intermedia present later in life with moderate anemia and do not require regular transfusions. Main clinical features in these patients are hypertrophy of erythroid marrow with medullary and extramedullary hematopoiesis and its complications (osteoporosis, masses of erythropoietic tissue that primarily affect the spleen, liver, lymph nodes, chest and spine, and bone deformities and typical facial changes, gallstones, painful leg ulcers and increased predisposition to thrombosis. Thalassemia minor is clinically asymptomatic but some subjects may have moderate anemia. Beta-thalassemias are caused by point mutations or, more rarely

  5. Thalassemia

    Science.gov (United States)

    Mediterranean anemia; Cooley anemia; Beta thalassemia; Alpha thalassemia ... alpha globin protein are missing or changed (mutated). Beta thalassemia occurs when similar gene defects affect production of ...

  6. A comparison of heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major.

    Science.gov (United States)

    Amoozgar, Hamid; Zeighami, Samaneh; Haghpanah, Sezaneh; Karimi, Mehran

    2017-01-01

    The goal of this study was to compare heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major. In this cross-sectional study, 60 patients with beta thalassemia major and 60 patients with beta thalassemia intermedia who had clinically no symptoms of arrhythmia and clinically normal heart function were evaluated using 24-hour ambulatory electrocardiogram monitoring and echocardiography. For data analysis SPSS ver.20 software was used. A P-value of less than 0.05 was considered statistically significant. The mean age of the beta thalassemia intermedia patients was 24.18 ± 7.9 years and the mean age in beta thalassemia major was 24.38 ± 7.7 years (P>0.05). Premature atrial contractions (PACs) were observed in 14 (23.3%) patients with beta thalassemia intermedia and in 22 (36.6%) beta thalassemia major patients. Premature ventricular contractions (PVCs) were detected in 8 (13.3%) patients in the beta thalassemia intermediate group and 16 (26.6) patients in the beta thalassemia major group, respectively. The left ventricular diastolic dimension, end-diastolic volume, and stroke volume were significantly higher in beta thalassemia intermedia group (Pintermedia group. Both atrial and ventricular arrhythmias were more common in the beta thalassemia major group. Higher end-diastolic volume and stroke volume were detected in the beta thalassemia intermedia group. Pulmonary acceleration time was lower in the beta thalassemia intermedia group, which can be an indicator of higher pulmonary pressure.

  7. Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

    Directory of Open Access Journals (Sweden)

    Najmaddin Saki

    2013-09-01

    Full Text Available Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was performed on patients with abnormal hematological findings in favor of alpha-thalassemia, beta-thalassemia or beta-hemoglobinopathies. Patients with low MCV and MCH levels and high HbA2 (>3.5 and those with low MCV and MCH and normal or low HbA2 were candidate for molecular analysis for beta and alpha thalassemia respectively. Abnormal Hb electrophoresis was diagnostic criteria for molecular analysis of beta-hemoglobinopathies.   Results: Study revealed that more than half of the patients with alpha-thalassemia affected simultaneously by beta-thalassemia and about thirty percent inherited beta-hemoglobinopathies. Among patients with beta-thalassemia, HbSCd6 (A-T was the most common mutation and in alpha-thalassemic patients α 3.7 was the commonest mutation.   Conclusion: Relatively high prevalence of co-inheritance of alfa-thalassemia with beta-thalassemia and hemoglobinopathies reflect the necessity of genetic consulting and molecular analysis in diagnosis of such conditions.

  8. Portal vein thrombosis after splenectomy for beta-thalassemia major

    International Nuclear Information System (INIS)

    Al-Hawsawi, Zakaria M.; Tarawah, Ahmed M.; Hassan, Ruhul Amin A.; Haouimi, Ammar S.

    2004-01-01

    Portal vein thrombosis is a recognized complication after splenectomy for beta-thalassemia major due to the chronic hypercoagulable state which has been recognized to exist in childhood thalassemia and contribute to thromboembolic events. We reporting one patient with beta-thalassemia major developed portal vein thrombosis following splenectomy. (author)

  9. Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

    OpenAIRE

    Najmaddin Saki; Akbar Dorgalaleh; Zahra Kashani Khatib; Shaban Alizadeh; Fakher Rahim; Hamid Galehdari; Bijan Kaikhaei; Mohammad Pedram; Ali Dehghani Fard

    2013-01-01

    Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was pe...

  10. BETA-THALASSEMIA SYNDROMES, CLINICAL AND LABORATORY APPROACH

    OpenAIRE

    Türkkan, Emine; Berrak, Su Gülsün; Canpolat, Cengiz

    2016-01-01

    The Beta ((3) thalassemia syndromes are a heterogeneous group of genetic disorders. The frequency of thalassemia is dependent on the ethnic origins of the patient population. Turkey is located in a geographic area of the world where thalassemia syndromes are common. The incidence rate of (3-thalassemia carriers was stated to be 2 per cent in Turkey. Clinical manifestations are diverse and range from asymptomatic hypochromia and microcytosis to profound anemia leading to death in early childho...

  11. Double heterozygocity for hemoglobin C and beta thalassemia dominant: A rare case of thalassemia intermedia

    Directory of Open Access Journals (Sweden)

    Alexandra Agapidou

    2018-01-01

    Full Text Available Beta thalassemia dominant results from mutations in the β globin chain gene resulting in the production of elongated, highly unstable beta globin chains. Several such mutations have been described and in a heterozygous state they may confer a phenotype more severe than that of β thalassemia trait and lead to a clinical syndrome of thalassemia intermedia and its associated complications such as extramedullary hemopoiesis, bone disease, endocrinopathies and iron overload even in the absence of transfusion. In this report we present a case of double heterozygocity for HbC and β thalassemia dominant leading to a series of complications that were treated successfully once the correct diagnosis was made.

  12. Scintigraphic evaluation of bone involvement in beta thalassemia major

    International Nuclear Information System (INIS)

    Armijo, Soledad; Hidalgo, Pablo

    2000-01-01

    In this article, the authors describe a 19 year old man with beta-thalassemia major and back pain, who was studied with a Tc99m Metilendiphosphonate (Tc99m MDP) bone scan. This case shows many of the complications of beta-thalassemia major in the skeletal system. Also we can see some indirect signs of endocrinopathies associated (Au)

  13. Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

    International Nuclear Information System (INIS)

    Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui; Tamrakar, Karuna

    2012-01-01

    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  14. Intracranial extramedullary hematopoiesis in beta-thalassemia.

    Science.gov (United States)

    Karki, Bivek; Xu, Yi-Kai; Tamrakar, Karuna; Wu, Yuan-Kui

    2012-01-01

    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  15. Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui [Nan fang Hospital, Southern Medical University, Guangzhou (China); Tamrakar, Karuna [Zhujiang Hospital, Southern Medical University, Guangzhou (China)

    2012-03-15

    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  16. Thalassemias

    Science.gov (United States)

    ... Intramural Research Home / Thalassemias Thalassemias Also known as What Is Thalassemias (thal-a- ... of thalassemia, go to "What Causes Thalassemias?" ) Alpha Thalassemias Alpha thalassemia silent carrier Alpha thalassemia minor, also ...

  17. Prevalence of hepatosplenomegaly in beta thalassemia minor subjects in Iran

    Energy Technology Data Exchange (ETDEWEB)

    Karimi, Mehran [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of)], E-mail: Karimim@sums.ac.ir; Bagheri, Mohammad Hadi [Department of Radiology, School of Medicine, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of); Tahmtan, Mehdi [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of); Shakibafard, Alireza [Department of Radiology, School of Medicine, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of); Rashid, Murtaza [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of)

    2009-01-15

    Introduction: Thalassemia is the most common hereditary blood disorder in the world. Iran is located on the thalassemic belt and there is a high prevalence of the hepatosplenomegaly in beta thalassemia minor patients which is reported to be very variable. The goal of this research was to study the frequency of these signs in the cases with beta thalassemia minor patients in Iran. Materials and methods: Two hundred and fifty-nine cases that referred to center for pre-marriage tests were divided into two groups according to their MCV, MCH, and HbA2 (beta thalassemia minor cases and control groups). Liver and spleen sizes were determined by ultrasonographic method and the two groups were compared with each other. Results: Average spleen volumes in case and control groups were 163.48 {+-} 133.97 and 126.29 {+-} 53.98 mm{sup 3}, respectively. Average spleen lengths in case and control groups were 10.71 {+-} 1.52 and 10.60 {+-} 5.4 cm, respectively. Conclusion: In the regions with high frequency of beta thalassemia, in case of finding large spleen size in the ultrasonography, a probable harmless differential diagnosis will be beta thalassemia minor that is not indicative of any serious disease. Volumetric measurement of spleen is more reliable for detection of splenomegaly in these patients.

  18. Prevalence of hepatosplenomegaly in beta thalassemia minor subjects in Iran

    International Nuclear Information System (INIS)

    Karimi, Mehran; Bagheri, Mohammad Hadi; Tahmtan, Mehdi; Shakibafard, Alireza; Rashid, Murtaza

    2009-01-01

    Introduction: Thalassemia is the most common hereditary blood disorder in the world. Iran is located on the thalassemic belt and there is a high prevalence of the hepatosplenomegaly in beta thalassemia minor patients which is reported to be very variable. The goal of this research was to study the frequency of these signs in the cases with beta thalassemia minor patients in Iran. Materials and methods: Two hundred and fifty-nine cases that referred to center for pre-marriage tests were divided into two groups according to their MCV, MCH, and HbA2 (beta thalassemia minor cases and control groups). Liver and spleen sizes were determined by ultrasonographic method and the two groups were compared with each other. Results: Average spleen volumes in case and control groups were 163.48 ± 133.97 and 126.29 ± 53.98 mm 3 , respectively. Average spleen lengths in case and control groups were 10.71 ± 1.52 and 10.60 ± 5.4 cm, respectively. Conclusion: In the regions with high frequency of beta thalassemia, in case of finding large spleen size in the ultrasonography, a probable harmless differential diagnosis will be beta thalassemia minor that is not indicative of any serious disease. Volumetric measurement of spleen is more reliable for detection of splenomegaly in these patients

  19. Oxidative stress and antioxidant status in beta-thalassemia heterozygotes

    Directory of Open Access Journals (Sweden)

    Luciana de Souza Ondei

    2013-01-01

    Full Text Available Background: Several studies have evaluated the oxidant and antioxidant status of thalassemia patients but most focused mainly on the severe and intermediate states of the disease. Moreover, the oxidative status has not been evaluated for the different beta-thalassemia mutations. Objective: To evaluate lipid peroxidation and Trolox equivalent antioxidant capacity in relation to serum iron and ferritin in beta thalassemia resulting from two different mutations (CD39 and IVS-I-110 compared to individuals without beta-thalassemia. Methods: One hundred and thirty subjects were studied, including 49 who were heterozygous for beta-thalassemia and 81 controls. Blood samples were subjected to screening tests for hemoglobin. Allele-specific polymerase chain reaction was used to confirm mutations for beta-thalassemia, an analysis of thiobarbituric acid reactive species was used to determine lipid peroxidation, and Trolox equivalent antioxidant capacity evaluations were performed. The heterozygous beta-thalassemia group was also evaluated for serum iron and ferritin status. Results: Thiobarbituric acid reactive species (486.24 ± 119.64 ng/mL and Trolox equivalent antioxidant capacity values (2.23 ± 0.11 mM/L were higher in beta-thalassemia heterozygotes compared to controls (260.86 ± 92.40 ng/mL and 2.12 ± 0.10 mM/L, respectively; p-value < 0.01. Increased thiobarbituric acid reactive species values were observed in subjects with the CD39 mutation compared with those with the IVS-I-110 mutation (529.94 ± 115.60 ng/mL and 453.39 ± 121.10 ng/mL, respectively; p-value = 0.04. However, average Trolox equivalent antioxidant capacity values were similar for both mutations (2.20 ± 0.08 mM/L and 2.23 ± 0.12 mM/L, respectively; p-value = 0.39. There was no influence of serum iron and ferritin levels on thiobarbituric acid reactive species and Trolox equivalent antioxidant capacity values. Conclusion: This study shows an increase of oxidative stress and

  20. Cardiac complications in beta-thalassemia: From mice to men

    Science.gov (United States)

    Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C.

    2017-01-01

    Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

  1. Cardiac complications in beta-thalassemia: From mice to men.

    Science.gov (United States)

    Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C; Chattipakorn, Nipon

    2017-06-01

    Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

  2. Beta-thalassemia intermedia associated with moyamoya syndrome.

    Science.gov (United States)

    Göksel, Basak Karakurum; Ozdogu, Hakan; Yildirim, Tulin; Oğuzkurt, Levent; Asma, Suheyl

    2010-07-01

    Moyamoya syndrome (MMS) is a progressive disorder. We report a 19-year-old boy with beta-thalassemia who presented with a left hemiparesis. Brain MRI showed old middle cerebral artery and left frontal subcortical white matter infarcts. Brain magnetic resonance angiography and digital subtraction angiography revealed occlusion of the bilateral internal carotid arteries with a rich network of basal collateral vessels. To our knowledge this is the third report of beta-thalassemia intermedia and MMS, and the first report of a patient in Turkey. It emphasizes the potential for cerebral infarct due to anemia, protein S and thrombocytosis.

  3. [Clinical analysis of three cases with beta-thalassemia].

    Science.gov (United States)

    Li, X Y; Liu, M J; Xu, L H; Xu, H G; Chen, H L; Fang, J P

    2018-04-02

    Objective: To study the diagnostic strategy of β-thalassemia through retrospective analysis of 3 cases of β-thalassemia. Methods: Three patients were admitted to the Department of Pediatrics, Sun Yat-sen Memorial Hospital of Sun Yat-sen University from January 2014 to June 2015. The clinical manifestations, hemoglobin electrophoresis and gene detection of these patients and their parents were analyzed, diagnostic ideas and key points were discussed when beta thalassemia gene detection did not explain clinical manifestations or hemoglobin electrophoresis. Results: Case 1, boy, 5 years old, was diagnosed as compound heterozygotes of β41-42 and IVS-Ⅱ-654 with hereditary persistence of fetal hemoglobin(HPFH) according to the clinical manifestations of mild anemia, normal size of liver and spleen, 92.8% fetal hemoglobin (HbF) and gene analysis. Case 2, girl, 3 years old, was confirmed the diagnosis of thalassemia intermedia with β41-42 heterozygote compound and ααα anti3.7 heterozygote in accordance with the manifestations of severe anemia, hepatosplenomegaly, 8.6% HbF, 4.1% hemoglobin A 2 (HbA 2 ) and gene analysis. Case 3, girl, 3 years old, with severe anemia, hepatosplenomegaly, 51.2% HbF and 3.7% HbA 2 , was diagnosed as thalassemia major with compound heterozygotes of PolyA (T→C) and β17 by DNA sequencing. Conclusion: The diagnosis of β-thalassemia should be confirmed by clinical manifestations of hemolytic anemia, hemoglobin electrophoresis, gene diagnosis and family survey.

  4. Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

    OpenAIRE

    Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

    1981-01-01

    Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...

  5. Current and future alternative therapies for beta-thalassemia major

    Directory of Open Access Journals (Sweden)

    Edouard de Dreuzy

    2016-02-01

    Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.

  6. X-ray scattering signatures of {beta}-thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Desouky, Omar S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt); Elshemey, Wael M. [Biophysics Department, Faculty of Science, Cairo University (Egypt)], E-mail: waelelshemey@yahoo.com; Selim, Nabila S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt)

    2009-08-11

    X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm{sup -1}, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; {beta}-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of {beta}-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm{sup -1}, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

  7. Approaches to management of beta-thalassemia intermedia

    Directory of Open Access Journals (Sweden)

    Joseph E. Maakaron

    2013-03-01

    Full Text Available Thalassemia intermedia is a genetically diverse group of diseases that is the result of an imbalance in the production of the alpha and beta chains with ensuing chronic hemolysis, ineffective erythropoiesis, and iron overload.Resulting complications include bone changes, hypercoagulability, and end-organ damage due to iron overload. This decade has witnessed major breakthroughs in the management of thalassemia. In this article, we examine these novelties in therapy including iron chelation therapy, stem cell transplant, and gene therapy.Iron chelation therapy has been revolutionized with the advent of deferasirox, a once-daily oral iron chelator, that has been shown to be safe and efficacious.Gene therapy was also at the core of this revolution with the discovery of novel gene elements and viral vectors allowing for better control and improved outcomes.

  8. Levels of Beta-2 Microglobulin and Cystatin C in Beta Thalassemia Major Patients

    Directory of Open Access Journals (Sweden)

    Ayse Kacar

    2014-03-01

    Full Text Available Aim: Thalassemia is accepted to be the most common genetic disease in the world. This study was performed to establish whether there was a glomerular renal damage, which was usually a less mentioned subject in patients with Beta Thalassemia Major, and to compare urea, creatinine and creatinine clearance with early indicators of kidney damage as Cystatin-C and %u03B2-2 microglobulin as on determining the glomerular damage. Material and Method: This study was prospectively performed in patients, who were regularly followed in the children hematology outpatient clinic with a diagnosis of Beta Thalassemia Major. Results: There was no statistically significant difference between urea and levels of creatinine clearance and Cystatin-C. There was a statistically negative relationship between creatinine and creatinine clearance at an advanced level as 53.7% (p: 0.002, p

  9. Thalassemia

    Science.gov (United States)

    ... Mediterranean (Greek, Italian and Middle Eastern), Asian, or African descent. Diagnosis & Tests How is thalassemia diagnosed? If your doctor thinks you or your child might have thalassemia, he’ll do a physical ...

  10. Thalassemia

    Science.gov (United States)

    Thalassemias are inherited blood disorders. If you have one, your body makes fewer healthy red blood cells ... oxygen to the body. That leads to anemia. Thalassemias occur most often among people of Italian, Greek, ...

  11. Adipocytokine concentrations in children with different types of beta-thalassemia.

    Science.gov (United States)

    Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz

    2014-06-01

    Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

  12. Is beta-thalassemia trait a protective factor against ischemic cerebrovascular accidents?

    Science.gov (United States)

    Karimi, Mehran; Borhani Haghighi, Afshin; Yazdani, Maryam; Raisi, Hamideh; Giti, Rahil; Namazee, Mohammad Reza

    2008-01-01

    In this research, we sought to determine the association between beta-thalassemia trait and ischemic cerebrovascular accident (CVA). In acase-control study, 148 patients with thromboembolic cerebrovascular events were evaluated for the presence of hypertension, diabetes mellitus, hyperlipidemia, and beta-thalassemia trait. A total of 156 age- and sex-matched patients with no cardiac or cerebrovascular diseases, serving as the control group, were also investigated for the above-mentioned risk factors. We found that 6.1% of patients with ischemic CVA and 12.2% of the control group had beta-thalassemia trait (P = .066). In male patients, the negative association between ischemic CVA and presence of beta-thalassemia trait was significant (P = .008). In patients, the prevalence of hypertension was also significantly different between those with and without beta-thalassemia trait (P = .01); those with beta-thalassemia trait had a lower mean blood pressure than those without the trait. beta-Thalassemia trait may have a protective effect against ischemic CVA that might be caused by the lower arterial blood pressure observed in those with this trait.

  13. High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

    Science.gov (United States)

    Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

    2017-12-01

    High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

  14. Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

    Science.gov (United States)

    Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

    2007-05-01

    We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

  15. Renal tubular dysfunction nephrocalcinosis in a patient with BetaThalassemia Minor

    International Nuclear Information System (INIS)

    Prabahar, M.R.; Jain, M.; Chandrasekaran, V.; Indumathi, E.; Soundrarajan, P.

    2008-01-01

    Thalassemia is a hereditary anemia resulting from defect in hemoglobinproduction. Beta thalassemia is due to impaired production. Beta thalassemiais due to impaired production of beta globin chains, leading to a relativeexcess of alpha globin chains. The term beta thalassemia minor is used todescribe heterozygotes, who carry one normal beta globin and one betathalassemic allele. The vast majority of these patients are asymptomatic.However, a variety of renal tubular abnormalities including hypercaliuria,hypomagnesemia with renal magnesium wasting, decreased tubular absorption ofphosphorous, hypouricemia with renal uric acid wasting, renal glycosuria andtubular proteinuria have been described even in patients with betathalassemia minor. We here in report a 24-year old patient who was found tohave thalassemia minor and nephrocalcinosis with evidence of renal tubulardysfunction. Investigations revealed normal renal function, hypercalciuria,reduced tubular reabsorption of phosphorous, hypomagnesemia and renalmagnesium wasting. Screening for aminoaciduria was found to be negative. Anacid loading test revealed normal urinary acidification. Ultrasonogram of theabdomen revealed nephrocalcinosis and splenomegaly. Detailed work up foranemia showed normal white cell and platelet count while peripheral smearshowed microcytic hypochromic anemia with few target cells. Hemoglobinelectrophoresis revealed hemoglobin A of 92%, hemoglobin A2 of 6.2% andhemoglobin F of 1.8% consistent with beta thalassemia minor. Her parentalscreening was normal. A diagnosis of beta thalassemia minor with renaltubular dysfunction was made and the patient was started on thiazidediuretics to reduce hypercalciuria and advised regular follow-up. (author)

  16. COAGULOPATHY IN BETA-THALASSEMIA: CURRENT UNDERSTANDING AND FUTURE PERSPECTIVES

    Directory of Open Access Journals (Sweden)

    M. Domenica Cappellini

    2009-12-01

    Full Text Available As the life expectancy of β-thalassemia patients has markedly improved over the last decade, several new complications are being recognized. The presence of a high incidence of thromboembolic events, mainly in thalassemia intermedia patients, has led to the identification of a hypercoagulable state in thalassemia. In this review, the molecular and cellular mechanisms leading to hypercoagulability in thalassemia are highlighted, and the current clinical experience is summarized. Recommendations for thrombosis prophylaxis are also discussed.

  17. Magnetic measurements on human erythrocytes: Normal, beta thalassemia major, and sickle

    Science.gov (United States)

    Sakhnini, Lama

    2003-05-01

    In this article magnetic measurements were made on human erythrocytes at different hemoglobin states (normal and reduced hemoglobin). Different blood samples: normal, beta thalassemia major, and sickle were studied. Beta thalassemia major and sickle samples were taken from patients receiving lifelong blood transfusion treatment. All samples examined exhibited diamagnetic behavior. Beta thalassemia major and sickle samples showed higher diamagnetic susceptibilities than that for the normal, which was attributed to the increase of membrane to hemoglobin volume ratio of the abnormal cells. Magnetic measurements showed that the erythrocytes in the reduced state showed less diamagnetic response in comparison with erythrocytes in the normal state. Analysis of the paramagnetic component of magnetization curves gave an effective magnetic moment of μeff=7.6 μB per reduced hemoglobin molecule. The same procedure was applied to sickle and beta thalassemia major samples and values for μeff were found to be comparable to that of the normal erythrocytes.

  18. Evaluation of pulmonary function in beta-thalassemia major patients

    International Nuclear Information System (INIS)

    Eidani, I.; Keikhaei, B.; Rahim, F.; Bagheri, A.

    2010-01-01

    Objective: To describe and quantify the functional change of the lung in patients with beta-thalassemia major (TM) and determine the correlation between pulmonary function test (PFT) results with hemoglobin, ferritin and age changes. Methodology: Pulmonary function tests were performed on 60 transfusion-dependent patients with TM, ranging in age from 10 to 45 years. Percent-predicted values for forced expiratory volume in one second (FEV1), and forced expiratory flows (FEF) 25-75% were significantly reduced, whereas forced expiratory vital capacity (FVC) and FEV1/FVC were closed to normal limits, indicating a restrictive disease. All factors including; FVC, FEV1, and FEV1/FVC, FEF 25-75% were negatively correlated with age and ferritin levels. In contrast, all factors including; FVC, FEV1, and FEV1/FVC, FEF 25-75% were positively correlated with hemoglobin (Hb). We performed linear regression analysis to study the simultaneous influence of the presence of age, ferritin, and Hb on obstructive PFT indexes. Results: Pulmonary function test results were normal in only 32 (53.3%) of 60 patients and the rest 28 cases (46.7%) showed abnormal pulmonary function. FEV1 and FEF 25% - 75% have significant negative correlation with age (r = - 0.64 p(r) = 0.003 and r = - 0.58 p(r) = 0.02 respectively), also have significant positive correlation with Hb (r = 0.31 p(r) = 0.015 and r = 0.33 p(r) = 0.01 respectively), and only FEF 25% - 75% has significant negative correlation with ferritin (r -0.26 p(r) = 0.04). Conclusion: The present study has shown that restrictive disease and reduced lung diffusing capacity are the predominant abnormalities of pulmonary function patients with TM. The low hemoglobin concentration and a fall in the diffusing capacity of the alveola - capillary membrane, together with the dependence of the reduced pulmonary diffusing capacity on age and serum ferritin levels, as well as of the entity of restrictive disease on age, suggests that pulmonary

  19. Human parvovirus B19 in patients with beta thalassemia major from Tehran, Iran.

    Science.gov (United States)

    Arabzadeh, Seyed Ali Mohammad; Alizadeh, Farideh; Tavakoli, Ahmad; Mollaei, Hamidreza; Bokharaei-Salim, Farah; Karimi, Gharib; Farahmand, Mohammad; Mortazavi, Helya Sadat; Monavari, Seyed Hamidreza

    2017-03-01

    Due to the tropism of human parvovirus B19 to erythroid progenitor cells, infection in patients with an underlying hemolytic disorder such as beta-thalassemia major leads to suppression of erythrocyte formation, referred to as transient aplasia crisis (TAC), which may be life-threatening. We investigated the prevalence of parvovirus B19 among patients with beta thalassemia major attending the Zafar Adult Thalassemia Clinic in Tehran, Iran. This cross-sectional study was performed to determine the presence of parvovirus B19 DNA in blood samples and parvovirus B19 genotypes in plasma samples of patients with thalassemia major. The population consisted of 150 patients with beta-thalassemia major who attended the Zafar clinic in Tehran. Specimens were studied using a real-time polymerase chain reaction assay. The prevalence of parvovirus B19 in our study population was 4%. Of 150 patients with thalassemia, six (4%) were positive for B19 DNA. There was no significant correlation between blood transfusion frequency and B19 DNA positivity. Finally, phylogenetic analysis of human parvovirus B19 revealed genotype I in these six patients. In this study, acute B19 infections were detected in patients with beta thalassemia major. Screening of such high-risk groups can considerably reduce the incidence and prevalence of B19 infection; thus, screening is required for epidemiologic surveillance and disease-prevention measures.

  20. The effects of beta-carotene and vitamin E on erythrocytes lipid peroxidation in beta-thalassemia patients

    Directory of Open Access Journals (Sweden)

    Soleiman Mahjoub

    2007-12-01

    Full Text Available BACKGROUND: Thalassemia is the most common hereditary disease in the world. Thalassemic erythrocytes are exposed to higher oxidative stress and lipid peroxidation. The aim of this study was to investigate the effects of beta-carotene and vitamin E on erythrocytes lipid peroxidation in beta-thalassemia patients.
    METHODS: A prospective double-blind, placebo-controlled study of the effect of beta-carotene and vitamin E on lipid peroxidation in erythrocytes membranes was performed on 120 beta-thalassemia major patients in four groups. The patients were supplemented for 4 weeks as follows: group 1 with beta-carotene (13 mg/day, group 2 with vitamin E (550 mg/day, group 3 with beta-carotene plus vitamin E and group 4 with placebo. We prepared all capsules for 4 roups in the same shape and color. Measurements of serum beta-carotene and vitamin E were performed by high performance
    liquid chromatography. After preparation of ghost cells from blood specimens, malondialdehyde (MDA was determined as index of lipid peroxidation in erythrocytes membranes before and after treatment. RESULTS: The levels of serum beta-carotene and vitamin E were significantly lower and MDA concentrations in erythrocytes membranes were significantly higher in beta-thalassemia patients compared to controls (P<0.001. In groups that treated with vitamin supplements for 4-weeks, lipid peroxidation rates were significantly reduced after treatment (P<0.001, but in placebo group there was not significant difference (P>0.05.
    CONCLUSIONS: Our findings provide evidence that an oral treatment with beta-carotene and vitamin E can significantly reduce lipid peroxidation of erythrocytes membranes and could be useful in management of beta-thalassemia major patients. KEYWORDS: Beta-thalassemia major, beta-carotene, vitamin E, malondialdehyde, lipid peroxidation.

  1. Extramedullary hematopoiesis and paraplegia in a patient with hemoglobin e-Beta thalassemia.

    Science.gov (United States)

    Alam, M R; Habib, M S; Dhakal, G P; Khan, M R; Rahim, M A; Chowdhury, A J; Mahmud, T K

    2010-07-01

    Extramedullary hematopoiesis (EMH) occurs in patients with various hematologic disorders involving a chronic increase in the production of red blood cells, and is often associated polycythemia vera and sickle cell anaemia, but is less common with thalassemia especially with hemoglobin E-beta thalassemia. Spinal cord compression due to EMH is a extremely rare complication of thalassemia and may present with paraparesis or paraplegia with or without sensory impairment. Treatment options mostly include surgery and/or radiotherapy. Whereas cases presenting with paraplegia have been treated with either surgery or radiotherapy with equal frequency and efficacy, almost all reported cases with paraplegia have been treated with surgery with or without radiation therapy. We hereby report a case of hemoglobin E-beta thalassemia with paraplegia treated successfully with radiotherapy.

  2. Extraosseous radiotracer uptake on bone scan in beta-thalassemia: report of one case

    International Nuclear Information System (INIS)

    Guezguez, M.; Nouira, M.; Sfar, R.; Chatti, K.; Ben Fradj, M.; Ben Ali, K.; Ajmi, S.; Essabbah, H.; Zrour, S.

    2009-01-01

    Red blood cell transfusion, main therapeutic modality of beta-thalassemia, leads to iron overload which may perturb several metabolic ways. The aim of this paper is to illustrate the uptake abnormalities observed on bone scan of thalassaemic patients and to discuss mechanisms of extraosseous accumulation of the radiopharmaceutical in this pathology. We report a 16-year-old child suffering from beta-thalassemia major undergoing transfusion therapy. A bone scan was indicated to look for osseous infection. This study revealed a little skeletal uptake and abnormal liver, splenic and renal accumulation. A repeat bone scan, performed three weeks later showed a better skeletal uptake which enabled the discovery of focal abnormalities and made the diagnostic easier. The effect of iron overload on radiopharmaceuticals uptake in bone scan is known since 1975. Dissociation of 99m Tc from the carrier ligand due to the presence of iron excess seems the most plausible hypothesis. Free 99m Tc can be bound to other tissular substrates which can explain extraosseous uptake. The normally available pool for bone is reduced and then the skeletal uptake decreased. This report limits considerably the sensitivity of the bone scan. A well-led iron chelation and eventually the use of diuretic drug may guarantee a better quality of bone scan images. (authors)

  3. Seroprevalence of parvovirus B19 infection in patients with beta thalassemia major in Fayoum University Hospital

    Directory of Open Access Journals (Sweden)

    Mohamed E. Al Ghwass

    2016-09-01

    Conclusion: Parvovirus B19 infection is detected in high rates among children with beta thalassemia major. Measures to avoid iatrogenic and nosocomial transmission have to be implemented including screening of donated blood for B19 especially blood given to patients with hematological disorders. Also data from this study support the need for introduction of an approved B19 vaccine that primarily protects children with thalassemia major against that infection.

  4. Some endocrinal aspects of pancreas in beta thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Badder, M A; Megahed, Y M; Gafer, M; Abdel Kariem, M M [Pediatric dept., faculty of medicine, Zagazig university and Middle eastern regional Radioisotope Center for The Arab Countries, (Egypt)

    1995-10-01

    The study was carried out to evaluate endocrinal aspects of the pancreas in thalassemia children, ages 5 - 10 years maintained under either regular or irregular iron chelation therapy. A matched control on healthy children, was included for comparison. As regards laboratory findings, fasting and post prandial blood sugar was significantly elevated in thalassemia children than the control and serum insulin was significantly lower in the irregular iron chelation group than both in the regular one and in the control group. Most cases of diabetic thalassemia children clinically and biochemically were of irregular iron chelation and with older age. They were frequently higher transfused. There is significant rise of serum ferritin in diabetic group than in diabetic thalassemia children. In conclusion, pancreatic dysfunction can be detected in thalassemia children, but regular iron chelation can reduce its occurrence. 10 tabs.

  5. Some endocrinal aspects of pancreas in beta thalassemia

    International Nuclear Information System (INIS)

    Badder, M.A.; Megahed, Y.M.; Gafer, M.; Abdel Kariem, M.M.

    1995-01-01

    The study was carried out to evaluate endocrinal aspects of the pancreas in thalassemia children, ages 5 - 10 years maintained under either regular or irregular iron chelation therapy. A matched control on healthy children, was included for comparison. As regards laboratory findings, fasting and post prandial blood sugar was significantly elevated in thalassemia children than the control and serum insulin was significantly lower in the irregular iron chelation group than both in the regular one and in the control group. Most cases of diabetic thalassemia children clinically and biochemically were of irregular iron chelation and with older age. They were frequently higher transfused. There is significant rise of serum ferritin in diabetic group than in diabetic thalassemia children. In conclusion, pancreatic dysfunction can be detected in thalassemia children, but regular iron chelation can reduce its occurrence. 10 tabs

  6. Beta limits for ETF

    International Nuclear Information System (INIS)

    Helton, F.J.; Miller, R.L.

    1982-01-01

    ETF (Engineering Test Facility) one-dimensional transport simulations indicate that a volume-average beta of 4% is required for ignition. It is therefore important that theoretical beta limits, determined by requiring equilibria to be stable to all ideal modes, exceed 4%. This paper documents an ideal MHD analysis wherein it is shown that, with appropriate plasma cross-sectional shape and current profile optimization, operation near 5% is possible. The critical beta value, however, depends on the functional form used for ff', which suggests that higher critical betas could be achieved by directly optimizing the safety factor profile. (author)

  7. Hypoparathyroidism and intracerebral calcification in patients with beta-thalassemia major

    Energy Technology Data Exchange (ETDEWEB)

    Karimi, M. [Iran-Shiraz-Namazee Hospital, Namazee Square, Hematology Research Center, Department of Pediatrics, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: karimim@sums.ac.ir; Rasekhi, A.R. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: rasekhia@sums.ac.ir; Rasekh, M. [Iran-Shiraz-Namazee Hospital, Namazee Square, Department of Endocrinology and Metabolism, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: Rasekhm@sums.ac.ir; Nabavizadeh, S.A. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: nabavia@gmail.com; Assadsangabi, R. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: assadsangabi@yahoo.com; Amirhakimi, G.H. [Iran-Shiraz-Namazee Hospital, Namazee Square, Department of Endocrinology and Metabolism, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: amirhakimig@sums.ac.ir

    2009-06-15

    Background: Hypoparathyroidism is one of the most important endocrine complications of thalassemia major. This study was conducted to evaluate the prevalence of intracerebral calcifications in patients with thalassemia with and without hypoparathyroidism. Methods: 47 beta-thalassemia patients with hypoparathyroidism underwent a brain CT scan to investigate the presence and extent of intracerebral calcification. 30 age- and sex-matched beta-thalassemic patients with normal parathyroid function who had undergone brain CT for headache, or some other minor neurologic problems were also enrolled in the study serving as controls. The amount of intracerebral calcification, hematologic parameters, and some clinical findings were compared between both groups. Results: Intracerebral calcification was present in 54.2% of beta-thalassemia patients with hypoparathyroidism. The most frequent sites of calcification were basal ganglia, and frontoparietal areas of the brain. Thalami, internal capsule, cerebellum and posterior fossa were other less frequently calcified regions of the brain. In contrast, there was no evidence of intracerebral calcifications in the 30 thalassemic patients with normal parathyroid function. There was not a statistically significant difference between serum ferritin concentrations in thalassemia patient with hypoparathyroidism and those with normal parathyroid function (2781 vs. 2178, P > 0.05). Conclusion: Intracranial calcification is a common finding in thalassemia patients with hypoparathyroidism, it can be extensive and involves most regions of the brain.

  8. Hypoparathyroidism and intracerebral calcification in patients with beta-thalassemia major

    International Nuclear Information System (INIS)

    Karimi, M.; Rasekhi, A.R.; Rasekh, M.; Nabavizadeh, S.A.; Assadsangabi, R.; Amirhakimi, G.H.

    2009-01-01

    Background: Hypoparathyroidism is one of the most important endocrine complications of thalassemia major. This study was conducted to evaluate the prevalence of intracerebral calcifications in patients with thalassemia with and without hypoparathyroidism. Methods: 47 beta-thalassemia patients with hypoparathyroidism underwent a brain CT scan to investigate the presence and extent of intracerebral calcification. 30 age- and sex-matched beta-thalassemic patients with normal parathyroid function who had undergone brain CT for headache, or some other minor neurologic problems were also enrolled in the study serving as controls. The amount of intracerebral calcification, hematologic parameters, and some clinical findings were compared between both groups. Results: Intracerebral calcification was present in 54.2% of beta-thalassemia patients with hypoparathyroidism. The most frequent sites of calcification were basal ganglia, and frontoparietal areas of the brain. Thalami, internal capsule, cerebellum and posterior fossa were other less frequently calcified regions of the brain. In contrast, there was no evidence of intracerebral calcifications in the 30 thalassemic patients with normal parathyroid function. There was not a statistically significant difference between serum ferritin concentrations in thalassemia patient with hypoparathyroidism and those with normal parathyroid function (2781 vs. 2178, P > 0.05). Conclusion: Intracranial calcification is a common finding in thalassemia patients with hypoparathyroidism, it can be extensive and involves most regions of the brain.

  9. Spinal cord compression in {beta}-thalassemia: follow-up after radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Fonseca, Silvana Fahel da; Figueiredo, Maria Stella; Cancado, Rodolfo Delfini; Nakadakare, Fernando; Segreto, Roberto; Kerbauy, Jose [Universidade Federal de Sao Paulo (UNIFESP), SP (Brazil). Escola Paulista de Medicina

    1998-12-01

    Spinal cord compression due to extramedullary hematopoiesis is a well-described bu rare syndrome encountered in several hematologic disorders, including {beta}-thalassemia. We report a case of a patient with intermediate {beta}-thalassemia and crural paraparesis due to spinal cord compression by a paravertebral extramedullary mass. She was successfully treated with low-dose radiotherapy and transfusions. After splenectomy, she was regularly followed up for over four years without transfusion or recurrence of spinal cord compression. Extramedullary hematopoiesis should be investigated in patients with hematologic disorders and spinal cord symptoms. The rapid recognition and treatment with radiotherapy can dramatically alleviate symptoms. (author)

  10. Regional consensus opinion for the management of Beta thalassemia major in the Arabian Gulf area

    Science.gov (United States)

    2013-01-01

    Thalassemia syndrome has diverse clinical presentations and a global spread that has far exceeded the classical Mediterranean basin where the mutations arose. The mutations that give rise to either alpha or beta thalassemia are numerous, resulting in a wide spectrum of clinical severity ranging from carrier state to life-threatening, inherited hemolytic anemia that requires regular blood transfusion. Beta thalassemia major constitutes a remarkable challenge to health care providers. The complications arising due to the anemia, transfusional iron overload, as well as other therapy-related complications add to the complexity of this condition. To produce this consensus opinion manuscript, a PubMed search was performed to gather evidence-based original articles, review articles, as well as published work reflecting the experience of physicians and scientists in the Arabian Gulf region in an effort to standardize the management protocol. PMID:24044606

  11. Premarital Screening of Beta Thalassemia Minor in north-east of Iran

    Science.gov (United States)

    Hashemizadeh, H; Noori, R

    2013-01-01

    Background Beta thalassemia is a preventable disease. Iran has about 20,000Patients who are homozygote for β-thalassaemia and 3,750,000 carriers. The aim of this study was to determine the prevalence of beta thalassemia minor among men who underwent premarital screening in Quchana city in Khorasan Razavi region of Iran Materials and Methods This research is a descriptive cross-sectional study. From 2010 to 2011, all participants (1000) under marriage coming to health center of Quchan underwent routine mandatory tests. Participants were considered to have beta-thalassemia minor on the condition that hey had a mean corpuscular volume (MCV) 3.5%. Venous blood was taken into an EDTA tube and the complete blood count and red blood cell indices were measured with a Coulter automated cell counter. Electrophoresis was performed on cellulose acetate. Results Mean and SD of hemoglobin, MCV and MCH were 16±2.9, 91±4 and 28.4±2, respectively. Hemoglobin A2 Higher than 3.5 percent was reported as 3.5%.The prevalence of beta-thassemia minor with high hemoglobin A2 and microcytic hypochromic anemia was 3.5% (P-value). Conclusion In countries with high prevalence of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. Detecting carrier couples with premarital screening program is an effective way of controlling thalassemia major. PMID:24575266

  12. Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

    OpenAIRE

    Selma Ünal; Günay Balta; Fatma Gümrük

    2014-01-01

    Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...

  13. Prevalence of Beta-Thalassemia in premarital screening in Al-Hassa, Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Suliman, A.

    2006-01-01

    The Al-Hassa area is one of the regions in Saudi Arabia where hemoglobinopathies are prevalent. The Saudi Ministry of Health designed a protocol for premarital testing after the royal decree in December 2003. The protocol was implemented in a February 2004 order. The aim of this study was to determine the prevalence of beta-thalassemia trait among subjects coming for premarital screening in the Al-Hassa area. From February 2004 to November 2004, healthy subjects coming to six marriages consultation centers in the Al-Hassa area underwent routine mandatory tests. Subjects were considered to have beta-thalassemia trait if they had a mean corpuscular volume (MCV), 80 fL and/or a mean corpuscular hemoglobin (MCH) 3.2%. Venous blood was taken into ETDA tube and the complete blood count and red blood cell indices were measured by a Coulter automated cell counter on the same day of hemoglobin collection. Electrophoresis was done on cellulose acetate. All Saudi participants (n=8918), including 4218 (47.3%) males and 4700 (52.7%) females were screened. The prevalence of beta-thalassemia trait with high hemoglobin A2 and microcytic hypochromic anemia was 3.4% (307/8918). In countries with a high prelevance of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. With a 3.4% prevalence of beta-thalassemia trait in premarital couples, future comprehensive programs are needed to know the actual prevalence of beta-thalassemia in Al-Hassa. (author)

  14. Determination of the spectrum of beta-thalassemia genes in Spain by use of dot-blot analysis of amplified beta-globin DNA.

    OpenAIRE

    Amselem, S; Nunes, V; Vidaud, M; Estivill, X; Wong, C; d'Auriol, L; Vidaud, D; Galibert, F; Baiget, M; Goossens, M

    1988-01-01

    We have delineated the molecular lesions causing beta-thalassemia in Spain, a country that has witnessed the passage of different Mediterranean populations over the centuries, in order to evaluate the extent of heterogeneity of these mutations and to make possible simplified prenatal diagnosis of the disorder in that country. The use of the polymerase chain-reaction (PCR) technique to preferentially amplify beta-globin DNA sequences that contain the most frequent beta-thalassemia mutations in...

  15. Blood transfusion versus hydroxyurea in beta-thalassemia in Iran: a cost-effectiveness study.

    Science.gov (United States)

    Ravangard, Ramin; Mirzaei, Zahra; Keshavarz, Khosro; Haghpanah, Sezaneh; Karimi, Mehran

    2017-11-21

    Thalassemia intermedia is a type of anemia which has several treatments modalities. We aimed to study the cost effectiveness of two treatments, including blood transfusion and hydroxyurea, in patients with beta-thalassemia intermedia in south of Iran referred to a referral center affiliated to Iran, Shiraz University of Medical Sciences in 2015. This was a cost-effectiveness study which was conducted on 122 patients with beta-thalassemia intermedia. The indicator of effectiveness in this study was the reduction of growth disorder (normal BMI). Data analysis was done using SPSS 21, Excel 2010 and Treeage 2011. Finally, the one-way sensitivity analysis was performed to determine the robustness of the results. The average annual costs of blood transfusion and the use of hydroxyurea in 2015 were 20733.27 purchasing power parity (PPP)$ and 7040.29 PPP$, respectively. The effectiveness of blood transfusion was57.4% while in hydroxyurea group was 60.7%. The results showed that the cost effectiveness of using hydroxyurea was more than that of blood transfusion. Therefore, it is recommended that the use of hydroxyurea in the treatment of patients with beta-thalassemia intermedia would become the first priority, and more basic and supplementary insurance coverage for treating such patients using hydroxyurea should be considered.

  16. [Beta thalassemia major and pregnancy during adolescence: report of two cases].

    Science.gov (United States)

    Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura

    2015-06-01

    Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

  17. Nitroblue tetrazolium test in patients with beta-thalassemia major

    International Nuclear Information System (INIS)

    Ghaffari, J.; Vahidshahi, K.; Kosaryan, M.; Karami, H.; Mahdavi, M.; Parvinnejad, N.

    2008-01-01

    Objective to assess the neutrophil function in thalassemia major (TM)patients and compare it with the control group and to recognize its relevantfactors. This was a retrospective cohort study, which was carried out fromOctober 2007 to February 2008 in the Thalassemia research Center in Boo AliSina Hospital in Sari, Mazandaran, North of Iran. The study populationconsisted of TM patients in Boo Ali Sina Teaching Hospital. The method ofsampling in the case group was systematic and it was target based in thecontrol group. The sample size determined was based on previous studies.Thalassemia major was diagnosed based on hemoglobin electrophoresis (casegroup). The control group was their brothers and sisters, who had +-5 yearsof age difference and were of the same gender as the patients. Datacollection was based on interview, investigating demographic characteristicsand also obtaining medical information from medical records of the patients.The neutrophil function was by performing nitroblue tetrazolium (NBT)reduction test. The test was carried out on both groups and the data wereanalyzed by software using SPSS version 13.0. In this study, 39 patients and39 healthy controls were compared. The average age of the patients was21.6+-5.3 years and it was 22.4+-5.1 years in healthy controls (p=0.7). Therewas a significant correlation between the test's results and the patients age(p=0.008). The rate of impaired NBT results in the patients was 36%, while itwas 10% in controls, which were significantly different. The neutrophilactivity based on NBT test was 89.9+-11.6% in the case group and 93.7+-2.51%in the control group (p=0.025). This study indicates that neutrophil activityin thalassemia patients was significantly lower, compared to the normalcontrol group, especially in young patients. Based on the results, evaluationof neutrophil function and pyogenic infections in TM patients seemsnecessary. (author)

  18. Identification of novel microsatellite markers preimplantation genetic diagnosis of beta-thalassemia.

    Science.gov (United States)

    Chen, Min; Tan, Arnold S C; Cheah, Felicia S H; Saw, Eugene E L; Chong, Samuel S

    2015-12-01

    Beta (β)-thalassemia is one of the most common monogenic diseases worldwide. Affected pregnancies can be avoided through preimplantation genetic diagnosis (PGD), which commonly involves customized assays to detect the different combinations of β-globin (HBB) gene mutations present in couples, in conjunction with linkage analysis of flanking microsatellite markers. Currently, the limited number of reported closely linked markers hampers their utility in indirect linkage-based PGD for this disorder. To increase the available markers closely flanking the HBB gene, an in silico search was performed to identify all markers within 1 Mb flanking the HBB gene. Fifteen markers with potentially high polymorphism information content (PIC) and heterozygosity values were selected and optimized into a single-tube pentadecaplex PCR panel. Allele frequencies and polymorphism and heterozygosity indices of each marker were assessed in five populations. A total of 238 alleles were observed from the 15 markers. PIC was >0.7 for all markers, with expected heterozygosity and observed heterozygosity values ranging from 0.74 to 0.90 and 0.72 to 0.88, respectively. Greater than 99% of individuals were heterozygous for at least seven markers, with at least two heterozygous markers on either side of the HBB gene. The pentadecaplex marker assay also performed reliably on single cells either directly or after whole genome amplification, thus validating its use in standalone linkage-based β-thalassemia PGD or in conjunction with HBB mutation detection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A Comparison of Quality of Life between Adolescences with Beta Thalassemia Major and their Healthy Peers

    Directory of Open Access Journals (Sweden)

    Shahram Baraz

    2016-01-01

    Full Text Available Background The chronic genetic blood disorder, thalassemia, affects Quality of life (QOL negatively. Regarding this, if adolescences with thalassemia are treated well, they will grow into an adult who will have a good potential for participating in society. Objectives: to determine the strongest predictor of QOL, compare QOL between the adolescents with beta-type major and their peers in Abadan city. Materials and Methods This was a cross-sectional study; the population consisted of 65 beta thalassemia major patients and 65  healthy peers with the same ages as the witness group. The data collection tools included SF-36 questionnaire and a questionnaire for demographic information. Data analysis was performed using independent t-test, correlation and linear regression by SPSS-16. Results The results of the study revealed that there is a significant difference (P < 0.05 in the average quality of life between the two groups of the study. On the other hand, the results showed that there was a meaningful relation between different aspects of life quality and family history of thalassemia            (P< 0.05. Also, there was a negative correlation between quality of life and the frequency of blood transfusion per year (P< 0.05. Conclusion Adolescences with beta thalassemia major do not have a desirable quality of life, therefore, this fact shows the necessity of serious reforming in various fields of health care, treatment, family, social and financial support, and rehabilitation that need more attention from health care policymakers.

  20. Sickle Cell Beta-Plus Thalassemia with Subcapsular Hematoma of the Spleen

    Directory of Open Access Journals (Sweden)

    Suyash Dahal

    2017-01-01

    Full Text Available While splenic complications like hypersplenism, sequestration crisis, and infarction are commonly reported in sickle cell variants like sickle cell beta-plus thalassemia, splenic rupture with hematoma is rare. We present a case of a 32-year-old young male who presented with dull left upper quadrant pain who was found to have multiple subcapsular splenic lacerations and hematoma on abdominal imaging. Hemoglobin electrophoresis confirmed sickle cell beta-plus thalassemia in the patient. There was no history of trauma, and rest of the workup for possible cause of spontaneous rupture of spleen was negative. With the patient refusing splenectomy, he was managed conservatively. Clinicians need to be aware of this rare complication of sickle cell variants.

  1. Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

    Science.gov (United States)

    Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

    1997-05-01

    The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

  2. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    Science.gov (United States)

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  3. Hemoglobin Interlaken in combination with beta thalassemia trait

    Directory of Open Access Journals (Sweden)

    Mara J. Ojeda

    2013-01-01

    Full Text Available We report a rare a1 globin gene variant (Hb Interlaken found in a 63-year-old woman of Italian ancestry living in Buenos Aires Province, Argentina. The variant, a missense mutation at cd15 (GGT → GAT causing a Gly →Asp amino acid substitution and also known as Hb J Oxford, was found in combination with the common thalassemia trait cd 39 (C→T. The clinical picture of the patient was that of a b-thalassemia trait. 我们曾报道在阿根廷布宜诺斯艾利斯一名63岁意大利血统的妇女体内发现罕有的1珠蛋白基因(因特拉肯血红蛋白)变体。研究发现该变体是导致Gly → Asp氨基酸置的错义突变,也称为Hb J Oxford,与常见的地中海贫血性症cd 39 (C → T)有关。该患者临床症状与乙型地中海贫血特征相同。

  4. One-step genetic correction of hemoglobin E/beta-thalassemia patient-derived iPSCs by the CRISPR/Cas9 system.

    Science.gov (United States)

    Wattanapanitch, Methichit; Damkham, Nattaya; Potirat, Ponthip; Trakarnsanga, Kongtana; Janan, Montira; U-Pratya, Yaowalak; Kheolamai, Pakpoom; Klincumhom, Nuttha; Issaragrisil, Surapol

    2018-02-26

    Thalassemia is the most common genetic disease worldwide; those with severe disease require lifelong blood transfusion and iron chelation therapy. The definitive cure for thalassemia is allogeneic hematopoietic stem cell transplantation, which is limited due to lack of HLA-matched donors and the risk of post-transplant complications. Induced pluripotent stem cell (iPSC) technology offers prospects for autologous cell-based therapy which could avoid the immunological problems. We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia. We used the CRISPR/Cas9 system to target the hemoglobin E mutation from one allele of the HBB gene by homology-directed repair with a single-stranded DNA oligonucleotide template. DNA sequences of the corrected iPSCs were validated by Sanger sequencing. The corrected clones were differentiated into hematopoietic progenitor and erythroid cells to confirm their multilineage differentiation potential and hemoglobin expression. The hemoglobin E mutation of HbE/β-thalassemia iPSCs was seamlessly corrected by the CRISPR/Cas9 system. The corrected clones were differentiated into hematopoietic progenitor cells under feeder-free and OP9 coculture systems. These progenitor cells were further expanded in erythroid liquid culture system and developed into erythroid cells that expressed mature HBB gene and HBB protein. Our study provides a strategy to correct hemoglobin E mutation in one step and these corrected iPSCs can be differentiated into hematopoietic stem cells to be used for autologous transplantation in patients with HbE/β-thalassemia in the future.

  5. [Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

    Science.gov (United States)

    Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

    2002-08-01

    To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV /=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were

  6. Spinal cord compression due to extramedullary hematopoiesis in beta-thalassemia intermedia

    International Nuclear Information System (INIS)

    Munn, Rita K.; Kramer, Carol A.; Arnold, Susanne M.

    1998-01-01

    Background: Extramedullary hematopoiesis (EMH) occurs in many disorders, including thalassemias and other hemoglobinopathies, and commonly presents in the spleen and liver. We present a case of spinal cord compression in a patient with beta-thalassemia intermedia, and review the literature and available treatment options. Patient and Methods: A 35-year-old black female with beta-thalassemia intermedia presented with a 3-week history of back pain and lower extremity weakness. Neurologic examination was consistent with spinal cord compression, and gadolinium enhanced magnetic resonance imaging (MRI) confirmed this diagnosis. She was given intravenous steroids and radiotherapy was begun in 200 cGy fractions to a total dose of 2000 cGy. Results: At the completion of radiotherapy the patient was ambulatory with mild residual weakness. MRI scans 16 months later showed smaller, but persistent masses, and she remains asymptomatic 5 years from her diagnosis. Conclusion: Recognition of spinal cord EMH requires prompt physical examination and MRI for accurate diagnosis. EMH can be managed with radiation, surgery, transfusions, or a combination of these therapies. Radiation in conservative doses of (750-3500 cGy) is non-invasive, avoids the surgical risks of potentially severe hemorrhage and incomplete resection, and has a high complete remission rate in the majority of patients. Relapse rates are moderate (37.5%), but retreatment provides excellent chance for second remission

  7. Frequency of hepatitis B and hepatitis C in multi - transfused beta thalassemia major patients

    International Nuclear Information System (INIS)

    Iqbal, M.M.; Hassan, S.; Aziz, S.

    2010-01-01

    To determine the frequency of hepatitis B and C virus infection among children with beta thalassemia major registered at Military Hospital Rawalpindi. Children attending Thalassemia Centre Military Hospital Rawalpindi for regular blood transfusion were registered. They belonged to different ethnic groups and came from different parts of the country. Their demographic data was recorded, detailed history taken and physical examination was carried out. Their serum samples were tested for hepatitis B surface antigen and anti HCV antibody assay with third generation commercial ELISA method. During the study; 141 patients of beta thalassemia major were screened. Out of them 50 patients (35.5% ,95% confidence interval 27.8-43.5)w ere found hepatitis C virus antibody positive and 1 patient (0.7 %) hepatitis B surface antigen positive. One patient (0.7%) had both hepatitis B and C virus infection. Mean age of hepatitis C infected patients was 10.4+3.85y ears (range 2-16 years). Mean age of uninfected patients was 6.1 + 3.59 years. (p value 0.000) In addition, the results indicate that higher prevalence of anti-HCV was significantly associated with longer duration of transfusion (p value <0.003). In spite of the fact that screened blood is used for transfusions, still a large number of patients have been found infected with hepatitis C. Therefore more accurate techniques are required for screening of blood to prevent transfusion associated transmission. (author)

  8. Targeted correction of a thalassemia-associated beta-globin mutation induced by pseudo-complementary peptide nucleic acids

    DEFF Research Database (Denmark)

    Lonkar, Pallavi; Kim, Ki-Hyun; Kuan, Jean Y

    2009-01-01

    Beta-thalassemia is a genetic disorder caused by mutations in the beta-globin gene. Triplex-forming oligonucleotides and triplex-forming peptide nucleic acids (PNAs) have been shown to stimulate recombination in mammalian cells via site-specific binding and creation of altered helical structures...

  9. Assessing the potential success of cystic fibrosis carrier screening: lessons learned from Tay-Sachs disease and beta-thalassemia.

    Science.gov (United States)

    Laberge, A-M; Watts, C; Porter, K; Burke, W

    2010-01-01

    The objective of this study was to identify factors involved in the success of 2 well-established population-based carrier screening programs - Tay-Sachs disease (TSD) in Ashkenazi Jews and beta-thalassemia in Sardinia and Cyprus - and to assess the potential for success of a population-based cystic fibrosis (CF) carrier screening strategy using these factors. We performed a literature review and key informant interviews. Factors involved in the success of TSD and beta-thalassemia carrier screening programs include disease characteristics (well-defined population at risk, severe disease with predictable course, availability of effective treatment), test characteristics (high sensitivity, straightforward interpretation of results), and community characteristics (involvement of community, support of families and advocacy groups, consensus in favor of avoiding affected births). Current CF screening strategies include few of the factors listed above. Unlike TSD and beta-thalassemia, the purpose of current CF carrier screening strategies is informed reproductive decision-making, without an explicit goal of reducing disease incidence. When compared to TSD and beta-thalassemia, CF is a less favorable candidate for population-based carrier screening. Because of its different purpose, CF carrier screening will require different measures of success than those used for TSD and beta-thalassemia carrier screening, and a consensus on the value or success of CF carrier screening may be difficult to achieve.

  10. Infusion of Autologous Retrodifferentiated Stem Cells into Patients with Beta-Thalassemia

    Directory of Open Access Journals (Sweden)

    Ilham Saleh Abuljadayel

    2006-01-01

    Full Text Available Beta-thalassemia is a genetic, red blood cell disorder affecting the beta-globin chain of the adult hemoglobin gene. This results in excess accumulation of unpaired alpha-chain gene products leading to reduced red blood cell life span and the development of severe anemia. Current treatment of this disease involves regular blood transfusion and adjunct chelation therapy to lower blood transfusion–induced iron overload. Fetal hemoglobin switching agents have been proposed to treat genetic blood disorders, such as sickle cell anemia and beta-thalassemia, in an effort to compensate for the dysfunctional form of the beta-globin chain in adult hemoglobin. The rationale behind this approach is to pair the excess normal alpha-globin chain with the alternative fetal gamma-chain to promote red blood cell survival and ameliorate the anemia. Reprogramming of differentiation in intact, mature, adult white blood cells in response to inclusion of monoclonal antibody CR3/43 has been described. This form of retrograde development has been termed “retrodifferentiation”, with the ability to re-express a variety of stem cell markers in a heterogeneous population of white blood cells. This form of reprogramming, or reontogeny, to a more pluripotent stem cell state ought to recapitulate early hematopoiesis and facilitate expression of a fetal and/or adult program of hemoglobin synthesis or regeneration on infusion and subsequent redifferentiation. Herein, the outcome of infusion of autologous retrodifferentiated stem cells (RSC into 21 patients with beta-thalassemia is described. Over 6 months, Infusion of 3-h autologous RSC subjected to hematopoietic-conducive conditions into patients with beta-thalassemia reduced mean blood transfusion requirement, increased mean fetal hemoglobin synthesis, and significantly lowered mean serum ferritin. This was always accompanied by an increase in mean corpuscular volume (MCV, mean corpuscular hemoglobin (MCH, and mean

  11. beta-Thalassemia present in cis to a new beta-chain structural variant, Hb Vicksburg [beta 75 (E19)Leu leads to 0].

    Science.gov (United States)

    Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R

    1981-01-01

    Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation.

  12. Shortened of the crown and root lengths of the mandibular permanent molar in beta major thalassemia children

    Directory of Open Access Journals (Sweden)

    Indra Primathena

    2011-07-01

    Full Text Available Beta major thalassemia is a genetically inherited blood disorder due to a genetic mutation on the polypeptide chains of hemoglobin which is manifested in the growth and development of the tooth. The objectives of the investigation were to obtain differences of the crown and root lengths of the mandibular first right side permanent molar between beta major thalassemia children and normal children group at the matching ages of 11 to 13 years old. The descriptive comparative method was used in the study and samples were selected using the purposive sampling technique. Sample numbers, which were obtained using the consecutive sampling technique, consists of 12 children of beta major thalassemia and 12 of normal children at the matching ages of 11 to 13 years. Periapical radiographs of both thalassemia and normal children were administered using the method of Seow and Lai. Data were analyzed using t-test method. The study revealed that the crown and root lengths of the mandibular first right side permanent molar of beta major thalassemia children were shorter than normal children at the ages of 11 to 13 years.

  13. The survival analysis of beta thalassemia major patients in South East of Iran

    International Nuclear Information System (INIS)

    Roudbari, M.; Soltani-Rad, M.; Roudbari, S.

    2008-01-01

    The objective was to determine the survival of beta-thalassemia major patients with transfusion, and its related factors in Southeast of Iran. This cross-sectional study was performed in Zahedan, Iran in 2007. The sample included patients who were referred from all over the Zahedan Thalassemia Center from 1998 to 2006. The data were collected using the patient's records, which were recorded by the staff during transfusion. The data included demographic and medical information blood group, blood RH, the kind of transfused blood [KTB], annual number of transfusions [ANOT], accompanied disease [AD], Hemoglobin [Hb] and ferritin level. For data analysis, the Kaplan-Meyer method, and Long Rank test together with Cox Regression were used. Forty-six of 578 patients died and 99% survived for the first year. The ages survival proportions were 5 (97.9%), 10 (97%), 15 (92.1%), and 20 (81.2%) years. The survival time showed significant relationships with the ANOT p=0.0053, KTB p=0.003, Hb=0.002 and ferritin level p=0.0087, and AD p=0.00. Using regular transfusion, paying attention to screening of transfused blood, increasing the families knowledge on the disease to prevent the bearing of thalassemia fetus, are recommended; finally, the detection and treating of the AD, are of great importance to extend the lifetime of the patients. (author)

  14. Q Sepharose micro-column chromatography: A simple screening method for identifying beta thalassemia traits and hemoglobin E carriers.

    Science.gov (United States)

    Wong, Peerapon; Sritippayawan, Suchila; Suwannakhon, Narutchala; Tapprom, Akamon; Deoisares, Rawisut; Sanguansermsri, Torpong

    2016-11-01

    For beta thalassemia control program in pregnancy, mass screening of the carrier state by determination of the hemoglobin (Hb) A 2 and Hb E proportions and mutation analysis is a preferred method for making prenatal diagnoses. Q Sepharose micro-column chromatography, developed for the determination of Hb A 2 and Hb E for screening purposes, was compared with high performance liquid chromatography (HPLC) to ascertain its relative accuracy and reliability. Results using Q Sepharose micro-column chromatography in 350 blood specimens, including 50 samples genetically proven to be beta thalassemia heterozygotes, were compared to HPLC for validation. An additional study was conducted to test a clinical application on a large-scale survey for beta thalassemia in 1581 pregnant women and their spouses. The mean (±SD) Hb A 2 proportions in the normal and genetically proven beta thalassemia heterozygotes were 2.70±0.40% and 6.30±1.23%, respectively, as determined by Q-Sepharose micro-column chromatography, and 2.65±0.31% and 5.37±0.96%, respectively, as determined by HPLC. The mean Hb E proportions in the Hb E heterozygotes were 23.25±4.13% and 24.72±3.5% as determined by Q Sepharose micro-column chromatography and HPLC, respectively. In the large-scale survey for beta thalassemia, 23 at risk couples were detected. Seven affected fetuses were identified by prenatal diagnosis. Q Sepharose micro-column chromatography was found to be reliable, reproducible and well-suited for large-scale surveys. Additionally, by being reusable and convenient, this simple and economical chromatography method may be an alternative means to screen for beta thalassemia and Hb E carriers in the mass population. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  15. A cross-sectional study of metabolic and endocrine complications in beta-thalassemia major

    International Nuclear Information System (INIS)

    Najafipour, F.; Aliasgarzadeh, A.; Aghamohamadzadeh, N.; Bahrami, A.; Mobasri, M.; Niafar, M.; Khoshbaten, M.

    2008-01-01

    Iron overload is a major problem in patients with beta-thalassemia major, and it has many structural and metabolic consequences. The aim of this study was evaluation of endocrine disturbances in patients with beta-thalassemia major who were older than 10 years of age. In this cross-sectional study, investigator collected demographic data and medical histories, as well as menstrual history in females, from the medical records of 56 patients with beta-thalassemia major. Patients were examined to determine their pubertal status and the standard deviation score for height for evaluation of short stature. For evaluation of glucose tolerance, a fasting blood glucose and oral glucose tolerance tests were performed. Evidence for diabetes mellitus was based on American Diabetes Association and World Health Organization criteria. Serum levels of calcium, phosphorous, thyroid-stimulating hormone, free thyroxin, luteinizing hormone and follicular-stimulating hormone and estradiol in girls and testosterone in boys were measured. The mean and standard deviation for age in the 56 patients (36 males and 20 females) was 15.62+-4.44 years. Diabetes mellitus was present in 5 patients (8.9%), impaired fasting glucose was found in 16 patients (28.6%) and an impaired glucose tolerance test was found in 4 patients (7.1%). Short stature (standard deviation score <-2) was seen in 25 (70%) boys and 14 (73%) girls. Impaired puberty was found in 40 patients (71%). Hypocalcaemia and primary overt hyperthyroidism were present in 23 (41%) and 9 patients (16%), respectively. Only eight patients (14.3%) had no endocrine abnormalities. Despite therapy with deferoxamine to treat iron overload, the risk of secondary endocrine dysfunction remained high. Hypogonadism was one of the most frequent endocrine complications. Impaired glucose tolerance, short stature, hypocalcemia, subclinical and overt hypothyroidism are also frequent. (author)

  16. Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.

    Science.gov (United States)

    Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S

    1999-09-01

    Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.

  17. [Molecular characterization of heterozygous beta-thalassemia in Lanzarote, Spain].

    Science.gov (United States)

    Calvo-Villas, José Manuel; de la Iglesia Iñigo, Silvia; Ropero Gradilla, Paloma; Zapata Ramos, María Francisca; Cuesta Tovar, Jorge; Sicilia Guillén, Francisco

    2008-04-05

    The aim of this study was to determine the molecular defects of heterozygous beta thalassaemia and to ascertain their distribution in Lanzarote. Molecular characterization was achieved by real time polymerase chain reaction (RT-PCR LightCycler, Roche), PCR-ARMS (PCR-amplification reaction mutations system) and DNA sequencing on an automated DNA sequencer. Two hundred forty-three heterozygous beta thalassaemia carriers were included between July 1991 and February 2007. RT-PCR detected the molecular defect in 81% of the beta thalassaemia chromosomes analyzed [113 codon CD 39 (C --> T); 41 IVS-1-nt-110 (G --> A), 25 IVS 1-nt-1 (G --> A) and 19 IVS 1-nt-6 (T --> C)]. The remaining 12 molecular defects included the deletion 619 bp (7.8%) and the mutations -28 (A --> G), IVS1-nt-2 (T --> G), CD 41/42 (-TTCT), CD 8/9 (+G), CD 51 (-C), CD 22 (G --> T) and CD 24 (T --> A), CD 67 (-TG) and the novel mutation CD 20/21-TGGA. The distribution of the mutations is similar to that found in the Mediterranean area. The increasing migratory flow received in the Canary Islands may explain the emergence of new mutations not reported before in our area.

  18. Endocrinopathies in Turkish children with Beta thalassemia major: results from a single center study.

    Science.gov (United States)

    Isik, Pamir; Yarali, Nese; Tavil, Betül; Demirel, Fatma; Karacam, Gülşah Bayram; Sac, Rukiye Unsal; Fettah, Ali; Ozkasap, Serdar; Kara, Abdurrahman; Tunc, Bahattin

    2014-10-01

    The endocrinological complications in β-thalassemia major patients do affect the life quality to a large extend. In this study, the endocrinological complications of 47 β-thalassemia patients, who have been followed-up at our hospital's pediatric hematology department, were evaluated. Out of β-thalassemia major cases included to this study, the 55.3% was male and 44.7% was female. The patients' mean levels of ferritin, whose mean age was 10.0 ± 4.5 years (2-20 years), were 2497 ± 1469 ng/mL (472-8558 ng/mL). At least one endocrinological pathology in 27 out of 47 (57.4%) and more than one endocrinological pathology in 14 out of 47 (29.7%) thalassemia patients were observed. The most frequently observed complication in followed-up cases was vitamin D insufficiency and deficiency (78.2%). The other complications in decreasing order were pubertal failure (41.6%), growth retardation (25.5%), decreased bone-mineral density (22.2%), secondary hyperparathyroidism (11.5%), overt hypothyroidism (4.25%), subclinical hypothyroidism (2.12%), and impaired glucose tolerance (2.12%). There was no statistically significant difference between serum mean ferritin level and endocrin complications (P > .05). Four patients (8.5%) had decreased signal intensity in pituitary magnetic resonance imaging (MRI) but this finding was not associated with ferritin levels (P = .87). MRI parameters were similar between patients with and without gonadal dysfunction. Mean height of the pituitary gland was 4.98 ± 1.1 mm (3-9 mm) and this was similar to those normal values in the literature. Ferritin levels were not correlated with pituitary height (P > .05). Beta thalassemia major, having the potential of leading to multisystemic complications, is a chronic disease that should be treated and followed-up by a multidisciplinary approach. Due to frequently encountered endocrinological complications, beta thalassemic patients should be followed-up regularly by hematology and endocrinology

  19. Chorionic villus sampling for beta-thalassemia: the first report of experience in Iran.

    Science.gov (United States)

    Akhlaghpoor, Shahram

    2006-12-01

    Beta-thalassemia is one of the most common hereditary disorders in Iran. The prenatal diagnosis of beta-thalassemia is part of a control program in our country and it began 13 years ago. During the past 8 years the number of procedures has increased significantly as also the legal abortions. This is the first report made on the CVS program in Iran. One thousand six hundred and sixty-one cases of transabdominal Chorionic Villus Sampling (CVS) have been retrospectively evaluated. Among them 1381 cases had inclusion criteria. CVS results, complications and fetal loss rate were evaluated. The distributions of the population at risk were divided between eight regions that have been proposed for beta-thalassemia mapping previously. The mean age of the patients was 26.2 +/- 5.2 years with mean gestational age of 11.4 +/- 1.4 weeks. CVS was successful in all the patients (100%) although 1% required a second procedure. Post CVS fetal loss was 1.45%. Other minor complications were bleeding or spotting (1.81%), amniotic fluid leak (0.5%), small sub-chorionic hematoma (0.58%), severe abdominal pain (0.6%) and severe vasovagal reaction (0.14%). Late complications were seen in 0.21% (oligohydraminos). Approximately 2/3 of the patients were referred from three regions of the country, North (26.8%), South West (22.4%), Central (19.5%) and the remainder (31.3%) were from the other five regions. CVS is a safe and effective method for prenatal diagnosis of beta-thalassemia in countries with a high prevalence as in Iran. The overall complication rate is quite low and acceptable. Fortunately the recent acceptance of legal abortion with respect to Muslim rules has increased the effectiveness of the procedure and made great advances in its application in Iran. Correspondingly, social knowledge has also improved but still there is a gap between the population at risk and the required prenatal diagnosis laboratories and sampling centers. 2006 John Wiley & Sons, Ltd.

  20. the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

    International Nuclear Information System (INIS)

    Abass, M.M.E.

    2004-01-01

    β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

  1. A study of membrane protein defects and alpha hemoglobin chains of red blood cells in human beta thalassemia

    International Nuclear Information System (INIS)

    Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.; Guetarni, D.; Bachir, D.; Colonna, P.; Beuzard, Y.

    1989-01-01

    The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with [ 3 H]N-ethylmaleimide. This pool of soluble alpha chains was 0.067 ± 0.017% of hemoglobin in blood of normal adult, 0.11 ± 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% in the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using [ 3 H]N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups

  2. Bone metabolism and mineral density in patients with beta-thalassemia major

    International Nuclear Information System (INIS)

    Dundar, U.; Kupesiz, A.; Yesilipeck, A.; Ozdem, S.; Gultekin, M.; Gilgil, E.; Tuncer, T.

    2007-01-01

    To evaluate bone metabolism in patients with beta-thalassemia major and to determine the factors associated with the development of osteoporosis. We studied 25 patients with thalassemia major with a mean age of 18.4 years (rang 5-31), age and gender matched 24 healthy controls who were attending the outpatient physical medicine and rehabilitation clinic of Akdeniz University Hospital between January 2004 and March 2004 in Turkey. Bone mineral density (BMD) of lumbar spine (L-1-L4) and proximal femur were determined using dual x-ray absorptiometry (DXA). Venous blood samples were obtained for determination of blood cell count and markers of bone formation and resorption. The BMD values, both at lumbar and femoral neck levels were significantly lower in patients compared to controls. Serum N-telopeptide level was slightly higher, whereas osteocalcin was slightly lower in patients, however, the values were not statistically significant. Plasma levels of insulin like growth factor-1 (IGF-I) and insulin like growth factor for binding protein-3 (IGFBP-3) were significantly lower in patients. Also, serum levels of estradiol and progesterone in females, luteinizing, hormone and follicle-stimulating hormone in both genders were significantly lower in patients. Serum levels of free testosterone and total testosterone were lower in patients, but not statistically significant. Patients also had significantly higher serum phosphorous levels and lower serum calcitonin levels compared to controls. The BMD is decreased in thalassemic patients. Growth retardation, growth hormone/IGF-I/IGFP-3 axis dysfunction, gonadal dysfunction and hypothalomo-pituitary-gonadal axis dysfunction may be responsible for the development of osteoporosis in the patients with beta-thalassemia major. (author)

  3. Noninvasive analysis of skin iron and zinc levels in beta-thalassemia major and intermedia

    International Nuclear Information System (INIS)

    Gorodetsky, R.; Goldfarb, A.; Dagan, I.; Rachmilewitz, E.A.

    1985-01-01

    Diagnostic x-ray spectrometry, a method based on x-ray fluorescence analysis, was used for noninvasive determination of iron and zinc in two distinct skin areas, representing predominantly dermal and epidermal tissues, in 56 patients with beta-thalassemia major and intermedia. The mean iron levels in the skin of patients with beta-thalassemia major and intermedia were elevated by greater than 200% and greater than 50%, respectively, compared with control values. The zinc levels of both skin areas examined were within the normal range. The data indicate that the rate and number of blood transfusions, which correlated well with serum ferritin levels (r . 0.8), are not the only factors that determine the amount of iron deposition in the skin (r less than 0.6). Other sources of iron intake contribute to the total iron load in the tissues, particularly in patients who are not given multiple transfusions. The noninvasive quantitation of skin levels may reflect the extent of iron deposition in major parenchymal organs. Repeated DXS examinations of the skin could monitor the clearance of iron from the tissues of patients with iron overload in the course of therapy with chelating agents

  4. Associations between a health-promoting lifestyle and quality of life among adults with beta-thalassemia major.

    Science.gov (United States)

    Maheri, Aghbabak; Sadeghi, Roya; Shojaeizadeh, Davoud; Tol, Azar; Yaseri, Mehdi; Ebrahimi, Mojtaba

    2016-01-01

    A health-promoting lifestyle (HPL) is a factor that affects the quality of life (QoL) in patients with beta-thalassemia (β-thalassemia). Due to the lack of studies of this issue, this study aimed to determine the association between HPL and QoL among adults with β-thalassemia. This cross-sectional (descriptive-analytic) study was conducted among 389 adult patients with β-thalassemia in Tehran, Iran. The research instrument included a questionnaire consisting of three parts: demographic items, the Short-Form Health Survey and the Health-Promoting Lifestyle Profile. The data were analyzed using SPSS version 23.0. The results were considered significant at the conventional pthalassemia; these four dimensions explained 37.9% of the variance in QoL. QoL and HPL were not at acceptable levels among patients with thalassemia. Therefore, educational interventions emphasizing spiritual growth, physical activity, and interpersonal relations are necessary for patients with thalassemia.

  5. Perfil de beta talassemia heterozigota obtido a partir de análise data mining em banco de dados The profile of beta thalassemia obtained by data mining analysis in a database

    Directory of Open Access Journals (Sweden)

    Ana L. B. Domingos

    2010-02-01

    Full Text Available Variations in the phenotypic expression of heterozygous beta thalassemia reflect the formation of different populations. To better understand the profile of heterozygous beta-thalassemia of the Brazilian population, we aimed at establishing parameters to direct the diagnosis of carriers and calculate the frequency from information stored in an electronic database. Using a Data Mining tool, we evaluated information on 10,960 blood samples deposited in a relational database. Over the years, improved diagnostic technology has facilitated the elucidation of suspected beta thalassemia heterozygote cases with an average frequency of 3.5% of referred cases. We also found that the Brazilian beta thalassemia trait has classic increases of Hb A2 and Hb F (60%, mainly caused by mutations in beta zero thalassemia, especially in the southeast of the country.

  6. Effect of Average Annual Mean Serum Ferritin Levels on QTc Interval and QTc Dispersion in Beta-Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Yazdan Ghandi

    2017-08-01

    Full Text Available Background There is evidence indicating impaired cardiomyocytic contractility, delayed electrical conduction and increased electrophysiological heterogeneities due to iron toxicity in beta-thalassemia major patients. In the present study, we compared the electrocardiographic and echocardiographic features of beta-thalassemia major patients with a healthy control group. Materials and Methods The average annual serum ferritin levels of fifty beta-thalassemia major patients were assessed. For each patient, corrected QT (QTc intervals and QTc dispersions (QTcd were calculated and V1S and V5R were measured. All subjects underwent two-dimensional M-mode echocardiography and Doppler study and were compared with 50 healthy subjects as a control group. Results QTc interval and dispersion were significantly higher in beta-thalassemia major patients (P= 0.001. The mean V5R (20.04 ± 4.34 vs. 17.14 ± 2.55 mm and V1S (10.24 ± 2.62 vs. 7.83 ± 0.38 mm showed considerably higher mean values in patients in comparison with control group.Peak mitral inflow velocity at early diastole and early to late ratio in the case- group was markedly higher(P

  7. Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

    Directory of Open Access Journals (Sweden)

    Selma Ünal

    2014-09-01

    Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

  8. Elevated plasma chemokine CCL18/PARC in beta-thalassemia

    NARCIS (Netherlands)

    Dimitriou, E.; Verhoek, M.; Altun, S.; Karabatsos, F.; Moraitou, M.; Youssef, J.; Boot, R.; Sarafidou, J.; Karagiorga, M.; Aerts, H.; Michelakakis, H.

    2005-01-01

    Plasma CCL18/PARC, a member of the CC chemokine family, has been found to be several ten-fold increased in symptomatic Gaucher type I patients. Elevated plasma chitotriosidase levels are a well-known abnormality in Gaucher patients, however, its diagnostic use is limited by the frequent genetic

  9. Adrenal glands in beta-thalassemia major: magnetic resonance (MR) imaging features and correlation with iron stores

    International Nuclear Information System (INIS)

    Drakonaki, Eleni; Papakonstantinou, Olympia; Maris, Thomas; Gourtsoyiannis, Nicholas; Vasiliadou, Artemis; Papadakis, Alex

    2005-01-01

    This study aimed at describing the magnetic resonance (MR) imaging features of the adrenal glands in beta-thalassemic patients and at investigating the relation between adrenal and hepatic siderosis. Adrenal signal intensity (SI) was retrospectively assessed on abdominal MR studies of 35 patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 12 healthy controls, using T1- (120/4/90), intermediate - (120/4/20), and T2*- (120/15/20) weighted GRE sequences. Adrenal SI was graded as grade 0 (normal SI on all sequences), grade 1 (hypointensity on T2* alone), or grade 2 (hypointensity on at least T2*). Adrenal size was measured in the thalassemic patients and compared with normative data. Liver-to-muscle (L/M) SI ratios, expressing hepatic siderosis, were estimated on each sequence. Serum ferritin levels were recorded. Adrenal hypointensity (grades 1 and 2) was noted in 24/35 (68.6%) patients. L/M ratios correlated significantly with adrenal SI in all sequences. Patients with grade 1 and grade 2 adrenal SI had significantly decreased L/M ratios compared with grade 0. Serum ferritin correlated significantly with L/M values but not with adrenal SI. Adrenal size was within normal limits. Diffuse hypointensity in normal-sized adrenals is a common MR finding in beta-thalassemic patients and correlates with the degree of hepatic siderosis. (orig.)

  10. Adrenal glands in beta-thalassemia major: magnetic resonance (MR) imaging features and correlation with iron stores

    Energy Technology Data Exchange (ETDEWEB)

    Drakonaki, Eleni; Papakonstantinou, Olympia; Maris, Thomas; Gourtsoyiannis, Nicholas [University Hospital of Heraklion, Department of Radiology, Heraklion (Greece); Vasiliadou, Artemis [Aghios Georgios Hospital of Chania, Thalassemia Unit, Chania (Greece); Papadakis, Alex [Venizelion Hospital of Heraklion, Thalassemia Unit, Heraklion (Greece)

    2005-12-01

    This study aimed at describing the magnetic resonance (MR) imaging features of the adrenal glands in beta-thalassemic patients and at investigating the relation between adrenal and hepatic siderosis. Adrenal signal intensity (SI) was retrospectively assessed on abdominal MR studies of 35 patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 12 healthy controls, using T1- (120/4/90), intermediate - (120/4/20), and T2*- (120/15/20) weighted GRE sequences. Adrenal SI was graded as grade 0 (normal SI on all sequences), grade 1 (hypointensity on T2* alone), or grade 2 (hypointensity on at least T2*). Adrenal size was measured in the thalassemic patients and compared with normative data. Liver-to-muscle (L/M) SI ratios, expressing hepatic siderosis, were estimated on each sequence. Serum ferritin levels were recorded. Adrenal hypointensity (grades 1 and 2) was noted in 24/35 (68.6%) patients. L/M ratios correlated significantly with adrenal SI in all sequences. Patients with grade 1 and grade 2 adrenal SI had significantly decreased L/M ratios compared with grade 0. Serum ferritin correlated significantly with L/M values but not with adrenal SI. Adrenal size was within normal limits. Diffuse hypointensity in normal-sized adrenals is a common MR finding in beta-thalassemic patients and correlates with the degree of hepatic siderosis. (orig.)

  11. Side effects of Deferasirox Iron Chelation in Patients with Beta Thalassemia Major or Intermedia

    Directory of Open Access Journals (Sweden)

    Murtadha Al-Khabori

    2013-03-01

    Full Text Available Objectives: Chelating agents remain the mainstay in reducing the iron burden and extending patient survival in homozygous beta-thalassemia but adverse and toxic effects may increase with the institution and long term use of this essential therapy. This study aimed to estimate the incidence of deferasirox (DFX side effects in patients with thalassemia major or intermedia.Methods: A retrospective study of 72 patients (mean age: 20.3±0.9 yrs; 36 male, 36 female with thalassemia major or intermedia treated at Sultan Qaboos University Hospital, Oman, was performed to assess the incidence of side effects related to deferasirox over a mean of 16.7 month follow-up period.Results: Six patients experienced rashes and 6 had gastro-intestinal upset. DFX was discontinued in 18 patients for the following reasons: persistent progressive rise(s in serum creatinine (7 patients; 40% mean serum creatinine rise from baseline, feeling unwell (2, severe diarrhea (1, pregnancy (1, death unrelated to chelator (2 and rise in serum transaminases (2. Three patients were reverted to desferoxamine and deferiprone combination therapy as DFX was no longer biochemically effective after 18 months of therapy. There was no correlation between baseline serum ferritin and serum creatinine or a rise in serum creatinine. Cardiac MRI T2* did not change with DFX therapy. However, there was an improvement in liver MRI T2* (p=0.013.Conclusion: Renal side effects related to deferasirox appear to be higher than those reported in published clinical trials. Further larger studies are required to confirm these findings.

  12. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  13. Resolution of alloimmunization and refractory autoimmune hemolytic anemia in a multi-transfused beta-thalassemia major patient

    Directory of Open Access Journals (Sweden)

    Joseph Philip

    2014-01-01

    Full Text Available Beta-thalassemia is one of the most prevalent autosomal disorders, which affect more than 400,000 newborn per year worldwide. In India, the carrier rate of beta-thalassemia varies from 3-17%. The overall rate of alloimmunization in thalassemia patients has been reported to be 5-30% in the world, which is mostly contributed by the alloimmunization to minor blood group antigen. Among Asians, the incidence of red cell alloimmunization is 22%. The recommended treatment for beta-thalassemia major is regular blood transfusion every 3 to 4 weeks. The development of anti-red cell antibodies (alloantibodies and/or autoantibodies can significantly complicate transfusion therapy. Alloantibodies are commonly associated with red cell hemolysis. Red cell autoantibodies appear less frequently, but they can result in clinical hemolysis called autoimmune hemolytic anemia (AIHA, and in difficulty in cross-matching blood. Patients with autoantibodies may have a higher transfusion rate and often require immunosuppressive drugs or alternative treatments including intravenous immunoglobulin (IVIg and rituximab (anti-CD20 monoclonal antibody.

  14. Beta thalassemia major: The effect of age on glomerular filtration rate

    Directory of Open Access Journals (Sweden)

    Majid Malaki

    2011-01-01

    Full Text Available Thalassemia is a common hereditary hemoglobinopathy disorder that affects many organs in the body. Estimation of kidney function is important, as it is the vital organ that plays the major role in the elimination of accumulated iron as well as the chelating drugs that have to be used as therapy. Sixty- three patients aged 1-29 years, with a mean ± SD of 14 ± 6.7 years, affected with beta- thalassemia major in Tabriz Children′s Hospital were evaluated for their renal function on the basis of their age, serum iron, serum ferritin and serum creatinine levels along with two methods of estimating glomerular filtration rate (GFR; by Schwartz method for those under 18 years old and using Modification of Diet in Renal Disease (MDRD formula for those who were 18 years and above. Elevation of serum creatinine denoting renal dysfunction was not seen in our patients, but hyperfiltration was a common finding. An increasing GFR was observed, which corresponded to age, but no relationships were seen between serum iron, serum ferritin, regular blood transfusion, chelating therapy to GFR.

  15. Better Renal Resistive Index Profile in Subjects with Beta Thalassemia Minor .

    Science.gov (United States)

    Basut, Fahrettin; Keşkek, Şakir Özgür; Gülek, Bozkurt

    2018-05-03

    Beta thalassaemia minor is a common genetic disorder without any characteristic symptoms except mild anemia. It is found to be associated with some cardiovascular risk factors such as insulin resistance and diabetes mellitus. The renal resistive index (RRI) is a measure of renal arterial resistance to blood flow. The aim of this study was to evaluate the renal resistive index in subjects with beta thalassaemia minor (BTM). A total of 253 subjects were included in this cross-sectional study. The study group consisted of 148 subjects with BTM and the control group consisted of 105 healthy subjects. Beta thalassaemia minor was diagnosed by complete blood count and hemoglobin electrophoresis. Blood pressure measurement and biochemical tests were performed. Renal resistive index of all subjects was measured using renal Doppler ultrasonography. Subjects with beta thalassemia minor had lower renal resistive indices compared to healthy subjects (0.58 ± 0.04 vs. 0.60 ± 0.06, p = 0.0016). Additionally, the RRI levels of subjects with BTM were correlated with systolic blood pressure (p = 0.017, r = 0.194). In this study, lower renal resistive index was found in subjects with BTM. This may be associated with decreased vascular resistance and blood viscosity in these subjects. ©2018The Author(s). Published by S. Karger AG, Basel.

  16. Impact of beta thalassemia on maxillary sinuses and sino-nasal passages: A case control study.

    Science.gov (United States)

    Ragab, Ahmed; Ragab, Seham Mohammed; Shawki, Mohammed

    2015-12-01

    Skeletal changes among beta (β) thalassemia children are well documented, but without available data regarding sino-nasal passages alterations. The authors investigated the maxillary sinuses and sino-nasal passages changes in β-thalassemia children and correlated such changes with the amount of transfused red cells and the erythroid marrow activity. Clinical analyses including otorhinolaryngical examination (ORL) were obtained in twenty β-thalassemia children and 20 matched healthy controls. Hemoglobin (Hb), serum ferritin, soluble transferrin receptor (sTfR) levels and bone mineral density of the lumbar spine (BMD ls) were assayed. The two groups were analyzed for the CT image parameters: bone thickness, anterior and posterior choanae diameters, extramedullary hematopoiesis and chronic rhinosinusitis (CRS) RESULTS: Nasal congestion/obstruction was identified in 14 (70%) children. Eight patients (40%) had criteria of chronic rhinosinusitis. In comparison with the normal controls, the increase in the roof, floor, medial, anterior, lateral and posterior maxillary bony walls thickness was significantly higher (1.26, 2.46, 2.6, 2.9, 3.23 and 5.34-folds, respectively). The mean posterior choanae horizontal, vertical diameters and their surface area were significantly reduced in the patients compared to the controls. The mean anterior maxillary wall bone thickness directly correlated with sTfR (P=0.047) while that of the posterior wall correlated inversely with Hb level (P=0.013). The mean vertical posterior choanae diameter had positive correlation with the amount of transfused red cells (P=0.001) and negative correlation with sTfR (P=0.001). The Hounsfield unit of maxillary sinus wall had direct relation with BMDls (P=0.003) CONCLUSIONS: Thalassemia children are at risk of different folds increase of maxillary sinuses walls thicknesses utmost at posterior and lateral walls. Other sino-nasal morbidities include diminished posterior choanal diameter, nasal obstruction

  17. Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis

    International Nuclear Information System (INIS)

    Hafeez, M.

    2007-01-01

    To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)

  18. Prevalence and Intensity of Depression in Mothers of Children with Beta-Thalassemia Major In Talghani Hospital of Gorgan, Iran

    Directory of Open Access Journals (Sweden)

    Nargesbeygom Mirbehbahani

    2014-01-01

    Full Text Available Background: Thalassemia is a chronic disease that it leads to psychological and social problems for parents. Mothers are at markedly increased risk of suffering from psychological distress and depression because they usually take on a considerable part of extra care that their children need.This study was designed to determine prevalence and intensity of depression in mothers with a thalassemic child. Material and Methods: In this cross – sectional study, 65 mothers of children with thalassemia major (case group and 65 mothers of children without thalassemia major (control group were assessed using the Beck Depression Inventory (BDI. Data were analyzed by using SPSS (v 16.0 for windows. Results: Prevalence of depression was significantly higher in case group than that in control group (84.6%vs. 56.9%, p <0.05. Moderate depression had a highest prevalence in the both groups (33.4% in case group and 30.8% in control group. Prevalence of severe depression in case group was markedly higher than that in control group (29.2% vs. 3.1% p<0.05. There was a significant difference between intensity of depression in mothers of case group that had another child with beta-thalassemia major (p<0.05. Conclusion: Mothers of children with thalassemia major are vulnerable to depression. They need psychosocial support to promote their health.

  19. Diffuse Hepatic Calcifications in a Transfusion-Dependent Patient with Beta-Thalassemia: A Case Report

    Directory of Open Access Journals (Sweden)

    Forough Saki

    2013-09-01

    Full Text Available Hepatic calcification is usually associated with infectious, vascular, or neoplastic processes in the liver. We report the first case of beta-thalassemia major with isolated diffuse hepatic calcification in a 23 year old woman, who had been transfusion-dependent since the age of 6 months. She was referred to our center with a chief complaint of abdominal pain. Computed tomography scan of the abdomen revealed diffuse hepatic calcification in the right, left, and caudate lobes of the liver. Her medical history disclosed hypoparathyroidism as well as chronic hepatitis C virus infection, which was successfully treated but led to early micronodular cirrhosis on liver biopsy. Other studies done to search for the cause of hepatic calcification failed to reveal any abnormalities. We suspect that hypoparathyroidism caused liver calcification, and should be, therefore, considered in the differential diagnosis of hepatic calcification if other causative factors have been ruled out.

  20. Evaluation of cognition in children with beta-thalassemia major and healthy counterparts in terms of abstract thinking and visual organization

    Directory of Open Access Journals (Sweden)

    Samaneh Homayouni-Meymandi

    2014-04-01

    Conclusion: The results show the potential impact of the disease on children›s cognitive levels and suggest that children with beta-thalassemia major need more attention in the field of education to promote their understanding.

  1. Peripheral Neuropathy: Not a Feature of Childhood Thalassemia

    African Journals Online (AJOL)

    Sedat Işıkay

    an iron chelator, used for transfusion dependent thalassemia patients has been associated with sensorineural and sensorimotor neurotoxicity.[7,8] However, the data in literature regarding the peripheral neuropathy and beta thalassemia is limited. Moreover, there is a gap in literature about the factors that have a role in.

  2. Characterization of beta-thalassemia mutations in patients from the state of Rio Grande do Norte, Brazil

    Directory of Open Access Journals (Sweden)

    Zama Messala Luna da Silveira

    2011-01-01

    Full Text Available 35 unrelated individuals were studied for characterization as either heterozygous or homozygous for beta-thalassemia. Molecular analysis was done by PCR/RFLP to detect the mutations most commonly associated with beta-thalassemia (β0IVS-I-1, β+IVS-I-6, and β039. In the patients who showed none of these mutations, the beta-globin genes were sequenced. Of the 31 heterozygous patients, 13 (41.9% had the β+IVS-I-6 mutation, 15 (48.4% the β0IVS-I-1 mutation, 2 (6.5% the β+IVS-I-110 mutation and 1 (3.2% the β+IVS-I-5 mutation. IVS-I-6 was detected in the four homozygotes. The mutation in codon 39, often found in previous studies in Brazil, was not detected in the present case. This is the first study aiming at identifying mutations that determine beta-thalassemia in the state of Rio Grande do Norte.

  3. Xmni polymorphism and disease severity in patients with beta thalassemia from northern Pakistan

    International Nuclear Information System (INIS)

    Hanif, T.B.; Ahmed, S.; Anwar, J.

    2015-01-01

    Thalassemia is a heterogeneous disorder and several genetic factors influence the severity of thalassemia. An accurate and early diagnosis of a mild thalassemia genotype helps to avoid unnecessary transfusion and its complications. The aim of this study is to identify the association between XmnI polymorphism and disease severity in patients with ?-thalassemia from northern Pakistan. Methods: The cross sectional study was conducted at the Department of Haematology, Armed Forces Institute of Pathology (AFIP) Rawalpindi, from September 2006 to June 2009. A total of 90 subjects including 30 with thalassemia major, 30 with thalassemia intermedia and 30 normal individuals were studied. DNA from each subject was tested for 15 ?-thalassemia mutations and the presence of XmnI polymorphism using Amplification Refractory Mutation System and Restriction Fragment Length Polymorphism respectively. Results: One normal and one thalassemia major subject were found to be positive for homozygous and heterozygous XmnI polymorphism respectively. Among the thalassemia intermedia group, XmnI polymorphism was found in 12/30 patients, of whom 10 were homozygous and 2 were heterozygous for it. Conclusion: XmnI polymorphism is an important genotypic factor in Pakistani population for making a prospective diagnosis of thalassemia intermedia and predicting the severity of the disease. (author)

  4. A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

    Science.gov (United States)

    Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

    2018-01-01

    Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

  5. [Pretreatment doses of antithymocyte globubin-fresenius for allogeneic hematopoietic stem cell transplantation for beta-thalassemia major].

    Science.gov (United States)

    Li, Chunfu; Wang, Yanhua; Wu, Xuedong; Pei, Fuyu; He, Yuelin; Feng, Xiaoqin; Liu, Huaying

    2012-05-01

    To investigate the effects of different doses of antithymocyte globubin-fresenius (ATG-F) for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in patients with beta-thalassemia Major. Sixty-four children with beta-thalassemia major undergoing allo-HSCT were divided into two equal groups to receive ATG-F pretreatments at high (30 mg/kg) or low (15 mg/kg) doses as part of the conditioning regimen including mainly cyclophosphamide, busulfan, fludarabine, and thiotepa. The outcomes of the patients were compared between the two groups. No obvious difference were noted in the time to leukocyte and platelet engraftment between the two groups. The incidence of grade II-IV acute graft-versus-host disease (aGVHD) appeared to be higher in the low-dose group than in the high-dose group (12.5% vs 9.4%). The incidence of grade III-IV aGVHD was also higher in the low dose group (12.5% vs 6.3%), but the difference was not statistically significant. Application of high-dose ATG-F was associated with a higher rate of probable and possible fungal infection (P<0.05). The two doses of ATG-F is feasible as a part of the conditioning regimen for allo-HSCT in children with beta-thalassemia major.

  6. The pancreas in {beta}-thalassemia major: MR imaging features and correlation with iron stores and glucose disturbunces

    Energy Technology Data Exchange (ETDEWEB)

    Papakonstantinou, Olympia [University Hospital of Heraklion, Medical School of Crete, Department of Radiology, Heraklion, Crete (Greece); Attikon Hospital, 2nd Department of Radiology, Athens (Greece); Ladis, Vasilios; Kostaridou, Stavroula; Berdousi, Helen; Kattamis, Christos [Thalassemia Unit, University of Athens, ' ' Aghia Sophia' ' Children' s Hospital, Athens (Greece); Maris, Thomas; Gourtsoyiannis, Nicholas [University Hospital of Heraklion, Medical School of Crete, Department of Radiology, Heraklion, Crete (Greece)

    2007-06-15

    The study aims at describing the MR features of pancreas in beta-thalassemia major, investigating the relations between MR findings and glucose disturbances and between hepatic and pancreatic siderosis. Signal intensity ratios of the pancreas and liver to right paraspinous muscle (P/M, L/M) were retrospectively assessed on abdominal MR imaging studies of 31 transfusion-dependent patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 10 healthy controls, using T1- (120/4/90), intermediate in and out of phase - (120/2.7, 4/20), and T2*-(120/15/20) weighted GRE sequences. Using the signal drop of the liver and pancreas on opposed phase images, we recorded serum ferritin and results of oral glucose tolerance test (OGTT). Decreased L/M and P/M on at least the T2* sequence were noticed in 31/31 and 30/31 patients, respectively, but no correlation between P/M and L/M was found. Patients with pathologic OGTT displayed a higher degree of hepatic siderosis (p < 0.04) and signal drop of pancreas on opposed phase imaging (p < 0.025), implying fatty replacement of pancreas. P/M was neither correlated with glucose disturbances nor serum ferritin. Iron deposition in the pancreas cannot be predicted by the degree of hepatic siderosis in beta-thalassemia major. Fatty replacement of the pancreas is common and may be associated with glucose disturbances. (orig.)

  7. Insulin-like growth factor-1 levels in children with Beta-thalassemia minor

    OpenAIRE

    Mehran Karimi; Hamdollah Karamifar; Nargrs Sobhani

    2008-01-01

    Objective: Growth retardation in children with b-thalassemia major is multifactorial. Some etiologies described for this condition are hemochromatosis, disturbed growth hormone (GH) / insulin growth factor-1 (IGF-1) axis, undernutrition and hypermetabolism. It has also been proven that growth retardation is present in b-thalassemia major children despite regular transfusion and chelation. Our aim was to evaluate the level of IGF-1 in b-thalassemia minor subjects and compare it with that in he...

  8. Insulin-like growth factor-1 levels in children with Beta-thalassemia minor

    Directory of Open Access Journals (Sweden)

    Mehran Karimi

    2008-09-01

    Full Text Available Objective: Growth retardation in children with b-thalassemia major is multifactorial. Some etiologies described for this condition are hemochromatosis, disturbed growth hormone (GH / insulin growth factor-1 (IGF-1 axis, undernutrition and hypermetabolism. It has also been proven that growth retardation is present in b-thalassemia major children despite regular transfusion and chelation. Our aim was to evaluate the level of IGF-1 in b-thalassemia minor subjects and compare it with that in healthy children. Material and Methods: Fifty children aged 6 months to 15 years with b-thalassemia minor (32 males, 18 females and 50 age- and sex-matched normal healthy children were selected. Medical history was taken and complete physical examination was done in each case; IGF-1 level was checked in all cases. This study was done in Shiraz, southern Iran, during 2005.Results: IGF-1 levels were significantly lower in b-thalassemia minor children than normal children (P = 0.015. This result demonstrates that some etiologies of growth failure in b-thalassemia major other than those described to date can exist, which may be shared with b-thalassemia minor in feature or may be transformed by genes that are either expressed or not.Conclusion: We conclude that in addition to that observed in b-thalassemia major, IGF-1 level is also decreased in b-thalassemia minor, and these two may have similar etiologies.

  9. Thalassemia and related hemoglobinopathies.

    Science.gov (United States)

    Sarnaik, Sharada A

    2005-04-01

    Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.

  10. Effect of long-term transfusion therapy on the glycometabolic status and pancreatic beta cell function in patients with beta Thalassemia major

    Directory of Open Access Journals (Sweden)

    Kamalakshi G Bhat

    2014-01-01

    Full Text Available Background: Diabetes mellitus is a major complication of iron overload in patients with beta thalassemia major. Design: This is a descriptive study conducted in a Tertiary Care Teaching Hospital to analyze beta cell function and insulin resistance, and their relation to iron overload status in beta thalassemia major. Fasting glucose, two-hour post load glucose, fasting insulin, alanine amino transaminase (ALT, and ferritin were used as outcome measures. The homeostatic model assessment (HOMA model was used to calculate the beta cell function and insulin resistance index. Results: Of the 30 cases, 20% had impaired fasting glucose, 3.3% had impaired glucose tolerance, and none had diabetes. Fasting glucose was not significant between the cases and controls (P = 0.113. Fasting insulin (P = 0.001, ferritin (P = 0.001, and ALT (P = 0.001 levels were significantly high in the cases. Insulin resistance index was significantly higher in the cases (P = 0.001 as also the beta cell function (P = 0.001. With increase in age and the number of units transfused there is a decline in beta cell function, fasting insulin, and insulin resistance after attaining the maximum level. This suggests that initial insulin resistance is followed by insulin depletion due to loss of beta cell function, leading to diabetes mellitus. Conclusion: Impaired glucose tolerance (IGT and insulin resistance precede the onset of insulin-dependent diabetes and adequate chelation therapy is essential for delaying the onset or for prevention of diabetes.

  11. Prospects and future of conservative management of beta thalassemia major in a developing country

    International Nuclear Information System (INIS)

    Rahman, M.; Lodhi, Y.

    2004-01-01

    Objective: To assess the efficacy, prospects and future of conservative management of beta thalassemia major patients in a developing country. Design: Patients registered at IHBTS were studied over a period of three years. They consented to being managed on moderate transfusion regimen, aiming to maintain a pre-transfusion haemoglobin(Hgb) level of 9.0 plus minus 1.0 g per dL. We studied their transfusion requirements, status for transfusion transmitted infections (TTls), serum ferritin levels and complications developing as a result of iron overload. Subjects: Initially all registered patients were included in this study. Sporadic patients as well as dropouts occurring due to any reason, (patients concurrently seeking treatment at other centres as well, or complying poorly to advised chelation therapy) were excluded from the study. The data presented here conforms to a cohort of 60 regular patients who adhered best to our selection criteria. Main Outcome Measures: 1) The study highlights the deficiencies and problems of conservative management for beta thalassemia major. 2) The major impact of our study is the message that conservative management in a poor country, like ours, is a no-win situation. 3) There is an urgent need to immediately start a prevention programme. Results: In the younger patients, blood consumption even on the moderate transfusion regimen is 120ml/kg/year, however with ascending age the consumption increases to 240ml/kg/year. A substantive number of the patients are either Hep C (35%) or Hep B (1.7%) positive. There are no HIV positive patients. Serum ferritin levels vary widely and could not be controlled due to poor compliance to chelation. 50% of the patients developed one or other complications of iron overload. The cost of treatment depending on the quality of care, is tremendous and beyond the reach of the common man. Conclusions: Conservative management may be the best alternative and at times the only hope for patients in our country

  12. A new valid formula in differentiating iron deficiency Anemia from beta-thalassemia trait

    International Nuclear Information System (INIS)

    Keikhaei, B.

    2010-01-01

    Objective: To compare the validity of a new index (Hb X RDW X 100/ (RBC)/sup 2/ X MCHC) with twelve discriminating functions (DFs) to differentiate iron deficiency anemia (IDA) and beta-thalassemia trait (beta-TT). Methodology: A total of 823 patients (317 IDA and 506 beta-TT) aged 15 to 35 year old were enrolled in this study. The diagnostic sensitivity, specificity and other validity parameters were calculated to assess the diagnostic reliability of the novel index [Keikhaei index (KI)] vis-a-vis the other published DFs [Mentzer Index (MI), Green and King Index (G and KI), red cell distribution width index (RDWI), England and Fraser Index (E and FI), Bessman and Feinstein index (B and FI), Telmissani et al index (TI), Srivastava and Bevington index (S and BI), Shine and Lal index (S and LI), Ricerca et al index (RI), Ehsani et al index (EI), Sirdah et al index (SI), and Red Blood Cell Count(RBC)] were calculated in all patients. Results: All thirteen DFs did not have the sensitivity and specificity of 100%. The KI, RDWI, Gand KI and E and FI showed the most sensitivity and specificity for both IDA and TT; moreover, the lowest reliable indices belonged to B and FI, SandLI and RI. Conclusion: According to Youden's index (YI), DFs in the order of highest to lowest were KI > G and KI > RDWI > E and FI > RBC> M I> EI > TI > SI > S and BI > RI> SandLI >B and FI. (author)

  13. Prevalence of renal tubular dysfunction in beta thalassemia minor in shiraz

    Directory of Open Access Journals (Sweden)

    Ali Moradi Nakhodcheri

    2012-02-01

    Full Text Available  Background & objective: β-Thalassemia minor is an asymptomatic hereditary disease. The first study on the relation of renal tubular dysfunction and β-thalassemia minor was performed in 2002 but those studies seem inadequate.The main goal of this study is through evaluation of renal tubular function in 100 patients with thalassemia minor. Materials & Methods: 100 patients with β- thalassemia which confirmed by hemoglobin electrophoresis and CBC as well as RBC indices were studied.14 out of 100 cases exit because of Urinary Tract Infection, diabetes mellitus or hypertension.Complete chemistry profile was performed on serum and urine of all reminder 86 patients (46 female and 40 male. Patients classified into two groups: β-thalassemia minor with anemia and without anemia. Another control group include 50 healthy individuals also considered.Then data analyzed by proper statistical methods. Results: 20 out of 86 reminder cases e.g. 24% showed at least one index of renal tubular dysfunction.58% of patients was been anemic and 42% non anemic. The most prominent tubular dysfunction was seen in a 29 years old lady with glucosuria and without anemia. conclusion: β-Thalassemia minor is common in Iran specially in Fars province. This study revealed significant renal tubular dysfunction in patient with β-thalassemia minor. So it is necessary to check out thalassemic patients for renal function tests periodically. Key words: β-thalassemia, minor,renal tubular dysfunction

  14. [Long-term effects of combined therapy in patients with beta-thalassemia major].

    Science.gov (United States)

    Bagnulo, S; Giannini, A M; Moscatelli, F; Stragapede, L; Acquafredda, A; Dammacco, A

    1998-01-01

    We evaluated therapy complications in 19 beta-thalassemia major patients (mean age from 3 years/5 months and 1 years/6 months) who were followed at II Pediatric Department-University of Bari. 3 out of 19 patients underwent allogenic BMT from matched related donor; 2 out of 19 underwent splenectomy. All of them were receiving hypertransfusion therapy and continuous chelation with DFO. In all patients we performed physical examination, laboratory assays, cardiac and endocrinologic function tests, serum HBV-HCV-HIV antibodies, otoscopy and audiometric test, fundus oculi, skeletal x-ray. 1 out of 19 patients, who was under 15, had a slight dilatation of left ventricle and arythmia. All patients were HBsAb positive. 4/19 patients were HCV Ab positive (ELISA test) with an increase in ALT-AST serum levels since at least 6 months. In 3 of them we assessed RIBA test, always positive. 3 of them underwent liver biopsy (1 iron overload 2 chronic active hepatitis). All patients were HIV Ab negative. 4/15 patients revealed low GH levels after Arginina test. 13 pre-pubescent patients had normal results with GNRH test but lower results after FSH test. 1 pubescent patient had gonadotropic hypophyseal deficit. 4 patients had subclinic hypothiroidism. We couldn't find any sequelas in bone-eyes-ears. Hypertransfusion therapy, chelation, profilaxis of infections improved length and quality of life in thalassemic patients. Hypogonadotropic hypogonadism remains a serious sequela and we think it needs to be treated.

  15. Orthodontic Consideration in Patients with Beta-Thalassemia Major: Case Report and Literature Review.

    Science.gov (United States)

    Einy, Shmuel; Hazan-Molina, Hagai; Ben-Barak, Ayelet; Aizenbud, Dror

    Beta Thalassemia (βT) patients present a unique facial appearance and specific craniofacial, jaw and dental patterns. Although this anomaly often requires orthodontic management, βT patients have received scant attention in the orthodontic and dental literature over the past 50 years. The aim of this article is to review the characteristic craniofacial and dental manifestation pattern of βT patients and to emphasize their preferred orthodontic management protocol by presenting a βT orthodontic treated patient. A 10 year old patient presented with a complaint of severe esthetic and functional disorders due to her diagnosis of βT. We initiated orthodontic treatment including a combined orthopedic and functional treatment modality to improve facial appearance. Maxillary restraint and increased mandibular size during treatment along with an increase in the vertical dimension were achieved. The patient presented with Angle class I molar relationship, with reduction of the excessive overjet and deep overbite. Orthodontic treatment comprised of maxillary orthopedic treatment directed especially toward premaxilla with light forces, and mandibular modification by functional appliance along with fixed orthodontic treatment is recommended in βT patients.

  16. Splenic uptake of both technetium-99m diphosphonate and technetium-99m sulfur colloid in sickle cell beta degrees thalassemia

    International Nuclear Information System (INIS)

    Heck, L.L.; Brittin, G.M.

    1989-01-01

    A 19-year-old black woman with sickle cell beta degrees thalassemia had experienced more than 100 hospital admissions for sickle cell crisis and aseptic necrosis of both femoral heads. Her spleen was enlarged threefold and accumulated both radiocolloid and bone-seeking agent on two occasions, demonstrating an exception to the rule in sickle cell anemia that spleens that take up bone-seeking agents demonstrate functional asplenia. In the context of fever, left upper quadrant pain, and splenomegaly, the pattern of calcification in the patient's spleen as revealed in ultrasound and CT studies suggested possible abscess and led to unnecessary splenectomy. The nuclear medicine studies did not support this diagnosis. Nuclear medicine physicians should not be misled by splenic findings of sickle cell thalassemia (and possibly of other heterozygous sickle cell disorders) that differ from those of the more familiar homozygous sickle cell anemia

  17. Endocrine dysfunction and growth retardation assessment in children with beta -thalassemia major

    International Nuclear Information System (INIS)

    Noureldin, A.M.; Ahmed, A.M.

    2002-01-01

    Children suffering from beta-thalassemia major are reported to have endocrine abnormalities and growth retardation. This study was carried out to study the cause of their growth retardation and determine the extent and rate of endocrine complications. Twenty beta-thalassemic major pubertal children, with mean baemoglobin and ferritin concentration of 8.8±0.6 and 3.597± 1.931, respectively, and twenty pubertal control children were used in the study. The anthropometric measurements that carried out revealed significant low growth rate in patient groups in comparison with control. Patients divided into two groups; I) D-thal with delayed growth and II) S-thal with stunted growth. Basal serum thyoid hormones (T 3 and T 4 ) and thyroid stimulating hormone (TSH) were measured in patient groups and control group. T 3 showed highly significant decrease (P 4 showed non-significant change and TSH showed highly significant increase (P<0.001). Serum growth hormone showed significant lower concentrations in patient groups with values of 2.163±0.9 ng/ml, (P<0.01) and 1.832±1.9ng/ml, (P<0.01) for delayed growth thalassemic group (D-thal) and stunted growth thalassemic group (S-thal), respectively. Serum concentration of insulin growth factor-1 (IGF-1) hormone was studied. D-thal and S-thal had significant lower basal IGF-1 concentrationsof-58.44% (P<0.001) for D-thal and -64.37%, (P<0.001) for S-thal

  18. Hemoglobina C em homozigose e interação com talassemia beta Homozygous hemoglobin C and its interaction with beta thalassemia

    Directory of Open Access Journals (Sweden)

    Ivan L. Angulo

    2009-01-01

    Full Text Available A hemoglobina C (Hb C é originária do oeste da África e é detectada por migração lenta na eletroforese alcalina em acetato de celulose. Consiste na mutação do gene da globina beta no códon 6 (GAG-AAG, resultando na substituição do sexto aminoácido da cadeia beta da hemoglobina humana, o ácido glutâmico, pelo aminoácido lisina. A cromatografia de alto desempenho (HPLC separa completamente as frações C e A2, permitindo caracterizar a presença da interação com talassemia beta. Esta entidade (Hb CC, em homozigoze é considerada benigna em relação à doença falciforme, já que a falcização não faz parte de sua fisiopatologia. A raridade do diagnóstico C homozigoto e C talassemia beta nos pacientes portadores de hemoglobinopatias nos alertou para a necessidade de se conhecer melhor e estudar aspectos clínicos e hematológicos dos casos dessa mutação em homozigose e na interação com a talassemia beta no ambulatório de anemias do Centro Regional de Hematologia e Hemoterapia de Ribeirão Preto, SP, Brasil.Hemoglobin C (Hb C originated in the west of Africa and is detected by alkaline electrophoresis by slow migration in cellulose acetate. It consists of a mutation of the beta globin gene in codon 6 (GAG-AAG, resulting in a substitution of glutamic acid, the sixth amino acid of the beta string of the human hemoglobin, for lysine. High performance chromatography (HPLC separates the C and A2 fractions completely, allowing the characterization of the presence of interactions with thalassemia beta. This entity (Hb CC is considered benign in respect to sickle cell disease, as sickle cells are not part of its physiopathology. The rarity of the diagnosis of homozygous C and beta thalassemia in patients with hemoglobinopathies showed the necessity of studying clinical and hematologic aspects of the cases of this mutation in homozygosis carriers and the interaction with beta thalassemia in the anemias clinic of the Regional Blood

  19. Fine-tiling array CGH to improve diagnostics for alpha- and beta-thalassemia rearrangements

    NARCIS (Netherlands)

    Phylipsen, M.; Chaibunruang, A.; Vogelaar, I.P.; Balak, J.R.; Schaap, R.A.; Ariyurek, Y.; Fucharoen, S.; den Dunnen, J.T.; Giordano, P.C.; Bakker, E.; Harteveld, C.L.

    2012-01-01

    Implementation of multiplex ligation-dependent probe amplification (MLPA) for thalassemia causing deletions has lead to the detection of new rearrangements. Knowledge of the exact breakpoint sequences should give more insight into the molecular mechanisms underlying these rearrangements, and would

  20. Morphological and dimensional characteristics of dental arch in children with beta thalassemia major

    Directory of Open Access Journals (Sweden)

    Disha Kumar

    2018-01-01

    Full Text Available Background and Objectives: The aim of this study was to examine the arch dimensions of beta thalassemia major patients in comparison with normal individuals. Materials and Methods: Dental arch dimensions were compared between thalassemic patients and normal individuals in the age group of 12–16 years in the maxillary and mandibular arch corresponding to each other regarding age, sex and Angle's molar relationship. A total number of sixty cases in each group were taken. Maxillary and mandibular impressions were made with alginate for all the sixty participants in each group and poured with die stone. Measurement of inter incisor, inter canine, inter premolar and intermolar arch width, arch depth, right anterior, right posterior, left anterior, and left posterior arch length was carried out from each cast using digital Vernier caliper.Results: Unpaired t-test was used for comparison between the two groups. Statistically, a significant difference was found between the case and control groups in the maxillary arch in intercanine width, inter premolar width, intermolar width, right anterior arch length, right posterior arch length, and left anterior arch length. However, no statistically significant difference was found between the groups in inter incisor width, left posterior arch length, and arch depth in the maxillary arch. In the mandibular arch, statistically significant difference was found between the case and control groups in inter canine width, inter premolar width, inter molar width, and left anterior arch length. However, no statistically significant difference was found between the case and control groups in the mandibular arch in interincisor width, right anterior arch length, right posterior arch length, and left posterior arch length. Conclusion: Dental arch widths and arch lengths were significantly reduced in thalassemic patients as compared to normal individuals for the maxillary and mandibular arches.

  1. Anxiety, depression and quality of life in patients with beta thalassemia major and their caregivers.

    Science.gov (United States)

    Yengil, Erhan; Acipayam, Can; Kokacya, Mehmet Hanifi; Kurhan, Faruk; Oktay, Gonul; Ozer, Cahit

    2014-01-01

    Mental health and health related quality of life is commonly affected in patients with chronic problems and their caregivers. In the present study, it was aimed to assess depression and anxiety in patients with beta thalassemia major (BTM) and in their caregivers; and to evaluate effects of these disorders on quality of life. The study was carried out in a district Hereditary Hemoglobinopathy Center and included 88 patients with BTM and 63 of their caregivers. All subjects were assessed using Beck Depression Inventory (BDI), Beck Anxiety Inventory (BAI) and Short Form-36 (SF-36) by a trained psychiatry resident via face-to-face interview. The BDI scores were 17 or above in 20.5% of the patients with BTM and 28.6% of their caregivers (P = 0.248). Of the patients with BTM, there were mild anxiety symptoms in 19.3%, while moderate and severe anxiety symptoms in 14.8% and 4.5%, respectively. Anxiety levels were similar between the patients with BTM and their caregivers (P = 0.878). It was found that BDI and BAI scores were negatively correlated to scores of physical health and mental health components of SF-36 in patients with BTM and their caregivers. In linear regression analysis, it was seen that depression affected physical and mental health of the patients with BTM and their caregivers regardless from anxiety. BTM leads an increase in the frequency of depression and anxiety in both patients and their caregivers, and affects negatively physical and mental components of quality of life.

  2. Survival Analysis and its Associated Factors of Beta Thalassemia Major in Hamadan Province

    Directory of Open Access Journals (Sweden)

    Reza Zamani

    2015-05-01

    Full Text Available Background: There currently is a lack of knowledge about the long-term survival of patients with beta thalassemia (BT, particularly in regions with low incidence of the disease. The aim of the present study was to determine the survival rate of the patients with BT major and the factors associated with the survival time. Methods: This retrospective cohort study was performed in Hamadan province, located in the west of Iran. The study included patients that referred to the provincial hospitals during 16 year period from 1997 to 2013. The follow up of each subject was calculated from the date of birth to the date of death. Demographic and clinical data were extracted from patients’ medical records using a checklist. Statistical analysis included the Kaplan-Meier method to analyze survivals, log-rank to compare curves between groups, and Cox regression for multivariate prognostic analysis. Results: A total of 133 patients with BT major were enrolled, 54.9% of whom were male and 66.2% were urban. The 10-, 20- and 30-year survival rate for all patients were 98.3%, 88.4% and 80.5%, respectively. Based on hazard ratio (HR, we found that accompanied diseases (P=0.01, blood type (P=0.03 and residency status (P=0.01 were significant predictors for the survival time of patients. Conclusion: The survival rate of BT patients has improved. Future researches such as prospective designs are required for the estimation of survival rate and to find other prognostic factors, which have reliable sources of data.

  3. Quality of life among Iranian patients with beta-thalassemia major using the SF-36 questionnaire

    Directory of Open Access Journals (Sweden)

    Sezaneh Haghpanah

    Full Text Available CONTEXT AND OBJECTIVE Patients with beta-thalassemia major (β-TM experience physical, psychological and social problems that lead to decreased quality of life (QoL. The aim here was to measure health-related QoL and its determinants among patients with β-TM, using the Short Form-36 (SF-36 questionnaire. DESIGN AND SETTING Cross-sectional study at the Hematology Research Center of Shiraz University of Medical Sciences, in southern Iran. METHODS One hundred and one patients with β-TM were randomly selected. After the participants' demographics and disease characteristics had been recorded, they were asked to fill out the SF-36 questionnaire. The correlations of clinical and demographic factors with the QoL score were evaluated. RESULTS There were 44 men and 57 women of mean age 19.52 ± 4.3 years (range 12-38. On two scales, pain (P = 0.041 and emotional role (P = 0.009, the women showed significantly lower scores than the men. Lower income, poor compliance with iron-chelating therapy and presence of comorbidities were significantly correlated with lower SF-36 scores. These factors were also found to be determinants of worse SF-36 scores in multivariate analysis. CONCLUSIONS We showed that the presence of disease complications, poor compliance with iron-chelating therapy and poor economic status were predictors of worse QoL among patients with β-TM. Prevention and proper management of disease-related complications, increased knowledge among patients regarding the importance of managing comorbidities and greater compliance with iron-chelating therapy, along with psychosocial and financial support, could help these patients to cope better with this chronic disease state.

  4. Better differential diagnosis of iron deficiency anemia from beta-thalassemia trait

    Directory of Open Access Journals (Sweden)

    Fakher Rahim

    2009-09-01

    Full Text Available Objective: Iron deficiency anemia (IDA and beta-thalassemia trait (ß-TT are the most common forms of microcytic anemia. This study was conducted to compare the validity of various discrimination indices in differentiating β-TT from IDA by calculating their sensitivity, specificity and Youden's index.Methods: Totally 323 subjects (173 children and 150 adults with microcytic anemia were involved in this study. We calculated 10 discrimination indices in all patients with IDA and β-TT. We divided the patients into two different groups as younger or older than 10 years. Results: None of the indices showed sensitivity and specificity of 100% in the patients older than 10 years, and in the patients younger than 10 years, only Shine & Lal index showed sensitivity close to 90% and specificity of 100%. The most accurate discriminative index for patients younger than 10 years was Shine & Lal and for those older than 10 years it was RDW index. According to Youden's index, Shine & Lal and RBC count showed the greatest diagnostic value in patients younger than 10 years and RDW and RBC count indices in those older than 10 years. Conclusion: None of the indices was completely sensitive and specific in differentiation between β-TT and IDA. Mean and median mean cell Hb density (MCHD were very close to normal values in both IDA and β-TT patients, but in the case of mean density of Hb/liter (MDHL, we found that the mean and median were significantly higher than normal values in β-TT and lower than normal values in IDA patients. In our study, Youden's index of RBC and Shine & Lal were the highest and most reliable indices in differentiating β-TT from IDA in the patients younger than 10 years. For patients older than 10 years, the most reliable discrimination indices were RBC and RDW.

  5. Hydroxyurea as a first-line treatment of extramedullary hematopoiesis in patients with beta thalassemia: Four case reports.

    Science.gov (United States)

    Karimi, Mehran; Cohan, Nader; Pishdad, Parisa

    2015-01-01

    Extramedullary hematopoiesis (EMH) is evidenced by erythropoietic masses, which occurs as a compensatory mechanism to overcome hypoxia during chronic anemia. EMH masses in spinal cord could lead to cord compression and neurological symptoms. Besides transfusion, radiotherapy, and surgery, hydroxyurea (HU) is also a treatment strategy in EMH. We described four cases of beta thalassemia with EMH who were treated with HU as a monotherapy. INTERVENTION (AND TECHNIQUE): HU therapy was done in all patients without any transfusion during therapy. HU is a good treatment option for patients with EMH and it could be a substitute for radiotherapy and invasive surgery or regular blood transfusion.

  6. [Current management of thalassemia intermedia].

    Science.gov (United States)

    Thuret, I

    2014-11-01

    Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Non-transfusion-dependent thalassemia encompasses 3 main clinical forms: beta-thalassemia intermedia, hemoglobin E/beta-thalassemia and alpha-thalassemia intermedia (HbH disease). Clinical severity of thalassemia intermedia increases with age, with more severe anemia and more frequent complications such as extramedullary hematopoiesis and iron overload mainly related to increased intestinal absorption. Numerous adverse events including pulmonary hypertension and hypercoagulability have been associated with splenectomy, often performed in thalassemia intermedia patients. The potential preventive benefit of transfusion and chelation therapies on the occurrence of numerous complications supports the strategy of an earlier therapeutic intervention. Increasing knowledge about pathophysiological mechanisms involved in thalassemia erythropoiesis and related iron overload is currently translating in novel therapeutic approaches. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  7. Evaluation of the children with beta-thalassemia in terms of their self-concept, behavioral, and parental attitudes.

    Science.gov (United States)

    Yalçn, Siddika Songül; Durmuşoğlu-Sendoğdu, Mine; Gümrük, Fatma; Unal, Selma; Karg, Eda; Tuğrul, Belma

    2007-08-01

    This study was planned to explore the self-concept, behavioral, and parental attitudes of the children with beta-thalassemia major, and the factors that affect them. The study was undertaken between January and June 2004 at the Hacettepe University Ihsan Doğramaci Children's Hospital, Pediatric Hematology Unit, Ankara and 43 voluntary children with beta-thalassemia major on regular blood transfusion and iron chelation treatment between the ages of 5.0 and 18.0 years were included into the study. Age, sex, birth order, school performance, hemoglobin value, serum ferritin levels, associated illness, splenectomy status, presence of thalassemic sibling or relatives, death of thalassemic relatives, place of residence, maternal and paternal education were recorded. Parental Attitude Research Instrument, Piers-Harris Self-Concept Scale, and Child Behavior Checklist were applied. Higher educated mothers have lower overprotection (P=0.009), parental discordance (P=0.044), and discipline scores (P=0.002) than lower educated mothers. In cases with death of thalassemic relatives, democratic/equality attitude scores were decreased (P=0.034). With stepwise multiple linear regression analysis, splenectomy, good school achievement, absence of death of thalassemic relatives, and serum ferritin levels were found to increase Piers-Harris Self-Concept Scale; however, total behavior problem score was found to decrease with increasing age, splenectomy and decreasing overprotection subscale of Parental Attitude Research Instrument scores. The self-esteem and behavior problems of children with thalassemia depended not only on the variables related exclusively to the child (age, school achievement) and the illness-associated conditions (splenectomy, serum ferritin levels) but also on the parental attitude (overprotection).

  8. Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

    Science.gov (United States)

    Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

    2016-06-15

    This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

  9. Pituitary gland height evaluated by MR in patients with {beta}-thalassemia major: a marker of pituitary gland function

    Energy Technology Data Exchange (ETDEWEB)

    Argyropoulou, M.I.; Metafratzi, Z.; Efremidis, S.C. [Dept. of Radiology, Univ. of Ioannina (Greece); Kiortsis, D.N. [Dept. of Physiology, Univ. of Ioannina (Greece); Bitsis, S.; Tsatoulis, A. [Dept. of Internal Medicine, Univ. of Ioannina (Greece)

    2001-12-01

    In transfusion-dependent {beta}-thalassemia major, increased iron deposition in the pituitary gland has a cytotoxic effect leading mainly to hypogonadotropic hypogonadism. Our purpose was to assess in these patients the height of the pituitary gland and to evaluate whether it represents a marker of pituitary gland function. In 29 patients with {beta}-thalassemia major and 35 age- and gender-matched controls the pituitary gland height was evaluated in a midline sagittal scan using a spin echo T1-weighted (500/20 TR/TE) sequence. In all patients, an extensive endocrine evaluation was performed, including measurements of spontaneous and stimulated levels of gonadotropins, thyroid hormones, growth hormone, insulin-like growth factor, and adrenal hormones. The pituitary gland height was lower in thalassemic patients with hypogonadotropic hypogonadism (n=15) (mean 3.48; SD 0.46) than in the age- and gender-matched controls (mean 6.29; SD 0.77), (P<0.001). No statistically significant difference was found between thalassemic patients without hormone dysfunction (n=14) (mean 5.34; SD 1.52) and age- and gender-matched controls (mean 5.91; SD 1.06). We conclude that in thalassemic patients the pituitary gland height is an additional marker of pituitary gland function and might be useful in clinical management. (orig.)

  10. Iron metabolism in heterozygotes for hemoglobin E (HbE), alpha-thalassemia1, or beta-thalassemia and in compound heterozygotes for HbE/ beta-thalassemia

    NARCIS (Netherlands)

    Zimmermann, M.B.; Fucharoen, S.; Winichagoon, P.; Sirankapracha, P.; Zeder, C.; Gowachirapant, S.; Judprasong, K.; Tanno, T.; Miller, J.L.; Hurrell, R.F.

    2008-01-01

    BACKGROUND: Despite large populations carrying traits for thalassemia in countries implementing universal iron fortification, there are few data on the absorption and utilization of iron in these persons. OBJECTIVE: We aimed to determine whether iron absorption or utilization (or both) in women

  11. Post-transfusion hypertension, convulsion and intracranial haemorrhage in beta-thalassemia major

    International Nuclear Information System (INIS)

    Masood, S.A.; Zaidi, A.

    2012-01-01

    The haematologic disorder b-thalassemia major is common in Pakistan. We describe a patient with undiagnosed thalassemia presenting with hypertension and convulsions and found to have cerebral haemorrhage on neuro-imaging. He had been transfused 2 weeks before this illness. Our experience is similar to a few case reports described in literature that were found to have cerebral haemorrhages post-mortem after a similar clinical presentation. All patients had a blood transfusion within 2 weeks prior to the presentation so association with transfusion has been proposed. We have reviewed the several mechanisms presented and discussed the findings. (author)

  12. Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

    Science.gov (United States)

    Clarke, G M; Higgins, T N

    2000-08-01

    Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

  13. Oxidative status and serum PON1 activity in beta-thalassemia minor.

    Science.gov (United States)

    Selek, Sahbettin; Aslan, Mehmet; Horoz, Mehmet; Gur, Mustafa; Erel, Ozcan

    2007-03-01

    Paraoxonase-1 (PON1) deficiency is related to increased susceptibility to low density lipoprotein oxidation and development of atherosclerosis. The aim of this study was to investigate paraoxonase and arylesterase activities along with oxidative status parameters, and to find out if there is any increased susceptibility to atherogenesis, which might be reflected with increased oxidative stress and decreased serum PON1 activity in beta-thalassemia minor (BTM) subjects. Thirty-two subjects with BTM and 28 healthy subjects as control were enrolled in the study. Serum paraoxonase and arylesterase activities, lipid hydroperoxide (LOOH) levels, total antioxidant capacity (TAC), total oxidant status (TOS) and oxidative stress index (OSI) were determined. Serum TAC, paraoxonase and arylesterase activities were significantly lower in BTM subjects than controls (for all p<0.001), while TOS, LOOH levels and OSI were significantly higher (p<0.001, p<0.05 and p<0.001; respectively). In BTM subjects, OSI, TOS, LOOH levels and TAC were significantly correlated with serum paraoxonase (r=-0.245, p<0.05; r=-0.231, p<0.05; r=-0.264, p<0.05 and, r=0.342, p<0.05, respectively) and arylesterase activities (r=-0.332, p<0.05, r=-0.308, p<0.05; r=-0.320, p<0.05 and r=0.443, p<0.05). Additionally, hemoglobin level was also correlated with serum paraoxonase (r=0.501, p<0.001) and arylesterase activities (r=0.501, p<0.001), TAC (r=0.402, p<0.05), TOS (r=-0.274, p<0.05) and OSI (r=-0.352, p<0.05). Oxidative stress is increased, while serum PON1 activity is decreased in BTM subjects. Decrease in PON1 activity seems to be associated with both the degree of oxidative stress and anemia. BTM subjects may be more prone to development of atherogenesis due to low serum PON1 activity.

  14. HB KURDISTAN [ALPHA-47(CE5)ASP-]TYR], A NEW ALPHA-CHAIN VARIANT IN COMBINATION WITH BETA-THALASSEMIA

    NARCIS (Netherlands)

    GIORDANO, PC; HARTEVELD, CL; STRENG, H; Oosterwijk, Jan; HEISTER, JGAM; AMONS, R; BERNINI, LF

    1994-01-01

    We have characterized the structural abnormality of a new alpha chain mutant found in a Kurdish; family. The clinical and hematological investigation of eight individuals have shown that the a variant is associated with a beta degrees-thalassemia mutation (nonsense codon 39). The tryptic peptide map

  15. Renal tubular dysfunction in pediatric patients with beta-thalassemia major

    Directory of Open Access Journals (Sweden)

    Ali Ahmadzadeh

    2011-01-01

    Full Text Available To evaluate the prevalence of renal tubular dysfunction in children with β-thalassemia (β-T major, we studied the glomerular and tubular function in 140 children with β-T major and compared them to a healthy control group at our center from May 2007 to April 2008. Fresh first morning samples were collected from each patient and analyzed for sodium, potassium, calcium (Ca, protein, uric acid (UA, creatinine (Cr, urine osmolality and urinary N-acetyl-β-D-glucosaminidase (UNAG activity. Blood samples were also collected for complete blood count, blood urea nitrogen (BUN, fasting blood sugar, serum creatinine (SCr, electrolytes, and ferritin before transfusion. Among the study patients, 72 were males, and the mean age was 11.5 (ranging 7-16 years. SCr levels were all within normal limits and all of them had normal glomerular filtration rate (GFR. The mean UNAG was 17.8 IU/L in the study patients (normal 0.15-11.5 IU/L and 3.2 IU/L in the control group (P 0.21 (P = 0.006. Nine (6.4% thalassemic patients with a mean age of 12 years had proteinuria (Upr/UCr > 0.2. Sixty-nine (49.3% out of the 140 patients and 45 (65.2% of the patients having UNAG had uricosuria also (UUA/UCr > 0.26. Ten (7% patients had microscopic hematuria and 10 (7% patients with a mean age of 13.5 years had glucosuria or diabetes mellitus. We conclude that tubular dysfunction is a relative common complication of the β-T major; UNAG and its index are the best to detect renal tubular dysfunction in these patients. Currently, periodic measurement of UCa/UCr and UUA/UCr ratios as well as urinalysis are recommended.

  16. Assessment of cognitive function in children with beta-thalassemia major: a cross-sectional study.

    Science.gov (United States)

    Raafat, Nelly; El Safy, Usama; Khater, Nahed; Hassan, Tamer; Hassan, Basheir; Siam, Ahmed; Youssef, Amira; El Shabrawy, Amany

    2015-03-01

    Multiple risk factors contribute to cognitive impairment in children with β-thalassemia major. For a more refined understanding of this issue, we attempted to evaluate cognitive function in β-thalassemia major patients and identify the relationship between possible cognitive dysfunction and the following: demography, transfusion and chelation characteristics, iron overload, and disease complications. We studied 100 β-thalassemia major children and 100 healthy controls who matched well in terms of age, sex, and socioeconomic status. All participants underwent psychometric assessment using Wechsler Intelligence Scale for Children-Third Edition, Arabic version. The mean Full-Scale IQ and Performance IQ of patients were significantly lower than those of controls, whereas no significant difference was found for Verbal IQ. No significant relationship existed between IQ and any of the assessed parameters. We concluded that Performance IQ, not Verbal IQ, was significantly affected in β-thalassemia major patients, but there was no clear association between IQ and any of the parameters. © The Author(s) 2014.

  17. A brief review on newborn screening methods for hemoglobinopathies and preliminary results selecting beta thalassemia carriers at birth by quantitative estimation of the HbA fraction.

    Science.gov (United States)

    Mantikou, Eleni; Arkesteijn, Sandra G; Beckhoven van, Jaqueline M; Kerkhoffs, Jean-Louis; Harteveld, Cornelis L; Giordano, Piero Carlo

    2009-12-01

    We present in a brief summary the basic aspects of the most rational technologies used for new born screening (NBS) of the hemoglobinopathies and we report the preliminary results for the identification of beta-thalassemia carriers at birth by measuring the expression of the HbA fraction. Separation and measurement of the Hb fractions in 1.500 cord blood samples collected among the multi-ethnic Dutch population using different methods. By using a cut of thalassemia can be preselected at birth with a reasonable degree of sensitivity and be confirmed by parent analysis.

  18. Low-cost matched sibling bone marrow transplant for standard-risk thalassemia in a limited-resource setting

    Directory of Open Access Journals (Sweden)

    Stalin Ramprakash

    2017-12-01

    Full Text Available Thalassemias are the most common inherited genetic disorder in India and a major public health burden with bone marrow transplant (BMT considered the only established curative therapy. We describe outcomes for patients (n = 71 with standard-risk thalassemia (liver size 80 at the last follow up. 5 patients (7% died, mortality related to transplant. Enough data existed for 2 centers in India (36/71 transplants to analyze overall costs from admission up to one-year post-BMT which revealed a median cost of Rs 7,30,445 ($11519 [Range Rs 4,52,821–10,32,842 ($ 7079–16147]. In conclusion, children with thalassemia in resource limited settings can achieve good outcomes with BMT at a reasonable cost.

  19. Diagnostic Value of N Terminal Pro B Type Natriuretic Peptide (NT-pro BNP in Cardiac Involvement in Patients with Beta- Thalassemia

    Directory of Open Access Journals (Sweden)

    Noor Mohammad Noori

    2017-04-01

    Full Text Available Background Heart failure is a major cause of death in thalassemia. The study aimed to determine the diagnostic value of N Terminal Pro B Type Natriuretic Peptide (NT-pro BNP, to early diagnose the cardiac involvement in beta- thalassemia major patients. Materials and Methods  80 thalassemia patients aged 7 to 18 years old (patients group, and 80 healthy age and gender matched controls were enrolled in the case-control study. Patients were selected from those attending to the clinic of Aliasghar hospital, Zahedan-Iran. They were subjected to echo-Doppler tissue and conventional examination for both right and left heart function. Data were analysis using SPSS 18.0 software. Results  NT-pro BNP increased in patients compared the controls (P

  20. Community genetics and health approaches for bringing awareness in tribals for the prevention of beta-thalassemia in India

    Directory of Open Access Journals (Sweden)

    Ranbir S. Balgir

    2011-08-01

    Full Text Available Betathalassemia syndromes are a group of hereditary disorders characterized by a genetic deficiency in the synthesis of β-globin chains. In the homozygous state, β-thalassemia (i.e., thalassemia major causes severe transfusion-dependent anemia. Inherited β-thalassemia syndromes cause high degree of hemolytic anemia, recurrent fever, clinical jaundice, frequent infections, bossing of cheek bones, growth retardation, splenomegaly, etc. and are responsible for high infant morbidity, mortality and fetal wastage in India. The victims include the infants, growing children, adolescent girls, pregnant women and a large chunk of ignorant people. In view of heavy genetic load, frequent requirement of blood transfusions, high cost of treatment and management, physical trauma, and mental and psychological harassment to the patients and their families, it has been realized that preventive community health and genetics approach is the most suitable for India. After carrier detection, prenatal diagnosis, and genetic couselling are the important options for couples at high risk for β-thalassemia. A prerequisite for successful prevention and intervention approach in India is the health education, bringing public awareness, sensitization, and community screening for the identification of heterozygotes or carriers in the concerned community. Some suggestions for the prevention of β-thalassemia in the vulnerable communities of India have been over emphasized for amelioration.β地中海贫血综合症是一簇遗传性异常,其特点是β球蛋白链接合处基因缺失。β地贫(或重型地贫)在纯和状态下导致严重的输液依赖型贫血症。遗传性的β地贫综合症引起严重的溶血性贫血、回归热、显性黄疸、常见感染、疼痛危象、颊骨浮肿、生长迟缓、脾肿大等症状,这导致在印度出现婴儿高发病率、死亡率和胎儿夭折。其受害人群包括婴儿、发

  1. Beta-thalassemia- institution based analysis of ethnic and geographic distribution, effect of consanguinity and safety of chorionic villus sampling as a diagnostic, tool for pre-natal diagnosis in selected patients

    International Nuclear Information System (INIS)

    Abdullah, K.N.; Liaqat, J.; Azim, W.

    2011-01-01

    To study the ethnic and geographic distribution of Beta-thalassemia amongst the patients included and to study the effect of consanguinity in promoting this disease. Also, to establish the safety of CVS when used as a pre-natal diagnostic tool in aiding the early diagnosis of Beta-thalassemia in selected patients. Study Design: Descriptive Study. Place and Duration of Study: PNS Shifa Karachi, from Jan 2008 to Dec 2008. Patients and Methods: A total of 223 women out of 240 that were referred from all over Sindh to PNS Shifa Hospital Karachi for susceptible gene mutations participated in the study. The standard procedure that was used in this study was trans-abdominal aspiration of chorionic villi through suction needle. The samples were then sent for further analysis to the Pathology Department at PNS Shifa Hospital Karachi. Results: In our study population Beta-thalassemia was most prevalent in Sindhi 107 (48%) followed by Punjabi 46 (21%), 27 (12%) Pathan, and 43 (19%) Balochi. Out of 223 women, 95 were of thalassemia trait, while 85 were of thalassemia major. Fifty five percent of thalassemia trait and 56% of thalassemia major fetus parents were first cousins. The rate of pregnancy loss after performing CVS was 2.0% with no complications reported. Conclusion: It is concluded that highest percentage of thalassemia is in first cousins and sindhi origin families are mostly affected. However CVS is a safe and effective tool for prenatal diagnosis and subsequent counselling in selected couples. (author)

  2. Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major

    Science.gov (United States)

    Soman, Salil; Rosenfeld, David L; Roychowdhury, Sudipta; Drachtman, Richard A; Cohler, Alan

    2009-01-01

    We describe a 16 year-old male with β thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH). After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions and near complete resolution of his neurological symptoms. While EMH causing cord compression in adolescents is rare in the current era of bone marrow transplantation or chronic transfusions, it should be considered when thalassemia major patients present with neurological deficits. The well defined imaging features of EMH can play a central role in its diagnosis and management, especially because surgical and / or radiotherapeutic intervention are often considered in cases of failed medical treatment. PMID:22470615

  3. Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Alan COHLER

    2009-01-01

    Full Text Available We describe a 16 year-old male with ß thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH. After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions and near complete resolution of his neurological symptoms. While EMH causing cord compression in adolescents is rare in the current era of bone marrow transplantation or chronic transfusions, it should be considered when thalassemia major patients present with neurological deficits. The well defined imaging features of EMH can play a central role in its diagnosis and management, especially because surgical and / or radiotherapeutic intervention are often considered in cases of failed medical treatment.

  4. Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major

    OpenAIRE

    Soman, Salil; Rosenfeld, David L; Roychowdhury, Sudipta; Drachtman, Richard A; Cohler, Alan

    2009-01-01

    We describe a 16 year-old male with ß thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH). After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions a...

  5. Health related quality of life in Middle Eastern children with beta-thalassemia

    Directory of Open Access Journals (Sweden)

    Caocci Giovanni

    2012-06-01

    Full Text Available Abstract Background Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. Methods We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years. HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. Results The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002, Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015 and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047. HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046 and their parents (p = 0.007. Conclusions The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children’s HRQoL.

  6. Health related quality of life in Middle Eastern children with beta-thalassemia.

    Science.gov (United States)

    Caocci, Giovanni; Efficace, Fabio; Ciotti, Francesca; Roncarolo, Maria Grazia; Vacca, Adriana; Piras, Eugenia; Littera, Roberto; Markous, Raji Suleiman Dawood; Collins, Gary Stephen; Ciceri, Fabio; Mandelli, Franco; Marktel, Sarah; La Nasa, Giorgio

    2012-06-22

    Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL) in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years). HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL) 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002), Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015) and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047). HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046) and their parents (p = 0.007). The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children's HRQoL.

  7. STUDY OF SERUM HAPTOGLOBIN LEVEL AND ITS RELATION TO ERYTHROPOIETIC ACTIVITY IN BETA THALASSEMIA CHILDREN .

    Directory of Open Access Journals (Sweden)

    Seham Ragab

    2015-02-01

    Full Text Available Background  :Serum haptoglobin (Hp is a reliable marker for hemolysis regardless the inflammatory state.  Objective: We investigated the possible relation between Hp depletion and hemolysis severity, hepatitis C virus (HCV infection and iron load in β-thalassemia children. Methods: Twenty  two β-thalassemia major (TM ,20 β-thalassemia  intermedia (TI children with 20 age and sex matched healthy controls were involved. Pre-transfusion hemoglobin level was considered . Serum ferritin , Hp  and transferrin receptor  levels (sTfR  (by ELISA , alanine aminotransferase (ALT and  aspartate aminotransferase (AST  (by colorimetric method were assayed. Markers of hepatitis C virus  (HCV  were done by PCR. Results:  The mean Hp levels among the studied groups were as follows; 8.02 ± 0.93 (mg/dl , 8.6 ±0.72 (mg/dl  and 122  ± 18.5(mg/dl   for TM ,TI and the controls respectively . Both patient groups had significantly lower Hp level compared to the controls (P<0.0001  with significant lower level in TM compared to TI  children ( P= 0.034  .Significant inverse correlations were  found between serum Hp and sTfR levels in thalassemia children combined and in each group (TM and TI as well as among HCV infected children. STfR   was the only significant independent predictor for  serum Hp level (t= -5.585 , P<0.0001 . Among  HCV infected patients , no significant correlation was found between serum Hp and serum transaminases  .Conclusion:  Serum Hp depletion in thalassemia had significant relation to disease severity and correlated   well with their erythropoietic activity, as assessed by the measurement of  sTfR without significant relation  HCV infection . Large sample  multicenter studies are  recommended.

  8. Imaging features of thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Tunaci, M.; Tunaci, A.; Engin, G.; Oezkorkmaz, B.; Acunas, G.; Acunas, B. [Dept. of Radiology, Istanbul Univ. (Turkey); Dincol, G. [Dept. of Internal Medicine, Istanbul Univ. (Turkey)

    1999-07-01

    Thalassemia is a kind of chronic, inherited, microcytic anemia characterized by defective hemoglobin synthesis and ineffective erythropoiesis. In all thalassemias clinical features that result from anemia, transfusional, and absorptive iron overload are similar but vary in severity. The radiographic features of {beta}-thalassemia are due in large part to marrow hyperplasia. Markedly expanded marrow space lead to various skeletal manifestations including spine, skull, facial bones, and ribs. Extramedullary hematopoiesis (ExmH), hemosiderosis, and cholelithiasis are among the non-skeletal manifestations of thalassemia. The skeletal X-ray findings show characteristics of chronic overactivity of the marrow. In this article both skeletal and non-skeletal manifestations of thalassemia are discussed with an overview of X-ray findings, including MRI and CT findings. (orig.)

  9. The Correlation between Troponin and Ferritin Serum Levels in the Patients with Major Beta-Thalassemia

    Directory of Open Access Journals (Sweden)

    Iraj Shahramian

    2013-06-01

    Full Text Available Background: Thalassemia is a hereditary hemoglobinopathy whose most common complication is cardiac involvement which ends up in these patients’ death. Since troponin is a sensitive and specific marker for the detection of microinfarct, we studied the relationship between troponin and ferritin serum levels for early diagnosis of cardiac involvement in these patients. Materials and Methods: This case-control study was performed on 80 patients, including 40 patients with major thalassemia and normal echocardiography and 40 healthy volunteers ranging from 6 months to 16 years old. All the children were examined and the eligible children who were not infected with known heart disease, iron deficiency anemia, kidney disease, diabetes, fever, and systemic diseases were enrolled into the study after obtaining written informed consents from their parents. At 8:00 A.M. before breakfast, 5cc blood was drawn from these children. After collecting the samples, ferritin and troponin serum levels were evaluated using ELISA and electro- kymonolonsense methods, respectively. The gathered data were analyzed through the SPSS statistical software (v. 20 and T-test. Besides, P value<0.05 was considered as statistically significant. Results: The study results revealed a significant difference between the two groups regarding the mean of the serum levels of troponin (P=0.045 and ferritin (P=0.001. In this study, no significant correlation was observed between serum troponin and ferritin levels and age and BMI in the two groups. Also, no significant relationship was found between serum troponin level and sex (P=0.264. Conclusions: In microinfarct, troponin increases independent of ferritin; therefore, it can be used for early detection of cardiac involvement in thalassemia patients to determine the sub-clinical effects.

  10. Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

    Science.gov (United States)

    Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

    2012-01-01

    This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

  11. Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

    Directory of Open Access Journals (Sweden)

    Capretto L

    2012-01-01

    Full Text Available Lorenzo Capretto1, Stefania Mazzitelli2, Eleonora Brognara2, Ilaria Lampronti2, Dario Carugo1, Martyn Hill1, Xunli Zhang1, Roberto Gambari2, Claudio Nastruzzi31Engineering Sciences, University of Southampton, Southampton, UK; 2Department of Biochemistry and Molecular Biology, 3Department of Pharmaceutical Sciences, University of Ferrara, Ferrara, ItalyAbstract: This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH, based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of ß-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying ß-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol

  12. Consanguinity Ratio in Beta-Thalassemia Major Patients in District Bannu

    International Nuclear Information System (INIS)

    Khan, M. S.; Ahmed, M.; Khan, R. A.; Mushtaq, N.; Shah, M. W. U.

    2015-01-01

    Objective: To assess the frequency of consanguinity in b-thalassemia major patients and its association with age, gender and hepatitis C virus antibody positivity. Methods: The cross-sectional study was conducted from June 2013 to July 2014 at various hospitals of district Bannu in the North Western Khyber Pakhtunkhwa province of Pakistan. Data was recorded on a predesigned questionnaire. Results: Out of 180 subjects, 133(74 percent) parents were cousins, while 47(26 percent) were unrelated. The frequency of anti-hepatitis C virus antibody positivity was 14(7.77 percent). Conclusion: High prevalence of the disease in the study region was due to consanguineous marriages. (author)

  13. Bone marrow changes in beta-thalassemia major: quantitative MR imaging findings and correlation with iron stores

    International Nuclear Information System (INIS)

    Drakonaki, Eleni E.; Karantanas, Apostolos H.; Maris, Thomas G.; Papadakis, Alex

    2007-01-01

    The purpose of this study is to describe the MR imaging features of bone marrow in beta-thalassemia major and investigate their relation to ferritin, liver and spleen siderosis. Spinal bone marrow was prospectively assessed on abdominal MR studies of 40 transfused beta-thalassemic patients and 15 controls using T1-w, Pd, T2*-w Gradient Echo (GRE) and T1-w turbo Spin Echo (TSE) sequences. Signal intensity (SI) ratios of liver, spleen and bone marrow to paraspinous muscles (L/M, S/M, B/M respectively) and the respective T2 relaxation rates (1/T2) were calculated. Serum ferritin levels were recorded. Bone marrow hypointensity in at least T2*-w GRE sequence was noted in 29/40 (72.5%) patients. Eleven/40 patients exhibited normal B/M on all MR sequences. Five/40 patients had normal B/M and low L/M. B/M correlated with L/M in T1-w TSE sequence only (r = 0.471, p = 0.05). B/M correlated with S/M and mean ferritin values in all sequences (r > 0.489, p - 0.496, p < 0.03 respectively). Marrow 1/T2 did not correlate with ferritin values or liver and spleen 1/T2. B/M in transfused beta-thalassemic patients is related to splenic siderosis and ferritin levels. Although marrow is usually hypointense, it may occasionally display normal SI coexisting with liver hypointensity, a pattern typical of primary hemochromatosis. (orig.)

  14. Bone marrow changes in beta-thalassemia major: quantitative MR imaging findings and correlation with iron stores

    Energy Technology Data Exchange (ETDEWEB)

    Drakonaki, Eleni E.; Karantanas, Apostolos H. [University Hospital of Heraklion, Radiology Department, Heraklion, Crete (Greece); Maris, Thomas G. [University of Crete, Department of Medical Physics, Heraklion, Crete (Greece); Papadakis, Alex [Venizelion General Hospital, Heraklion, Crete (Greece)

    2007-08-15

    The purpose of this study is to describe the MR imaging features of bone marrow in beta-thalassemia major and investigate their relation to ferritin, liver and spleen siderosis. Spinal bone marrow was prospectively assessed on abdominal MR studies of 40 transfused beta-thalassemic patients and 15 controls using T1-w, Pd, T2*-w Gradient Echo (GRE) and T1-w turbo Spin Echo (TSE) sequences. Signal intensity (SI) ratios of liver, spleen and bone marrow to paraspinous muscles (L/M, S/M, B/M respectively) and the respective T2 relaxation rates (1/T2) were calculated. Serum ferritin levels were recorded. Bone marrow hypointensity in at least T2*-w GRE sequence was noted in 29/40 (72.5%) patients. Eleven/40 patients exhibited normal B/M on all MR sequences. Five/40 patients had normal B/M and low L/M. B/M correlated with L/M in T1-w TSE sequence only (r = 0.471, p = 0.05). B/M correlated with S/M and mean ferritin values in all sequences (r > 0.489, p < 0.01 and r > - 0.496, p < 0.03 respectively). Marrow 1/T2 did not correlate with ferritin values or liver and spleen 1/T2. B/M in transfused beta-thalassemic patients is related to splenic siderosis and ferritin levels. Although marrow is usually hypointense, it may occasionally display normal SI coexisting with liver hypointensity, a pattern typical of primary hemochromatosis. (orig.)

  15. alpha-thalassemia, HbS, and beta-globin gene cluster haplotypes in two Afro-Uruguayan sub-populations from northern and southern Uruguay

    Directory of Open Access Journals (Sweden)

    Julio A. da Luz

    2006-01-01

    Full Text Available Hemoglobinopathies are the most common monogenic disorders worldwide; however, they have never been systematically studied from a genetic perspective in Uruguay. In this study, we determined the frequencies of hemoglobin variants in Afro-Uruguayans. A sample of 52 healthy unrelated Afro-Uruguayans from the northern (N = 28 and southern (N = 24 regions of the country was analyzed. Eight individuals (15.4% were heterozygous for -alpha3,7thalassemia; seven of them (29.2% were originally from the southern region, whereas one of them (3.6% was from the northern region; the differences between both regions were statistically significant (p = 0.016 +/-0.003. The only structural mutation detected was betaS, which is typical of African populations. Four individuals (10% were heterozygous for betaS, three of them (13.6% from the South, and one (5.6% from the North. The betaS haplotypes were analyzed in eight individuals: two were homozygous betaS/betaS, two were heterozygous betaS/betathal, and four were heterozygous betaS/betaª. This haplotype distribution (60% Bantu, 20% Benin, and 20% Bantu A2 is in agreement with historical records reporting a predominantly Bantu origin for the enslaved Africans brought to Uruguay. Even though this is a preliminary study, due to the small sample size, our results are suggestive of a relatively high incidence of hemoglobinopathies in the Afro-Uruguayan population.

  16. Prevalence of anti HCV infection in patients with beta-thalassemia in Isfahan-Iran

    Directory of Open Access Journals (Sweden)

    Behrooz Ataei

    2012-01-01

    Conclusions: Our findings revealed that blood transfusion was the main risk factors for HCV infection among beta-thalassemic patients. Therefore, more blood donor screening programs and effective screening techniques are needed to prevent transmission of HCV infection among beta-thalassemic patients.

  17. Beta-Thalassemia Major and Female Fertility: The Role of Iron and Iron-Induced Oxidative Stress

    Science.gov (United States)

    Roussou, Paraskevi; Tsagarakis, Nikolaos J.; Diamanti-Kandarakis, Evanthia

    2013-01-01

    Endocrine complications due to haemosiderosis are present in a significant number of patients with beta-thalassemia major (BTM) worldwide and often become barriers in their desire for parenthood. Thus, although spontaneous fertility can occur, the majority of females with BTM is infertile due to hypogonadotropic hypogonadism (HH) and need assisted reproductive techniques. Infertility in these women seems to be attributed to iron deposition and iron-induced oxidative stress (OS) in various endocrine organs, such as hypothalamus, pituitary, and female reproductive system, but also through the iron effect on other organs, such as liver and pancreas, contributing to the impaired metabolism of hormones and serum antioxidants. Nevertheless, the gonadal function of these patients is usually intact and fertility is usually retrievable. Meanwhile, a significant prooxidants/antioxidants imbalance with subsequent increased (OS) exists in patients with BTM, which is mainly caused by tissue injury due to overproduction of free radicals by secondary iron overload, but also due to alteration in serum trace elements and antioxidant enzymes. Not only using the appropriate antioxidants, essential trace elements, and minerals, but also regulating the advanced glycation end products, could probably reduce the extent of oxidative damage and related complications and retrieve BTM women's infertility. PMID:24396593

  18. Deletion of a region that is a candidate for the difference between the deletion forms of hereditary persistence of fetal hemoglobin and deltabeta-thalassemia affects beta- but not gamma-globin gene expression.

    NARCIS (Netherlands)

    R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)

    1999-01-01

    textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch

  19. Assessment of status of thyroid function in patients of beta thalassemia major, reporting to OPD of military hospital, rawalpindi

    International Nuclear Information System (INIS)

    Jehanzeb, K.

    2016-01-01

    Objective: To determine the status of thyroid functions in patients of Beta Thalassemia Major, reporting to OPD of Military Hospital, Rawalpindi. Study Design: Descriptive cross sectional study. Place and Duration of Study: Paediatric Outpatients Department of Military Hospital, Rawalpindi from 1st Jan to 30th Jun 2012. Material and Methods: After taking informed consent from the parents of all the children fulfilling the inclusion criteria, detailed history was taken and blood samples were drawn by strict aseptic means. Samples taken from these patients included complete blood and thyroid profile (serum thyroxine T4, triiodothyronine T3 and thyroid stimulating hormone TSH). These blood samples were labeled and sent to Armed Forces Institute of Pathology (AFIP), Rawalpindi for analysis by enzyme-linked immunosorbent assay (ELISA). Primary hypothyroidism was defined by TSH levels >4IU/ml. Statistical analysis was done at the end of study using SPSS version 10. Significance for association was calculated using student t-test. Results: Sixty patients fulfilled the inclusion criteria out of these sixty four patients lost the follow up while 56 patients completed the study. Out of 56 patients, 21 (37.5 percent) had biochemical evidence of hypothyroidism. Mean Ferritin level was 3924 +- 1247ng/ml in hypothyroid and 3136 +- 1387ng/ml in euthyroid patients indicating a significant difference in mean serum ferritin levels between hypothyroid patients and others. Conclusion: The study demonstrates hypothyroidism in a significant number of hyper transfused Beta- thalassemic patients, emphasizing the importance of monitoring thyroid functions in thalassemic patients, particularly in those receiving suboptimal chelation. (author)

  20. Metastable beta limit in DIII-D

    International Nuclear Information System (INIS)

    La Haye, R.J.; Callen, J.D.; Gianakon, T.A.

    1997-06-01

    The long-pulse, slowly evolving single-null divertor (SND) discharges in DIII-D with H-mode, ELMs, and sawteeth are found to be limited significantly below (factor of 2) the predicted ideal limit β N = 4l i by the onset of tearing modes. The tearing modes are metastable in that they are explained by the neoclassical bootstrap current (high β θ ) destabilization of a seed island which occurs even if Δ' θ , there is a region of the modified Rutherford equation such that dw/dt > 0 for w larger than a threshold value; the plasma is metastable, awaiting the critical perturbation which is then amplified to the much larger saturated island. Experimental results from a large number of tokamaks indicate that the high beta operational envelope of the tokamak is well defined by ideal magnetohydrodynamic (MHD) theory. The highest beta values achieved have historically been obtained in fairly short pulse discharges, often <1-2 sawteeth periods and < 1-2 energy replacement times. The maximum operational beta in single-null divertor (SND), long-pulse discharges in DIII-D with a cross-sectional shape similar to the proposed ITER tokamak is found to be limited significantly below the threshold for ideal instabilities by the onset of resistive MHD instabilities

  1. Prevalence of hepatitis G virus in Pakistani children with transfusion dependent beta- thalassemia major.

    Science.gov (United States)

    Moatter, T; Adil, S; Haroon, S; Azeemuddin, S; Hassan, F; Khurshid, M

    1999-10-01

    We ought to obtain data on the prevalence of the newly discovered tranfusion transmittable hepatitis G virus in polytransfused b- thalassemia major children. Each individual had received multiple blood transfusions, from 12 to 36 per year. No documentation of prior hepatic infection was available. Serum samples were collected prospectively from the randomly selected subjects and were analyzed for HGV RNA by polymerase chain reaction using primer specific for two different regions of the HGV genome. Among the 100 individuals examined 21 were positive for HGV RNA. Four patients had evidence of dual infection, both HGV RNA and HCV RNA were isolated from their sera. While in one sample presence of both HGV RNA and HBV DNA was established. Only one child was positive for hepatitis E antibodies. The sera of 10 children were reactive for hepatitis B surface antigen whereas 35 individuals were positive for hepatitis C virus antibody. The ALT levels were variable in HGV infected children. Four out of 16 (25%) showed peak ALT levels of 218 IU/I, 8/16 (50%) children demonstrated slightly elevated ALT levels whereas 25% individuals showed normal ALT levels. Alkaline Phosphatase levels were elevated in 90% of the children and 20% patients of this series also had higher GGT levels. The observed AP levels were not statistically different among HGV, HGV/HCV or HGV/HBV groups. Even though the ALT levels were deranged in the children with HGV alone but none of the children had demonstrated symptoms of liver disease, their direct and total bilirubin levels were normal and no complain of jaundice was recorded. In conclusion, our findings suggested that like other blood borne hepatic viruses, HGV is also prevalent in the high risk group of multiple transfused patients in Pakistan but our results support the absence of any causal relationship between HGV and hepatitis.

  2. Metabolic and endocrinologic complications in beta-thalassemia major: a multicenter study in Tehran

    Directory of Open Access Journals (Sweden)

    Hashemi Reza

    2003-08-01

    Full Text Available Abstract Background The combination of transfusion and chelation therapy has dramatically extended the life expectancy of thalassemic patients. The main objective of this study is to determine the prevalence of prominent thalassemia complications. Methods Two hundred twenty patients entered the study. Physicians collected demographic and anthropometric data and the history of therapies as well as menstrual histories. Patients have been examined to determine their pubertal status. Serum levels of 25(OH D, calcium, phosphate, iPTH were measured. Thyroid function was assessed by T3, T4 and TSH. Zinc and copper in serum were determined by flame atomic absorption spectrophotometry. Bone mineral density (BMD measurements at lumbar and femoral regions have been done using dual x-ray absorptiometry. The dietary calcium, zinc and copper intakes were estimated by food-frequency questionnaires. Results Short stature was seen in 39.3% of our patients. Hypogonadism was seen in 22.9% of boys and 12.2% of girls. Hypoparathyroidism and primary hypothyroidism was present in 7.6% and 7.7% of the patients. About 13 % of patients had more than one endocrine complication with mean serum ferritin of 1678 ± 955 micrograms/lit. Prevalence of lumbar osteoporosis and osteopenia were 50.7% and 39.4%. Femoral osteoporosis and osteopenia were present in 10.8% and 36.9% of the patients. Lumbar BMD abnormalities were associated with duration of chelation therapy. Low serum zinc and copper was observed in 79.6% and 68% of the study population respectively. Serum zinc showed significant association with lumbar but not femoral BMD. In 37.2% of patients serum levels of 25(OH D below 23 nmol/l were detected. Conclusion High prevalence of complications among our thalassemics signifies the importance of more detailed studies along with therapeutic interventions.

  3. thalassemia induced hypercoagulability

    African Journals Online (AJOL)

    Subjects and methods: Venous blood samples were collected from ten normal control subjects and thirty patients with beta-thalassemia major (divided into two groups, splenectomized and unsplenectomized). To all studied individuals, plasma substance P and sP-selectin were assayed by an enzyme linked Immunosorbent ...

  4. Improved limits on beta(-) and beta(-) decays of Ca-48

    Czech Academy of Sciences Publication Activity Database

    Bakalyarov, A.; Balysh, A.; Barabash, AS.; Beneš, P.; Briancon, C.; Brudanin, V. B.; Čermák, P.; Egorov, V.; Hubert, F.; Hubert, P.; Korolev, NA.; Kosjakov, VN.; Kovalík, Alojz; Lebedev, NA.; Novgorodov, A. F.; Rukhadze, NI.; Štekl, NI.; Timkin, VV.; Veleshko, IE.; Vylov, T.; Umatov, VI.

    2002-01-01

    Roč. 76, č. 9 (2002), s. 545-547 ISSN 0021-3640 Institutional research plan: CEZ:AV0Z1048901 Keywords : beta decay * double beta decay * Ca-48 Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 1.483, year: 2002

  5. Interação entre Hb C [beta6(A3Glu>Lys] e IVS II-654 (C>T beta-talassemia no Brasil Hb C [beta6(A3Glu>Lys] and IVS II - 654 (C>T beta thalassemia interaction in Brazil

    Directory of Open Access Journals (Sweden)

    Claudia R. Bonini-Domingos

    2003-06-01

    Full Text Available Thalassemias are a heterogeneous group of inherited disorders characterized by a microcytic hypochromic anemia and an imbalance in the synthesis of the globin-chains. Hb C is the second most frequently variant of hemoglobin found in Brazil. The laboratory diagnosis of hemoglobinopathies, including thalassemias, is growing in importance, particularly because of an increasing requirement for neonatal diagnosis of abnormal hemoglobins. Screening tests were carried out using alkaline and acid electrophoresis, globin-chain analysis by cellulose acetate in alkaline pH, isoelectric focusing and HPLC. The molecular characterization was made by PCR-ASO for Hb C and beta thalassemia mutants. Large-scale screening and discriminative methodologies must provide information about the hemoglobin polymorphisms in Brazilian population. HPLC is a powerful tool in these cases. Molecular characterization is important to genetic counseling and clinical management, in particular for the Brazilian population that have an intense racial admixture, with great variability of hemoglobins. In this paper an association between Hb C and beta thalassemia (IVS-II-654 in a black family from Brazil was described.

  6. Improved treatment satisfaction and convenience with deferasirox in iron-overloaded patients with beta-Thalassemia: Results from the ESCALATOR Trial.

    Science.gov (United States)

    Taher, Ali; Al Jefri, Abdullah; Elalfy, Mohsen Saleh; Al Zir, Kusai; Daar, Shahina; Rofail, Diana; Baladi, Jean François; Habr, Dany; Kriemler-Krahn, Ulrike; El-Beshlawy, Amal

    2010-01-01

    Patient-reported outcomes of once-daily oral deferasirox (Exjade) in iron-overloaded patients with beta-thalassemia not achieving successful chelation with prior deferoxamine and/or deferiprone were investigated in a prospective, open-label, 1-year, multicenter study in the Middle East (ESCALATOR). The initial dose of deferasirox was 20 mg/kg/day, with subsequent dose adjustments. At baseline and the end of study (EOS), patients (n = 237) completed a 5-point rating scale for treatment satisfaction and convenience, and recorded time lost to treatment. At EOS, 90.7% of patients were 'satisfied'/'very satisfied' with their iron chelation therapy (ICT) versus 23.2% at baseline. 92.8% (EOS) versus 21.5% (baseline) of patients considered their therapy to be 'convenient'/'very convenient'. Time lost to therapy for daily activities was substantially reduced (3.2 +/- 8.6 [mean +/- SD; EOS] vs. 30.1 +/- 44.2 [baseline] h/month). Patients reported greater satisfaction and convenience, and lower impact on daily activities, with deferasirox than with previous ICT. This may help improve adherence to lifelong ICT in iron-overloaded beta-thalassemia patients. 2010 S. Karger AG, Basel.

  7. THE CERVICAL VERTEBRAL BONE MATURATION OF Hb E BETA THALASSEMIA PATIENTS OF DEUTEROMALAY AGED 9 – 14 YEARS

    Directory of Open Access Journals (Sweden)

    Loes D. Sjahruddin

    2006-04-01

    Full Text Available One of the growth indicators that can be used to assess a child’s developmental growth is through skeletal maturation. Skeletal maturity can be evaluated by using anatomical changes of the cervical vertebral bones observed on the lateral cephalometric radiographs. The purpose of this study was to determine the stage of cervical vertebrae maturation of Hb E β thalassemia patients by comparing the shape changes of the second to fourth cervical vertebrae bodies with a control group. The design of this study was cross sectional. The subjects were children with Hb E β thalassemia aged 9 – 14 years. The results showed that the retarded maturation of the cervical vertebrae in Hb E β thalassemia was not found in the subjects of pre-puberty age (9 – 11 years old, but in those of puberty age (12 – 14 years old.

  8. Extraosseous radiotracer uptake on bone scan in beta-thalassemia: report of one case; Fixation extraosseuse du radiotraceur lors de la realisation d'une scintigraphie du squelette chez un patient atteint de beta-thalassemie: a propos d'un cas

    Energy Technology Data Exchange (ETDEWEB)

    Guezguez, M.; Nouira, M.; Sfar, R.; Chatti, K.; Ben Fradj, M.; Ben Ali, K.; Ajmi, S.; Essabbah, H. [CHU Sahloul, Service de Medecine Nucleaire, Sousse (Tunisia); Zrour, S. [EPS F. Bourguiba, Service de Rhumatologie, Monastir (Tunisia)

    2009-10-15

    Red blood cell transfusion, main therapeutic modality of beta-thalassemia, leads to iron overload which may perturb several metabolic ways. The aim of this paper is to illustrate the uptake abnormalities observed on bone scan of thalassaemic patients and to discuss mechanisms of extraosseous accumulation of the radiopharmaceutical in this pathology. We report a 16-year-old child suffering from beta-thalassemia major undergoing transfusion therapy. A bone scan was indicated to look for osseous infection. This study revealed a little skeletal uptake and abnormal liver, splenic and renal accumulation. A repeat bone scan, performed three weeks later showed a better skeletal uptake which enabled the discovery of focal abnormalities and made the diagnostic easier. The effect of iron overload on radiopharmaceuticals uptake in bone scan is known since 1975. Dissociation of {sup 99m}Tc from the carrier ligand due to the presence of iron excess seems the most plausible hypothesis. Free {sup 99m}Tc can be bound to other tissular substrates which can explain extraosseous uptake. The normally available pool for bone is reduced and then the skeletal uptake decreased. This report limits considerably the sensitivity of the bone scan. A well-led iron chelation and eventually the use of diuretic drug may guarantee a better quality of bone scan images. (authors)

  9. Evaluation of the BeTha gene 1 kit for the qualitative detection of the eight most common Mediterranean beta-thalassemia mutations.

    Science.gov (United States)

    Ugozzoli, L A; Lowery, J D; Reyes, A A; Lin, C I; Re, A; Locati, F; Galanello, R; Macioni, L; Maggio, A; Giambona, A; Loutradi, A; Boussiou, M; Wallace, R B

    1998-11-01

    We describe the evaluation of the Bio-Rad BeTha Gene 1 kit (Bio-Rad Laboratories, Hercules, CA), a DNA-probe assay designed for the qualitative determination of the eight most common Mediterranean beta-thalassemia mutations. The kit utilizes the principle of allele-specific oligonucleotide (ASO) hybridization. Following sample preparation and in vitro DNA amplification by the polymerase chain reaction (PCR), an allele-specific detection of the amplified products by a nonradioactive enzymatic assay is performed. Genomic DNA is prepared from an individual's whole blood with a DNA purification matrix. In a second step, the beta-globin gene is amplified in a multiplex PCR reaction containing four 5' biotinylated oligonucleotide primers. In a final step, an aliquot of the PCR reaction is first chemically denatured and then captured in two eight-well strips of a 96-well enzyme-linked immunosorbent assay (ELISA) plate by hybridization to an immobilized ASO probe. Each DNA sequence at each of the eight mutation sites is represented by one normal and one mutant ASO. During this capture/hybridization step, which is performed at 37 degrees C, only perfectly matched PCR products will be captured by an ASO. Subsequently, the allele-specific captured biotin-labeled PCR products are detected by a colorimetric enzymatic reaction. The system permits the detection of 16 beta-thalassemia alleles using a high-throughput format that can be automated easily. A clinical feasibility study was performed to evaluate the functionality (method comparison study, assay validity using samples previously collected and stored at various temperatures for different periods of time, interference on kit performance, and assay validity for prenatal diagnosis) and the usability (ease of use, sample throughput) of the kit. The analysis of 110 samples previously studied with reference methods showed 100% clinical sensitivity and specificity. We demonstrate here that the procedure not only increases the

  10. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    Science.gov (United States)

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

  11. Non-transfusion-dependent thalassemias

    Science.gov (United States)

    Musallam, Khaled M.; Rivella, Stefano; Vichinsky, Elliott; Rachmilewitz, Eliezer A.

    2013-01-01

    Non-transfusion-dependent thalassemias include a variety of phenotypes that, unlike patients with beta (β)-thalassemia major, do not require regular transfusion therapy for survival. The most commonly investigated forms are β-thalassemia intermedia, hemoglobin E/β-thalassemia, and α-thalassemia intermedia (hemoglobin H disease). However, transfusion-independence in such patients is not without side effects. Ineffective erythropoiesis and peripheral hemolysis, the hallmarks of disease process, lead to a variety of subsequent pathophysiologies including iron overload and hypercoagulability that ultimately lead to a number of serious clinical morbidities. Thus, prompt and accurate diagnosis of non-transfusion-dependent thalassemia is essential to ensure early intervention. Although several management options are currently available, the need to develop more novel therapeutics is justified by recent advances in our understanding of the mechanisms of disease. Such efforts require wide international collaboration, especially since non-transfusion-dependent thalassemias are no longer bound to low- and middle-income countries but have spread to large multiethnic cities in Europe and the Americas due to continued migration. PMID:23729725

  12. Increase in beta limit in tokamak plasmas

    International Nuclear Information System (INIS)

    Kamada, Yutaka

    2003-01-01

    This paper reviews recent studies of tokamak MHD stability towards the achievement of a high beta steady-state, where the profile control of current, pressure, and rotation, and the optimization of the plasma shape play fundamental roles. The key instabilities include the neoclassical tearing mode, the resistive wall mode, the edge localized mode, etc. In order to demonstrate an economically attractive tokamak reactor, it is necessary to increase the beta value simultaneously with a sufficiently high integrated plasma performance. Towards this goal, studies of stability control in self-regulating plasma systems are essential. (author)

  13. Limiting beta of stellarators with no net current

    International Nuclear Information System (INIS)

    Strauss, H.R.; Monticello, D.A.

    1981-01-01

    Using reduced nonlinear MHD equations, we find finite beta, resistive, l = 2 stellarator equilibria with no net current. We then investigate stability to low mode number internal MHD modes, and find beta limits comparable to tokamaks. Low shear equilibria appear to be substantially more stable than high shear

  14. Prospective evaluation of patient-reported outcomes during treatment with deferasirox or deferoxamine for iron overload in patients with beta-thalassemia.

    Science.gov (United States)

    Cappellini, Maria Domenica; Bejaoui, Mohamed; Agaoglu, Leyla; Porter, John; Coates, Thomas; Jeng, Michael; Lai, Maria Eliana; Mangiagli, Antonio; Strauss, Gabriele; Girot, Robert; Watman, Nora; Ferster, Alina; Loggetto, Sandra; Abish, Sharon; Cario, Holger; Zoumbos, Nicolaos; Vichinsky, Elliott; Opitz, Herbert; Ressayre-Djaffer, Catherine; Abetz, Linda; Rofail, Diana; Baladi, Jean-Francois

    2007-05-01

    Iron chelation therapy (ICT) with deferoxamine (DFO), the current standard for the treatment of iron overload in patients with transfusion-dependent disorders such as beta-thalassemia, requires regular subcutaneous or intravenous infusions. This can lead to reduced quality of life and poor adherence, resulting in increased morbidity and mortality in iron-overloaded patients with beta-thalassemia. Deferasirox is an orally administered iron chelator that has been approved for use in the United States, Switzerland, and other countries. This analysis was conducted to compare patient-reported outcomes (PROs) during receipt of DFO infusions or once-daily oral therapy with deferasirox (ICL670). PROs were prospectively evaluated as part of a randomized, Phase III study comparing the efficacy and safety profile of DFO 20 to 60 mg/kg per day with those of deferasirox 5 to 30 mg/kg per day in patients (age > or =2 years) with beta-thalassemia who were receiving regular transfusions and had a liver iron concentration of > or =2 mg/g dry weight. PRO questionnaires were completed by patients or a parent or legal guardian at baseline, week 4, week 24, and end of study (EOS). Patients assessed their level of satisfaction with study treatment (very satisfied, satisfied, neutral, dissatisfied, or very dissatisfied) and rated its convenience (very convenient, convenient, neutral, inconvenient, or very inconvenient). Time lost from normal activities due to ICT in the previous 4 weeks was recorded using a single global assessment. At week 4, patients who had previous experience with DFO were asked to indicate their preference for treatment (ICT received before the study, ICT received during the study, no preference, or no response) and the reason for that preference. At EOS, all patients were asked if they would be willing to continue using the ICT they had received during the study. All study analyses were performed in all patients who received at least 1 dose of study medication

  15. Hemochromatosis C282Y gene mutation as a potential susceptibility factor for iron-overload in Egyptian beta-thalassemia patients

    Directory of Open Access Journals (Sweden)

    G.M. Mokhtar

    2018-04-01

    Full Text Available Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene’s mutation especially the C282Y mutation. The interaction between hemoglobin chain synthesis’ disorders and the C282Y mutation may worsen the clinical picture of beta-thalassemia major (β-TM. Aim: To establish the prevalence of the C282Y mutations in Egyptian β-TM patients and to address its adverse effects. Methods: Two-hundred and five β-TM patients were recruited and divided into two groups based on their serum ferritin (SF; group I (N = 125 (SF ≤ 2500 ng/dl and group II (N = 80 (SF > 2500 ng/dl. All patients were subjected to clinical and laboratory assessment with special emphasis on iron overload complications. Genotyping was assessed by polymerase chain reaction for detection of C282Y mutation in HFE gene. Results: The C282Y mutation was not detected in the studied β-TM neither in homozygous nor heterozygous state. There were several iron overload complications including cardiac complication (9.1%, liver disease (36.6%, delayed puberty (56.6%, primary (35.71% and secondary amenorrhea (21.42%, short stature (27.3%, diabetes (3.4%, neutropenia (9.7%, arthralgia (10.2%, gastrointestinal (21.1%, depression (2.9% and others (12.05%. Group I showed a statistically significant lower rate of taking iron-rich diet when compared to group II. Group II showed significant longer mean duration of disease, higher total transfusion rate per life, lower mean HbF% level, higher mean HbA% level, and higher rate of elevated liver enzymes than patients with SF ≤ 2500 ng/dl. Conclusion: The C282Y mutation was not detected in the studied cohort of Egyptian β-TM patients neither in homozygous nor heterozygous state in spite of manifestations of iron overload complications. Keywords: Beta-thalassemia major, Hereditary hemochromatosis, The C282Y mutation, Iron overload complications, Egyptian

  16. Beta limit of resistive plasma in Torsatron / Heliotron

    International Nuclear Information System (INIS)

    Itoh, K.; Ichiguchi, K.; Itoh, S.I.

    1992-02-01

    Stability against the interchange mode in the Torsatron / Heliotron device is investigated, taking into account the effects of the resistivity, current diffusivity, ion viscosity and thermal diffusivity. Critical beta for the low-mode-number stability is found at the finite beta value. For the range of plasma parameters of the present experiments, the resistive mode and current diffusive mode set comparable critical beta values, which are consistent with experimental observations. In future high temperature plasmas, the current diffusive mode determines the stability limit for the global mode. (author)

  17. Facts about Thalassemia

    Science.gov (United States)

    ... CDC’s Work Related Information UDC System Basics About Thalassemia Recommend on Facebook Tweet Share Compartir Did You ... to death. What are the different types of thalassemia? When we talk about different “types” of thalassemia, ...

  18. Thalassemia: Healthy Living

    Science.gov (United States)

    ... Thalassemia” More What can a person living with thalassemia do to stay healthy? A healthy lifestyle is ... disorder”, as well as making healthy choices. Managing Thalassemia Thalassemia is a treatable disorder that can be ...

  19. Development of a PCR/LDR/capillary electrophoresis assay with potential for the detection of a beta-thalassemia fetal mutation in maternal plasma.

    Science.gov (United States)

    Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li

    2010-08-01

    Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.

  20. High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group.

    Science.gov (United States)

    Tan, Jin-Ai Mary Anne; Lee, Ping-Chin; Wee, Yong-Chui; Tan, Kim-Lian; Mahali, Noor Fadzlin; George, Elizabeth; Chua, Kek-Heng

    2010-01-01

    Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.

  1. Identification of low frequency anti-erythrocyte antibodies in chronically transfused patient with beta-thalassemia: a case report

    Directory of Open Access Journals (Sweden)

    Ana Rúbia Magalhães Ferreira

    2015-02-01

    Full Text Available The rate of erythrocyte alloimmunization in tranfusion-dependent patients can reach 50%, although the frequency of clinically relevant antibodies in transfused patients is not fully known, it is estimated that about 1% of patients are sensitized to each unit of transfused RBCs. The aim of this study is to report the case of  an 11-year-old girl with ?-thalassemia major, chronically transfused, which was detected in pre-transfusion protocol, the presence of two rare anti-erythrocyte antibodies: anti-Colton b (anti-Cob and anti-Lutheran 14 (anti-Lu14. To survey the clinical and laboratory patient history, research records filed in the archives of the university hospital in which the patient is monitored system was performed. The phenotyping erythrocyte in multitransfused patients is essential to decrease the risk of complications due to alloimmunization and estimate the availability of compatible blood. Thus, the report of this case may contribute to increase knowledge about of the real frequency of uncommon anti-erythrocyte antibodies in thalassemic patients.

  2. Nonsense-mediated decay mechanism is a possible modifying factor of clinical outcome in nonsense cd39 beta thalassemia genotype

    Directory of Open Access Journals (Sweden)

    Maria Concetta Renda

    2012-11-01

    Full Text Available Nonsense-mediated mRNA decay (NMD is a surveillance system to prevent the synthesis of non-functional proteins. In β-thalassemia, NMD may have a role in clinical outcome. An example of premature translation stop codons appearing for the first time is the β-globin cd39 mutation; when homozygous, this results in a severe phenotype. The aim of this study was to determine whether the homozygous nonsense cd39 may have a milder phenotype in comparison with IVS1,nt110/cd39 genotype. Genotypes have been identified from a cohort of 568 patients affected by β-thalassemia. These genotypes were compared with those found in 577 affected fetuses detected among 2292 prenatal diagnoses. The nine most common genotypes, each with an incidence rate of 1.5% or over, and together accounting for 80% of genotype frequencies, underwent statistical analysis. Genotype prevalence was calculated within the overall group. Results are expressed as proportions with 95% confidence intervals; P≤0.05 was considered statistically significant. A binomial distribution was assumed for each group; z-tests were used to compare genotype frequencies observed in the patient group with frequencies in the affected fetus group. In the absence of selecting factors, prevalence of these two genotypes was compared between a cohort of 568 β-thalassemia patients (PTS and 577 affected fetuses (FOET detected during the same period. IVS1,nt110/cd39 was significantly more prevalent in FOET than PTS (P<0.0001, while there was no significant difference in prevalence of cd39/cd39 in FOET compared with PTS (P=0.524. These results suggest a cd39 genotype NMD mechanism may be associated with improved clinical outcomes in thalassemia major. 无义介导的mRNA 降解(NMD) 是一种预防非功能性蛋白质合成的监控系统。在β地中海贫血中,NMD可能对临床结果有影响。第一次出现的过早终止密码子(PTC)为β珠蛋白cd39突变;若为纯合

  3. Pathophysiology and treatment of patients with beta-thalassemia – an update [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Eitan Fibach

    2017-12-01

    Full Text Available Thalassemia (thal is an autosomal recessive, hereditary, chronic hemolytic anemia due to a partial or complete deficiency in the synthesis of α-globin chains (α-thal or β-globin chains (β-thal that compose the major adult hemoglobin (α2β2. It is caused by one or more mutations in the corresponding genes. The unpaired globin chains are unstable; they precipitate intracellularly, resulting in hemolysis, premature destruction of red blood cell [RBC] precursors in the bone marrow, and a short life-span of mature RBCs in the circulation. The state of anemia is treated by frequent RBC transfusions. This therapy results in the accumulation of iron (iron overload, a condition that is exacerbated by the breakdown products of hemoglobin (heme and iron and the increased iron uptake for the chronic accelerated, but ineffective, RBC production. Iron catalyzes the generation of reactive oxygen species, which in excess are toxic, causing damage to vital organs such as the heart and liver and the endocrine system. Herein, we review recent findings regarding the pathophysiology underlying the major symptoms of β-thal and potential therapeutic modalities for the amelioration of its complications, as well as new modalities that may provide a cure for the disease.

  4. Beta limit due to resistive instabilities in T-10

    International Nuclear Information System (INIS)

    Kislov, D.A.; Esipchuk, Yu.V.; Kirneva, N.

    2001-01-01

    Soft beta limiting phenomena have been observed in T-10 in ECRH heated plasmas. Neoclassical tearing modes are supposed to be responsible for the beta limitation. The MHD onset was observed at high β p but low β N values. Critical β has been found to be almost independent of collisionality parameter ν e *. Sawtooth stabilization by ECCD does not result in an increase of critical β. Dependence of the critical β on the q(r) profile (modified by ECCD) has been observed. (author)

  5. Effect of beta limits on reactor performance in EBT

    International Nuclear Information System (INIS)

    Uckan, N.A.; Spong, D.A.; Nelson, D.B.

    1981-01-01

    Because of uncertainties in extrapolating results of simplified models to a reactor plasma, the parameters that influence the beta limits cannot be determined accurately at the present time. Also, the reasonable changes within the models and/or assumptions are seen to affect the core beta limits by almost an order of magnitde. Hence, at the present, these limits cannot be used as a rigid (and reliable) requirement for ELMO Bumpy Torus (EBT) reactor engineering considerations. However, sensitivity studies can be carried out to determine the boundaries of the operating regime and to demonstrate the effects of various modes, assumptions, and models on reactor performance (Q value). First, the modes believed to limit the core β and ring plasma performance are discussed, and the simplifications and/or assumptions involved in deriving these limits are highlighted. Then, the implications of these limits for a reactor are given

  6. Hypertriglyceridemia Thalassemia Syndrome: Common Disease, Uncommon Association.

    Science.gov (United States)

    Das, Lipsa; Samprathi, Madhusudan; Shukla, Umesh; Bandyopadhyay, Debapriya; Das, Rashmi Ranjan

    2016-07-01

    Hypertriglyceridemia has been rarely described with thalassemia, an entity called hypertriglyceridemia-thalassemia syndrome. The authors describe a young infant diagnosed with thalassemia major with severe hypertriglyceridemia. The presence of severe hypertriglyceridemia in this child which rapidly resolved after transfusion, probably suggests a self limited mechanism which may not require therapy. Though hypertriglyceridemia has been reported with hemolytic anemias, the mechanism is unclear. This case illustrates that thalassemia may be associated with hypertriglyceridemia; once familial and secondary causes are ruled out, clinicians may wait for spontaneous resolution before considering specific therapy.

  7. Comparison of right and left side heart functions in patients with thalassemia major, patients with thalassemia intermedia, and control group.

    Science.gov (United States)

    Noori, Noormohammad; Mohamadi, Mehdi; Keshavarz, Kambiz; Alavi, Seyed Mostafa; Mahjoubifard, Maziar; Mirmesdagh, Yalda

    2013-01-01

    Heart disease is the main cause of mortality and morbidity in patients with beta thalassemia, rendering its early diagnosis vital. We studied and compared echocardiographic findings in patients with beta thalassemia major, patients with beta thalassemia intermedia, and a control group. Eighty asymptomatic patients with thalassemia major and 22 asymptomatic cases with thalassemia intermedia (8-25 years old) were selected from those referred to Ali Asghar Hospital (Zahedan-Iran) between June 2008 and June 2009. Additionally, 80 healthy individuals within the same age and sex groups were used as controls. All the individuals underwent echocardiography, the data of which were analyzed with the Student t-test. The mean value of the pre-ejection period/ejection time ratio of the left ventricle during systole, the diameter of the posterior wall of the left ventricle during diastole, the left and right isovolumic relaxation times, and the right myocardial performance index in the patients with beta thalassemia major and intermedia increased significantly compared to those of the controls, but the other parameters were similar between the two patient groups. The mean values of the left and right pre-ejection periods, left ventricular end systolic dimension, and left isovolumic contraction time in the patients with thalassemia intermedia increased significantly compared to those of the controls. In the left side, myocardial performance index, left ventricular mass index, isovolumic contraction time, and deceleration time exhibited significant changes between the patients with thalassemia major and those with thalassemia intermedia, whereas all the echocardiographic parameters of the right side were similar between these two groups. The results showed that the systolic and diastolic functions of the right and left sides of the heart would be impaired in patients with thalassemia major and thalassemia intermedia. Consequently, serial echocardiography is suggested in

  8. Beta limits in EBT and their implications for a reactor

    International Nuclear Information System (INIS)

    Uckan, N.A.; Spong, D.A.; Nelson, D.B.

    1982-01-01

    Theoretical models indicate limits on core beta ranging from a few percent to 10-20% depending on the models and/or assumptions. Some of the parameters that enter into these beta limits are: the ratio of the ring radial scale length to the average radius of curvature, epsilon=Δ/Rsub(c); the ratio of the cold to the hot plasma density, fsub(R)=nsub(cold)/nsub(hot); the ratios of the hot electron drift frequency to the ion cyclotron frequency, ωsub(dh)/ωsub(ci), and to the drift Alfven frequency ωsub(dh)/kVsub(A); the ratio of the ring electron temperature to the core ion temperature, Tsub(R)/Tsub(i); the ring beta βsub(R); etc. Because of uncertainties in extrapolating results of simplifield models to a reactor plasma, the above parameters that influence the beta limits cannot be determined accurately at the present time. Also, reasonable changes within the models and/or assumptions are seen to affect the core beta limits by almost an order of magnitude. Hence, at the present, these limits cannot be used as a rigid (and reliable) requirement for ELMO Bumpy Torus (EBT) reactor engineering considerations. However, sensitivity studies can be carried out to determine the boundaries of the operating regime and to demonstrate the effects of various modes, assumptions, and models on reactor performance (Q value). First the modes believed to limit the core β and ring plasma performance are discussed, and the simplifications and/or assumptions involved in deriving these limits are highlighted. Then, the implications of these limits for a reactor are given. (author)

  9. Alpha Thalassemia (For Parents)

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Alpha Thalassemia KidsHealth / For Parents / Alpha Thalassemia What's in this ... Symptoms Diagnosis Treatment Print en español Alfa talasemia Thalassemias Thalassemias are a group of blood disorders that ...

  10. Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system.

    Science.gov (United States)

    Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang

    2015-05-01

    The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.

  11. The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Mohammad Soleiman Soltanpour

    2018-01-01

    Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

  12. Comparing prevalence of Iron Deficiency Anemia and Beta Thalassemia Trait in microcytic and non-microcytic blood donors: suggested algorithm for donor screening

    Directory of Open Access Journals (Sweden)

    Tiwari Aseem

    2009-01-01

    Full Text Available Background: The prevalence of microcytosis in donors and Iron Deficiency Anemia (IDA and Beta-Thalassemia trait (BTT in microcytic and non-microcytic donors has not been studied in India. The present study aims at finding the same. Materials and Methods: Initially 925 donor samples were evaluated on cell-counter. Of these, 50 were found to be microcytic. These were subjected to Ferritin and HbA2 determination. Subsequently, an additional 51, age-and-sex matched non-microcytic donor samples were selected to serve as controls. These were subjected to the same tests. Results: The prevalence of microcytosis was 5.4% (50/925. Among the microcytic donors, 52% were IDA, 36% BTT, 8% both, and 4% none. In case of non-microcytic donors 29.4% were IDA, 3.9% BTT, and 66.7% none. Conclusions: The study revealed a high prevalence of IDA and BTT in blood donors and a higher probability of finding these in the microcytic samples. This prompted authors to suggest an algorithm for screening of blood donors for IDA and BTT. The algorithm recommends doing an hemogram on all donor samples, routinely. Ferritin could be done only in microcytic samples. At levels lower than15 ng/ml, it is diagnosed as IDA, and therefore, HPLC is performed only for non-IDA samples with Ferritin levels higher than 15 ng/ml. By employing this algorithm, a substantial number of IDA and BTT could be diagnosed while keeping the number of Ferritin tests small and the number of HPLC tests even smaller and thus making it cost efficient.

  13. Parathyroid hormone in pediatric patients with β-thalassemia major ...

    African Journals Online (AJOL)

    The aim of the study is to estimate the level of serum parathyroid hormone and its relation to bone mineral density in transfusion dependent beta-thalassemia major children. Subjects and methods: We measured serum calcium, phosphorus and parathyroid hormone in a sample of pediatric patients with thalassemia, ...

  14. Coinheritance of Β-Thalassemia and Sickle Cell Anaemia

    African Journals Online (AJOL)

    GB

    2016-11-06

    Nov 6, 2016 ... ABSTRACT. BACKGROUND: Genes for haemoglobin S are found in high frequencies in Nigeria. However, there is little information on beta thalassemia in sickle cell anaemia in this population. The clinical presentation of HbS- β thalassemia is enormously variable, ranging from an asymptomatic state to a ...

  15. Diabetes mellitus complicating β-thalassemia: a case report

    African Journals Online (AJOL)

    A case of beta-thalassemia major complicated by diabetes mellitus in a Fiji national is presented. The mechanisms involved in the pathogenesis of this complication are highlighted. Keywords: β-thalassemia, diabetes mellitus, iron overload. Annals of African Medicine Vol.2(1) 2003: 36-38 ...

  16. Thalassemia major and consanguinity in Shiraz city, Iran.

    Science.gov (United States)

    Asadi-Pooya, Ali Akbar; Doroudchi, Mehrnoosh

    2004-09-05

    Beta-thalassemia is among the most common genetic disorders in the world and in Iran, with widespread occurrence. A cross-sectional study on 648 beta-thalassemia patients in Shiraz, Iran was carried out to determine the demography of beta-thalassemia major in Shiraz city, Fars province, Iran and also the rate of consanguinity and the significance of pre-marriage counseling in decreasing familial marriages and consequently preventing this autosomal recessive genetic disease. All interviewed patients had thalassemia major and their age, sex, and the consanguinity between parents were recorded. 40.6% of beta-thalassemia patients were outcomes of first-cousin marriages. Comparison of the percentages of familial marriages (consanguinity) between parents of beta-thalassemia patients and a sample of normal population, revealed a statistically significant difference (pmarriages among thalassemic families, however, more education and awareness of young women and men about the increased risk of beta-thalassemia after familial marriage through pre-marriage counseling is still necessary.

  17. Limits on Tensor Coupling from Neutron $\\beta$-Decay

    OpenAIRE

    Pattie Jr, Robert W.; Hickerson, Kevin P.; Young, Albert R.

    2013-01-01

    Limits on the tensor couplings generating a Fierz interference term, b, in mixed Gamow-Teller Fermi decays can be derived by combining data from measurements of angular correlation parameters in neutron decay, the neutron lifetime, and $G_{\\text{V}}=G_{\\text{F}} V_{ud}$ as extracted from measurements of the $\\mathcal{F}t$ values from the $0^{+} \\to 0^{+}$ superallowed decays dataset. These limits are derived by comparing the neutron $\\beta$-decay rate as predicted in the standard model with t...

  18. The Hemoglobin E Thalassemias

    Science.gov (United States)

    Fucharoen, Suthat; Weatherall, David J.

    2012-01-01

    Hemoglobin E (HbE) is an extremely common structural hemoglobin variant that occurs at high frequencies throughout many Asian countries. It is a β-hemoglobin variant, which is produced at a slightly reduced rate and hence has the phenotype of a mild form of β thalassemia. Its interactions with different forms of α thalassemia result in a wide variety of clinical disorders, whereas its coinheritance with β thalassemia, a condition called hemoglobin E β thalassemia, is by far the most common severe form of β thalassemia in Asia and, globally, comprises approximately 50% of the clinically severe β-thalassemia disorders. PMID:22908199

  19. β-Thalassemia Intermedia: A Bird’s-Eye View

    Directory of Open Access Journals (Sweden)

    Anthony Haddad

    2014-03-01

    Full Text Available Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison

  20. β-Thalassemia Intermedia: A Bird’s-Eye View

    Science.gov (United States)

    Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

    2014-01-01

    Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe

  1. β-Thalassemia Intermedia: A Bird's-Eye View.

    Science.gov (United States)

    Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

    2014-03-01

    Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum's extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia

  2. Studies on limiter confined toroidal plasma in BETA

    International Nuclear Information System (INIS)

    Bera, D.; Reddy, C.; Jayakumar, R.; Kaw, P.K.

    1984-01-01

    Plasma equilibrium and stability in the presence of a toroidal magnetic field and a poloidal limiter is being studied experimentally in the BETA experiment. In a simple toroidal magnetic field, plasma cannot be in equilibrium because of the effect of the magnetic field curvature, which tends to expand the plasma. The electric field, which causes this expansion, is short circuited if a poloidal conducting limiter is placed and this brings about a quasi-equilibrium. In the model the charge separation current flows on the surface of the plasma and closes the path by flowing parallel to the magnetic field away from the limiter and transverse to the field at the limiter. For such an equilibrium, the vertical pressure profile is expected to be uniform, while the radial pressure profile is determined by transport. Such a profile is unstable to Rayleigh-Taylor instabilities, if the magnetic field gradient and the pressure gradient have the same sense

  3. High density regimes and beta limits in JET

    International Nuclear Information System (INIS)

    Smeulders, P.

    1990-01-01

    Results are first presented on the density limit in JET discharges with graphite (C), Be gettered graphite and Be limiters. There is a clear improvement in the case of Be limiters. The Be gettered phase showed no increase in the gas fueled density limit, except with Ion Cyclotron Resonance Heating (ICRH), but, the limit changed character. During MARFE-formation, any further increase in density was prevented, leading to a soft density limit. The soft density limit was a function of input power and impurity content with a week dependence on q. Helium and pellet fuelled discharges exceeded the gas-fuelled global density limits, but essentially had the same edge limit. In the second part, results are presented of high β operation in low-B Double-Null (DN) X-point configurations with Be-gettered carbon target plates. The Troyon limit was reached during H-mode discharges and toroidal β values of 5.5% were obtained. At high beta, the sawteeth were modified and characterised by very rapid heat-waves and fishbone-like pre- and post-cursors with strongly ballooning character. 17 refs., 5 figs

  4. Beta limitation of matter-antimatter boundary layers

    International Nuclear Information System (INIS)

    Lehnert, B.

    1987-08-01

    A model has earlier been proposed for a boundary layer which separates a cloud of matter from one of antimatter in a magnetized ambiplasma. In this model steady pressure equilibrium ceases to exist when a certain beta limit is exceeded. The latter is defined as the ratio between the ambiplasma and magnetic field pressures which balance each other in the boundary layer. Thus, at an increasing density, the high-energy particles created by annihilation within the layer are 'pumped up' to a pressure which cannot be balanced by a given magnetic field. The boundary layer then 'disrupts'. The critical beta limit thus obtained falls within the observed parameter ranges of galaxies and other large cosmical objects. Provided that the considered matter-antimatter balance holds true, this limit is thus expected to impose certain existence conditions on matter-antimatter boundary layers. Such a limitation may apply to certain cosmical objects and cosmological models. The maximum time scale for the corresponding disruption development has been estimated to be in the range from about 10 -4 to 10 2 seconds for boundary layers at ambiplasma particle densities in the range from 10 4 to 10 -2 m -3 , respectively. (author)

  5. Thalassemia: Complications and Treatment

    Science.gov (United States)

    ... on Facebook Tweet Share Compartir If I have thalassemia, how does it affect my body? Since your ... like flu shots and other vaccines. How is thalassemia treated? The type of treatment a person receives ...

  6. New Limit on Time-Reversal Violation in Beta Decay

    International Nuclear Information System (INIS)

    Mumm, H. P.; Chupp, T. E.; Cooper, R. L.; Coulter, K. P.; Freedman, S. J.; Fujikawa, B. K.; Garcia, A.; Jones, G. L.; Nico, J. S.; Thompson, A. K.; Trull, C. A.; Wietfeldt, F. E.; Wilkerson, J. F.

    2011-01-01

    We report the results of an improved determination of the triple correlation DP·(p e xp v ) that can be used to limit possible time-reversal invariance in the beta decay of polarized neutrons and constrain extensions to the standard model. Our result is D=[-0.96±1.89(stat)±1.01(sys)]x10 -4 . The corresponding phase between g A and g V is φ AV =180.013 deg. ±0.028 deg. (68% confidence level). This result represents the most sensitive measurement of D in nuclear β decay.

  7. Beta and current limits in the Doublet III tokamak

    International Nuclear Information System (INIS)

    Strait, E.J.; Chu, M.S.; Jahns, G.L.

    1986-04-01

    Neutral-beam heated discharges in Doublet III exhibit an operational beta limit, β/sub T/(%) less than or equal to 3.5 I(MA)/a(m)B(T), in good agreement with several theoretical predictions for ideal external kink or ballooning modes. These theories predict that the β limit has no explicit dependence on plasma shape (for nominal dee shapes). This aspect of the theory was confirmed in Doublet III by varying the elongation (kappa) from 1.0 to 1.6 and the triangularity (delta) from -0.1 to 0.9 and finding in all cases the same β limit. The maximum achievable beta thus depends on the minimum achievable value of the safety factor q. In Doublet III, the operational current limit is given by q greater than or equal to 1.7 for limiter-defined discharges and q greater than or equal to 2.7 for separatrix-defined discharges. Operation with q approx.2 was achieved for 1.0 less than or equal to kappa less than or equal to 1.6. Both β and q limits are characterized by major disruptions which usually terminate the discharge. In both cases, the disruptions often have a precursor oscillation with toroidal mode number n = 1, poloidal mode number m = 2 or 3, a frequency of zero to a few kHz, and a growth time on the order of a millisecond. These observations suggest that the proximate cause of these disruptions is a kink or tearing mode, pressure-driven in one case and current-driven in the other. Theoretical analyses of discharges at both limits will be compared. Modes with a high toroidal mode number, 3 less than or equal to n less than or equal to 5, and ballooning character have been observed near the β/sub T/ limit. These modes do not appear to be closely connected with the disruptions. Heating efficiency, ΔW/ΔP, remains constant up to the limiting disruption. Fishbone modes appear to be mainly a feature of high β/sub p/ operation and not connected to the β/sub T/ limit

  8. Ideal-MHD beta limits: scaling laws and comparison with Doublet III high-beta plasmas

    International Nuclear Information System (INIS)

    Bernard, L.C.; Bhadra, D.K.; Helton, F.J.; Lao, L.L.; Todd, T.N.

    1983-06-01

    Doublet III (DIII) recently has achieved a value for #betta#, the ratio of volume averaged plasma to magnetic pressure, of 4.5%. This #betta# value is in the range required for an economically attractive tokamak reactor, and also close to the relevant limit predicted by ideal-MHD theory. It is therefore of great interest to assess the validity of the theory by comparison with experiment and thus to have a basis for the prediction of future reactor performance. A large variety of plasma shapes have been obtained in DIII. These shapes can be divided into two classes: (1) limiter discharges, and (2) diverted discharges, which are of great interest because of their good confinement in the H-mode operation. We derive simple scaling laws from the variation of optimized ideal-MHD beta limits (#betta#/sub c/) with plasma shape parameters. The current profile is optimized for fixed plasma shapes, separately for the high-n (ballooning) and the low-n (kink) modes. Results are presented in the form of suitability normalized curves of #betta# versus poloidal beta, #betta#/sub p/, for both ballooning and kink modes in order to simultaneously compare all the DIII experimental data

  9. Frequency of Thalassemia in Iran and Khorasan Razavi

    Directory of Open Access Journals (Sweden)

    Gholam Hasan Khodaei

    2013-12-01

    Full Text Available Introduction: Beta-thalassemia is the most common hereditary disease in Iran. More than two million carriers of beta-thalassemia live in Iran. Since the Iranian population is a mixture of different ethnic groups, it is necessary to determine the frequency  in the different parts of the country. Materials and Methods: This descriptive study is a cross sectional study with helping by professional groups fighting diseases in Khorasan Razavi province.   Results: In Iran, according to World Health Organization, about 4 percent of the population, are carriers of the thalassemia gene. In other words, about 2-3 million people are suffering from thalassemia minor.Now, more than 18 thousand cases of thalassemia are scattered across the country in different provinces, are different. Mazandaran, Gilan, Hormozgan, Khuzestan, kohgiloyeh, Fars, Bushehr, Sistan and Baluchestan, Kerman and Isfahan, are 10 provinces with high prevalence in our country. We have 342 cases of thalassemia major in Khorasan Razavi province.   Conclusion: Prevalence  of thalassemia in our country is 3.6%  and Iran is located on the belt of thalassemia and due to a history of consanguinity, this disease has a prevalence of 0.6% among in the provinces of Khorasan Razavi.

  10. Genetics Home Reference: alpha thalassemia

    Science.gov (United States)

    ... Facebook Twitter Home Health Conditions Alpha thalassemia Alpha thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Alpha thalassemia is a blood disorder that reduces the production ...

  11. Effect of bootstrap current on MHD equilibrium beta limit in heliotron plasmas

    International Nuclear Information System (INIS)

    Watanabe, K.Y.

    2001-01-01

    The effect of bootstrap current on the beta limit of MHD equilibria is studied systematically by an iterative calculation of MHD equilibrium and the consistent bootstrap current in high beta heliotron plasmas. The LHD machine is treated as a standard configuration heliotron with an L=2 planar axis. The effects of vacuum magnetic configurations, pressure profiles and the vertical field control method are studied. The equilibrium beta limit with consistent bootstrap current is quite sensitive to the magnetic axis location for finite beta, compared with the currentless cases. For a vacuum configuration with the magnetic axis shifted inwards in the torus, even in the high beta regimes, the bootstrap current flows to increase the rotational transform, leading to an increase in the equilibrium beta limit. On the contrary, for a vacuum configuration with the magnetic axis shifted outwards in the torus, even in the low beta regimes, the bootstrap current flows so as to reduce the rotational transform; therefore, there is an acceleration of the Shafranov shift increase as beta increases, leading to a decrease in the equilibrium beta limit. The pressure profiles and vertical field control methods influence the equilibrium beta limit through the location of the magnetic axis for finite beta. These characteristics are independent of both device parameters, such as magnetic field strength, and device size in the low collisional regime. (author)

  12. Mental health status in patients with Thalassemia major in Iran

    Directory of Open Access Journals (Sweden)

    Mahdieh Nasiri

    2014-02-01

    Full Text Available Thalassemia major is a genetic blood disorder that is detected by the symptoms of chronic and severe anemia, enlarged liver and spleen, failure to thrive and bone deformities in particular deformed face and bulging forehead. Due to changes in physical appearance, the disease can influence on other aspects of the patient's life, so the disease can have a strong impact on the mental health of these patients and their families. Previous studies showed that 80% of patients with thalassemia major have at least one psychiatric disorder. The aim of this paper was to review the mental health status of patients with Beta-thalassemia major in Iran.

  13. Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

    Science.gov (United States)

    Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

    2018-03-01

    β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

  14. Pulmonary hypertension associated with thalassemia syndromes

    Science.gov (United States)

    Fraidenburg, Dustin R.; Machado, Roberto F.

    2016-01-01

    Chronic hemolytic anemia has increasingly been identified as an important risk factor for the development of pulmonary hypertension. Within the thalassemia syndromes, there are multiple mechanisms, both distinct and overlapping, by which pulmonary hypertension develops and that differ among β-thalassemia major or intermedia patients. Pulmonary hypertension in β-thalassemia major correlates with the severity of hemolysis, yet in patients whose disease is well treated with chronic transfusion therapy, the development of pulmonary hypertension can be related to cardiac dysfunction and the subsequent toxic effects of iron overload rather than hemolysis. β-thalassemia intermedia, on the other hand, has a higher incidence of pulmonary hypertension owing to the low level of hemolysis that exists over years without the requirement for frequent transfusions, while splenectomy is shown to play an important role in both types. Standard therapies such as chronic transfusion have been shown to mitigate pulmonary hypertension, and appropriate chelation therapy can avoid the toxic effects of iron overload, yet is not indicated in many patients. Limited evidence exists for the use of pulmonary vasodilators or other therapies, such as l-carnitine, to treat pulmonary hypertension associated with thalassemia. Here we review the most recent findings regarding the pathogenic mechanisms, epidemiology, presentation, diagnosis, and treatment of pulmonary hypertension in thalassemia syndromes. PMID:27008311

  15. Beta limit of crescent and bean shaped tokamaks

    International Nuclear Information System (INIS)

    Naitou, H.; Yamazaki, K.

    1988-01-01

    The maximum attainable beta values which can be expected in tokamaks with crescent (BEAN 1) and rounded (BEAN 2) bean shaped cross-sections are obtained numerically by using the linear ideal MHD stability analysis code ERATO. The current profiles are optimized with a fixed pressure profile for high values of beta, keeping Mercier, high-n ballooning and n=1 kink modes stable. The poloidal plasma cross-sections are inscribed in a rectangle with an aspect ratio of three and an ellipticity of two. A confocal wall, the distance of which from the plasma surface is equal to the horizontal minor plasma radius, is present to stabilize against the kink mode. Depending on the shape and triangularity (indentation), a beta value of 10 to 17% is obtained. It is also shown that the coefficient of the Troyon-type beta scaling increases for an indented plasma. In the case of small indentation, the BEAN 1 type tokamaks show higher beta values than the BEAN 2 type. For strong indentation, the BEAN 2 type gives the highest beta value. (author). 29 refs, 15 figs

  16. Detection of glycemic abnormalities in adolescents with beta thalassemia using continuous glucose monitoring and oral glucose tolerance in adolescents and young adults with β-thalassemia major: Pilot study

    Directory of Open Access Journals (Sweden)

    Ashraf T Soliman

    2013-01-01

    Full Text Available Background: Both insulin deficiency and resistance are reported in patients with β-thalassemia major (BTM. The use of continuous blood glucose monitoring (CGM, among the different methods for early detection of glycemic abnormalities, has not been studied thoroughly in these adolescents. Materials and Methods: To assess the oralglucose tolerance (OGT and 72-h continuous glucose concentration by the continuous glucose monitoring system (CGMS and calculate homeostatic model assessment (HOMA, and the quantitative insulin sensitivity check index (QUICKI was conducted in 16 adolescents with BTM who were receiving regular blood transfusions every 2-4 weeks and iron-chelation therapy since early childhood. Results: Sixteen adolescents with BTM (age: 19.75 ± 3 years were investigated. Using OGTT, (25% had impaired fasting blood (plasma glucose concentration (BG (>5.6 mmol/L. 2-h after the glucose load, one of them had BG = 16.2 mmol/L (diabetic and two had impaired glucose tolerance (IGT (BG > 7.8 and 11.1 mmol/L and 9 with IGT (56%. HOMA and QUICKI revealed levels 0.33 (0.36 ± 0.03, respectively, ruling out significant insulin resistance in these adolescents. There was a significant negative correlation between the β-cell function (B% on one hand and the fasting and the 2-h BG (r=−0.6, and − 0.48, P < 0.01, respectively on the other hand. Neither fasting serum insulin nor c-peptide concentrations were correlated with fasting BG or ferritin levels. The average and maximum blood glucose levels during CGM were significantly correlated with the fasting BG (r = 0.68 and 0.39, respectively, with P < 0.01 and with the BG at 2-hour after oral glucose intake (r = 0.87 and 0.86 respectively, with P < 0.001. Ferritin concentrations were correlated with the fasting BG and the 2-h blood glucose levels in the OGTT (r = 0.52, and r = 0.43, respectively, P < 0.01 as well as with the average BG recorded by CGM (r = 0.75, P < 0.01. Conclusion: CGM has proven to

  17. Imaging features of thalassemia

    International Nuclear Information System (INIS)

    Tunaci, M.; Tunaci, A.; Engin, G.; Oezkorkmaz, B.; Acunas, G.; Acunas, B.; Dincol, G.

    1999-01-01

    Thalassemia is a kind of chronic, inherited, microcytic anemia characterized by defective hemoglobin synthesis and ineffective erythropoiesis. In all thalassemias clinical features that result from anemia, transfusional, and absorptive iron overload are similar but vary in severity. The radiographic features of β-thalassemia are due in large part to marrow hyperplasia. Markedly expanded marrow space lead to various skeletal manifestations including spine, skull, facial bones, and ribs. Extramedullary hematopoiesis (ExmH), hemosiderosis, and cholelithiasis are among the non-skeletal manifestations of thalassemia. The skeletal X-ray findings show characteristics of chronic overactivity of the marrow. In this article both skeletal and non-skeletal manifestations of thalassemia are discussed with an overview of X-ray findings, including MRI and CT findings. (orig.)

  18. Ideal MHD beta-limits of poloidally asymmetric equilibria

    Energy Technology Data Exchange (ETDEWEB)

    Todd, A.M.M.; Miller, A.E.; Grimm, R.C.; Okabayashi, M.; Dalhed, H.E. Jr.

    1981-05-01

    The ideal MHD stability of poloidally asymmetric equilibria, which are typical of a tokamak reactor design with a single-null poloidal divertor is examined. As with symmetric equilibria, stability to non-axisymmetric modes improves with increasing triangularity and ellipticity, and with lower edge safety factor. Pressure profiles optimized with respect to ballooning stability are obtained for an asymmetric shape, resulting in ..beta../sub critical/ approx. = 5.7%. The corresponding value for an equivalent symmetric shape is ..beta../sub critical/ approx. = 6.5%.

  19. Parathyroid hormone in pediatric patients with β-thalassemia major ...

    African Journals Online (AJOL)

    Mostafa El-Nashar

    2016-04-09

    Apr 9, 2016 ... 1. Introduction. Beta-thalassemia is an inherited anemia caused by unbalanced ... The work has been carried out in accordance with the World ... The life expectancy of patients with b-thalassemia has greatly improved with ...

  20. Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

    Science.gov (United States)

    Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

    2016-01-01

    Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

  1. Estimation of the adiabatic energy limit versus beta in Baseball II

    International Nuclear Information System (INIS)

    Foote, J.H.

    1976-01-01

    Several estimates of the adiabatic energy limit versus beta in Baseball II are summarized, and the calculational methods used to obtain them are described. Some estimates are based on analytic expressions; for others, particle orbits are calculated, magnetic-moment jumps are inspected, and adiabatic limits then derived. The results are sensitive to the assumed variation of the combined vacuum-plus-plasma magnetic field. The calculated adiabatic energy limit falls rapidly with beta, even for a gradual magnetic-field variation. If we assume a sharp depression in the axial profile of the combined magnetic field for a finite-beta plasma, the adiabatic limit can be further markedly reduced

  2. Dependence of the DIII-D beta limit on the current profile

    Energy Technology Data Exchange (ETDEWEB)

    Strait, E.J.; Chu, M.S.; Ferron, J.R.; Lao, L.L.; Osborne, T.H.; Taylor, T.S.; Turnbull, A.D. (General Atomics, San Diego, CA (United States)); Lazarus, E.A. (Oak Ridge National Lab., TN (United States))

    1991-01-01

    The maximum beta values achieved in DIII-D are not fully described by the simple scaling law [beta][sub max][proportional to]I/aB. There is, in addition, a dependence on the form of the current profile as parameterized by the safety factor q and internal inductance l[sub i]. The maximum experimentally achieved value of normalized beta [beta][sub N] = [beta]/(I/aB) varies from 3.5 at low safety factor q (q[sub 95]<3) to 5 at higher values of q. At low q, discharges are terminated by disruptions at high [beta][sub N] and at both the low and high l[sub i] boundaries of the stable range. These disruptions are attributed to external and global kink modes. At higher q, such disruptions are much less frequent, and beta is limited by slowly growing resistive modes, fishbones, and possibly by ballooning modes. At each value of q, the maximum beta tends to increase with internal inductance l[sub i]. A numerical study of kink mode stability has shown a similar trend for optimized pressure profiles. These observations have suggested a new scaling law for the operational beta limit: [beta][sub max]=4l[sub i](I/aB), which fits the DIII-D data well. (author) 13 refs., 4 figs.

  3. Echocardiographic evaluation of thalassemia intermedia patients in Duhok, Iraq.

    Science.gov (United States)

    Mohammad, Ameen Mosa

    2014-12-11

    Cardiac complications are among the most serious problems of thalassemia intermedia patients. The current study was initiated to address the latter issue through the study of the echocardiographic findings and correlate it with clinical characteristics of thalassemia intermedia patients in Duhok, Kurdistan region, Iraq. An echocardiographic assessment of 61 beta-thalassemia intermedia cases was performed. It included 30 males and 31 females, with a mean age 19.6 ± 7.5 years. The standard echostudy of two-dimension and M-mode measurements of cardiac chambers were done. The continuous doppler regurgitant jet of tricuspid and pulmonary valves were recorded. Left ventricle diastolic function was assessed by pulsed doppler of mitral valve inflow. To correlate the clinical with echocardiographic findings, patients were divided, according to tricuspid regurgitant velocity, into three groups (intermedia patients. Therapeutic trails targeting these complications are indicated, and echocardiographic assessment is necessary to be offered early for thalassemia intermedia.

  4. Thalassemia intermedia: An overview

    African Journals Online (AJOL)

    Rabah M. Shawky

    2012-04-25

    Apr 25, 2012 ... abnormalities occur due to massive expansion of erythroid bone marrow activity ..... [3] Savage D, Wood NAP, Bidwell JL, Fitches A, Old JM, Hui KM. Detection of b-thalassemia mutations using DNA heteroduplex generator ...

  5. Learning about Thalassemia

    Science.gov (United States)

    Skip to main content Learning About Thalassemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

  6. Role of Three-Dimensional Speckle Tracking Echocardiography in the Quantification of Myocardial Iron Overload in Patients with Beta-Thalassemia Major.

    Science.gov (United States)

    Li, Shu-Juan; Hwang, Yu-Yan; Ha, Shau-Yin; Chan, Godfrey C F; Mok, Amanda S P; Wong, Sophia J; Cheung, Yiu-Fai

    2016-09-01

    The new three-dimensional speckle tracking echocardiography (3DSTE) may enable comprehensive quantification of global left ventricular (LV) myocardial mechanics. Twenty-four patients aged 29.3 ± 5.2 years and 22 controls were studied. 3DSTE was performed to assess LV 3D global strain, twist and torsion, ejection fraction, and systolic dyssynchrony index (SDI). The LV SDI was calculated as % of SD of times-to-peak strain of 16 segments/RR interval. The global performance index (GPI) was calculated as (global 3D strain·torsion)/SDI. Area under the receiver operating characteristic curve (AUC) was calculated to determine the capability of 3DSTE parameters to discriminate between patients with (cardiac magnetic resonance T2* overload. Compared with controls, patients had significantly lower LV global 3D strain (P overload. The LV composite index of strain, torsion, and dyssynchrony derived from 3DSTE enables sensitive detection of myocardial iron overload in patients with thalassemia. © 2016, Wiley Periodicals, Inc.

  7. Study of MHD stability beta limit in LHD by hierarchy integrated simulation code

    International Nuclear Information System (INIS)

    Sato, M.; Watanabe, K.Y.; Nakamura, Y.

    2008-10-01

    The beta limit by the ideal MHD instabilities (so-called 'MHD stability beta limit') for helical plasmas is studied by a hierarchy integrated simulation code. A numerical model for the effect of the MHD instabilities is introduced such that the pressure profile is flattened around the rational surface due to the MHD instabilities. The width of the flattening of the pressure gradient is determined from the width of the eigenmode structure of the MHD instabilities. It is assumed that there is the upper limit of the mode number of the MHD instabilities which directly affect the pressure gradient. The upper limit of the mode number is determined using a recent high beta experiment in the Large Helical Device (LHD). The flattening of the pressure gradient is calculated by the transport module in a hierarchy integrated code. The achievable volume averaged beta value in the LHD is expected to be beyond 6%. (author)

  8. Ion temperature anisotropy limitation in high beta plasmas

    International Nuclear Information System (INIS)

    Scime, Earl E.; Keiter, Paul A.; Balkey, Matthew M.; Boivin, Robert F.; Kline, John L.; Blackburn, Melanie; Gary, S. Peter

    2000-01-01

    Measurements of parallel and perpendicular ion temperatures in the Large Experiment on Instabilities and Anisotropies (LEIA) space simulation chamber display an inverse correlation between the upper bound on the ion temperature anisotropy and the parallel ion beta (β=8πnkT/B 2 ). Fluctuation measurements indicate the presence of low frequency, transverse, electromagnetic waves with wave numbers and frequencies that are consistent with predictions for Alfven Ion Cyclotron instabilities. These observations are also consistent with in situ spacecraft measurements in the Earth's magnetosheath and with a theoretical/computational model that predicts that such an upper bound on the ion temperature anisotropy is imposed by scattering from enhanced fluctuations due to growth of the Alfven ion cyclotron instability. (c) 2000 American Institute of Physics

  9. Preliminary Study of Ideal Operational MHD Beta Limit in HL-2A Tokamak Plasmas

    International Nuclear Information System (INIS)

    Shen Yong; Dong Jiaqi; He Hongda; Turnbull, A. D.

    2009-01-01

    Magnetohydrodynamic (MHD) n = 1 kink mode with n the toroidal mode number is studied and the operational beta limit, constrained by the mode, is calculated for the equilibrium of HL-2A by using the GATO code. Approximately the same beta limit is obtained for configurations with a value of the axial safety factor q 0 both larger and less than 1. Without the stabilization of the conducting wall, the beta limit is found to be 0.821% corresponding to a normalized beta value of β c N = 2.56 for a typical HL-2A discharge with a plasma current I p = 0.245 MA, and the scaling of β c N ∼constant is confirmed. (magnetically confined plasma)

  10. Beta limits in H-modes and VH-modes in JET

    Energy Technology Data Exchange (ETDEWEB)

    Smeulders, P; Hender, T C; Huysmans, G; Marcus, F; Ali-Arshad, S; Alper, B; Balet, B; Bures, M; Deliyanakis, N; Esch, H de; Fshpool, G; Jarvis, O N; Jones, T T.C.; Ketner, W; Koenig, R; Lawson, K; Lomas, P; O` Brien, D; Sadler, G; Stok, D; Stubberfield, P; Thomas, P; Thomen, K; Wesson, J [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking; Nave, M F [Universidade Tecnica, Lisbon (Portugal). Inst. Superior Tecnico

    1994-07-01

    In Hot-ion H- and VH-modes, the highest achieved beta was about 10% below the Troyon value in the best case of discharge 26087. The operational space of the high beta discharges obtained before March 1992 has been explored as function of the parameters H{sub ITER89P}, {beta}{sub n}, q{sub 95}, I{sub p}. Also, a limiting envelope on the fusion reactivity as a function of the average plasma pressure and beta has been observed with R{sub DD} related to {beta}{sub {phi}}{sup 2}.B{sub {phi}}{sup 4}. MHD stability analysis shows that the JET VH modes at the edge are in the second region for ballooning mode stability. The dependence of ballooning stability and the n=1 external kink on the edge current density is analyzed. (authors). 6 figs., 6 refs.

  11. Limits on neutrino masses from tritium beta decay

    CERN Document Server

    Bonn, J; Bornschein, L; Flatt, B; Kraus, C V; Otten, E W; Schall, J P; Thuemmler, T; Weinheimer, C

    2002-01-01

    The presently lowest limit for the mass of the electron neutrino is m nu < 2.2 eV (95 % C.L.) derived from measurements at Mainz up to 1999. The data taken in 2000 are not fully analyzed yet but limits of possible distortions as reported by the Troitsk group can be given. The next generation neutrino mass experiment KATRIN is briefly discussed.

  12. SCREENING CORD BLOOD FOR HEMOGLOBINOPATHIES AND THALASSEMIA BY HPLC

    NARCIS (Netherlands)

    VANDERDIJS, FPL; VANDENBERG, GA; SCHERMER, JG; MUSKIET, FD; LANDMAN, H; MUSKIET, FAJ

    We evaluated the use of an HPLC method for screening hemoglobins in cord blood. We studied the genotype frequencies of the structural hemoglobin variants HbS and HbC and the synthesis variants alpha- and beta+-thalassemia in babies born on Curacao. During three months, 67.2% of all (748) newborns

  13. Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

    Science.gov (United States)

    Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

    2018-03-01

    There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

  14. Beta-limiting MHD instabilities in improved performance NSTX spherical torus plasmas

    International Nuclear Information System (INIS)

    Menard, J.E.; Bell, M.G.; Bell, R.E.

    2003-01-01

    Global magnetohydrodynamic stability limits in the National Spherical Torus Experiment (NSTX) have increased significantly recently due to a combination of device and operational improvements. First, more routine H-mode operation with broadened pressure profiles allows access to higher normalized beta and lower internal inductance. Second, the correction of a poloidal field coil induced error-field has largely eliminated locked tearing modes during nor- mal operation and increased the maximum achievable beta. As a result of these improvements, peak beta values have reached (not simultaneously) β t = 35%, β N 6.5, N > = 4.5, β / l i =10, and β= 1.4. High β P operation with reduced tearing activity has allowed a doubling of discharge pulse-length to just over 1 second with sustained periods of β N ∼ 6. Details of the β limit scalings and β-limiting instabilities in various operating regimes are described. (author)

  15. Experiments close to the beta-limit in W7-AS

    International Nuclear Information System (INIS)

    Weller, A; Geiger, J; Werner, A; Zarnstorff, M C; Nuehrenberg, C; Sallander, E; Baldzuhn, J; Brakel, R; Burhenn, R; Dinklage, A; Fredrickson, E; Gadelmeier, F; Giannone, L; Grigull, P; Hartmann, D; Jaenicke, R; Klose, S; Knauer, J P; Koenies, A; Kolesnichenko, Ya I; Laqua, H P; Lutsenko, V V; McCormick, K; Monticello, D; Osakabe, M; Pasch, E; Reiman, A; Rust, N; Spong, D A; Wagner, F; Yakovenko, Yu V

    2003-01-01

    A major objective of the experimental program in the last phase of the W7-AS stellarator was to explore and demonstrate the high-beta performance of advanced stellarators. MHD-quiescent discharges at low impurity radiation levels with volume averaged beta-values of up to beta=3.4% have been achieved. A very important prerequisite was the attainment of the high density H-Mode (HDH) regime. This was made possible by the installation of extensive graphite plasma facing components designed for island divertor operation. The co-directed neutral beam injection provided increased absorbed heating power of up to 3.2 MW in high-beta plasmas with B<=1.25 T. The anticipated improved features concerning equilibrium and stability at high plasma beta could be verified experimentally by the comparison of x-ray data with free boundary equilibrium calculations. The maximum beta found in configurations with a rotational transform around t=0.5 is determined by the available heating power. No evidence of a stability limit has been found in the accessible configuration space, and the discharges are remarkably quiescent at maximum beta, most likely due the increase of the magnetic well depth. An increase in low m/n MHD activity is typically observed during the transition towards high beta. The beneficial stability properties of net-current-free configurations could be demonstrated by comparison with configurations where a significant inductive current drive was involved. Current driven instabilities such as tearing modes and soft disruptions can prevent access to beta-values as high as in the currentless case. The experimental results indicate that optimized stellarators such as W7-X can be considered as a viable option for an attractive stellarator fusion reactor

  16. Peripheral neuropathy in thalassemia

    International Nuclear Information System (INIS)

    Sawaya, Raja A.; Tahir, A.; Zahad, L.

    2006-01-01

    Patients with thalassemia may complain of numbness and weakness of lower extremities. The aim of the study was to determine whether these patients suffer from a polyneuropathy and to determine any contributing factors for the development of neuropathy. We examined 30 patients with thalasemia major and intermedia, clinically and electrophysiologically. We correlated these findings with demographics, blood status and treatment and compared electrophysiologic data with 30 age and sex matched normal subjects or historical controls. We found that 78% of thalassemia patients suffer from a mild sensory polyneuropathy. The neuropathy seemed to be worse in the intermedia type. Thalassemia patients who received blood transfusions and deferoaximine had better nerve faction than those who did not, irrespective of the dose of the deferoxamine. The neuropathy was worse for the older patients, irrespective of the sex. The hemoglobin level, and the fact that some patients underwent spleenctomy, did not affect the status of the patient's nerves. Patients with thalassemia may suffer from a sensor polyneuropathy especially as they grow older and they are not optimally treated. (author)

  17. The Prevalence of the Beta Thalassemia Trait among the Pregnant Women who attended the ANC Clinic in a PHC, by using the NESTROF Test in Bangalore, Karnataka.

    Science.gov (United States)

    Kulkarni, Praveen; Masthi, N R Ramesh; Niveditha, Sr; Suvarna, R

    2013-07-01

    Contaxt: Every year in India 6000 to 8000 children are born with thalassaemia major. The birth of such a child produces considerable physical and economic strain on the affected child, its family and the community at large. Thus, the emphasis must shift from the treatment to the prevention of such births in the future. To find out the prevalence of the Beta Thalassaemia trait among the pregnant women who attended the antenatal clinics in a Primary Health Centre, by using the NESTROF test; to describe the socio-demographic characteristics of the study subjects, to find out the pregnancies which were 'at risk' of delivering babies with Thalassaemia major and to find out the 'awareness' of the pregnant women regarding Thalassaemia. This exploratory study was conducted in a PHC which was attached to the Department of Community Medicine of a medical college which was situated in Bangalore, India, for a period of 3 months. All the pregnant women who attended the antenatal clinic and the husbands of the NESTROF positive women were included in the study. The details regarding the sociodemographic characteristics of the women were collected on a structured proforma and the NESTROF test was performed. Out of the 210 pregnant women who were tested, 18 (8.5%) were thalassaemia carriers. 12 (66.6%) of them were between 20 - 25 years of age. 5 (27.7%) were born out of 2(nd) degree consanguineous marriages. 7 (38.8%) had a history of abortions, among which 6 (33.3%) were in the 1(st) trimesters of their pregnancies. Out of the 18 positive women, 9 (50%) had turned up with their husbands. All of the husbands were negative for the Thalassaemia carrier status. Thus, there was no pregnancy which was at a risk of delivering babies with thalassaemia major. None (100%) of the pregnant women were aware of the disease, thalassaemia. The prevalence of the Beta Thalassaemia trait among the pregnant women was 8.5%.

  18. Spreadsheet design and validation for characteristic limits determination in gross alpha and beta measurement

    International Nuclear Information System (INIS)

    Prado, Rodrigo G.P. do; Dalmazio, Ilza

    2013-01-01

    The identification and detection of ionizing radiation are essential requisites of radiation protection. Gross alpha and beta measurements are widely applied as a screening method in radiological characterization, environmental monitoring and industrial applications. As in any other analytical technique, test performance depends on the quality of instrumental measurements and reliability of calculations. Characteristic limits refer to three specific statistics, namely, decision threshold, detection limit and confidence interval, which are fundamental to ensuring the quality of determinations. This work describes a way to calculate characteristic limits for measurements of gross alpha and beta activity applying spreadsheets. The approach used for determination of decision threshold, detection limit and limits of the confidence interval, the mathematical expressions of measurands and uncertainty followed standards guidelines. A succinct overview of this approach and examples are presented and spreadsheets were validated using specific software. Furthermore, these spreadsheets could be used as tool to instruct beginner users of methods for ionizing radiation measurements. (author)

  19. Stability Limits of High-Beta Plasmas in DIII-D

    International Nuclear Information System (INIS)

    Strait, E.J.

    2005-01-01

    Stability at high beta is an important requirement for a compact, economically attractive fusion reactor. DIII-D experiments have shown that ideal magnetohydrodynamic (MHD) theory is an accurate predictor of the ultimate stability limits for tokamaks, and the Troyon scaling law has provided a useful approximation of ideal stability limits for discharges with 'conventional' profiles. However, variation of the discharge shape, pressure profile, and current density profile can lead to ideal MHD beta limits that differ significantly from simple Troyon scaling. The need for profiles consistent with steady-state operation places an important additional constraint on plasma stability. Nonideal effects can also be important and must be taken into account. For example, neoclassical tearing modes (NTMs), resulting from plasma resistivity and the nonlinear effects of the bootstrap current, can become unstable at beta values well below the ideal MHD limit. DIII-D experiments are now entering a new era of unprecedented control over plasma stability, including suppression of NTMs by localized current drive at the island location, and direct feedback stabilization of kink modes with a resistive wall. The continuing development of physics understanding and control tools holds the potential for stable, steady-state fusion plasmas at high beta

  20. Intrinsic Electron Mobility Limits in beta-Ga2O3

    OpenAIRE

    Ma, Nan; Tanen, Nicholas; Verma, Amit; Guo, Zhi; Luo, Tengfei; Huili; Xing; Jena, Debdeep

    2016-01-01

    By systematically comparing experimental and theoretical transport properties, we identify the polar optical phonon scattering as the dominant mechanism limiting electron mobility in beta-Ga2O3 to lower than 200 cm2/Vs at 300 K for donor doping densities lower than 1018 cm-3. In spite of similar electron effective mass of beta-Ga2O3 to GaN, the electron mobility is 10x lower because of a massive Frohlich interaction, due to the low phonon energies stemming from the crystal structure and stron...

  1. Marrow heterotopia in thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Papavasiliou, C.; Gouliamos, A.; Andreou, J.

    1986-05-01

    The subject of marrow heterotopia has been reviewed on the basis of 15 cases suffering from thalassemia. Other cases reported in the literature were also reviewed. Using conventional radiography, scintigraphy, computerized tomography and myelography, 17% of the cases admitted into the hospital with the diagnosis of Thalassemia, were found to have macroscopic masses of marrow heterotopia. The most common site of development of these masses was the costovertebral gutter, followed by the anterior end of the ribs and the extradural space of the spinal canal. In one case, masses were located in the maxillary antra. The clinical implications, the pathogenesis of the masses and the differential diagnosis from other tumour-like entities are discussed. Three patients presented with symptoms and signs of spinal cord compression. All three patients were treated satisfactorily with small doses of radiotherapy.

  2. The Prevention of Thalassemia

    Science.gov (United States)

    Cao, Antonio; Kan, Yuet Wai

    2013-01-01

    The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods taht are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus. PMID:23378598

  3. Molecular Diagnostics of ?-Thalassemia

    OpenAIRE

    Atanasovska, B; Bozhinovski, G; Chakalova, L; Kocheva, S; Karanfilski, O; Plaseska-Karanfiska, D

    2012-01-01

    A high-quality hemoglobinopathy diagnosis is based on the results of a number of tests including assays for molecular identification of causative mutations. We describe the current diagnostic strategy for the identification of ?-thalassemias and hemoglobin (Hb) variants at the International Reference Laboratory for Haemoglobinopathies, Research Centre for Genetic Engineering and Biotechnology (RCGEB) ?Georgi D. Efremov,? Skopje, Republic of Macedonia. Our overall approach and most of the meth...

  4. Increasing the beta limit due to neoclassical tearing modes by raising the axial safety factor q(0) > 1

    International Nuclear Information System (INIS)

    La Haye, R.J.; Strait, E.J.; Rice, B.W.

    2000-01-01

    Resistive neoclassical tearing modes (NTMs) can cause the stable beta value in long pulse, high confinement plasmas to fall significantly below that predicted by ideal theory. The NTM islands which degrade confinement and limit beta are induced and sustained by helically perturbed bootstrap currents. A combination of shaping and q-profile modification is used in the DIII-D tokamak to increase this beta limit. (author)

  5. Beta-limiting MHD Instabilities in Improved-performance NSTX Spherical Torus Plasmas

    International Nuclear Information System (INIS)

    J.E. Menard; M.G. Bell; R.E. Bell; E.D. Fredrickson D.A. Gates: S.M. Kaye; B.P. LeBlanc; R. Maingi; D. Mueller; S.A. Sabbagh; D. Stutman; C.E. Bush; D.W. Johnson; R. Kaita; H.W. Kugel; R.J. Maqueda; F. Paoletti; S.F Paul; M. Ono; Y.-K.M. Peng; C.H. Skinner; E.J. Synakowski; the NSTX Research Team

    2003-01-01

    Global magnetohydrodynamic stability limits in the National Spherical Torus Experiment (NSTX) have increased significantly recently due to a combination of device and operational improvements. First, more routine H-mode operation with broadened pressure profiles allows access to higher normalized beta and lower internal inductance. Second, the correction of a poloidal field coil induced error-field has largely eliminated locked tearing modes during normal operation and increased the maximum achievable beta. As a result of these improvements, peak beta values have reached (not simultaneously) β t = 35%, β N = 6.4, N > = 4.5, β N /l i = 10, and β P = 1.4. High β P operation with reduced tearing activity has allowed a doubling of discharge pulse-length to just over 1 second with sustained periods of β N ∼ 6 above the ideal no-wall limit and near the with-wall limit. Details of the β limit scalings and β-limiting instabilities in various operating regimes are described

  6. Endocrinopathies in thalassemia major patient

    Science.gov (United States)

    Lubis, D. A.; Yunir, E. M.

    2018-03-01

    Advanced in chelation therapy and regular blood transfusion have marked improvements in the life expectancy of patients with thalassemia major, however these patients still have to deal with several complications. We report a 19-year-old male, presented with multiple endocrine complication-related thalassemia; hypogonadism, short stature, osteoporosis with history of fracture, and subclinical hypothyroid.

  7. The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

    NARCIS (Netherlands)

    E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

    1983-01-01

    textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

  8. The MSSM with large tan(beta) beyond the decoupling limit

    International Nuclear Information System (INIS)

    Hofer, L.; Scherer, D.; Nierste, U.

    2009-01-01

    If the parameter tan(beta) of the MSSM is large, enhanced loop corrections must be resumed to all orders in perturbation theory. We perform this resummation for flavour-diagonal and flavour-violating tan-beta-enhanced corrections without resorting to the decoupling limit, in which the MSSM is reduced to an effective 2HDM. Our results enable us to clarify the dependence of the resumed expressions on the renormalization scheme and to cover two new classes of processes with supersymmetric particles, which are both intractable with the conventional effective-2HDM method: The first class are collider processes with external supersymmetric particles; the second class are loop processes which vanish in the decoupling limit of supersymmetry. Applying the resummation formulae to FCNC processes in B physics, we find an interesting new effect in observables in which the chromomagnetic effective operator is important. (author)

  9. Hydroxyurea for hemoglobin E/β-thalassemia: a systematic review and meta-analysis.

    Science.gov (United States)

    Algiraigri, Ali H; Kassam, Aliya

    2017-12-01

    Hemoglobin E-beta thalassemia (Hb E/β-thalassemia) is a distinct, yet common, type of β-thalassemia, in which the patient co-inherits a β-thalassemia allele from one parent, and a structural variant, Hb E, from the other parent. This co-inheritance leads to remarkable clinical heterogeneity, varying degrees of chronic anemia, and a wide spectrum of complications due to ineffective erythropoiesis and iron overload. Hydroxyurea (HU), an oral chemotherapeutic drug, is expected to decrease disease severity. To assess the clinical efficacy and safety of HU in Hb E/β-thalassemia patients. We searched MEDLINE, EMBASE, Cochrane databases, and major preceding conferences for studies that assessed HU in Hb E/β-thalassemias patients. The effect size was estimated as a proportion (responder/sample size). Qualities of eligible studies were assessed using NIH tools. A total of five [one randomized clinical trial (RCT) and four observational] studies involving 106 patients were included. HU was associated with a significant RR of 46% with no statistical heterogeneity. No serious adverse effects were reported. Patients with Hb E/β-thalassemia may benefit from a trial of HU, though large RCTs assessing efficacy should be conducted to confirm the findings of this meta-analysis and to assess long-term toxicity and response sustainability.

  10. Thalassemias and hemoglobinopathies in Turkey.

    Science.gov (United States)

    Canatan, Duran

    2014-01-01

    Thalassemias and hemoglobinopathies are a serious health problem in Turkey. There is a 70-year history of thalassemia in Turkey. The first patient with β-thalassemia major (β-TM) was reported in 1941. The first clinical and hematological studies were published by Aksoy in 1958. The overall incidence of β-thalassemia (β-thal) was reported by Çavdar and Arcasoy to be 2.1% in 1971. Important steps such as written regulations, education and prevention campaigns, have been taken to prevent thalassemia in Turkey by the Ministry of Health (MOH), the Turkish National Hemoglobinopathy Council (TNHC) and the Thalassemia Federation of Turkey (TFT) since 2000. A national hemoglobinopathy prevention program was started in provinces with a high prevalence by the MOH in 2003. While the percentage of premarital screening test was 30.0% of all couples in 2003, it reached 86.0% in 2013. While the number of newborn with thalassemias and hemoglobinopathies was 272 in 2002, it had dropped to 25 in 2010. There has been a 90.0% reduction of affected births in the last 10 years.

  11. Psychopathological tendencies and quality of life among patients with thalassemia

    International Nuclear Information System (INIS)

    Anwar, K.; Waqar, S.

    2017-01-01

    To explore the relationship between psychopathological tendencies and Quality of Life (QoL) among patients with Thalassemia major. Methodology: In this correlational study, data were collected from the blood transfusion dependent patients of beta-thalassemia major in Rawalpindi and Islamabad hospitals from September to December 2014. Urdu version of Worlds Health Organization Quality of Life Scale-BREF (WHOQOL-BREF) and Brief Symptom Inventory (BSI) methods were administered on 74 patients of thalassemia major. Pearson Product Correlation, Independent Sample t-test, One-way ANOVA and Post Hoc analysis were used. Results: There was higher levels of somatization, hostility and obsessive compulsive (OC) and lower levels of psychoticism. There was negatively affected social and psychological domains of life while comparatively better QoL related to environmental conditions of the patients. There was negative relationship between psychopathological tendencies and QoL among patients. Moreover, mother's education level negatively related with psychopathological tendencies among patients. Males scored high on depression and interpersonal sensitivity, whereas females scored high on anxiety, paranoid ideation and somatization. Female patients experienced better QoL as compared to male counterparts. Conclusion: There were higher degrees of psychopathological tendencies among patients with thalassemia major which affected their QoL mainly on social and psychological domains. (author)

  12. Thalassemia and malaria: new insights into an old problem.

    Science.gov (United States)

    Clegg, J B; Weatherall, D J

    1999-01-01

    The hemoglobinopathies are probably the world's most common genetic diseases: The World Health Organization has estimated that at least 5% of the population are carriers for one or other of the most serious forms, the alpha- and beta-thalassemias and the structural variant hemoglobins S, C, and E, which are found at polymorphic frequencies in many countries. All these hemoglobinopathies are believed to provide protection against malaria, and it is thought that, in malarial regions of the world, natural selection has been responsible for elevating and maintaining their gene frequencies, an idea first proposed 50 years ago by J.B.S. Haldane. Epidemiological studies undertaken in the 1950s on hemoglobin S in Africa provided support for the "malaria hypothesis," but until recently it has proved extremely difficult to verify it for the thalassemias. The application of molecular methods has, however, provided new opportunities to address this old question. Population and molecular genetic analysis of thalassemia variants, and microepidemiological studies of the relationship between alpha-thalassemia and malaria in the southwest Pacific, have provided unequivocal evidence for protection. Surprisingly, some of this protection appears to derive from enhanced susceptibility in very young thalassemic children to both Plasmodium falciparum and, especially, P. vivax, and this early exposure appears to provide the basis for better protection in later life.

  13. Limit on Neutrinoless Double Beta Decay of 76Ge by GERDA

    Science.gov (United States)

    Agostini, M.; Allardt, M.; Andreotti, E.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Heider, M. Barabè; Barros, N.; Baudis, L.; Bauer, C.; Becerici-Schmidt, N.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Brudanin, V.; Brugnera, R.; Budjáš, D.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; Cossavella, F.; Demidova, E. V.; Domula, A.; Egorov, V.; Falkenstein, R.; Ferella, A.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gotti, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Guthikonda, K. K.; Hampel, W.; Hegai, A.; Heisel, M.; Hemmer, S.; Heusser, G.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Csáthy, J. Janicskó; Jochum, J.; Junker, M.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Klimenko, A.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Machado, A. A.; Macolino, C.; Majorovits, B.; Maneschg, W.; Misiaszek, M.; Nemchenok, I.; Nisi, S.; Shaughnessy, C. O.'.; Pandola, L.; Pelczar, K.; Pessina, G.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salathe, M.; Schmitt, C.; Schreiner, J.; Schulz, O.; Schwingenheuer, B.; Schönert, S.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Strecker, H.; Tarka, M.; Ur, C. A.; Vasenko, A. A.; Volynets, O.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wojcik, M.; Yanovich, E.; Zavarise, P.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

    The Gerda experiment at the Laboratori Nazionali del Gran Sasso in Italy uses germanium detectors made from material with an enriched 76Ge isotope fraction to search for neutrinoless double beta decay of this nucleus. Applying a blind analysis we find no signal after an exposure of 21.6 kg·yr and a background of about 0.01 cts/(keV·kg·yr). A half-life limit of Tov1/2> 2.1 · 1025 yr (90% C.L.) is extracted. The previous claim of a signal for 76Ge is excluded with 99% probability in a model independent way.

  14. Hb D/Talassemia beta associada à anemia crônica Hb D/ Beta thalassaemia associated with chronic anaemia

    Directory of Open Access Journals (Sweden)

    Paulo C. Naoum

    2002-03-01

    Full Text Available We describe a case of Hb D/Beta thalassemia associated with chronic anemia. Hematological analyses performed in a patient with chronic anemia demonstrating microcytosis and hypochromic in his erythrocytes. Specific laboratory diagnosis performed by alkaline and acid electrophoresis, and fetal determination by alkali resistance, indicated it to be Hb D associated with beta thalassemia. Analyses carried out on his family (father, mother and brother confirmed the suspected diagnosis. Hb D/Beta thalassemia is a very rare interaction in the Brazilian population, and its determination required specific laboratorial techniques and hematological analyses.

  15. Critical appraisal of discriminant formulas for distinguishing thalassemia from iron deficiency in patients with microcytic anemia.

    Science.gov (United States)

    Urrechaga, Eloísa; Hoffmann, Johannes J M L

    2017-08-28

    thalassemia diagnosis, but in countries with limited resources, they can be helpful in identifying those patients who need further examinations for genetic anemia.

  16. Approach to high stability beta limit and its control by fast wave current drive in reversed field pinch plasma

    International Nuclear Information System (INIS)

    Kusano, K.; Kondoh, Y.; Gesso, H.; Osanai, Y.; Saito, K.N.; Ukai, R.; Nanba, T.; Nagamine, Y.; Shiina, S.

    2001-01-01

    Before the generation of steady state, dynamo-free RFP configuration by rf current driving scheme, it is necessary to find an optimum configuration into high stability beta limit against m=1 resonant resistive MHD modes and reducing nonlinearly turbulent level with less rf power. As first step to the optimization study, we are interested in partially relaxed state model (PRSM) RFP configuration, which is considered to be closer to a relaxed state at finite beta since it has force-free fields for poloidal direction with a relatively shorter characteristic length of relaxation and a relatively higher stability beta limit to m=1 resonant ideal MHD modes. The stability beta limit to m=1 resonant resistive MHD modes can be predicted to be relatively high among other RFP models and to be enhanced by the current density profile control using fast magnetosonic waves (FMW), which are accessible to high density region with strong absorption rate. (author)

  17. High beta tokamak operation in DIII-D limited at low density/collisionality by resistive tearing modes

    International Nuclear Information System (INIS)

    La Haye, R.J.; Lao, L.L.; Strait, E.J.; Taylor, T.S.

    1997-01-01

    The maximum operational high beta in single-null divertor (SND) long pulse tokamak discharges in the DIII-D tokamak with a cross-sectional shape similar to the proposed International Thermonuclear Experimental Reactor (ITER) device is found to be limited by the onset of resistive instabilities that have the characteristics of neoclassically destabilized tearing modes. There is a soft limit due to the onset of an m/n=3/2 rotating tearing mode that saturates at low amplitude and a hard limit at slightly higher beta due to the onset of an m/n=2/1 rotating tearing mode that grows, slows down and locks. By operating at higher density and thus collisionality, the practical beta limit due to resistive tearing modes approaches the ideal magnetohydrodynamic (MHD) limit. (author). 15 refs, 4 figs

  18. Alpha+ -thalassemia protects against anemia associated with asymptomatic malaria: evidence from community-based surveys in Tanzania and Kenya.

    NARCIS (Netherlands)

    Veenemans, J.; Andang'o, P.E.; Mbugi, E.V.; Kraaijenhagen, R.J.; Mwaniki, D.L.; Mockenhaupt, F.P.; Roewer, S.; Olomi, R.M.; Shao, J.F.; Meer, J.W.M. van der; Savelkoul, H.F.J.; Verhoef, H.

    2008-01-01

    BACKGROUND: In hospital-based studies, alpha(+)-thalassemia has been found to protect against severe, life-threatening falciparum malaria. alpha(+)-Thalassemia does not seem to prevent infection or high parasite densities but rather limits progression to severe disease--in particular, severe

  19. a+- Thalassemia Protects against Anemia Associated with Asymptomatic Malaria: Evidence from Community-Based Surveys in Tanzania and Kenya

    NARCIS (Netherlands)

    Veenemans, J.; Andang'o, P.E.A.; Mbugi, E.V.; Kraaijenhagen, R.; Mwaniki, D.; Mockenhaupt, F.P.; Roewer, S.; Olomi, R.M.; Shao, J.F.; Meer, van der J.W.M.; Savelkoul, H.F.J.; Verhoef, J.C.M.

    2008-01-01

    Background. In hospital-based studies, ¿+-thalassemia has been found to protect against severe, life-threatening falciparum malaria. ¿+-Thalassemia does not seem to prevent infection or high parasite densities but rather limits progression to severe disease¿in particular, severe malarial anemia. We

  20. Marcadores eletrocardiográficos para detecção precoce de doença cardíaca em pacientes com talassemia beta maior Electrocardiographic markers for the early detection of cardiac disease in patients with beta-thalassemia major

    Directory of Open Access Journals (Sweden)

    Kemal Nisli

    2010-04-01

    Full Text Available OBJETIVO: Analisar comparativamente a dispersão da onda P (DOP em pacientes com talassemia beta maior (β-TM e indivíduos saudáveis (controles para a detecção precoce do risco de arritmias. MÉTODOS: Oitenta e uma crianças com β-TM, com idades entre 4 e 19 anos, e 74 crianças saudáveis (grupo controle foram submetidas a exame eletrocardiográfico e ecocardiograma transtorácico de rotina para avaliação cardíaca. A DOP foi calculada como a diferença entre as durações máxima e mínima da onda P. RESULTADOS: Houve uma diferença estatisticamente significativa entre o grupo de estudo e o grupo controle no pico de velocidade do fluxo transmitral no início da diástole (E e na razão E/fluxo transmitral tardio (A. A duração máxima da onda P e a DOP foram significativamente maiores nos pacientes com β-TM do que nos indivíduos controles. CONCLUSÕES: O aumento da DOP em nossos pacientes com β-TM pode estar relacionado à depressão na condução intra-atrial, devido à dilatação atrial, e ao aumento da atividade simpática. Estes pacientes devem ser acompanhados atentamente devido à possibilidade de ocorrência de arritmias com risco de vida.OBJECTIVE: To comparatively evaluate P-wave dispersion (PWD in patients with β-thalassemia major (TM and healthy control subjects for the early prediction of arrhythmia risk. METHODS: Eighty-one children with β-TM, aged 4-19 years, and 74 healthy children (control group underwent routine electrocardiography and transthoracic echocardiography for cardiac evaluation. PWD was calculated as the difference between the maximum and the minimum P-wave duration. RESULTS: There was a statistically significant difference between study and control groups in peak early (E mitral inflow velocity and E/late (A velocity ratio. Maximum P-wave duration and PWD were found to be significantly higher in β-TM patients than in control subjects. CONCLUSIONS: Increased PWD in our β-TM patients might be related

  1. Limits on neutrino-less double beta decay of 100Mo

    International Nuclear Information System (INIS)

    Ejiri, H.; Fushimi, K.; Hayashi, K.; Kishimoto, T.; Kudomi, N.; Ohsumi, H.; Okada, K.; Shima, T.; Tanaka, J.

    1996-01-01

    Exclusive measurements of neutrino-less double beta decays (0νββ) of 100 Mo were made by means of ELEGANT V. Most stringent lower limits on the half-lives for the ground-state transition were obtained for the 0νββ processes as T 1/2 0ν (m ν ) > 5.2 x 10 22 y, T 1/2 0ν (λ) > 3.9 x 10 22 y and T 1/2 0ν (η) > 5.1 x 10 22 y, for the mass term left angle m ν right angle, for the right-handed current terms of left angle λ right angle and left angle η right angle, respectively, and as T 1/2 0νB > 5.4 x 10 21 y for the process (0νββB) followed by a Majoron (B). These limits lead to the upper limits of left angle m ν right angle -6 , left angle η right angle -8 and left angle g B right angle -5 with g B being the coupling of B with the neutrino field. Limits on other possible processes beyond the standard theory are discussed. (orig.)

  2. Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

    Science.gov (United States)

    Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

    2017-12-30

    Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

  3. The Thalassemia International Federation: a global public health paradigm

    Directory of Open Access Journals (Sweden)

    Elpidoforos S. Soteriades

    2014-09-01

    Full Text Available Many international organizations are struggling today to coordinate limited economic and human resources in support of governments’ efforts to advance public health around the world. The United Nations and the World Health Organization, along with others play a pivotal role in this global effort. Furthermore, during the past few decades an increasingly higher percentage of global efforts on public health are carried out by specific health initiatives, international projects and non-governmental patient-oriented organizations. The Thalassemia International Federation (TIF is one such organization focusing on the control of thalassemia around the world. The current paper aims at presenting a comprehensive overview of the mission, goals, objectives and activities of this organization. Our ultimate goal is to highlight TIF’s public health paradigm and diffuse its success at an international levels for others to follow. TIF is devoted to disseminating information, knowledge, experience and best practices around the world to empower patients with thalassemia and their relatives, support health professionals providing care to such patients and promote national and international policies, which secure equal access to quality care for all patients with thalassemia.

  4. Thalassemia, extramedullary hematopoiesis, and spinal cord compression: A case report.

    Science.gov (United States)

    Bukhari, Syed Sarmad; Junaid, Muhammad; Rashid, Mamoon Ur

    2016-01-01

    Extramedullary hematopoiesis (EMH) refers to hematopoiesis outside of the medulla of the bone. Chronic anemia states such as thalassemia can cause hematopoietic tissue to expand in certain locations. We report a case of spinal cord compression due to recurrent spinal epidural EMH, which was treated with a combination of surgery and radiotherapy. Pakistan has one of the highest incidence and prevalence of thalassemia in the world. We describe published literature on diagnosis and management of such cases. An 18-year-old male presented with bilateral lower limb paresis. He was a known case of homozygous beta thalassemia major. He had undergone surgery for spinal cord compression due to EMH 4 months prior to presentation. Symptom resolution was followed by deterioration 5 days later. He was operated again at our hospital with complete resection of the mass. He underwent local radiotherapy to prevent recurrence. At 2 years follow-up, he showed complete resolution of symptoms. Follow-up imaging demonstrated no residual mass. The possibility of EMH should be considered in every patient with ineffective erythropoiesis as a cause of spinal cord compression. Treatment of such cases is usually done with blood transfusions, which can reduce the hematopoietic drive for EMH. Other options include surgery, hydroxyurea, radiotherapy, or a combination of these on a case to case basis.

  5. IRON CHELATION THERAPY IN THALASSEMIA SYNDROMES

    Directory of Open Access Journals (Sweden)

    Paolo Cianciulli

    2009-06-01

    Full Text Available Transfusional hemosiderosis is a frequent complication in patients with transfusion dependent chronic diseases such as  thalassemias and severe type of sickle cell diseases. As there are no physiological mechanisms to excrete the iron contained in transfused red cells (1 unit of blood contains approximately 200 mg of iron the excess of iron is stored in various organs. Cardiomyopathy is the most severe complication covering more than 70% of the causes of death of thalassemic patients. Although the current reference standard iron chelator deferoxamine (DFO has been used clinically for over four decades, its effectiveness is limited by a demanding therapeutic regimen that leads to poor compliance. Despite poor compliance, because of the inconvenience of subcutaneous infusion, DFO improved considerably the survival and quality of life of patients with thalassemia. Deferiprone since 1998 and Deferasirox since 2005 were licensed for clinical use. The oral chelators have a better compliance because of oral use, a comparable efficacy to DFO in iron excretion and probably a better penetration to myocardial cells. Considerable increase in iron excretion was documented with combination therapy of DFO and Deferiprone. The proper use of the three chelators will improve the prevention and treatment of iron overload, it will reduce  complications, and improve survival and quality of life of transfused patients

  6. Guidelines for the Standard Monitoring of Patients With Thalassemia: Report of the Thalassemia Longitudinal Cohort.

    Science.gov (United States)

    Tubman, Venée N; Fung, Ellen B; Vogiatzi, Maria; Thompson, Alexis A; Rogers, Zora R; Neufeld, Ellis J; Kwiatkowski, Janet L

    2015-04-01

    Chronic transfusion therapy has played a central role in extending life expectancy for patients with hemoglobinopathies such as thalassemia. However, this life-saving therapy is associated with numerous complications that now comprise the bulk of management considerations for patients with thalassemia. This review reports on the experience of the Thalassemia Longitudinal Cohort and reviews available literature to establish guidelines for the management of patients with thalassemia.

  7. Closely linked polymorphic marker: successful application in preimplantation genetic diagnosis for beta-thalassemia%紧密连锁的多态性位点在β地中海贫血植入前遗传学诊断中的应用

    Institute of Scientific and Technical Information of China (English)

    邓捷; 庄广伦; 彭文林; 周灿权; 李洁; 方丛; 李穗萍; 陈勇; 童大跃

    2005-01-01

    目的探讨与β珠蛋白基因紧密连锁的多态性位点 HumTH01在β地中海贫血(β地贫)植入前遗传学诊断(preimplantation genetic diagnosis,PGD)中的作用.方法对4例已出生重型β地贫患儿的、双方均为β地贫基因携带者的夫妇进行了6个周期的PGD治疗,应用多重巢式PCR同时检测β珠蛋白基因及 HumTH01基因,选择健康的胚胎移植入子宫.结果 6个周期共活检44个胚胎,获得44个卵裂球,其中41个卵裂球扩增成功,35个胚胎经PCR分析后获得明确诊断,移植了14个胚胎,获得1例临床妊娠.孕17周时经脐带血穿刺,证实为完全正常胚胎,现已出生一正常女婴.单个卵裂球平均扩增效率为89.7%,等位基因脱扣(allele drop-out, ADO)率为14.4%. HumTH01基因可以帮助检测出ADO及污染的发生.结论本研究为国内首次报道应用多重巢式PCR同时检测β珠蛋白基因及 HumTH01基因对β地贫进行植入前遗传学诊断并成功获得临床妊娠.在PGD中同时检测与β珠蛋白基因紧密连锁的多态性位点可以降低PGD中由于ADO及污染造成的误诊的风险.%Objective To evaluate the applicability of the polymorphic marker closely linked with beta-globin gene for the preimplantati on genetic diagnosis (PGD) in couples at risk of having child with beta-thalassemia. Methods Single cell multiplex nested PCR which coamplifies the beta-globin gene and the closely linked polymorphic marker, HumTHO1 gene, was applied in six clinical PGD cycles for four couples with beta-thalassemia. Results In six clinical PGD cycles, a total of 44 embryos were biopsied and 44 blastomeres were obtained. Forty-one blastomeres were amplified and thirty-five embryos were given definite diagnoses. Fourteen embryos were transferred back to the uterus of the patients and one pregnancy went on well and ended with one live healthy birth, which confirmed the results of PGD. The average amplification efficiency of single blastomere was 89.7% and

  8. Thalassemia and Hemoglobin E in Southern Thai Blood Donors

    Directory of Open Access Journals (Sweden)

    Manit Nuinoon

    2014-01-01

    Full Text Available Thalassemia and hemoglobin E (Hb E are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%, heterozygous α-thalassemia 1 (1.7%, heterozygous β-thalassemia without α-thalassemia (0.9%, heterozygous Hb E without α-thalassemia (5.2%, double heterozygotes for Hb E/α-thalassemia 1 (1.7%, homozygous Hb E without α-thalassemia (0.9%, and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%. The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors.

  9. Thalassemia and Hemoglobin E in Southern Thai Blood Donors

    Science.gov (United States)

    Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol

    2014-01-01

    Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%), heterozygous α-thalassemia 1 (1.7%), heterozygous β-thalassemia without α-thalassemia (0.9%), heterozygous Hb E without α-thalassemia (5.2%), double heterozygotes for Hb E/α-thalassemia 1 (1.7%), homozygous Hb E without α-thalassemia (0.9%), and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%). The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors. PMID:25050123

  10. High poloidal beta equilibria in TFTR limited by a natural inboard poloidal field null

    International Nuclear Information System (INIS)

    Sabbagh, S.A.; Gross, R.A.; Mauel, M.E.; Navratil, G.A.; Bell, M.G.; Bell, R.; Bitter, M.; Bretz, N.L.; Budny, R.V.; Bush, C.E.; Chance, M.S.; Efthimion, P.C.; Fredrickson, E.D.; Hatcher, R.; Hawryluk, R.J.; Hirshman, S.P.; Janos, A.C.; Jardin, S.C.; Jassby, D.L.; Manickam, J.; McCune, D.C.; McGuire, K.M.; Medley, S.S.; Mueller, D.; Nagayama, Y.; Owens, D.K.; Okabayashi, M.; Park, H.K.; Ramsey, A.T.; Stratton, B.C.; Synakowski, E.J.; Taylor, G.; Wieland, R.M.; Zarnstorff, M.C.; Kesner, J.; Marmar, E.S.; Terry, J.L.

    1991-07-01

    Recent operation of the Tokamak Fusion Test Reactor TFTR, has produced plasma equilibria with values of Λ triple-bond β p eq + l i /2 as large as 7, εβ p dia triple-bond 2μ 0 ε /much-lt B p much-gt 2 as large as 1.6, and Troyon normalized diamagnetic beta, β N dia triple-bond 10 8 t perpendicular>aB 0 /I p as large as 4.7. When εβ p dia approx-gt 1.25, a separatrix entered the vacuum chamber, producing a naturally diverted discharge which was sustained for many energy confinement times, τ E . The largest values of εβ p and plasma stored energy were obtained when the plasma current was ramped down prior to neutral beam injection. The measured peak ion and electron temperatures were as large as 24 keV and 8.5 keV, respectively. Plasma stored energy in excess of 2.5 MJ and τ E greater than 130 msec were obtained. Confinement times of greater than 3 times that expected from L-mode predictions have been achieved. The fusion power gain. Q DD , reached a values of 1.3 x 10 -3 in a discharge with I p = 1 MA and εβ p dia = 0.85. A large, sustained negative loop voltage during the steady state portion of the discharge indicates that a substantial non-inductive component of I p exists in these plasmas. Transport code analysis indicates that the bootstrap current constitutes up to 65% of I p . Magnetohydrodynamic (MHD) ballooning stability analysis shows that while these plasmas are near, or at the β p limit, the pressure gradient in the plasma core is in the first region of stability to high-n modes. 24 refs., 10 figs

  11. The marrow heterotopia in thalassemia

    International Nuclear Information System (INIS)

    Papavasiliou, C.; Gouliamos, A.; Andreou, J.

    1986-01-01

    The subject of marrow heterotopia has been reviewed on the basis of 15 cases suffering from thalassemia. Other cases reported in the literature were also reviewed. Using conventional radiography, scintigraphy, computerized tomography and myelography, 17% of the cases admitted into the hospital with the diagnosis of Thalassemia, were found to have macroscopic masses of marrow heterotopia. The most common site of development of these masses was the costovertebral gutter, followed by the anterior end of the ribs and the extradural space of the spinal canal. In one case, masses were located in the maxillary antra. The clinical implications, the pathogenesis of the masses and the differential diagnosis from other tumour-like entities are discussed. Three patients presented with symptoms and signs of spinal cord compression. All three patients were treated satisfactorily with small doses of radiotherapy. (orig.)

  12. Serum zinc level in thalassemia

    International Nuclear Information System (INIS)

    Keikhaei, B.; Badavi, M.; Pedram, M.; Zandian, K.

    2010-01-01

    To compare serum zinc level between Thalassemia Major (TM) patients and normal population at Shafa Hospital in South West of Iran. A total of 25 male and 36 female of TM patients were enrolled in this study. Out of 61 patients thirty were treated by deferroxamine (DFO) and 31 were on the combination of DFO and deferiprone (DEF) protocol therapy. Sixty normal subjects of the matching age and gender were recruited as controls. From each patient and control group 2 ml of blood was taken in fasting condition. Cell blood count and serum zinc were carried out for both thalassemia patients and normal subjects. The mean age of patients and control group was 15+- 5 years. Mean serum zinc level was 68.97+- 21.12 mu g/dl, 78.10-28.50 mu g/dl, and 80.16+- 26.54 mu g/dl in the TM with DFO, TM with DFO + DEF combination protocol and control group respectively. There was no significant correlation between patients and control group. However 50 percent of TM with DFO, 38.7 percent of TM with DFO + DEF and 32.8 percent of control group had hypozincemia. Nearly 40 to 50 percent of TM patients and one third of normal subjects are suffering from hypozincemia. This study shows that low level of serum zinc is a health problem in both thalassemia patients and normal population in South West of Iran. (author)

  13. Results on neutrinoless double beta decay search in GERDA. Background modeling and limit setting

    Energy Technology Data Exchange (ETDEWEB)

    Becerici Schmidt, Neslihan

    2014-07-22

    The search for the neutrinoless double beta decay (0νββ) process is primarily motivated by its potential of revealing the possible Majorana nature of the neutrino, in which the neutrino is identical to its antiparticle. It has also the potential to yield information on the intrinsic properties of neutrinos, if the underlying mechanism is the exchange of a light Majorana neutrino. The Gerda experiment is searching for 0νββ decay of {sup 76}Ge by operating high purity germanium (HPGe) detectors enriched in the isotope {sup 76}Ge (∝ 87%), directly in ultra-pure liquid argon (LAr). The first phase of physics data taking (Phase I) was completed in 2013 and has yielded 21.6 kg.yr of data. A background index of B∼10{sup -2} cts/(keV.kg.yr) at Q{sub ββ}=2039 keV has been achieved. A comprehensive background model of the Phase I energy spectrum is presented as the major topic of this dissertation. Decomposition of the background energy spectrum into the individual contributions from different processes provides many interesting physics results. The specific activity of {sup 39}Ar has been determined. The obtained result, A=(1.15±0.11) Bq/kg, is in good agreement with the values reported in literature. The contribution from {sup 42}K decays in LAr to the background spectrum has yielded a {sup 42}K({sup 42}Ar) specific activity of A=(106.2{sub -19.2}{sup +12.7}) μBq/kg, for which only upper limits exist in literature. The analysis of high energy events induced by α decays in the {sup 226}Ra chain indicated a total {sup 226}Ra activity of (3.0±0.9) μBq and a total initial {sup 210}Po activity of (0.18±0.01) mBq on the p{sup +} surfaces of the enriched semi-coaxial HPGe detectors. The half life of the two-neutrino double beta (2νββ) decay of {sup 76}Ge has been determined as T{sub 1/2}{sup 2ν}=(1.926±0.094).10{sup 21} yr, which is in good agreement with the result that was obtained with lower exposure and has been published by the Gerda collaboration

  14. Results on neutrinoless double beta decay search in GERDA. Background modeling and limit setting

    International Nuclear Information System (INIS)

    Becerici Schmidt, Neslihan

    2014-01-01

    The search for the neutrinoless double beta decay (0νββ) process is primarily motivated by its potential of revealing the possible Majorana nature of the neutrino, in which the neutrino is identical to its antiparticle. It has also the potential to yield information on the intrinsic properties of neutrinos, if the underlying mechanism is the exchange of a light Majorana neutrino. The Gerda experiment is searching for 0νββ decay of 76 Ge by operating high purity germanium (HPGe) detectors enriched in the isotope 76 Ge (∝ 87%), directly in ultra-pure liquid argon (LAr). The first phase of physics data taking (Phase I) was completed in 2013 and has yielded 21.6 kg.yr of data. A background index of B∼10 -2 cts/(keV.kg.yr) at Q ββ =2039 keV has been achieved. A comprehensive background model of the Phase I energy spectrum is presented as the major topic of this dissertation. Decomposition of the background energy spectrum into the individual contributions from different processes provides many interesting physics results. The specific activity of 39 Ar has been determined. The obtained result, A=(1.15±0.11) Bq/kg, is in good agreement with the values reported in literature. The contribution from 42 K decays in LAr to the background spectrum has yielded a 42 K( 42 Ar) specific activity of A=(106.2 -19.2 +12.7 ) μBq/kg, for which only upper limits exist in literature. The analysis of high energy events induced by α decays in the 226 Ra chain indicated a total 226 Ra activity of (3.0±0.9) μBq and a total initial 210 Po activity of (0.18±0.01) mBq on the p + surfaces of the enriched semi-coaxial HPGe detectors. The half life of the two-neutrino double beta (2νββ) decay of 76 Ge has been determined as T 1/2 2ν =(1.926±0.094).10 21 yr, which is in good agreement with the result that was obtained with lower exposure and has been published by the Gerda collaboration. According to the model, the background in Q ββ ±5 keV window is resulting from close

  15. Aseptic necrosis of femoral head complicating thalassemia

    International Nuclear Information System (INIS)

    Orzincolo, C.; Castaldi, G.; Scutellary, P.N.; Bariani, L.; Pinca, A.

    1986-01-01

    Aseptic necrosis of the femoral head is described in 4 patients, selected from 280 patients with homozygous β-thalassemia (Cooley anemia). The incidence of the complication appears to be very high (14.5per mille) in thalassemia, compared to the general population. The possible mechanism are discussed. (orig.)

  16. [Clinical management of beta-thalassaemia].

    Science.gov (United States)

    Thuret, Isabelle

    2014-10-01

    Beta-thalassemia syndromes are autosomal recessive disorders related to the inability to produce beta-globin chains. Thalassemia major is by definition a transfusion dependent anemia and iron overload is the leading cause of death and morbidity. Beta-thalassemia is rarely encountered in France where patients mainly originated from Mediterranean countries and South East Asia. Recently, two major advances have substantially improved the disease management: oral iron chelation therapy and the introduction of cardiac MRI for monitoring cardiac iron. Hematopoietic stem cell transplantation remains, in clinical practice, the only curative approach and is proposed to children having an HLA-identical sibling. Diagnosis of thalassemia trait is important in order to propose genetic counseling to couples at risk. Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Clinical severity increases with age with a more severe anemia, thrombotic complications and extra-medullary hematopoiesis. Iron overload, optimally monitored with liver MRI, occurs in adult patients and is related to increased iron hyper-absorption.

  17. Improved limit on the mass of ν/sub e/ from the beta decay of molecular tritium

    International Nuclear Information System (INIS)

    Bowles, T.J.; Friar, J.L.; Robertson, R.G.H.; Stephenson, G.J. Jr.; Wark, D.L.; Wilkerson, J.F.; Knapp, D.A.

    1989-01-01

    We report a new upper limit of 13.4 eV (95% confidence level) on the mass of the electron antineutrino from a study of the shape of the beta spectrum of free molecular tritium. This result appears to be inconsistent with a reported value for the mass of 26(5) eV. The electron neutrino is evidently not massive enough to close the universe by itself. 23 refs., 1 fig., 2 tabs

  18. Improved limit on the mass of bar νe from the beta decay of molecular tritium

    International Nuclear Information System (INIS)

    Bowles, T.J.; Robertson, R.G.H.; Wark, D.L.; Wilkerson, J.F.; Stephenson, G.J.; Friar, J.L.; Knapp, D.A.

    1990-01-01

    We report a new upper limit of 13.4 eV (95% confidence level) on the mass of the electron antineutrino from a study of the shape of the beta spectrum of free molecular tritium. This result appears to be inconsistent with a reported value for the mass of 26(5) eV. The electron neutrino is evidently not massive enough to close the universe by itself. 21 refs., 1 fig., 2 tabs

  19. Assessment of serum ferritin levels in thalassemia and non-thalassemia patients presented with anemia

    Directory of Open Access Journals (Sweden)

    Mohammed Mahdi Abdulomohsin AL-Zubaidi

    2015-01-01

    Objectives: The aim of this study was to assess serum ferritin levels in B-thalassemia patients, and to compare it with non-thalassemic anemia and healthy control. Materials and methods : A prospective cross sectional study conducted at Thalassemia Center in Ibn Al- Baladi Hospital for Children and Women during the period from1st February to 30th May 2014 during their attendance to out-patient clinic. A total .number of 101 patients complaining of anemia (51 patients with thalassemia, 50 with non-thalassemia in addition to 50 healthy subjects considered as control. All patients were tested for Serum ferritin levels and all results were obtained through automated quantitative test for use Vidas machine Results : The mean serum ferritin levels in cases of thalassemia was 9542 ± 782 ng/ml while serum ferritin levels in control sample was 138 ± 323 ng/ml in male and 28 ± 108 ng/ml in female . in patients with non-thalassemia anemia, the levels of serum ferritin was 1 ± 80 ng/ml. Age of all patients in this study ranged from 3day-9year .the age of thalassemia patients ranged from 1-6 year and p-value was(0.23 while the age of patients with non-thalassemia anemia was 1-5 year and p-value was (0.11. Conclusion: This study confirm that serum ferritin is high in patients wih thalassemia than non thalassemia.

  20. beta-thalassaemia major hos børn og unge i Danmark

    DEFF Research Database (Denmark)

    Jung, Anne; Main, Katharina Maria; Scheibel, Elma

    2002-01-01

    INTRODUCTION: Beta-thalassemia major occurs with increasing frequency among Danish children as a result of immigration. The aim of the study was to estimate the occurrence of beta-thalassemia major in Denmark, analyse the treatment and organ functions, and identify areas for an improved treatment...... strategy. MATERIAL AND METHODS: During 1998-99 all Danish pediatric departments were contacted for identification of children aged 0-18 years with beta-thalassemia major. Blood transfusions and chelation therapy were registered, and for Eastern Denmark clinical, endocrine, cardiac, and serologic parameters...... were performed. RESULTS: Twenty-six children had beta-thalassemia major. Out of these, 20 received blood transfusions, and 17 patients were chelated. Eight patients were not chelated owing to previous bone marrow transplantation, treatment with hydroxyurea or ferritin

  1. Beta-thalassaemia major hos børn og unge i Danmark

    DEFF Research Database (Denmark)

    Jung, A.; Main, K.M.; Scheibel, E.

    2002-01-01

    INTRODUCTION: Beta-thalassemia major occurs with increasing frequency among Danish children as a result of immigration. The aim of the study was to estimate the occurrence of beta-thalassemia major in Denmark, analyse the treatment and organ functions, and identify areas for an improved treatment...... strategy. MATERIAL AND METHODS: During 1998-99 all Danish pediatric departments were contacted for identification of children aged 0-18 years with beta-thalassemia major. Blood transfusions and chelation therapy were registered, and for Eastern Denmark clinical, endocrine, cardiac, and serologic parameters...... were performed. RESULTS: Twenty-six children had beta-thalassemia major. Out of these, 20 received blood transfusions, and 17 patients were chelated. Eight patients were not chelated owing to previous bone marrow transplantation, treatment with hydroxyurea or ferritin

  2. Thalassemia and hemoglobinopathies in an ethnic minority group in Central Vietnam: implications to health burden and relationship between two ethnic minority groups.

    Science.gov (United States)

    Nguyen, Nga Thi; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Van Nguyen, Hoa; Phan, Hoa Thi Thuy; Fucharoen, Goonnapa; Fucharoen, Supan

    2017-07-01

    Thalassemia is a genetic condition that can result in long and expensive treatments, and severe thalassemia may lead to death if left untreated. Couples contributing two genes for thalassemia place their children at particular risk for severe thalassemia. Gene frequency of thalassemia varies in Vietnam, but presents remarkably high levels among some ethnic minority groups. Limited information about thalassemia frequency makes prevention and control of thalassemia difficult. This study aimed to determine gene frequency of certain types of thalassemia among 390 women of reproductive age of the Ta-Oi ethnic minority. Hemoglobin and DNA analyses were carried out to diagnose thalassemia and hemoglobinopathies. Of the total participants, 56.1% (95% CI = 51.1-61.1) carried thalassemia genes. A remarkably high frequency of hemoglobin Constant Spring (Hb CS) of 23.8% (95% CI = 19.7-28.4) was noted. The frequency of α + -thalassemia (-3.7 kb deletion) was 26.4% (95% CI = 22.1-31.1), while hemoglobin E (Hb E) and hemoglobin Paksé (Hb Ps) were identified at frequencies of 14.6 (95% CI = 11.2-18.5) and 2.6% (95% CI = 1.4-5.0), respectively. Further analysis of α-globin gene haplotype revealed the same Hb CS haplotype (+ - M + + -) as of the Co-Tu minority, a neighboring minority of the Ta-Oi, indicating that these two minorities may share the same ancestors. This information will be helpful for further studies in population genetics, as well as the development prevention and control program in the region.

  3. INFECTIONS IN THALASSEMIA AND HEMOGLOBINOPATHIES

    Directory of Open Access Journals (Sweden)

    Deborah Rund

    2009-06-01

    Full Text Available

     

    The clinical approach to thalassemia and hemoglobinopathies, specifically Sickle Cell Disease (SCD, based on transfusions, iron chelation and bone marrow transplantation has ameliorated their prognosis. Nevertheless, infections still may cause serious complications in these patients. The susceptibility to infections in thalassemia and SCD arises both from a large spectrum of immunological abnormalities and from exposure to specific infectious agents. Four fundamental issues will be focused upon as central causes of immune dysfunction: the diseases themselves; iron overload, transfusion therapy and the role of the spleen. Thalassemia and SCD differ in their pathogenesis and clinical course. It will be outlined how these differences affect immune dysfunction, the risk of infections and the types of most frequent infections in each disease. Moreover, since transfusions are a fundamental tool for treating these patients, their safety is paramount in reducing the risks of infections. In recent years, careful surveillance worldwide and improvements in laboratory tests reduced greatly transfusion transmitted infections, but the problem is not completely resolved. Finally, selected topics will be discussed regarding Parvovirus B19 and transfusion transmitted infections as well as the prevention of infectious risk postsplenectomy or in presence of functional asplenia.

  4. Thalassemia mutations in Gaziantep, Turkey

    African Journals Online (AJOL)

    STORAGESEVER

    2010-02-22

    Feb 22, 2010 ... Table 3. Frequency of β-thalassemia mutations in the Eastern Mediterranean. Mutation. This study Turkey Cyprus Greece Syria Palestine Bulgaria Azerbaijan Iran Iraq. IVS 1.110 (G>A). 29.1. 39.3. 79.7. 42.1. 24.1. 17.6. 24.2. 20.2. 4.8 1.9. IVS 2.1 (G>A). 12.3. 4.7. -. 3.3. 4.2. 2.9. -. -. 33.9 18.3. IVS 1.1 (G>A).

  5. What Unrelated Hematopoietic Stem Cell Transplantation in Thalassemia Taught us about Transplant Immunogenetics

    Science.gov (United States)

    La Nasa, Giorgio; Vacca, Adriana; Littera, Roberto; Piras, Eugenia; Orru, Sandro; Greco, Marianna; Carcassi, Carlo; Caocci, Giovanni

    2016-01-01

    Although the past few decades have shown an improvement in the survival and complication-free survival rates in patients with beta-thalassemia major and gene therapy is already at an advanced stage of experimentation, hematopoietic stem cell transplantation (HSCT) continues to be the only effective and realistic approach to the cure of this chronic non-malignant disease. Historically, human leukocyte antigen (HLA)-matched siblings have been the preferred source of donor cells owing to superior outcomes compared with HSCT from other sources. Nowadays, the availability of an international network of voluntary stem cell donor registries and cord blood banks has significantly increased the odds of finding a suitable HLA matched donor. Stringent immunogenetic criteria for donor selection have made it possible to achieve overall survival (OS) and thalassemia-free survival (TFS) rates comparable to those of sibling transplants. However, acute and chronic graft-versus-host disease (GVHD) remains the most important complication in unrelated HSCT in thalassemia, leading to significant rates of morbidity and mortality for a chronic non-malignant disease. A careful immunogenetic assessment of donors and recipients makes it possible to individualize appropriate strategies for its prevention and management. This review provides an overview of recent insights about immunogenetic factors involved in GVHD, which seem to have a potential role in the outcome of transplantation for thalassemia. PMID:27872728

  6. Evaluation of Discrimination Indices Validity for Screening of β-Thalassemia Trait

    Directory of Open Access Journals (Sweden)

    Ahmadi A.

    2009-11-01

    Full Text Available AbstractBackground and Objectives: β-thalassemia trait (β-TT and iron deficiency anemia (IDA are the most common forms of microcytic anemia. Screening of β-thalassemia trait is important for medical counseling before marriage and preventing β-thalassemia major birth results. The most common problem in screening -TT is differentiating it from IDA. The aim of this study was to define the sensitivity, specificity, and predictive values of some discrimination indices for screening of β-TT in a sample of such patients.Methods: A total of 82 patients with microcytic anemia (MCV< 80 fl were selected from Namazi Hospital, Shiraz, Iran, and 9 discrimination indices were calculated for them. The patients were divided intotwo groups: 42 patients with β-TT and 40 patients with IDA. The sensitivity, specificity, positive and negative predictive values and Youden,s index of each discrimination index were calculated for screening β-TT.Results: None of the discrimination indices showed 100% of sensitivity and specificity. But the Shin and Lal index, RDW index and RBC count showed the highest and valuable value for screening β-TT.Conclusion: Some discrimination indices like Shin and Lal index, RDW index and RBC index are valuable indices in screening β-TT.Keywords: Beta- Thalassemia; Anemia, Iron Deficiency.

  7. WHAT UNRELATED HEMATOPOIETIC STEM CELL TRANSPLANTATION IN THALASSEMIA TAUGHT US ABOUT TRANSPLANT IMMUNOGENETICS.

    Directory of Open Access Journals (Sweden)

    Giorgio La Nasa

    2016-10-01

    Full Text Available Abstract Although the past few decades have shown an improvement in the survival and complication-free survival rates in patients with beta-thalassemia major and gene therapy is already at an advanced stage of experimentation, hematopoietic stem cell transplantation (HSCT continues to be the only effective and realistic approach to the cure of this chronic non-malignant disease. Historically, human leukocyte antigen (HLA-matched siblings have been the preferred source of donor cells owing to superior outcomes compared with HSCT from other sources. Nowadays, the availability of an international network of voluntary stem cell donor registries and cordon blood banks has significantly increased the odds of finding a suitable HLA matched donor. Stringent immunogenetic criteria for donor selection have made it possible to achieve overall survival (OS and thalassemia-free survival (TFS rates comparable to those of sibling transplants. However, acute and chronic graft-versus-host disease (GVHD remains the most important complication in unrelated HSCT in thalassemia, leading to considerable rates of morbidity and mortality for a chronic non-malignant disease. A careful immunogenetic assessment of donors and recipients makes it possible to individuate appropriate strategies for its prevention and management. This review provides an overview on recent insights about immunogenetic factors involved in GVHD, which seem to have a potential role in the outcome of transplantation for thalassemia.

  8. Lower limits of detection in using carbon nanotubes as thermoluminescent dosimeters of beta radiation

    Science.gov (United States)

    Alanazi, Abdulaziz; Jurewicz, Izabela; Alalawi, Amani I.; Alyahyawi, Amjad; Alsubaie, Abdullah; Hinder, Steven; Bañuls-Ciscar, Jorge; Alkhorayef, Mohammed; Bradley, D. A.

    2017-11-01

    World-wide, on-going intensive research is being seen in adaptation of carbon nanotubes (CNTs) for a wide variety of applications, particular interest herein being in the thermoluminescent (TL) properties of CNTs and their sensitivity towards energetic radiations. Using beta radiation delivering dose levels of a few Gy it has been observed in previous study that strain and impurity defects in CNTs give rise to significant TL yields, providing an initial measure of the extent to which electron trapping centres exist in various qualities of CNT, from super-pure to raw. This in turn points to the possibility that there may be considerable advantage in using such media for radiation dosimetry applications, including for in vivo dosimetry. CNTs also have an effective atomic number similar to that of adipose tissue, making them suitable for soft tissue dosimetry. In present investigations various single-wall carbon nanotubes (SWCNT) samples in the form of buckypaper have been irradiated to doses in the range 35-1.3 Gy, use being made of a 90Sr beta source, the response of the CNTs buckypaper with dose showing a trend towards linearity. It is shown for present production methodology for buckypaper samples that the raw SWCNT buckypaper offer the greatest sensitivity, detecting doses down to some few tens of mGy.

  9. Hemoglobin Q-Thailand and its combinations with other forms of thalassemia or hemoglobinopathies in northern Thailand.

    Science.gov (United States)

    Panyasai, Sitthichai; Pornprasert, Sakorn

    2014-01-01

    There have been no reports for the frequency of Hb Q-Thailand [alpha 74(EF3)Asp --> His, GAC > CAC] and its combinations either with other forms of thalassemia or hemoglobinopathies in Northern Thailand. The aims of this study were to search for Hb Q-Thailand and its combinations in Northern Thai population and to analyze fractions of hemoglobin in Hb Q-Thailand and its combinations on high performance liquid chromatography (HPLC) chromatograms and/or capillary electrophoresis (CE) electrophoregrams. Blood samples from public and private hospitals in 7 northern provinces of Thailand were analyzed for thalassemia and hemoglobinopathy diagnoses using HPLC and/or CE and DNA analysis techniques at the Thalassemia Laboratory, Associated Medical Sciences Clinical Service Center, Chiang Mai, Thailand. Hb Q-Thailand was found in 13 of 13,596 (0.10%) samples; 6 were heterozygous Hb Q-Thailand, 4 were compound Hb Q-Thailand/alpha-thalassemia-1 Southeast Asian (SEA) type deletion and 3 with combinations of Hb Q-Thailand/beta(0)-thalassemia, Hb Q-Thailand/Hb E and Hb Q-Thailand/Hb E/alpha-thalassemia-1 SEA type deletion. The fractions of hemoglobin on HPLC chromatograms and CE electrophoregrams were observed based on types of combinations. Hb Q-Thailand and its combinations could be found in northern Thai population with the frequency of 0.10%. Thus, the better understanding of HPLC chromatogram and/or CE electrophoregram patterns of Hb Q-Thailand and its combination is essential for diagnosis and genetic counseling of thalassemia and hemoglobinopathies in this area.

  10. Posterior transverse interarch discrepancy on HbE β thalassemia patients

    Directory of Open Access Journals (Sweden)

    Yuniar Zen

    2011-03-01

    Full Text Available Background: One of the symptoms that often arises on thalassemia patients is disharmony dentofacial, class II skeletal malocclusion, as a result of the malrelation of maxilla and mandible. This malrelation can be affected by either maxillary bone position, dentoalveolar maxillary position, mandibular bone position, dentoalveolar mandibular position, or combinations of those components. Purpose: The study was aimed to examine whether there is posterior transverse interarch discrepancy on the HbE β thalassemia patients or not. Methods: This study is an observational research with cross-sectional design. The sample consisted of 33 HbE β thalassemia patients and 33 non-thalassemia patients as a control group aged 12–14 years. Lateral cephalogram was carried out and dental casts of maxillary and mandibular dental arches were also taken in all of those patients. Results: There was no difference between the maxillary intermolar width of the HbE β thalassemia patients and that of the normal ones, but the mandibular intermolar width of the HbE β thalassemia patients was significantly smaller than that of the normal ones. Beside that, posterior transverse interarch discrepancy of of the HbE β thalassemia patients was significantly greater than that of the normal ones, which showed great difference between maxillary and mandibular intermolar widths. Conclusion: Posterior transverse interarch discrepancy of the HbE β thalassemia patients was different from that of the normal ones. The dentofacial abnormalities on the HbE β thalassemia patients aged 12–14 years primarily was due to disporposional dentofacial growth in the vertical, sagittal, and transversal directions, especially in the posterior region.Latar belakang: Salah satu akibat yang sering timbul pada penderita talasemia adalah disharmoni dentofasial berupa maloklusi skeletal kelas II yang merupakan kelainan hubungan maksila dan mandibula. Malrelasi ini dapat dipengaruhi oleh posisi

  11. Gene Therapy in Thalassemia and Hemoglobinopathies

    OpenAIRE

    Breda, Laura; Gambari, Roberto; Rivella, Stefano

    2009-01-01

    Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

  12. Multiple transfused thalassemia major: Ocular manifestations in a hospital-based population

    Directory of Open Access Journals (Sweden)

    Taneja Rashi

    2010-01-01

    Full Text Available Purpose: To study the ocular manifestations in multiple transfused beta-thalassemia major patients and assess the ocular side-effects of iron chelating agents. Materials and Methods: In this prospective observational study, 45 multiple transfused beta-thalassemia major children between six months and 21 years of age were enrolled and assigned groups according to the treatment regimens suggested. Group A received only blood transfusions, Group B blood transfusions with subcutaneous desferrioxamine, Group C blood transfusions with desferrioxamine and oral deferriprone and Group D blood transfusions with deferriprone. Ocular status at the time of enrolment was documented. Subjects were observed quarterly for one year for changes in ocular status arising due to the disease process and due to iron chelation therapy. Children with hemoglobinopathies other than beta-thalassemia major, congenital ocular anomalies and anemia due to other causes were excluded. Results: Ocular involvement was observed in 58% of patients. Lenticular opacities were the most common ocular finding (44%, followed by decreased visual acuity (33%. An increased occurrence of ocular changes was observed with increase of serum ferritin and serum iron levels as well as with higher number of blood transfusions received. Desferrioxamine seemed to have a protective influence on retinal pigment epithelium (RPE mottling. Occurrence of lenticular opacities and RPE degeneration correlated positively with use of desferrioxamine and deferriprone respectively. Follow-up of patients for one year did not reveal any change in ocular status. Conclusion: Regular ocular examinations can aid in preventing, delaying or ameliorating the ocular complications of thalassemia.

  13. Hepcidin is suppressed by erythropoiesis in hemoglobin E β-thalassemia and β-thalassemia trait

    Science.gov (United States)

    Jones, Emma; Pasricha, Sant-Rayn; Allen, Angela; Evans, Patricia; Fisher, Chris A.; Wray, Katherine; Premawardhena, Anuja; Bandara, Dyananda; Perera, Ashok; Webster, Craig; Sturges, Pamela; Olivieri, Nancy F.; St. Pierre, Timothy; Armitage, Andrew E.; Porter, John B.; Weatherall, David J.

    2015-01-01

    Hemoglobin E (HbE) β-thalassemia is the most common severe thalassemia syndrome across Asia, and millions of people are carriers. Clinical heterogeneity in HbE β-thalassemia is incompletely explained by genotype, and the interaction of phenotypic variation with hepcidin is unknown. The effect of thalassemia carriage on hepcidin is also unknown, but it could be relevant for iron supplementation programs aimed at combating anemia. In 62 of 69 Sri Lankan patients with HbE β-thalassemia with moderate or severe phenotype, hepcidin was suppressed, and overall hepcidin inversely correlated with iron accumulation. On segregating by phenotype, there were no differences in hepcidin, erythropoiesis, or hemoglobin between severe or moderate disease, but multiple linear regression showed that erythropoiesis inversely correlated with hepcidin only in severe phenotypes. In moderate disease, no independent predictors of hepcidin were identifiable; nevertheless, the low hepcidin levels indicate a significant risk for iron overload. In a population survey of Sri Lankan schoolchildren, β-thalassemia (but not HbE) trait was associated with increased erythropoiesis and mildly suppressed hepcidin, suggesting an enhanced propensity to accumulate iron. In summary, the influence of erythropoiesis on hepcidin suppression associates with phenotypic disease variation and pathogenesis in HbE β-thalassemia and indicates that the epidemiology of β-thalassemia trait requires consideration when planning public health iron interventions. PMID:25519750

  14. My Story: Real Stories of People Living with Thalassemia

    Science.gov (United States)

    ... Share Compartir Real Stories from People living with Thalassemia On this Page Rahul’s Story Aaron’s Story Rahul’s ... is Rahul Kapoor, and I was born with thalassemia, a blood disorder which requires transfusions every other ...

  15. A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

    Science.gov (United States)

    Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

    2016-10-01

    The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Thalassemia and Hemoglobin E in Southern Thai Blood Donors

    OpenAIRE

    Nuinoon, Manit; Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol

    2014-01-01

    Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were ...

  17. Neural-net predictor for beta limit disruptions in JT-60U

    International Nuclear Information System (INIS)

    Yoshino, R.

    2005-01-01

    Prediction of major disruptions occurring at the β -limit for tokamak plasmas with a normal magnetic shear in JT-60U was conducted using neural networks. Since no clear precursors are generally observed a few tens of milliseconds before the β -limit disruption, a sub-neural network is trained to output the value of the β N limit every 2 ms. The target β N limit is artificially set by the operator in the first step to train a network with non-disruptive shots as well as disruptive shots, and then in the second step the target limit is modified using the β N limit output from the trained network. The adjusted target greatly improves the consistency between the input data and the output. This training, the 'self-teaching method', has greatly reduced the false alarm rate triggered for non-disruptive shots. To improve the prediction performance further, the difference between the output β N limit and the measured β N , and 11 parameters, are inputted to the main neural network to calculate the 'stability level'. The occurrence of a major disruption is predicted when the stability level decreases to the 'alarm level'. Major disruptions at the β -limit have been predicted by the main network with a prediction success rate of 80% at 10 ms prior to the disruption while the false alarm rate is lower than 4% for non-disruptive shots. This 80% value is much higher than that obtained for a network trained with a fixed target β N limit set to be the maximum β N observed at the start of a major disruption, lower than 10%. A prediction success rate of 90% with a false alarm rate of 12% at 10 ms prior to the disruption has also been obtained. This 12% value is about half of that obtained for a network trained with a fixed target β N limit

  18. Beta-limit of a large tokamak with a circular cross-section

    International Nuclear Information System (INIS)

    Tsunematsu, Toshihide; Takeda, Tatsuoki; Kurita, Gen-ichi; Azumi, Masafumi; Matsuura, Toshihiko; Gruber, R.; Troyon, F.

    1982-01-01

    The dependence of stabilizing effect of a conducting shell on a poloidal beta value (βsub(p)) is investigated as to instabilities with low toroidal mode numbers (n = 1 and 2) for a tokamak with a circular cross-section such as JT-60. The n = 1 mode is completely stabilized by the conducting shell which is located at a practically possible position and the critical position of the shell becomes closer to the plasma surface with increasing βsub(p). The stabilizing effect on the n = 2 mode is remarkable for higher βsub(p) when the shell is placed sufficiently close to the plasma surface but the shell far from the plasma surface has hardly an effect on the stability property of a higher βsub(p) plasma. It is concluded that critical β of about 2% is attainable even in a standard circular tokamak such as JT-60 and higher β value is also expected by taking advantage of the closely located conducting shell. (author)

  19. Limit on the anti nu/sub e/ mass in free molecular tritium beta decay

    International Nuclear Information System (INIS)

    Bowles, T.J.; Wilkerson, J.F.; Browne, J.C.; Maley, M.P.; Robertson, R.G.H.; Knapp, D.A.; Helffrich, J.A.

    1986-01-01

    The question of a nonzero neutrino mass has received considerable attention since the claims of Lyubimov et al in 1980 were published which showed evidence for an electron antineutrino mass between 14 and 46 eV, with a best fit value of 35 eV. However, there are still considerable concerns about possible systematic problems in thier experiment. Many of these concerns revolve around the use of a tritiated valine source, in which the energy given up in final state excitations of the molecule following the veta decay of one of the tritium atoms is comparable to the size of the neutrino mass observed. The effect of these final state effects is difficult to calculate in a molecule as complex as valine. In addition, ionization energy loss and backscattering of the betas in traversing the solid source are appreciable and must be very accurately accounted for. These concerns have led us to carry out an experiment using free molecular tritium as the source material. The final state effects have been accurately calculated for the tritium molecule and the uncertainties in these calculations cannot generate a spurious neutrino mass greater than 1 eV. in addition, the energy loss in the source is small because the source consists of tritium only and there is no backscattering

  20. Hemoglobinopathies and thalassemia screening among Senoi Orang Asli in Peninsular Malaysia

    Science.gov (United States)

    Rong, Danny Koh Xuan; Ismail, Endom; Sabudin, Raja Zahratul Azma Raja; Hussin, Noor Hamidah; Othman, Ainoon

    2015-09-01

    Orang Asli are the minority indigenous people in Peninsular Malaysia and can be divided into 3 main groups (Negrito, Senoi and Proto Malay) with different six sub-ethnics under each group. Within the Senoi group, the six sub-ethnics are sub-ethnic Mah Meri, Semoq Beri, Che Wong, Jah Hut, Semai and Temiar. This study was aimed to investigate the current prevalence of α- and β-thalassemia and hemoglobinopathies and their mutation types among all six sub-ethnics of Senoi Orang Asli. Blood samples from 685 Senoi participants were collected and sent immediately for routine full blood count analysis and hemoglobin sub-typing. Of 378 subjects screened, 7 subjects were found to be Hemoglobin E (HbE) beta thalassemia carriers, 13 beta thalassaemic, 35 Hemoglobin Constant Spring (HbCS) carriers, 6 compound HbE and HbCS carriers, 32 with HbE disease and 163 HbE heterozygote carriers. The findings of high HbE among Temiars and Jah Huts and high HbCS exclusively in Jah Huts in this study suggest distinct differences across sub-ethnics under Senoi group. Understanding of prevalence and wide spectrum of thalassemia and hemoglobinopathies among Senoi and Orang Asli is essential for national thalassaemia awareness and prevention program, especially in Orang Asli communities.

  1. Beta-trace protein in ascites and pleural effusions: limits of CSF leakage detection.

    Science.gov (United States)

    Dietzel, Joanna; Krebs, Alexander; Böttcher, Dominique; Sieb, Manuela; Glocker, Michael O; Lüdemann, Jan; Roser, Markus; Dressel, Alexander

    2012-06-10

    Rhino- and/or otoliquorrhea can be diagnosed by detecting beta-trace protein (β-TP) in nasal or ear secretions, as β-TP is found in high concentrations in cerebrospinal fluid (CSF) but not in serum. CSF fistulae following trauma or surgery can also occur at other anatomical sites, resulting in CSF leakage into the thoracic and abdominal cavities. By analogy, determination of ß-TP has also been used to diagnose CSF admixture in pleural effusions and ascites. However, no systematic study has yet evaluated the concentrations of β-TP in such fluids in the absence of CSF. To determine the validity of β-TP determination as a marker for the presence of CSF, we investigated β-TP concentrations in pleural effusions and ascites without CSF admixture. Patients from whom samples of ascites or pleural effusion and a paired plasma sample were available were investigated. One hundred sixty-four patients were prospectively recruited. ß-TP concentrations were determined by nephelometry. Mass spectrometric proteome analysis confirmed the presence of ß-TP in the samples. Median β-TP concentrations detected in ascites and pleural effusions (range, 0.014-26.5 mg/L, median 2.29 mg/L) exceeded the corresponding plasma concentrations 2.6-fold. According to cutoffs published to diagnose rhino- and otoliquorrhea, between 6.1% and 95.7% of the specimens would have been erroneously rated CSF-positive. Protein analysis confirmed the presence of β-TP in pleural effusion and ascites. Ascites and pleural effusion contain high concentrations of β-TP that exceed the levels in corresponding plasma. Therefore, β-TP is not a specific marker for the presence of CSF in these fluids.

  2. Thalassemia

    Science.gov (United States)

    ... Report Cards Careers Archives Pregnancy Before or between pregnancies Nutrition, weight & fitness Prenatal care Is it safe? Labor & ... Careers Archives Health Topics Pregnancy Before or between pregnancies Nutrition, weight & fitness Prenatal care Is it safe? Labor & ...

  3. Beliefs about chelation among thalassemia patients

    Directory of Open Access Journals (Sweden)

    Trachtenberg Felicia L

    2012-12-01

    Full Text Available Abstract Background Understanding patients’ views about medication is crucial to maximize adherence. Thalassemia is a congenital blood disorder requiring chronic blood transfusions and daily iron chelation therapy. Methods The Beliefs in Medicine Questionnaire (BMQ was used to assess beliefs in chelation in thalassemia patients from North America and London in the Thalassemia Longitudinal Cohort (TLC of the Thalassemia Clinical Research Network (TCRN. Chelation adherence was based on patient report of doses administered out of those prescribed in the last four weeks. Results Of 371 patients (ages 5-58y, mean 24y, 93% were transfused and 92% receiving chelation (26% deferoxamine (DFO; a slow subcutaneous infusion via portable pump, 63% oral, 11% combination. Patients expressed high “necessity” for transfusion (96%, DFO chelation (92% and oral chelation (89%, with lower “concern” about treatment (48%, 39%, 19% respectively. Concern about oral chelation was significantly lower than that of DFO (p Conclusions Despite their requirement for multimodal therapy, thalassemia patients have positive views about medicine, more so than in other disease populations. Patients may benefit from education about the tolerability of chelation and strategies to effectively cope with side effects, both of which might be beneficial in lowering body iron burden. Clinicaltrials.gov identifier NCT00661804

  4. High beta-palmitate fat controls the intestinal inflammatory response and limits intestinal damage in mucin Muc2 deficient mice.

    Directory of Open Access Journals (Sweden)

    Peng Lu

    Full Text Available BACKGROUND: Palmitic-acid esterified to the sn-1,3 positions of the glycerol backbone (alpha, alpha'-palmitate, the predominant palmitate conformation in regular infant formula fat, is poorly absorbed and might cause abdominal discomfort. In contrast, palmitic-acid esterified to the sn-2 position (beta-palmitate, the main palmitate conformation in human milk fat, is well absorbed. The aim of the present study was to examine the influence of high alpha, alpha'-palmitate fat (HAPF diet and high beta-palmitate fat (HBPF diet on colitis development in Muc2 deficient (Muc2(-/- mice, a well-described animal model for spontaneous enterocolitis due to the lack of a protective mucus layer. METHODS: Muc2(-/- mice received AIN-93G reference diet, HAPF diet or HBPF diet for 5 weeks after weaning. Clinical symptoms, intestinal morphology and inflammation in the distal colon were analyzed. RESULTS: Both HBPF diet and AIN-93G diet limited the extent of intestinal erosions and morphological damage in Muc2(-/- mice compared with HAPF diet. In addition, the immunosuppressive regulatory T (Treg cell response as demonstrated by the up-regulation of Foxp3, Tgfb1 and Ebi3 gene expression levels was enhanced by HBPF diet compared with AIN-93G and HAPF diets. HBPF diet also increased the gene expression of Pparg and enzymatic antioxidants (Sod1, Sod3 and Gpx1, genes all reported to be involved in promoting an immunosuppressive Treg cell response and to protect against colitis. CONCLUSIONS: This study shows for the first time that HBPF diet limits the intestinal mucosal damage and controls the inflammatory response in Muc2(-/- mice by inducing an immunosuppressive Treg cell response.

  5. High beta-palmitate fat controls the intestinal inflammatory response and limits intestinal damage in mucin Muc2 deficient mice.

    Science.gov (United States)

    Lu, Peng; Bar-Yoseph, Fabiana; Levi, Liora; Lifshitz, Yael; Witte-Bouma, Janneke; de Bruijn, Adrianus C J M; Korteland-van Male, Anita M; van Goudoever, Johannes B; Renes, Ingrid B

    2013-01-01

    Palmitic-acid esterified to the sn-1,3 positions of the glycerol backbone (alpha, alpha'-palmitate), the predominant palmitate conformation in regular infant formula fat, is poorly absorbed and might cause abdominal discomfort. In contrast, palmitic-acid esterified to the sn-2 position (beta-palmitate), the main palmitate conformation in human milk fat, is well absorbed. The aim of the present study was to examine the influence of high alpha, alpha'-palmitate fat (HAPF) diet and high beta-palmitate fat (HBPF) diet on colitis development in Muc2 deficient (Muc2(-/-)) mice, a well-described animal model for spontaneous enterocolitis due to the lack of a protective mucus layer. Muc2(-/-) mice received AIN-93G reference diet, HAPF diet or HBPF diet for 5 weeks after weaning. Clinical symptoms, intestinal morphology and inflammation in the distal colon were analyzed. Both HBPF diet and AIN-93G diet limited the extent of intestinal erosions and morphological damage in Muc2(-/-) mice compared with HAPF diet. In addition, the immunosuppressive regulatory T (Treg) cell response as demonstrated by the up-regulation of Foxp3, Tgfb1 and Ebi3 gene expression levels was enhanced by HBPF diet compared with AIN-93G and HAPF diets. HBPF diet also increased the gene expression of Pparg and enzymatic antioxidants (Sod1, Sod3 and Gpx1), genes all reported to be involved in promoting an immunosuppressive Treg cell response and to protect against colitis. This study shows for the first time that HBPF diet limits the intestinal mucosal damage and controls the inflammatory response in Muc2(-/-) mice by inducing an immunosuppressive Treg cell response.

  6. Study of alpha hemoglobin stabilizing protein expression in patients with β thalassemia and sickle cell anemia and its impact on clinical severity.

    Science.gov (United States)

    Mahmoud, Hanan Mohamed; Shoeib, Ahmed Al-Saiid Hamed; Abd El Ghany, Shereen Mohamed; Reda, Marwa Mohamed; Ragab, Iman Ahmed

    2015-12-01

    The α hemoglobin stabilizing protein (AHSP) binds α-Hb and prevents its precipitation limiting free α-Hb toxicities. Our aim was to study AHSP expression in β thalassemia syndromes in relation to their clinical severity and to compare it with its level in sickle cell anemia. We compared patients with β-thalassemia (n=37) (β-thalassemia major (BTM) (n=19) and β-thalassemia intermedia (BTI) (n=18)) with 12 patients with sickle cell anemia as regards clinical severity, age at presentation, transfusion dependency, mean pre-transfusion hemoglobin level, use of hydroxyurea and AHSP expression by real time quantitative PCR. Median (and IQR) AHSP expression was significantly higher in patients with sickle cell anemia 2275 (3898) compared to thalassemia 283 (718), P=0.001, with no significant difference between BTM and BTI (P=0.346). It was also significantly higher in non-transfusion dependent patients with β thalassemia (NTDT) compared to transfusion dependent ones (P=0.019), and in patients on hydroxyurea therapy (Psickle cell anemia versus thalassemia, with no significant difference between BTM and BTI. Expression was higher in patients with NTDT and on hydroxyurea therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. β-Thalassemia Intermedia: A Clinical Perspective

    Science.gov (United States)

    Musallam, Khaled M.; Taher, Ali T.; Rachmilewitz, Eliezer A.

    2012-01-01

    Our understanding of the molecular and pathophysiological mechanisms underlying the disease process in patients with β-thalassemia intermedia has substantially increased over the past decade. Earlier studies observed that patients with β-thalassemia intermedia experience a clinical-complications profile that is different from that in patients with β-thalassemia major. In this article, a variety of clinical morbidities are explored, and their associations with the underlying disease pathophysiology and risk factors are examined. These involve several organs and organ systems including the vasculature, heart, liver, endocrine glands, bone, and the extramedullary hematopoietic system. The effects of some therapeutic interventions on the development of clinical complications are also discussed. PMID:22762026

  8. Management of ß-thalassemia – Consensus and controversies!

    Directory of Open Access Journals (Sweden)

    Mamta V. Manglani

    2017-12-01

    Full Text Available The mainstay of treatment of ß-Thalassemia major includes life-long regular packed red cell transfusions and iron chelation. With advances in understanding the molecular biology and its implications in the patients, newer modalities are now being explored to offer a better quality of life to transfusion dependent thalassemic patients. Improved safety of transfusions, newer chelator drugs and combination of chelators have improved outcomes in these patients. Amlodipine along with chelators may be a future option for preventing cardiac iron overload related complications. Drugs which improve HbF levels and thus ameliorate anemia such as hydroxyurea, butyrates azacytidine etc. have also been explored with little relief to transfusion dependent patients. HSCT, which is the only curative treatment available at present, has its own limitations as sibling donors may not be available to many. However, there has been extensive work done on improving outcomes with MUD and Haplo-identical HSCT in the recent times. Gene therapy using lentiviral vectors is also offering great hope to these children. Induced Pluripotent Stem Cells (iPSC is a promising advance in the treatment of thalassemia. Several newer molecules targeting different pathophysiologic aspects are being explored and have met with good success. These include luspatercept, sotatercept, macrophage inhibition, JAK2 inhibition using ruxolitinib etc. Controversies regarding use of wheat grass and ESAs are relatively less worrisome. But use of thalidomide should be done with great caution. Despite its success reported in anecdotal reports, in the absence of adequate data with larger trials, its role in routine management of thalassemia syndromes remains to be ascertained.

  9. Allogeneic stem cell transplantation for thalassemia major in India

    Directory of Open Access Journals (Sweden)

    Vikram Mathews

    2017-12-01

    Full Text Available Allogeneic stem cell transplantation (allo-SCT is the only currently available curative treatment for thalassemia major. Since it was first done in 1981, several thousand patients have benefited from it and it is now possible to offer this treatment in different parts of the world with good results. With better risk stratification and supportive care, the results of allo-SCT are now very good even in high risk patients who have significant iron overload related organ dysfunction. The improvements have mainly been in the conditioning strategies with less toxic myeloablation and management of the complications of SCT. However, several challenges remain. Transplant related complications still cause significant morbidity and mortality. There is data to show that the results of transplantation as best if done in well transfused and chelated patients <7 years of age. As only a third of the patients will have a matched related donor, there is need for investigating SCT with alternative donors. Experience with SCT for thalassemia major from matched unrelated donors or haplo-identical donors is still limited but needs further exploration. Adequate management needs to be provided post-SCT for all pre-existing complications particularly iron chelation to prevent further organ dysfunction. Systematic follow-up is needed to measure long term outcomes. The biggest challenges in India are the cost of this treatment and access to centres capable of providing this treatment. With greater support from the government, health insurance and philanthropic programs, there has been a rapid increase in the number of SCTs for thalassemia major in India. The number centres providing this treatment are also increasing making this curative treatment more widely available in India.

  10. New limit for the half-life of double beta decay of {sup 94}Zr to the first excited state of {sup 94}Mo

    Energy Technology Data Exchange (ETDEWEB)

    Dokania, N.; Nanal, V.; Gupta, G.; Pillay, R.G.; Ghosh, C. [Tata Institute of Fundamental Research, Department of Nuclear and Atomic Physics, Mumbai (India); Pal, S. [Tata Institute of Fundamental Research, Pelletron Linac Facility, Mumbai (India); Rath, P.K. [University of Lucknow, Department of Physics, Lucknow (India); Tretyak, V.I. [Institute for Nuclear Research, Kyiv (Ukraine); Garai, A.; Krishnamoorthy, H. [Tata Institute of Fundamental Research, India-based Neutrino Observatory, Mumbai (India); Homi Bhabha National Institute, Mumbai (India); Raina, P.K. [Indian Institute of Technology, Department of Physics, Rupnagar (India); Bhushan, K.G. [Bhabha Atomic Research Centre, Technical Physics Division, Mumbai (India)

    2017-04-15

    Neutrinoless double beta decay is a phenomenon of fundamental interest in particle physics. The decay rates of double beta decay transitions to the excited states can provide input for Nuclear Transition Matrix Element calculations for the relevant two neutrino double beta decay process. It can be useful as supplementary information for the calculation of Nuclear Transition Matrix Element for the neutrinoless double beta decay process. In the present work, double beta decay of {sup 94}Zr to the 2{sup +}{sub 1} excited state of {sup 94}Mo at 871.1 keV is studied using a low background ∝ 230 cm{sup 3} HPGe detector. No evidence of this decay was found with a 232 g.y exposure of natural zirconium. The lower half-life limit obtained for the double beta decay of {sup 94}Zr to the 2{sup +}{sub 1} excited state of {sup 94}Mo is T{sub 1/2}(0ν + 2ν) > 3.4 x 10{sup 19} y at 90% C.L., an improvement by a factor of ∝ 4 over the existing experimental limit at 90% C.L. The sensitivity is estimated to be T{sub 1/2} (0ν + 2ν) > 2.0 x 10{sup 19} y at 90% C.L. using the Feldman-Cousins method. (orig.)

  11. Transfusion regimens in thalassemia intermedia

    Directory of Open Access Journals (Sweden)

    Z. Karakas

    2011-12-01

    Full Text Available Thalassemia intermedia (TI is a heterogeneous disease, in terms of both clinical manifestations and underlying molecular defects. Some TI patients are asymptomatic until adult life, whereas others are symptomatic from early childhood. In contrast with patients with Thalassemia major (TM, the severity of anemia is less and the patients do not require transfusions during at least the first few years of life. Many patients with TI, especially older ones, have been exposed to the multiple long-term effects of chronic anemia and tissue hypoxia and their compensatory reactions, including enhanced erythropoiesis and increased iron absorption. Bone marrow expansion and extramedullary hematopoiesis lead to bone deformities and liver and spleen enlargement. Therapeutic strategies in TI are not clear and different criteria are used to decide the initiation of transfusion and chelation therapy, modulation of fetal hemoglobin production, and hematopoietic stem cell transplantation on an individual basis. The clinical picture of well-treated TM patients with regular transfusionchelation therapy is better from TI patients who have not received adequate transfusion therapy. There is a significant role of early blood transfusion to prevent and treat complications commonly associated with TI, such as extramedullary erythropoiesis and bone deformities, autoimmune hemolytic anemia, leg ulcers, gallstones, pseudoxantoma elasticum, hyperuricosuria, gout and pulmonary hypertension, which are rarely seen in thalassemia major. Nowadays, indications of transfusion in patients with TI are chronic anemia (Hb < 7 g/dL, bone deformities, growth failure, extramedullary erythropoiesis, heart failure, pregnancy and preparation for surgical procedures. Conclusion: Adequate (regular or tailored transfusion therapy is an important treatment modality for increasing the quality of life in patients with thalassemia intermedia during childhood. 就临床表象和潜在的分子缺

  12. Molecular identification of Sicilian (dߺ-thalassemia associated with ß-thalassemia and hemoglobin S in Brazil

    Directory of Open Access Journals (Sweden)

    Andrade T.G. de

    2002-01-01

    Full Text Available We describe the clinical and molecular characteristics of two unrelated Brazilian families with an association of the Sicilian form of (deltaߺ-thalassemia with hemoglobin S and ß-thalassemia. Direct sequencing of the ß-globin gene showed only the hemoglobin S mutation in patient 1 and the ß-thalassemia IVS1-110 in patient 2. The other allele was deleted in both patients and PCR of DNA samples of the breakpoint region of both patients showed a band of approximately 1,150 bp, expected to be observed in the DNA of carriers of Sicilian (deltaߺ-thalassemia. The nucleotide sequence of this fragment confirmed the Sicilian deletion. There are few reports concerning the Hb S/(deltaߺ-thalassemia association and patient 2 is the first reported case of Sicilian type of (deltaߺ-thalassemia in association with ß-thalassemia documented at the molecular level.

  13. Genetics Home Reference: alpha thalassemia X-linked intellectual disability syndrome

    Science.gov (United States)

    ... Alpha thalassemia X-linked intellectual disability syndrome Alpha thalassemia X-linked intellectual disability syndrome Printable PDF Open ... to view the expand/collapse boxes. Description Alpha thalassemia X-linked intellectual disability syndrome is an inherited ...

  14. Preventing thalassemia in Lebanon: successes and challenges in a developing country.

    Science.gov (United States)

    Abi Saad, Michele; Haddad, Anthony G; Alam, Elie S; Aoun, Sanaa; Maatouk, Pascale; Ajami, Najat; Khairallah, Therese; Koussa, Suzanne; Musallam, Khaled M; Taher, Ali T

    2014-01-01

    Thalassemia continues to be a major health burden. The chronicity of the disease and the high cost of life-long treatment make prevention strategies crucial in the management of this disease. In this article, we revisit different successful prevention strategies, and underline the Lebanese model. The Chronic Care Center (CCC), Beirut, is the only specialized center in Lebanon for the treatment and prevention of thalassemia. The current number of patients registered up to August 2013 was 724, representing cases from all over Lebanon. In 1994, the center launched a national prevention program following the World Health Organization (WHO) recommendations. The major activities of the program include awareness campaigns, screening for thalassemia carriers in the general population and high risk groups, registry of new cases and follow-up on the mandatory premarital law (established at the same time). Screening programs showed a carrier rate of around 2.3% in the general population, and 4.0-41.0% in high risk groups. The major pitfall in the law is that only persons with a mean corpuscular volume (MCV) of >70.0 fL are asked to perform further hemoglobin (Hb) testing. A significant decrease in the number of new cases of thalassemia patients in Lebanon reflects the efforts deployed in the prevention of the disease. However, some limitations are faced in reaching a complete eradication of the disease, mainly due to the fact that abortion is illegal and due to pitfalls and incorrect implementation of the premarital law.

  15. [Oromaxillofacial changes in thalassemia major].

    Science.gov (United States)

    De Mattia, D; Pettini, P L; Sabato, V; Rubini, G; Laforgia, A; Schettini, F

    1996-01-01

    Sixty patients (31 male and 29 female) with thalassemia major, aged between 6 and 26 years, 18 of which were splenectomized, were observed in this study evaluating the oro-maxillo-facial alterations and correlating them to transfusion indexes, serum ferritin levels, splenectomy and age. For each patient a haematologic and odontostomatologic card was filed with a view to report the medical and clinical history regarding: the haematologic picture, the prevention of caries and parodontal disease, the facies characteristics, the odonto-stomatologic examination, the orthodontic diagnosis, the skull X-rays and the orthopantomography. Poor oral hygiene as well as misknowledge of prevention were generally observed. All the patients showed carious lesions but most of them had never seen a dentist for therapy. The disharmonious growth of splanchnocranium, with the enlargement of the jaw and of its alveolar process, induced by the bone marrow hyperplasia, produced various and serious malocclusion stages (Angle's II class, deep bite, open bite), gnathologic alterations, hypodiaphanous paranasal sinuses and orbital hypertelorism, with a typical oriental-like facies. Malocclusion and the poor oral hygienic conditions determined the occurrence of marginal gingivitis, mainly localized at the level of the lower frontal teeth. In only 3 patients the oral mucous membrane was pale and atrophic. During this investigation agenesia and dental retention were reported in 30% and in 26% of the examined cases respectively, while no patients had supernumerary teeth. Tooth volume, position and shape abnormalities rarely occurred. Only in two patients was enamel hypoplasia described. The caries frequency greatly varied in number and in degree. Only five patients did not show any carious lesions. The caries index (DMF) for the permanent teeth calculated in all the 60 subjects was 5, 12 +/- 4.76. By utilizing Spearman's rank test the number of teeth with caries in the permanent dentition (DFM

  16. The pancreas in β-thalassemia major: MR imaging features and correlation with iron stores and glucose disturbunces

    International Nuclear Information System (INIS)

    Papakonstantinou, Olympia; Ladis, Vasilios; Kostaridou, Stavroula; Berdousi, Helen; Kattamis, Christos; Maris, Thomas; Gourtsoyiannis, Nicholas

    2007-01-01

    The study aims at describing the MR features of pancreas in beta-thalassemia major, investigating the relations between MR findings and glucose disturbances and between hepatic and pancreatic siderosis. Signal intensity ratios of the pancreas and liver to right paraspinous muscle (P/M, L/M) were retrospectively assessed on abdominal MR imaging studies of 31 transfusion-dependent patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 10 healthy controls, using T1- (120/4/90), intermediate in and out of phase - (120/2.7, 4/20), and T2*-(120/15/20) weighted GRE sequences. Using the signal drop of the liver and pancreas on opposed phase images, we recorded serum ferritin and results of oral glucose tolerance test (OGTT). Decreased L/M and P/M on at least the T2* sequence were noticed in 31/31 and 30/31 patients, respectively, but no correlation between P/M and L/M was found. Patients with pathologic OGTT displayed a higher degree of hepatic siderosis (p < 0.04) and signal drop of pancreas on opposed phase imaging (p < 0.025), implying fatty replacement of pancreas. P/M was neither correlated with glucose disturbances nor serum ferritin. Iron deposition in the pancreas cannot be predicted by the degree of hepatic siderosis in beta-thalassemia major. Fatty replacement of the pancreas is common and may be associated with glucose disturbances. (orig.)

  17. Psychosocial implications of Thalassemia Major.

    Science.gov (United States)

    Aydinok, Yesim; Erermis, Serpil; Bukusoglu, Nagihan; Yilmaz, Deniz; Solak, Ufuk

    2005-02-01

    Many causes including the chronicity of disease, burden of treatment modalities, morbidities, and the expectation of early death resulting from the disease complications, may lead to psychosocial burden in Thalassemia Major (TM) patients. A total of 38 patients with TM and their mothers were recruited to evaluate the psychosocial burden as well as to disclose whether the psychological status of the patients contribute to the compliance with the therapy or to the contrary. Demographic and disease variables were obtained. Child Behavior Check-list (CBCL) was completed by the mothers of the patients. A detailed psychiatric interview based on the 4th edition of the Diagnostic and Statistical Manual diagnostic criteria was performed for each patient. Symptom Distress Checklist 90 (SCL-90) scale was given to all mothers for evaluating their psychopathology. Although CBCL scores remained between the normal ranges, desferrioxamine mesylate (DFO)-compliant patients and the patients with lower ferritin values had significantly higher scores. A total of 24% of the patients had a psychiatric diagnosis including major depression, anxiety disorder, tic disorder, and enuresis nocturnal. The psychiatric diagnosis was significantly higher in the patients who were compliant with desferrioxamine compared with the non-compliant group (P = 0.007). The SCL-90 scores indicated that the mothers who had a child with good adherence to DFO had higher scale scores than the mothers with a poor adherent child. The increase risk of psychosocial and behavioral problems in thalassemics and their parents indicated the importance of a lifelong psychosocial support for the prevention of mental health issues. The patients and their parents, who were more conscious of the illness, were more worried but more compliant with the therapy and need stronger psychiatric support.

  18. Intracranial extramedullary hematopoiesis in patients with thalassemia: a case report and review of the literature.

    Science.gov (United States)

    Eskazan, Ahmet Emre; Ar, Muhlis Cem; Baslar, Zafer

    2012-08-01

    Extramedullary hematopoiesis (EH) is a compensatory phenomenon that results in the production of blood cell precursors outside the marrow in patients with chronic hemolytic anemia and ineffective erythropoiesis. EH usually involves the liver, spleen, and lymph nodes. It can also be found at paravertebral, intrathoracic, or pelvic locations. Intracranial EH is a rare entity and often asymptomatic but can sometimes lead to symptomatic tumor-like masses. Treatment options are controversial and include hypertransfusion, surgical excision, radiotherapy, and hydroxyurea (HU). Successful treatment of an intracranial EH mass with HU and blood transfusions in a beta-thalassemia major patient was discussed along with a review of the published literature on intracranial EH in thalassemia. In our patient, the extramedullary hematopoietic mass in the interhemispheric fissure showed a marked improvement after 6 months of HU and hypertransfusion therapy. In the English literature, there are a few cases with intracranial EH and thalassemia, which were treated with different treatment modalities, with different outcomes. There is no standard treatment approach in patients with symptomatic EH. HU with hypertransfusion regimen is a reasonable first-choice modality in treating intracranial EH masses. © 2012 American Association of Blood Banks.

  19. Detection of thalassemia genes using smeared blood film or leukocytes adhering to polysthylene fibers.

    Science.gov (United States)

    Tatsumi, N; Yokota, M; Shindoh, K; Funahara, Y; Nathalang, O; Sukpanichnant, S; Bunyaratvej, A; Fucharoen, S

    1997-01-01

    Presently genetic analyses for thalassemia types require relatively large amounts of heparinized blood (5 to 10 ml), and transport as well as degeneration of these sample is a problem in the developing world. We have developed a new method to simplify this procedure and obtain DNAs from small specimens. As experimental materials, thinly smeared blood on a glass slide or blood filtered with and adhered on polysthylene telephtalate (PST) fibers were used. These materials could be safely stored without interfering with DNA extraction for up to 3 months. The slide materials were digested with proteinase K, and DNA was extracted with Tris-EDTA-phenol:chloroform and precipitated with absolute ethanol. The PST specimens were washed with physiologic saline and treated in the same manner as described above. Products were easily amplified by PCR and digested with restriction endonucleases for beta thalassemia typing as well as for HLA-DQA1 gene typing. Results obtained by this method correlated well with previously reported incidences for thalassemia and HLA-DQA1 types in Thailand. This method can be used in the routine laboratory because it allows for stable and biosafe genetic analyses.

  20. Urine β2 Microglobulin and other Biochemical Indices in β Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Yazdan Ghandi

    2009-12-01

    Full Text Available To find if some indices have predictive value for renal complications. We conducted a cross sectional and included 80 patients with the age ranged 5-17 years, all with the proven diagnosis of β-thalassemia major. A urine and 5 ml of blood sample were obtained from all of the cases. Biochemical indices such as serum levels of creatinine, Na, Mg, Hb, and ferritin and also urine levels of Na, Mg, creatinine and β2 microglobulin was measured. All data analysis was performed using SPSS 14.0. P-Spearman test was applied to assess correlation between urine beta-2-microglobulin and other variables. Patients GFR was in normal range. Abnormal level of urine β2 microglobulin was reported in 44 patients (55%. P Spearman test proved correlation only between urine β2 microglobulin and FE-Mg. We concluded that renal proximal tubular dysfunction may oocur in children with β thalassemia major without clinical manifestations of renal dysfunction or decrease in GFR. We warn not to rely only on GFR as a early indicator for renal complications among children with β thalassemia major.

  1. Quality of Life in Children with Thalassemia and their Caregivers in India.

    Science.gov (United States)

    Sharma, Sapna; Seth, Bageshree; Jawade, Prashant; Ingale, Madhavi; Setia, Maninder Singh

    2017-03-01

    To assess and compare the Quality of Life (QOL) of children with beta-thalassemia major on regular transfusion therapy with normal children, and of the caregivers of children with beta-thalassemia major to that of caregivers of normal children. A cross-sectional comparison of QOL in 75 thalassemic and 80 non-thalassemic children was conducted using the PedsQL™ 4.0 generic core scale. Also self-rated health was assessed in their caregivers using Short Form-36 Health Survey. The total QOL score according to child-self report [83.7 (10.8) vs. 97.6 (3.3); p < 0.001] and parent-proxy report [84.2 (11.9) vs. 96.7 (3.5); p < 0.001] was significantly lower in cases as compared with controls. It was found that a significantly higher proportion of caregivers of cases reported poor health compared with caregivers of controls (29.2% vs. 2.5%, p < 0.001). Even after adjusting for age, sex, socio-economic status, and total QOL score by the parent, it was found that caregivers of thalassemic children were significantly more likely to report poor health compared with those of controls (odds ratio: 15.8, 95% confidence intervals: 2.8-89.9). Health Related QOL is significantly affected in children with beta-thalassemia major on regular transfusion across all age groups, gender and socio-economic classes and also in their caregivers.

  2. β-Thalassemia intermedia: a comprehensive overview and novel approaches.

    Science.gov (United States)

    Asadov, Chingiz; Alimirzoeva, Zohra; Mammadova, Tahira; Aliyeva, Gunay; Gafarova, Shahla; Mammadov, Jeyhun

    2018-01-29

    β-Thalassemia intermedia is a clinical condition of intermediate gravity between β-thalassemia minor, the asymptomatic carrier, and β-thalassemia major, the transfusion-dependent severe anemia. It is characterized by a significant clinical polymorphism, which is attributable to its genetic heterogeneity. Ineffective erythropoiesis, chronic anemia, and iron overload contribute to the clinical complications of thalassemia intermedia through stepwise pathophysiological mechanisms. These complications, including splenomegaly, extramedullary erythropoiesis, iron accumulation, leg ulcers, thrombophilia, and bone abnormalities can be managed via fetal hemoglobin induction, occasional transfusions, chelation, and in some cases, stem cell transplantation. Given its clinical diversity, thalassemia intermedia patients require tailored approaches to therapy. Here we present an overview and novel approaches to the genetic basis, pathophysiological mechanisms, clinical complications, and optimal management of thalassemia intermedia.

  3. Knowledge, Attitude and Practice of Carrier Thalassemia Marriage Volunteer in Prevention of Major Thalassemia.

    Science.gov (United States)

    Karimzaei, Tahmineh; Masoudi, Qolamreza; Shahrakipour, Mahnaz; Navidiyan, Ali; Jamalzae, Abd Al-Qaffar; Zoraqi Bamri, Ahmad

    2015-06-09

    Thalassemia is the most common genetic disorder and rising in the world as a health problem. Due to the criticality of this disease, in our country thalassemia prevention programs are more importance. The aim of this study was investigation of knowledge, attitude and behavior of marrying partners who were thalassemia genetic carriers in prevention of the birth of the children with major thalassemia. This study was a descriptive-analytic study. Data collection tool was a self-administered questionnaire that included 43 items. The content validity of questionnaire was investigated under the supervision of physicians, experts of health education and promotion. Its reliability was confirmed by Cronbach's Alpha test. The subjects in the study consisted of 100 marrying partners who were genetic carriers of thalassemia who referred to Premarital Counseling Center in Iranshahr City. Iranshahr is a a large city of Sistan and Balouchestan Province that located in southeast of Iran. The subjects were selected by convenience non-probability sampling method. Data analyzed using descriptive and analytic statistical tests in SPSS 16.00 and level of significance considered on αpre-diploma. The research findings showed that 7% and 62% of the subjects had poor and mediocre levels of knowledge respectively. Also results showed that only 13% of them had a satisfactory behavior and educational status had a positive correlation with knowledge, behavior, perceived susceptibility and perceived severity (Pcounseling (33%) and premarital screening (27%) were the most important strategies for prevention of thalassemia. The perceived barriers were the strongest predictors for preventive behaviors of incidence of major thalassemia in marrying partners, therefor educational interventions should focused on perceived barriers removing in Volunteer marrying partners.

  4. Physiologically based pharmacokinetics of radioiodinated human beta-endorphin in rats. An application of the capillary membrane-limited model

    Energy Technology Data Exchange (ETDEWEB)

    Sato, H.; Sugiyama, Y.; Sawada, Y.; Iga, T.; Hanano, M.

    1987-07-01

    In order to simulate the distribution and elimination of radioiodinated human beta-endorphin (/sup 125/I-beta-EP) after iv bolus injection in rats, we proposed a physiologically based pharmacokinetic model incorporating diffusional transport of /sup 125/I-beta-EP across the capillary membrane. This model assumes that the distribution of /sup 125/I-beta-EP is restricted only within the blood and the tissue interstitial fluid, and that a diffusional barrier across the capillary membrane exists in each tissue except the liver. The tissue-to-blood partition coefficients were estimated from the ratios of the concentration in tissues to that in arterial plasma at the terminal (pseudoequilibrium) phase. The total body plasma clearance (9.0 ml/min/kg) was appropriately assigned to the liver and kidney. The transcapillary diffusion clearances of /sup 125/I-beta-EP were also estimated and shown to correlate linearly with that of inulin in several tissues. Numerically solving the mass-balance differential equations as to plasma and each tissue simultaneously, simulated concentration curves of /sup 125/I-beta-EP corresponded well with the observed data. It was suggested by the simulation that the initial rapid disappearance of /sup 125/I-beta-EP from plasma after iv injection could be attributed in part to the transcapillary diffusion of the peptide.

  5. Premature epiphyseal fusion and extramedullary hematopoiesis in thalassemia

    International Nuclear Information System (INIS)

    Colavita, N.; Orazi, C.; Danza, S.M.; Falappa, P.G.; Fabbri, R.

    1987-01-01

    The main skeletal abnormalities in β-thalassemia are widening of medullary spaces, rarefaction of bone trabeculae, thinning of cortical bone, and perpendicular periosteal spiculation. Premature epiphyseal fusion (PEF) and extramedullary hematopoiesis (EH) are found, though more rarely. The incidence of PEF and EH in 64 patients affected by β-thalassemia is reported. The different incidence of such complications in thalassemia major and intermedia is reported, and a possible correlation with transfusion regimen is also considered. (orig.)

  6. Amplificação gênica alelo-específica na caracterização das hemoglobinas S, C e D e as interações entre elas e talassemias beta Allele-specific genic amplification in the characterization of hemoglobins S, C, D and interactions among them and with beta thalassemia

    Directory of Open Access Journals (Sweden)

    Luciane Cristina Bertholo

    2006-08-01

    Full Text Available INTRODUÇÃO: As hemoglobinopatias resultam de alterações hereditárias, sendo prevalentes em muitas regiões do mundo, mas atingem a população brasileira de forma significativa. Elas são decorrentes de alterações em genes estruturais responsáveis pelo aparecimento das hemoglobinas variantes e/ou em genes reguladores, resultando nas talassemias. A identificação dessas patologias tem sido rotineiramente realizada por procedimentos eletroforéticos, contudo nossa experiência laboratorial evidencia que as mesmas nem sempre apresentam resoluções suficientes para a correta caracterização da mutação. CASUÍSTICAS E MÉTODOS: O propósito deste trabalho foi estabelecer uma metodologia válida para a caracterização das hemoglobinas S, C e D em homozigose ou heterozigose, e suas possíveis interações, baseada na amplificação gênica alelo-específica (PCR-AE com a utilização de primers sense, antisense e primers que se acoplam na posição do alelo mutante e na respectiva posição do alelo normal. RESULTADOS E DISCUSSÃO: Os resultados evidenciaram a validade dessa metodologia na caracterização das mutações, sendo esse procedimento de fácil realização, reprodutível e possível de ser aplicado em um significativo número de amostras.BRACKGROUND: The hemoglobinopathies are a group of hereditary hemoglobin disorders in worldwide distribution, affecting Brazilian population significantly; they are decurrent of alterations in structural genes, responsible for hemoglobin variants, and/or in regulatory genes, resulting the thalassemia. These disorders have been identified in most cases by electrophoretics procedures, and our laboratory experience points out that sometimes they do not obtain enough resolution for a right characterization of mutation. MATERIAL AND METHOD: The objective of this study was to establish a valid laboratory methodology for the characterization of hemoglobins S, C and D in homozygous or heterozygous and

  7. Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

    Science.gov (United States)

    Kho, S L; Chua, K H; George, E; Tan, J A M A

    2013-07-15

    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

  8. Diversity of [beta]-globin mutations in Israeli ethnic groups reflects recent historic events

    Energy Technology Data Exchange (ETDEWEB)

    Filon, D.; Oron, V.; Krichevski, S.; Shaag, A.; Goldfarb, A.; Aker, M.; Rachmilewitz, E.A.; Rund, D.; Oppenheim, A. (Hebrew Univ. Hadassah-Medical School, Jerusalem (Israel)) (and others)

    1994-05-01

    The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsense codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.

  9. GROWTH AND ENDOCRINE FUNCTION IN TUNISIAN THALASSEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Naouel GUIRAT

    2018-05-01

    Full Text Available Beta-thalassemia major (TM is among prevalent hereditary disorders imposing high expenses on health-care system worldwide. The patient’s survival is dependent on lifetime blood transfusion which leads to iron overload and its toxicity on various organs including endocrine glands. This article provides an overview of  endocrine disorders in beta-TM patients. This single center investigation enrolled 28 beta-TM patients (16 males, 12 females  regularly transfused with packed red cell since early years of life. For each patient were determined: age, sex, number of transfusions received, history of splenectomy and anthropometric parameters. Evaluation for hormonal status including growth, gonadal, thyroid, adrenal cortex, and parathyroid glands was done for all patients. Dual energy X-ray absorptiometry was used to diagnose osteoporosis. Assessment of iron overload status was performed by measuring the serum ferritin concentration and the results of magnetic resonance imaging T2*. Growth retardation was found in 16 of the 28 studied patients (57 %.Thirteen among them had delayed puberty. Spontaneous puberty was achieved in 16 cases. Growth hormone (GH deficiency was found in 10 cases (35 %. Seventeen among the studied patients (60 % developed disorders of glucose homeostasis. Subclinical hypothyroidism was found in six patients (21 %. Intensive chelation therapy had allowed the reversibility of this complication in five cases. Adrenal Insufficiency was found in 9 cases (32%. Hypoparathyroidism has occurred in one case. Ten of the 28 studied patients had osteoporosis (35%. Twenty-three of the 28 studied patients (82% had at least one endocrine complication.

  10. Risk of Erectile Dysfunction in Transfusion-naive Thalassemia Men

    Science.gov (United States)

    Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

    2015-01-01

    Abstract Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities. PMID:25837766

  11. Thalassemia paravertebral tumors and bone marrow scan

    International Nuclear Information System (INIS)

    Huglo, D.; Rose, C.; Deveaux, M.; Bauters, F.; Marchandise, X.

    1995-01-01

    Two first cousins with thalassemia and with a paravertebral mass had had an indium 111 chloride bone marrow scan. Result of scan influenced therapy: medical treatment in one case where an extramedullary erythropoiesis was confirmed, surgical treatment in the other case. The use of dual-isotope SPECT (indium 111 chloride, HDP -99 Tc) constitutes a contribution to the establishment of diagnosis of extramedullary erythropoiesis, giving to bone marrow scintigraphy a merited importance, avoiding the biopsy. (authors). 15 refs., 5 figs

  12. Increased knowledge of thalassemia promotes early carrier status examination among medical students

    Directory of Open Access Journals (Sweden)

    Julius Broto Dewanto

    2016-04-01

    A higher thalassemia knowledge score causes medical students to be willing to undergo thalassemia carrier status examination at an earlier point in timing. A well-organized educational program focusing on thalassemia and early screening in young adults may enhance the thalassemia prevention program.

  13. The limit of small Rossby numbers for randomly forced quasi-geostrophic equation on $\\beta$-plane

    OpenAIRE

    Kuksin, Sergei; Maiocchi, Alberto

    2014-01-01

    We consider the 2d quasigeostrophic equation on the $\\beta$-plane for the stream function $\\psi$, with dissipation and a random force: $$ (*)\\qquad (-\\Delta +K)\\psi_t - \\rho J(\\psi, \\Delta\\psi) -\\beta\\psi_x= \\langle \\text{random force}\\rangle -\\kappa\\Delta^2\\psi +\\Delta\\psi, $$ where $\\psi=\\psi(t,x,y), \\ x\\in\\mathbb{R}/2\\pi L\\mathbb{Z}, \\ y\\in \\mathbb{R}/2\\pi \\mathbb{Z}$. For typical values of the horizontal period $L$ we prove that the law of the action-vector of a solution for $(*)$ (formed...

  14. Correction of a splice-site mutation in the beta-globin gene stimulated by triplex-forming peptide nucleic acids

    DEFF Research Database (Denmark)

    Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S

    2008-01-01

    Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian...... DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent...

  15. Dificuldades na identificação laboratorial da talassemia alfa Difficulty on laboratory identification of alpha thalassemia

    Directory of Open Access Journals (Sweden)

    Karlla Greick Batista Dias-Penna

    2010-04-01

    Full Text Available Introdução: Talassemia alfa é uma síndrome associada à redução da síntese de cadeias de globina do tipo alfa. A gravidade das manifestações clínicas está relacionada com a quantidade de globinas produzida e a estabilidade das cadeias beta presentes em excesso. A talassemia alfa mínima resulta da deleção de apenas um dos quatro genes a (-α/αα. Clinicamente apresenta anemia leve com microcitose ou ausência de anemia, sendo o diagnóstico realizado por meio de visualização da hemoglobina (Hb H por eletroforese alcalina em acetato de celulose ou por identificação de inclusões celulares de Hb H coradas pelo azul de crezil brilhante. Objetivo: Avaliar portadores de talassemia alfa e seus respectivos progenitores, correlacionando perfil hematológico e presença de Hb H, utilizando procedimentos laboratoriais clássicos em três diferentes amostragens. Discussão e conclusão: Os dados obtidos mostram que a presença de Hb H, indicativo de talassemia alfa, pode não ser confirmada em uma análise posterior. Entre os fatores que podem influenciar no não aparecimento de Hb H em pessoa comprovadamente com talassemia alfa está a deficiência de ferro. A talassemia alfa está associada a defeitos envolvendo os genes codificadores da cadeia alfa, mas também pode estar relacionada com desbalanciamento temporário na expressão dos genes globina, diminuição de alfa ou aumento de beta, o que poderia explicar o aparecimento de tetrâmeros de cadeia beta (Hb H, sugerindo diagnóstico de talassemia alfa mínima.Introduction: Alpha thalassemia is a syndrome with associated with the reduction of alpha globin chain synthesis. The severity of clinical manifestations is related to the amount of globins produced and the stability of beta chains that are present in excess. Alpha thalassemia minor is caused by the deletion of one of the four genes a (-α/αα. Clinically, it presents mild anemia with microcytosis or absence of anemia. The

  16. Spectrum of α-thalassemia mutations in Qazvin Province, Iran

    African Journals Online (AJOL)

    use

    2011-12-05

    Dec 5, 2011 ... α-Thalassemia is a widespread inherited disease particularly prevalent in the middle East Asia population, including Iran. The aim of this study was to define the molecular spectrum and frequency of α-thalassemia mutations in prospective couples of Qazvin province. A total of 120,000 subjects were.

  17. β-Thalassemia and Polycythemia vera : Targeting chronic stress erythropoiesis

    NARCIS (Netherlands)

    Crielaard, Bart J; Rivella, Stefano

    β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective

  18. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    Energy Technology Data Exchange (ETDEWEB)

    Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others

    1994-09-01

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  19. Hematopoietic stem cell transplantation from non-sibling matched family donors for patients with thalassemia major in Jordan.

    Science.gov (United States)

    Hussein, Ayad Ahmed; Al-Zaben, Abdulhadi; Khattab, Eman; Haroun, Anas; Frangoul, Haydar

    2016-02-01

    There are limited data on the outcome of patients with thalassemia receiving HSCT from non-sibling matched family donors. Of the 341 patients with thalassemia major that underwent donor search at our center from January 2003 to December 2011, 236 (69.2%) had fully matched family donor of which 28 patients (8.2%) had non-sibling matched family donors identified. We report on seven patients with a median age of eight yr (4-21) who underwent myeloablative (n = 4) or RIC (n = 3) HSCT. The median age of the donors was 33 yr (4-47), three were parents, two first cousins, one paternal uncle, and one paternal aunt. All patients achieved primary neutrophil and platelet engraftment at a median of 18 (13-20) and 16 days (11-20), respectively. One patient developed grade II acute GVHD, and two patients developed limited chronic GVHD. One patient experienced secondary GF requiring a second transplant. At a median follow-up of 69 months (7-110), all patients are alive and thalassemia free. Our data emphasize the need for extended family HLA typing for patients with thalassemia major in regions where there is high rate of consanguinity. Transplant from non-sibling matched family donor can result in excellent outcome. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Endogenous PKI gamma limits the duration of the anti-apoptotic effects of PTH and beta-adrenergic agonists in osteoblasts.

    Science.gov (United States)

    Chen, Xin; Song, In-Hwan; Dennis, James E; Greenfield, Edward M

    2007-05-01

    PKI gamma knockdown substantially extended the anti-apoptotic effects of PTH and beta-adrenergic agonists, whereas PKI gamma overexpression decreased these effects. Therefore, inhibition of PKI gamma activity may provide a useful co-therapy in combination with intermittent PTH or beta-adrenergic agonists for bone loss in conditions such as osteoporosis. PTH has both catabolic and anabolic effects on bone, which are primarily caused by cAMP/protein kinase A (PKA) signaling and regulation of gene expression. We previously showed that protein kinase inhibitor-gamma (PKI gamma) is required for efficient termination of cAMP/PKA signaling and gene expression after stimulation with PTH or beta-adrenergic agonists. Inhibition of osteoblast apoptosis is thought to be an important, but transient, mechanism partly responsible for the anabolic effects of intermittent PTH. Therefore, we hypothesized that endogenous PKI gamma also terminates the anti-apoptotic effect of PTH. PKI gamma knockdown by antisense transfection or siRNA was used to examine the ability of endogenous PKI gamma to modulate the anti-apoptotic effects of PTH and beta-adrenergic agonists in ROS 17/2.8 cells. Knockdown of PKI gamma substantially extended the anti-apoptotic effects of PTH, whether apoptosis was induced by etoposide or dexamethasone. In contrast, overexpression of PKI gamma decreased the anti-apoptotic effect of PTH pretreatment. This study is also the first demonstration that beta-adrenergic agonists mimic the anti-apoptotic effects of PTH in osteoblasts. Moreover, PKI gamma knockdown also substantially extended this anti-apoptotic effect of beta-adrenergic agonists. Taken together, these results show that endogenous PKI gamma limits the duration of the anti-apoptotic effects of cAMP/PKA signaling in osteoblasts. Because significant individual variability exists in the anabolic responses to PTH therapy in current clinical treatment of osteoporosis, inhibition of PKI gamma activity may provide a

  1. Fetal red blood cell parameters in thalassemia and hemoglobinopathies.

    Science.gov (United States)

    Karnpean, Rossarin; Fucharoen, Goonnapa; Fucharoen, Supan; Ratanasiri, Thawalwong

    2013-01-01

    With the lack of fetal blood specimens in routine practice, little is known about red blood cell (RBC) parameters of fetuses with various thalassemia syndromes. This study aimed to describe these in various forms of thalassemia. The study was performed on 93 fetal blood specimens obtained from pregnant women by cordocentesis during 18-24 weeks of gestation. RBC parameters were recorded on automated analyzer. Hemoglobin (Hb) and DNA analyses were performed for definite genotyping. No significant difference in RBC parameters was observed between non-thalassemic fetuses and those with β-thalassemia trait, Hb E trait, homozygous Hb E and β-thalassemia/Hb E disease. However, in those with α(0)-thalassemia trait and double heterozygous α(0)-thalassemia/Hb E, slight reduction in mean corpuscular volume (MCV) was noted. Fetuses with the Hb H disease showed significant reductions in Hb, MCV and mean corpuscular Hb (MCH). Marked reductions in Hb, hematocrit, MCH and mean cell Hb concentration and increased RBC distribution width with numerous nucleated RBC were clearly observed in Hb Bart's hydrops fetalis. Simple analysis of fetal RBC parameters is useful for making presumptive prenatal diagnosis of α-thalassemia syndromes including Hb H disease and Hb Bart's hydrops fetalis which can then be confirmed by Hb and DNA analyses. Copyright © 2013 S. Karger AG, Basel.

  2. Diagnostic significance of red cell indices in beta-thalassaemia trait

    International Nuclear Information System (INIS)

    Hussain, Z.; Malik, N.; Chughtai, A.S.

    2005-01-01

    The purpose of this study was to evaluate the formulae for the diagnosis of beta-thalassemia trait cases in settings where electrophoreses is not available. The study included 50 cases of beta-thalassaemia trait already diagnosed by Hb electrophoresis. CBC samples were analyzed on Sysmex K4500 and red cell indices were used to evaluate formulae for differentiating beta thalassaemia trait from iron deficiency anemia. The formula MCV/RBC and MCH/RBC identified 56% of the cases. Formula MCV - (5 x Hb)- RBC - 8.4 identified 54% of beta thalassemia trait cases. The formula MCV x MCH identified 92% of cases. RBC indices given by 100 electronic counters can be used to differentiate iron deficiency anemia from beta-thalassaemia trait at least provisionally in areas where Hb electrophoresis is not available. (author)

  3. Bone marrow transplantation in patients with Thalassemia

    Directory of Open Access Journals (Sweden)

    Ghavamzadeh A

    1993-05-01

    Full Text Available During April, 1991 and September, 1993, eighteen patients with major thalassemia admitted to Shariati BMT center. Seventeen patients were transplanted were from HLA identical siblings and one from. his HLA identical father. Eleven of the donors were the known cases of minor thalassemia. The range of patients' age was within 3-10 years (with the average of 5 years and 11 months. Among them, seven patients were male and eleven were female. As the other international BMT centers, we classified our patients into three classes. Our criteria for this classification were hepatomegaly, ferretin, and liver fibrous; 60% of our patients were put in class I and 40% in class II. All of our patients revealed a GVHD (severe graft vs. host disease three weeks post-BMT as pruritus, diarrhea, and skin erythema especially in hands and feet. Two of the patients showed severe GVHD. One of the patients had chimerism after BMT. Although one year after BMT has passed, the patients is still depended on blood transfusion. One patient, despite graft rejection, died nine months post-BMT; another one died after +70 due to GVHD. During 2.5 years, the overall graft survival rate was 88% in our center

  4. Awareness among Parents of β-Thalassemia Major Patients Regarding Prenatal Diagnosis and Premarital Screening in Day Care Centre of Transfusion Medicine Department.

    Science.gov (United States)

    Rudra, S; Chakrabarty, P; Hossain, M A; Ripon, M J; Rudra, M; Mirza, T T

    2016-01-01

    Thalassemia is one of the most common genetic diseases in the world. It is a major health problem, brings much morbidity, early mortality and a great deal of misery for a family both financially and emotionally. The patients suffering from beta thalassemia major do not survive for more than 5 years without blood transfusion. Blood transfusion is usually administered every two to five weeks to maintain the pre-transfusion hemoglobin level of 9-10 gm/dL. This study carried out in the department of Transfusion Medicine of Mymensingh Medical College Hospital from January 2014 to June 2014. A total of 200 parents were interviewed. There was a slight preponderance of females which accounted for 57.5% of the parents. Ninety seven (45.5%) had an income less than Rs. 5000 per month. Nearly 50% were illiterate with only 24.5% with a higher education. Consanguinity was positive in 72.5% of the parents with extended family history of thalassemia positive in 40.8%. Only 29.5% were immunized against Hepatitis B. Around 27.5% did not know whether they should be immunized. Fifty five percent of parents knew children should receive Dysferol. Twelve percent were aware of consanguinity to be a risk factor for thalassaemia with only 5% having undergone antenatal diagnosis. Parental knowledge about thalassemia and its preventive measures is inadequate; this requires intervention in the form of public health education programs concentrating on high risk/targeted population.

  5. Genotyping of Kell, Duffy, Kidd and RHD in patients with b Thalassemia

    Directory of Open Access Journals (Sweden)

    Castilho Lilian

    2000-01-01

    Full Text Available Determination of Rh, Kell, Duffy and Kidd phenotypes in addition to ABO is used to prevent the alloimmunization to red blood cells (RBCs antigens and as part of the antibody identification process in patients with beta Thalassemia. However, phenotyping in these patients can be time consuming and difficult to interpret. In these situations, it would be valuable to have an alternative to hemagglutination tests to determine the patient's antigen profile. We used PCR-RFLP to genotype such patients. DNA was prepared from 50 patients with beta Thalassemia who had been phenotyped by routine hemagglutination, and tested for Kell, Kidd, Duffy/GATA mutation by PCR-RFLP. RHD/non-D was analysed by PCR product size associated to RHD gene sequence in intron 4 and exon 10/3'UTR. The genotyping assays were performed without knowledge of phenotype results. For RHD/non-D, 47 were RhD+ and RHD+/RHCE+, and 3 were RhD- and RHD-/RHCE+. For Kell, 48 kk were K2K2 and 2 Kk were K1K2. For Duffy, of 44 samples that had normal GATA box, 8 Fy(a+b- were FYA/FYA, 15 Fy(a+b+ were FYB/FYB, and 19 Fy(a+b+ were FYA/FYB; of the other 4 samples 3 were FYA/FYB and heterozygous GATA mutation, and 1 Fy(a-b- was FYB/FYB, homozygous GATA mutation. Two samples phenotyped as Fy(a+b- that had normal GATA , presented the 265T/298A mutations and two samples phenotyped as Fy(a-b+ were genotyped was FYA/FYB.. For Kidd , 15 Jk(a+b were JKA/JKA, 12 Jk(a-b+ were JKB/JKB, and 20 Jk(a+b+ were JKA/JKB. Three samples phenotyped as JK(a+b+ were genotyped as JKB/JKB. Genotype is more accurate than phenotype for determination of blood groups in polytransfused patients with betaThalassemia. Genotyping in these patients can be helpful to select antigen-negative RBCs for transfusion.

  6. PRENATAL DIAGNOSIS OF β-THALASSEMIAS AND HEMOGLOBINOPATHIES

    Directory of Open Access Journals (Sweden)

    Maria Cristina Rosatelli

    2009-11-01

    Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

  7. ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Amit Kumar Tiwari

    2016-11-01

    Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

  8. Study on Moessbauer spectra of hemoglobin in thalassemia

    International Nuclear Information System (INIS)

    Guo Xuanhui; Zhao Nanming; Zhang Xiufang

    1988-01-01

    The 57 Fe Moessbauer spectra of erythrocytes in normal subjects and nine patients of different thalassemias were studied. Together with clinical analysis, the correlation between the components in the spectra and different types of anemias was discussed. (orig.)

  9. Study on Mössbauer spectra of hemoglobin in thalassemia

    Science.gov (United States)

    Xuanhui, Guo; Nanming, Zhao; Xiufang, Zhang; Naifei, Gao; Youwen, Huang; Rongxin, Wang

    1988-02-01

    The57Fe Mössbauer spectra of erythrocytes in normal subjects and nine patients of different thalassemias were studied. Together with clinical analysis, the correlation between the components in the spectra and different types of anemias was discussed.

  10. Atypical location of extramedullary hematopoietic masses in thalassemia

    International Nuclear Information System (INIS)

    Gemenis, T.; Philippou, A.; Gouliamos, A.; Kalovidouris, A.; Papavasiliou, C.; Papacharalambus, X.; Panani, A.; Chalevelakis, G.; Raptis, S.

    1989-01-01

    A case of β-thalassemia with multiple foci of extramedullary hematopoiesis (EH) is reported. EH masses were demonstrated in the presacral and the costovertebral space. EH foci were also encountered in the spleen. (orig.) [de

  11. RESEARCH ARTICLE The prevalence and spectrum of thalassemia ...

    Indian Academy of Sciences (India)

    Navya

    Thalassemia is the most common autosomal recessive disorder worldwide (Joly et al. ... results from a gross gene deletion (Bank 2015; Colah et al. ... France) to assess the concentration of hemoglobin (Hb) A, A2, and F, and any abnormal.

  12. Hematopoietic Stem Cell Transplantation in Thalassemia and Sickle Cell Anemia

    Science.gov (United States)

    Lucarelli, Guido; Isgrò, Antonella; Sodani, Pietro; Gaziev, Javid

    2012-01-01

    The globally widespread single-gene disorders β-thalassemia and sickle cell anemia (SCA) can only be cured by allogeneic hematopoietic stem cell transplantation (HSCT). HSCT treatment of thalassemia has substantially improved over the last two decades, with advancements in preventive strategies, control of transplant-related complications, and preparative regimens. A risk class–based transplantation approach results in disease-free survival probabilities of 90%, 84%, and 78% for class 1, 2, and 3 thalassemia patients, respectively. Because of disease advancement, adult thalassemia patients have a higher risk for transplant-related toxicity and a 65% cure rate. Patients without matched donors could benefit from haploidentical mother-to-child transplantation. There is a high cure rate for children with SCA who receive HSCT following myeloablative conditioning protocols. Novel non-myeloablative transplantation protocols could make HSCT available to adult SCA patients who were previously excluded from allogeneic stem cell transplantation. PMID:22553502

  13. Thalassemia, extramedullary hematopoiesis, and spinal cord compression: A case report

    OpenAIRE

    Bukhari, Syed Sarmad; Junaid, Muhammad; Rashid, Mamoon Ur

    2016-01-01

    Background: Extramedullary hematopoiesis (EMH) refers to hematopoiesis outside of the medulla of the bone. Chronic anemia states such as thalassemia can cause hematopoietic tissue to expand in certain locations. We report a case of spinal cord compression due to recurrent spinal epidural EMH, which was treated with a combination of surgery and radiotherapy. Pakistan has one of the highest incidence and prevalence of thalassemia in the world. We describe published literature on diagnosis and m...

  14. Hepatitis G virus infection and genotypes in Iraqi thalassemia patients

    Directory of Open Access Journals (Sweden)

    Maryam S Ibrahim

    2015-01-01

    Conclusion: the prevalence rate of HGV RNA in β-thalassemia major patients is 18.2%, while the prevalence rate of anti-HGV (past infection is 10.4%. No one of thalassemia patients had HGV RNA and anti-HGV simultaneously. The Gene sequence analysis of PCR products identified HGV genotypes 2 and 5 with percentage of 91.7% and 8.3% respectively

  15. Molecular basis for dominantly inherited inclusion body β-thalassemia

    International Nuclear Information System (INIS)

    Thein, S.L.; Hesketh, C.; Wood, W.G.; Clegg, J.B.; Old, J.M.; Weatherall, D.J.; Taylor, P.; Temperley, I.J.; Hutchinson, R.M.

    1990-01-01

    Analysis of the molecular basis of dominantly inherited β-thalassemia in four families has revealed different mutations involving exon 3 of the β-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of β-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation

  16. Hepatic uptake of technetium-99m diphosphonate in thalassemia major

    International Nuclear Information System (INIS)

    Levy, H.M.; Smith, R.

    1986-01-01

    Two cases of thalassemia major are presented in which bone scintigraphy demonstrated diffuse hepatic uptake of Tc-99m diphosphonate. Although abnormal splenic and renal uptake of Tc-99m phosphates has been reported in patients with thalassemia major, hepatic uptake has not been reported previously. This scintigraphic finding is presumably due to increased iron deposition in the liver, resulting from increased iron turnover and retention in these patients and from multiple previous blood transfusions

  17. Coexistence of Malaria and Thalassemia in Malaria Endemic Areas of Thailand

    Science.gov (United States)

    Kuesap, Jiraporn; Chaijaroenkul, W.; Rungsihirunrat, K.; Pongjantharasatien, K.; Na-Bangchang, Kesara

    2015-01-01

    Hemoglobinopathy and malaria are commonly found worldwide particularly in malaria endemic areas. Thalassemia, the alteration of globin chain synthesis, has been reported to confer resistance against malaria. The prevalence of thalassemia was investigated in 101 malaria patients with Plasmodium falciparum and Plasmodium vivax along the Thai-Myanmar border to examine protective effect of thalassemia against severe malaria. Hemoglobin typing was performed using low pressure liquid chromatography (LPLC) and α-thalassemia was confirmed by multiplex PCR. Five types of thalassemia were observed in malaria patients. The 2 major types of thalassemia were Hb E (18.8%) and α-thalassemia-2 (11.9%). There was no association between thalassemia hemoglobinopathy and malaria parasitemia, an indicator of malaria disease severity. Thalassemia had no significant association with P. vivax infection, but the parasitemia in patients with coexistence of P. vivax and thalassemia was about 2-3 times lower than those with coexistence of P. falciparum and thalassemia and malaria without thalassemia. Furthermore, the parasitemia of P. vivax in patients with coexistence of Hb E showed lower value than coexistence with other types of thalassemia and malaria without coexistence. Parasitemia, hemoglobin, and hematocrit values in patients with coexistence of thalassemia other than Hb E were significantly lower than those without coexistence of thalassemia. Furthermore, parasitemia with coexistence of Hb E were 2 times lower than those with coexistence of thalassemia other than Hb E. In conclusion, the results may, at least in part, support the protective effect of thalassemia on the development of hyperparasitemia and severe anemia in malaria patients. PMID:26174819

  18. Distribution of thalassemias and associated hemoglobinopathies identified by prenatal diagnosis in Taiwan.

    Science.gov (United States)

    Peng, Ching-Tien; Liu, Su-Ching; Peng, Yi-Chin; Lin, Tsai-Hsiu; Wang, Shiow-Jain; Le, Ching-Yi; Shih, Mu-Chin; Tien, Ni; Lu, Jang-Jih; Lin, Chien-Yu

    2013-10-01

    Hemoglobin (Hb) gene disorders are common hereditary disorders in Taiwan, and α- and β-thalassemias are among the well-known Hb disorders here. Our study provides a primary reference for designing a locally relevant antenatal diagnostic test to control the spread of thalassemia. Between 1998 and 2011, prenatal diagnoses for identifying thalassemia and hemoglobinopathies were performed on 1240 fetuses at risk for α-hydrops and β-thalassemia major. Of 1240 specimens analyzed, 1082 (87%) were obtained by amniocentesis; 125 (10%), by chorionic villus sampling; and 33 (3%), by cordocentesis. Prenatal diagnoses revealed that 21.5% of these fetuses as thalassemia major (including α-thalassemia hydrops, β-thalassemia major, and Hb E/β-thalassemia); 50.2%, for thalassemia minor (include α-thalassemia carrier, β-thalassemia carrier, and α-thalassemia combined β-thalassemia carrier); and 28.3% for normal type (include non-α, β-thalassemia). The most common α-hydrops were SEA (Southeast Asian) and Philippine type (frequencies of 74.91 and 5.24%, respectively). The frequency of the IVS-II-654 combined codons 41/42 mutation, the most common β-thalassemia major mutation in this region, was 5.24%. Two fetuses were found with E/β-thalassemia (HbE/IVS-II-654 and HbE/codons 41/42, respectively). Since 1993, Taiwan's Department of Health adopted a national program for screening pregnancies to control spread of thalassemia. In the last 10years, less than 3 such cases have occurred per year. After 2003, this number was 0 for a total of 4years (2003, 2004, 2007, and 2008). In Taiwan, incidence and frequency of thalassemia genotypes were similar to those previously reported. The national program for screening pregnancies to control spread of thalassemia that resulted in a marked decline in the number of newborns with thalassemia major. Interestingly, prenatal diagnoses revealed 21.5% for thalassemia major, 50.2% for thalassemia minor, 28.3% normal comparison of thalassemia

  19. Limitations of the HOMA-B score for assessment of beta-cell functionality in interventional trials-results from the PIOglim study.

    Science.gov (United States)

    Pfützner, Andreas; Derwahl, Michael; Jacob, Stephan; Hohberg, Cloth; Blümner, Ernst; Lehmann, Ute; Fuchs, Winfried; Forst, Thomas

    2010-08-01

    Drugs with unspecific stimulating effects on beta-cell secretion increase the homeostasis model assessment (HOMA)-B score, indicating improved beta-cell "function." We investigated whether the beta-cell protection provided by adding pioglitazone (PIO) to glimepiride (GLIM) in comparison to up-titrating the GLIM dose alone is reflected by appropriate changes in several measures of beta-cell function, including HOMA-B score. This double-blind, parallel prospective 6-month study was performed with 82 patients (47 men, 35 women; age, 61 +/- 9 years; duration of disease, 5.3 +/- 4.4 years; body mass index, 32.6 +/- 6.0 kg/m(2); hemoglobin A1c [HbA1c], 7.3 +/- 0.7%) with GLIM monotherapy (1-3 mg). They were randomized to receive a GLIM + PIO combination with up-titration (2 mg + 30 mg/4 mg + 30 mg/4 mg + 4 mg) or to remain on GLIM (up-titration 4/5/6 mg). Observation parameters determined at baseline and end point included HOMA-B, HOMA-IR, HbA1c, glucose, insulin, and intact proinsulin. There was a slight increase in the HOMA-B score in the GLIM group but not in the GLIM + PIO arm (baseline/end point: for GLIM, 71 +/- 48/88 +/- 64; for PIO + GLIM, 74 +/- 56/69 +/- 52). Improvements in the other observation parameters were predominantly detected in the PIO + GLIM group (HbA1c, 7.20 +/- 0.61%/6.36 +/- 0.90%; HOMA-IR, 7.0 +/- 4.5/4.1 +/- 2.1; intact proinsulin, 12.4 +/- 10.3/7.6 +/- 4.8 pmol/L [all P HOMA-IR, 7.4 +/- 4.5/7.5 +/- 4.3 [not significant]; intact proinsulin, 17.3 +/- 21.6/16.3 +/- 15.5 pmol/L [not significant]). The PIO + GLIM combination led to overall improvement of laboratory biomarkers for beta-cell function, except for HOMA-B. Glimepiride up-titration had no such effects but increased the HOMA-B score. HOMA-B seems to provide misleading results when used as a diagnostic tool in patients treated with sulfonylurea drugs. A corrective term for consideration of proinsulin in the HOMA-B equation may address this limitation.

  20. Diabetes mellitus in β-thalassemia major patients

    Directory of Open Access Journals (Sweden)

    Riadi Wirawan

    2003-06-01

    Full Text Available β-thalassemia major is a disease caused by β polypeptide chain synthesis disorder which is inherited as an autosomal recessive from both parents which is marked by little or no β globin chain synthesis. Medication for β thalassemia major patients is by repeated blood transfusions, which causes hemochromatosis. Hemochromatosis can occur in various organs including the pancreas. The aim of the study was to assess the alteration of plasma glucose concentration and the hemochromatosis prevalence. Fasting plasma glucose concentration and serum ferritin examination were measured in 115 β thalassemia major patients with ages between 10-23 years who were out-patients in the Thalassemia Centre, Department of Child Health, Medical School, University of Indonesia / Dr. Cipto Mangunkusumo General Hospital, Jakarta. The plasma glucose concentration examination was conducted by the GDH enzymatic method, with American Diabetes Association (ADA criteria in the evaluation, while the serum ferritin examination was conducted with the microparticle enzyme immuno assay (MEIA method. All patients had hemochromatosis, 14.8% of the patients had impaired fasting glucose level and 2.6% of the patients showed indications of diabetes mellitus. β thalassemia major patients who receive frequent transfusions will develop hemochromatosis that will in turn impair the pancreatic function. (Med J Indones 2003; 12: 87-93 Keywords : β thalassemia major, hemochromatosis, diabetes mellitus

  1. Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

    Science.gov (United States)

    Sabath, Daniel E

    2017-07-01

    To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  2. Recent trends in the gene therapy of β-thalassemia

    Science.gov (United States)

    Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

    2015-01-01

    The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

  3. Altered erythropoiesis and iron metabolism in carriers of thalassemia

    Science.gov (United States)

    Guimarães, Jacqueline S.; Cominal, Juçara G.; Silva-Pinto, Ana Cristina; Olbina, Gordana; Ginzburg, Yelena Z.; Nandi, Vijay; Westerman, Mark; Rivella, Stefano; de Souza, Ana Maria

    2014-01-01

    The thalassemia syndromes (α- and β-thalassemia) are the most common and frequent disorders associated with ineffective erythropoiesis. Imbalance of α- or β-globin chain production results in impaired red blood cell synthesis, anemia and more erythroid progenitors in the blood stream. While patients affected by these disorders show definitive altered parameters related to erythropoiesis, the relationship between the degree of anemia, altered erythropoiesis and dysfunctional iron metabolism have not been investigated in both α-thalassemia carriers (ATC) and β-thalassemia carriers (BTC). Here we demonstrate that ATC have a significantly reduced hepcidin and increased soluble transferrin receptor levels but relatively normal hematological findings. In contrast, BTC have several hematological parameters significantly different from controls, including increased soluble transferrin receptor and erythropoietin levels. These changings in both groups suggest an altered balance between erythropoiesis and iron metabolism. The index sTfR/log ferrin and (hepcidin/ferritin)/sTfR are respectively increased and reduced relative to controls, proportional to the severity of each thalassemia group. In conclusion, we showed in this study, for the first time in the literature, that thalassemia carriers have altered iron metabolism and erythropoiesis. PMID:25307880

  4. Non-transfusion Dependent Thalassemias: A Developing Country Perspective.

    Science.gov (United States)

    Mukherjee, Somnath; Das, Rashmi R; Raghuwanshi, Babita

    2015-01-01

    Non-transfusion-dependent thalassemias (NTDT) encompass a group of hereditary chronic hemolytic anemia, which, as the name indicates, not require regular blood transfusion for survival. These include β-thalassemia intermedia, hemoglobin E/β-thalassemia, and Hemoglobin H disease (α- thalassemia intermedia). Individuals with structural variant of hemoglobin especially Hemoglobin S and Hemoglobin C associated with "α" or "β" thalassemia in heterozygous condition may also present with similar features of NTDT. NTDT patients are not immune to the development of transfusion unrelated complications in the long run. These hereditary chronic hemolytic anemias are still under-recognized in developing countries like India, where the disease burden might be high causing significant morbidity. The pathophysiologic hallmark that characterizes this group of disorders (ineffective erythropoiesis, hemolysis, chronic anemia) leads to a number of serious complications, similar to transfusion dependent thalassemia. So, timely diagnosis and institution of appropriate preventive/remedial measures as well as education of patient population can help decrease the morbidity to a significant extent. In the present review, focus will be on the pathophysiological mechanisms and available management options of NTDT from a developing country perspective like India.

  5. Assessment of Iron Overload in Homozygous and Heterozygous Beta Thalassemic Children below 5 Years of Age

    Directory of Open Access Journals (Sweden)

    Dhiraj J. Trivedi

    2014-07-01

    Full Text Available Background: Thalassemia is a genetic disease having 3-7% carrier rate in Indians. It is transfusion dependent anemia having high risk of iron overloading. A clinical symptom of iron overload becomes detectable in second decade causing progressive liver, heart and endocrine glands damage. There is a need to assess iron overload in thalassemics below 5 years of age to protect them from complications at later age of life. Aims and objectives: Present study was undertaken to estimate serum iron status and evaluate serum transferrin saturation in both homozygous & heterozygous form of thalassemia as an index of iron overload among children of one to five years of age. Materials and Methods: Clinically diagnosed thirty cases of β thalassemia major & thirty cases of β thalassemia minor having severe anemia, hepatospleenomegaly and between 1 year to 5 years of age were included in study group and same age matched healthy controls were included in the study. RBC indices and HbA, HbA2 and HbF were estimated along with serum iron & serum Total Iron Binding Capacity (TIBC and serum transferrin levels. Results: Significant difference was observed in hemoglobin levels between control and both beta thalassemia groups. Mean Corpuscular Volume (MCV and Mean Corpuscular Hemoglobin (MCH values were reduced. Hemoglobin electrophoresis showed the elevated levels of HbF and HbA2 in both beta thalassemia groups. Among serum iron parameters, serum iron, TIBC and transferrin saturation were elevated whereas serum transferrin levels were low in thalassemia major in children below 5 years of age. Conclusion: Although clinical symptoms of iron overload have been absent in thalassemic children below five years of age, biochemical iron overloading has started at much lower age which is of great concern.

  6. Hemolytic disease of the newborn caused by a new deletion of the entire beta-globin cluster.

    OpenAIRE

    Pirastu, M; Kan, Y W; Lin, C C; Baine, R M; Holbrook, C T

    1983-01-01

    We describe a new type of gamma delta beta-thalassemia in four generations of a family of Scotch-Irish descent. The proposita presented with hemolytic disease of the newborn, which was characterized by a microcytic anemia. Initial restriction endonuclease analysis of the DNA showed no grossly abnormal patterns, but studies of polymorphic restriction sites and gene dosage revealed an extensive deletion that removed all the beta- and beta-like globin genes from the affected chromosome. In situ ...

  7. Pain in thalassemia - an emerging complication

    Directory of Open Access Journals (Sweden)

    P.J. Giardina

    2011-12-01

    Full Text Available Many thalassemia subjects both transfused Major (TM and nontransfused Intermedia (TI suffer from longstanding bone disease, reduced or low bone mass (osteopenia or osteoporosis, fractures and bone pain. Unexpected musculoskeletal disease occurs despite longstanding hypertransfusion and new iron chelation strategies. Conditions which have been implicated in its pathogenesis include the massive ineffective erythropoiesis, chronic hypoxia associated with anemia, the local metabolic dysfunction from hemochromatosis, iron chelation toxicity, trace mineral deficiencies such as zinc deficiency, low vitamin D concentrations, the effect of endocrine dysfunction such as hypoparathyroidism, hypogonadism and growth hormone deficiency from hemochromatosis and the chronic inflammatory state induced by iron excess. The pathogenesis of bone disease has been attributed to the underlying marrow expansion of medullary bone caused by the massive ineffective erythropoiesis and subsequent cortical thinning. The process of normal bone health is maintained by a metabolic interplay of several hormonal factors including growth hormone, estrogen, testosterone, parathyroid hormone all of which can be diminished by iron overload in Thalassemia. Trace metals and vitamins including calcium, copper, zinc or vitamin C can also be deficient from iron excess or iron chelation which are also important contributors to bone metabolism. Indeed toxicities of iron chelation itself on bone development in the growing child associated with zinc deficiency, high Deferoxamine dosing and low iron burdens or the collagenous joint disease associated with deferiprone chelation have further contributed to the current musculoskeletal disease of Thalassemias. Decreased spinal height, vertebral flattening and scoliosis have also been reported. Magnetic Resonance Imaging (MRI of adolescent and adult β Thalassemia Major and Intermedia patients with osteoporosis and pain have assisted in defining the

  8. BETA digital beta radiometer

    International Nuclear Information System (INIS)

    Borovikov, N.V.; Kosinov, G.A.; Fedorov, Yu.N.

    1989-01-01

    Portable transportable digital beta radiometer providing for measuring beta-decay radionuclide specific activity in the range from 5x10 -9 up to 10 -6 Cu/kg (Cu/l) with error of ±25% is designed and introduced into commercial production for determination of volume and specific water and food radioactivity. The device specifications are given. Experience in the BETA radiometer application under conditions of the Chernobyl' NPP 30-km zone has shown that it is convenient for measuring specific activity of the order of 10 -8 Cu/kg, and application of a set of different beta detectors gives an opportunity to use it for surface contamination measurement in wide range of the measured value

  9. Estimates of the effect on hepatic iron of oral deferiprone compared with subcutaneous desferrioxamine for treatment of iron overload in thalassemia major: a systematic review

    Directory of Open Access Journals (Sweden)

    Caro J

    2002-11-01

    Full Text Available Abstract Background Beta thalassemia major requires regular blood transfusions and iron chelation to alleviate the harmful accumulation of iron. Evidence on the efficacy and safety of the available agents, desferrioxamine and deferiprone, is derived from small, non-comparative, heterogeneous observational studies. This evidence was reviewed to quantitatively compare the ability of these chelators to reduce hepatic iron. Methods The literature was searched using Medline and all reports addressing the effect of either chelator on hepatic iron were considered. Data were abstracted independently by two investigators. Analyses were performed using reported individual patient data. Hepatic iron concentrations at study end and changes over time were compared using ANCOVA, controlling for initial iron load. Differences in the proportions of patients improving were tested using χ2. Results Eight of 11 reports identified provided patient-level data relating to 30 desferrioxamine- and 68 deferiprone-treated patients. Desferrioxamine was more likely than optimal dose deferiprone to decrease hepatic iron over the average follow-up of 45 months (odds ratio, 19.0, 95% CI, 2.4 to 151.4. The degree of improvement was also larger with desferrioxamine. Conclusions This analysis suggests that desferrioxamine is more effective than deferiprone in lowering hepatic iron. This comparative analysis – despite its limitations – should prove beneficial to physicians faced with the challenge of selecting the optimal treatment for their patients.

  10. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  11. Effects of blood transfusion on exercise capacity in thalassemia major patients.

    Directory of Open Access Journals (Sweden)

    Daniela Benedetto

    Full Text Available Anemia has an important role in exercise performance. However, the direct link between rapid changes of hemoglobin and exercise performance is still unknown.To find out more on this topic, we studied 18 beta-thalassemia major patients free of relevant cardiac dysfunction (age 33.5±7.2 years,males = 10. Patients performed a maximal cardiopulmolmonary exercise test (cycloergometer, personalized ramp protocol, breath-by-breath measurements of expired gases before and the day after blood transfusion (500 cc of red cell concentrates. After blood transfusion, hemoglobin increased from 10.5±0.8 g/dL to 12.1±1.2 (p<0.001, peak VO2 from 1408 to 1546mL/min (p<0.05, and VO2 at anaerobic threshold from 965 to 1024mL/min (p<0.05. No major changes were observed as regards heart and respiratory rates either at peak exercise or at anaerobic threshold. Similarly, no relevant changes were observed in ventilation efficiency, as evaluated by the ventilation vs. carbon dioxide production relationship, or in O2 delivery to the periphery as analyzed by the VO2 vs. workload relationship. The relationship between hemoglobin and VO2 changes showed, for each g/dL of hemoglobin increase, a VO2 increase = 82.5 mL/min and 35 mL/min, at peak exercise and at anaerobic threshold, respectively. In beta-thalassemia major patients, an acute albeit partial anemia correction by blood transfusion determinates a relevant increase of exercise performance, observed both at peak exercise and at anaerobic threshold.

  12. Risk Factors to Growth Retardation in Major Thalassemia

    Directory of Open Access Journals (Sweden)

    Riva Uda

    2011-03-01

    Full Text Available The increasing in the life span of patients with major thalassemia should be followed by increased quality of life. There are factors which can affect growth retardation in these patients. The aim of this study was to find out the risk factors for growth retardation in patients with major thalassemia. An analytical study with cross-sectional design was conducted at Pediatric Thalassemia Clinics of Dr.Hasan Sadikin Hospital, Bandung, in June to July 2006. The subjects of this study were patients with major thalassemia. Inclusion criteria’s were age under 14 years old, had no chronic diseases like tuberculosis, cerebral palsy with complete medical records. Risk factors were the timing of diagnosis, initial and dose of deferoxamine, volume of transfused blood, mean pretransfusion hemoglobin level, family income, and age. Antropometric measurement indices were used to assess the growth which expressed in Z score. Growth evaluated based on height/age (H/A and growth retardation if H/A <-2 SD. Risk factors for growth retardation were analyzed separately using chi-square test and odds ratio (OR with 95% confidence interval (CI. Then they were analyzed simultaneously with logistic regression method. Subjects consisted of 152 patients with major thalassemia. Seventy three thalassemia patients were stunted. Analysis showed that age (OR: 5.42, 95% CI:2.32–12.65, p <0.001, dosage of deferoxamine (OR: 4.0, 95% CI: 1.29–12.41, p: 0.016, and family income (OR: 2.32, 95% CI: 1.06–5.06, p: 0.036 were risks factors for growth retardation. Conclusion, risk factors for growth retardation in major thalassemia are age, dosage of deferoxamine, and family income.

  13. Thalassemia and hemoglobinopathies in Thua Thien Hue Province, Central Vietnam.

    Science.gov (United States)

    Nguyen, Hoa Van; Sanchaisuriya, Kanokwan; Nguyen, Dung; Phan, Hoa Thi Thuy; Siridamrongvattana, Sirivara; Sanchaisuriya, Pattara; Fucharoen, Supan; Fucharoen, Goonnapa; Schelp, Frank P

    2013-01-01

    A community-based assessment of thalassemias and hemoglobinopathies was conducted at the Thua Thien Hue Province, Central Vietnam. By cluster sampling, a total of 410 pregnant women attending the antenatal care service at 30 commune health centers were recruited consecutively from September 2011 to June 2012. Hemoglobin (Hb) analysis was performed using an automated Hb analyzer. α-Thalassemia (α-thal) genes were identified by polymerase chain reaction (PCR)-based techniques. Out of the 410 pregnant women, 2.7% carried α(0)-thal and 1.2% were β-thal carriers. One woman with the - -(THAI) deletion was also found. Among the females under survey, structural Hb variants with 3.2% Hb E [β26(B8)Glu→Lys, GAG>AAG; HBB: c.78G>C] and 3.7% Hb Constant Spring [Hb CS; α142, Term→Gln, TAA>CAA (α2); HBA2: c.427T>C] were found. Assessing the frequency of thalassemias and hemoglobinopathies by ethnicity, Kinh (Vietnamese) and ethnic minority groups, Hb CS with a high frequency of 24.0% was observed in the ethnic minority groups. These results provide basic population-based information, are useful not only for implementing measures for prevention and control of thalassemias in the region but also for studying the importance of thalassemias and hemoglobinopathies in ethnic minorities within Southeast Asia.

  14. Measurement of the CP-violating phase $\\beta$ in $B^0\\rightarrow J/\\psi \\pi^+\\pi^-$ decays and limits on penguin effects

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreassen, Rolf; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Belogurov, Sergey; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Bizzeti, Andrea; Bjørnstad, Pål Marius; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borgia, Alessandra; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casanova Mohr, Raimon; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Counts, Ian; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew Christopher; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pascal; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Di Canto, Angelo; Di Domenico, Antonio; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gastaldi, Ugo; Gauld, Rhorry; Gavardi, Laura; Gazzoni, Giulio; Geraci, Angelo; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gianì, Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, Vladimir; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Hampson, Thomas; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jaton, Pierre; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kelsey, Matthew; Kenyon, Ian; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Korolev, Mikhail; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kurek, Krzysztof; Kvaratskheliya, Tengiz; La Thi, Viet Nga; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lambert, Robert W; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lowdon, Peter; Lucchesi, Donatella; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Machefert, Frederic; Machikhiliyan, Irina V; Maciuc, Florin; Maev, Oleg; Malde, Sneha; Malinin, Alexander; Manca, Giulia; Mancinelli, Giampiero; Mapelli, Alessandro; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathe, Zoltan; Matteuzzi, Clara; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; McSkelly, Ben; Meadows, Brian; Meier, Frank; Meissner, Marco; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Moggi, Niccolò; Molina Rodriguez, Josue; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Katharina; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Nicol, Michelle; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Orlandea, Marius; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Arantza; Pal, Bilas Kanti; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parkes, Christopher; Parkinson, Christopher John; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Pesen, Erhan; Petridis, Konstantin; Petrolini, Alessandro; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Rachwal, Bartolomiej; Rademacker, Jonas; Rakotomiaramanana, Barinjaka; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruiz, Hugo; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepp, Indrek; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skillicorn, Ian; Skwarnicki, Tomasz; Smith, Anthony; Smith, Edmund; Smith, Eluned; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Sterpka, Christopher Francis; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Stroili, Roberto; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szumlak, Tomasz; T'Jampens, Stephane; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Todd, Jacob; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ubeda Garcia, Mario; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Whitehead, Mark; Wiedner, Dirk; Wilkinson, Guy; Wilkinson, Michael; Williams, Matthew; Williams, Mike; Wilschut, Hans; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Wen Chao; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang

    2015-01-01

    Time-dependent CP violation is measured in the $B^0\\rightarrow J/\\psi\\pi^+\\pi^-$ channel for each $\\pi^+\\pi^-$ resonant final state using data collected with an integrated luminosity of 3.0 fb$^{-1}$ in $pp$ collisions using the LHCb detector. The final state with the largest rate, $J/\\psi\\rho^0(770)$, is used to measure the CP-violating angle $2\\beta^{\\rm eff}$ to be $(41.7\\pm 9.6_{-6.3}^{+2.8})^{\\circ}$. This result can be used to limit the size of penguin amplitude contributions to CP violation measurements in, for example, $B_s^0\\rightarrow J/\\psi\\phi$ decays. Assuming approximate SU(3) flavour symmetry and neglecting higher order diagrams, the shift in the CP-violating phase $\\phi_s$ is limited to be within the interval [$-1.05^\\circ$, +$1.18^\\circ$] at 95% confidence level. Changes to the limit due to SU(3) symmetry breaking effects are also discussed.

  15. GENETIC FACTORS INFLUENCING HEMOGLOBIN F LEVEL IN β-THALASSEMIA/HB E DISEASE.

    Science.gov (United States)

    Ruangrai, Waraporn; Jindadamrongwech, Sumalee

    2016-01-01

    Genetic factors influencing Hb F content in adult red blood cells include β-thalassemia genotypes, co-inheritance of α-thalassemia traits and single nucleotide polymorphisms (SNPs). Genotyping of α- and β-thalassemia and five SNPs in β-globin gene cluster previously identified in genome-wide association studies as being markers of elevated Hb F in β-thalassemia were performed in 81 subjects diagnosed with β-thalassemia/Hb E. Hb F levels are higher (0.9-7.1 g/dl) in subjects (n = 57) with the severe compared to mild β-thalassemia (0.8-2.5 g/ dl) (n = 4) genotypes, and are similarly low (0.7-3.5 g/dl) in those (n = 15) with α-thalassemia co-inheritance. Hb F levels in non-thalassemia controls (n = 150) range from 0 to 0.15 g/dl. The presence of homozygous minor alleles of the 5 SNPs are significant indicators of β-thalassemia/Hb E individuals with high Hb F (> 4 g/dl), independent of their thalassemia genotypes. Given that re-activation of γ-globin genes leads to amelioration of β-thalassemia severity, understanding how genetic factors up-regulate Hb F production may lead to possible therapeutic interventions, genetically or pharmacologically, of this debilitating disease in the not too distant future.

  16. Thalidomide has a significant effect in patients with thalassemia intermedia.

    Science.gov (United States)

    Li, YunShuan; Ren, Quan; Zhou, Yali; Li, Pingping; Lin, Wanhua; Yin, Xiaolin

    2018-01-01

    To investigate the effect of thalidomide in patients with thalassemia intermedia. We observed the effect of thalidomide in seven patients with thalassemia intermedia requiring blood transfusion. Four of the patients were transfusion-independent, and three patients were transfusion-dependent. For the four transfusion-independent patients, hemoglobin concentration increased significantly (≥2 g/dl) in three and moderately (1-2 g/dl) in one. After 3 months of treatment, hemoglobin concentration increased 3.2 ± 1.2 g/dl compared to pretreatment. Among the three transfusion-dependent patients, transfusion was terminated after one month of treatment in one patient and decreased >50% in the other two patients, accompanied by an increase in the average hemoglobin concentration. Thalidomide had a significant effect in patients with thalassemia intermedia. Further studies of a larger scale and more rigorous design are warranted.

  17. Neurotic manifestations in adolescents with thalassemia major.

    Science.gov (United States)

    Moorjani, J D; Issac, Chithira

    2006-07-01

    To study the neurotic manifestations in thalassemic adolescents as a consequence of long-term illness. From July 2003, thirty six thalassemic adolescents and forty normal adolescents were selected with age ranging from 13 to 18 and with same socio economic status and family background. Middlesex Hospital Questionnaire by Crown and Crisp [1966] was administered and Mann Whiteny 'U' test was employed to measure free-floating anxiety, phobia, somatic anxiety, obsession, depression, hysteria and total neuroticism score. An interview was conducted along with the questionnaire to detect the problems in depth. Parents of thalassemic adolescents were interviewed subsequently to realize the behavioral problems existing along with neuroticism. Thirty-six of thalassemic and all forty normal adolescents returned the questionnaires. The responses suggest a marked difference in total neuroticism score and all other variables except that of hysteria. The interview on parents of thalassemic adolescents exposed various behavioral problems in these adolescents. Thalassemic adolescents were having higher scores in neuroticism. Some behavioral problems are also found to exist along with neurotic manifestations. There remains a need to improve the management of thalassemia in terms of psychological aspects in order to improve the mental health of this group.

  18. Post Splenectomy Outcome in β-Thalassemia.

    Science.gov (United States)

    Merchant, Rashid H; Shah, Ami R; Ahmad, Javed; Karnik, Alka; Rai, Nooralam

    2015-12-01

    To evaluate changes in annual blood transfusion requirements and complications after splenectomy in patients with β-thalassemia. Forty post-splenectomy β-thalassemic patients aged 8-33 y, receiving regular blood transfusions and chelation therapy were included and non transfusion dependant patients were excluded from this retrospective cross-sectional study. Details about their surgery, transfusion requirements, and platelet levels were recorded on a standard proforma. All patients underwent a B-mode and color-coded duplex sonography of the hepatoportal system during the study period. The average ferritin level in the year prior to the study was 4432 mcg/L (range 480-12,200 mcg/L). The annual blood transfusion requirement in the first year and 5 y post splenectomy [mean ± SD (138.41 ± 90.38 ml/kg/y); (116 ± 41.44 ml/kg/y)] were significantly different from requirements before splenectomy [(mean ± SD) 294.85 ± 226 ml/kg/y; p value splenectomy with a mean rise of 4,51,000/mm(3) (p value splenectomy. Increase in annual blood transfusion requirement should be investigated to find the cause.

  19. Outcomes, utilization, and costs among thalassemia and sickle cell disease patients receiving deferoxamine therapy in the United States.

    Science.gov (United States)

    Delea, Thomas E; Hagiwara, May; Thomas, Simu K; Baladi, Jean-Francois; Phatak, Pradyumna D; Coates, Thomas D

    2008-04-01

    Deferoxamine mesylate (DFO) reduces morbidity and mortality associated with transfusional iron overload. Data on the utilization and costs of care among U.S. patients receiving DFO in typical clinical practice are limited however. This was a retrospective study using a large U.S. health insurance claims database spanning 1/97-12/04 and representing 40 million members in >70 health plans. Study subjects (n = 145 total, 106 sickle cell disease [SCD], 39 thalassemia) included members with a diagnosis of thalassemia or SCD, one or more transfusions (whole blood or red blood cells), and one or more claims for DFO. Mean transfusion episodes were 12 per year. Estimated mean DFO use was 307 g/year. Central venous access devices were required by 20% of patients. Cardiac disease was observed in 16% of patients. Mean total medical costs were $59,233 per year including $10,899 for DFO and $8,722 for administration of chelation therapy. In multivariate analyses, potential complications of iron overload were associated with significantly higher medical care costs. In typical clinical practice, use of DFO in patients with thalassemia and SCD receiving transfusions is low. Administration costs represent a large proportion of the cost of chelation therapy. Potential complications of iron overload are associated with increased costs. (c) 2007 Wiley-Liss, Inc.

  20. Detection of Early Right Ventricular Dysfunction in Young Patients With Thalassemia Major Using Tissue Doppler Imaging

    Science.gov (United States)

    Bornaun, Helen; Dedeoglu, Reyhan; Oztarhan, Kazim; Dedeoglu, Savas; Erfidan, Erkan; Gundogdu, Muge; Aydogan, Gonul; Cengiz, Dicle

    2016-01-01

    Background Myocardial iron overload is the most common cause of mortality in patients with thalassemia major (TM), also known as beta-thalassemia. T2* cardiovascular magnetic resonance imaging (MRI) is the best way of monitoring cardiac iron, and new echocardiographic techniques can be used to assess cardiac function. Objectives The aim of this study was to assess the systolic and diastolic right ventricular (RV) function of patients with TM using tissue Doppler imaging (TDI) and to determine whether this echocardiographic technique is an adequate diagnostic tool for the screening and detection of subclinical cardiac dysfunction. Patients and Methods Eighty-four patients with TM were evaluated by conventional echocardiography and pulse-wave TDI. The data of the TM group (Group 1) were compared with that of 85 age- and sex-matched healthy controls (Group 2). Cardiovascular T2* MRI examinations were performed in 49 of the 85 patients. Results The patients with TM had significantly lower values for weight, height, body mass index, systolic arterial pressure, deceleration time, E’/A’, and ejection time (ET) than the controls. Group 1 also had significantly higher values for peak early diastolic velocity (E) over peak late diastolic velocity (A), peak early diastolic velocity of TDI (E’), peak late diastolic velocity of TDI (A’), E/E’, isovolumetric relaxation time, isovolumetric contraction time, and RV magnetic perfusion imaging (MPI) than Group 2. Conclusions RV diastolic dysfunction occurs before systolic deterioration in patients with TM and cannot be screened with conventional echocardiographic techniques. In routine practice, TDI measurements, MPI (for global function) and the E/E’ parameter (for diastolic function) can be used to screen and detect early RV dysfunction. PMID:27617076

  1. Vitamin A equivalency of beta-carotene in healthy adults: limitation of the extrinsic dual-isotope dilution technique to measure matrix effect.

    NARCIS (Netherlands)

    Loo-Bouwman, C.A. Van; West, C.E.; Breemen, R.B. van; Zhu, D.; Siebelink, E.; Versloot, P.; Hulshof, P.J.; Lieshout, M. van; Russel, F.G.M.; Schaafsma, G.; Naber, A.H.J.

    2009-01-01

    Data on the vitamin A equivalency of beta-carotene in food are inconsistent. We quantified the vitamin A equivalency (microg) of beta-carotene in two diets using the dual-isotope dilution technique and the oral-faecal balance technique. A diet-controlled, cross-over intervention study was conducted

  2. Measurement of HbA1c and HbA2 by Capillarys 2 Flex Piercing HbA1c programme for simultaneous management of diabetes and screening for thalassemia.

    Science.gov (United States)

    Ke, Peifeng; Liu, Jiawei; Chao, Yan; Wu, Xiaobin; Xiong, Yujuan; Lin, Li; Wan, Zemin; Wu, Xinzhong; Xu, Jianhua; Zhuang, Junhua; Huang, Xianzhang

    2017-10-01

    Thalassemia could interfere with some assays for haemoglobin A 1c (HbA 1c ) measurement, therefore, it is useful to be able to screen for thalassemia while measuring HbA 1c . We used Capillarys 2 Flex Piercing (Capillarys 2FP) HbA 1c programme to simultaneously measure HbA 1c and screen for thalassemia. Samples from 498 normal controls and 175 thalassemia patients were analysed by Capillarys 2FP HbA 1c programme (Sebia, France). For method comparison, HbA 1c was quantified by Premier Hb9210 (Trinity Biotech, Ireland) in 98 thalassaemia patients samples. For verification, HbA 1c from eight thalassaemia patients was confirmed by IFCC reference method. Among 98 thalassaemia samples, Capillarys 2FP did not provide an HbA 1c result in three samples with HbH due to the overlapping of HbBart's with HbA 1c fraction; for the remaining 95 thalassaemia samples, Bland-Altman plot showed 0.00 ± 0.35% absolute bias between two systems, and a significant positive bias above 7% was observed only in two HbH samples. The HbA 1c values obtained by Capillarys 2FP were consistent with the IFCC targets (relative bias below ± 6%) in all of the eight samples tested by both methods. For screening samples with alpha (α-) thalassaemia silent/trait or beta (β-) thalassemia trait, the optimal HbA 2 cut-off values were ≤ 2.2% and > 2.8%, respectively. Our results demonstrated the Capillarys 2FP HbA 1c system could report an accurate HbA 1c value in thalassemia silent/trait, and HbA 2 value (≤ 2.2% for α-thalassaemia silent/trait and > 2.8% for β-thalassemia trait) and abnormal bands (HbH and/or HbBart's for HbH disease, HbF for β-thalassemia) may provide valuable information for screening.

  3. Adult Human Pancreatic Islet Beta-Cells Display Limited Turnover and Long Lifespan as Determined by In-Vivo Thymidine Analog Incorporation and Radiocarbon Dating

    Energy Technology Data Exchange (ETDEWEB)

    Perl, S; Kushner, J A; Buchholz, B A; Meeker, A K; Stein, G M; Hsieh, M; Kirby, M; Pechhold, S; Liu, E H; Harlan, D M; Tisdale, J F

    2010-03-15

    Diabetes mellitus results from an absolute or relative deficiency of insulin producing pancreatic beta-cells. The adult human beta-cell's turnover rate remains unknown. We employed novel techniques to examine adult human islet beta-cell turnover and longevity in vivo. Subjects enrolled in NIH clinical trials received thymidine analogues [iododeoxyuridine (IdU) or bromodeoxyuridine (BrdU)] 8-days to 4-years prior to death. Archival autopsy samples from ten patients (aged 17-74 years) were employed to assess beta-cell turnover by scoring nuclear analog labeling within insulin staining cells. Human adult beta-cell longevity was determined by estimating the cells genomic DNA integration of atmospheric carbon-14 ({sup 14}C). DNA was purified from pancreatic islets isolated from cadaveric donors; whole islet prep DNA was obtained from a 15 year old donor, and purified beta-cell DNA was obtained from two donors (age 48 and 80 years). {sup 14}C levels were then determined using accelerator mass spectrometry (AMS). Cellular 'birth date' was determined by comparing the subject's DNA {sup 14}C content relative to a well-established {sup 14}C atmospheric prevalence curve. In the two subjects less than age 20 years, 1-2% of the beta-cell nuclei co-stained for BrdU/IdU. No beta-cell nuclei co-stained in the eight patients more than 30 years old. Consistent with the BrdU/IdU turnover data, beta-cell DNA {sup 14}C content indicated the cells 'birth date' occurred within the subject's first 30 years of life. Under typical circumstances, adult human beta-cells and their cellular precursors are established by young adulthood.

  4. Improving adherence with deferoxamine regimen in thalassemia major using education

    Directory of Open Access Journals (Sweden)

    Gholamreza Pouladfar

    2006-02-01

    Full Text Available Background: Subcutaneous deferoxamine is the first line for management of iron overload in thalassemia major. There is a wide deferoxamine adherence variation in patients with thalassemia major. In order to assess the effect of education on patients and their parents, a cognitive approach was used. Methods: In a randomized control trial, 78 consecutive patients with thalassemia major were randomly divided into educational (38 cases, 50% male and 50% female and control (40 cases, 65% male and 35% female groups. Oral and practical education sessions for deferoxamine injection were planned. Deferoxamine usage, pump function, side effects, knowledge levels of the patients and their parents, and ferritin serum levels were assessed before and after the trail. The knowledge was also evaluated promptly after educational sessions. Results: the mean age of experimental and control groups were 14.6 and 13.0 years, respectively. There was no significant difference in age, sex and weight (P>0.05 at the end of the study, there was no significant change in the level of knowledge in both groups however, the patients who used deferoxamine at least 5 times a week were increased in the experimental group (P0.001. Conclusion: A cognitive approach had relatively significant effect on deferoxamine adherence. However, educational sessions had not dramatic change in knowledge levels of the patients and their parents, but oral and practical education produced a significant change in decreasing local side effects of subcutaneous deferoxamine in thalassemia major.

  5. Alpha thalassemia among sickle cell anaemia patients in Kampala ...

    African Journals Online (AJOL)

    Keywords: Alpha thalassemia, sickle cell anaemia patients, Kampala, Uganda. DOI: http://dx.doi.org/10.4314/ahs.v15i2.48. Introduction. In the early 1960's many adults with sickle cell anaemia. (SCA) as well as those with mild disease were reported in Jamaica1. Various factors, both genetic and environmental, are.

  6. Relationship between Personality Traits and Happiness in Patients with Thalassemia

    Directory of Open Access Journals (Sweden)

    Babollah Bakhshipour

    2014-12-01

    Full Text Available Background: The aim of this study was determining the relationship between personality traits and happiness in patients with major thalassemia. Materials and Methods: The design of this study was descriptive (correlational study. The target population of this study was all under-treated patients with major thalassemia in Amirkola thalassemia center in 2011. Among these patients, 150 patients were sampled using simple random sampling method and Morgan's table. The data were analyzed by means of calculating Pearson correlation coefficients and multiple linear regression analysis. The patients were asked to complete NEO-five factor Inventory (short form and Oxford happiness inventory. Results: Based on the results, the coefficient of regression analysis of NEO personality factors (big five and happiness was 0.45, which shows a linear relationship between personality factors of NEO and happiness in patients with thalassemia. Thus, there is a statistically significant relationship among personality traits (neuroticism, extroversion, openness, agreeableness, conscientiousness and happiness. Conclusion: Among personality traits, extroversion, flexibility, agreeableness and conscientiousness had positive statistically meaningful relationship with happiness i.e. patients with lower scores in neuroticism, were happier.

  7. Frequency of short stature in - thalassemia major patients

    International Nuclear Information System (INIS)

    Aslam, M.S.; Roshan, E.; Shahid, M.

    2013-01-01

    Objective: To determine the frequency of short stature in children with - thalassemia major receiving multiple transfusions at Military Hospital Rawalpindi. Study Design: Descriptive cross sectional study. Place and Duration of Study: Study was conducted at Military Hospital from 1st January 2010 to 30th June 2010. Subjects and Methods: Total 100 multi-transfused cases of - thalassemia major were included in the study. The height of every child was measured in centimeters using the same free-standing standard stadiometer, and the same technique by a single pediatrician. Results: Out of 100 patients of - thalassemia major 57.0% (n=57) were male while 43% (n=43) were female. Mean age was 9.94 years (SD +- 2.93) with range of 6 to 14 years. Mean height was 115.77 cm (SD +- 13.79) with range of 72.00 to 148.00 cm. 57.0% (n=57) were found to be short statured while 43.0% (n=43) were with normal height. Mean age of short statured patients was 11.61 +- 2.34 years and mean age of patients with normal height was 7.73 +- 2.05 years. Conclusion: The frequency of short stature in our patients with - thalassemia major receiving multiple transfusions is high. There is need to monitor the height of thalassemic children regularly and to improve the quality of care being provided to them so as to improve their quality of life. (author)

  8. Study of glycolytic intermediates in hereditary elliptocytosis with thalassemia

    Directory of Open Access Journals (Sweden)

    Pavri Roshan

    1977-01-01

    Full Text Available Glycolytic intermediates like ATP, DPG and GSH have been studied in a family with. hereditary elliptocytosis and thalassemia. Results indicate a fall in ATP with a concomitant rise in DPG in the Patient. Findings are discussed in relation to other data.

  9. Irradiation for progressive paraparesis in β-thalassemia intermedia

    International Nuclear Information System (INIS)

    Wilson, J.J.; Hill, M.E.; Crookston, J.H.

    1980-01-01

    This article describes the case history of a patient suffering from β-thalassemia intermedia. The patient was treated with radiation to the thoraic spine (1500 rad in 5 days) and his condition improved. Subsequent tomography indicated the success of this type of irradiation without recourse to laminectomy. (T.I.)

  10. Background radiation accumulation and lower limit of detection in thermoluminescent beta-gamma dosimeters used by the centralized external dosimetry system

    International Nuclear Information System (INIS)

    Sonder, E.; Ahmed, A.B.

    1991-12-01

    A value for ''average background radiation'' of 0.75 mR/week has been determined from a total of 1680 thermoluminescent dosimeters (TLD's) exposed in 70 houses for periods up to one year. The distribution of results indicates a rather large variation among houses, with a few locations exhibiting backgrounds double the general average. Some discrepancies in the short-term background accumulation of TLD's have been explained as being due to light leakage through the dosimeter cases. In addition the lower limit of detection (L D ) for deep and shallow dose equivalents has been determined for these dosimeters. The L D for occupational exposure depends strongly on the time a dosimeter is exposed to background radiation in the field. The L D can vary from a low of 2.4 mrem for high energy gamma rays when the background accumulation period is less than a few weeks to values as high as 66 mrem for uranium beta particles when background has been allowed to accumulate for more than 21 weeks

  11. Recent trends in the gene therapy of β-thalassemia

    Directory of Open Access Journals (Sweden)

    Finotti A

    2015-02-01

    Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

  12. Carrier screening for thalassemia and hemoglobinopathies in Canada.

    Science.gov (United States)

    Langlois, Sylvie; Ford, Jason C; Chitayat, David

    2008-10-01

    To provide recommendations to physicians, midwives, genetic counsellors, and clinical laboratory scientists involved in pre-conceptional or prenatal care regarding carrier screening for thalassemia and hemoglobinopathies (e.g., sickle cell anemia and other qualitative hemoglobin disorders). To determine the populations to be screened and the appropriate tests to offer to minimize practice variations across Canada. The Medline database was searched for relevant articles published between 1986 and 2007 on carrier screening for thalassemia and hemoglobinopathies. Key textbooks were also reviewed. Recommendations were quantified using the Evaluation of Evidence guidelines developed by the Canadian Task Force on Preventive Health Care. The evidence collected from the Medline search was reviewed by the Prenatal Diagnosis Committee of the Canadian College of Medical Geneticists (CCMG) and the Genetics Committee of the Society of Obstetricians and Gynaecologists of Canada (SOGC). Screening of individuals at increased risk of being carriers for thalassemia and hemoglobinopathies can identify couples with a 25% risk of having a pregnancy with a significant genetic disorder for which prenatal diagnosis is possible. Ideally, screening should be done pre-conceptionally. However, for a significant proportion of patients, the screening will occur during the pregnancy, and the time constraint for obtaining screening results may result in psychological distress. This guideline does not include a cost analysis. 1. Carrier screening for thalassemia and hemoglobinopathies should be offered to a woman if she and/or her partner are identified as belonging to an ethnic population whose members are at higher risk of being carriers. Ideally, this screening should be done pre-conceptionally or as early as possible in the pregnancy. (II-2A) 2. Screening should consist of a complete blood count, as well as hemoglobin electrophoresis or hemoglobin high performance liquid chromatography. This

  13. Serum ferritin levels, socio-demographic factors and desferrioxamine therapy in multi-transfused thalassemia major patients at a government tertiary care hospital of Karachi, Pakistan

    Directory of Open Access Journals (Sweden)

    Rehman Anis

    2011-08-01

    Full Text Available Abstract Background Beta thalassemia is the most frequent genetic disorder of haemoglobin synthesis in Pakistan. Recurrent transfusions lead to iron-overload manifested by increased serum Ferritin levels, for which chelation therapy is required. Findings The study was conducted in the Pediatric Emergency unit of Civil Hospital Karachi after ethical approval by the Institutional Review Board of Dow University of Health Sciences. Seventy nine cases of beta thalassemia major were included after a written consent. The care takers were interviewed for the socio-demographic variables and the use of Desferrioxamine therapy, after which a blood sample was drawn to assess the serum Ferritin level. SPSS 15.0 was employed for data entry and analysis. Of the seventy-nine patients included in the study, 46 (58.2% were males while 33 (41.8% were females. The mean age was 10.8 (± 4.5 years with the dominant age group (46.2% being 10 to 14 years. In 62 (78.8% cases, the care taker education was below the tenth grade. The mean serum Ferritin level in our study were 4236.5 ng/ml and showed a directly proportional relationship with age. Desferrioxamine was used by patients in 46 (58.2% cases with monthly house hold income significant factor to the use of therapy. Conclusions The mean serum Ferritin levels are approximately ten times higher than the normal recommended levels for normal individuals, with two-fifths of the patients not receiving iron chelation therapy at all. Use of iron chelation therapy and titrating the dose according to the need can significantly lower the iron load reducing the risk of iron-overload related complications leading to a better quality of life and improving survival in Pakistani beta thalassemia major patients. Conflicts of Interest: None

  14. Diagnosis of Compound Heterozygous Hb Tak/β-Thalassemia and HbD-Punjab/β-Thalassemia by HbA2 Levels on Capillary Electrophoresis.

    Science.gov (United States)

    Panyasai, Sitthichai; Sakkhachornphop, Supachai; Pornprasert, Sakorn

    2018-01-01

    A misdiagnosis of β-thalassemia carrier in samples with Hb Tak and HbD-Punjab, the β-variants, can be a cause of inappropriate genetic counseling thus having a new case of β-thalassemia major. A capillary electrophoresis (CE) is very efficient in separating and quantifying HbA 2 . In this study, HbA 2 levels of samples which were doubted for compound heterozygous Hb Tak/β-thalassemia or heterozygous HbD-Punjab/β-thalassemia were measured and compared between CE and high performance liquid chromatography (HPLC). The molecular confirmation for Hb Tak, HbD-Punjab and β-thalassemia codons 17 (A > T), 41/42 (-TCTT), 71/72 (+A) and IVSI-nt1 (G > T) mutations and 3.4 kb deletion were also performed. Based on DNA analysis, 3 cases were diagnosed as compound heterozygous Hb Tak/β-thalassemia and one for HbD-Punjab/β-thalassemia. The elevated HbA 2 levels were found in all 4 samples with rages of 4.6-7.3% on CE while those were not found on HPLC. Thus, the elevated HbA 2 measured by CE can be used as a screening parameter for differentiating the homozygote of Hb Tak and HbD-Punjab from the compound heterozygote of these hemoglobinopathies and β-thalassemia.

  15. The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype

    Directory of Open Access Journals (Sweden)

    Türker Bilgen

    2011-09-01

    Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.

  16. Speculative Betas

    OpenAIRE

    Harrison Hong; David Sraer

    2012-01-01

    We provide a model for why high beta assets are more prone to speculative overpricing than low beta ones. When investors disagree about the common factor of cash-flows, high beta assets are more sensitive to this macro-disagreement and experience a greater divergence-of-opinion about their payoffs. Short-sales constraints for some investors such as retail mutual funds result in high beta assets being over-priced. When aggregate disagreement is low, expected return increases with beta due to r...

  17. Two cloned β thalassemia genes are associated with amber mutations at codon 39

    Science.gov (United States)

    Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

    1981-01-01

    Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

  18. Dimensions of social capital of families with thalassemia in an indigenous population in Tamil Nadu, India - a qualitative study.

    Science.gov (United States)

    Palanisamy, Bharathi; Kosalram, Kalpana; Gopichandran, Vijayaprasad

    2017-06-24

    Studies have shown that social capital is positively associated with health, and the association is context-based. Indigenous populations with poor access to health care largely depend on social capital for their health care needs. This study was conducted to explore the dimensions and types of social capital and its utilization by families with thalassemia for their health and well-being in an indigenous population in Tamil Nadu, India. The participants in the study were parents who had children with thalassemia, belonged to an indigenous community in Tamil Nadu, were poor and marginalized, and had poor access to health care. Different dimensions and types of social capital were examined with the help of qualitative in-depth interviews using a phenomenological approach. A total of 8 in-depth interviews were conducted and transcribed. Thematic analysis of the data was performed. The social capital identified through the in-depth interviews consisted of various levels of family support, financial support from relatives and neighbors, the provision of information from formal and informal networks, and trust in the physician. Indigenous communities are close-knit due to their geographical remoteness and limited accessibility. Family ties were a form of social capital that encouraged bonding, and provided support and care to the children affected by thalassemia. The bonding also helped to meet the regular requirement of blood donation for the children. Relatives and neighbors were an asset that served as a bridge for the families affected, helping them in times of immediate and urgent financial need, making it easier to sustain long-term treatment and providing emotional support. There were informal networks that bridged parents belonging to indigenous and non-indigenous communities, with the latter providing the former with information to help them choose better health care at an affordable cost. The other formal links were the ties between the parents and

  19. Screening for thalassemia and other hemoglobinopathies in a tertiary care hospital of West Bengal: implications for population screening.

    Science.gov (United States)

    Jain, Bhawna Bhutoria; Roy, Rabindra Nath; Ghosh, Sulekha; Ghosh, Tapan; Banerjee, Uma; Bhattacharya, Subodh Kumar

    2012-01-01

    Hemoglobinopathies are common genetic disorders of hemoglobin, which can be prevented by population screening and offering genetic counseling. In absence of population-based screening for hemoglobinopathies, the hospital-based diagnosis register provide idea about the extent of problem in the community. The present study was undertaken to find out the burden of hemoglobinopathies and spectrum of this disorders among the population who were screened in the hospital-based screening program. A record-basedanalysis of subjects who underwent screening for hemoglobinopathies in Burdwan Medical College and Hospital over a period of 3 years and 4 months revealed that overall 29.3% of subjects were positive for hemoglobinopathies. Beta thalassemia heterozygous was the most commonhemoglobinopathy in this region closely followed by hemoglobin E heterozygous. In view of high prevalence of hemoglobinopathies in this region, a routine premarital screening program is needed for identification and prevention of high-risk marriages.

  20. Effect of Combined versus Monotherapy with Deferoxamine and Deferiprone in Iron Overloaded Thalassemia Patients: a Randomized Clinical Trial

    Directory of Open Access Journals (Sweden)

    Sasan Hejazi

    2016-06-01

    Full Text Available Background: Patients with transfusional iron overload have depended on iron chelation therapy and improving chelation regimens have been of the highest priority. The aim of this study was to compare effect of combined versus monotherapy with Deferoxamine (DFO and Deferiprone (DFP in iron overloaded beta thalassemia (BT major patients Materials and Methods We studied 36 BT major patients (mean age 7.6±4.6; range 3–16 years attending the Ormieh Motahari hospital for regular transfusional support. Patients were randomly allocated to receive one of the following two treatments: DFO in combination with DFP (n=12, DFO alone (n=12 and DFP alone (n=12. Serum ferritin level, liver enzymes, blood urea nitrogen, and creatinine and side effects were monitored over a 12 months period. Results: After one year, serum ferritin decreased more significantly in patients on DFO+DFP therapy compared to patients who only received DFO or DFP alone (P

  1. Effect ALPHA Globalin Gene Deletion and GAMMA Globin Gene -158 (C/T) Polymorphism in BETA- Thalassaemic Patients

    International Nuclear Information System (INIS)

    EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.

    2008-01-01

    The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.

  2. β-Thalassemia and Polycythemia vera: targeting chronic stress erythropoiesis.

    Science.gov (United States)

    Crielaard, Bart J; Rivella, Stefano

    2014-06-01

    β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective erythrocytes and anemia, while patients with Polycythemia vera present with high hemoglobin levels because of excessive red blood cell synthesis - both pathologies may characterized by lasting high erythropoietic activity, i.e. chronic stress erythropoiesis. In both diseases, therapeutic strategies targeting chronic stress erythropoiesis may improve the address phenotype and prevent secondary pathology, such as iron overload. The current review will address the basic concepts of these strategies to reduce chronic stress erythropoiesis, which may have significant clinical implications in the near future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Thermogravimetric analysis coupled with chemometrics as a powerful predictive tool for ß-thalassemia screening.

    Science.gov (United States)

    Risoluti, Roberta; Materazzi, Stefano; Sorrentino, Francesco; Maffei, Laura; Caprari, Patrizia

    2016-10-01

    β-Thalassemia is a hemoglobin genetic disorder characterized by the absence or reduced β-globin chain synthesis, one of the constituents of the adult hemoglobin tetramer. In this study the possibility of using thermogravimetric analysis (TGA) followed by chemometrics as a new approach for β-thalassemia detection is proposed. Blood samples from patients with β-thalassemia were analyzed by the TG7 thermobalance and the resulting curves were compared to those typical of healthy individuals. Principal Component Analysis (PCA) was used to evaluate the correlation between the hematological parameters and the thermogravimetric results. The thermogravimetric profiles of blood samples from β-thalassemia patients were clearly distinct from those of healthy individuals as result of the different quantities of water content and corpuscular fraction. The hematological overview showed significant decreases in the values of red blood cell indices and an increase in red cell distribution width value in thalassemia subjects when compared with those of healthy subjects. The implementation of a predictive model based on Partial Least Square Discriminant Analysis (PLS-DA) for β-thalassemia diagnosis, was performed and validated. This model permitted the discrimination of anemic patients and healthy individuals and was able to detect thalassemia in clinically heterogeneous patients as in the presence of δβ-thalassemia and β-thalassemia combined with Hb Lepore. TGA and Chemometrics are capable of predicting ß-thalassemia syndromes using only a few microliters of blood without any pretreatment and with an hour of analysis time. A fast, rapid and cost-effective diagnostic tool for the β-thalassemia screening is proposed. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Burden of thalassemia in India: The road map for control

    Directory of Open Access Journals (Sweden)

    Roshan Colah

    2017-12-01

    Full Text Available The thalassemias and structural haemoglobin variants are the commonest monogenic disorders globally. India has a huge burden with an estimated 100,000 patients with a β thalassemia syndrome and around 150,000 patients with sickle cell disease, but few among them are optimally managed, and allogeneic stem cell transplant is unaffordable for the majority of families. A feasible option for control is to promote education and awareness programmes, intensify screening in all the states with micromapping to assess the true burden, and develop adequate facilities for genetic counselling and prenatal diagnosis in public sector Institutions. Government and non-government organizations have been working towards this goal for the last 3 to 4 decades but community control in a vast and diverse country is challenging and a national programme reaching all rural regions where almost 70% of the population resides is yet to begin. Strategies to control thalassemia need to include 1 Educating health professionals, school and college students, pregnant women and the population at large 2 Establishing prenatal diagnosis facilities in different regions of the country 3 Setting up a greater number of Day Care Centres for managing existing thalassemia patients 4 Developing cost-effective facilities for stem cell transplantation across the country. This review explores strategies by which Central and State Governments, NGOs, Parents-Patients Societies and Corporate Houses can work together to successfully reduce the burden of hemoglobinopathies in India. Guidelines for implementation of such a national programme have recently been prepared by the National Health Mission, Ministry of Health and Family Welfare with the help of several experts in the country.

  5. Adrenal extramedullary hematopoiesis associated with β-thalassemia major

    OpenAIRE

    Bijan Keikhaei; Ahmad Soltani Shirazi; Mahboob Mohammad Pour

    2012-01-01

    The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hema - topoiesis (EMH). EMH is a rare complication in thalassemia major (TM) and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdomin...

  6. Prevalence of Periodontal Disease in Children with Leukemia and Thalassemia

    OpenAIRE

    Marhamah; Maulidita, Hardianti

    2014-01-01

    Background. Various periodontal disease can occur in children and adolescents. Some can take place quickly and periodontal tissue damage. Several previous studies indicate that systemic diseases associated with periodontal disease in children. Objectives. This study aims to determine the prevalence of periodontal disease in children with leukemia and thalassemia. Methods. The design study is a cross-sectional approach. Periodontal pocket depth measurements performed using the WHO standa...

  7. Malabsorption of vitamin B12 in homozygous β-thalassemia

    International Nuclear Information System (INIS)

    Vlachos, P.; Liakakos, D.

    1976-01-01

    Schilling tests were performed in ten children aged 5-12 years suffering from homozygous β-thalassemia. 57 Co labelled vitamin B 12 values excreted in the urine have been found much lower than normal and remained low when the same procedure was repeated with the addition of intrinsic factor. The possible factors responsible for this malabsorption of vitamin B 12 seemed to be liver damage and folic acid deficiency. (orig.) [de

  8. Non-transfusion dependent thalassemia: translating evidence to guidelines

    Directory of Open Access Journals (Sweden)

    Afif R. Harb

    2014-12-01

    Full Text Available The thalassemias are a group of inherited disorders of hemoglobin synthesis characterized by various degrees of defective production of the α- or β-globin chains of adult hemoglobin A. Non-transfusion- dependent thalassemia (NTDT includes a group of thalassemia patients who do not require regular RBC transfusions for survival, but may require occasional transfusions due to infection or pregnancy or may require more regular transfusions later in life due to splenomegaly or other complications. Due to the rising phenomenon of global migration, this previously well-localized entity is currently spreading more and more worldwide reaching Northern America and Northern Europe. The clinical picture of NTDT is governed by the severity of the ineffective erythropoiesis and the chronic hemolytic anemia, which, in turn, lead to iron overload, hypercoagulability, and an array of clinical complications involving almost every organ system. Patients with NTDT suffer from complications that are distinct from those encountered in patients with transfusion- dependent thalassemia (TDT in addition to the complications shared by both TDT and NTDT. As a consequence, patients with NTDT deserve a care specifically tailored to their needs. In the care of patients with NTDT, aiming at a standardized yet personalized care is not an easy task especially that NTDT patients lie on a heterogeneous spectrum with a wide variability in their clinical presentation and response to therapy. Therefore, guidelines emerge as a necessity to answer the specific needs of NTDT patients and the clinicians caring for them. In this article, we summarize the complications most commonly associated with NTDT and the recommendations of the guidelines for the management of patients with NTDT, based on the best available evidence.

  9. X-ray scattering signatures of β-thalassemia

    International Nuclear Information System (INIS)

    Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.

    2009-01-01

    X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1 , respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1 , in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

  10. Glutathione Redox System in β-Thalassemia/Hb E Patients

    Directory of Open Access Journals (Sweden)

    Ruchaneekorn W. Kalpravidh

    2013-01-01

    Full Text Available β-thalassemia/Hb E is known to cause oxidative stress induced by iron overload. The glutathione system is the major endogenous antioxidant that protects animal cells from oxidative damage. This study aimed to determine the effect of disease state and splenectomy on redox status expressed by whole blood glutathione (GSH/glutathione disulfide (GSSG and also to evaluate glutathione-related responses to oxidation in β-thalassemia/Hb E patients. Twenty-seven normal subjects and 25 β-thalassemia/Hb E patients were recruited and blood was collected. The GSH/GSSG ratio, activities of glutathione-related enzymes, hematological parameters, and serum ferritin levels were determined in individuals. Patients had high iron-induced oxidative stress, shown as significantly increased serum ferritin, a decreased GSH/GSSG ratio, and increased activities of glutathione-related enzymes. Splenectomy increased serum ferritin levels and decreased GSH levels concomitant with unchanged glutathione-related enzyme activities. The redox ratio had a positive correlation with hemoglobin levels and negative correlation with levels of serum ferritin. The glutathione system may be the body’s first-line defense used against oxidative stress and to maintain redox homeostasis in thalassemic patients based on the significant correlations between the GSH/GSSH ratio and degree of anemia or body iron stores.

  11. X-ray scattering signatures of β-thalassemia

    Science.gov (United States)

    Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.

    2009-08-01

    X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

  12. Evaluation of cardiac functions in patients with thalassemia major

    International Nuclear Information System (INIS)

    Kucuk, N.O.; Aras, G.; Sipahi, T.; Ibis, E.; Akar, N.; Soylu, A.; Erbay, G.

    1999-01-01

    It is known that a blood transfusion is necessary for survival in patients with thalassemia, but it may cause myocardial dysfunction due to myocardial siderosis as in other organs. The aim of this study was to evaluate myocardial perfusion by means of stress thallium scanning (MPS) and left ventricular functions by rest radionuclide ventriculography (RNV). Twenty-one patients at ages 9-16 (mean 12.1±3.2) who have been diagnosed with thalassemia for 4-15 years mean 12.7±4.8) were included in the study. They had blood transfusion 78-318 times (mean 162.1±71). MPS and RNV was performed within two days after the any transfusion. MPS showed ischemia in 3 patients and normal perfusion in 18 patients. RNV revealed normal systolic parameters (wall motion, EF, PER, TPE) but diminished diastolic parameters (TPF, PFR) compared with normal values (p<0.05). We conclude that ischemia or fixed defects may be seen in stress MPS as results of cardiac involvement in patients with thalassemia. But, RNV is an important and preferable test for the early detection of subclinic cardiomyopathy. RNV may therefore show diastolic abnormalities before the systolic abnormalities show up. (author)

  13. Body Composition in Adult Patients with Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Marianna Vlychou

    2016-01-01

    Full Text Available Objective. To assess body composition in adult male and female patients with thalassemia major by dual-energy X-ray absorptiometry (DXA and to compare the findings with a group of healthy age-matched controls. Methods. Our study group included sixty-two patients (27 males, mean age 36 years, and 35 females, mean age 36.4 years and fifteen age-matched healthy controls. All patients had an established diagnosis of thalassemia major and followed a regular blood transfusion scheme since childhood and chelation treatment. Fat, lean, and bone mineral density (BMD were assessed with dual-energy X-ray absorptiometry. Ferritin levels and body mass index of all patients and controls were also recorded. Student t-test and Wilcoxon test were performed and statistical significance was set at p<0.05. Results. BMD and whole body lean mass are lower in both male and female adult patients compared with controls (p<0.01 in both groups, whereas whole body fat mass was found to have no statistically significant difference compared to controls. Regional trunk fat around the abdomen was found to be lower in male patients compared to controls (p=0.02. Conclusion. Severe bone loss and diminished lean mass are expected in adult male and female patients with thalassemia major. Fat changes seem to affect mainly male patients.

  14. Evaluation of cardiac functions in patients with thalassemia major

    Energy Technology Data Exchange (ETDEWEB)

    Kucuk, N.O.; Aras, G.; Sipahi, T.; Ibis, E.; Akar, N.; Soylu, A.; Erbay, G. [Ankara Univ. (Turkey). Medical School

    1999-06-01

    It is known that a blood transfusion is necessary for survival in patients with thalassemia, but it may cause myocardial dysfunction due to myocardial siderosis as in other organs. The aim of this study was to evaluate myocardial perfusion by means of stress thallium scanning (MPS) and left ventricular functions by rest radionuclide ventriculography (RNV). Twenty-one patients at ages 9-16 (mean 12.1{+-}3.2) who have been diagnosed with thalassemia for 4-15 years mean 12.7{+-}4.8) were included in the study. They had blood transfusion 78-318 times (mean 162.1{+-}71). MPS and RNV was performed within two days after the any transfusion. MPS showed ischemia in 3 patients and normal perfusion in 18 patients. RNV revealed normal systolic parameters (wall motion, EF, PER, TPE) but diminished diastolic parameters (TPF, PFR) compared with normal values (p<0.05). We conclude that ischemia or fixed defects may be seen in stress MPS as results of cardiac involvement in patients with thalassemia. But, RNV is an important and preferable test for the early detection of subclinic cardiomyopathy. RNV may therefore show diastolic abnormalities before the systolic abnormalities show up. (author)

  15. Free water surface constructed wetlands limit the dissemination of extended-spectrum beta-lactamase producing Escherichia coli in the natural environment.

    Science.gov (United States)

    Vivant, Anne-Laure; Boutin, Catherine; Prost-Boucle, Stéphanie; Papias, Sandrine; Hartmann, Alain; Depret, Géraldine; Ziebal, Christine; Le Roux, Sophie; Pourcher, Anne-Marie

    2016-11-01

    The fates of Escherichia coli and extended-spectrum beta-lactamase-producing E. coli (ESBL E. coli) were studied over a period of one year in a free water surface constructed wetland (FWS CW) with a succession of open water zones and vegetation ponds (Typha or Phragmites), that received the effluent from a wastewater treatment plant. ESBL E. coli were detected and isolated from all sampling areas of the FWS CW throughout the study period. They represented 1‰ of the total E. coli population regardless of the origin of samples. Two main factors affected the log removal of E. coli and of ESBL E. coli: the season and the presence of vegetation. Between the inlet and the outlet of the FWS CW, the log removal of E. coli ranged from 1.5 in the warmer season (summer and fall) to 3.0 in the colder season (winter and spring). The concentrations of E. coli decreased significantly in the vegetated areas during the colder season, but increased in the warmer season, suggesting an effect of the plant growth stage on the survival of E. coli. Among the 369 ESBL E. coli isolates collected during our study, 84% harbored the CTX-M-ESBL type and 55.3% carried bla genes on plasmid DNA. Furthermore, 93% of the ESBL E. coli isolates were multidrug resistant but the proportion of resistant strains did not change significantly along the FWS CW. ESBL E. coli were characterized by MLST analysis using the 7 genes based Achtman Scheme. ESBL E. coli isolated from water, sediments, roots and feces of myocastors collected in the FWS CW and in the recipient river were genotypically related, suggesting persistence and circulation of the ESBL producing E. coli throughout the FWS CW and in the receiving river. Overall, these observations show that FWS CW could be an efficient treatment for ESBL E. coli disinfection of wastewater and could limit their dissemination in the aquatic environment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Tables of double beta decay data

    Energy Technology Data Exchange (ETDEWEB)

    Tretyak, V.I. [AN Ukrainskoj SSR, Kiev (Ukraine)]|[Strasbourg-1 Univ., 67 (France). Centre de Recherches Nucleaires; Zdesenko, Y.G. [AN Ukrainskoj SSR, Kiev (Ukraine)

    1995-12-31

    A compilation of experimental data on double beta decay is presented. The tables contain the most stringent known experimental limits or positive results of 2{beta} transitions of 69 natural nuclides to ground and excited states of daughter nuclei for different channels (2{beta}{sup -}; 2{beta}{sup +}; {epsilon}{beta}{sup +}; 2{epsilon}) and modes (0{nu}; 2{nu}; 0{nu}M) of decay. (authors). 189 refs., 9 figs., 3 tabs.

  17. A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).

    NARCIS (Netherlands)

    Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.

    2010-01-01

    Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene

  18. Consequences and costs of noncompliance with iron chelation therapy in patients with transfusion-dependent thalassemia: a literature review.

    Science.gov (United States)

    Delea, Thomas E; Edelsberg, John; Sofrygin, Oleg; Thomas, Simu K; Baladi, Jean-Francois; Phatak, Pradyumna D; Coates, Thomas D

    2007-10-01

    Patients with thalassemia major require iron chelation therapy (ICT) to prevent complications from transfusional iron overload. Deferoxamine is effective, but requires administration as a slow continuous subcutaneous or intravenous infusion five to seven times per week. Deferiprone is a three-times-daily oral iron chelator, but has limited availability in the United States. Deferasirox is a once-daily oral iron chelator that was approved in the United States in 2005 for patients older than 2 years of age with transfusional iron overload. Published evidence on rates of compliance with ICT and the association between compliance, and the incidence and costs of complications of iron overload, in patients with thalassemia major was reviewed. A total of 18 studies were identified reporting data on compliance with ICT, including 7 that examined deferoxamine only, 6 that examined deferiprone only, and 5 that compared deferoxamine and deferiprone; no studies reporting compliance with deferasirox were identified. In studies of deferoxamine only, estimated mean compliance ranged from 59 to 78 percent. Studies of deferiprone generally reported better compliance, ranging from 79 to 98 percent. Results of comparative studies of deferoxamine and deferiprone suggest that compliance may be better with oral therapy. Numerous studies demonstrate that that poor compliance with ICT results in increased risk of cardiac disease and endocrinopathies, as well as lower survival. Although data on the costs of noncompliance are limited, a recent model-based study estimated the lifetime costs of inadequate compliance with deferoxamine to be $33,142. Inadequate compliance with ICT in thalassemia major is common and results in substantial morbidity and mortality, as well as increased costs.

  19. {beta} - amyloid imaging probes

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Jae Min [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2007-04-15

    Imaging distribution of {beta} - amyloid plaques in Alzheimer's disease is very important for early and accurate diagnosis. Early trial of the {beta} -amyloid plaques includes using radiolabeled peptides which can be only applied for peripheral {beta} - amyloid plaques due to limited penetration through the blood brain barrier (BBB). Congo red or Chrysamine G derivatives were labeled with Tc-99m for imaging {beta} - amyloid plaques of Alzheimer patient's brain without success due to problem with BBB penetration. Thioflavin T derivatives gave breakthrough for {beta} - amyloid imaging in vivo, and a benzothiazole derivative [C-11]6-OH-BTA-1 brought a great success. Many other benzothiazole, benzoxazole, benzofuran, imidazopyridine, and styrylbenzene derivatives have been labeled with F-18 and I-123 to improve the imaging quality. However, [C-11]6-OH-BTA-1 still remains as the best. However, short half-life of C-11 is a limitation of wide distribution of this agent. So, it is still required to develop an Tc-99m, F-18 or I-123 labeled agent for {beta} - amyloid imaging agent.

  20. CLINICAL APPLICATION OF RECOMBINANT ERYTHROPOIETIN IN BETA-THALASSAEMIA INTERMEDIA.

    Science.gov (United States)

    Asadov, Ch; Alimirzoyeva, Z; Hasanova, M; Mammadova, T; Shirinova, A

    2016-06-01

    Research objective is to study the efficacy of recombinant erythropoietin (epoetin alfa) as alternative method of treatment beta-thalassemia intermedia. Study involved 58 patients with beta-thalassemia intermedia (23 women and 35 men). In all observed patients was defined levels of hemoglobin (Hb), red blood cells (RBC), erythrocyte indexes (MCV, MCH, MCHC), hemoglobin fractions (HbA, HbA2, HbF), serum ferritin, serum erythropoietin before and after administrated rEPO. All patients received rEPO during 6 month at the dose - 10000 IU subcutaneously. The majority of patients - 39 (67%) had a good response to rEPO (increase in hemoglobin level more than 20 g/l); 16 patients (28%) had a mean response (increase in Hb 10 - 20 g/l); in 3 (5%) patients occurred poor response to rEPO therapy (increase in Hb intermedia patients there was a statistically significant change in the number of RBC, levels of HbF and sEPO. The evaluation of interdependence between the indices of the baseline sEPO and increased Hb values in patients after rEPO treatment revealed the presence of the reverse direct relationship (r=-0.67). Based on the results, it can be concluded that the use of rEPO in complex therapy of beta-thalassemia intermedia leads to increased levels of Hb and consequently reducing the need for blood transfusions, and accordingly expected to prevent severe complications of blood transfusion (alloimmunization, hypersplenism, iron overload, contamination transmissible infections) facilitating normal growth and development, and a better quality of life.

  1. Treating thalassemia major-related iron overload: the role of deferiprone

    Directory of Open Access Journals (Sweden)

    Berdoukas V

    2012-10-01

    use of other combinations in chelation treatment, some of which have been used only in a very limited fashion to date. All these advances in management require absolute cooperation and understanding of parents, children, and, subsequently, the patients themselves. Only with such cooperation can normal long-term survival be achieved, as adherence to treatment is now likely the primary barrier to longevity.Keywords: thalassemia, iron overload, iron chelation therapy, magnetic resonance imaging, deferoxamine, deferiprone, deferasirox

  2. Study on molecular epidemiology of the alpha-thalassemias in Liuzhou City, Guangxi Autonomous Region, China.

    Science.gov (United States)

    Cai, Ren; Liu, Jingzhong; Wang, Lirong; Liang, Xin; Xiao, Bai; Su, Liu; Zhou, Yan; Pan, Lizhen

    2004-01-01

    Guangxi is one of the provinces of Southern China with the highest incidence of alpha-thalassemia (thal). Liuzhou is the second biggest city in Guangxi. To find out the incidence of the various alpha-thal genotypes, and their distribution in the Liuzhou area, an F820 Blood Cell Analysis System was used to measure the parameters of red blood cells. A SPIFE Rapid Auto-Electrophoresis System was used to analyze the normal and abnormal hemoglobins (Hbs). Multiplex polymerase chain reaction (mPCR) was used to detect the alpha-globin genotypes. Thirty-two (2.05%) out of 7805 young couples undergoing pre-marriage counseling, were diagnosed as having an Hb H (beta4) disease. The study of 1228 cord blood samples revealed 138 newborn children carrying an alpha-thal determinant with nine different genotypes, thus making the total incidence of alpha-thal 11.24%. Among 185 cases of Hb H, 119 (64.1%) were confirmed as being deletional, and 66 cases (35.7%) nondeletional types. The severity of the Hb H diseases could be classified in the following order: alphaCSalpha/--SEA (alphaConstant (Spring)alpha/--Southeast Asia); alpha(-4.2)/--SEA; alpha(-3.7)/--SEA. Ten cases of alpha-thal determinants were found in combination with beta-thal. The mPCR technique can detect all kinds of combinations of the three common large deletions (--SEA, alpha(-4.2) and alpha(-3.7)) accurately and conveniently.

  3. Beta spectrometry

    International Nuclear Information System (INIS)

    Dryak, P.; Zderadicka, J.; Plch, J.; Kokta, L.; Novotna, P.

    1977-01-01

    For the purpose of beta spectrometry, a semiconductor spectrometer with one Si(Li) detector cooled with liquid nitrogen was designed. Geometrical detection efficiency is about 10% 4 sr. The achieved resolution for 624 keV conversion electrons of sup(137m)Ba is 2.6 keV (FWHM). A program was written in the FORTRAN language for the correction of the deformation of the measured spectra by backscattering in the analysis of continuous beta spectra. The method permits the determination of the maximum energy of the beta spectrum with an accuracy of +-5 keV. (author)

  4. Failure to replicate the internal structure of Greek-specific thalassemia quality of life instrument in adult thalassemia patients in Sabah.

    Science.gov (United States)

    Keowmani, Thamron; Lee, Lily Wong Lee

    2016-01-01

    To study the validity and reliability of the Malay version of the Specific Thalassemia Quality of Life Instrument (STQOLI) in Sabah's adult thalassemia patients. This cross-sectional study was done at Thalassemia Treatment Centre, Queen Elizabeth Hospital in Sabah, Malaysia. Eighty-two adult thalassemia patients who fulfilled the inclusion and exclusion criteria were conveniently selected for participation in the study. The English version of STQOLI was translated into Malay by using forward and back translations. The content of the questionnaire was validated by the chief hematologist of the hospital. The construct validity of the 40-item questionnaire was assessed by principal component analysis with varimax rotation and the scale reliability was assessed by Cronbach's alpha. The study failed to replicate the internal structure of the Greek STQOLI. Instead, 12 factors have been identified from the exploratory factor analysis, which accounted for 72.2% of the variance. However, only eight factors were interpretable. The factors were iron chelation pump impact, transfusion impact, time spent on treatment and its impact on work and social life, sex life, side effects of treatment, cardiovascular problems, psychology, and iron chelation pill impact. The overall scale reliability was 0.913. This study was unable to replicate the internal structure of the Greek STQOLI in Sabah's adult thalassemia patients. Instead, a new structure has emerged that can be used as a guide to develop a questionnaire specific for adult thalassemia patients in Sabah. Future research should focus on the eight factors identified from this study.

  5. Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach

    Directory of Open Access Journals (Sweden)

    Shah PS

    2017-05-01

    Full Text Available Parth S Shah,1 Nidhi D Shah,2 Hari Shankar P Ray,3 Nikunj B Khatri,3 Ketan K Vaghasia,3 Rutvik J Raval,4 Sandip C Shah,3 Mandava V Rao5 1Department of Medicine, Lahey Hospital and Medical Center, Boston, MA, 2Department of Pediatrics, Nassau University Medical Centre, New York, NY, USA; 3Supratech Micropath Laboratory and Research Institute, 4Department of Zoology, 5School of Sciences, Gujarat University, Ahmedabad, Gujarat, India Background: β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors.Purpose: The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management.Patients and methods: Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods.Results: Of these (75 referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%. The majority of case types were of β-thalassemia minor (49, 65.33%, followed by HbE traits (6, 8.0% and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33% types and then HbE homozygous (2, 2.66%, as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34% combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29% followed by deletion 619bp (9, 13.23% and c.79G>A (8, 11

  6. Beta Blockers

    Science.gov (United States)

    ... may not work as effectively for people of African heritage and older people, especially when taken without ... conditions/high-blood-pressure/in-depth/beta-blockers/ART-20044522 . Mayo Clinic Footer Legal Conditions and Terms ...

  7. Review of the beta situation

    International Nuclear Information System (INIS)

    Sheffield, J.

    1982-01-01

    This note lists some of the possible causes of beta limitation in tokamak and discusses what is known and what is involved in investigating them. The motivation for preparing this note is the observed degradation of confinement with increasing beta poloidal β/sub p/ and beam power P/sub b/ in ISX-B

  8. Thalassemia in Messina: a sociological approach to chronic disease

    Directory of Open Access Journals (Sweden)

    Silvia Carbone

    2014-04-01

    Full Text Available Changing the care along with improved treatment, have altered the life of thalassemia patients, one of the world’s most common genetic diseases (Thalassemia International Federation; http://www.thalassemia.org.cy. The new demography of the disease, with its widely variable phenotypes, has implications for its diagnosis, counseling, and management. Improved of the new treatment of this ancient disease is essential for optimizing survival. From June 2010 to January 2011, we interviewed 36 people with thalassemia from a primary care in Messina (Center of Genetics and Immunology. The aim of this study is to show the results of a survey conducted in this Center in Messina. This study shows the importance of influence of a multidisciplinary approach, medical, psychological and social, that addresses the changing treatment and epidemiology of thalassemia in order to ensure a better quality of life and survival. Understanding the influence of all three types of resources, medical, psychological and social, is critical for constructing ways to enhance health capability, chronic disease self-management, and health.  以更好的护理方式改善治疗,改变了地中海贫血(一种世界上最常见的遗传性疾病)患者的生活。地中海贫血国际联合会,http://www.thalassemia.org.cy。新的疾病人口统计学方法,凭借着不同的方式地中海贫血症的诊断,咨询和管理产生了影响。对于这种古老的疾病,改善的新疗法对病人生存能力至关重要。从2010年6月至2011年1月,我们在墨西拿的一家初级保健中心(遗传学及免疫学)采访了36位地中海贫血患者。本研究的目的是在墨西拿的这家保健中心得出调查结果。研究显示了针对地中海贫血症,运用多学科方法 —— 医疗,心理和社会以确保患者拥有更好的生存力和生活质量的重要影响力。理解这三种资源的影响力 —— 医疗,心理和社会

  9. Bone marrow transplantation for thalassemia: a global perspective

    Directory of Open Access Journals (Sweden)

    Mohamed Hamed Hussein

    2013-03-01

    Full Text Available Even though severe thalassemia is a preventable disease, over 100,000 new cases are born yearly, particularly in the Middle East and South-East Asia. Most of these children may not reach adulthood because long-term appropriate supportive care is either inaccessible or unaffordable. Bone marrow transplantation (BMT remains the only available definitive cure and success rates can be very high in appropriately selected patients, i.e. low-risk younger children with a matched family donor. In these circumstances BMT may be justified medically, ethically as well as financially, in fact, the cost of low-risk BMT is equivalent to that of a few years of non-curative supportive. This manuscript will briefly review the current status of bone marrow transplantation for thalassemia major with particular emphasis on a global prospective and present the experience of the Cure2Children Foundation supporting sustainable and scalable start up BMT programs in low-resource settings. The initial twelve consecutive patients managed in two start up BMT units in Pakistan (Children’s Hospital of the Pakistan Institute of Medical Sciences, Islamabad and India (South East Asia Institute for Thalassemia, Jaipur were included in this analysis. These initial six patients per each institution where purposely chosen as the focus of this report because they represent the steepest phase of the learning curve. The median age at transplant was 3.9 years, range 0.9 to 6.0, liver was no greater than 2 cm from costal margin, and all received matched related BMT. A structured on-site focused training program as well as ongoing intensive on-line cooperation was provided by the Cure2Children team of professionals. At a median follow-up of 7.5 months (range 3.5 to 33.5 months both thalassemia-free and overall survival are 92%, one patient died of encephalitis-meningitis of unknown cause. No rejections where observed. Neutrophil recovery occurred at a median of 15.5 days (range 13

  10. Thalassemia and hemoglobinopathies in Southeast Asian newborns: diagnostic assessment using capillary electrophoresis system.

    Science.gov (United States)

    Srivorakun, Hataichanok; Fucharoen, Goonnapa; Changtrakul, Yossombat; Komwilaisak, Patcharee; Fucharoen, Supan

    2011-04-01

    We have investigated the Capillarys 2 Hemoglobin testing system to assist in presumptive diagnosis of thalassemia and hemoglobinopathies commonly found in Southeast Asia. Study was conducted on 226 newborns. Hematological parameters were recorded and Hb profiles were examined on the Capillarys 2 Hemoglobin analyzer (SEBIA). DNA analyses were used to establish the final diagnoses. Among 226 newborns examined, 122 had thalassemias with 17 different genotypes. The capillary electrophoresis system could provide useful data for presumptive diagnoses of cases, especially those with Hb E and α-thalassemia. Hb E was found to be 2.6-6.2% in heterozygote whereas Hb Bart's were clearly observed in cases with compound heterozygous or homozygous α(+)-thalassemia and heterozygous α(0)-thalassemia. Hb H disease and other forms of α-thalassemia could be differentiated based on the presence of Hb Bart's and its percentage. The capillary electrophoresis system is applicable to newborn screening for common forms of thalassemia in Southeast Asia. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  11. Reactivation of fetal hemoglobin in thalassemia and sickle cell disease

    Directory of Open Access Journals (Sweden)

    Sandro Eridani

    2014-09-01

    Full Text Available Considerable attention has been recently devoted to mechanisms involved in the perinatal hemoglobin switch, as it was long ago established that the survival of fetal hemoglobin (HbF production in significant amount can reduce the severity of the clinical course in severe disorders like β-thalassemia and sickle cell disease (SCD. For instance, when β-thalassemia is associated with hereditary persistence of fetal hemoglobin (HPFH the disease takes a mild course, labeled as thalassemia intermedia. The same clinical amelioration occurs for the association between HPFH and SCD. As for the mechanism of this effect, some information has been obtained from the study of natural mutations at the human β-globin locus in patients with increased HbF, like the Corfu thalassemia mutations. Important evidence came from the discovery that drugs capable of improving the clinical picture of SCD, like decitabine ad hydroxycarbamide, are acting through the reactivation, to some extent, of HbF synthesis. The study of the mechanism of action of these compounds was followed by the identification of some genetic determinants, which promote this event. In particular, among a few genetic factors involved in this process, the most relevant appears the BCL11A gene, which is now credited to be able to silence γ-globin genes in the perinatal period by interaction with several erythroid-specific transcription factors and is actually considered as a barrier to HbF reactivation by known HbF inducing agents. Epigenetics is also a player in the process, mainly through DNA demethylation. This is certified by the recent demonstration that hypomethylating agents such as 5-azacytidine and decitabine, the first compounds used for HbF induction by pharmacology, act as irreversible inhibitors of demethyltransferase enzymes. Great interest has also been raised by the finding that several micro-RNAs, which act as negative regulators of gene expression, have been implicated in the

  12. Physical growth in children with transfusion-dependent thalassemia

    Directory of Open Access Journals (Sweden)

    Harish K Pemde

    2011-02-01

    Full Text Available Harish K Pemde, Jagdish Chandra, Divya Gupta, Varinder Singh, Rajni Sharma, AK DuttaDepartment of Pediatrics, Lady Hardinge Medical College, Kalawati Saran Children's Hospital, New Delhi, IndiaObjective: To describe physical growth and related factors in transfusion-dependent thalassemia patients.Methods: This is a cross-sectional analysis of the records of the patients registered at and being followed up by the Thalassemia Day Care Center (TDCC at Kalawati Saran Children's Hospital, New Delhi, India. Clinical and laboratory parameters were recorded on a spreadsheet for analysis. Clinical parameters included weight, height, sexual maturity ratings, and general and systemic physical examination. Laboratory parameters included pretransfusion hemoglobin (Hb, periodic serum ferritin, and tests for viral markers of human immunodeficiency virus (HIV and hepatitis B and C. Z-scores for weight, height, and body mass index (BMI were calculated using World Health Organization reference data. Statistical analysis was carried out using Microsoft Excel® and Stata® software.Results: Out of 214 patients registered at the TDCC since 2001, 154 were included in this study. The mean age of patients was 9.19 years (range 0.5–20 years. Pretransfusion Hb was well maintained (mean 9.21 g/dL; 95% confidence interval [CI]: 9.06–9.36, but the mean serum ferritin levels were approximately three times (3112 ng/mL the desired value despite the patients being on deferiprone (72% or deferasirox (25%. One-third (33.11% of the patients had short stature, 13% were thin, and 10.82% were very thin (BMI z-score <-3. No patient was overweight or obese. Linear regression coefficient showed that for every 1-year increase in age, the mean ferritin value increased by 186.21 pg/mL (95% CI: 143.31–228.27. Height z-scores had significant correlation with mean ferritin levels, whereas correlation with mean pretransfusion Hb was not significant statistically. Mean ferritin levels

  13. Quality of life assessment of children with thalassemia

    OpenAIRE

    Masyitah Sri Wahyuni; Muhammad Ali; Nelly Rosdiana; Bidasari Lubis

    2011-01-01

    Background Thalassemia is a chronic disease that is becoming a major health problem in the world, including the Mediterranean, as well as Malaysia, Thailand and Indonesia. This condition clearly affects the patient's quality of life, because of the condition itself and the effects of treatment. Assessment is needed to detennine actions to be taken to improve the quality of life in thalassemic children. Objective To assess the differences in quality of life of thalassemic children comp...

  14. Thalassemia in the United Arab Emirates: Why it can be prevented but not eradicated.

    Directory of Open Access Journals (Sweden)

    Sehjeong Kim

    Full Text Available Thalassemia is a genetic blood disorder that causes abnormal hemoglobin. Hemoglobin is a protein in red blood cells that carries oxygen and is made of two proteins from four α-globin genes and two β-globin genes. A defect in one or more of these genes causes thalassemia. The treatment of thalassemia mostly depends on life-long blood transfusions and removal of excessive iron from the blood stream. Such tremendous blood consumption puts pressure on the national blood stock in many countries. In particular, in the United Arab Emirates (UAE, various forms of thalassemia prevention have been used and hence, the substantial reduction of the thalassemia major population has been achieved. However, the thalassemia carrier population still remains high, which leads to the potential increase in the thalassemia major population through carrier-carrier marriages. In this work, we investigate the long-term impact and efficacy of thalassemia prevention measures via mathematical modeling at a population level. To our best knowledge, this type of assessment has not been done before and there is no mathematical model that has investigated such a problem for thalassemia or any blood disorders at a population level. By using UAE data, we perform numerical simulations of our model and conduct sensitivity analysis of parameter values to see which parameter values affect most the dynamics of our model. We discover that the prevention measures can contribute to reduce the prevalence of the disease only in the short term but not eradicate the disease in the long term.

  15. Low and fixed dose of hydroxyurea is effective and safe in patients with HbSβ(+) thalassemia with IVS1-5(G→C) mutation.

    Science.gov (United States)

    Dehury, Snehadhini; Purohit, Prasanta; Patel, Siris; Meher, Satyabrata; Kullu, Bipin Kishore; Sahoo, Lulup Kumar; Patel, Nayan Kumar; Mohapatra, Alok Kumar; Das, Kishalaya; Patel, Dilip Kumar

    2015-06-01

    Despite compelling evidence that hydroxyurea is safe and effective in sickle cell disease, it is prescribed sparingly due to several barriers like knowledge gaps in certain genotypes, apprehension about its safety and toxicity, and limited resources. We undertook this study to find out the efficacy and safety of HU in patients with HbSβ(+) -thalassemia with IVS1-5(G→C) mutation. We registered 318 patients with HbSβ(+) -thalassemia with IVS1-5(G→C) mutation. Of these, 203 were enrolled for hydroxyurea treatment at a low and fixed dose of 10 mg/kg/day. One hundred four patients (Group-I: 37 children and Group-II: 67 adults) with ≥2 years of hydroxyurea treatment were studied. The rate of vaso-occlusive crises, requirement of blood transfusion and rate of hospitalization reduced from 3 to 0.5, 1 to 0 and 1 to 0 in Group-I and 3 to 0, 1 to 0 and 0.5 to 0 in Group-II respectively after HU therapy (P hydroxyurea is suitable for treatment of patients with HbSβ(+) -thalassemia in resource poor setting. © 2014 Wiley Periodicals, Inc.

  16. Simultaneous determination of F-beta-alanine and beta-alanine in plasma and urine with dual-column reversed-phase high-performance liquid chromatography

    NARCIS (Netherlands)

    van Kuilenburg, A. B.; Stroomer, A. E.; Peters, G. J.; van Gennip, A. H.

    2001-01-01

    F-beta-Alanine and beta-alanine were detected in plasma and urine samples with fluorescence detection of orthophthaldialdehyde derivatives of F-beta-alanine and beta-alanine after separation with dual-column reversed-phase HPLC. The detection limits of F-beta-alanine and beta-alanine in the HPLC

  17. High-level transfer and long-term expression of the human beta-globin gene in a mouse transplant model.

    Science.gov (United States)

    Raftopoulos, H; Ward, M; Bank, A

    1998-06-30

    Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.

  18. Paraplegia due to extramedullary hematopoiesis in thalassemia treated successfully with radiation therapy.

    Science.gov (United States)

    Malik, Monica; Pillai, Lakshmi S; Gogia, Nidhi; Puri, Tarun; Mahapatra, M; Sharma, Daya Nand; Kumar, Rajat

    2007-03-01

    Spinal cord compression due to extramedullary hematopoiesis (EMH) is a rare complication of thalassemia and generally presents as paraparesis with sensory impairment. Complete paraplegia is extremely rare in EMH due to thalassemia although it is known to occur in polycythemia vera and sickle cell anemia. Treatment options mostly include surgery and/or radiotherapy. Whereas cases presenting with paraparesis have been treated with either surgery or radiotherapy with equal frequency and efficacy, almost all reported cases with paraplegia have been treated with surgery with or without radiation therapy. We hereby report a case of thalassemia intermedia with paraplegia treated successfully with radiotherapy.

  19. Associations between a+-thalassemia and Plasmodium falciparum malarial infection in northeastern Tanzania

    DEFF Research Database (Denmark)

    Enevold, Anders; Alifrangis, Michael; Sanchez, Juan J

    2007-01-01

    BACKGROUND: The 2 most common hemoglobinopathies, sickle cell trait and alpha (+)-thalassemia, confer partial resistance to fatal forms of malaria, but the molecular basis for this protection is still not understood. Examination of the relationship between these traits and malaria transmission...... the prevalence of the 2 traits and malariometric indices were investigated by logistic regression. Short tandem repeat (STR) microsatellite allele frequencies were used to assess population substructuring. RESULTS: The frequency of alpha (+)-thalassemia ranged from 10%-25% in high-altitude villages (>1200 m......) to 45%-55% in low-altitude villages (thalassemia decreased by approximately 12% per 100-m increase in altitude (P

  20. Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach

    Science.gov (United States)

    Shah, Parth S; Shah, Nidhi D; Ray, Hari Shankar P; Khatri, Nikunj B; Vaghasia, Ketan K; Raval, Rutvik J; Shah, Sandip C; Rao, Mandava V

    2017-01-01

    Background β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors. Purpose The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management. Patients and methods Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods. Results Of these (75) referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%). The majority of case types were of β-thalassemia minor (49, 65.33%), followed by HbE traits (6, 8.0%) and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33%) types and then HbE homozygous (2, 2.66%), as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34%) combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29%) followed by deletion 619bp (9, 13.23%) and c.79G>A (8, 11.76%) in our study group. Five cases (nos. 24, 27, 33, 58, and 71) exhibited coinheritance between β0/β+ (2), β0/β D (1), and c.124_127delTTCT/β+ or β0(2) affecting the Rajasthani and Gujarati populations in our study of the Western region of India. Conclusion We strongly recommend these Western populations for genetic screening before adopting reproductive technologies and interracial marital relations. PMID:28546763

  1. Alpha-thalassemia genetic testing: an important anemia diagnostic tool in patients of African heritage.

    Science.gov (United States)

    Dasanu, Constantin A

    2010-01-01

    Inherited alpha-thalassemia genotypes have been shown to have a rather high prevalence in some patient populations of African heritage. These genotypes lead to mild anemia with microcytic indices and a normal hemoglobin electrophoresis. In our outpatient department, we analyzed 54 consecutive patients of African descent with longstanding microcytic anemia, but no evidence of iron deficiency. We detected alpha-thalassemia gene deletions in 94 percent of these patients. Alpha-thalassemia genetic testing appears cost-effective in an otherwise unexplained, longstanding microcytic anemia in patients of African origin.

  2. Proxy indicators for identifying iron deficiency among anemic vegetarians in an area prevalent for thalassemia and hemoglobinopathies.

    Science.gov (United States)

    Wongprachum, Kasama; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Siridamrongvattana, Sirivara; Manpeun, Suwanna; Schlep, Frank P

    2012-01-01

    The study aimed to determine the proportion of iron deficiency (ID) anemia (IDA) among vegans in northeast Thailand and to explore whether mathematical formulas derived from red blood cell (RBC) indices are applicable for IDA screening in the study population. Blood samples from 234 individuals (age 6-45 years) living in a vegan community were taken. Complete blood cell count, serum ferritin, hemoglobin profiles and DNA analysis for α-thalassemia were determined. Anemia was defined using the WHO criteria adjusted for age and sex. Serum ferritin thalassemia and hemoglobinopathies was 56.4% (95% CI = 49.8-62.9%). Of the anemic participants, 45.4% had ID. Based on the receiver-operating characteristic curve analysis, 4 formulas were applicable for predicting ID among anemic individuals (highest sensitivity of 86.4%). The proposed formulas might be used as proxy indicators for the identification of ID among anemic children and adult vegans if more sophisticated laboratory determinations are not available due to limited financial resources. Copyright © 2012 S. Karger AG, Basel.

  3. A presacral mass in a patient with thalassemia intermedia: A case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Anbardar

    2016-01-01

    Full Text Available Extramedullary hematopoiesis (EMH is defined as the production of the myeloid and erythroid elements outside the bone marrow. It is usually a compensatory mechanism of the myeloid and erythroid production due to increased breakdown or diminished production of erythrocytes. Presacral EMH is an extremely rare condition, and there is a limited number of case reports published in the literature. A 39-year-old female patient as a known case of thalassemia intermedia presented with lower abdominal pain. A computerized tomography scan showed a large presacral mass, associated with bone destruction. The patient was admitted for exploratory laparotomy with suspicion to malignant lesions, but the final pathological diagnosis was EMH. It should be considered in differential diagnosis of mass-like lesions in the presacral area in patients with predisposing factors such as thalassemia, although there were malignant features such as bone destruction in imaging studies. Preoperative diagnostic tools such as fine needle aspiration and biopsy could help us to render the definite diagnosis and prevent unnecessary operation.

  4. Phenotype-genotype correlation in β-thalassemia

    Directory of Open Access Journals (Sweden)

    R. Galanello

    2011-12-01

    Full Text Available The clinical manifestations of β-thalassemia are extremely heterogeneous, ranging from severe transfusion-dependent anemia, to the mild non transfusion dependent thalassemia intermedia and to the asymptomatic carrier state. The remarkable phenotypic variability is primary due to variations in the different globin genes (primary gene modifiers. The main pathophysiological determinant of the severity of β-thalassemia syndromes is the extent of a/non-a globin chain imbalance. Therefore, any factor capable of reducing the globin chain imbalance may have an ameliorating effect on the clinical picture. The most common mechanisms responsible of the amelioration of the phenotype are mild or silent β thalassemia alleles, coinheritance of a thalassemia, or of genetic determinants associated with increased g globin chain production. Rarely, other complex mechanisms including dominantly inherited β thalassemia, somatic deletion of β globin gene and coinheritance of extra a globin genes with heterozygous β thalassemia have been reported. In addition to the variability of the phenotype resulting from primary gene modifiers, other genetic factors (secondary gene modifiers, mapping outside the β and a globin cluster, may influence the disease complications. Among these factors the ones best so far defined are those affecting bilirubin, iron and bone metabolism. However, the new methods of DNA analysis (i.e. GWAS and related methods are expect expand the number of genes or gene variants involved in the phenotypic variability and in the response to treatment of β thalassemia. 从严重的输液依赖型贫血症到轻度非输液依赖性中间型地中海贫血,再到无症状携带状态,β地中海贫血的临床表现极度异源性。 由于不同珠蛋白基因(初级基因修饰因子)发生各种变异,主要表现为显著的表型变异。 α/非α珠蛋白链不平衡程度是加重β地中海贫血综合症

  5. Growth and endocrine disorders in thalassemia: The international network on endocrine complications in thalassemia (I-CET position statement and guidelines

    Directory of Open Access Journals (Sweden)

    Vincenzo De Sanctis

    2013-01-01

    Full Text Available The current management of thalassemia includes regular transfusion programs and chelation therapy. It is important that physicians be aware that endocrine abnormalities frequently develop mainly in those patients with significant iron overload due to poor compliance to treatment, particularly after the age of 10 years. Since the quality of life of thalassemia patients is a fundamental aim, it is vital to monitor carefully their growth and pubertal development in order to detect abnormalities and to initiate appropriate and early treatment. Abnormalities should be identified and treatment initiated in consultation with a pediatric or an adult endocrinologist and managed accordingly. Appropriate management shall put in consideration many factors such as age, severity of iron overload, presence of chronic liver disease, thrombophilia status, and the presence of psychological problems. All these issues must be discussed by the physician in charge of the patient′s care, the endocrinologist and the patient himself. Because any progress in research in the field of early diagnosis and management of growth disorders and endocrine complications in thalassemia should be passed on to and applied adequately to all those suffering from the disease, on the 8 May 2009 in Ferrara, the International Network on Endocrine Complications in Thalassemia (I-CET was founded in order to transmit the latest information on these disorders to the treating physicians. The I-CET position statement outlined in this document applies to patients with transfusion-dependent thalassemia major to help physicians to anticipate, diagnose, and manage these complications properly.

  6. Study on effectiveness of transfusion program in thalassemia major patients receiving multiple blood transfusions at a transfusion centre in Western India

    Directory of Open Access Journals (Sweden)

    Shah Neeraj

    2010-01-01

    Full Text Available Background : Children suffering from beta-thalassemia major require repeated blood transfusions which may be associated with dangers like iron overload and contraction of infections such as HIV, HCV, and HBsAg which ultimately curtail their life span. On the other hand, inadequate transfusions lead to severe anemia and general fatigue and debility. Materials and Methods: Data were obtained from 142 beta-thalassemia major patients aged 3 years or more receiving regular blood transfusions at a transfusion centre in Western India from 1 April 2009 to 30 June 2009. The clinical data and laboratory results were subsequently analyzed. Results: Of the 142 patients, 76 (53.5% were undertransfused (mean Hb <10 gm%. 96 (67% of the patients were taking some form of chelation therapy but out of them only 2 (2% were adequately chelated (S. ferritin <1000 ng/ml. 5 (3.5% of the patients were known diabetics on insulin therapy. 103 (72% of the patients were retarded in terms of growth. The prevalence of transfusion-transmitted infections (TTIs such as HCV, HIV, and HBsAg was respectively 45%, 2%, and 2%, with the prevalence of HCV being significantly more than the general population. The HCV prevalence showed positive correlation with the age of the patients and with the total no of blood transfusions received. As many as 15% (6 out of 40 children who were born on or after 2002 were HCV positive despite the blood they received being subjected to screening for HCV. Conclusions: The study suggests the need to step up the transfusions to achieve hemoglobin goal of 10 gm% (as per the moderate transfusion regimen and also to institute urgent and effective chelation measures with the aim of keeping serum ferritin levels below 1000 ng/ml to avoid the systemic effects of iron overload. In addition, strict monitoring of the children for endocrinopathy and other systemic effects of iron overload should be done. Rigid implementation of quality control measures for the

  7. Red cell distribution width in the diagnosis of iron deficiency anemia and thalassemia trait

    International Nuclear Information System (INIS)

    Adil, M.M.; Junaid, A.; Zaman, I.; Ishtiaque, Z.B.

    2010-01-01

    To evaluate diagnostic importance of Red Cell Distribution Width (RDW) in differentiating iron deficiency anemia from Thalassemia trait. A total of 100 cases aged 5 months to 50 years of either sex with diagnosed iron deficiency anemia or thalassemia trait were compared with respect to their RDW value. RDW value in iron deficiency anemia was between 36.2% to 55.2% (Mean 44.1%). The range of RDW in Thalassemia trait was 14.7% to 24.9% (Mean 19.8%). Conclusions The very high range of RDW in iron deficiency anemia as compared to slight elevation of the value in thalassemia trait in our study suggests that RDW value obtained from simple Complete Blood Counts (CBC) can help in differentiating the two pathologies. (author)

  8. molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia

    International Nuclear Information System (INIS)

    Kamel, S.A.L.M.

    2004-01-01

    β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University

  9. Hubungan Kadar Feritin Serum dengan Gangguan Fungsi Paru Pasien Thalassemia Mayor Anak

    Directory of Open Access Journals (Sweden)

    Marte Robiul Sani

    2016-11-01

    Kesimpulan. Terdapat hubungan bermakna kadar feritin serum dengan gangguan fungsi paru pasien thalassemia mayor anak dan kadar feritin 4.839 μg/L merupakan batasan kadar feritin yang berhubungan dengan gangguan fungsi paru.

  10. [Advances in Pathogenesis and Related Clinical Research of Thromboembolism in Patients with Thalassemia after Splenectomy].

    Science.gov (United States)

    Sun, Na; Cheng, Peng; Deng, Dong-Hong

    2016-06-01

    Thalassemia is the most common human hereditary hemolytic anemia. Due to splenomegaly and hypersp-lenism, splenectomy can be used as a means of treatment for thalassemia. Various complications following splenectomy, however, especially thromboembolic complications are remarkable. This review summarizes the incidence, clinical manifestations and development time of thromboembolism. The pathogenesis of thromboembolism after splenectomy in thalassemia, such as abnormal platelet number and function, changes in red cell membrane, endothelial cell damage, dysfunction of other procoagulant and anticoagulant factors, and local factors associated with splenectomy are elaborated and the trategies to prevent and treat the thromboembolic events in thalassemia after splenectomy, including the attention to risk factors associated with splenectomy, a reassessment of splenectomy, regular blood transfusion to reduce the ratio of abnormal red blood cells, treatment with anticoagulant and antiplatelet drugs, application of hydroxyurea and stem cell transplantation are discussed.

  11. Effect of gamma irradiation on membranes of normal and pathological erythrocytes (beta-thalassemia)

    International Nuclear Information System (INIS)

    Sportelli, L.; Bonincontro, A.; Cametti, C.; Consiglio Nazionale delle Ricerche, Rome

    1987-01-01

    The influence of ionizing radiation on the membrane of human normal erythrocytes has extensively been studied and a variety of effects including changes in the cation fluxes or in non-electrolytes permeability, in membrane fluidity, in peroxidation of unsaturated lipids as well as chemical composition or structural modifications has been observed. However, only few studies deal with the effects of ionizing radiation on pathological red blood cells. In this work, we have investigated by means of electron spin resonance (ESR) spectroscopy the effects of 60 Co γ-radiation on the normal and homozygous β-thalassemic human erythrocyte membranes. (orig.)

  12. Peripheral Blood stem cell transplantation in children with Beta-thalassemia major

    International Nuclear Information System (INIS)

    Farzana, T.; Shamsi, T.S.; Irfan, M.; Ansari, S.H.; Baig, M.I.; Shakoor, N.

    2003-01-01

    Objective: To share the preliminary data on stem cell transplantation in Pakistan. Results: Engraftment was achieved in all patients except one who required a second dose of bone marrow graft on day +21. Median time to achieve absolute neutrophil count of > 0.5 x 10/sup 9/ /l was 9.0 days (range 8 - 31 days) and platelet count of > 20 x 10/sup 9/ /l was 14 days (12 - 35 days). Acute GVHD was seen in 3 patients, one patient had grade IV gut GVHD; another patient had grade III gut GVHD while third patient had grade II skin GVHD. Median hospital stay was 29 days. Six patients were well and transfusion independent 3 to 36 months post transplant. One episode of primary graft failure required a second dose of bone marrow harvest. Another episode of graft rejection received two doses of donor lymphocytes infusion. There were 4 deaths due to grade IV gut GVHD because of uncontrolled systemic Candida infection and one due to hepatic veno-occlusive (VOD) disease. Conclusion: Allogeneic peripheral blood stem cell transplantation can be safely and economically carried out in Pakistan. Although there had been 4 deaths during 36 months follow-up, with increasing understanding and experience the outcome is expected to improve. (author)

  13. The Association between Myocardial Iron Load and Ventricular Repolarization Parameters in Asymptomatic Beta-Thalassemia Patients

    Directory of Open Access Journals (Sweden)

    Mehmet Kayrak

    2012-01-01

    Full Text Available Previous studies have demonstrated impaired ventricular repolarization in patients with β-TM. However, the effect of iron overload with cardiac T2* magnetic resonance imaging (MRI on cardiac repolarization remains unclear yet. We aimed to examine relationship between repolarization parameters and iron loading using cardiac T2* MRI in asymptomatic β-TM patients. Twenty-two β-TM patients and 22 age- and gender-matched healthy controls were enrolled to the study. From the 12-lead surface electrocardiography, regional and transmyocardial repolarization parameters were evaluated manually by two experienced cardiologists. All patients were also undergone MRI for cardiac T2* evaluation. Cardiac T2* score <20 msec was considered as iron overload status. Of the QT parameters, QT duration, corrected QT interval, and QT peak duration were significantly longer in the β-TM group compared to the healthy controls. Tp−Te and Tp−Te dispersions were also significantly prolonged in β-TM group compared to healthy controls. (Tp-Te/QT was similar between groups. There was no correlation between repolarization parameters and cardiac T2* MRI values. In conclusion, although repolarization parameters were prolonged in asymptomatic β-TM patients compared with control, we could not find any relation between ECG findings and cardiac iron load.

  14. β-Thalassemia mutations and hemoglobinopathies in Adana, Turkey: results from a single center study

    OpenAIRE

    Guvenc, Birol; Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

    2012-01-01

    Introduction β-Thalassemia and hemoglobinopathies are common genetic disorders in Turkey and in this retrospective study our aim was to determine the frequency of β-thalassemia and hemoglobinopathies in Adana, which is one of the biggest cities located in the southern part of Turkey. Material and methods Data from 3000 individuals admitted to Seyhan Hereditary Blood Disorders Center in Adana were evaluated. The blood samples were collected into EDTA-containing tubes and hematological paramete...

  15. Interaction of malaria with a common form of severe thalassemia in an Asian population

    Science.gov (United States)

    O'Donnell, A.; Premawardhena, A.; Arambepola, M.; Samaranayake, R.; Allen, S. J.; Peto, T. E. A.; Fisher, C. A.; Cook, J.; Corran, P. H.; Olivieri, Nancy F.; Weatherall, D. J.

    2009-01-01

    In many Asian populations, the commonest form of severe thalassemia results from the coinheritance of HbE and β thalassemia. The management of this disease is particularly difficult because of its extreme clinical diversity; although some genetic and adaptive factors have been identified as phenotypic modifiers, the reasons remain unclear. Because the role of the environment in the course of severe thalassemia has been neglected completely and because malaria due to both Plasmodium falciparum and Plasmodium vivax has been prevalent in Sri Lanka, we carried out a pilot study of patients with HbE β thalassemia that showed high frequencies of antibodies to both parasite species and that 28.6% of the children had DNA-based evidence of current infection with P. vivax. Malarial antibodies then were assessed in patients with HbE β thalassemia compared with those in age-matched controls. There was a significant increase in the frequency of antibodies in the thalassemic patients, particularly against P. vivax and in young children. There was also a higher frequency in those who had been splenectomized compared with those with intact spleens, although in the latter it was still higher than that in the controls. The thalassemic patients showed significant correlations between malaria antibody status and phenotype. Patients with HbE β thalassemia may be more prone to malaria, particularly P. vivax, which is reflected in their clinical severity. Because P. vivax malaria is widespread in Asia, further studies of its interaction with HbE β thalassemia and related diseases are required urgently as a part of ongoing thalassemia control programs. PMID:19841268

  16. CARDIAC FUNCTION AND IRON CHELATION IN THALASSEMIA MAJOR AND INTERMEDIA: A REVIEW OF THE UNDERLYING PATHOPHYSIOLOGY AND APPROACH TO CHELATION MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Athanasios Aessopos

    2009-07-01

    Full Text Available Heart disease is the leading cause of mortality and one of the main causes of morbidity in beta-thalassemia. Patients with homozygous thalassemia may have either a severe phenotype which is usually transfusion dependent or a milder form that is thalassemia intermedia.  The two main factors that determine cardiac disease in homozygous β thalassemia are the high output state that results from chronic tissue hypoxia, hypoxia-induced compensatory reactions and iron overload.  The high output state playing a major role in thalassaemia intermedia and the iron load being more significant in the major form. Arrhythmias, vascular involvement that leads to an increased pulmonary vascular resistance and an increased systemic vascular stiffness and valvular abnormalities also contribute to the cardiac dysfunction in varying degrees according to the severity of the phenotype.  Endocrine abnormalities, infections, renal function and medications can also play a role in the overall cardiac function.  For thalassaemia major, regular and adequate blood transfusions and iron chelation therapy are the mainstays of management. The approach to thalassaemia intermedia, today, is aimed at monitoring for complications and initiating, timely, regular transfusions and/or iron chelation therapy.  Once the patients are on transfusions, then they should be managed in the same way as the thalassaemia major patients.  If cardiac manifestations of dysfunction are present in either form of thalassaemia, high pre transfusion Hb levels need to be maintained in order to reduce cardiac output and appropriate intensive chelation therapy needs to be instituted.  In general recommendations on chelation, today, are usually made according to the Cardiac Magnetic Resonance findings, if available.  With the advances in the latter technology and the ability to tailor chelation therapy according to the MRI findings as well as the availability of three iron chelators, together with

  17. Diabetes in Patients with ß-thalassemia or other Hemoglobinopathies - Analysis from the DPV Database.

    Science.gov (United States)

    Warncke, K; Konrad, K; Kohne, E; Hammer, E; Ohlenschläger, U; Herrlinger, S; Jäger, A; Holl, R W

    2016-11-01

    Background: Diabetes mellitus is a common endocrinopathy in patients with thalassemia major, but the occurrence of hemoglobinopathies is rare in Germany and Western Europe. The longitudinal German-Austrian DPV (Diabetes Patienten Verlaufsdokumentation) registry allows a comprehensive characterization of this group of patients. Patients/methods: Patients from the DPV-registry agedthalassemia major or other hemoglobinopathies were compared to patients with type 1 diabetes (T1D) and type 2 diabetes (T2D) using the statistical software SAS 9.4. Results: 94 patients (0.13% of patients) with hemoglobinopathies are registered in DPV. 82.4% of 17 patients with thalassemia major, 100% of 12 patients with sickle cell disease (SCD) and >90% of 65 patients with other hemoglobinopathies receive insulin treatment. In the majority of patients with thalassemia major, hemosiderosis is documented. Patients with thalassemia major developed diabetes at a median age of 14.6 [IQR 8.4-18.0] years (9.0 years [5.3-12.5] in T1D; 18.7 years [14.2-25.6] in TD2; both pthalassemia major is probably caused by hemosiderosis due to polytransfusion, while patients with SCD/thalassemia minor are most likely affected by T1D. The high rate of hypoglycemia in patients with ß-thalassemia major may be caused by liver fibrosis and a lack of hepatic glycogen stores. © Georg Thieme Verlag KG Stuttgart · New York.

  18. Prevalence of periodontal disease in children with leukemia disease and thalassemia

    Directory of Open Access Journals (Sweden)

    Hardianti Maulidita

    2016-06-01

    Full Text Available Various periodontal disease can occur in children and adolescents. Some can take place quickly and periodontal tissue damage. Several previous studies indicate that systemic diseases associated with periodontal disease in children. This study aims to determine the prevalence of periodontal disease in children with leukemia and thalassemia. The design study is a cross-sectional approach. Periodontal pocket depth measurements performed using the WHO standard of measurement. The samples in this study were drawn from the entire population using accidental sampling method. Sampled population was pediatric patients with leukemia and thalassemia. These patients were undergoing treatment in hospital Wahidin Sudirohusodo Hospital Makassar. During the study, children with leukemia as many as 18 patients and children with thalassemia by 8 patients. Distribution of pediatric patients suffering from leukemia by CPITN score; score of 2 as many as 10 patients (55.6%, a score of 1 as 6 patients (33.3%, and  score of 0 as many as 2 patients (11.1%. CPITN score in children with thalassemia; scores 2 in 1 patient (12.5%, a score of 1 as 6 patients (75%, and score of 0 by 1 patient (12.5%. Children who have leukemia and thalassemia, showed the rate of occurrence of different periodontal disease. Children with leukemia shows the level of periodontal disease is higher than in children with thalassemia disease.

  19. Association of erythrocyte deformability with red blood cell distribution width in metabolic diseases and thalassemia trait.

    Science.gov (United States)

    Vayá, Amparo; Alis, Rafael; Suescún, Marta; Rivera, Leonor; Murado, Julian; Romagnoli, Marco; Solá, Eva; Hernandez-Mijares, Antonio

    2015-01-01

    Increased red blood distribution width (RDW) in anemia is related to disturbances in the cellular surface/volume ratio, usually accompanied by morphological alterations, while it has been shown in inflammatory diseases that the activity of pro-inflammatory cytokines disturbing erythropoiesis increases RDW. Recently it has been reported that higher RDW is related with decreased erythrocyte deformability, and that it could be related with the association of RDW and increased risk of cardiovascular diseases. In order to analyze the influence of morphological alterations and proinflammatory status on the relationship between RDW and erythrocyte deformability, we analyzed erythrocyte deformability along with RDW and other hematological and biochemical parameters in 36 α-thalassemia, 20 β-thalassemia, 20 δβ-thalassemia trait carriers, 61 metabolic syndrome patients and 76 morbidly obese patients. RDW correlated inversely with erythrocyte deformability in minor β-thalassemia (r =-0.530, p thalassemia is often accompanied by more marked cell-shaped perturbations than other thalassemia traits. This could be the reason for this negative association only in this setting. Higher anisocytosis seems to be associated with greater morphologic alterations (shape/volume), which reduce erythrocyte deformability. The proinflammatory profile in metabolic patients can be related to the positive association of RDW with erythrocyte deformability found in these patients. However, further research is needed to explain the mechanisms underlying this association.

  20. Metabolic syndrome in Iraqi female patients with major β-thalassemia

    Directory of Open Access Journals (Sweden)

    Shaemaa Hadi Abdulsada

    2017-02-01

    Full Text Available Patients with β-thalassemia may have an increased risk for diabetes mellitus and cardiovascular diseases due to high level of iron which may lead to insulin resistanceand metabolic syndrome. So this study aimed to evaluate the levels of lipids profile in Iraqi female patients with β-thalassemia. Forty twofemale (age 15-30 years were enrolled in this study. Blood was collected and the sera were separated from (22 female patients with β-thalassemia who were attended the Ibn-Al-Baladi hospital from September 2012 to January 2013 and (20 healthy subject as a control group. Body mass index (BMI, lipid profile, FSG, insulin, insulin resistance, insulin sensitivity, B-cell function, iron, atherogenic index of serum were estimated. The results showed the presence of a significant increase in serum iron and significant decrease in insulin, B-cell function, LDL, VLDL, and TC in serum of patients with β-thalassemia when compared with control group. BMI also showed a significant decrease in patients when compared with the controls. Serum Insulin resistance, insulin sensitivity, HDL, TG, AIS, and FSG showed no-significant differences in patients with β-thalassemia when compared with control group. We concluded there was no metabolic syndrome in female patients with β-thalassemia.

  1. Failure to replicate the internal structure of Greek-specific thalassemia quality of life instrument in adult thalassemia patients in Sabah

    Directory of Open Access Journals (Sweden)

    Keowmani T

    2016-02-01

    Full Text Available Thamron Keowmani,1 Lily Wong Lee Lee21Clinical Research Centre, 2Hematology Unit, Queen Elizabeth Hospital, Kota Kinabalu, Sabah, MalaysiaPurpose: To study the validity and reliability of the Malay version of the Specific Thalassemia Quality of Life Instrument (STQOLI in Sabah’s adult thalassemia patients.Patients and methods: This cross-sectional study was done at Thalassemia Treatment Centre, Queen Elizabeth Hospital in Sabah, Malaysia. Eighty-two adult thalassemia patients who fulfilled the inclusion and exclusion criteria were conveniently selected for participation in the study. The English version of STQOLI was translated into Malay by using forward and back translations. The content of the questionnaire was validated by the chief hematologist of the hospital. The construct validity of the 40-item questionnaire was assessed by principal component analysis with varimax rotation and the scale reliability was assessed by Cronbach’s alpha.Results: The study failed to replicate the internal structure of the Greek STQOLI. Instead, 12 factors have been identified from the exploratory factor analysis, which accounted for 72.2% of the variance. However, only eight factors were interpretable. The factors were iron chelation pump impact, transfusion impact, time spent on treatment and its impact on work and social life, sex life, side effects of treatment, cardiovascular problems, psychology, and iron chelation pill impact. The overall scale reliability was 0.913.Conclusion: This study was unable to replicate the internal structure of the Greek STQOLI in Sabah’s adult thalassemia patients. Instead, a new structure has emerged that can be used as a guide to develop a questionnaire specific for adult thalassemia patients in Sabah. Future research should focus on the eight factors identified from this study.Keywords: STQOLI, validity, reliability, Malay, transfusion

  2. Adrenal extramedullary hematopoiesis associated with β-thalassemia major

    Directory of Open Access Journals (Sweden)

    Bijan Keikhaei

    2012-01-01

    Full Text Available The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hema - topoiesis (EMH. EMH is a rare complication in thalassemia major (TM and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdominal computed tomography scan revealed a right well-defined suprarenal mass 7.7¥7.3¥5.8 cm in size. The diagnosis of EMH was confirmed with ultrasonographic-guided fine needle biopsy. Treatment options which include intensified regular blood transfusion and hydroxyurea have been started.

  3. Adrenal extramedullary hematopoiesis associated with β-thalassemia major.

    Science.gov (United States)

    Keikhaei, Bijan; Shirazi, Ahmad Soltani; Pour, Mahboob Mohammad

    2012-05-10

    The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hematopoiesis (EMH). EMH is a rare complication in thalassemia major (TM) and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdominal computed tomography scan revealed a right well-defined suprarenal mass 7.7×7.3×5.8 cm in size. The diagnosis of EMH was confirmed with ultrasonographic-guided fine needle biopsy. Treatment options which include intensified regular blood transfusion and hydroxyurea have been started.

  4. Paraspinal extramedullary hematopoiesis in patients with thalassemia intermedia.

    Science.gov (United States)

    Haidar, Rachid; Mhaidli, Hani; Taher, Ali T

    2010-06-01

    Ineffective erythropoiesis in patients with thalassemia intermedia drives extramedullary hematopoietic tumor formation in several parts of the body. Paraspinal involvement has received increasing attention due to the associated morbidity secondary to spinal cord compression. Although the history and physical examination may help narrow the differential diagnosis, radiographic imaging remains essential to confirm the existence of hematopoietic tissue. Characteristic appearance has been observed mainly on magnetic resonance imaging. Several treatment options have been described, including transfusion therapy, laminectomy, radiotherapy, and the use of fetal hemoglobin inducing agents that decrease the hematopoietic drive. However, the ideal management scheme remains controversial. Until large prospective trials evaluate the efficacy and safety of the available treatment options, both in single and in combination therapy, an individualized approach should be entertained.

  5. Magnetic resonance imaging of transfusional hemosiderosis complicating thalassemia major

    International Nuclear Information System (INIS)

    Brasch, R.C.; Wesbey, G.E.; Gooding, C.A.; Koerper, M.A.

    1984-01-01

    Tissue deposits of hemosiderin, a paramagnetic iron-protein complex, resulted in marked abnormalities of magnetic resonance (MR) spin-echo signal intensity within the viscera of three children with transfusional hemosiderosis and thalassemia major. In all patients the liver and bone marrow demonstrated abnormally low spin-echo intensities and the kidneys and muscles had abnormally high intensities. These observations correlate with in vitro MR observation of ferric (Fe +3 ) solutions, in which concentrations of ferric salts greater than 20 mmol yielded higher intensities than did water alone. MR imaging is sensitive to the tissue deposition of hemosiderin, and MR intensity appears to provide a rough measure of the amount of iron deposited

  6. Moessbauer studies of blood diseases: thalassemia and malaria

    International Nuclear Information System (INIS)

    Bauminger, E.R.

    1988-01-01

    In 57 F Moessbauer studies of blood samples obtained from patients with thalassemia large amounts of iron, yielding a well defined spectrum, different from that obtained in oxy - or deoxy-hemoglobin, were found. The additional iron component was identified as due to ferritin - the iron storage protein. The amounts of ferritin-like iron were comparable to those of hemoglobin iron and were especially large in reticulocytes. Desferral was found to remove ferritin-like iron from serum, but not from red blood cells. In malaria, a parasite induced blood disease, the iron containing compound in the malarial pigment in rats infected by Plasmodium berghei was found to be trivalent high spin, different from any known iron porphyrin, yet was found to be similar to hemin in human blood cells infected by P. falciparum. The difference in the spectra obtained in RBC infected with drug sensitive and drug resistance strains and the effect of medication on the spectra is discussed. (author)

  7. Serum Prohepcidin Levels in Children with Thalassemia Major and Intermedia

    Directory of Open Access Journals (Sweden)

    Celil Yılmaz

    2017-04-01

    Full Text Available Objective: To determine the role of hepcidin hormone levels in iron accumulation in patients with thalassemia major (TM and thalassemia intermedia (TI. Materials and Methods: Serum prohepcidin and ferritin levels were determined in 34 patient with TM, 10 patient with TI, who attended the Department of Pediatric Hematology Adnan Menderes University Medical Faculty and the Department of Pediatrics at Aydın Atatürk State Hospital between 1 September 2006 and 30 September 2007 and 40 control patients without infection/inflammation, hepatitis or liver failure. Serum prohepcidin levels were measured using a commercial enzyme-linked immunosorbent assay kit (DRG International, Inc. Marburg, Germany; ferritin was studied with chemiluminescence method (Immulite 2000 DPC. Results: Mean serum ferritin levels in TM, TI and control groups were 2347.97±1724.81 ng/mL (range: 144-8015 ng/mL, 1352.40±918.94 ng/mL (range: 311-3109 ng/mL, and 33.35±12.03 ng/mL (range: 20-69.1 ng/mL, respectively. Serum prohepcidin levels in the same groups were 221.78±74.38 ng/mL (range: 7l.14-446.57 ng/mL, 173.31±52.14 ng/mL (range: 100.83-267.69 ng/mL, and 218.20±50.37 ng/mL (range: 116.18-330.43 ng/mL, respectively. There was a statistically significant difference in prohepcidin levels between patients with TI and control group only (p=0.016. No correlation was found between prohepcidin and ferritin levels in all groups (r=-0.023, p=0.839. Conclusion: Low levels of prohepcidin in patients with TI may be related to increased erythropoietic activity. Prohepcidin can be an indicator of active erythropoiesis.

  8. Psychometric properties of the Specific Thalassemia Quality of Life Instrument for adults

    Directory of Open Access Journals (Sweden)

    Lyrakos GN

    2012-07-01

    Full Text Available Georgios N Lyrakos,1,2 Demetra Vini,2 Helen Aslani,2 Marouso Drosou-Servou212nd Department of Anesthesiology, School of Medicine, University of Athens, Pain Clinic, Attikon University Hospital, 2Thalassemia Unit, General Hospital of Nikaia Ag. Panteleimon, Athens, GreeceBackground: No specific questionnaire has been developed to assess the health-related quality of life of thalassemia patients. Thus, the main objective of this study was to develop, according to psychometric standards, a self-administered Specific Thalassemia Quality of Life Instrument (STQOLI for adult patients.Methods: First, a qualitative phase was conducted to generate items and identify domains using the critical analysis incident technique and a literature review. A list of easily comprehensible, non-redundant items was defined using the Delphi technique and a pilot study on ten thalassemia patients. This phase involved both patients and experts. The second step was a quantitative validation phase comprising a study of 128 thalassemia patients in a single hospital. It was designed to select items, identify dimensions, and measure reliability and internal and concurrent validity. The psychometric and scaling properties of the proposed 41-item Specific Thalassemia Quality of Life Instrument were then assessed among patients recruited from the Thalassemia Unit at the General Hospital of Nikaia, Greece.Results: The final questionnaire had 41 items comprising four main domains and one global item about general health. The factorial structure was satisfactory (loading > 0.40 on each factor of the four domains for all items. Interscale correlations ranged from 0.06 to 0.78, Cronbach's α-coefficients were 0.78 for the psychosocial domain, 0.77 for the chelation domain, 0.72 for the transfusion domain, 0.81 for the disease and symptoms domain, and 0.840 for the total score of the questionnaire.Conclusion: The 41-item Specific Thalassemia Quality of Life Instrument seems to be a

  9. Prevalence of Pulmonary Hypertension in Patients with Thalassemia Intermedia in 2009: a single center's experience.

    Science.gov (United States)

    Moghaddam, Hassan Mottaghi; Badiei, Zahra; Eftekhari, Kambiz; Shakeri, Reza; Farhangi, Hamid

    2015-07-01

    There are various clinical symptoms of thalassemia intermedia, and they lie roughly between those of major and minor forms of the disease. Patients with thalassemia intermedia occasionally require blood transfusions. This renders them susceptible to pulmonary arterial hypertension (PAH) syndrome, which is one of the most significant complications in patients with thalassemia intermedia. PAH is more common in in thalassemia intermedia than in thalassemia major, and it may cause cardiac complications in patients who are older than 30. The objective of this study was to estimate the prevalence of PAH in thalassemia intermedia patients so that they can be referred expeditiously for treatment, thereby preventing the complications that occur later. This cross sectional study was conducted under the supervision of hematology department of Mashhad Medical University. Forty-one patients with thalassemia intermedia were examined at the Sarvar Thalassemia and Hemophilia Clinic of Mashhad. Electrocardiography, chest radiography, and echocardiography tests were performed for all of the patients by the same pediatric cardiologist. The data were processed by SPSS software, version 11.5, and the results were analyzed using chi-squared, Student's t, and Mann-Whitney tests. The mean age of the patients was 21.93±8.34. They had been under pediatric heart specialists' constant examination and treatment since their childhood when they were diagnosed with TI, and continue to receive regular follow-up care. The prevalence of pulmonary hypertension was 24% in our study population. In patients with thalassemia intermedia, the left ventricular (LV) mass indices were about 3-5 times higher than would be expected in a normal population. Patients with higher LV mass indices have a greater risk of developing pulmonary hypertension, and those with serum ferritin levels below 1000 ng/ml are less susceptible to diastolic dysfunction. Pulmonary hypertension is common in patients with thalassemia

  10. Gene and Cell Therapy for β-Thalassemia and Sickle Cell Disease with Induced Pluripotent Stem Cells (iPSCs): The Next Frontier.

    Science.gov (United States)

    Papapetrou, Eirini P

    2017-01-01

    In recent years, breakthroughs in human pluripotent stem cell (hPSC) research, namely cellular reprogramming and the emergence of sophisticated genetic engineering technologies, have opened new frontiers for cell and gene therapy. The prospect of using hPSCs, either autologous or histocompatible, as targets of genetic modification and their differentiated progeny as cell products for transplantation, presents a new paradigm of regenerative medicine of potential tremendous value for the treatment of blood disorders, including beta-thalassemia (BT) and sickle cell disease (SCD). Despite advances at a remarkable pace and great promise, many roadblocks remain before clinical translation can be realistically considered. Here we discuss the theoretical advantages of cell therapies utilizing hPSC derivatives, recent proof-of-principle studies and the main challenges towards realizing the potential of hPSC therapies in the clinic.

  11. Prevalência de talassemias e hemoglobinas variantes em pacientes com anemia não ferropênica Prevalence of thalassemias and variant hemoglobins in patients with non-ferropenic anemia

    Directory of Open Access Journals (Sweden)

    Sandrine C. Wagner

    2005-03-01

    Full Text Available Para estabelecer a freqüência de hemoglobinopatias e talassemias em pacientes com anemia não ferropênica foram estudados 58 casos de pacientes comprovadamente com anemia não ferropênica e 235 controles obtidos de pessoas sem anemia. Todas as amostras foram obtidas do Hospital de Clínicas de Porto Alegre (HCPA, RS, Brasil. As técnicas realizadas foram eletroforese em acetato de celulose, pH alcalino, pesquisa citológica de Hb H, HPLC, hemograma e ferritina. A análise dos dados realizada no grupo de pacientes com anemia não ferropênica demonstrou que 63,8% eram portadores de alguma forma de anemia hereditária: 25,9% de talassemia alfa heterozigota, 32,8% de talassemia beta heterozigota, 3,4% de heterozigose para hemoglobina S (Hb AS e 1,7% de homozigose para hemoglobina C (Hb CC. No grupo dos controles, foram identificados 14,1% de anemias hereditárias, sendo destas 11,5% de talassemia alfa, 0,9% de talassemia beta, 1,3% de heterozigose para hemoglobina S (Hb AS e 0,4% de heterozigose para hemoglobina C (Hb AC. Os resultados obtidos permitem concluir que a prevalência de talassemias e hemoglobinas variantes no grupo controle é coincidente com a descrita na literatura. Entretanto, a excepcional prevalência dessas hemopatias hereditárias em pessoas com anemia não ferropênica deve ser divulgada entre médicos e serviços de saúde dada a sua importância no diagnóstico definitivo de anemia e dos corretos procedimentos terapêuticos.To establish the frequency of hemoglobinopathies and thalassemias in patients with non-ferropenic anemia, 58 patients with confirmed non-ferropenic anemia and 235 non-anemic individuals (control group were studied. All samples were obtained from the Hospital de Clínicas de Porto Alegre (HCPA, Rio Grande do Sul, Brazil. The techniques used were Alkaline pH cellulose acetate electrophoresis and cytological screening of Hb, Hl, HPLC, hemogram and ferritin. The data analysis showed that 63% of the

  12. Risk of erectile dysfunction in transfusion-naive thalassemia men: a nationwide population-based retrospective cohort study.

    Science.gov (United States)

    Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

    2015-04-01

    Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction. This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities.

  13. Factors associated with continuing emergence of β-thalassemia major despite prenatal testing: a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Al Sabbah H

    2017-09-01

    Full Text Available Haleama Al Sabbah,1 Sarah Khan,1 Abdallah Hamadna,2 Lamia Abu Ghazaleh,2 Anwar Dudin,2 Bashar Adnan Karmi3 1College of Natural and Health Sciences, Zayed University, Dubai, UAE; 2Faculty of Medicine, An-Najah National University, Nablus, Palestine; 3Thalassemia Patients’ Friends Society, Ramallah, Palestine Purpose: Health care initiatives focusing on prenatal testing and premarital genetic screening aiming to reduce the incidence of β-thalassemia have emerged during the last decade. In Palestine, 4% of the population are known thalassemia carriers with new cases continuing to appear despite the availability of prenatal testing. This study aims to identify factors that influence the decision to retain or abort fetuses affected by β-thalassemia in Palestine. Methods: Convenience sampling was used to select 32 women (72 fetuses who were at risk of having a baby with β-thalassemia. A questionnaire on prenatal testing, test results, pregnancy outcomes, and factors influencing the decision to terminate the pregnancy were used for this cross-sectional study. The data were analyzed using SPSS version 17. Results: Among the fetuses screened, 36 (50% were thalassemia carriers and 20 (28% had β-thalassemia; 17 (85% affected fetuses were aborted. Religious beliefs were the most cited reason for opposing abortion while prior experience with β-thalassemia patients and awareness programs promoted abortions. Mothers who opted to retain an affected fetus had modest educational attainment. Higher educational level was significantly associated with the decision to abort an affected fetus (p<0.05. Conclusion: A religious consensus is needed on the abortion of fetuses affected by β-thalassemia. Improving female education and increasing awareness on thalassemia could help reduce the incidence of β-thalassemia in Palestine and around the world. Keywords: abortion, Islam, fetus, awareness

  14. [Neonatal screening of hemoglobinopathies and G6PD deficiency in Catalonia (Spain). Molecular study of sickle cell disease associated with alpha thalassemia and G6PD deficiency].

    Science.gov (United States)

    Mañú Pereira, María Del Mar; Cabot, Anna; Martínez González, Ana; Sitjà Navarro, Eulalia; Cararach, Vicent; Sabrià, Josep; Boixaderas, Jordi; Teixidor, Roser; Bosch, Albert; López Vílchez, M Angeles; Martín Ibáñez, Itziar; Carrión, Teresa; Plaja, Pere; Sánchez, Mario; Vives Corrons, José Luis

    2007-06-30

    The prevalence of hemoglobinopathies and glucose-6-phosphate dehidrogenase (G6PD) deficiency in the Catalan neonatal population is increasing due to immigration. Coinheritance of more than a single RBC genetic defect is becoming more frequent and diagnostic pitfalls are also increasing. We intended to demonstrate the need to perform an early diagnosis of sickle cell disease (SCD) by means of neonatal screening, to establish the prevalence of SCD associated with alpha thalassemia and G6PD deficiency and to identify genotypes associated with sickle cell disease and G6PD deficiency. 4,020 blood samples from newborns were screened. For the screening of hemoglobinopathies the high performance liquid chromatography method was used and for G6PD deficiency the fluorescent spot test was employed. We studied the association between betaS gene and alpha thalassaemia del-3.7 Kb. SCD and G6PD deficiency genotypes were established. Prevalence of SCD in population at risk was 1/475 newborns. Prevalence of G6PD deficiency in population at risk was 1/43, and in autochthonous population was 1/527 newborns. In all the cases, sickle hemoglobin was confirmed by ARMS (amplification refractory mutation system). Association between betaS gene and alpha thalassaemia del-3.7 Kb was found in 32.2% of the samples, and an association between betaS gene and G6PD deficiency was observed in 7% of the samples. This study confirms the high prevalence of SCD and G6PD deficiency in population at risk as well as their genetic and clinical heterogeneity. The study of genotype/phenotype relationships allows a better knowledge of molecular mechanism and is useful to establish suitable criteria of diagnosis.

  15. 'Rakter dosh'--corrupting blood: The challenges of preventing thalassemia in Bengal, India.

    Science.gov (United States)

    Chattopadhyay, Sreeparna

    2006-11-01

    Thalassemia is an inherited blood disorder that has been receiving increasing attention in India. However, prevention of thalassemia in India continues to be difficult despite efforts of public health professionals and the government. Using West Bengal as a case study, this paper attempts to unravel some of the barriers to the prevention campaign and the consequent under utilization of the program. Lack of access, low awareness, low-risk perception and poverty are all important proximate constraints; however, one of the greatest barriers to the program is rooted in cultural notions of blood, marriage, identity, personhood and kinship in Bengali society. Blood is so deeply valued in the Bengali kinship system that this genetic mutation is perceived to be corrupting the blood (rakter dosh). Being a thalassemia carrier (i.e., having thalassemia minor) renders an individual unfit as a suitable marriage partner because of beliefs related to purity of blood, its association with the continuity of the lineage, and subsequent transmission of desirable traits to future generations. The risk of non-marriage affects women disproportionately, and parents are not inclined to test their daughters because of the possibility of not being able to marry them off to eligible suitors. The stigma associated with having thalassemia minor (TMI) is a deterrent to the disclosure of thalassemia status as well as to testing. Using anthropological theories and ethnographic methods, this paper focuses on the gendered process by which the diagnosis of a thalassemia carrier 'spoils' identities, thereby creating a disjuncture between the goals of the prevention program and people's need for social conformity, and ultimately between medical desirability and social desirability. The paper also suggests policies for enhancing the utilization of the program. Finally the conclusions from this study have potential applications for public health prevention programs that confront problems of stigma in

  16. The frequency of β-globin gene haplotypes, α-thalassemia and genetic polymorphisms of methylenetetrahydrofolate reductase, factor V Leiden and prothrombin genes in children with sickle cell disease in Rio de Janeiro, Brazil Frequência dos haplótipos da globina beta, da talassemia alfa e dos polimorfismos genéticos dos genes da metilenotetrahidrofolato redutase, do fator V Leiden e da protrombina em crianças com doença falciforme no Rio de Janeiro, Brasil

    Directory of Open Access Journals (Sweden)

    Isaac L. Silva Filho

    2010-02-01

    Full Text Available A freqüência dos haplótipos beta S e beta C do gene da globina e a prevalência de talassemia alfa e de mutações nos genes da metilenotetrahidrofolato redutase (MTHFR-C677T, do fator V de Leiden e da protrombina (G20210A foi estudada em crianças com doença falciforme do Rio de Janeiro. O haplótipo Bantu foi o mais freqüente (65,9%, 21,2% das crianças (18% heterozigotas e 3% homozigotas apresentam talassemia com mutação alfa 3.7kb, ao contrário da mutação alfa 4.2kb que não foi encontrada. Os alelos 677CT e 677TT da MTHFR foram observados em 20,2% e 4,8%, respectivamente. Os haplótipos Camarões, Árabe-Indiano e Senegal não foram detectados na amostra estudada, bem como mutações no gene do fator V de Leiden e da protrombina. Somente o haplótipo beta C CI foi observado. Esse é o primeiro estudo realizado em uma amostra proveniente do Programa de Triagem Neonatal para Hemoglobinopatias do estado do Rio de Janeiro. Apesar do Rio de Janeiro ser a segunda maior cidade brasileira e seus habitantes expressarem o elevado grau de miscigenação ocorrida no país, nossos resultados ainda coincidem com os registros históricos dos fluxos migratórios do gene beta S para o Brasil, bem como refletem a forte influência de indivíduos de origem africana na população do Rio de Janeiro.

  17. PSYCHOLOGICAL EVALUATION IN PREGNANT WOMEN AFFECTED BY THALASSEMIA MAJOR: TRAITS AND PERSONALITY

    Directory of Open Access Journals (Sweden)

    Giuseppina Messina

    2010-01-01

    Full Text Available Background. The reproductive and sexual health issues concerning persons affected by thalassemia major are complex. The study was planned to investigate the psychological attitudes and expectations in a group of thalassemic pregnant women attending hospital for regular blood transfusion. Methods. The study included 20 consecutive thalassemic patients and a control group of 42 healthy pregnant volunteers. We evaluated the personality structure by Rorschach's test and the presence of psychic symptoms by SCL-90-R and STAI. Results. Narcissism and sexual traumas are significantly higher in thalassemic women with respects to the control group. Also the percent of anxiety and depression observed with the SCL-90-R was significantly higher than in control group. The score observed with the STAI shows that the state of anxiety changed significantly between thalassemic pregnant women and the control group, even though the scores values aren’t pathologic in neither group. Conclusions. This study addresses the need for developing, implementing and evaluating proper psychological support for thalassemic pregnant patients. The limit of this study is to analyze just thalassemic women because it doesn’t consider other pathologies; so the results can’t be extended to other pathologies different from thalassemic. Moreover, psychological screening and support prior to, during and following pregnancy would be indicated. Since not there are psychological studies in literature on the pregnancy in the thalassemic patients, the evaluation of the effects of pregnancy on the thalassemic disease will be the aim of future psychological investigations.

  18. Evaluation of some essential element levels in thalassemia major patients in Mosul district, Iraq.

    Science.gov (United States)

    Al-Samarrai, Abdulmunaim H; Adaay, Mohaisen H; Al-Tikriti, Khudhair A; Al-Anzy, Muayed M

    2008-01-01

    To evaluate the levels of some essential elements in thalassemic patients in Mosul, Iraq. One hundred and five thalassemic blood transfusion dependent children, 2.5-18 years of age attending Ibn-Al-Atheer teaching hospital in Mosul City, Iraq, during 2005, were used in this study. Fifty-four healthy subjects served as a control group. Patients were allocated in a non-randomized prospective cross-sectional hospital based study. Essential elements levels were estimated. The mean, standard deviation, correlation coefficient, and z-test were used. P-values copper, and potassium levels were found among the 105 thalassemic patients compared to the 54 controls. Levels of calcium, phosphate, and sodium were within normal limits. Fluctuations in the essential elements levels seem to be related to the different complications associated with the disease. Zinc deficiency may be attributed to hyperzincuria resulted from the release of Zn from hemolyzed red cells. Hypercupremia occurs in acute and chronic infections and hemochromatosis, which is a principal complication of thalassemia. Increased Na levels may be due to renal damage. Hypomagnesemia may occur due to hypoparathyroidism.

  19. Evaluation of some essential elements levels in thalassemia patients in Mosul, Iraq

    International Nuclear Information System (INIS)

    Al-Samarrai, Abdulmunaim H.; Al-Tikriti, Khudhair A.; Al-Anzy, Muayed M.; Adaay, Mohaisen H.

    2008-01-01

    Objective was to evaluate the levels of some essential elements in thalassemic patients in Mousel, Iraq. One hundred and five thalassemic blood transfusion dependent children, 2.5-18 years of age attending Ibn-Al-Atheer teaching hospital in Mosul City, Iraq, during 2005, were used in this study. Fifty-four healthy subjects served as a control group. Patients were allocated in a non-randomized prospective cross-sectional hospital study. Essential elements levels were estimated. The mean, standard deviation, correction coefficient and z-test were used. P-values < 0.05 were considered statistically significant. Low serum Zinc, Magnesium, high serum copper and potassium levels were found among the 105 thalassemic patients compared to the 54 controls. Levels of calcium, phosphate and sodium were within normal limits. Fluctuations in the essential elements levels seem to be related to the different complications associated with the disease. Zinc deficiency may be attributed to hyperzincuria resulted from the release of Zn from hemolyzed red cells. Hypercupremia occurs in acute and chronic infections and hemochromatosis, which is a principal complication of thalassemia. Increased Na levels may be due to renal damage. Hypomagnesemia may occur due to hypoparathyroidism. (author)

  20. Reducing the iron burden and improving survival in transfusion-dependent thalassemia patients: current perspectives

    Directory of Open Access Journals (Sweden)

    Bayanzay K

    2016-08-01

    Full Text Available Karim Bayanzay, Lama Alzoebie Department of Hematology, Gulf Medical University, Ajman, United Arab Emirates Abstract: Hypertransfusion regimens for thalassemic patients revolutionized the management of severe thalassemia; transforming a disease which previously led to early infant death into a chronic condition. The devastating effect of the accrued iron from chronic blood transfusions necessitates a more finely tuned approach to limit the complications of the disease, as well as its treatment. A comprehensive approach including carefully tailored transfusion protocol, continuous monitoring and assessment of total body iron levels, and iron chelation are currently the mainstay in treating iron overload. There are also indications for ancillary treatments, such as splenectomy and fetal hemoglobin induction. The main cause of death in iron overload continues to be related to cardiac complications. However, since the widespread use of iron chelation started in the 1970s, there has been a general improvement in survival in these patients. Keywords: hematology, chelators, deferoxamine, deferiserox, deferiprone, liver iron concentration, iron overload, serum ferritin concentration, hepatic iron storage, iron chelation therapy

  1. Thalassemia intermedia as a result of heterozygosis for ß0-thalassemia and aaaanti-3.7/aa genotype in a Brazilian patient

    Directory of Open Access Journals (Sweden)

    Kimura E.M.

    2003-01-01

    Full Text Available We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa. The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.

  2. Recent patents and technology transfer for molecular diagnosis of β-thalassemia and other hemoglobinopathies.

    Science.gov (United States)

    Breveglieri, Giulia; Finotti, Alessia; Borgatti, Monica; Gambari, Roberto

    2015-01-01

    Biological tests and genetic analyses for diagnosis and characterization of hematological diseases in health laboratories are designed with the aim of meeting the major medical needs of hospitals and pharmaceutical companies involved in this field of applied biomedicine. Genetic testing approaches to perform diagnosis consist of molecular techniques, which should be absolutely reproducible, fast, sensitive, cheap, and portable. Biological tests analyzed involve adult/newborn subjects, whereas genetic analyses involve adult thalassemia patients, newborns, embryos/fetuses (including non-invasive prenatal diagnosis), pre-implantation embryos, and pre-fertilization oocytes. The most recent findings in the diagnostic approach for β-thalassemias are related to three major fields of investigation: moving towards ultrasensitive methodologies for effective detection of the primary causative mutation of β-thalassemia, including the development of polymerase chain reaction-free approaches and non-invasive prenatal diagnosis; comparing analyses of the genotype of β-thalassemia patients to high-HbF-associated polymorphisms; introducing whole genome association assays and next-generation sequencing. All these issues should be considered and discussed in the context of several aspects, including regulatory, ethical and social issues. DNA sequence data aligned with the identification of genes central to the induction, development, progression, and outcome of β-thalassemia will be a key point for directing personalized therapy.

  3. Splenectomy for Children With Thalassemia: Total or Partial Splenectomy, Open or Laparoscopic Splenectomy.

    Science.gov (United States)

    Al-Salem, Ahmed H

    2016-01-01

    Splenomegaly and hypersplenism are common complications among children with thalassemia necessitating splenectomy. Thirty-six children (27 β-thalassemia major, 3 Hb H disease, and 6 thalassemia intermediate) had total splenectomy (11 laparoscopic and 13 open splenectomy) or partial splenectomy (12 patients). In the partial splenectomy group, 2 with Hb H required no transfusions. For those with β-thalassemia major who had partial splenectomy (9 patients), there was a reduction in the number of transfusions from a preoperative mean of 15.2 transfusions per year to a postoperative mean of 8.2 transfusions per year. Subsequently and as a result of increase in the size of splenic remnant, their transfusions increased, but none required total splenectomy. Twenty-four patients had total splenectomy (13 open and 11 laparoscopic splenectomy). Their postsplenectomy transfusions decreased from a preoperative mean of 17.8 transfusions per year to a postoperative mean of 10 transfusions per year. There was no mortality, and none developed postoperative sepsis or thrombotic complications. Total splenectomy is beneficial for children with β-thalassemia major and hypersplenism by reducing their transfusion requirements. Laparoscopic splenectomy is however more beneficial. Partial splenectomy reduces their transfusion requirements, but only as a temporary measure, and so it is recommended for children younger than 5 years of age.

  4. BETA (Bitter Electromagnet Testing Apparatus)

    Science.gov (United States)

    Bates, Evan M.; Birmingham, William J.; Rivera, William F.; Romero-Talamas, Carlos A.

    2017-10-01

    The Bitter Electromagnet Testing Apparatus (BETA) is a 1-Tesla (T) prototype of the 10-T Adjustable Long Pulse High-Field Apparatus (ALPHA). These water-cooled resistive magnets use high DC currents to produce strong uniform magnetic fields. Presented here is the successful completion of the BETA project and experimental results validating analytical magnet designing methods developed at the Dusty Plasma Laboratory (DPL). BETA's final design specifications will be highlighted which include electromagnetic, thermal and stress analyses. The magnet core design will be explained which include: Bitter Arcs, helix starters, and clamping annuli. The final version of the magnet's vessel and cooling system are also presented, as well as the electrical system of BETA, which is composed of a unique solid-state breaker circuit. Experimental results presented will show the operation of BETA at 1 T. The results are compared to both analytical design methods and finite element analysis calculations. We also explore the steady state maximums and theoretical limits of BETA's design. The completion of BETA validates the design and manufacturing techniques that will be used in the succeeding magnet, ALPHA.

  5. Oxidative stress and age-related changes in T cells: is thalassemia a model of accelerated immune system aging?

    Science.gov (United States)

    Ghatreh-Samani, Mahdi; Esmaeili, Nafiseh; Soleimani, Masoud; Asadi-Samani, Majid; Ghatreh-Samani, Keihan; Shirzad, Hedayatolah

    2016-01-01

    Iron overload in β-thalassemia major occurs mainly due to blood transfusion, an essential treatment for β-thalassemia major patients, which results in oxidative stress. It has been thought that oxidative stress causes elevation of immune system senescent cells. Under this condition, cells normally enhance in aging, which is referred to as premature immunosenescence. Because there is no animal model for immunosenescence, most knowledge on the immunosenescence pattern is based on induction of immunosenescence. In this review, we describe iron overload and oxidative stress in β-thalassemia major patients and how they make these patients a suitable human model for immunosenescence. We also consider oxidative stress in some kinds of chronic virus infections, which induce changes in the immune system similar to β-thalassemia major. In conclusion, a therapeutic approach used to improve the immune system in such chronic virus diseases, may change the immunosenescence state and make life conditions better for β-thalassemia major patients.

  6. PRENATAL DIAGNOSIS OF β-THALASSEMIAS AND HEMOGLOBINOPATHIES

    Directory of Open Access Journals (Sweden)

    Luisella Saba

    2009-06-01

    Full Text Available

     

    Prenatal diagnosis of β-thalassemia was accomplished for the first time in the 1970s by globin chain synthesis analysis on fetal blood obtained by placental aspiration at 18-22 weeks gestation. Since then, the molecular definition of the β- globin gene pathology, the development of procedures of DNA analysis, and the introduction of chorionic villous sampling have dramatically improved prenatal diagnosis of this  disease and of related disorders.  Much information is now available about the molecular mechanisms of the diseases and the molecular testing is widespread.

    As prenatal diagnosis has to provide an accurate, safe and early result, an efficient screening of the population and a rapid molecular characterization of the couple at risk, are necessary prerequisites. In the last decades  earlier and less invasive approaches for prenatal diagnosis were developed . A overview of the most promising procedure will be done.

    Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

    Limits on heavy neutrino mixing from the beta decay of 38mK confined in a magneto-optical trap

    International Nuclear Information System (INIS)

    Trinczek, M.C.

    2001-01-01

    This thesis details the search for mixing between electron neutrinos and possible heavy neutrinos using the positron decay of 38m K produced at ISAC, TRIUMF's new radioactive beam facility. Using the novel technique of laser atom trapping to confine 38m K, direct limits on such mixing in β-decay are determined for the mass range of 0.7 MeV/c 2 to 3.8 MeV/c 2 . The results, for part of this mass range, provide the best direct limits for the mixing of heavy neutrinos with the electron neutrino in the literature to date. The Standard Model of electroweak physics has been able to describe a wide range of experimental results, but an unresolved question arises in accounting for lepton masses. The charged leptons (electrons, muons and taus) have masses which vary enormously from one to another (m e = 0.511 MeV/c 2 , m μ = 106 MeV/c 2 , m τ = 1777 MeV/c 2 ), while their accompanying neutrinos appear to have no (or very little) mass. If neutrinos have finite mass, then mixing could occur among the different neutrino species. Thus, evidence of mixing would indicate the existence of non-zero neutrino mass and of the need to modify or extend the Standard Model. Consequently, this is a highly active field of physics. Evidence of possible neutrino mass and oscillation has been recently observed by the detection of energetic neutrinos from the atmosphere. The TRINAT collaboration at TRIUMF has searched for evidence of physics beyond the Standard Model using a radioactive source of 38m K atoms held in a neutral atom trap. The trap provides a source of several thousand atoms confined to a volume of less than a cubic millimeter, suspended in a vacuum vessel, in which the 38m K undergoes radioactive decay with the emission of a positron and a neutrino. This results in the creation of a daughter nucleus, 38 Ar , with momentum equal to the vector sum of the momenta of the positron and the neutrino. The unperturbed nucleus then recoils from the trap and is detected in coincidence

  7. Decreased bone uptake of technetium-99m polyphosphate in thalassemia major

    International Nuclear Information System (INIS)

    Valdez, V.A.; Jacobstein, J.G.

    1980-01-01

    Bone scans were performed with Tc-99m stannous polyphosphate on four patients with thalassemia major. Three of the scans show generalized decrease in skeletal uptake of the radiopharmaceutical, associated with renal enlargement and markedly increased renal radioactivity. The skeletal findings are consistent with the known bone abnormalities in thalassemia major, which are secondary to the extensive marrow hyperplasia and include loss of trabeculae and cortical thinning with consequent loss of bone mass. The increased renal uptake is probably due in part to the increased renal excretion (secondary to the poor bone uptake) and in part to the tubular dilatation and renal enlargement associated with thalassemia major. In addition, the presence of excessive amounts of iron in these patients may play a role in both the skeletal and renal findings

  8. Cardiac iron overload in chronically transfused patients with thalassemia, sickle cell anemia, or myelodysplastic syndrome.

    Directory of Open Access Journals (Sweden)

    Mariane de Montalembert

    Full Text Available The risk and clinical significance of cardiac iron overload due to chronic transfusion varies with the underlying disease. Cardiac iron overload shortens the life expectancy of patients with thalassemia, whereas its effect is unclear in those with myelodysplastic syndromes (MDS. In patients with sickle cell anemia (SCA, iron does not seem to deposit quickly in the heart. Our primary objective was to assess through a multicentric study the prevalence of cardiac iron overload, defined as a cardiovascular magnetic resonance T2*8 ECs in the past year, and age older than 6 years. We included from 9 centers 20 patients with thalassemia, 41 with SCA, and 25 with MDS in 2012-2014. Erythrocytapharesis did not consistently prevent iron overload in patients with SCA. Cardiac iron overload was found in 3 (15% patients with thalassemia, none with SCA, and 4 (16% with MDS. The liver iron content (LIC ranged from 10.4 to 15.2 mg/g dry weight, with no significant differences across groups (P = 0.29. Abnormal T2* was not significantly associated with any of the measures of transfusion or chelation. Ferritin levels showed a strong association with LIC. Non-transferrin-bound iron was high in the thalassemia and MDS groups but low in the SCA group (P<0.001. Hepcidin was low in thalassemia, normal in SCA, and markedly elevated in MDS (P<0.001. Two mechanisms may explain that iron deposition largely spares the heart in SCA: the high level of erythropoiesis recycles the iron and the chronic inflammation retains iron within the macrophages. Thalassemia, in contrast, is characterized by inefficient erythropoiesis, unable to handle free iron. Iron accumulation varies widely in MDS syndromes due to the competing influences of abnormal erythropoiesis, excess iron supply, and inflammation.

  9. Prevalence of β-thalassemia and other haemoglobinopathies in six cities in India: a multicentre study.

    Science.gov (United States)

    Mohanty, D; Colah, R B; Gorakshakar, A C; Patel, R Z; Master, D C; Mahanta, J; Sharma, S K; Chaudhari, U; Ghosh, M; Das, S; Britt, R P; Singh, S; Ross, C; Jagannathan, L; Kaul, R; Shukla, D K; Muthuswamy, V

    2013-01-01

    The population of India is extremely diverse comprising of more than 3,000 ethnic groups who still follow endogamy. Haemoglobinopathies are