Directory of Open Access Journals (Sweden)
Katrin Bromber
2009-05-01
Full Text Available Review of the monograph: Holger Stoecker: Afrikawissenschaften in Berlin von 1919 bis 1945. Zur Geschichte und Topographie eines wissenschaftlichen Netzwerkes, Stuttgart: Franz Steiner Verlag 2008, ISBN 978-3-515-09161-9, 359 pages. Besprechung der Monographie: Holger Stoecker: Afrikawissenschaften in Berlin von 1919 bis 1945. Zur Geschichte und Topographie eines wissenschaftlichen Netzwerkes, Stuttgart: Franz Steiner Verlag 2008, ISBN 978-3-515-09161-9, 359 Seiten.
DEFF Research Database (Denmark)
Walter Benjamin (1892-1940). Tolkning af alle 33 kapitler i Benjamins bybarndomserindringer fra Berlin i begyndelsen af det 20. århundrede.......Walter Benjamin (1892-1940). Tolkning af alle 33 kapitler i Benjamins bybarndomserindringer fra Berlin i begyndelsen af det 20. århundrede....
Battling Creaticide: An Interview with David C. Berliner
Ambrose, Don
2012-01-01
This article presents an interview with David C. Berliner, a Regents' Professor in the College of Education at Arizona State University. His books include "Educational Psychology," "The Manufactured Crisis," and "The Handbook of Educational Psychology." He has served as president of the American Educational Research Association and of the…
Visit to MPA Stuttgart - Universitaet Stuttgart
International Nuclear Information System (INIS)
1980-01-01
The booklet contains the introduction lectures to the following demonstration tests of the MPA Stuttgart: - Large scale specimen tensile testing; - full size vessel; - high speed tensile machine; - explosion high speed tensile machine; - heat affected zone simulation. (RW)
Energy Technology Data Exchange (ETDEWEB)
Grosshans, D. [Neckarwerke Stuttgart AG (Germany)
1998-12-31
The housing area Burgholzhof is located on a hill above the valley of Stuttgart in the city borough of Canstatt. The building area has a size of 13.4 hectare and will contain 1,360 flats with a total heated area of 86,000 square metres that can house 2,800 people. Heat will be supplied by a heating power station, a plant for thermal use of solar energy and a heat distribution system built by Neckarwerke Stuttgart (Stuttgart utility company). The Neckarwerke Stuttgart paid the construction costs of the plant for thermal utilisation of solar energy. They will not be included in the energy price charged to the consumer. (orig.) [Deutsch] Das Wohngebiet `Burgholzhof` liegt auf einer Anhoehe ueber dem Talkessel der Landeshauptstadt Stuttgart im Stadtteil Bad-Cannstatt. Die Bebauungsflaeche betraegt nach einer im Jahr 1997 durchgefuehrten Arrondierung 13,4 ha. Im Endausbau werden etwa 1360 Wohneinheiten mit einer beheizten Gesamtflaeche von etwa 86 000 m{sup 2} entstanden sein. Somit koennen etwa 2800 Buergerinnen und Buerger in diesem neuen Stadtteil wohnen. Zur Waermeversorgung wurde ein Heizwerk, eine Anlage zur thermischen Nutzung der Sonnenenergie und ein Waermeverteilsystem von den NWS erstellt. Die Kosten fuer den Bau der Anlage zur thermischen Nutzung der Sonnenenergie wurden von den NWS uebernommen. Sie sind somit kein Bestandteil des an die Nutzer zu verrechnenden Waermepreises. (orig.)
Making Space Cool - Successful Outreach at Yuri's Night Stuttgart
Hill, Christine; Bretschneider, Jens; Nathanson, Emil; Grossmann, Agnes
Yuri’s Night - also known as the “World Space Party” - is the annual celebration commemorating Gagarin’s historic flight on April 12, 1961, and the maiden voyage of the American space shuttle on April 12, 1981. It was created by young space enthusiasts in 2000 at the annual Space Generation Congress and was first celebrated in 2001, registering more than 60 events around the world from the start. Since then the interest in celebrating human spaceflight grew constantly to over 350 events across all seven continents in 2013. The honoring of Yuri Gagarin’s first spaceflight in Stuttgart started in 2007 and resulted in one of the largest events outside the US, with five parties following in 2008, 2009, 2010, 2012 and 2013. The Stuttgart event was originally organized as space party for an audience at the age of 20 and beyond including informative aspects at the afternoon and a following party far into the night. Since 2010 the focus of the Yuri’s Night Stuttgart is to bring awareness of space exploration to people of all ages, including particularly many participatory hands-on space activities for kids and families that attract hundreds of visitors every year. As much as Yuri’s Night is a worldwide party, the events in Stuttgart successfully concentrate on educational aspects that help to inspire new generations of space enthusiasts who will ultimately shape the future of space exploration. It is therefore not only a look back to one of the greatest achievements of the 20th Century, but it is also a look into the future: from multinational cooperation on the International Space Station to benefit of space flight to the introduction of the next generation of space technology. This paper will introduce the celebrations of Yuri’s Night in Stuttgart of the past four years and compare them to the early events. It provides a summary of the development of the Yuri’s Night including educational aspects, public relations and media attraction and gives
DEFF Research Database (Denmark)
Jespersen, Per Homann
Indlæggets baggrund og formål I det såkaldte COINCO-projekt, et INTERREG-projekt støttet af regioner og byer mellem Oslo og Berlin, er der udviklet en strategi for et tættere samarbejde i korridoren (Jespersen et al. 2007). Udbygning af infrastrukturen for passagerer og gods er en væsentlig del h...... Oslo - Göteborg". Sluttrapport. Jespersen, P. H., Jensen, A., Stroschein, C., & Lundgren, A. 2007, COINCO - Corridor of Innovation and Cooperation - Strategy 2025. Landex, A. 2006, Railway Capacity Oslo-Berlin, Center for Trafik og Transport, Danmarks Tekniske Universitet, Lyngby. ...
High-voltage shared-service line in the Stuttgart area
Energy Technology Data Exchange (ETDEWEB)
Goerler, W; Benz, A [Technische Werke der Stadt Stuttgart A.G. (F.R. Germany)
1976-01-01
In congested areas the line construction engineer has to cope with a great variety of difficulties - amenity problems, line crossings, and road crossings. The authors describe the prerequisites for and the construction of a HV shared-service line of approx. 25 km in the congested area of Stuttgart, where several three-phase and single- phase a.c. systems are run on one set of pylons.
Berlin Mitte: Alexanderplatz and Friedrichstaße: Urban and historical images
Directory of Open Access Journals (Sweden)
Aranđelović Biljana
2014-01-01
Full Text Available Berlin Mitte is one of the most interesting parts of the city, located in the core of Berlin where every corner and stone can tell a story. Mitte, the cultural center of Berlin is also known as the political and economic hub of Berlin. This paper explores the urban and historical image of two important parts of Berlin Mitte district: Alexanderplatz and Friedrichstaße. Friedrichstraße, as the main shopping and business street in this area, was planned with great attention by Prussian authorities, while the area around Alexanderplatz grew up randomly and its streets did not follow any special urban patterns. All potential international investors wanted to come to Friedrichstraße after the fall of the Wall, while Alexanderplatz was not so attractive to them. Many famous architects took part in numerous competitions regarding urban planning reconstructions of the famous Alex throughout the 20th century. These two areas of the Mitte district, Alexanderplatz and Friedrichstaße, are very important for contemporary Berlin and both areas have different problems.
Cogan, John J.
1990-01-01
Compares East and West Berlin before and after the fall of the Berlin Wall in November 1989. Offers divergent viewpoints on German reunification from interviews of two professors: one from East Germany, the other from West Germany. Recommends that social studies classes incorporate current events such as German reunification. (CH)
(Non-Monumental Layers of Berlin
Directory of Open Access Journals (Sweden)
Juli Székely
2016-09-01
Full Text Available The two books reviewed in this article, Hsiu-Ling Kuos’s Monumentality and Modernity in Hitler’s Berlin (2013 and Janet Ward’s Post-Wall Berlin (2011, focus on the structural, political, social and aesthetic transformation of Berlin, from the first half of the twentieth century to the ‘post-wall’ era. Since both authors strongly emphasize the former and present status of monumental architecture and monumental memory, this book review pays particular attention to a critical discussion of the (non-monumental layers of Berlin.
Dahlke, Birgit
2011-01-01
Berlin has always been a literary space of extremely diverse political and cultural projections. This essay investigates why after the unification of East and West Berlin the city has been imagined as a play zone of sexual self-fulfilment by authors such as Inka Parei, Tanja Dückers, Kathrin Röggla, Judith Hermann and Julia Franck. Have such erotic adventures replaced political vision in our post-utopian decade? What is the purpose of the laboured allegorisation of the fall of the wall in Durs Grünbein's essays or in the novels of Katja Lange-Müller and Thomas Hettche? The sexification of historical and political processes recalls similar stereotypes in the East German literature of the 1980s: the metropolis as a whore in works by Heiner Müller or Wolf Biermann, but also by younger authors of the independent literary scene in Berlin like Uwe Kolbe or Frank-Wolf Matthies.
Energy Technology Data Exchange (ETDEWEB)
Hentschel, Klaus; Webel, Josef (eds.)
2016-07-01
The knowledge of material research and its history is not very common among scientists and engineers alike. Within the scope of an interdisciplinary teaching project carried out for the first time in the summer semester 2014 and ever since then every summer semester at the University of Stuttgart, an attempt is made to approach material research both from a scientific, technical and historical perspective. The Material Testing and Materials Testing Institute in Stuttgart (MPA), the liquid crystals and the screen technology as well as the superconductivity were selected as topics, which have a long tradition in research and teaching in Stuttgart. In this anthology the materials of the teaching project are summarized. [German] Das Wissen um die Materialforschung und ihre Geschichte ist selbst unter Naturwissenschaftlern und Ingenieuren wenig verbreitet. Im Rahmen eines erstmals im Sommersemester 2014 und seither dann jedes Sommersemester an der Universitaet Stuttgart durchgefuehrten interdisziplinaeren Lehrprojektes wird deshalb der Versuch unternommen, sich der Materialforschung sowohl aus naturwissenschaftlicher und technischer als auch aus historischer Perspektive anzunaehern. Als Themenbereiche wurden dafuer die Materialpruefung und Materialpruefungsanstalt (MPA) Stuttgart, die Fluessigkristalle und die Bildschirmtechnik sowie die Supraleitung ausgewaehlt, die in Stuttgart auf eine lange Tradition in Forschung und Lehre zurueckblicken. Im vorliegenden Sammelband sind die Materialien des Lehrprojektes zusammengefasst.
Fatal accidents due to train surfing in Berlin.
Strauch, H; Wirth, I; Geserick, G
1998-06-08
This study was undertaken for the purpose of analysing under the aspect of legal medicine, fatal accidents due to train surfing in the local transport system of Berlin (S-Bahn and underground). The period of investigation was from 1989 through 1995, with 41 train surfing accidents, among them 18 with fatal outcome. Evaluation included those 14 deaths which were forensically autopsied. It was based on autopsy records of Berlin-based university institutes (Humboldt University and Free University) as well as the Brandenburg State Institute of Legal Medicine. Also used were data obtained from the Berlin Transport Police Record. The casualties were aged between 13 and 25 years, most of them between 16 and 20. The male-female gender ratio was 13:1. Accidents occurred above all in the warmer season of the year, most of them between 20:00 h and midnight. More than 50% of all cases were affected by alcohol, but centrally acting medicaments or other addictive drugs were not noticed at all. Most of the fatal accidents occurred to users of the Berlin S-Bahn network. Older train models were the preferred surfing objects due to their structural peculiarities. Collision with close-to-track obstacles and slipping from the train proved to be the major sources of danger. An analysis of injuries revealed polytraumatisation but for one exception, with craniocerebral injuries being the most common and severest events. The longest survival time amounted to 24 h. As the psychosocial causes of high-risk behaviour of adolescents will hardly be controllable, withdrawal of technical, that is structural design possibilities appears to be the most important approach to prevention of accidents in the future. This demand is met by the new series of the Berlin S-Bahn. The model of the old series, suitable for surfing, still accounts for about 10% of the rolling stock and is to be decommissioned in 1998.
Memory effect in the deposition of C20 fullerenes on a diamond surface
Du, A. J.; Pan, Z. Y.; Ho, Y. K.; Huang, Z.; Zhang, Z. X.
2002-07-01
In this paper, the deposition of C20 fullerenes on a diamond (001)-(2×1) surface and the fabrication of C20 thin film at 100 K were investigated by a molecular dynamics (MD) simulation using the many-body Brenner bond order potential. First, we found that the collision dynamic of a single C20 fullerene on a diamond surface was strongly dependent on its impact energy. Within the energy range 10-45 eV, the C20 fullerene chemisorbed on the surface retained its free cage structure. This is consistent with the experimental observation, where it was called the memory effect in ``C20-type'' films [P. Melion et al., Int. J. Mod. B 9, 339 (1995); P. Milani et al., Cluster Beam Synthesis of Nanostructured Materials (Springer, Berlin, 1999)]. Next, more than one hundred C20 (10-25 eV) were deposited one after the other onto the surface. The initial growth stage of C20 thin film was observed to be in the three-dimensional island mode. The randomly deposited C20 fullerenes stacked on diamond surface and acted as building blocks forming a polymerlike structure. The assembled film was also highly porous due to cluster-cluster interaction. The bond angle distribution and the neighbor-atom-number distribution of the film presented a well-defined local order, which is of sp3 hybridization character, the same as that of a free C20 cage. These simulation results are again in good agreement with the experimental observation. Finally, the deposited C20 film showed high stability even when the temperature was raised up to 1500 K.
Defense.gov - Special Report - Fall of the Berlin Wall - 20th Anniversary
barrier followed. On Nov. 9, 1989, after East Germany promised greater freedom of travel, protestors . The Iron Curtain that divided Europe for decades finally fell, ushering in a new era of freedom and John F. KennedyÂs ÂIch bin ein Berliner speech. June 26, 1963 White House Diary video - KennedyÂs
Emil Fahrenkamp : Bauten und Projekte für Berlin
Jacob, B.
2006-01-01
Thema der vorliegenden Arbeit ist die umfassende Aufarbeitung und Dokumentation der Bauten und Projekte Emil Fahrenkamps (*1885, 1966) in Berlin und Potsdam-Babelsberg sowie die kritische Einordnung seiner Arbeiten in den Kontext der Baugeschichte des 20. Jahrhunderts. Den zentralen
Risk of the research reactor BER II in Berlin; Risiken des Berliner Experimentierreaktors BER II
Energy Technology Data Exchange (ETDEWEB)
Paulitz, Henrik; Hoevener, Barbara; Rosen, Alex
2015-04-20
The research reactor BER II is sited at the periphery of Berlin in the neighborhood of residential areas. The operational license is limited until December 31, 2019. The reactor is funded by the Federal Government (90%) and the city of Berlin (10%). The stress test has shown that the reactor is not secured against an aircraft crash (airliner or fast flying military jet), meltdown with remarkable radiological consequences to the public would be the consequence. Further hazards result from the radioactive waste transport, explosions and fires. The emergency measures cannot be considered to be sufficient. The city of Berlin would not be able to fulfill the required measures in case of a radiation accident.
Integrity of power plant components. Research performed by Professor K. Kussmaul at MPA Stuttgart
International Nuclear Information System (INIS)
Roos, E.; Maile, K.
1998-01-01
The history of the Staatliche Materialpruefungsanstalt - the State Material Testing Institute - (MPA) Stuttgart is characterized by the scientific qualifications of its directors. During the 40 years of work at the MPA, Professor Karl Kussmaul has come up to the expectations of this tradition and has with his works firmly established the renowned 'Stuttgarter Schule' - the School of Stuttgart - founded by Bach. (orig.) [de
International Nuclear Information System (INIS)
Fischerhof, H.
1980-01-01
In a decision dated December 20, 1979, the Federal Constitutional Court refused to accept the complaint of unconstitutionality brought by the Technische Werke (Municipal Utilities) of the city of Stuttgart (TWS) against two decisions by the Stuttgart Municipal Court in favor of non-payers and part payers of electricity bills. The reasons given for the refusal to accept the complaint state that there was every indication of the Stuttgart judgements being faulty. On the basis of this finding, TWS can continue to demand payment in full of their electricity bills. The Federal Constitutional Court maintains that civil rights could not be applied to TWS as a corporation under private law, whose activities exclusively consisted in providing the public with means of existence and whose shares were held in full by an agency with rights of jurisdiction. In a footnote, the author argues that the refusal to grant protection of civil rights to TWS was in conflict with the equal rights principle. (HSCH) [de
Neural Networks in R Using the Stuttgart Neural Network Simulator: RSNNS
Directory of Open Access Journals (Sweden)
Christopher Bergmeir
2012-01-01
Full Text Available Neural networks are important standard machine learning procedures for classification and regression. We describe the R package RSNNS that provides a convenient interface to the popular Stuttgart Neural Network Simulator SNNS. The main features are (a encapsulation of the relevant SNNS parts in a C++ class, for sequential and parallel usage of different networks, (b accessibility of all of the SNNSalgorithmic functionality from R using a low-level interface, and (c a high-level interface for convenient, R-style usage of many standard neural network procedures. The package also includes functions for visualization and analysis of the models and the training procedures, as well as functions for data input/output from/to the original SNNSfile formats.
The incidence of ARDS and associated mortality in severe TBI using the Berlin definition.
Aisiku, Imoigele P; Yamal, Jose-Miguel; Doshi, Pratik; Rubin, Maria Laura; Benoit, Julia S; Hannay, Julia; Tilley, Barbara C; Gopinath, Shankar; Robertson, Claudia S
2016-02-01
The incidence of adult respiratory distress syndrome (ARDS) in severe traumatic brain injury (TBI) is poorly reported. Recently, a new definition for ARDS was proposed, the Berlin definition. The percentage of patients represented by TBI in the Berlin criteria study is limited. This study describes the incidence and associated mortality of ARDS in TBI patients. The study was an analysis of the safety of erythropoietin administration and transfusion threshold on the incidence of ARDS in severe TBI patients. Three reviewers independently assessed all patients enrolled in the study for acute lung injury/ARDS using the Berlin and the American-European Consensus Conference (AECC) definitions. A Cox proportional hazards model was used to assess the relationship between ARDS and mortality and 6-month Glasgow Outcome Scale (GOS) score. Two hundred patients were enrolled in the study. Of the patients, 21% (41 of 200) and 26% (52 of 200) developed ARDS using the AECC and Berlin definitions, respectively, with a median time of 3 days (interquartile range, 3) after injury. ARDS by either definition was associated with increased mortality (p = 0.04) but not with differences in functional outcome as measured by the GOS score at 6 months. Adjusted analysis using the Berlin criteria showed an increased mortality associated with ADS (p = 0.01). Severe TBI is associated with an incidence of ARDS ranging from 20% to 25%. The incidence is comparable between the Berlin and AECC definitions. ARDS is associated with increased mortality in severe TBI patients, but further studies are needed to validate these findings. Epidemiologic study, level II.
A comparison of municipal solid waste management in Berlin and Singapore.
Zhang, Dongqing; Keat, Tan Soon; Gersberg, Richard M
2010-05-01
A comparative analysis of municipal solid waste management (MSWM) in Singapore and Berlin was carried out in order to identify its current status, and highlight the prevailing conditions of MSWM. An overview of the various aspects of MSWM in these two cities is provided, with emphasis on comparing the legal, technical, and managerial aspects of MSW. Collection systems and recycling practiced with respect to the involvement of the government and the private sector, are also presented. Over last two decades, the city of Berlin has made impressive progress with respect to its waste management. The amounts of waste have declined significantly, and at the same time the proportion that could be recovered and recycled has increased. In contrast, although Singapore's recycling rate has been increasing over the past few years, rapid economic and population growth as well as change in consumption patterns in this city-state has caused waste generation to continue to increase. Landfilling of MSW plays minor role in both cities, one due to geography (Singapore) and the other due to legislative prohibition (Berlin). Consequently, both in Singapore and Berlin, waste is increasingly being used as a valuable resource and great efforts have been made for the development of incineration technology and energy recovery, as well as climate protection. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Chan, Adrian; And Others
This unit, designed for use with high school and community college students, uses primary materials, literature, and interactive lesson plans to present the city of Berlin (Germany) as a case study of some of the 20th century's most significant events. In lesson 1, students take a pre-test, view a video about the Berlin Wall, and discuss the kinds…
Activities of the MPA Stuttgart in connection with QA of nuclear power plants
International Nuclear Information System (INIS)
Maier, H.J.
1980-01-01
The MPA Stuttgart (Institute of Testing of Materials, University of Stuttgart) is concerned with quality assurance of german nuclear power plants, additional to the technical inspection organizations and the plant owners. The orders are given by state authorities, federal authorities and the RSK (reactor security commission). There are shown some examples of this work, concerning with materials and testing of materials. (orig./RW)
Energy Technology Data Exchange (ETDEWEB)
Herzog, Uwe
2011-03-15
Ancient scrolls, historical construction plans or handwritten fragments of well-known literati from the region - the treasures of the Stuttgart's city archive are irretrievable. With the reopening of the archive on 24th January, 2011 in a completely retrofitted historical warehouse ensemble in Bad Cannstatt (Federal Republic of Germany) these valuable documents already are stored in the new magazine. Related with this, significant improvements are accompanied by a substantially larger available space, short ways and mobile shelf walls. Furthermore, the climatic storage conditions for the sensitive archives now were put at the highest level: Henceforth, the old papers, drawings, photos or paintings can be stored at a constant temperature of 18 Celsius and at a air humidity of 50 %.
Energy Technology Data Exchange (ETDEWEB)
Dame, Thorsten
2011-07-01
The author presents a case study from the view of economic and architectural history, i.e. the history and development of the Berlin utility, Berliner Elektrizitaetswerke. It is shown that planning, design and construction were not the result of a dialogue between the architect and the utility but that economic, political and cultural goals of policy and public administration had to be integrated as well. The architecture of the industrial buildings therefore should be viewed as part of the community relations in general, i.e. as an element of the interaction between private, state and civilian society interests.
Dead Center: Berlin, the Postmodern Gothic, and Norman Ohler's Mitte
Directory of Open Access Journals (Sweden)
Steffen H. Hantke
2006-06-01
Full Text Available Cultural critics often frame present-day Berlin as a space of historical discontinuities, a nexus of modernity and postmodernity that, in its orientation toward the future, represents post-reunification Germany in all its complexity. However, this framing tends to suppress Gothic imagery, of which traces can be found in the critical discourse on the city. Recuperating such Gothic tropes from critical discourse, and then consciously and strategically re-deploying them, can be a valuable strategy for opening up new venues of thinking about the lingering presence of the past, the high cost of modernization, and the uncanny emotional and affective dimensions of urban space. While this project of recuperation has been taken on in some critical analyses of Berlin, most notably among them Brian Ladd's The Ghosts of Berlin (1997, it is the new German literature on Berlin that proceeds more boldly into the terrain of the Gothic. Among this new "Berlin literature," Norman Ohler's critically acclaimed Gothic novel Mitte (2001 stands out as a cogent analysis of the new Berlin and of the problems of inhabiting a decentralized urban space and reconnecting it to authentic historical experience.
Freizeit beim Feind. US-amerikanische Soldaten in Ost-Berlin
Directory of Open Access Journals (Sweden)
Stefanie Eisenhuth
2018-04-01
Full Text Available This article focuses on an almost forgotten type of ›border crosser‹ in the divided city of Berlin: the members of the American military community. To them (as well as to the members of the French and British forces, the Berlin Wall marked the front line of the Cold War. At the same time, though, they were allowed to cross the border and spend their free time in East Berlin. Especially in the 1970s and 1980s, when the dollar was tumbling, American families took advantage of the favourable exchange rate and crossed the border for cheap shopping, dining and entertainment. Due to Berlin’s status, the GDR government had to tolerate this kind of tourism, but nevertheless tried to prevent any personal contact between Americans and East Germans. The regime could also benefit financially from the Western tourists. This demonstrates the ambivalence of the Honecker era, the concurrence of an increased openness and internal erosion. The study is based on documents from the GDR’s Ministry for State Security, the West Berlin Senate Chancellery and the US Berlin Brigade as well as on contemporary newspaper articles. * * * Der Aufsatz widmet sich einer ungewöhnlichen Gruppe von Berliner Grenzgängern: den vor Ort stationierten US-Soldaten. Für sie (wie auch für die Soldaten der britischen und französischen Armee markierte die Mauer einerseits die Front des Kalten Krieges, andererseits durften sie diese ohne große Kontrollen passieren und ihre Freizeit in Ost-Berlin verbringen – was sie besonders in den 1970er- und 1980er-Jahren auch intensiv taten, denn in Zeiten der Dollarkrise versprach die östliche Stadthälfte viel Vergnügen, Restaurantbesuche und Einkaufsmöglichkeiten für wenig Geld. Die DDR-Regierung war genötigt, die Grenzgänge zu tolerieren. Von dieser Form des Tourismus konnte sie finanziell profitieren, versuchte konkrete Kontaktaufnahmen aber zu vermeiden. Der Umgang mit den Grenzgängen amerikanischer Soldaten und ihrer
International Nuclear Information System (INIS)
Hentschel, Klaus; Webel, Josef
2016-01-01
The knowledge of material research and its history is not very common among scientists and engineers alike. Within the scope of an interdisciplinary teaching project carried out for the first time in the summer semester 2014 and ever since then every summer semester at the University of Stuttgart, an attempt is made to approach material research both from a scientific, technical and historical perspective. The Material Testing and Materials Testing Institute in Stuttgart (MPA), the liquid crystals and the screen technology as well as the superconductivity were selected as topics, which have a long tradition in research and teaching in Stuttgart. In this anthology the materials of the teaching project are summarized. [de
Farías, Ignacio
2009-01-01
Mittels einer Untersuchung von standardisierten Praktiken (Stadtrundgängen und Stadtrundfahrten) und Dispositiven (Stadtkarten, Reiseführer) fürs „Touren“ von Städten zeigt diese Dissertation, (1) wie die Stadt Berlin in ein virtuelles Objekt, nämlich, einen touristischen Zielort, transformiert wird, ( 2) wie diese Transformation nicht nur durch die Bewegung von Touristen im Raum und das Unterwegssein ermöglicht wird, sondern durch touristische Kommunikation über die Stadt, und (3) wie diese ...
End-of-life care for immigrants in Germany. An epidemiological appraisal of Berlin.
Henke, Antje; Thuss-Patience, Peter; Behzadi, Asita; Henke, Oliver
2017-01-01
Since the late 1950's, a steadily increasing immigrant population in Germany is resulting in a subpopulation of aging immigrants. The German health care system needs to adjust its services-linguistically, culturally, and medically-for this subpopulation of patients. Immigrants make up over 20% of the population in Germany, yet the majority receive inadequate medical care. As many of the labor immigrants of the 1960s and 1970s are in need of hospice and palliative care (HPC), little is known about this specialized care for immigrants. This epidemiological study presents utilization of HPC facilities in Berlin with a focus on different immigrant groups. A validated questionnaire was used to collect data from patients at 34 HPC institutions in Berlin over 20 months. All newly admitted patients were recruited. Anonymized data were coded and analyzed by using SPSS and compared with the population statistics of Berlin. 4118 questionnaires were completed and included in the analysis. At 11.4% the proportion of immigrants accessing HPC was significantly (pimmigrants in Berlin population, 17.7% immigrants in HPC population) and 61-70 years (16,9% vs. 13,1%). The largest ethnic groups are Turks, Russians, and Poles, with a different weighting than in the general population: Turkish immigrants were 24% of all Berlin immigrants, but only 13.6% of the study immigrant population (OR: 0.23, 95%CI: 0.18-0.29, pimmigrants account for 5.6% and 9.2% in the population, but 11.5% and 24.8% in the study population respectively (Russian: OR 0.88, 95%CI: 0.66-1.16; Polish: OR 1.17, 95%CI: 0.97-1.42). Palliative care wards (PC) were used most often (16.7% immigrants of all PC patients); outpatient hospice services were used least often by immigrants (11.4%). Median age at first admission to HPC was younger in immigrants than non-immigrants: 61-70 vs. 71-80, p = 0.03. Immigrants are underrepresented in Berlin´s HPC and immigrants on average make use of care at a younger age than non
Berlin in Television Drama Series: A Mediated Space
Directory of Open Access Journals (Sweden)
Susanne Eichner
2017-07-01
Full Text Available Since the early days of film Berlin and the film studios in its suburbs was an important site of production. Signature films for film historians such as Metropolis and The Blue Angel were shot at the UFA studios in Babelsberg. Throughout its history Berlin was and is a popular place for media productions with the city functioning as a text, full of meaning that turns into branded value. The article will investigate the complex relationship of historical and societal events and Berlin as a production site and an imaginary landscape respectively cityscape. Based on the analysis of national and international drama series we will argue that the increasing importance of Berlin as production site and location goes hand in hand with an increasing mediated imagination of the city as a cinematic respectively televisual space that is able to represent past events such as the Nazi regime and the cold war and actual events such as organised crime, counter terrorist activities, and an intercultural life in a modern metropolis.
Landscape changes in East Berlin after 1989
Dellenbaugh, Mary Hartshorn
2014-01-01
Die Arbeit behandelt eine Reihe zusammenhängender Veränderungen, die nach dem Fall der Mauer im Ostteil von Berlin stattfanden. In drei Aufsätzen wird die Geschichte des unmittelbaren Wandels der Diskurse über Raumtypologien dargestellt, die symbolische Aneignung beschrieben, die in den Aushandlungsprozessen um die Schaffung einer vereinten Berliner Innenstadt stattfand und die Auswirkungen der Veränderungen in der diskursiven und symbolischen Neuausrichtung am Beispiel der Entwicklung zweie...
Energy Technology Data Exchange (ETDEWEB)
Roos, E.; Alsmann, U. [Stuttgart Univ. (Germany). Staatliche Materialpruefungsanstalt
1998-11-01
The Government-supported, joint project by IWW Freiburg, BAM Berlin, IWW Magdeburg, and MPA Stuttgart is intended to yield insight into the mechanisms underlying the WPS, warm prestress effect, and to derive on this basis a quantitative description of the WPS effect. (orig./CB) [Deutsch] Ziel eines durch das BMBF gefoerderten Gemeinschaftsprojekts von IWW Freiburg, BAM Berlin, IWW Magdeburg und MPA Stuttgart ist es, die Mechanismen des WPS-(warm prestress)-Effekts zu erklaeren und auf dieser Basis eine quantitative Beschreibung des WPS-Effekts zu ermoeglichen. (orig./MM)
Annus, Taavi, 1977-
2004-01-01
Arvustus: Thiele, Carmen. Selbstbestimmungsrecht und Minderheitenschutz in Estland. Berlin : Springer, 1999 ; Das Recht der nationalen Minderheiten in Osteuropa. Berlin : Berlin Verlag Arno Spitz, 1999
Landgericht Stuttgart condemns power price boycotters to payment
International Nuclear Information System (INIS)
Anon.
1981-01-01
With its judgment of 18th December 1980 - 10 0 164/80 - the LG Stuttgart has condemned an electricity customer who, being an opponent of nuclear energy, had been keeping back ten per cent of the power price and transfering this amount to a trust account to the payment of the arrears. A public utility company cooperating with a nuclear power plant and supplying its customers with electric power from this npp had submitted its claim. (orig./HP) [de
Arabin, B; Raum, E; Mohnhaupt, A; Schwartz, F W
1999-06-01
When perinatal medicine emerged as a new medical discipline in the 1960s, Berlin was as one of the world's leading centers. During that time, the city was separated into two parts, each fostering its own health care system. After the destruction of the Berlin Wall, it was possible to speak with the citizens of East Berlin and to access their database systems. This created the singular opportunity to objectively compare the development of perinatal care in both parts of Berlin. Rates of maternal, perinatal, and infant mortality as well as the rate of preterm deliveries were evaluated over time and between East and West Berlin. The timing of introduction of 20 specific perinatal interventions was evaluated across 18 hospitals with more than 500 deliveries (11 in West Berlin and 7 in East Berlin). Interviews were conducted with 100 gynecologists, 100 midwives, and 100 women who had recently delivered their first child from each side of the city regarding their opinions of the importance of these interventions for the quality of perinatal medicine and how they would distribute a budget to improve maternity care. Maternal, perinatal, and infant mortality decreased in both parts of Berlin until 1990 (p Berlin, though the preterm delivery rate was slightly lower in East Berlin compared with West Berlin (p Berlin. In contrast, certain public health measures--such as maternal transport, screening programs for diabetes, and support of breastfeeding--were introduced much earlier in East Berlin. There were significant differences between the beliefs of gynecologists, midwives, and mothers in East and West Berlin. In general, citizens of East Berlin were more enthusiastic about technological medical advances, whereas citizens of West Berlin were more supportive of public health and alternative methods. In addition, there were significant differences between female and male physicians in their beliefs about how to improve health care, regardless of whether they resided in East
Best Practices: Intercultural Integration of Arabic Refugees in Berlin
Kyuchukov, Hristo; New, William
2017-01-01
The paper presents the work of a Berlin-based NGO (ANE) in Germany, which works with migrants and Arab refugees. The organisation has a strong record publishing a Parents Newsletter and conducting family counselling for migrants and refugees in Berlin. One of the major activities of the organisation in 2016 was an international conference with…
Risk of the research reactor BER II in Berlin
International Nuclear Information System (INIS)
Paulitz, Henrik; Hoevener, Barbara; Rosen, Alex
2015-01-01
The research reactor BER II is sited at the periphery of Berlin in the neighborhood of residential areas. The operational license is limited until December 31, 2019. The reactor is funded by the Federal Government (90%) and the city of Berlin (10%). The stress test has shown that the reactor is not secured against an aircraft crash (airliner or fast flying military jet), meltdown with remarkable radiological consequences to the public would be the consequence. Further hazards result from the radioactive waste transport, explosions and fires. The emergency measures cannot be considered to be sufficient. The city of Berlin would not be able to fulfill the required measures in case of a radiation accident.
Berliner Philarmoniker ATLAS visit
ATLAS Collaboration
2017-01-01
The Berliner Philarmoniker in on tour through Europe. They stopped on June 27th in Geneva, for a concert at the Victoria Hall. An ATLAS visit was organised the morning after, lead by the ATLAS spokesperson Karl Jakobs (welcome and overview talk) and two ATLAS guides (AVC visit and 3D movie).
Mitigation of urban heat stress – a modelling case study for the area of Stuttgart
Directory of Open Access Journals (Sweden)
Fallmann, Joachim
2014-04-01
Full Text Available In 2050 the fraction of urban global population will increase to over 69%, which means that around 6.3 billion people are expected to live in urban areas (UN 2011. Cities are the predominant habitation places for humans to live and are vulnerable to extreme weather events aggravating phenomena like heat stress. Finding mitigation strategies to sustain future development is of great importance, given expected influences on human health. In this study, the mesoscale numerical model WRF is used on a regional scale for the urban area of Stuttgart, to simulate the effect of urban planning strategies on dynamical processes affecting urban climate. After comparing two urban parameterisation schemes, a sensitivity study for different scenarios is performed; it shows that a change of the reflective properties of surfaces has the highest impact on near-surface temperatures compared to an increase of urban green areas or a decrease of building density. The Urban Heat Island (UHI describes the temperature difference between urban and rural temperatures; it characterises regional urban climate and is responsible for urban-rural circulation patterns. Applying urban planning measures may decrease the intensity of the UHI in the study area by up to 2 °C by using heat-reflective roof paints or by 1 °C through replacing impervious surfaces by natural vegetation in the urban vicinity – compared to a value of 2.5 °C for the base case. Because of its topographical location in a valley and the overall high temperatures in this region, the area of Stuttgart suffers from heat stress to a comparatively large extent.
Pärt: Berliner Messe / Rob Cowan
Cowan, Rob
1998-01-01
Uuest heliplaadist "Pärt: Berliner Messe. The Beatitudes. Annum per Annum. Magnificat. Seven Magnificat Antiphons. De profundis. Polyphony / Steven Layton with Andrew Lucas" Hyperion CDA66960 (74 minutes:DDD)
Bergmann, K E; Bergmann, R L; Richter, R; Finke, C; Dudenhausen, J W
2009-11-01
In June 1909, The Empress Auguste Victoria House in Berlin was opened. This first institute for preventive paediatrics had the objective to overcome infant mortality in Germany. This objective was attained. Since then, an unprecedented decrease of mortality in all age groups occurred as well as a doubling of life expectancy. With this "retreat of death", our concepts of health changed fundamentally, and a new spectrum of diseases emerged. This article discusses some mile stones of this change, and explains why we find more illness despite the great improvement in the field of health. The "new diseases" amenable to early prevention are presented in a table. To make disease prevention successful requires the participation of the individual. Therefore, it is important to know the demand to make a good programme effective in the population. Empirical results of a nationwide representative study on the demand by expecting and young parents for preventive consultation are presented. Anticipatory guidance of young parents is a modern approach to health promotion and disease prevention. A controlled trial shows that this approach improved knowledge, behaviour, health risk indicators, health, and development during the first two years after delivery. Future studies should focus on long term effects of early health promotion. Copyright Georg Thieme Verlag KG Stuttgart . New York.
Energy Technology Data Exchange (ETDEWEB)
Mager, Hans; Schulz, Juergen; Weigand, Reinhold (comps.)
2011-06-15
With the move into the office building in the Stresemann Street in Berlin (Federal Republic of Germany), the Federal Ministry for the Environment, Nature Conservation and Nuclear Safety adopts a remarkable new building in the new centre of Berlin. It is the first Federal authority at all which works in a low-energy and passive house. This brochure under consideration reports on the history and architecture of the new office building as well as its sustainable energy management and life cycle assessments.
Berlin: Sustainability and Tour Guides in a Partial Dark Tourism Destination
Asaf Leshem
2013-01-01
When guiding in Berlin about the Holocaust or about the Cold War, tour guides often hear the phrase: “I didn’t come here for that, but I want to see that as well...” Many of Berlin’s 10 Million visitors per year claim to have an attraction towards both the morbid and the lighter side of the city. Following from that popular sentiment it is argued that Berlin can be defined as a Partial Dark Tourism Destination. As such, it is further argued that Berlin is prone to an increase of socio-econom...
Radiotherapy of benign diseases in Berlin (West)
International Nuclear Information System (INIS)
Saller, A.
1979-01-01
1. In Berlin (West), X-ray therapy was applied during the year 1973 in 18 hospitals and by 33 practicing physicians. The 3rd quarter of the year 1973 was taken as basis for the frequency of therapeutic X-ray application. From a total of 15912 patients, 9432 were X-rayed on account of malignant diseases, 6480 because of benigne diseases. This number definitely surpasses the number of cases treated in Munich by X-ray therapy. In Berlin, this might be connected to the age structure. 2. Utilizing the quotations and calculations put down in the report about the effect of atomic radiation by the Scientific Committee of the United Nations, and the values quoted for gonadal doses in the literature, a total-GSD-value of 0.82 +- 0.2 mrem/a was calculated for hospitals and practicing physicians in Berlin. In spite of higher frequencies, this value is approximately of the same order of magnitude as the values calculated for Munich for the year 1971 by I. and H.P. Schmelz. 3. The total-GSD-value for the population of the Federal Republic of Germany resulting from artificial radiation exposure during 1976 is reported to be approximately 60 mrem. Thus, the GSD-value for the X-ray therapy of benign diseases lies approximately at 1.3% and should be of minor significance for radiation-hygienic reflections. 4. Of primary concern is still the radiation exposure to individual patients. Because of possible secondary effects, X-ray therapy for keloids and hemangiomas in infancy and youth are of particular significance. For this reason, its proportion to GSD is also in Berlin relatively large. (orig.) [de
Energy Technology Data Exchange (ETDEWEB)
Gerth, H. [Weeber und Partner, Inst. fuer Stadtplanung und Sozialforschung, Berlin/Stuttgart (Germany)
1997-12-31
The initial and environment situations of the two apartment buildings in central Berlin and at Berlin-Marzahn are described including the structure of households. The procedure adopted in this social science project is also dealt with: participation and information of residents. The results of the survey among residents concerning satisfaction with redevelopment, thermal comfort prior to and after redevelopment, heating habits, and experience with automatic heating control are reported. (MSK) [Deutsch] Im Folgenden wird die Ausgangs-und Umgebungssituation der beiden Wohnhaeuser in Berlin-Mitte und Berlin-Marzahn geschildert. Dabei wird Auskunft ueber die Struktur der Haushalte gegeben. Ebenso wird die Vorgehensweise des sozialwissenschaftlichen Projekts beschrieben: Bewohnerbeteiligung und -information. Die Ergebnisse der Bewohnerbefragungen zu Zufriedenheit mit der Sanierung, zum Waermeempfinden vor und nach der Sanierung, zu Gewohnheiten in der Heizperiode, sowie zum Umgang mit der Heizungsregelungstechnik werden dargelegt.
Genetic research at a fivefold children's burial from medieval Berlin.
Rothe, Jessica; Melisch, Claudia; Powers, Natasha; Geppert, Maria; Zander, Judith; Purps, Josephine; Spors, Birgit; Nagy, Marion
2015-03-01
Berlin originated from the two twin cities Berlin and Cölln, which both were founded at the beginning of the 13th century. However the real date of their foundation as well as the origin of the first settlers is still unknown. On the Berlin site the historic city center is still visible in the Nikolaiviertel, but the medieval origin of Cölln disappeared almost completely. In 2007 a large scale excavation, which comprised an area of about 1700m(2) of the historical center of the St. Peters church, recovers the remains of Cölln's first citizens and span a period of 500 years of medieval population. Here we present the first genetic analysis of a fivefold children's burial from excavations in Berlin. The genetic data unveiled next to ancestry and eye color data also the kinship and the gender of the five individuals. Together with the archeological context the new gained information help to shed more light on the possible reasons for this burial. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Wauer, H J; Kühne, H; Kox, W J
2000-01-01
Soon after announcement of the first American ether anesthesias in 1846 one started to anesthetize with ether in Europe. The first ether anesthesia in Germany took place on January 24th, 1947, and was given by Johann Ferdinand Heyfelder in Erlangen. Two weeks later the first ether anesthesia in Berlin was given on February 6th, 1847, by the orthopaedic surgeon Heimann-Wolff Berend. On February 12th, 1847, the surgeon Johann Friedrich Dieffenbach used ether to anesthetize a patient in the Berlin university hospital. Still in 1847 he published his book "The Ether against Pain" which used to be the standard textbook of anesthesia in Germany for many years to come. On February 15th, 1847, Johann Christian Jüngken operated his first patient under ether anesthesia in the surgical department of the Charité hospital assisted by Rudolf Virchow. Since then several famous Berlin surgeons influenced the development of modern anesthesia until the middle of the 20th century. The nitrous oxide bottle was introduced into practice by the Barth company in cooperation with the dentist Carl Sauer and Kurt Schimmelbusch introduced his mask for ether anesthesia. Carl Ludwig Schleich reported at the German congress of surgery in 1894 about his first experience with infiltration anesthesia. Spinal anesthesia developed by August Bier in Kiel was improved during his time in Berlin.
Education through music--the model of the Musikkindergarten Berlin.
Uibel, Stefanie
2012-04-01
In 2005, the pianist and conductor Daniel Barenboim initiated the Musikkindergarten Berlin as the first kindergarten in which music is not only used as an occasional add-on but as the central education medium for the child every day. The skills of specially trained kindergarten teachers combined with regular visits by professional musicians of the Staatskapelle Berlin (the Berlin State Opera orchestra) form the basis of a new educational concept, in which children experience music in all its different aspects and in its unique capability as a transfer medium into all the other educational areas. In this context, the method, the aim, and the experimental ground is not only education in or with music, but through music. This paper provides information and examples about first-hand experiences over the last six years. © 2012 New York Academy of Sciences.
Energy Technology Data Exchange (ETDEWEB)
Hilse, Annika; Leix, Carmen; Fischer, Klaus; Kranert, Martin [Stuttgart Univ. (Germany). Inst. fuer Siedlungswasserbau, Wasserguete- und Abfallwirtschaft
2013-10-01
As a part of the overall project Stuttgart city with energy efficiency - SEE an integrated bioenergy concept Wilhelma at the Institute for Sanitary Engineering, Water Quality and Waste Management (ISWA) in cooperation with the Institute of Energy Economics and the Rational Use of Energy (IER) is created. The biomass potential analysis was recently completed; a differentiated analysis of energy demand is still pending. The Stuttgart Zoo Wilhelma has a significant biomass potential. With about 340 acres of gardens and parks which fall Wilhelma to care and the residue biomass of around 9000 zoo animals, offers the Stuttgart Zoo and Garden Wilhelma, together with the urban green space a high biomass potential, which is currently unused. For energy recovery through anaerobic digestion in a biogas plant are suitable 3900 t/a of biomass, which are 87% of the total exploitable biomass. For energy recovery by incineration are suitable 600 t/a of biomass, equivalent to the remaining 13% of recoverable biomass. This could be a total energy potential of about 6219 MWh/year are covered if the biomass is fully developed. Of these, 64% come from the fermentation and 36% from burning. About the determined biomass potential can be expected to be covered the electricity and heat demand of up to 16% (integrated bio-energy concept). To fully cover the energy requirements possibility of further use of renewable energy sources (e.g. solar panels on the roofs) must be examined and evaluated. (orig.)
Templehof Aprt, Berlin, Germany. Revised Uniform Summary of Surface Weather Observations (RUSSWO)
1977-09-16
OBSERVATIONS 78Ř USAF ETAC luo 64 0.14.5 (OL A) ..NVIOv ID.rO.,s oF INIs 1o1M Aft 0650til it DATA PRUCESStNG~ fRANCH J 4 ElA c CEILING VERSUS VISIBILITY AIR...BERLIN 67-76 )I STATION -. STA1IOMNAME FOOD I00T CUMULATIVE PERCENTAGE FREQUENCY OF OCCURRENCE lei (FROM HOURLY OBSERVATIONS) HOUR$ PERCENTAGE
The Berlin Wall: A Simulation for the Social Studies Classroom
Russell, William B., III
2010-01-01
November 9, 2009, marked the twentieth anniversary of the opening of the Berlin Wall. The Wall, a symbol of the Cold War, separated the German people for 28 years (1961-1989), keeping those on the East side isolated. Although the construction and dismantling of the Berlin Wall is a significant part of history, the topic is little covered in the…
“Modeling and Measuring Competencies” Conference, Berlin, 24-25 February 2011
Gulikers, J.T.M.; Mulder, M.
2013-01-01
In February 2011, I visited Berlin in order to attend a special conference on “Modeling and Measuring Competencies in Higher Education”, organized by the Humboldt University of Berlin and the Johannes Gutenberg University of Mainz. It was a special conference as it addressed this topic only over a
Rhythmanalysing Berlin Marathon
DEFF Research Database (Denmark)
Edensor, Tim; Larsen, Jonas
2017-01-01
This paper draws on Lefebvre’s rhythmanalysis to investigate the multiple rhythms of the Berlin Marathon, exemplifying and expanding understandings about the rhythms of places and mobilities. First, we discuss how isorhythmic order is imposed on the city and event by race organizers. Secondly, we...... show that a marathon depends upon the preparatory training or ‘dressage’ performed by the thousands who have made themselves ‘race-ready’. Thirdly, we explore the changing individual and collective rhythms that continuously emerge according to contingencies and stages of the race to compose...
Acute respiratory distress syndrome: the Berlin Definition.
Ranieri, V Marco; Rubenfeld, Gordon D; Thompson, B Taylor; Ferguson, Niall D; Caldwell, Ellen; Fan, Eddy; Camporota, Luigi; Slutsky, Arthur S
2012-06-20
The acute respiratory distress syndrome (ARDS) was defined in 1994 by the American-European Consensus Conference (AECC); since then, issues regarding the reliability and validity of this definition have emerged. Using a consensus process, a panel of experts convened in 2011 (an initiative of the European Society of Intensive Care Medicine endorsed by the American Thoracic Society and the Society of Critical Care Medicine) developed the Berlin Definition, focusing on feasibility, reliability, validity, and objective evaluation of its performance. A draft definition proposed 3 mutually exclusive categories of ARDS based on degree of hypoxemia: mild (200 mm Hg < PaO2/FIO2 ≤ 300 mm Hg), moderate (100 mm Hg < PaO2/FIO2 ≤ 200 mm Hg), and severe (PaO2/FIO2 ≤ 100 mm Hg) and 4 ancillary variables for severe ARDS: radiographic severity, respiratory system compliance (≤40 mL/cm H2O), positive end-expiratory pressure (≥10 cm H2O), and corrected expired volume per minute (≥10 L/min). The draft Berlin Definition was empirically evaluated using patient-level meta-analysis of 4188 patients with ARDS from 4 multicenter clinical data sets and 269 patients with ARDS from 3 single-center data sets containing physiologic information. The 4 ancillary variables did not contribute to the predictive validity of severe ARDS for mortality and were removed from the definition. Using the Berlin Definition, stages of mild, moderate, and severe ARDS were associated with increased mortality (27%; 95% CI, 24%-30%; 32%; 95% CI, 29%-34%; and 45%; 95% CI, 42%-48%, respectively; P < .001) and increased median duration of mechanical ventilation in survivors (5 days; interquartile [IQR], 2-11; 7 days; IQR, 4-14; and 9 days; IQR, 5-17, respectively; P < .001). Compared with the AECC definition, the final Berlin Definition had better predictive validity for mortality, with an area under the receiver operating curve of 0.577 (95% CI, 0.561-0.593) vs 0.536 (95% CI, 0.520-0.553; P
Bridge in Berlin Fragments of a journey between Necropolis and Elysium
DEFF Research Database (Denmark)
Pihl, Ole Verner
”Bridge in Berlin" af Ole Pihl Bogen ”Bridge in Berlin" er en ”Graphic Novel” og fænomenologisk poetisk rejse i tid og rum, der undersøger broens betydning i byen og i vores bevidsthed, eksemplificeret og fortalt fra en bestemt bro i Berlin, nemlig Friedrichsbrücke på Museums Insel. I fortællingen...... bliver broen fortolket på flere måder både som konkret forbindelse mellem to steder, to tilstande, arkitektur og kultur historie og som poetisk metafor for forandring og transformation. En af hovedpersonerne i bogen er den store tyske neoklassicistiske arkitekt Carl Friedrich Schinkel. Han fortæller...
The University of Stuttgart IKE/University of Arizona student research program
International Nuclear Information System (INIS)
Seale, R.L.
1988-01-01
The University of Stuttgart's Institut fuer Kernenergetik und Energiesysteme (IKE) and the University of Arizona have had a joint program in which graduate students from the IKE spend 1 yr on the University of Arizona campus. This program started in 1982 largely as the result of an initiative begun by K.H. Hoecker, then director of IKE. Since 1985, Alfred Voss has been director and the program has continued without interruption. Under the program, the Deutscher Akademisher Austauschdienst, a government agency of the Federal Republic of Germany has funded scholarships for students from IKE, which provide support for 1 yr during which they attend the University of Arizona as visiting student scholars and engage in a research project under the direction of one of our faculty, which satisfies a part of the requirements for the Ingenieur-Diplom Fachrichtung Maschinenbau. The students get credit for their research from the University of Stuttgart. The topics have a broad range and include software development, artificial intelligence, radiation transport, and energy management studies
Energy Technology Data Exchange (ETDEWEB)
McLead, E.A.
2002-07-01
Designing and constructing the technical facilities for a historical building like the 'Spreespeicher' in Berlin is a difficult but interesting task. The building is owned by Universal Music. Each department has its own office structure, and all offices and structures were integrated in a functional overall concept by the planners of Happold Ingenieure. [German] Klima, Lueftung und Elektroinstallation fuer ein historisches Gebaeude wie den Berliner Spreespeicher zu entwickeln, ist eine schwierige, aber reizvolle Aufgabe. Besonders, wenn der Nutzer Universal Music heisst: Jede Abteilung besitzt ihre eigene Buerostruktur, und alle mussten die TGA-Planer von Happold Ingenieure in ein funktionierendes Gesamtkonzept integrieren. (orig.)
Torre de televisión, Stuttgart
Directory of Open Access Journals (Sweden)
Leonhardt, F.
1957-11-01
Full Text Available Descripción general y estudio estático de la torre de televisión, construida en Stuttgart, de unos 310 m de altura total —antena metálica incluida— y provista de una especie de tronco de cono invertido, de mayor diámetro medio que el del fuste de la torre que, situado en la parte superior de la torre entre los 138 y 150 m de altura respecto al suelo, se ha subdividido, en altura, formando cuatro plantas, en las que se han alojado los servicies y un restaurante. Por encima de este cuerpo superior troncocónico se ha construido una terraza para poder disfrutar de espléndidas vistas panorámicas. La torre propiamente dicha tiene 10,8 m de diámetro en la base y 5,04 m en la parte superior, con una altura de 138 m entre estas dos secciones extremas.
The acceleration of the masculine in early-twentieth-century Berlin.
Prickett, David James
2012-01-01
In early-twentieth-century Berlin, agents of speed and industrialisation, such as the railway, contributed to the seemingly unbridled velocity of urban life. Doctors and cultural critics took an ambivalent stance toward the impact of speed and technology on the human body. Critics argued that these factors, in conjunction with sexual excess and prostitution, accelerated the sexual maturation of young men, thereby endangering ‘healthy’ male sexuality. This comparison of Hans Ostwald's socio-literary study Dunkle Winkel in Berlin (1904) with Georg Buschan's sexual education primer Vom Jüngling zum Mann (1911) queries the extent to which speed shaped the understanding of ‘the masculine’ in pre-World-War-I Germany. The essay thus examines Ostwald's and Buschan's arguments and postulates that speed in the city (Berlin) can be seen as a feminised, sexualised force that determined sex in the city. According to this reading, the homosexual urban dandy resisted the accelerated modernist urban tempo, whereas the heterosexual man and hegemonic, heteronormative masculinity yielded to speed. ‘“Das Verhältnis”’ became a fleeting, momentary alternative to stable marital relationships, which in turn contributed to the general ‘crisis’ of – and in– masculinity in early-twentieth-century Berlin.
Safe water supply without disinfection in a large city case study: Berlin.
Grohmann, A; Petersohn, D
2000-01-01
Berlin's water supplies originate exclusively from groundwater. For sustainable water management, river water is treated by flocculation and filtration and used either for artificial groundwater recharge (rivers Spree and Havel) or for bank filtration (Nordgraben and Lake Tegel). Drinking water chlorination was abandoned in Berlin (West) in 1978, and in Berlin (East) in 1992, following German unification. Chlorine consumption for the purpose of weekly performance checks in the chlorination plants of Berlin's 11 waterworks and occasional chlorination within the pipe system following pipe burst events amounts to 2500 kg per year. Based on the annual water demand of 250 million cubic metres, this is equivalent to 0.01 mg of chlorine per litre. Microbiological monitoring at the 11 waterworks and at 383 sampling points within the pipe system shows CFU at less than 10/1 ml-1 and coliforms and E. coli invariably at 0/100 ml-1. In view of the low AOX content, a multiplication of bacteria within the pipe system can be expected to occur not at all or only to a small extent. Resource protection measures, filter backwashing and pipe system maintenance in observance of the relevant technical rules will continue to ensure that the quality of Berlin's drinking water meets stringent hygiene requirements without chlorination.
Pasarela suspendida en Stuttgart
Directory of Open Access Journals (Sweden)
Leonhardt, Fritz
1963-06-01
Full Text Available Following the gardening exhibition held in Stuttgart in 1961, the parks and gardens along the river Neckar have been greatly improved and modified, and as there is a considerable pedestrian traffic in this zone, it became necessary to build a footbridge to cross one of the main roadways. This footbridge leads on one side towards the station and on the other in the direction of the Theatre Palace. A public competition was organised to find the best design for this structure, and various firms submitted projects. The chosen one consists of a suspended, metal, flattened arch structure, and a thin walking deck. The arch has 90 ms span, and approach ramps, since the large number of pedestrians precluded the use of steps. The arched box girder is 0.5 ms deep and 5.50 ms wide. The beam is continuous, and hangs from cables which are attached at five points of the bridge, at points separated from each other 18, 17, 17, 17 and 18 ms. These cables run over a metal pillar. To give the pillar greater stability, a number of piles were driven into the ground, and the foundation block for the pillar was placed on these piles. Although the soil is not sufficiently stable to avoid small settlements of the foundations, this is not too important, since the structure is suspended, and small settlements, of even a few centimetres, would not modify the strength and stability of the project.Como consecuencia de la exposición de jardinería, celebrada en la ciudad de Stuttgart en 1961, los jardines y parques que se extienden hacia el río Neckar han experimentado una profunda modificación, y, como en esta zona el tráfico de peatones es de consideración, se ha creído necesario levantar una pasarela que cruce una avenida de gran circulación rodada. Este paso superior se bifurca, a un lado, en dos direcciones distintas cuyas rampas se orientan: una hacia la estación y la otra hacia la zona del palacio de la Diputación y Teatros. La estructura se sacó a concurso p
Chukwuma Charles Soludo
2012-01-01
The paper evaluates the economic partnership agreement (EPA) which the European Union is forging with African, Caribbean and Pacific (ACP) countries and concludes that it is a raw deal for these developing countries. Particularly for Africa, the author likens the EPA to the Berlin conference of 1884–1885 that divided Africa among the European powers. EPA as the second scramble for Africa would merely turn Africa into a dumping ground for European goods and severely undermine its nascent dev...
Barreira, Eliane R; Munoz, Gabriela O C; Cavalheiro, Priscilla O; Suzuki, Adriana S; Degaspare, Natalia V; Shieh, Huei H; Martines, João A D S; Ferreira, Juliana C; Lane, Christianne; Carvalho, Werther B; Gilio, Alfredo E; Precioso, Alexander R
2015-05-01
In 2012, a new acute respiratory distress syndrome definition was proposed for adult patients. It was later validated for infants and toddlers. Our objective was to evaluate the prevalence, outcomes, and risk factors associated with acute respiratory distress syndrome in children up to 15 years according to the Berlin definition. A prospective, multicenter observational study from March to September 2013. Seventy-seven PICU beds in eight centers: two private hospitals and six public academic hospitals in Brazil. All children aged 1 month to 15 years admitted to the participating PICUs in the study period. None. All children admitted to the PICUs were daily evaluated for the presence of acute respiratory distress syndrome according to the American-European Consensus Conference and Berlin definitions. Of the 562 patients included, acute respiratory distress syndrome developed in 57 patients (10%) and 58 patients (10.3%) according to the Berlin definition and the American-European Consensus Conference definition, respectively. Among patients with acute respiratory distress syndrome according to the Berlin definition, nine patients (16%) were mild, 21 (37%) were moderate, and 27 (47%) were severe. Compared with patients without acute respiratory distress syndrome, patients with acute respiratory distress syndrome had significantly higher severity scores, longer PICU and hospital length of stay, longer duration of mechanical ventilation, and higher mortality (p < 0.001). The presence of two or more comorbidities and admission for medical reasons were associated with development of acute respiratory distress syndrome. Comparisons across the three the Berlin categories showed significant differences in the number of ventilator-free days (21, 20, and 5 d, p = 0.001) and mortality for severe acute respiratory distress syndrome (41%) in comparison with mild (0) and moderate (15%) acute respiratory distress syndrome(p = 0.02). No differences in PICU or hospital stay were
Berlin: Sustainability and Tour Guides in a Partial Dark Tourism Destination
Directory of Open Access Journals (Sweden)
Asaf Leshem
2013-10-01
Full Text Available When guiding in Berlin about the Holocaust or about the Cold War, tour guides often hear the phrase: “I didn’t come here for that, but I want to see that as well...” Many of Berlin’s 10 Million visitors per year claim to have an attraction towards both the morbid and the lighter side of the city. Following from that popular sentiment it is argued that Berlin can be defined as a Partial Dark Tourism Destination. As such, it is further argued that Berlin is prone to an increase of socio-economic and socio-cultural negative impacts. The premise of the research is that Berlin’s tour guides function as a link between the residents of the city and the visitors. The thesis, then, is that tour guides play a role and can contribute to development of social, cultural and economic urban tourism sustainability. An analysis of tourism impacts and tourists-residents relations is presented, in which the tour guide plays a role in influencing the visitor’s behaviour. I conclude that tour guides have greater influence on social, cultural and economic behaviour of the tourist than previously considered, and therefore a potential to enhance sustainable tourism development in Berlin. The significance of this research is in the way it points out to the roles Berlin tour guides play in facilitation of sustainable tourism development in the city. Furthermore, the research shows the ways in which tour guides contribute to increasing responsible tourist behaviour.
Extreme ultraviolet spectroscopy of highly charged argon ions at the Berlin EBIT
International Nuclear Information System (INIS)
Biedermann, C; Radtke, R; Fussmann, G; Allen, F I
2007-01-01
Extreme ultraviolet radiation from highly charged argon was investigated at the Berlin Electron Beam Ion Trap with a 2 m grazing incidence spectrometer. Lines in the wavelength range 150 to 660 A originating from C-like Ar 12+ to Li-like Ar 15+ ions have been identified and are compared with database information from solar line lists and predictions. Line ratios for the observed resonance, intercombination and forbidden lines offer important diagnostic capabilities for low density, hot plasmas
Kalevipoeg - ein Interview mit Prof. Dr. Peter Petersen / Peter Petersen ; interv. Laine Paavo
Petersen, Peter
2005-01-01
Kalevipoja uuest saksakeelsest väljaandest: Kalevipoeg : das estnische Nationalepos / in der Übersetzung von Ferdinand Löwe ; herausgegeben von Peter Petersen Ilm. andmed Stuttgart ; Berlin : Mayer, 2004.
Directory of Open Access Journals (Sweden)
Samuel Merrill
2014-10-01
Full Text Available Ende 2012 hat das Zitty Magazin des Tagesspiegels seine Werbekampagne „Das ist so Berlin“ gestartet. Seither sind kleine rot-weiße Aufkleber mit dieser Aussage überall in der Stadt aufgetaucht, auf Mülleimern, U-Bahn-Schildern und Bushaltestellen. Zum Teil als Reaktion auf diese Kampagne, fragt diese kritische, bilinguale Rezension Was ist so Berlin? um die aktuellen Linien und Fragestellungen der Stadtforschung in Berlin zu diskutieren. Dazu werden die Berlin-Sitzungen zweier internationaler Tagungen des Jahres 2013 rezensiert, die Sitzungen der Jahreskonferenz der Association of American Geographers (Los Angeles 9-13 April und es Jahrestreffen des Research Committee 21 (Berlin 29-31, sowie der Sammelband – The Berlin Reader: A Compendium on Urban Change and Activism (Transcript, 2013, herausgegeben von Matthias Bernt, Britta Grell und Andrej Holm. Im Anschluss betont die Rezension die Notwendigkeit die Vorstellungen zu Berlin und Berlins exceptionalism, die in der Stadtforschung entwickelt werden, fortlaufend so zu beleuchten, dass eine pluralistische Rhetorik, die Position und Verantwortung von Forscher_innen und wissenschaftliche Forschungslücken, berücksichtigt werden.
2013-07-10
...) to be located on a water supply conduit at the City of Berlin's municipal water treatment plant (WTP... diameter cement-transite water main leading to the City's WTP; (2) piping, valves, control panels, and.... The WTP will use the power produced by the proposed project to run process equipment, lighting, and...
Srovnání vybraných burzovních trhů v německy mluvících zemích
Horáková, Veronika
2010-01-01
This bachelor thesis compares four regional stock exchanges in Germany. These are stock exchanges in Berlin, Munich, Stuttgart and Frankfurt. The Frankfurt stock exchange is the most important stock market in Germany and it is often used as a benchmark for the whole German market. The goal of this paper is to inform about the system of the German stock market system in general and describe not only the well-known Frankfurt stock exchange but the smaller stock exchanges of regional importace a...
The role of studies and analysis in the Berlin crisis
International Nuclear Information System (INIS)
Schake, K.
1994-01-01
The question posed for this conference was whether military exercises, studies and analysis have made an appreciable difference in the policies associated with tactical nuclear forces (TNF) in the North Atlantic Treaty Organization (NATO). Some of the papers leave the impression that studies, analysis and military exercises have very little impact on the strategy, policy decisions and force posture of NATO tactical nuclear forces. The studies and analyses undertaken during the 1961 Berlin crisis suggest a very different conclusion: that studies and analyses, when specific in scope and carrying some sense of immediacy, can be enormously influential. Whether one considers the changes to be positive or negative, the experience of the 1961 Berlin crisis suggests that studies and analyses had a tangible and direct impact both on contingency planning for the Berlin crisis specifically and on discussions of the role of tactical nuclear forces more broadly. The results of these studies and analyses are discussed
Energy Technology Data Exchange (ETDEWEB)
Vogt, Regine; Fehrenbach, Horst [ifeu - Institut fuer Energie- und Umweltforschung Heidelberg GmbH, Heidelberg (Germany); Wiegel, Ulrich; Ebert, Knud [ICU - Ingenieurconsulting Umwelt und Bau Berlin, Berlin (Germany); Schwilling, Thomas; Mehner, Heidelinde [SenStadtUm - Senatsverwaltung fuer Stadtentwicklung und Umwelt, Berlin (Germany). Referat Abfallwirtschaft
2013-05-15
On behalf of the Senate Department for Environment of the State of Berlin IFEU Heidelberg and ICU Berlin analysed a climate friendly waste treatment for the 36 most important waste types. The inventory for 2010 showed that the management of the 6.7 million tonnes of waste in the State of Berlin led to a remarkable prevention of greenhouse gas emissions of about -900,000 tonnes of CO{sub 2}-equivalents. Treatment optimisation for half of the waste types and increased source separation of dry recyclables and organics can lead to an additional mitigation of greenhouse gases of about -248,000 tonnes CO{sub 2}-equivalents. The impact of waste management on the global warming potential was determined using the standardised LCA method modified for waste management. A key element of the study was the intensive and constructive exchange with stakeholders. The results were integrated into an action plan based on the findings of the analysis of potentials and optimisation scenarios. For the relevant waste types of municipal origin property specifications were prepared. The specifications include distinct minimum criteria for an optimised treatment to reach the identified waste specific greenhouse gas reductions. The focus of the study was on climate change. A second study will be extended to further important environmental impacts like resource saving. (orig.)
International Nuclear Information System (INIS)
Loechel, B; Erko, A; Lemke, St; Senf, F; Nelles, B; Schmidt, M
2013-01-01
In 2009 Carl Zeiss stopped the manufacture of precision gratings. All users of their gratings were very concerned about this decision, since they all need precision gratings for their experiments. One of the institutes of the HZB, the Institute for Nanometer Optics and Technology (INT), has extensive experience in micro fabrication (technology group). In spring 2010, HZB decided to take over the old C. Zeiss grating fabrication and build up its own technology center for grating fabrication. In March 2010, the INT applied to the Senate of Berlin for funding for our project from the European Regional Development Fund (ERDF). In October 2010, HZB received an approval of its application from the Senate of Berlin (contract No 20072013 2/43). Using this governmental support, HZB will install all necessary equipment and processes to fulfill these demands until end of 2013.
Hernu, R; Wallet, F; Thiollière, F; Martin, O; Richard, J C; Schmitt, Z; Wallon, G; Delannoy, B; Rimmelé, T; Démaret, C; Magnin, C; Vallin, H; Lepape, A; Baboi, L; Argaud, L; Piriou, V; Allaouchiche, B; Aubrun, F; Bastien, O; Lehot, J J; Ayzac, L; Guérin, C
2013-12-01
The Berlin definition for acute respiratory distress syndrome (ARDS) is a new proposal for changing the American-European consensus definition but has not been assessed prospectively as yet. In the present study, we aimed to determine (1) the prevalence and incidence of ARDS with both definitions, and (2) the initial characteristics of patients with ARDS and 28-day mortality with the Berlin definition. We performed a 6-month prospective observational study in the ten adult ICUs affiliated to the Public University Hospital in Lyon, France, from March to September 2012. Patients under invasive or noninvasive mechanical ventilation, with PaO2/FiO2 Conference and the Berlin definition criteria. The complete data set was measured at the time of inclusion. Patient outcome was measured at day 28 after inclusion. During the study period 3,504 patients were admitted and 278 fulfilled the American-European Consensus Conference criteria. Among them, 18 (6.5 %) did not comply with the Berlin criterion PEEP ≥ 5 cmH2O and 20 (7.2 %) had PaO2/FiO2 ratio ≤200 while on noninvasive ventilation. By using the Berlin definition in the remaining 240 patients (n = 42 mild, n = 123 moderate, n = 75 severe), the overall prevalence was 6.85 % and it was 1.20, 3.51, and 2.14 % for mild, moderate, and severe ARDS, respectively (P > 0.05 between the three groups). The incidence of ARDS amounted to 32 per 100,000 population per year, with values for mild, moderate, and severe ARDS of 5.6, 16.3, and 10 per 100,000 population per year, respectively (P Berlin definition of ARDS. Neither the stratification by severity nor the PaO2/FiO2 at study entry was independently associated with mortality.
The S-Bahn Challenge in Berlin
Beckenbach, Isabel; Borndörfer, Ralf; Knoben, Loes; Kretz, David; Uetz, Marc Jochen
Traveling an entire subway or S-Bahn network as fast as possible has become a kind of sport in many major cities, with increasing popularity. The Guinness Book of Records already has several entries in this category, all quite recent. Of course, the S-Bahn network of Berlin had been a blatant gap in
A comparison of municipal solid waste management in Berlin and Singapore
International Nuclear Information System (INIS)
Zhang Dongqing; Keat, Tan Soon; Gersberg, Richard M.
2010-01-01
A comparative analysis of municipal solid waste management (MSWM) in Singapore and Berlin was carried out in order to identify its current status, and highlight the prevailing conditions of MSWM. An overview of the various aspects of MSWM in these two cities is provided, with emphasis on comparing the legal, technical, and managerial aspects of MSW. Collection systems and recycling practiced with respect to the involvement of the government and the private sector, are also presented. Over last two decades, the city of Berlin has made impressive progress with respect to its waste management. The amounts of waste have declined significantly, and at the same time the proportion that could be recovered and recycled has increased. In contrast, although Singapore's recycling rate has been increasing over the past few years, rapid economic and population growth as well as change in consumption patterns in this city-state has caused waste generation to continue to increase. Landfilling of MSW plays minor role in both cities, one due to geography (Singapore) and the other due to legislative prohibition (Berlin). Consequently, both in Singapore and Berlin, waste is increasingly being used as a valuable resource and great efforts have been made for the development of incineration technology and energy recovery, as well as climate protection.
Directory of Open Access Journals (Sweden)
Ana Souto
2018-03-01
Full Text Available This article explores memory studies from the audience’s perspective, focusing on the perception of Holocaust narratives in two museums in Berlin. This research builds on and contributes to a number of emerging issues on memory studies, tourism perception and museum design: the debate on experiential authenticity, Dark Tourism, as well as the analysis of memory studies from the perspective of the user. The main data facilitating the analysis is based on responses shared on TripAdvisor; the case studies being the Otto Weidt Workshop for the Blind Museum and the Jewish Museum Berlin. The analysis of these museums, focusing on their narratives, design features and comments from visitors, will highlight a potential shift from the traditional object-focused museum, to a phenomenological subject-focused one. It will be argued, then, that the understanding and consumption of authenticity encompasses a very flexible definition, not only based on the nature of the objects exhibited, but on the production of authentic experiences.
The Berlin tradition in Chicago: Franz Alexander and the Chicago Institute for Psychoanalysis.
Schmidt, Erika S
2010-01-01
Freud considered Franz Alexander, the first graduate of the Berlin Psychoanalytic Institute and an assistant in the Berlin Polyclinic, to be "one of our strongest hopes for the future." Alexander went on to become the first director of the Chicago Institute for Psychoanalysis in 1932 and modeled some of the Chicago Institute's mission on his Berlin experiences. He was also a researcher in psychosomatic medicine, a prolific writer about psychoanalysis and prominent in psychoanalytic organizations. As he proposed modifications in psychoanalytic technique, he became a controversial figure, especially in the elaboration of his ideas about brief therapy and the corrective emotional experience. This paper puts Alexander's achievements in historical context, draws connections between the Berlin and Chicago Institutes and suggests that, despite his quarrels with traditional psychoanalysis, Alexander's legacy may be in his attitude towards psychoanalysis, characterized by a commitment to scientific study, a willingness to experiment, and a conviction about the role of psychoanalysis within the larger culture.
ITB Berlin: The world's leading tourism fair
Directory of Open Access Journals (Sweden)
Đeri Lukrecija
2010-01-01
Full Text Available MICE is a significant segment of tourism industry. It is of great interest for exhibitors and visitors, as well as for host cities and organizers. ITB Berlin represents the world's leading travel trade show. This paper analyses the key trends of this event in the last five year period (from 2004 until 2008. Analyzed data was annually gathered by Gelzus Messe-Marktforschung GmbH. This research focused on exhibitors', trade visitors and private visitors' origin, age distribution of private visitors, exhibiting companies, exhibiting branches, interest for travel according to type and overall impression and outlook that was gathered through surveys at ITB Berlin. Data was collected in the period 2004-2008 and placed together to make a five year overview. The goal is to present a development of above mentioned values and to discover potential patterns and predict future trends for this tourism fair. .
Fegert, J M; Geiken, G; Lenz, K
1992-12-01
The fall of the Berlin wall caused a sudden increase in migration from East-Germany to West-Berlin. In our sample we compared 155 Berlin elementary school children to 17 children from East-Germany now living in Berlin and 25 immigrant children most oft them coming from Turkey and Poland. Although many authors expected short-term disorders of adaptation, we found a constancy of psychiatric diagnosis in the migration group. We noticed important differences particularly in the new psychosocial situation of the former East German mothers, with many single-mother-families, where the mothers now were often unemployed.
Dynamics of Sub-urbanisation - The Growing Periphery of the Metropolis. Berlin 1890 - 2000
H. Reif (Heinz)
2003-01-01
textabstractWhat controls the secular process of sub-urbanisation of Berlin to garden and satellite cities and what were the effects? Through the massive retreat of its wealthy and academic bourgeoisie from the centre, Berlin became a bipolar city. On this side of the "railway ring", stood the
Ecological monitoring for Berlin and its back country
International Nuclear Information System (INIS)
Meyer, G.
1992-01-01
In 1991, the city of Berlin started the implementation of the 'monitoring program natural budget'. The aim of this program is the assessment of biological and ecological effects of atmospheric pollution as well as the analysis and evaluation of the functioning of the natural balance in pine forest ecosystems in the city area of Berlin and in the close vicinity. The investigations should make temporal and regional statements possible. Techniques of active and passive monitoring are applied (effect cadastre) as well as extensive investigations in long-term observation areas (at present pine forest systems). The ecosystem itself is in the foreground as a sensitive indicator for an existing atmospheric pollution load. The results should enable forecasts of the development of the related organisms and the ecosystems under the effect of anthropogenic load factors. (orig.) [de
Individuality and modernity in Berlin: self and society from Weimar to the Wall
Föllmer, M.
2013-01-01
Moritz Föllmer traces the history of individuality in Berlin from the late 1920s to the construction of the Berlin Wall in August 1961. The demand to be recognised as an individual was central to metropolitan society, as were the spectres of risk, isolation and loss of agency. This was true under
Directory of Open Access Journals (Sweden)
B. A. R. Mohr
2003-01-01
Full Text Available In dieser Untersuchung werden beispielhaft die Lebenswege und Karrieren von Berliner Geowissenschaftlerinnen im Zeitraum von 1906 bis 1945 nachgezeichnet und analysiert. Ähnlich wie an anderen deutschen bzw. westlichen Universitäten, aber im Gegensatz zu Russland, begann die Tätigkeit von Frauen in den Geowissenschaften spät, und das Fach wurde auch relativ selten gewählt, hauptsächlich wegen der zu geringen Berufschancen. Aber die besondere Situation in Berlin mit mehreren sich ergänzenden Institutionen und dem daraus resultierenden breiten Spektrum an geowissenschaftlichen Disziplinen, sowie ausgezeichneten Professoren, ließ dennoch Raum für eine Ausbildung in diesem Bereich und erlaubte, wenn auch in bescheidenem Maße, eine gewisse Karrieremöglichkeit. Während der hier untersuchten 40 Jahre haben weniger als 20 Frauen in den Geowissenschaften und benachbarten Gebieten promoviert. Mehrere dieser Frauen blieben in dem von ihnen gewählten Fach weiterhin aktiv und wurden erfolgreich. Zwei Frauen gelang eine akademische Karriere — eine als Universitätsprofessorin, die auch Schülerinnen hatte. Andere arbeiteten an staatlichen Institutionen, wie z. B. dem Geologischen Landesamt. Wenige Frauen blieben nach ihrer Verheiratung beruflich aktiv, wenn auch nicht offiziell angestellt, sondern als Ehefrauen. Andere arbeiteten als "Ersatz" für die im Kriege stehenden Männer. Einige waren aus persönlichen und politischen Gründen, insbesondere während der NS-Zeit, gezwungen, die Geowissenschaften zu verlassen, konnten aber teilweise auf anderen Gebieten erfolgreich arbeiten. This paper documents the lives and careers of women geoscientists at the Berlin Friedrich-Wilhelms-University from 1906 through 1945. Traditionally, in Germany, women had difficulties to be accepted in geosciences (except for geography/geology teachers, because of strong links between geology and mining, a field dominated clearly by men. In western European countries
The Humboldt High Magnetic Field Center at Berlin
International Nuclear Information System (INIS)
Hansel, S; Mueller, H-U; Anh, T T; Richter, B; Rossmann, H; Ortenberg, M von
2006-01-01
The Humboldt High Magnetic Field Center is operated by the Chair for Magnetotransport in Solids of the Department of Physics of the Humboldt-Universitaet zu Berlin. It provides DC-magnetic fields up to 20 T, pulsed nondestructive fields of up to 60 T and megagauss fields of up to 331 T using a single-turn coil generator for experimental application focusing on solid state physics. Magneto-optical investigations are carried out in the MIR, NIR and visible wavelength range as well as transport and magnetization experiments. The facility is open to the scientific community and welcomes users within the European project EuroMagNET. The laboratory will be closed in fall 2006 but its experimental facilities will be further accessible to the community in other labs. The single-turn coil generator will be transferred to LNCMP, Toulouse, France, continuing to provide applicable megagauss fields to the European Community
Symbolic Uses of the Berlin Wall, 1961-1989.
Bruner, Michael S.
1989-01-01
Examines samples from public discourse during the period 1961-1989, which reveal several different symbolic uses of the Berlin Wall. Suggests these differences reflect the never-completed struggle between the United States and the Soviet Union. (KEH)
Zweiwegintegration durch zweisprachige Bildung? Ergebnisse aus der Staatlichen Europa-Schule Berlin
Meier, Gabriela
2012-06-01
While there is no simple recipe of how to respond to the multitude of languages present in many European schools, this article presents a promising alternative to monolingual education. The focus is on Staatliche Europa-Schule Berlin (SESB), a two-way immersion (TWI) model that unites children whose mother tongue is German with children whose mother tongue is another locally spoken language in one class and teaches them together in two languages. Thus in this model, offered by 17 primary schools and 13 secondary schools in Berlin, pupils learn in two languages from and with each other. Based on a largely quantitative, quasi-experimental study with 603 students, evidence is provided that there are a number of peace-linguistic benefits that can promote two-way social integration, besides fostering personal and societal multilingualism. This suggests that TWI education as practised in Berlin could serve as an educational model for other multilingual parts of Europe.
[From traditional to modern hospital--from Paris to Berlin].
Murken, Axel Hinrich
Discussions about the modernisation and reform of the Hôtel Dieu in Paris concerning the catastrophic fire of 1772 there were followed very closely in Prussia and other German countries, though for a long time this had only slight consequences for modernising developments in the hospitals of Berlin or other administrative capitals of Germany. In contrast to this, the Hôpital Lariboisière was praised as a model example in Germany soon after its completion in 1854 after the pre-revolutionary Parisian plans, was imitated in Berlin twenty years later. It must be added that in Prussia great importance was attached to stricter requirements for hygiene and ventilation than in Paris. This was clearly demonstrated barely in the construction of the pavilionhospital in Berlin-Friedrichshain (1868-1874) with an extremely decentralized layout. It was not until two generations later with the completion of the municipal hospital Westend in Charlottenburg (1904-1907), a suburb of Berlin, that a slightly modified "Lariboisière" in the Wilheminian brick Baroque style was built. Similarily the acceptance of high-rise construction was, compared with Paris, considerably delayed on the German hospital scene. Whereas in the USA and France plans had been made for high-rise hospitals from the 1920s on and realized by 1935, as with the Hôpital Beaujon in Paris (1932-1935), there were fundamental reservations about them in Germany. As a result, this conception of the structure, with an effective concentration of inpatient care in towers together with separate low-rise buildings for functions such as treatment and diagnosis, only gradually gained acceptance in Germany at the end of the 1960s. On the other hand, German architects such as Hermann Distel (1875-1946) or Ernst Kopp (1890-1962), had already, indeed before the Second World War, promoted the high-rise type for inpatient care on theoretical grounds. In addition, two hospitals providing medical care within in Berlin, Martin
The Berlin International Consensus Meeting on Concussion in Sport.
Davis, Gavin A; Ellenbogen, Richard G; Bailes, Julian; Cantu, Robert C; Johnston, Karen M; Manley, Geoffrey T; Nagahiro, Shinji; Sills, Allen; Tator, Charles H; McCrory, Paul
2018-02-01
The Fifth International Conference on Concussion in Sport was held in Berlin in October 2016. A series of 12 questions and subquestions was developed and the expert panel members were required to perform a systematic review to answer each question. Following presentation at the Berlin meeting of the systematic review, poster abstracts and audience discussion, the summary Consensus Statement was produced. Further, a series of tools for the management of sport-related concussion was developed, including the Sport Concussion Assessment Tool Fifth edition (SCAT5), the Child SCAT5, and the Concussion Recognition Tool Fifth edition. This paper elaborates on this process, the outcomes, and explores the implications for neurosurgeons in the management of sport-related concussion. Copyright © 2017 by the Congress of Neurological Surgeons.
Nature reserve Pfaueninsel in Berlin-Wannsee. V. The Lichen Flora
Energy Technology Data Exchange (ETDEWEB)
Grummann, V J; Poelt, J
1972-01-01
During the years 1965-1971 about 95 species of lichens were identified within the district of West Berlin. A few of them were growing on trees; corticolous foliaceous species are present in very reduced numbers, and the surviving individuals do not appear healthy. The majority of the species are found on walls and large rocks or on the ground in pine woods. Even these species are showing signs of diminution. Several species seem to have disappeared since the beginning of the observations. Air pollution is singled out as the cause of the decline of the lichens. Berlin today must be considered a lichen desert. 29 references, 2 figures.
Urban and rural mortality rates during heat waves in Berlin and Brandenburg, Germany
International Nuclear Information System (INIS)
Gabriel, Katharina M.A.; Endlicher, Wilfried R.
2011-01-01
In large cities such as Berlin, human mortality rates increase during intense heat waves. Analysis of relevant data from north-eastern Germany revealed that, during the heat waves that occurred between 1990 and 2006, health risks were higher for older people in both rural and urban areas, but that, during the two main heat waves within that 17-year period of time, the highest mortality rates were from the city of Berlin, and in particular from its most densely built-up districts. Adaptation measures will need to be developed, particularly within urban areas, in order to cope with the expected future intensification of heat waves due to global climate change. - Highlights: → Periods of heat stress enhance mortality rates in Berlin and Brandenburg. → Heat-related mortality is an urban as well as a rural problem. → During extreme events highest mortality rates can be found in the city centre. → Mortality rates correlate well with the distribution of sealed surfaces. → Health risks are higher for older than for younger people. - During periods of severe heat stress the pattern of mortality rates in Berlin and Brandenburg was found to correlate well with the distribution of sealed surfaces.
10. ročník „Berlin 10“ konference v Jihoafrické republice
Czech Academy of Sciences Publication Activity Database
Burešová, Iva
-, č. 4 (2012) E-ISSN 1805-2800. [Berlin10. Stellenbosch, 06.11.2012-08.11.2012] Keywords : conferences * Berlin Open Access Conference * open access http://www.lib.cas.cz/casopis-informace/10-rocnik-%E2%80%9Eberlin-10-konference-v-jihoafricke-republice/
Directory of Open Access Journals (Sweden)
Andrew Hurley
2011-09-01
Full Text Available Hubertus Siegert’s impressionistic documentary, Berlin Babylon, illuminates the demolition and urban renewal of Berlin during the mid-late 1990s. This was a critical phase in the city’s history, as it prepared, amidst a flurry of excitement and anticipation, to become the united Germany's seat of power. Siegert's film seeks to give pause for thought, but deliberately eschews a “voice of god” voiceover, opting instead for a poetic audiovisual montage. This includes shots of the cityscape (and its lacunae, archival footage documenting the wartime devastation and subsequent dynamiting of buildings, observational cinema of the city’s busy building sites, and of verbal snippets from various architects, developers and politicians––following the film title’s cue, the agents in a rerun of the construction of the Tower of Babel––as well as epigraphs from the Bible and Walter Benjamin, and a prominent soundscape and musical score. As this article will demonstrate, the film’s (mostly sombre soundtrack plays a critical role here, commenting on the footage, and beyond that on the whole project of the new ‘Berlin Republic’ and its attitude to architectural heritage and twentieth century history. Re-figuring the theme of this volume, Berlin Babylon’s music is a form of writing about (collapsing, old architecture and history. And yet, the soundtrack is not as unambiguous as a voiceover might have been, and thereby allows creative space for the audience’s interpretation, a matter that was very important to the film’s director. This article will focus, in particular, on three elements: the use (and treatment of historical recordings in the film; the use of silence; and finally the way in which tracks from the Berlin band Einstürzende Neubauten use music, noise and text to comment on the project of the new Berlin.
Berlin Reflectance Spectral Library (BRSL)
Henckel, D.; Arnold, G.; Kappel, D.; Moroz, L. V.; Markus, K.
2017-09-01
The Berlin Reflectance Spectral Library (BRSL) provides a collection of reflectance spectra between 0.3 and 17 µm. It was originally dedicated to support space missions to small solar system bodies. Meanwhile the library includes selections of biconical reflectance spectra for spectral data analysis of other planetary bodies as well. The library provides reference spectra of well-characterized terrestrial analogue materials and meteorites for interpretation of remote sensing reflectance spectra of planetary surfaces. We introduce the BRSL, summarize the data available, and access to use them for further relevant applications.
A new superhard carbon allotrope: Orthorhombic C20
Wei, Qun; Zhao, Chenyang; Zhang, Meiguang; Yan, Haiyan; Zhou, Yingjiao; Yao, Ronghui
2018-06-01
A new superhard carbon orthorhombic allotrope oC20 is proposed, which exhibits distinct topologies including C4, C3 and two types of C6 carbon rings. The calculated elastic constants and phonon spectra reveal that oC20 is mechanically and dynamically stable at ambient pressure. The calculated electronic band structure of oC20 shows that it is an indirect band gap semiconductor with a band gap of 4.46 eV. The Vickers hardness of oC20 is 75 GPa. The calculated tensile and shear strength indicate that the weakest tensile strength is 64 GPa and the weakest shear strength is 48 GPa, which means oC20 is a potential superhard material.
Microfilming of the Bach Manuscripts in the Staatsbibliothek Berlin.
Penzold, Leonhard
1998-01-01
Describes a microfilming project to preserve music manuscripts of Johann Sebastian Bach at the Staatsbibliothek Berlin (Germany), highlighting project goals, problems and peculiarities encountered filming the collection, color micrography, and black-and-white filming. (PEN)
The research reactor BER II at the Helmholtz-Center Berlin
Energy Technology Data Exchange (ETDEWEB)
Krohn, Herbert [Helmholtz-Zentrum Berlin (HZB), Berlin (Germany)
2012-10-15
For basic and application-oriented research assignments the Helmholtz-Center Berlin (Helmholtz Zentrum Berlin - HZB) runs a research reactor that operates as a source of neutron beams for a wide range of scientific investigations. At the end of the 1980{sup th} the BER II was completed renewed and fitted with new experimental facilities. The BER II is a light water cooled and moderated swimming pool type reactor to be operated at 10 MW thermal power. Six neutron guides deliver cold neutrons from the cold moderator cell to a neutron guide hall adjacent to the experiment hall. With its 24 experimental stations, experimenters at HZB have practically all neutron scattering or neutron radiography techniques at their disposal. (orig.)
Investigations on medical film processing in the city of Berlin
International Nuclear Information System (INIS)
Pape, U.
1986-01-01
An investigation on the methods of film processing in diagnostic radialogy departments can for instance be understood as a mere statistical representation of number and type of processing apparatus and film types, chemical methods and processing time, or it can be done as an attempt to objectively compare the film processing methods by means of a densitometric evaluation of equally exposed films of current usage within a given department. Such a comparative evaluation has been suggested by the diagnostics experts of the Berlin association of medical physicists, who presented their proposals within the course of project planning talks for a planned field test with a phantom for X-ray diagnostics, to be carried out in Berlin. (orig.) [de
The research reactor BER II at the Helmholtz-Center Berlin
International Nuclear Information System (INIS)
Krohn, Herbert
2012-01-01
For basic and application-oriented research assignments the Helmholtz-Center Berlin (Helmholtz Zentrum Berlin - HZB) runs a research reactor that operates as a source of neutron beams for a wide range of scientific investigations. At the end of the 1980 th the BER II was completed renewed and fitted with new experimental facilities. The BER II is a light water cooled and moderated swimming pool type reactor to be operated at 10 MW thermal power. Six neutron guides deliver cold neutrons from the cold moderator cell to a neutron guide hall adjacent to the experiment hall. With its 24 experimental stations, experimenters at HZB have practically all neutron scattering or neutron radiography techniques at their disposal. (orig.)
THE UNTOLD STORY OF A LEGEND IN THE DEVELOPMENT OF ...
African Journals Online (AJOL)
PHILIP AYODELE
The history of contemporary ceramics in Nigeria cannot be told without .... legends and illustrated these on his works thus preserving these as subject of ... he exhibited at Madrid, Spain in 1979; Stuttgart, Germany in 1980; Berlin, Germany.
Energy Technology Data Exchange (ETDEWEB)
Heufelder, J.; Cordini, D.; Heese, J.; Homeyer, H.; Kluge, H.; Morgenstern, H. [Hahn-Meitner-Inst. Berlin, Augentumortherapie (Germany); Fuchs, H. [Hahn-Meitner-Inst. Berlin, Augentumortherapie (Germany); Augenklinik, Charite - Universitaetsmedizin Berlin, Campus Benjamin Franklin (Germany); Hoecht, S.; Nausner, M.; Hinkelbein, W. [Klinik fuer Radioonkologie und Strahlentherapie, Charite - Universitaetsmedizin Berlin, Campus Benjamin Franklin (Germany); Bechrakis, N.E.; Foerster, M.H. [Augenklinik, Charite - Universitaetsmedizin Berlin, Campus Benjamin Franklin (Germany)
2004-07-01
Eye tumors (choroidal melanomas, iris melanomas, and choroidal hemangiomas) are being treated with 68 MeV protons since 1998 at the Ion Beam Laboratory of the Hahn-Meitner Institute of Berlin (Germany's first proton therapy center), in cooperation with the Charite University Hospital in Berlin, Campus Benjamin Franklin. The proton beam, generated via a combination of Van de Graaff accelerator and cyclotron, is prepared by passive shaping for conformal tumor irradiation. A digital X-ray verification of the tumor location with the patient in sitting position limits the position uncertainties to a maximum of 0,3 mm. The treatment planning is performed using the program EYEPLAN. OCTOPUS, a CT-based planning program developed in cooperation with the German Cancer Research Center of Heidelberg, is under pre-clinical testing. Thus far, more than 400 patients have been irradiated. The first results are comparable to those obtained in other proton therapy centers. At the end of 2002, the University Hospital of Essen has also become a cooperation partner of the Hahn-Meitner Institute. (orig.) [German] Seit 1998 werden am Ionenstrahllabor des Hahn-Meitner-Instituts Berlin (Deutschlands erster Einrichtung zur Protonentherapie) im Rahmen eines Kooperationsvertrages mit der Charite - Universitaetsmedizin Berlin, Campus Benjamin Franklin, Augentumoren (Aderhautmelanome, Irismelanome und Aderhauthaemangiome) mit 68-MeV-Protonen bestrahlt. Der mittels einer Kombination aus Van de Graaff-Beschleuniger und Zyklotron erzeugte Protonenstrahl wird passiv fuer eine konformale Bestrahlung des Tumors aufbereitet. Eine digitale Roentgenkontrolle der Lagerung des sitzenden Patienten beschraenkt die Lagerungsunsicherheit auf maximal 0,3 mm. Fuer die Bestrahlungsplanung wird das modellbasierte Planungsprogramm EYEPLAN verwendet. In vorklinischer Erprobung befindet sich das mit dem Deutschen Krebsforschungszentrum Heidelberg entwickelte CT-basierte Planungsprogramm OCTOPUS. Bisher wurden
Riviello, Elisabeth D; Buregeya, Egide; Twagirumugabe, Theogene
2017-02-01
The acute respiratory distress syndrome (ARDS) was re-defined by a panel of experts in Berlin in 2012. Although the Berlin criteria improved upon the validity and reliability of the definition, it did not make diagnosis of ARDS in resource limited settings possible. Mechanical ventilation, arterial blood gas measurements, and chest radiographs are not feasible in many regions of the world. In 2014, we proposed and applied the Kigali modification of the Berlin definition in a hospital in Rwanda. This review synthesizes literature from the last 18 months relevant to the Kigali modification. In the last 18 months, the need for a universally applicable ARDS definition was reinforced by advances in supportive care that can be implemented in resource poor settings. Research demonstrating the variable impact of positive end expiratory pressure on hypoxemia, the validity of using pulse oximetry rather than arterial blood gas to categorize hypoxemia, and the accuracy of lung ultrasound support the use of the Kigali modification of the Berlin definition. Studies directly comparing the Berlin definition to the Kigali modification are needed. Ongoing clinical research on ARDS needs to include low-income countries.
Sine, Christy R; Belenkiy, Slava M; Buel, Allison R; Waters, J Alan; Lundy, Jonathan B; Henderson, Jonathan L; Stewart, Ian J; Aden, James K; Liu, Nehemiah T; Batchinsky, Andriy; Cannon, Jeremy W; Cancio, Leopoldo C; Chung, Kevin K
2016-01-01
The purpose of this study was to compare the Berlin definition to the American-European Consensus Conference (AECC) definition in determining the prevalence of acute respiratory distress syndrome (ARDS) and associated mortality in the critically ill burn population. Consecutive patients admitted to our institution with burn injury that required mechanical ventilation for more than 24 hours were included for analysis. Included patients (N = 891) were classified by both definitions. The median age, % TBSA burn, and injury severity score (interquartile ranges) were 35 (24-51), 25 (11-45), and 18 (9-26), respectively. Inhalation injury was present in 35.5%. The prevalence of ARDS was 34% using the Berlin definition and 30.5% using the AECC definition (combined acute lung injury and ARDS), with associated mortality rates of 40.9 and 42.9%, respectively. Under the Berlin definition, mortality rose with increased ARDS severity (14.6% no ARDS; 16.7% mild; 44% moderate; and 59.7% severe, P Berlin definition was not different from patients without ARDS (P = .91). The Berlin definition better stratifies ARDS in terms of severity and correctly excludes those with minimal disease previously captured by the AECC.
Mental constructs and the cognitive reconstruction of the Berlin wall.
Tijus, C A; Santolini, A
1996-07-01
In this study of how to change people's conceptions of certain facts (i.e., the position of the Berlin Wall), a surprising psychological phenomenon was discovered. In the trial test, instead of designing a wall to enclose West Berlin, most people described and drew a short and straight wall that divided the city from north to south. Two methods were created, based on two general information-processing components involved in problem solving, to study how people might repair their misconceptions by themselves. The do-it-yourself method consisted of providing people with the task of thinking about how to build the wall and then drawing it, instead of just asking them to draw it. The distance-to-goal evaluation method consisted of asking the participants how the wall they had drawn would actually prevent passage from East Germany to West Berlin. The results showed that both methods had important effects in repairing misconceptions, but improvement in performance with the distance-to-goal method was less significant for those participants who were first provided the task of thinking about how to build the wall. These findings are consistent with the hypothesis that awareness of functional properties plays an important role in structuring and restructuring mental constructs.
Evaluation of Traffic Accident Risk in In-City Bus Drivers: The Use of Berlin Questionnaire
Ekren, Pervin Korkmaz; Uysal, Funda Elmas; Başoğlu, Özen K.
2018-01-01
OBJECTIVES Traffic accidents associated with high mortality rate may produce serious problems especially in highways. Obstructive sleep apnea (OSA) has been associated with a high risk for traffic accidents due to excessive daytime sleepiness even in in-city drivers. In the present study, it was aimed to evaluate the rate of OSA symptoms and to identify risk factors associated with traffic accidents in in-city bus drivers. MATERIAL AND METHODS A self-administered questionnaire including demographic and anthropometric features, sleep and work schedules, Berlin questionnaire, Epworth sleepiness score (ESS), and history of traffic accidents was used. RESULTS The questionnaire was conducted for 1400 male bus drivers (mean age, 38.0±6.4 y, body mass index, 27.8±3.9 kg/m2). A total of 1058 (75.6%) drivers had one or more accidents while driving bus. According to the Berlin questionnaire, 176 (12.6%) drivers were found to have high OSA risk and the accident rate was 83.0% in high-risk group, whereas 74.5% of low-risk drivers had accidents (p=0.043). The drivers with a history of traffic accident were older (p=0.030), had higher ESS (p=0.019), and were more in the high-risk OSA group according to the Berlin questionnaire (p=0.015). In multivariate linear regression analysis, traffic accident was associated with only Berlin questionnaire (p=0.015). CONCLUSION The present results support that city bus drivers with high OSA risk according to Berlin questionnaire have increased accident rates. Therefore, we suggest using Berlin questionnaire for screening sleep apnea not only in highway drivers but also in in-city bus drivers. PMID:29755810
The impact of public employment on private sector activity: Evidence from Berlin
Faggio, G.; Schluter, T.; vom Berge, P.
2016-01-01
We use the move of the seat of the German government from Bonn to Berlin in 1999 to test competing views about the impact of public employment on private sector activity in a local labor market. Using employment data from a 50% sample of establishments across 190 Berlin postcodes, we apply a treatment intensity approach which takes the possibility of spillovers into account. Results indicate that the arrival of 100 public sector jobs into an area generates 55 additional jobs in the private se...
Gertrud Huwelmeier
2013-01-01
After the fall of the Berlin Wall and the breakdown of the East German Socialistgovernment, thousands of former contract workers from Vietnam stayedin the then reunified Germany. Due to their resulting precarious economicsituation, a large number of these migrants became engaged in small businessand petty trade. Some of them, women in particular, have become successfulentrepreneurs and wholesalers in recently built bazaars in the eastern parts ofBerlin. Most interestingly, parts of these urba...
Ecology in a walled city: researching urban wildlife in post-war Berlin.
Lachmund, Jens
2007-06-01
The division of Berlin in the aftermath of World War II and the erection of the Wall in 1961 were not only of tremendous political, social and cultural significance, but also had implications for the way in which science was undertaken in this city. For ecologists living and working in the enclosed city part of West Berlin, the lack of accessible countryside motivated them to focus their fieldwork increasingly on urban sites and, thereby, to engage themselves in one of the most significant attempts to develop an ecology of the city.
Der Umlauf der spanischen Handschriften aus dem Antiquariat Leo Liepmannssohns in Paris und Berlin
Directory of Open Access Journals (Sweden)
Romero Naranjo, Francisco Javier
2004-12-01
Full Text Available One of the antique libraries most representative of the second half of the 19th century was that of Leo Liepmannssohn, with branches in Paris and Berlin. Its importance grew over time due to its auctions of many manuscripts by J. S. Bach, Handel, Mozart, Beethoven and other composers, a fact that explains how the author came across it during his investigation into the referred manuscripts. The object of this investigation is a collection of more than 300 folders that can be consulted in the Music Department in the Staatsbibliothek Preußischer Kulturbesitz in Berlin. The folders contain the annual catalogues from the antique library of Liepmannssohn (Berlin comprising the years 1866 to 1923. Each catalogue consists of a list of all the sales from the corresponding year in alphabetical order and contains, besides manuscripts, literature, musical treatises and the portraits of several composers. There are many Spanish manuscripts included in these catalogues whose distribution was so important that in 1900 Liepmannssohn published an exclusive catalogue for Spanish and Portuguese manuscripts, 291 of which the librarian had sold during that year. During the celebration of those auctions many documents, musical treatises and manuscripts, both known and unknown, were brought to light. The investigation earned out contributes to our knowledge about the works of different Spanish composers from the 16th to the 19th centuries and their distribution abroad, especially in Berlin.
[de] Eines der repräsentativsten Antiquariate der zweiten Hälfte des XIX Jh. und des Anfangs des XX Jh. wurde von Leo Liepmannssohn in den Städten Paris und Berlin verwaltet. Durch die Versteigerung vieler Handschriften von J.S. Bach, Händel, Mozart, Beethoven und anderer Komponisten gewann das Antiquariat zusatzlich an Bedeutung. Deswegen ist es verstandlich, dass der Autor auf das Antiquariat stieß, als er Nachforschungen über den
Energy Technology Data Exchange (ETDEWEB)
Pauls, K. (ed.)
2001-06-01
On July, 18{sup th}, 2000, the Centre of Technology Assessment in Baden-Wuerttemberg invited representatives of organisations for the disabled to take part in a round table in order to discuss barrierfree public transport in the region of Stuttgart with Dr. Witgar Weber, vice regional director of the Verband Region Stuttgart and Mr. Nils Himmelmann, representative of Switch Transit Consult. In the first lecture, Dr. Witgar Weber explained tasks of the Verband Region Stuttgart concerning public transport, especially the S-Bahn. Mr. Nils Himmelmann explained the work he is doing on instruction for the Verband Region Stuttgart, at finding solutions to reduce the problem of a vertical and horizontal interval at the entrance of S-Bahn carriages. As a result of the round table, a profile of requirements was compiled by participants, including preferences for a barrierfree use of the S-Bahn. For the S-Bahn system they demand a partial raise of platforms and where a static raise is not possible there should be a dynamic partial raise. This measure should be combined with an extending step at the entrances of the S-Bahn to solve both horizontal and vertical intervals. Further, the integration of disabled and handicapped people in planning is essential at an early stage. Not only for new projects but also for the modifications of trails or carriages. Therewith, concrete problems can be identified immediately which leads to a reduction of costs in realising requirements for a barrierfree public transport instead of very expensive modifications afterwards. (orig.) [German] Auf Einladung der Akademie fuer Technikfolgenabschaetzung in Baden-Wuerttemberg kamen am 18.07.00 Vertreterinnen und Vertreter von Behindertenverbaenden zu einem Runden Tisch, um das Thema, Barrierefreiheit im OePNV in der Region Stuttgart' zusammen mit Dr. Witgar Weber, stellvertretender Regionaldirektor beim Verband Region Stuttgart (VRS), und Nils Himmelmann von der Firma Switch Transit Consult zu
Synthesis of 20-14C 3β-hydroxy-5β-pregnan-20-one
International Nuclear Information System (INIS)
Garraffo, H.M.; Gros, E.G.
1982-01-01
20 - 14 C 3β-hydroxy-5β-pregnan-20-one was synthesised by condensing 3β-acetoxy-5β-androstan-17-one with potassium 14 C cyanide to produce cyanohydrin. This was dehydrated and the resulting unsaturated nitrile treated with methylmagnesiumiodide to produce hydroxypregnenone. Hydrogenation of this gave 14 C 3β-hydroxy-5β-pregnan-20-one. (U.K.)
Working Group 'Air pollution abatement' of the University of Stuttgart -ALS. Annual report 1990
International Nuclear Information System (INIS)
1991-01-01
Despite considerable efforts for air pollution abatement - examples are here desulphurization and nitrogen removal in power and large combustion plants as well as catalytic converters for automobiles there are still many problems to solve. Many small and medium-size companies still have to reduce production-related pollutant emissions, traffic still is a major source of pollutants. Air pollution abatement in the new Federal states and other Eastern European countries is a particularly urgent task and reductions of CO 2 emissions from energy production processes with fossil fuels are not least a great challenge. Apart from industry, legislation and administration especially science is called upon to find solutions to these problems. The university of Stuttgart takes up the challenge. Numerous institutes - 17 of 8 faculties -united in the working group ''air pollution abatement'' of the university of Stuttgart which carries out in interdisciplinary cooperation research work in the area of air pollution abatement. In this annual report activities of individual member states institutes in the area of air pollution abatement (fields of study, current research projects, cooperations and publications in 1991) as well as joint projects are presented. (orig./KW) [de
Challenging a Home Country: A Preliminary Account of Indonesian Student Activism in Berlin, Germany
Directory of Open Access Journals (Sweden)
Syafiq Hasyim
2014-12-01
Full Text Available This article gives an overview on Indonesian student activism in Berlin, Germany. Based on documents (published and unpublished, interviews, and conversations with former and current student activists, the paper scrutinizes the trajectory of activism of Indonesian students in the capital of Germany since the 1960s and asks about the evolution of specific student organizations, the issues and topics they tackled, and their media and networking strategies. The article illustrates the activities of the PPI Berlin as a dominant example of Indonesian students’ political activism abroad and the activities of Indonesian Muslim students as a prominent example of religious-based activism which has gained significance since the fall of Suharto. These examples indicate the diversity of Indonesian student activists in Berlin that are nevertheless united in their aspirations to challenge politics back home.
Reactions to Receiving a Gift-Maternal Scaffolding and Cultural Learning in Berlin and Delhi.
Kärtner, Joscha; Crafa, Daina; Chaudhary, Nandita; Keller, Heidi
2016-05-01
This study shows how Berlin (n = 35) and Delhi (n = 28) mothers scaffold a common and highly scripted social situation, namely gift giving, and enable cultural learning in 19-month-olds. Using modeling and prompting to encourage appropriate responses, mothers took culture-specific directions during scaffolding that were in line with the broader cultural model as assessed by maternal socialization goals (SGs). Whereas Berlin mothers prioritized autonomous SGs, Delhi mothers emphasized autonomous and relational SGs to similar degrees. During scaffolding, Berlin mothers focused on maximizing positive affect and acknowledging the gift, whereas Delhi mothers prompted toddlers to acknowledge the giver more often. Furthermore, there were differences in toddlers' behavior in line with these culture-specific scripts guiding gift giving. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.
On quiet wheels through Berlin's underground
Hohwieler, Eckard
2011-01-01
Many Berliners still have clear memories from last winter of the massive technical problems experienced by the city's S-Bahn - the municipal rail system operated by the German national railroad the Deutsche Bahn. At times only half the trains were running; the rest had to be taken out of service for safety reasons. For operators of railway vehicles in particular, it is important to know the condition of their trains so as to be able to plan their maintenance and repair in advance. In the inno...
The specific role of FAM20C in amelogenesis.
Wang, X; Jung, J; Liu, Y; Yuan, B; Lu, Y; Feng, J Q; Qin, C
2013-11-01
Previously, we showed that Sox2-Cre;Fam20C(fl/fl) mice in which Fam20C was ubiquitously inactivated had severe defects in dentin, enamel, and bone, along with hypophosphatemia. It remains to be determined if the enamel defects in the mice with universal inactivation of Family with sequence similarity 20-C (FAM20C) were associated with the dentin defects and whether hypophosphatemia in the knockout mice contributed to the enamel defects. In this study, we crossed Fam20C(fl/fl) mice with keratin 14-Cre (K14-Cre) transgenic mice to specifically inactivate Fam20C in the epithelial cells, including the dental epithelial cells that are responsible for forming tooth enamel. X-ray, backscattered scanning electron microscopic, and histological analyses showed that the K14-Cre;Fam20C(fl/fl) mice had severe enamel and ameloblast defects, while their dentin and alveolar bone were not significantly affected. Accordingly, serum biochemistry of the K14-Cre;Fam20C(fl/fl) mice showed normal phosphate and FGF23 levels in the circulation. Analysis of these data indicates that, while FAM20C is a molecule essential to amelogenesis, its inactivation in the dental epithelium does not significantly affect dentinogenesis. Hypophosphatemia makes no significant contribution to the enamel defects in the mice with the ubiquitous deletion of Fam20C.
Ana Souto
2018-01-01
This article explores memory studies from the audience’s perspective, focusing on the perception of Holocaust narratives in two museums in Berlin. This research builds on and contributes to a number of emerging issues on memory studies, tourism perception and museum design: the debate on experiential authenticity, Dark Tourism, as well as the analysis of memory studies from the perspective of the user. The main data facilitating the analysis is based on responses shared on TripAdvisor; the ca...
Directory of Open Access Journals (Sweden)
Kathrin Specht
2015-04-01
Full Text Available How can buildings be combined with agricultural production and what are the major potential benefits and challenges for the introduction of zero-acreage farming (ZFarming in Berlin from the relevant stakeholders’ perspectives? These questions were explored through a series of interviews and stakeholder workshops held between 2011 and 2013. The aim was to identify the most suitable building-integrated farming model for the Berlin metropolitan area and to develop guidelines for the model’s successful and sustainable implementation through a stakeholder-driven approach. This paper provides an aggregated synthesis of the outcomes derived from the qualitative interviews and stakeholder workshops. As the results reveal, the stakeholders perceive potential benefits and challenges related to the issue of ZFarming in all dimensions (economic, social, environmental and political. They largely agreed on the importance of focusing on local resources, using energy-efficient production—including social and educational aspects—and developing new market structures when introducing ZFarming to the city of Berlin. The stakeholders identified urban rooftop greenhouses (RTG as the most promising farming model for Berlin. In a joint collaboration of all stakeholders, a manual for RTG was developed within the participatory innovation process that addresses the identified problems and challenges associated with future implementation and governance of RTG in Berlin and beyond.
International Nuclear Information System (INIS)
Ehrmann, M.
1996-01-01
The article briefly explains the background of the Berlin summit conference as well as some results, as for instance the ''Berlin mandate'', or agreements concerning organisational structures or procedures like those termed ''joint implementation''. (Orig./CB) [de
Heat storage in the Hettangian aquifer in Berlin - results from a column experiment
Milkus, Chri(Sch)augott
2015-04-01
Aquifer Thermal Energy Storage (ATES) is a sustainable alternative for storage and seasonal availability of thermal energy. However, its impact on the subsurface flow regime is not well known. In Berlin (Germany), the Jurassic (Hettangian) sandstone aquifer with highly mineralized groundwater (TDS 27 g/L) is currently used for heat storage. The aim of this study was to examine the hydrogeochemical changes that are caused by the induced temperature shift and its effects on the hydraulic permeability of the aquifer. Column experiments were conducted, in which stainless steel columns were filled with sediment from the aquifer and flushed with native groundwater for several weeks. The initial temperature of the experiment was 20°C, comparable to the in-situ conditions within the aquifer. After reaching equilibrium between sediment and water, the temperature was increased to simulate heating of the aquifer. During the experiment, physical and chemical parameters (pH, ORP, dissolved oxygen and dissolved carbon dioxide) were measured at the outflow of the column and the effluent water was sampled. Using a Scanning Electron Microscope, the deposition of precipitated minerals and biofilm on sediment grains was analyzed. Changes in hydraulic properties of the sediment were studied by the use of tracer tests with Uranin.
The 2nd Guards Tank Army in the Berlin Strategic Offensive Operation
Directory of Open Access Journals (Sweden)
Vladimir Ottovich Daynes
2015-01-01
Full Text Available One of the greatest battles of the Great Patriotic and also the World War II took place on the outskirts of the capital of Nazi Germany on April 16, 1945. Three magor fronts - 1st Belorussian, 2nd Byelorussian, 1st Ukrainian - and four tank armies were involved. They were not used as highly mobile groups to enter Berlin from the north and north-west, they were sent first to break powerful enemy defenses, and then to wage battles on the streets. The Supreme Command and the commanders of the 1st Byelorussian and 1st Ukrainian fronts understood the inevitability of heavy losses in tanks and troops, but deliberately took this step. The aim was not only a speedy capture of the German capital and the end of the war, but also to be ahead of allies on their way to Berlin. The article deals with the planning and preparation for the Berlin Strategic Offensive Operation, the use of 2nd Guards Tank Army, who played along with other tank divisions a magor role in the success of this operation.
Energy Technology Data Exchange (ETDEWEB)
Kempin, T. [Berliner Stadtreinigungsbetrieb, Berlin (Germany)
2004-07-01
The MVA Ruhleben incinerator has state-of-the-art technology, volume-dependent prime costs of 100-130 EUR/t, an acceptance payment of 63.70 EUR/t, employees covered by collective agreement system, disposal capacities of 500,000 tpa of residues, ecological sustainability, and customer-friendliness. Its importance will increase in the future as more than half of the expected waste volume of 983,000 tpa will be processed from 2005. (orig.) [German] Die MVA Ruhleben gewaehrleistet derzeit den Stand der Technik, mengenabhaengige Selbstkosten zwischen 100 EUR/t und 130 EUR/t, ein Annahmeentgelt von 63,70 EUR/t, soziale tarifgebundene Arbeitsplaetze, Entsorgungssicherheit, derzeit fuer 500.000 Tonnen Abfall pro Jahr, oekologische Nachhaltigkeit, Kundenfreundlichkeit. Die MVA Ruhleben wird zukuenftig fuer die Abfallentsorgung in Berlin eine noch groessere Bedeutung haben. Mit etwa 520.000 t/a Abfallentsorgungskapazitaet wird sie mehr als die Haelfte des erwarteten ueberlassungspflichtigen Restabfallaufkommens von 983.000 t/a ab 2005 verarbeiten. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Fengler, W.; Stehle, J. [TU Dresden (Germany). Fakultaet Verkehrswissenschaften ' ' Friedrich List' ' ; Schach, R. [TU Dresden (Germany). Fakultaet Bauingenieurwesen; Stephan, A. [Inst. fuer Bahntechnik GmbH, Dresden/Berlin (Germany)
2008-07-01
In a pre-study, the Government of the State of Saxony commissioned a comparison between wheel/rail and maglev technology for high-speed operations on the northern section of the pan-European Corridor IV. From the holistic perspective of the business evaluation and the expected economic impact, it can be concluded that there is a case for establishing a guided high-speed link between Berlin and Budapest and that the plan should be pursued further. Teh pre-study showed that, taking a comprehensive view of investment and operational aspects, the Transrapid technology already stands comparison with wheel/rail technology. (orig.)
Limits—Urban Density and Mobility Networks in West Berlin during the Period of Containment
Directory of Open Access Journals (Sweden)
Vanessa Miriam Carlow
2014-10-01
Full Text Available If space may be conceptualized as a natural resource, much like gas, oil, or minerals, then its production and use can also be thought of as something to be properly managed, taken care of, and not wasted. Limiting the expansion of the footprint of built-up land in urban areas forces this particular resource (space to be used more efficiently—in a sense, compelling it to be more creative and productive. These spatial constraints on urban areas generate different kinds of densification processes within the existing city, propagating densification, and with it new patterns and uses in urban development, as well as novel approaches to mitigating the hazards of dense urban environments. This paper examines the case of how spatial containment in West Berlin during the period of the Berlin Wall (1961–1989 produced such outcomes. West Berlin during this period can be considered a unique case of spatial containment, where a relatively large and vibrant modern city had to work around a clear and indelible limit to its physical expansion. This paper will discuss ways in which the containment influenced patterns of development in West Berlin toward densification and connectivity, focusing on the expansion of its infrastructural networks, and discuss the development of a new building culture around transformation and densification, including hybrid architectures and mitigation devices to deal with difficult sites produced by the densification.
Distributed medical services within the ATM-based Berlin regional test bed
Thiel, Andreas; Bernarding, Johannes; Krauss, Manfred; Schulz, Sandra; Tolxdorff, Thomas
1996-05-01
The ATM-based Metropolitan Area Network (MAN) of Berlin connects two university hospitals (Benjamin Franklin University Hospital and Charite) with the computer resources of the Technical University of Berlin (TUB). Distributed new medical services have been implemented and will be evaluated within the highspeed MAN of Berlin. The network with its data transmission rates of up to 155 Mbit/s renders these medical services externally available to practicing physicians. Resource and application sharing is demonstrated by the use of two software systems. The first software system is an interactive 3D reconstruction tool (3D- Medbild), based on a client-server mechanism. This structure allows the use of high- performance computers at the TUB from the low-level workstations in the hospitals. A second software system, RAMSES, utilizes a tissue database of Magnetic Resonance Images. For the remote control of the software, the developed applications use standards such as DICOM 3.0 and features of the World Wide Web. Data security concepts are being tested and integrated for the needs of the sensitive medical data. The highspeed network is the necessary prerequisite for the clinical evaluation of data in a joint teleconference. The transmission of digitized real-time sequences such as video and ultrasound and the interactive manipulation of data are made possible by Multi Media tools.
Urban climate modifies tree growth in Berlin
Dahlhausen, Jens; Rötzer, Thomas; Biber, Peter; Uhl, Enno; Pretzsch, Hans
2018-05-01
Climate, e.g., air temperature and precipitation, differs strongly between urban and peripheral areas, which causes diverse life conditions for trees. In order to compare tree growth, we sampled in total 252 small-leaved lime trees ( Tilia cordata Mill) in the city of Berlin along a gradient from the city center to the surroundings. By means of increment cores, we are able to trace back their growth for the last 50 to 100 years. A general growth trend can be shown by comparing recent basal area growth with estimates from extrapolating a growth function that had been fitted with growth data from earlier years. Estimating a linear model, we show that air temperature and precipitation significantly influence tree growth within the last 20 years. Under consideration of housing density, the results reveal that higher air temperature and less precipitation led to higher growth rates in high-dense areas, but not in low-dense areas. In addition, our data reveal a significantly higher variance of the ring width index in areas with medium housing density compared to low housing density, but no temporal trend. Transferring the results to forest stands, climate change is expected to lead to higher tree growth rates.
Urban climate modifies tree growth in Berlin
Dahlhausen, Jens; Rötzer, Thomas; Biber, Peter; Uhl, Enno; Pretzsch, Hans
2017-12-01
Climate, e.g., air temperature and precipitation, differs strongly between urban and peripheral areas, which causes diverse life conditions for trees. In order to compare tree growth, we sampled in total 252 small-leaved lime trees (Tilia cordata Mill) in the city of Berlin along a gradient from the city center to the surroundings. By means of increment cores, we are able to trace back their growth for the last 50 to 100 years. A general growth trend can be shown by comparing recent basal area growth with estimates from extrapolating a growth function that had been fitted with growth data from earlier years. Estimating a linear model, we show that air temperature and precipitation significantly influence tree growth within the last 20 years. Under consideration of housing density, the results reveal that higher air temperature and less precipitation led to higher growth rates in high-dense areas, but not in low-dense areas. In addition, our data reveal a significantly higher variance of the ring width index in areas with medium housing density compared to low housing density, but no temporal trend. Transferring the results to forest stands, climate change is expected to lead to higher tree growth rates.
Blohmer, J U; Schmalisch, G; Klette, I; Grineisen, Y; Kohls, A; Guski, H; Lichtenegger, W
1999-01-01
To investigate whether the incidence of cervical intraepithelial neoplasia (CIN), in particular of high grade CIN, increased in Berlin during the period 1970-1989 and whether the ages of women with CIN had decreased. In the former German Democratic Republic, which had a highly centralized public health system, all gynecologic operations performed on women living in the Mitte district of Berlin were carried out during the period 1970-1989 (when the Berlin Wall fell) in the gynecologic clinic of the Charité Hospital. The incidence of all CIN increased from year to year over the observation period: 0.04% (1970-1971), 0.10% (1980-1981), 0.39% (1988-1989). There was a particularly high increase in the incidence of high grade intraepithelial neoplasms (CIN 3): 0.016% (1970-1971), 0.056% (1980-1981), 0.25% (1988-1989). With a virtually unchanged age distribution for women in the Mitte district of Berlin, the median age of women with CIN 3 decreased significantly from 1970 to 1989, from 39.5 (1970) to 33 (1989) (P < .001). The increase in the incidence of CIN, especially of high grade CIN, as well as the reduction in age for onset of the disease, makes high participation in screening necessary, above all among young women.
By bus and by train into the past. Berlin and its legacy in Annett Gröschner’s writing
Directory of Open Access Journals (Sweden)
Ewa Pytel-Bartnik
2015-12-01
Full Text Available This paper concentrates on the strategies of reconstructing the past as inscribed into the urban space of Berlin and discussed within the literary field. Developed by the German writer Annett Gröschner, they have been used to reexamine the history of the city – only dimly reflected in the present urban landscape. Her perspective emphasizes the distinctive spatial and architectural organization of the city, particularly after the fall of the Berlin Wall. In order to harness her dialec-tical composition of the spacing of-the-past, Gröschner uses the map of various routes on the Berlin public transport network, some inner-city artefacts set along those lines, and also the city map with its constant modifications to create appropriate landmarks through which she [re]constructs Berlin's past-present.
Berlin: A Model for the Teaching of Contemporary German Culture.
Jankowsky, Karen; Remmler, Karyn
1987-01-01
Presents the goals, procedures, visual aids, instructional materials used in a German conversation and culture class taught in English. The courses are intended to realistically portray the way of life and the environment of the people of East and West Berlin. (LMO)
Stamm-Balderjahn, Sabine; Bartel, Susanne; Wilke, Kristin; Spyra, Karla
2018-02-01
The internet portal 'herzwegweiser.de' was developed to assist individuals with cardiovascular diseases in the phase III rehabilitation in the region of Berlin-Brandenburg. It provides information on this specific disease as well as on aftercare services, e. g. regional cardiac groups. For the medical and therapeutic colleagues specific information such as treatment guidelines and a cardiac group placement service for trainers and medical doctors were set up. The study was based on a mixed-methods design. Initially, structured interviews were conducted to identify the expectations and needs of the internet portal. After implementation of the portal, a partially standardized written survey was used to evaluate its acceptance and usability. 105 former rehab patients and 42 medical colleagues participated. The evaluation of the questionnaires was carried out with frequency distributions, mean comparisons and Chi-square tests. The site was rated with an overall high approval rating. Over 90% of the former rehab patients rated content, structure, design, and the search function of the portal positive as did more than 85% of the medical colleagues. 97% of the former rehab patients and 95% professionals would recommend 'herzwegweiser.de'. This internet portal can serve as a model for other regions and possibly other diseases. © Georg Thieme Verlag KG Stuttgart · New York.
[Acute respiratory distress syndrome: a review of the Berlin definition].
de Luis Cabezón, N; Sánchez Castro, I; Bengoetxea Uriarte, U X; Rodrigo Casanova, M P; García Peña, J M; Aguilera Celorrio, L
2014-01-01
Acute Respiratory Distress Syndrome (ARDS) is due to many causes. The absence of a universal definition up until now has led to a series of practical problems for a definitive diagnosis. The incidences of ARDS and Acute Lung Injury (ALI) vary widely in the current literature. The American-European Consensus Conference definition has been applied since its publication in 1994 and has helped to improve knowledge about ARDS. However, 18 years later, in 2011, the European Intensive Medicine Society, requested a team of international experts to meet in Berlin to review the ARDS definition. The purpose of the Berlin definition is not to use it as a prognostic tool, but to improve coherence between research and clinical practice. Copyright © 2013 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Published by Elsevier España. All rights reserved.
Directory of Open Access Journals (Sweden)
Antonio Luigi Palmisano
2012-12-01
Full Text Available Can we speak of a Berlin School of Anthropology? During the XXth century the Institut für Ethnologie of the Freien Universität had an intense research activity and a significant plurality of theoretical approaches. Particularly, at the end of the 70’s a wide group of researchers gathered in Berlin around the IfE. These scholars not only focused their attention on specific geographical areas (above all Northeast Africa and Central Asia but also developed common themes which led to the debate on the methodology and epistemology of Anthropology. Research activities catalysed around charismatic figures of German and European Anthropology and this led to the promotion of the idea of long-term fieldwork and to a particular attention to the critical definition of the qualities of ethnological knowledge. With the development and the application of the notion of imaginäre Ethnografie and with the theorization of the modified states of consciousness, the relationship between der Wissenschaftler und das Irrationale – to recall the title of a book published during those years – could finally be reconsidered in a continuous dialogue with researchers such as Hans Peter Duerr and Paul Feyerabend. This is how what I would like to define as “the Berlin stream of Anthropology” was born; and many scholars who later left the IfE for the wide world may or may not recognize themselves in it.
Potsdamer Platz, Berlin - Autographic Experiences, cultural heritage and branded environments
DEFF Research Database (Denmark)
Allingham, Peter
2009-01-01
One of the main attractions found at Potsdamer Platz in Berlin is Sony Center, a "brandscape" that appeals and communicates to experientially and culturally minded audiences of citizens and tourists. Apart from commercial and cultural venues Sony Center contains apartments, numerous cafés...
6. GESA symposium on experimental stress analysis, May 6 and 7, 1982 Stuttgart
Energy Technology Data Exchange (ETDEWEB)
1982-04-01
Under the scientific chairmanship of Dr. H. Wolf, KWU Muehlheim/Ruhr, the 6th Symposium of the Gemeinschaft Experimentelle Spannungsanalyse (GESA = Experimental Stress Analysis Association) takes place in the Schwabenlandhalle at Fellbach near Stuttgart. The meeting will be organized by VDI/VDE-Gesellschaft Mess- und Regelungstechnik (GMR = VDI/VDE Society for Instrumentation and Control Engineering) located at Duesseldorf. It will be associated with an exposition of firms working in the field of experimental mechanics and presenting among other things developments in the fields of measuring transmitters, data acquisition and processing.
6. GESA symposium on experimental stress analysis, May 6 and 7, 1982 Stuttgart
International Nuclear Information System (INIS)
Anon.
1982-01-01
Under the scientific chairmanship of Dr. H. Wolf, KWU Muehlheim/Ruhr the 6th Symposium of the Gemeinschaft Experimentelle Spannungsanalyse (GESA = Experimental Stress Analysis Association) takes place in the Schwabenlandhalle at Fellbach near Stuttgart. The meeting will be organized by VDI/VDE-Gesellschaft Mess- und Regelungstechnik (GMR = VDI/VDE Society for Instrumentation and Control Engineering) located at Duesseldorf. It will be associated with an exposition of firms working in the field of experimental mechanics and presenting among other things developments in the fields of measuring transmitters, data acquisition and processing. (orig./RW) [de
Kuik, Friderike; Lauer, Axel; von Schneidemesser, Erika; Butler, Tim
2017-04-01
mobile measurements conducted during a campaign in summer 2014. The results show that this approach allows us to estimate NO2 concentrations at roadside reasonably well. The approach can be applied when observations show a strong correlation between roadside NO2 concentrations and traffic emissions from a single type of road. The method, however, shows weaknesses for intersections where observed NO2 concentrations are influenced by traffic on several different roads. We then apply this downscaling approach to estimate the impact of different traffic emission scenarios both on urban background and street level NO2 concentrations. References Kuik, F., Lauer, A., Churkina, G., Denier van der Gon, H. A. C., Fenner, D., Mar, K. A., and Butler, T. M.: Air quality modelling in the Berlin-Brandenburg region using WRF-Chem v3.7.1: sensitivity to resolution of model grid and input data, Geosci. Model Dev., 9, 4339-4363, doi:10.5194/gmd-9-4339-2016, 2016.
Boss, Joseph Daniel; Tosi, Joaquin; Glybina, Inna; Tewari, Asheesh; Abrams, Gary W
2017-02-01
To describe the structural and functional changes that occur in traumatic Berlin's edema involving the macula through assessment with multifocal electroretinogram (mfERG), microperimetry, fundus photography, and spectral-domain optical coherence tomography (SD-OCT). Retrospective case series of five eyes from four patients with macular traumatic Berlin's edema. Patients underwent baseline mfERG (three eyes), MP1 microperimetry (three eyes), fundus photography (five eyes), and SD-OCT (five eyes). All eyes with Berlin's edema showed abnormal findings on baseline SD-OCT, including disruption and fragmentation of the inner segment/ outer segment layer. In two patients with unilateral blunt ocular trauma who underwent mfERG, there was complete loss of the foveal peak in affected eyes. All three eyes that underwent microperimetry showed depressed retinal sensitivity in the area of Berlin's edema. SD-OCT, microperimetry, and mfERG can be used to help diagnose, stratify traumatic severity, and follow structural and functional progression over time in patients with Berlin's edema. [Ophthalmic Surg Lasers Imaging Retina. 2017;48:114-121.]. Copyright 2017, SLACK Incorporated.
Ebersbach, Georg; Ebersbach, Almut; Gandor, Florin; Wegner, Brigitte; Wissel, Jörg; Kupsch, Andreas
2014-05-01
To determine whether physical activity may affect cognitive performance in patients with Parkinson's disease by measuring reaction times in patients participating in the Berlin BIG study. Randomized controlled trial, rater-blinded. Ambulatory care. Patients with mild to moderate Parkinson's disease (N=60) were randomly allocated to 3 treatment arms. Outcome was measured at the termination of training and at follow-up 16 weeks after baseline in 58 patients (completers). Patients received 16 hours of individual Lee Silverman Voice Treatment-BIG training (BIG; duration of treatment, 4wk), 16 hours of group training with Nordic Walking (WALK; duration of treatment, 8wk), or nonsupervised domestic exercise (HOME; duration of instruction, 1hr). Cued reaction time (cRT) and noncued reaction time (nRT). Differences between treatment groups in improvement in reaction times from baseline to intermediate and baseline to follow-up assessments were observed for cRT but not for nRT. Pairwise t test comparisons revealed differences in change in cRT at both measurements between BIG and HOME groups (intermediate: -52ms; 95% confidence interval [CI], -84/-20; P=.002; follow-up: 55ms; CI, -105/-6; P=.030) and between WALK and HOME groups (intermediate: -61ms; CI, -120/-2; P=.042; follow-up: -78ms; CI, -136/-20; P=.010). There was no difference between BIG and WALK groups (intermediate: 9ms; CI, -49/67; P=.742; follow-up: 23ms; CI, -27/72; P=.361). Supervised physical exercise with Lee Silverman Voice Treatment-BIG or Nordic Walking is associated with improvement in cognitive aspects of movement preparation. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Gertrud Huwelmeier
2013-04-01
Full Text Available After the fall of the Berlin Wall and the breakdown of the East German Socialistgovernment, thousands of former contract workers from Vietnam stayedin the then reunified Germany. Due to their resulting precarious economicsituation, a large number of these migrants became engaged in small businessand petty trade. Some of them, women in particular, have become successfulentrepreneurs and wholesalers in recently built bazaars in the eastern parts ofBerlin. Most interestingly, parts of these urban spaces, former industrial areason the periphery of Germany’s capital, have been transformed into religiousplaces. This article explores the formation of female Vietnamese Buddhistnetworks on the grounds of Asian wholesale markets. It argues that transnationalmobilities in a post-socialist setting encourage border-crossing religious activities,linking people and places to various former socialist countries as well as to theSocialist Republic of Vietnam. Further, by considering political tensions betweenVietnamese in the eastern and western part of Berlin, this contribution illustratesthe negotiation of political sensitivities among diasporic Vietnamese in reunitedGermany. Based on ethnographic fieldwork among female lay Buddhists, itfocuses on entrepreneurship and investigates the relationship between business,migration and religious practices.
Puaca, Brian M.
2005-01-01
In this paper, the author highlights the Berlin Student Parliament and assesses educational innovations of the postwar era. The Berlin Student Parliament is but one example of the postwar pedagogical and curricular initiatives that sought to prepare West German pupils for their responsibilities in the new democracy. The organization believe that…
Cianchetta, I.; Trentelman, K.; Maish, J.; Saunders, D.; Foran, B.; Walton, M.; Sciau, Ph.; Wang, T.; Pouyet, E.; Cotte, M.; Meirer, F.; Liu, Y.; Pianetta, P.; Mehta, A.
2015-01-01
XANES spectroscopy was used to complement the results previously obtained with Raman spectroscopy by the same group to determine the firing conditions used in the production of a single vessel painted by the Berlin Painter in the 5th century B.C. The vessel, part of the collection of the J. Paul
The influence of geopolitical change on the well-being of a population: the Berlin Wall.
Héon-Klin, V; Sieber, E; Huebner, J; Fullilove, M T
2001-03-01
Social cohesion is recognized as a fundamental condition for healthy populations, but social cohesion itself arises from political unity. The history of the Berlin Wall provides a unique opportunity to examine the effects of partition on social cohesion and, by inference, on health. This ethnographic study consisted of examination of the territory formerly occupied by the Wall, formal and informal interviews with Berlin residents, and collection of cultural documents related to the Wall. Transcripts, field notes, and documents were examined by means of a keyword-in-context analysis. The separation of Berlin into 2 parts was a traumatic experience for the city's residents. After partition, East and West Germany had divergent social, cultural, and political experiences and gradually grew apart. The demolition of the Wall--the symbol and the instrument of partition--makes possible but does not ensure the reintegration of 2 populations that were separated for 40 years. The evolution of a new common culture might be accelerated by active attempts at cultural and social exchange.
Bölscher, Jens; Dumm, Michaela; Suthfeldt, René; Vogt, Benjamin; Bölscher, Judith; Terytze, Konstantin; Schulte, Achim
2017-01-01
Der vorliegende Bericht behandelt die Ergebnisse des Forschungsprojektes RUBUS, welches im Zeitraum November 2013 bis November 2015 von der Freien Universität Berlin durchgeführt wurde. Gegenstand des Projektes ist die Untersuchung der aktuellen Belastungssituation und der Dynamik der Sedimente in der Rummelsburger Bucht als Teil der urbanen Spree in Berlin. Das Projekt hat die Klärung der räumlichen Verteilung, Quantifizierung und Bewertung der Schadstoffbelastung in den Sedimenten der Ru...
Tissot, Cecile; Buchholz, Holger; Mitchell, Max B; da Cruz, Eduardo; Miyamoto, Shelley D; Pietra, Bill A; Charpentier, Arnaud; Ghez, Olivier
2010-03-01
Mechanical circulatory devices are indicated in patients with refractory cardiac failure as a bridge to recovery or to transplantation. Whenever required, transportation while on mechanical support is a challenge and still limited by technical restrictions or distance. We report the first pediatric case of transatlantic air transportation on a Berlin Heart EXCOR ventricular assist device (Berlin Heart, Berlin, Germany) of a 13-yr-old American female who presented in cardiogenic shock with severe systolic dysfunction while vacationing in France. Rapid hemodynamic deterioration occurred despite maximal medical treatment, and she was supported initially with extracorporeal membrane oxygenation converted to a Berlin Heart EXCOR left ventricular assist device. Long-distance air transportation of the patient was accomplished 3 wks after implantation from Marseille, France, to Denver, Colorado. No adverse hemodynamic effects were encountered during the 13.5-hr flight (8770 km). The patient did not recover sufficient cardiac function and underwent successful orthotopic heart transplantation 3 months after the initial event. Our experience suggests that long-distance air transportation of pediatric patients using the Berlin Heart EXCOR mobile unit as a bridge to recovery or transplantation is feasible and appears safe.
TU Berlin Rover Family for Terrestrial Testing of Complex Planetary Mission Scenarios
Kryza, L.; Brieß, K.
2018-04-01
The TU Berlin has developed a family of planetary rovers for educational use and research activities. The paper will introduce these cost-effective systems, which can be used for analogue mission demonstration on Earth.
Tours de Babel et lettres de feu : motifs bibliques dans le Berlin de Vladimir Nabokov
Manolescu-Oancea, Monica
2017-01-01
When examining the critical responses to Vladimir Nabokov’s representations of Berlin in his Russian fiction, it is quite surprising to notice that two antithetical positions have been formulated, one which stresses the absence of Berlin as a city in Nabokov’s texts, and a more recent position emphasizing, on the contrary, the substantial presence of the city in terms of references, landmarks and recognizable sites. This article adopts a different stance, focusing on two Old Testament motifs ...
File list: InP.Myo.20.AllAg.C2C12 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available InP.Myo.20.AllAg.C2C12 mm9 Input control Muscle C2C12 SRX262224,SRX262225,SRX148229...695944 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Myo.20.AllAg.C2C12.bed ...
The first international leprosy conference, Berlin, 1897: the politics of segregation.
Pandya, S S
2004-01-01
The present paper examines the first attempts to internationalise the problem of leprosy, a subject hitherto overlooked by historians of imperialism and disease. The last decade of the nineteenth century saw many in the civilised countries of the imperialist West gripped by a paranoia about an invasion of leprosy via germ-laden immigrants and returning expatriates who had acquired the infection in leprosy endemic colonial possessions. Such alarmists clamoured for the adoption of vigorous leper segregation policies in such colonies. But the contagiousness of leprosy did not go unquestioned by other westerners. The convocation in Berlin of the first international meeting on leprosy revealed the interplay of differing and sometimes incompatible views about the containment of leprosy by segregation. The roles of officials from several countries, as well as the roles of five protagonists (Albert Ashmead, Jules Goldschmidt, Edvard Ehlers. Armauer Hansen, and Phineas Abraham) in the shaping of the Berlin Conference are here examined.
To Save a City: The Berlin Airlift, 1948-1949
1998-01-01
Berliners gainfully employed , the blockade threw some 10 percent out of work. Since the unemployed received a ration card, this factor had little effect...Organization, these units employed large numbers of German laborers. Similarly, the Forward Airfield Supply Organization accomplished all cargo handling in...use as coal sacks. Additionally, EUCOM pro- cured jute bags in England and in Switzerland , although these would last only from three to five trips
Enlightening City Childhoods: Walter Benjamin's Berlin and Erich Kästner's Dresden
Lathey, Gillian
2016-01-01
Walter Benjamin, cultural critic and philosopher, compiled "Berlin childhood around 1900" (trans. Howard Eiland, 2006) while in exile from Germany in the early 1930s, filtering impressions of a privileged childhood through a politicised adult consciousness. Erich Kästner, journalist, poet, satirist and author of the children's classic…
Optimization of C20 isomers structure
International Nuclear Information System (INIS)
Ndjaka, J.M.B.; Charlier, J.C.
2001-07-01
We have performed geometry optimization of various possible planar and three-dimensional C 20 geometries. The planar structures considered include a linear chain, a monoclinic ring, and a bicyclic bow tie; while the three-dimensional geometric; consisted of a bowl or corranulene structure and a fullerene cage. In agreement with Wang et al MP2's calculations, our results predict the corranulene bowl to be the lowest energy structure. From the ground state geometry to the highest energy, considered C 20 structures, listed in increasing energy, are bowl, cage, bow tie, ring and chain. For the ring and bow tie isomers, the shape of the optimized structure deviates from that of the initial configuration; while the shape of the optimised bowl, cage and chain remain unchanged. (author)
Bordes, Julien; Lacroix, Guillaume; Esnault, Pierre; Goutorbe, Philippe; Cotte, Jean; Dantzer, Eric; Meaudre, Eric
2014-06-01
Acute respiratory distress syndrome (ARDS) is a leading cause of mortality in burn patients. Smoke inhalation, pneumonia and inflammation process are the major causes of ARDS in burn patients. The American European Consensus Conference (AECC) definition proposed in 1994 has recently been revised by the Berlin definition. Our objective was to describe the epidemiology of ARDS comparing the Berlin definition with the AECC definition in a retrospective cohort of burn patients. We reviewed admitted burn adult patients for a two year period, and investigated patient who received mechanical ventilation for more than 48 h and in whom pneumonia was diagnosed. 40 patients were analyzed. According to the AECC definition, 11 patients met criteria for ALI (27.5%), and 29 patients for ARDS (72.5%). According to the Berlin definition, all patients met criteria for ARDS: 4 (10%) for a severe ARDS, 25 (62.5%) for a moderate ARDS, 11 (27.5%) for a mild ARDS. Inhalation injury was diagnosed in 10 patients (25%). Categorizing patients with the Berlin definition showed statistically significative difference of mortality within the three groups, but not with the AECC definition. The Berlin definition seems to be more accurate than the AECC definition to assess the severity of ARDS in term of outcome in burn patients. This definition may facilitate prompt recognition of ARDS in burn patients, and promote protective ventilation strategy to a larger number of patients. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.
Ruess, Susanne
2010-01-01
The history of Jewish nursing in World War I has so far not been central to medical history research. Rosa Bendit's war diary is still the only source available on the voluntary service Jewish nurses provided during World War I. Their number was small compared to that of nurses in general. Jewish nursing in Germany has hardly been researched. Jewish nurses, like their Christian colleagues, took on wartime nursing tasks voluntarily. This paper will focus on the experiences of the nurses who were sent to various locations in East and West by the Stuttgart Jewish Nurses' Home. Based on quotations from the war diary their position within the medical service will be described, compared and analyzed. The paper draws attention to special characteristics in the comparison ofJewish and Christian nurses and explores issues such as religious observance, religious discrimination, patriotism and differences in the evaluation of the nurses' work. A brief outline of the history of the Stuttgart Jewish Nurses' Home illustrates their working conditions. The Jewish nurses applied themselves with as much effort and devotion as their Christian counterparts. Although there were only few of them, the Jewish nurses managed to establish a recognized position for themselves within the medical service. The history of Jewish nursing in Stuttgart ended in 1941 when the Jewish Nurses' Home was dissolved by the Nazis and four nurses were murdered in concentration camps.
Energy Technology Data Exchange (ETDEWEB)
Anon.
1998-09-01
The Weiterbildungsakademie Weinheim (WAW) organised an interesting conference on the use of heat for refrigeration. Chaired by Dipl.-Ing. Eberhard Thne from the Institute for Energy Economy and Rational Utilisation of Energy of Stuttgart University the conference dealt with different applications and operating results of adsorption- and absorption refrigerators and direct-fuelled gas absorbers. Papers looked at different case studies such as refrigeration for Ikea Saarlouis, the district hospital in Heilbronn, the Federal Agency for Environmental Protection in Augsburg, Munich Airport or the Technical University of Berlin.(orig.). [Deutsch] Eine aeusserst praxisorientierte und interessante Fachtagung zum Thema Einsatz von Waerme fuer die Kaelteproduktion veranstaltete die Weiterbildungs-Akademie Weinheim (WAW) am 18. Juni dieses Jahres. Unter der Leitung von Dipl.-Ing. Eberhard Thoene vom Institut fuer Energiewirtschaft und Rationelle Energieanwendung der Universitaet Stuttgart wurden verschiedene Anwendungsbeispiele und Betriebsergebnisse zu Absorptions- und Adsorptions-Kaelteanlagen sowie direktbefeuerter Gasabsorber vorgestellt. Referiert wurde ueber die Kaelteversorgung so unterschiedlicher Objekte wie Ikea Saarlouis, das Kreiskrankenhaus Landkreis Heilbronn, das Landesamt fuer Umweltschutz in Augsburg, der Flughafen Muenchen oder die TU Berlin. (orig.)
1981 research programme and budget of Hahn-Meitner-Institut fuer Kernforschung Berlin
International Nuclear Information System (INIS)
Anon.
1981-01-01
Hahn-Meitner-Institut fuer Kernforschung Berlin (HMI) is one of the twelve large research centers of the Federal Republic of Germany; like the other centers, it has to present a combined research programme and budget (programme budget) every year. In these programme budgets, as in the medium-term financial planning in the federal budget, planning for the current year is combined with a medium-term plan for the three next years. For the year 1981, the budget of HMI includes a total expenditure of about DM 85 million, DM 71.2 million of which are direct R + D expenditures. This R + D programme is carried by 396 of the total staff of 705. Research is done in the following fields (approximate figures): Heavy ion physics DM 23.0 million. Radiation- and photochemistry DM 11.4 million. Solid state research DM 20.9 million. Nuclear chemistry DM 8.9 million. Data processing/electronics DM 7.0 million. (orig./UA) [de
Bedford, Paul J; Oesterhelweg, Lars
2013-09-01
Forensic radiology has become a common modality in many forensic practices around the world. Here, we report and compare the usage patterns in the cities of Melbourne, Australia, and Berlin, Germany, using 16 multislice scanners in two large forensic facilities with both machines integrated in the mortuary. While in Melbourne all bodies receive a full body computed tomography (CT) scan resulting in nearly 5,000 scans per year, the situation differs in Berlin where approximately 250 state prosecutor sanctioned cases are scanned per year. While in Melbourne the CT scanner is an integral element of the process of determining whether further examinations will follow, in contrast in Berlin all cases proceed to autopsy irrespective of the findings from the CT scan. While pathologists in Berlin receive on site training to use the CT scanner by a highly experienced forensic pathologist who has previously been involved in the Virtopsy(®) program in Switzerland, training of pathologists in Melbourne is multifaceted. A radiologist with extensive experience in the forensic environment is employed part time at the institute in Melbourne and provides radiology lectures including topics such as postmortem artifacts, regional anatomy, and neuroradiology. CT is gaining acceptance as a useful modality for presenting information to the courts and juries, as well as providing an easily accessible platform to review cases and initiated research projects.
Gupta, Samriti; Sankar, Jhuma; Lodha, Rakesh; Kabra, Sushil K
2018-01-01
Our objective was to compare the prevalence and outcomes of pediatric acute respiratory distress syndrome using the Pediatric Acute Lung Injury Consensus Conference (PALICC) criteria and Berlin definitions. We screened case records of all children aged 1 month to 17 years of age admitted to the Pediatric Intensive Care Unit (PICU) over a 3-year period (2015-2017) for presence of any respiratory difficulty at admission or during PICU stay. We applied both PALICC and Berlin criteria to these patients. Data collection included definition and outcome related variables. Data were compared between the "PALICC only group" and the "Berlin with or without PALICC" group using Stata 11. Of a total of 615 admissions, 246 were identified as having respiratory difficulty at admission or during PICU stay. A total of 61 children (prevalence 9.9%; 95% CI: 7.8-12.4) fulfilled the definition of acute respiratory distress syndrome (ARDS) with either of the two criteria. While 60 children (98%) fulfilled PALICC criteria, only 26 children (43%) fulfilled Berlin definition. There was moderate agreement between the two definitions (Kappa: 0.51; 95% CI: 0.40-0.62; observed agreement 85%). Greater proportion of patients had severe ARDS in the "Berlin with or without PALICC group" as compared to the "PALICC only" group (50 vs. 19%). There was no difference between the groups with regard to key clinical outcomes such as duration of ventilation (7 vs. 8 days) or mortality [51.4 vs. 57.7%: RR (95% CI): 0.99 (0.64-1.5)]. In comparison to Berlin definition, the PALICC criteria identified more number of patients with ARDS. Proportion with severe ARDS and complications was greater in the "Berlin with or without PALICC" group as compared to the "PALICC only" group. There were no differences in clinical outcomes between the groups.
David, Matthias; Borde, Theda; Brenne, Silke; Ramsauer, Babett; Hinkson, Larry; Henrich, Wolfgang; Razum, Oliver; Breckenkamp, Jürgen
2018-02-01
Acculturation is a complex, multidimensional process involving the integration of the traditional norms, values, and lifestyles of a new cultural environment. It is, however, unclear what impact the degree of acculturation has on obstetric outcomes. Data collection was performed in 2011 and 2012 at three obstetric tertiary centers in Berlin, Germany. Standardized interviews (20-30 min.) were performed with support of evaluated questionnaires. The primary collected data were then linked to the perinatal data recorded at the individual clinics provided from the obstetric centers which correspond with the routinely centralized data collected for quality assurance throughout Germany. The questionnaire included questions on sociodemographic, health care, and migrant-related aspects. Migrant women and women with a migration background were assessed using the Frankfurt Acculturation Scale, a one-dimensional measurement tool to assess the degree of acculturation (15 items on language and media usage as well as integration into social networks). In summary, 7100 women were available for the survey (response rate of 89.6%) of which 3765 (53%) had a migration background. The probability of low acculturation is significantly (p relationships between the degree of acculturation and obstetric parameters show no significant differences for prematurity, 5 min.-Apgar values > 7, arterial umbilical cord pH values > 7.00 and admissions to the neonatal unit. In Berlin, among migrant women a low degree of acculturation may have an unfavorable effect on the utilization of pregnancy care provision. However, there were no relevant differences in obstetric outcome parameters in relation to the degree of acculturation within the migrant population of Berlin.
Energy Technology Data Exchange (ETDEWEB)
Buchner, Peter [Viega GmbH und Co. KG, Attendorn (Germany). Flaechentemperiersysteme
2011-07-01
Hugo Boss, Esprit, Brax, Puma, Comma or more s.Oliver - 'the labels Berlin 1 and 2 ' became a hotspot of the international world of fashion in Berlin (Federal Republic of Germany) within a few years. However, the concept to combine high-quality brands and their large showrooms under one roof was a challenge not only for architects. Also in the building services and especially in keeping rooms with their strongly varying extent of utilization at a moderate temperature all the stops had to be pulled out.
NOAA-CIRES 20th Century Reanalysis (V2c)
National Oceanic and Atmospheric Administration, Department of Commerce — The 20th Century Reanalysis version 2c (20CRV2c)is an effort led by PSD and the CIRES at the University of Colorado to produce a reanalysis dataset spanning the...
Review of Berliner & Biddle "The Manufactured Crisis"
Directory of Open Access Journals (Sweden)
Lawrence C. Stedman
1996-01-01
Full Text Available In a provocative new book, The Manufactured Crisis, David Berliner and Bruce Biddle make four sweeping claims about U.S. achievement: there never was a test score decline, today's students are "out-achieving their parents substantially" (p. 33, U.S. students "stack up very well" in international assessments (p. 63, and the general education crisis is a right-wing fabrication. As a progressive, I'm sympathetic to their concerns, but as a scholar who specializes in this material, I find their analysis deeply flawed and misleading. They mischaracterize the test score decline data, mishandle the international findings, and fail to acknowledge students' continuing low levels of academic achievement.
Berlin, Maryland - How One Small City is Using Science to Change its World
Allen, L.; Silbergeld, E.
2016-12-01
Small cities are uniquely challenged to mitigate environmental issues in their communities because they usually lack the financial resources and technical expertise to address them. The Town of Berlin, population 4,500, recently purchased approximately 60 acres of private property located at 9943 Old Ocean City Boulevard. The property was previously owned by Tyson Chicken, Inc. and contains a chicken processing plant which has not been in use for over 10 years. Historically the plant emitted significant odors which limited the Town's ability to diversify its economic base. The plant closure provided an opportunity to convert the property to another use, but the downturn in the economy delayed that change. The Town intends to establish recreation oriented uses on the property with the following goals in mind: Create a common ground for the people of Berlin that will unite various neighborhoods. Create synergy between ecological sustainability and community resilience Upgrade the ponds on the property to make them the design focal point Through the Thriving Earth Exchange, the Town of Berlin connected with Dr. Ellen Silbergeld to resolve the question of how to remediate the ponds. Dr. Silbergeld is trained as an environmental engineer and public health researcher, with substantial experience in environmental issues in the poultry industry. This case study will show how one small city is working with a volunteer scientist to convert a blighted piece of property into a multi-use public space for the benefit of its residents and guests.
Reimer, E.; Kerschbaumer, A.; Beekmann, M.; Neißner, F.
2003-04-01
Urban emissions of particulate matter and precursors of ozone are very important in relation to the EU-council directives and national pollution abatement strategies. Knowledge about the contribution of anthropogenic urban sources and about long range transport of polluted air to local concentrations is needed for any reduction strategy. Thus, within the German Atmospheric Research Program AFO2000 a project has been started to investigate the formation and transport of PM10/PM2.5 in the greater Berlin area by sampling and analysing PM, using LIDAR as well as physico-chemical measurements to determine density, partical size distribution and chemical composition of the aerosol. Participants are: Freie Universität Berlin, Institute for Meteorology BTU Cottbus, Air Chemistry Department Elight Laser Systems GmbH Freie Universität Berlin, Physics Department Environmental Administration, Berlin Government with an additional PM campaign Measurements at central Berlin monitoring stations exceed standard PM10 tresholds. Therefore, it is important to get a better knowledge about PM sources within and outside the city. Long term applications of the chemical transport model with an aerosol-module REM3/Calgrid is used to explain transport, formation and deposition processes. Backward and forward trajectories are used to determine source/receptor relationships between the observations and European wide emission maps for ozone, precursors and PM10 and PM2,5 by correlation between observed primary aerosols in Berlin and possible sources. The measurements obtained within the project are also used to validate REM3/Calgrid with special respect to SO4, NO3, NH4 and ozone precursors.
Energy Technology Data Exchange (ETDEWEB)
Massmann, G.; Pekdeger, A. [Freie Universitaet Berlin (Germany). Institut fuer Geologische Wissenschaften, Arbeitsbereich Hydrogeologie; Duennbier, U. [Berliner Wasserbetriebe, Labor, Berlin (Germany); Heberer, T. [Niedersaechsisches Landesamt fuer Verbraucherschutz und Lebensmittelsicherheit (LAVES), Lebensmittelinstitut Oldenburg (Germany); Richter, D. [DVGW - Technologiezentrum Wasser (TZW), Karlsruhe (Germany); Sueltenfuss, J. [Universitaet Bremen (Germany). Institut fuer Umweltphysik, AG Ozeanographie; Tosaki, Y. [University of Tsukuba (Japan). Sustainable Environmental Studies, Graduate School of Life and Environmental Sciences
2009-09-15
Bank filtration is the natural or anthropogenically induced process of surface water infiltration into an aquifer. It is of particular importance as a method to gain or pre-treat water for drinking water production. The hydrodynamic and hydrochemical processes during bank filtration were investigated at one rural site in the Oderbruch and at two urban sites in Berlin (Germany). Results show that these sites differ substantially with regard to the characteristics of the hyporheic zone (permeable versus clogged), travel times (decades versus months to decades) and shape of the redox zones (horizontal versus vertical redox succession). The hyporheic zone is a key parameter determining the site characteristics. Since the surface water in Berlin contains a proportion of treated sewage, a number of wastewater-bound substances (e. g. pharmaceutical residues) have been detected in the surface water. Most of them were, however, fully or partly removed during bank filtration. The redox conditions are an important key parameter with regard to the elimination (or persistence) of a number of organic trace compounds (e. g. phenazone, sulfamethoxazole, clindamycin), whose elimination depends on the prevailing redox environment. (orig.) [German] Uferfiltration ist die natuerlich bedingte oder anthropogen induzierte Infiltration von Oberflaechenwasser in den Grundwasserleiter und ist insbesondere als Methode der Rohwassergewinnung fuer die Trinkwasserproduktion von Bedeutung. Die hydrodynamischen und hydrochemischen Prozesse bei der Uferfiltration wurden an einer Untersuchungstransekte im laendlichen Oderbruch und an zwei Transekten im urbanen Berlin umfangreich untersucht, dabei lag ein Schwerpunkt auf der Anwendung verschiedener Tracermethoden. Die Ergebnisse zeigen, dass sich die Standorte sehr stark insbesondere bezueglich der Beschaffenheit der Gewaessersohle (gut bzw. schlecht durchlaessig), der Fliesszeiten (Jahrzehnte bzw. Monate bis Jahrzehnte) und der Ausbildung von
Balthasar, Heike; Dumke, Alexander; van Gasselt, Stephan; Gross, Christoph; Michael, Gregory; Musiol, Stefanie; Neu, Dominik; Platz, Thomas; Rosenberg, Heike; Schreiner, Björn; Walter, Sebastian
2014-05-01
Since 2003 the High Resolution Stereo Camera (HRSC) experiment on the Mars Express mission is in orbit around Mars. First images were sent to Earth on January 14th, 2004. The goal-oriented HRSC data dissemination and the transparent representation of the associated work and results are the main aspects that contributed to the success in the public perception of the experiment. The Planetary Sciences and Remote Sensing Group at Freie Universität Berlin (FUB) offers both, an interactive web based data access, and browse/download options for HRSC press products [www.fu-berlin.de/planets]. Close collaborations with exhibitors as well as print and digital media representatives allows for regular and directed dissemination of, e.g., conventional imagery, orbital/synthetic surface epipolar images, video footage, and high-resolution displays. On a monthly basis we prepare press releases in close collaboration with the European Space Agency (ESA) and the German Aerospace Center (DLR) [http://www.geo.fu-berlin.de/en/geol/fachrichtungen/planet/press/index.html]. A release comprises panchromatic, colour, anaglyph, and perspective views of a scene taken from an HRSC image of the Martian surface. In addition, a context map and descriptive texts in English and German are provided. More sophisticated press releases include elaborate animations and simulated flights over the Martian surface, perspective views of stereo data combined with colour and high resolution, mosaics, and perspective views of data mosaics. Altogether 970 high quality PR products and 15 movies were created at FUB during the last decade and published via FUB/DLR/ESA platforms. We support educational outreach events, as well as permanent and special exhibitions. Examples for that are the yearly "Science Fair", where special programs for kids are offered, and the exhibition "Mars Mission and Vision" which is on tour until 2015 through 20 German towns, showing 3-D movies, surface models, and images of the HRSC
Hillen, T; Schaub, R; Hiestermann, A; Kirschner, W; Robra, B P
2000-08-01
To compare the health status and factors influencing the health of populations that had previously lived under different political systems. Cross sectional health and social survey using postal interviews. The relation between self reported health and psychosocial factors (stressful life events, social support, education, health promoting life style and health endangering behaviour) was investigated. To determine East-West differences a logistic regression model including interaction terms was fitted. East and West Berlin shortly after reunification 1991. Representative sample of 4430 Berlin residents aged 18 years and over (response rate 63%). Of all respondents, 15.4% rated their health as unsatisfactory. Residents of East Berlin rated their health more frequently as unsatisfactory than residents of West Berlin (Or(age adjusted)= 1.29, 95%CI 1.08, 1.52), these differences occurred predominantly in the over 60 years age group. Logistic regression showed significant independent effects of stressful life events, social support, education, and health promoting life style on self rated health. The effects of education and health promoting life style were observed to be more pronounced in the western part of Berlin. Old age and female sex showed a stronger association with unsatisfactory health status in the eastern part of Berlin. For subjects aged over 60 years there was evidence that living in the former East Berlin had an adverse effect on health compared with West Berlin. The impact of education and a health promoting lifestyle on self rated health seemed to be weaker in a former socialist society compared with that of a Western democracy. This study supports an "additive model" rather than a "buffering model" in explaining the effects of psychosocial factors on health.
Energy Technology Data Exchange (ETDEWEB)
Lemogne, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1965-06-01
Tensile stress tests been carried out at low temperatures (between 20 C and -196 C) on monocrystalline and polycrystalline uranium of various purities. The mechanical properties of the monocrystals have been related, at all temperatures, to plastic flow mechanisms. Below -100 C brittle fracture occurs on the planes making up the twins. A detailed study of the plastic behaviour at -196 C has made it possible to show that all the twin planes except the [176] plane were liable to become privileged planes for brittle fracture. The mechanical properties of the polycrystals, the breaking stress and the elongation at breaking point, decrease as the temperature decreases from 20 to -196 C; they undergo a transition however - not to be confused with the ductile-brittle transition - whose position and strength depend on the grain size and on the purity. It has been verified also that Petch's law is approximately applicable to the plastic flow and rupture stresses; a study has also been made of the influence of temperature and purity on the constants occurring in this equation. Finally, experiments at -196 C on the deformation up to breaking point of polycrystalline samples cold-worked at 20 C have shown the importance of the role played by intergranular cracks in the plastic behaviour of uranium. (author) [French] Des essais de traction ont ete realises a basse temperature (entre 20 C et -196 C, sur des monocristaux et des polycristaux d'uranium de differentes puretes. Les proprietes mecaniques des monocristaux ont ete reliees, a toutes temperatures, aux mecanismes d'ecoulement plastique. Une rupture fragile intervient a partir de -100 C sur les plans de composition de macle. L'etude detaillee du comportement plastique a -196 C a permis de preciser que tous les plans de macle, sauf [176], etaient susceptibles de devenir des plans de rupture fragile privilegies. Les proprietes mecaniques des polycristaux, contrainte de rupture et allongement a la rupture, decroissent quand on
Directory of Open Access Journals (Sweden)
Samriti Gupta
2018-04-01
Full Text Available ObjectivesOur objective was to compare the prevalence and outcomes of pediatric acute respiratory distress syndrome using the Pediatric Acute Lung Injury Consensus Conference (PALICC criteria and Berlin definitions.MethodsWe screened case records of all children aged 1 month to 17 years of age admitted to the Pediatric Intensive Care Unit (PICU over a 3-year period (2015–2017 for presence of any respiratory difficulty at admission or during PICU stay. We applied both PALICC and Berlin criteria to these patients. Data collection included definition and outcome related variables. Data were compared between the “PALICC only group” and the “Berlin with or without PALICC” group using Stata 11.ResultsOf a total of 615 admissions, 246 were identified as having respiratory difficulty at admission or during PICU stay. A total of 61 children (prevalence 9.9%; 95% CI: 7.8–12.4 fulfilled the definition of acute respiratory distress syndrome (ARDS with either of the two criteria. While 60 children (98% fulfilled PALICC criteria, only 26 children (43% fulfilled Berlin definition. There was moderate agreement between the two definitions (Kappa: 0.51; 95% CI: 0.40–0.62; observed agreement 85%. Greater proportion of patients had severe ARDS in the “Berlin with or without PALICC group” as compared to the “PALICC only” group (50 vs. 19%. There was no difference between the groups with regard to key clinical outcomes such as duration of ventilation (7 vs. 8 days or mortality [51.4 vs. 57.7%: RR (95% CI: 0.99 (0.64–1.5].ConclusionIn comparison to Berlin definition, the PALICC criteria identified more number of patients with ARDS. Proportion with severe ARDS and complications was greater in the “Berlin with or without PALICC” group as compared to the “PALICC only” group. There were no differences in clinical outcomes between the groups.
Giesbrecht, Gordon G; Jamieson, Christopher; Cahill, Farrell
2007-06-01
Firefighters experience significant heat stress while working with heavy gear in a hot, humid environment. This study compared the cooling effectiveness of immersing the forearms and hands in 10 and 20 degrees C water. Six men (33 +/- 10 yr; 180 +/- 4 cm; 78 +/- 9 kg; 19 +/- 5% body fat) wore firefighter 'turn-out gear' (heavy clothing and breathing apparatus weighing 27 kg) in a protocol including three 20-min exercise bouts (step test, 78 W, 40 degrees C air, 40% RH) each followed by a 20-min rest/cooling (21 degrees C air); i.e., 60 min of exercise, 60 min of cooling. Turn-out gear was removed during rest/cooling periods and subjects either rested (Control), immersed their hands in 10 or 20 degrees C water (H-10, H-20), or immersed their hands and forearms in 10 or 20 degrees C water (HF-10, HF-20). In 20 degrees C water, hand immersion did not reduce core temperature compared with Control; however, including forearm immersion decreased core temperature below Control values after both the second and final exercise periods (p hand immersion produced a lower core temperature (0.8 degrees C above baseline) than all other conditions (1.1 to 1.4 degrees C above baseline) after the final exercise period (p Hand and forearm immersion in cool water is simple, reduces heat strain, and may increase work performance in a hot, humid environment. With 20 degrees C water, forearms should be immersed with the hands to be effective. At lower water temperatures, forearm and/or hand immersion will be effective, although forearm immersion will decrease core temperature further.
Directory of Open Access Journals (Sweden)
W. Gross
2004-01-01
Full Text Available Die Entwicklung des Geologisch-Paläontologischen Instituts und Museums der Universität Berlin von einer Institution, die Geologie zusammen mit Paläontologie als eine Einheit vertrat, über eine Institution, die eine geotektonische Ausrichtung hatte, zu einer auf Paläontologie konzentrierten Institution wird nachvollzogen. Die beiden Institutsdirektoren am Anfang des 20sten Jahrhunderts waren Vertreter der allumfassenden Geologie des 19ten Jahrhunderts, während die beiden folgenden Direktoren eine Geologie ohne Paläontologie vertraten. Das führte zu einer Trennung der beiden Richtungen, und nach der III. Hochschulreform der DDR 1968 verblieb allein die sammlungsbezogene Paläontologie am Museum. Nach der Wiedervereinigung wurde ein Institut für Paläontologie mit biologischer Ausrichtung mit zwei Professuren, einer für Paläozoologie und einer für Paläobotanik, eingerichtet. The development of the Geologisch-Paläontologisches Institut und Museum of the Museum für Naturkunde at the Humboldt University (formerly Friedrich-Wilhelm-Universität in Berlin from a geology-paleontology institution to a pure paleontology institution is described. The first two directors of the department in the beginning of the 20th century, Prof, von Branca and Prof. Pompeckj, represented a 19th century concept of a geology, which included paleontology, even vertebrate paleontology as the crown jewel of geology. They fought sometimes vigorously against a separation of paleontology from geology. The next two directors. Prof. Stille and Prof, von Bubnoff, were the leading geologists in Germany; to be a student of Stille was a special trade mark in geology of Germany. They represented a geology centered on tectonics. The separation of paleontology as separate section was prepared. The destructions of the Second World War, the following restaurations and the division of Germany into two States influenced strongly their directorships. The education of geologists
Fitness as "Social Heritage": A Study of Elementary School Pupils in Berlin
Pfister, Gertrud; Reeg, Annemarie
2006-01-01
Health and fitness among children and adolescents is a subject currently receiving public attention. This article focuses on the fitness of German pupils (third and fourth grades) in five schools in Berlin with widely differing social catchment areas as well as children from differing social backgrounds. Besides an orthopaedic examination and…
L. Harrison: Mass (to St. Anthony); A. Pärt: Berliner Messe / Robert Cowan
Cowan, Robert
1994-01-01
Uuest heliplaadist "L. Harrison: Mass (to St. Anthony); A. Pärt: Berliner Messe. Oregon Repertory Singers / Gilbert Seeley. Koch International Classics CD 37 177-2; Pärt - comparative version: Estonian Phil. Chbr. Ch., Tallinn CO / Kaljuste" (11/93)(ECM) 439 162-2
Neutron damage of silicon detectors at 20 deg C
International Nuclear Information System (INIS)
Bardos, R.; Gorfine, G.; Guy, L.; Moorhead, G.; Taylor, G.; Tovey, S.
1992-01-01
This contribution reports new data on the damage of silicon detectors by low energy (1 MeV) neutrons. The data were taken at the end of 1991. Three exposures of UA2 Inner Silicon detectors were made: at +20 deg C, -15 deg C and -95 deg C. A high neutron flux enabled the required fluences to be achieved in relatively short times. This increases the sensitivity of the experiment to damage types with shorter self-annealing time constants. This note discusses the new data taken at +20 deg C. Analysis of the low temperature exposures is in progress. 5 refs., 15 figs
Energy Technology Data Exchange (ETDEWEB)
D`Amore, F. [CNR, Pisa (Italy). International Institute for Geothermal Research ; Mejia, J.T. [Comision Ejuctiva Hidroelectrica del Rio Lempa, El Salvador (El Salvador)
1999-02-01
A study has been made to obtain the main chemical and physical reservoir conditions of the Berlin field (El Salvador), before the commencement of large-scale exploitation of the geothermal resource. The upflow zone and the main flow path within the geothermal system have been determined from the area distribution of chemical parameters such as Cl concentrations, ratios such as Na/K, K/Mg, K/Ca, and temperatures computed from silica concentrations and cation ratios. Gas compositions have been used to calculate reservoir parameters such as temperature, steam fraction and P{sub CO{sub 2}}. The computer code WATCH (new edition 1994) has been used to evaluate the temperature of equilibrium between the aqueous species and selected alteration minerals in the reservoir. The fluid in Berlin flows to the exploited reservoir from the south, entering it in the vicinity of well TR-5. Along its flow-path (south-north direction), the fluid is cooled by boiling and conductive cooling. The chloride-enthalpy diagram indicates the existence of a parent water, with a chemical composition similar to well TR-5, that boils and the residual brine produces the fluid of well TR-3, which is very concentrated in salts. The fluid of TR-5 is probably produced from this parent water, generating the fluids of wells TR-2 and TR-9 by boiling, and the fluids of wells TR-1 and TR-4 by conductive cooling. The computed values for the deep steam fraction clearly indicate that this is a liquid-dominated system, with computed temperature values decreasing from 310{sup o}C (upflow zone) to about 230{sup o}C, from south to north. (author)
Contested Namesakes: East Berlin School Names under Communism and in Reunified Germany
Plum, Catherine
2005-01-01
In this article, the author discusses how the municipal authorities eliminate the names of all schools in eastern Berlin in 1990 to formalize the spontaneous purge of school identities. She added, that the renaming of primary and secondary schools at this historical juncture provides a unique vantage point for examining what the democratic turning…
Berlin Electron Storage Ring BESSY: a dedicated XUV synchrotron radiation facility
International Nuclear Information System (INIS)
Muelhaupt, G.; Bradshaw, A.M.
1985-01-01
In response to national requirements in the fields of basic research, metrology and x-ray lithography it was decided in late 1977 to build a dedicated XUV synchrotron radiation source in Berlin. The history of the BESSY project, the user-oriented factors that determined the design parameters, the construction and commissioning of the facility as well as user operation and funding issues are reviewed
At home, I’m a tourist: Musical migration and affective citizenship in Berlin
Garcia, Luis-Manuel
2015-01-01
This article explores the ways in which musical, sonic, and more broadly sensory experiences of Berlin provide the ground for an ambivalent sense of civic belonging for a cadre of migrants affiliated with the city’s local electronic dance music scenes. Drawn from ethnographic fieldwork, the accounts
Directory of Open Access Journals (Sweden)
Jutta Weber
2008-03-01
Full Text Available LIBER's Manuscript Librarians Group held its third conference, entitled 'Communicating Manuscripts' in Berlin from 28-30 November 2007. More than 70 participants from all over Europe came to discuss their experiences and opinions concerning manuscripts (ranging from medieval codices to modern papers and letter collections — in response to a series of papers delivered by a number of specialists from European research libraries and archival institutions. For the Staatsbibliothek it was a pleasure to welcome them and to make the days in Berlin comfortable and successful.
Boetticher, Manfred von, 1947-
2012-01-01
Arvustus: Geisteswissenschaft und Publizistik im Baltikum des 19. und frühen 20. Jahrhunderts (Schriften der Baltischen Historischen Kommission, 17; Baltische Biographische Forschungen, 1). Hrsg. von Norbert Angermann, Wilhelm Lenz und Konrad Maier. (Berlin: LIT-Varlag, 2011)
Directory of Open Access Journals (Sweden)
Corinna Haas
2014-03-01
Full Text Available Wie können „Piraten und „Kapitalisten“ zusammenarbeiten? Welche Komplizenschaften können Hacker und Journalisten, Profis und Amateure miteinander eingehen, wenn es darum geht, die Informationsfreiheit im Internet zu verteidigen? Diesen Fragen ging die „Complicity – Berliner Gazette Konferenz 2013“ im Berliner SUPERMARKT nach. Die Autorinnen kommentieren die Konferenz aus ihrer Perspektive als Teilnehmerinnen. Ihr Beitrag reflektiert die Konfrontation von Bibliotheksutopie und Bibliotheksrealität, den „piratischen„ Umgang mit Urheberrechtsproblemen und Open Access sowie die Interessenkonvergenzen von Bibliothekaren und Internetaktivisten How can pirates and capitalists work together? And how is it possible for hackers and journalists, professionals and amateurs to enter into complicity, in order to defend the freedom of information on the web? These were the issues the Complicity – Berliner Gazette Conference 2013“ dealt with at the SUPERMARKT in Berlin. The authors comment on the conference from a participant’s point of view. Their contribution reflects confrontations of utopias and realities of the library, „pirate„ ways to deal with copyright problems and Open Access, as well as the convergence of interests between librarians and internet activists.
Directory of Open Access Journals (Sweden)
Jiri Kende
2015-12-01
Full Text Available Moderne Bibliothekssysteme werden zunehmend als Software as a Service (SaaS angeboten. Die Berliner Bibliotheken der Freien Universität Berlin, der Humboldt Universität, der Technischen Universität und der Universität der Künste haben für 2016 gemeinsam den Umstieg auf das cloudbasierte Bibliothekssystem Alma beschlossen. Der Aufsatz berichtet über die Herausforderungen während der zweijährigen Vertragsverhandlungen mit besonderem Augenmerk auf den Datenschutz. Modern library management systems are increasingly offered as Software as a Service (SaaS.The libraries of the Free University Berlin, the Humboldt university, the Technical university and the University of Arts decided concertedly to move in 2016 to the cloud based next generation library management system Alma. The article reviews the challenges during the contract negotiations with a special focus on data protection.
Inverting Images of the 40s: The Berlin Wall and Collective Amnesia.
Loshitzky, Yosefa
1995-01-01
Examines images of World War II invoked in two live, international music concerts (one rock, one classical) celebrating the fall of the Berlin Wall. Argues that Western television's choice of imagery represented the Wall's demise as a marker of the end of the Cold War rather than a vanishing monument of Germany's conflicted struggle with Holocaust…
Measurement of population exposure by radiological screening in private companies in Berlin
International Nuclear Information System (INIS)
Dreyer, U.
1982-06-01
In the first quarter of 1975, 21,647 employees (males: 16,336; females: 5,311) of private companies in Berlin were screened. The mean number of exposures per examination was 2.3 (2.3 in males, 2.2 in females). The genetically significant doses (GSD) of this group was calculated to be 1.514 mrem/a. (orig./HP) [de
Achberger, M; Linden, M; Benkert, O
1999-04-01
The reunification of Germany confronted citizens in East and West Germany with many changes in their lives. These changes may be considered as critical life events. Especially for those in East Germany, life circumstances drastically changed, and individuals were increasingly required to adopt and develop coping capabilities. In addition to new opportunities and freedom, there was threatening uncertainty about the future. Theories of life events and stress postulate that threat events have an impact on human well-being. It was expected that there would be an increased rate of psychiatric morbidity after unification, especially in the eastern part of Germany. An international study by the WHO on psychiatric disorders in general health care was carried out in 1990, 1 year after the opening of the Berlin Wall, in both parts of Berlin and in Mainz, West Germany. This allowed for a comparison of the prevalence rates of psychiatric disorders among general health care patients in the East and West, after the euphoria immediately following unification had subsided. The prevalence rates of current ICD-10 diagnoses and of subthreshold disorders in East Berlin were similar to the rates in West Berlin and Mainz. The recognition rate of psychiatric disorders by physicians did not differ in East Berlin as compared to West Berlin and Mainz. Contrary to the prediction expected from the literature on individual negative life events, major changes in life circumstances and stressful life events on a societal level within 1 year did not have a major impact on psychological function.
Energy Technology Data Exchange (ETDEWEB)
Vogt, Regine; Fehrenbach, Horst
2012-09-15
The waste management of the State of Berlin (Federal Republic of Germany) shall be re-aligned and optimized in particular under the aspects of resource protection and climate change in order to achieve a more relevant reduction of harmful greenhouse gases (carbon dioxide, methane, nitrous oxide) up to the year 2020. In order to evaluate these targets and in order to control the waste streams, an annual material balance, carbon footprint and environmental impact shall be created for non-hazardous wastes. Under this aspect, the authors of the contribution under consideration analyze the waste management situation in the State of Berlin with regard to the waste streams and the associated relevant greenhouse gas emissions. From this, optimization potentials are derived and optimized with respect to their reduction effects. A catalogue of measures for a possible implementation of identified measures is created. A user-friendly Excel tool was developed for the annual implementation of identified measures.
New blackbody calibration source for low temperatures from -20 C to +350 C
Mester, Ulrich; Winter, Peter
2001-03-01
Calibration procedures for infrared thermometers and thermal imaging systems require radiation sources of precisely known radiation properties. In the physical absence of an ideal Planck's radiator, the German Committee VDI/VDE-GMA FA 2.51, 'Applied Radiation Thermometry', agreed upon desirable specifications and limiting parameters for a blackbody calibration source with a temperature range from -20 degree(s)C to +350 degree(s)C, a spectral range from 2 to 15 microns, an emissivity greater than 0.999 and a useful source aperture of 60 mm, among others. As a result of the subsequent design and development performed with the support of the laboratory '7.31 Thermometry' of the German national institute of natural and engineering sciences (PTB), the Mester ME20 Blackbody Calibration Source is presented. The ME20 meets or exceeds all of the specifications formulated by the VDI/VDE committee.
Directory of Open Access Journals (Sweden)
Hans Kordy
2003-01-01
Full Text Available La gestión de la calidad busca la evaluación del tratamiento psicoterapéutico. Un aspecto central se relaciona con el desarrollo de baterías de evaluación y criterios de evaluación adecuados. El modelo Stuttgart-Heidelberg (S-H representa un sistema que proporciona conceptos, instrumentos psicométricos y un programa informático desarrollado para la gestión de la calidad basada en el feedback activo. La información central del modelo Stuttgart-Heidelberg es el resultado individual del tratamiento. El planteamiento es que la psicoterapia puede mejorarse si proporcionamos información sobre los resultados terapéuticos (en especial los negativos, pues los procesos de solución de problemas se estimularán por el feedback recibido. El presente trabajo presenta un inventario de evaluación, la evaluación estandarizada de los resultados y las diversas herramientas de feedback del modelo SH. Un estudio sistemático incluyendo 1715 pacientes de un hospital especializado en trastornos psicosomáticos documenta la validez de este abordaje. Los resultados empíricos refuerzan una estrategia de transparencia acerca de lo que acontece en la práctica clínica por ejemplo, acerca de los tratamientos administrados, sus resultados y costos. Implicaciones para la posterior optimización de los servicios de salud son discutidos.
Possibility of gas sensor based on C_2_0 molecular devices
International Nuclear Information System (INIS)
Zhao, Wenkai; Yang, Chuanlu; Zou, Dongqing; Sun, Zhaopeng; Ji, Guomin
2017-01-01
We theoretically investigate the possibility of diatomic gas detection (NO, CO, O_2) by making use of the transport properties of the C_2_0 molecular junctions. The calculations are performed by using nonequilibrium Green's function (NEGF) formalism in combination with density functional theory (DFT). In this work, we systematically study the most stable adsorption structural configurations, adsorption energy, and the transport properties on C_2_0 molecular junctions with these diatomic gas molecules. It is found that NO and O_2 gas molecule can be detected selectively. We suggest its possibility of nanosensors for highly sensitive and selective based on C_2_0 molecular junction systems. - Highlights: • The most favorable adsorption site is investigated. • The mechanism of gas sensors is revealed. • NO and O_2 gas molecules can be detected by C_2_0 selectively.
Rational use of energy at the University of Stuttgart building environment. Final report
Energy Technology Data Exchange (ETDEWEB)
Schmidt, F.; Freihofer, H. [Forschungsinst. fuer Kerntechnik und Energiewandlung e.V., Stuttgart (Germany). Abt. Wissensverarbeitung und Numerik; Stergiaropoulos, K.; Claus, G. [Forschungsgesellschaft Heizung-Lueftung-Klimatechnik Stuttgart mbH (Germany); Harter, J.; Ast, H. [IFB, Dr. R. Braschel GmbH, Stuttgart (Germany); Will, M.; Haerther, H.; Franke, H. [Sulzer-Infra Deutschland GmbH, Stuttgart (Germany)
1999-07-01
We have demonstrated with the project REUSE that it is possible to optimise complex building ensembles (properties) energetically by applying the contracting model. However, there are some basic requirements which have to be fullfilled to reach such a goal. They include 1. basic consense among those dealing with specific aspects concerning energy use of the buildings considered, 2. transparent and most actual measured data of energy consumption, 3. unified and reliable system for evaluation of measures taken to save energy (base line), 4. partners who are able to define measures which have to be undertaken to save energy in a specific building and who are able to implement these measures effectively and user friendly. This report describes how we have fullfilled these requirements at the campus 'Pfaffenwald' of the University of Stuttgart. Numerous daily life difficulties had to be overcome before the project became a success and we were able to derive valuable consequences. These consequences went far beyond the original goal to save energy worth about 3 to 4 Million Deutsche Marks and finally resulted in a new thinking about energy use at the campus. Therefore, we see the project REUSE as extremely successful and hope it will encourage similar projects and provide valuable hints to them. (orig.) [German] Im Vorhaben REUSE wurde gezeigt, dass und wie es moeglich ist, komplexe Liegenschaften nach dem Contracting Modell energetisch zu optimieren. Voraussetzungen dafuer sind: 1. ein gemeinsames Basisverstaendnis all derer mit Energiefragen befassten, 2. eine transparente und zeitnahe Erfassung der Verbraeuche, 3. ein einheitliches und verlaessliches System zur Bewertung der Massnahmen zur Energieeinsparung (Baseline) und 4. Partner, die Massnahmen an Einzelobjekten effektiv und kundenfreundlich umsetzen koennen. Dieser Bericht zeigt auf, wie wir an der Liegenschaft CAMPUS Pfaffenwald der Universitaet Stuttgart diese Voraussetzungen geschaffen haben, wie die
Possibility of gas sensor based on C{sub 20} molecular devices
Energy Technology Data Exchange (ETDEWEB)
Zhao, Wenkai [School of Physics and Optoelectronics Engineering, Ludong University, Yantai 264025 (China); Yang, Chuanlu, E-mail: yangchuanlu@126.com [School of Physics and Optoelectronics Engineering, Ludong University, Yantai 264025 (China); Zou, Dongqing [School of Physics, State Key Laboratory of Crystal Materials, Shandong University, Jinan 250100 (China); Sun, Zhaopeng [School of Physics and Optoelectronics Engineering, Ludong University, Yantai 264025 (China); Ji, Guomin [Electrical and Computer Engineering, The University of Oklahoma, Norman, Tulsa, OK 74078 (United States)
2017-06-09
We theoretically investigate the possibility of diatomic gas detection (NO, CO, O{sub 2}) by making use of the transport properties of the C{sub 20} molecular junctions. The calculations are performed by using nonequilibrium Green's function (NEGF) formalism in combination with density functional theory (DFT). In this work, we systematically study the most stable adsorption structural configurations, adsorption energy, and the transport properties on C{sub 20} molecular junctions with these diatomic gas molecules. It is found that NO and O{sub 2} gas molecule can be detected selectively. We suggest its possibility of nanosensors for highly sensitive and selective based on C{sub 20} molecular junction systems. - Highlights: • The most favorable adsorption site is investigated. • The mechanism of gas sensors is revealed. • NO and O{sub 2} gas molecules can be detected by C{sub 20} selectively.
Saindon, Brent Allen
2012-01-01
This essay considers the rhetoric of space in a rapidly transforming culture. Using Michel Foucault's concept of "heterotopias" to understand the rhetorical power of a building's disposition, it is argued that the Jewish Museum Berlin contains two heterotopias, one within the other. The first is Daniel Libeskind's original building…
The polarized neutron small-angle scattering instrument at BENSC Berlin
International Nuclear Information System (INIS)
Keller, T.; Krist, T.; Danzig, A.; Keiderling, U.; Mezei, F.; Wiedenmann, A.
2000-01-01
A polarized neutron beam has been installed at the small-angle neutron-scattering instrument V4 at BENSC Berlin. The main component of this new option is a 1.8 m long cavity transmission polarizer. The advantages of this device compared to the conventional bender polarizers are: (i) high transmission (35% of unpolarized beam at λ=6 A); (ii) the polarization is better than 93% in the wavelength band 4 A 3 O 4 particles embedded in a glass matrix) are presented and compared to a measurement with unpolarized neutrons
Xanthobacter sp. C20 contains a novel bioconversion pathway for limonene
Werf, M.J. van der; Keijzer, P.M.; Schaft, P.H. van der
2000-01-01
Xanthobacter sp. C20 was isolated from sediment of the river Rhine using cyclohexane as sole source of carbon and energy. Xanthobacter sp. C20 converted both enantiomers of limonene quantitatively into limonene-8,9-epoxide, a not previously described bioconversion product of limonene. With
Directory of Open Access Journals (Sweden)
Barbara Schneider-Kempf
2014-12-01
Full Text Available Die Öffentlichkeitsarbeit der Staatsbibliothek zu Berlin zielt auf eine wirksame Darstellung ihrer bibliothekarischen Weltschätze und ihrer Serviceangebote für die Wissenschaft ab. Sie ruht auf drei Säulen: kulturelle Breitenbildung für wenig bibliotheksaffine Kreise, allgemeine und breit gefächerte Öffentlichkeitsarbeit sowie Aktionen, die sich an spezielle communities in der Wissenschaft richten. Der Beitrag informiert auch über die erfolgreiche Umsetzung dieser Strategie anhand zahlreicher Beispiele. Er zeigt, wie es der Staatsbibliothek in der Hauptstadt Berlin, in der viele Gedächtnisinstitutionen tätig sind, gelingt, öffentlich präsent zu bleiben und ihr Profil zu vermitteln. The public relations work of the Berlin State Library – Prussian Cultural Heritage aims at effectively presenting its globally significant treasures as well as its services for the scientific world. It is based on three pillars: cultural education for the general public, especially for people who are not naturally close to libraries; a general and wide variety of public relations work; and events which target special communities in science. The paper also presents many examples for the effectual implementation of this strategy. It shows how the State Library, in the capital city of Berlin with its many memory institutions, succeeds in keeping a strong presence and communicating its profile to the public.
A Local Dimension of Integration Policies? A Comparative Study of Berlin, Malmö, and Rotterdam
R. Dekker (Rianne); H. Emilsson (Henrik); B. Krieger (Bernhard); P.W.A. Scholten (Peter)
2015-01-01
textabstractThis study examines three theses on local integration policies by a qualitative comparative case study of integration policies in three cities in three different countries (Berlin, Malmö, and Rotterdam). We found little evidence of a congruent local dimension of integration policies.
International Nuclear Information System (INIS)
Allen, F.I.; Biedermann, C.; Radtke, R.; Fussmann, G.
2006-01-01
Highly charged ions are extracted from the Berlin Electron Beam Ion Trap for investigations of charge exchange with a gas target. The classical over-the-barrier model for slow highly charged ions describes this process, whereby one or more electrons are captured from the target into Rydberg states of the ion. The excited state relaxes via a radiative cascade of the electron to ground energy. The cascade spectra are characteristic of the capture state. We investigate x-ray photons emitted as a result of interactions between Ar 17+ ions at energies ≤5q keV with Ar atoms. Of particular interest is the velocity dependence of the angular momentum capture state l c
Revisiter Séville à Berlin, pour mieux la voir.
Directory of Open Access Journals (Sweden)
Emmanuelle Tricoire
2004-03-01
Full Text Available Fabrizio Plessi expose au Martin Gropius Bau , à Berlin, à deux pas de la Potsdamer Platz extraite du néant depuis une dizaine d’années, jusqu’au 31 mai 2004. Cela s’appelle « Traumwelt », monde de rêve, monde rêvé. Au pop art américain des années soixante répond en écho la Nuova Figurazione italienne à laquelle participe Fabrizio Plessi. L’artiste vénitien expose abondamment depuis les années soixante, dans des musées, dans des châteaux, dans les espaces ...
Staatsbibliothek zu Berlin
2017-01-01
Seit ihrer Gründung im Jahr 1661 ist die Staatsbibliothek zu Berlin (SBB) für die Öffentlichkeit zugänglich. In dieser Tradition sowie im Bewusstsein ihrer besonderen historischen Verantwortung steht die SBB zu ihrer Verpflichtung, wissenschaftliches Wissen der Gesellschaft unbeschränkt und gleichberechtigt zur Verfügung zu stellen. Als Einrichtung der Stiftung Preußischer Kulturbesitz hat sie die Berliner Erklärung über den offenen Zugang zu wissenschaftlichem Wissen unterzeichnet. Deren Zie...
Staatsbibliothek zu Berlin
2016-01-01
Seit ihrer Gründung im Jahr 1661 ist die Staatsbibliothek zu Berlin (SBB) für die Öffentlichkeit zugänglich. In dieser Tradition sowie im Bewusstsein ihrer besonderen historischen Verantwortung steht die SBB zu ihrer Verpflichtung, wissenschaftliches Wissen der Gesellschaft unbeschränkt und gleichberechtigt zur Verfügung zu stellen. Als Einrichtung der Stiftung Preußischer Kulturbesitz hat sie die Berliner Erklärung über den offenen Zugang zu wissenschaftlichem Wissen unterzeichnet. Deren Zie...
Single-neutron knockout from 20C and the structure of 19C
Directory of Open Access Journals (Sweden)
J.W. Hwang
2017-06-01
Full Text Available The low-lying unbound level structure of the halo nucleus 19C has been investigated using single-neutron knockout from 20C on a carbon target at 280 MeV/nucleon. The invariant mass spectrum, derived from the momenta of the forward going beam velocity 18C fragment and neutrons, was found to be dominated by a very narrow near threshold (Erel=0.036(1 MeV peak. Two less strongly populated resonance-like features were also observed at Erel=0.84(4 and 2.31(3 MeV, both of which exhibit characteristics consistent with neutron p-shell hole states. Comparisons of the energies, measured cross sections and parallel momentum distributions to the results of shell-model and eikonal reaction calculations lead to spin-parity assignments of 5/21+ and 1/21− for the levels at Ex=0.62(9 and 2.89(10 MeV with Sn=0.58(9 MeV. Spectroscopic factors were also deduced and found to be in reasonable accord with shell-model calculations. The valence neutron configuration of the 20C ground state is thus seen to include, in addition to the known 1s1/22 component, a significant 0d5/22 contribution. The level scheme of 19C, including significantly the 1/21− cross-shell state, is well accounted for by the YSOX shell-model interaction developed from the monopole-based universal interaction.
Energy Technology Data Exchange (ETDEWEB)
Genath, Bernd
2010-11-15
In May 2010, the district major of Berlin-Lichtenberg (Federal Republic of Germany), Christina Emmrich, and the future boss of the Swedish furniture furniture IKEA, Jutta Iskalla, symbolically laid the foundation for the meanwhile 46th IKEA furniture store in Germany with a unique building engineering: The urban waste water heats and cools the office rooms and salesrooms via heat pump. The furniture centre is to be opened in December 2010.
Literature in focus: A Berlin Romance
2005-01-01
The CERN staff have many hidden talents. Who knows, maybe a colleague you see every day is actually a virtuoso violinist, an accomplished sportsman or an internationally renowned collector. Mathilde Fontanet, a translator in the CERN Translation and Minutes Service, is a writer in her spare time. Those who read her first essays in the Graviton no doubt spotted her talent. Following the publication of four short stories, her first novel, 'Rabenstrasse 5', was published in Switzerland in May 2005. Its backdrop is the busy Berlin arts faculty in the early 1980s. Lydia, a student, meets a young woman who leads her into some rather unusual activities. In parallel, two friends, both professors of literature, each record their thoughts and emotions in a diary. The paths of Lydia and the two professors are to cross... The novel will be published in France on 14 October. Mathilde Fontanet will present it in the framework of a forthcoming 'Literature in Focus' event in the CERN Library. Mathilde Fontanet'Rabenstras...
Leuschner, Vincenz; Bondü, Rebecca; Allroggen, Marc; Scheithauer, Herbert
2016-01-01
Threats and announcements of homicidal violence at schools may have massive consequences like evacuations, police searches, criminal investigations, or loss of the sense of security by students, teachers, and parents. However, there is a lack of systematic studies about that phenomenon. The present article would like to contribute to closing the research gap. It presents results about the frequency and structure of threats and announcements of homicidal violence in schools in Berlin. The study is based on an official dataset from school administration reports of violent acts in Berlin schools which has been studied within the Berlin Leaking-Projekt. The sample consists of 427 threats and announcements of homicidal violence between 1996 and 2007. The study is an exceptional analysis of the phenomenon: it presents crosscutting results about frequency and characteristics of threats and the threatening students as well as results of a longitudinal analysis about the development of threats and announcements. Results show a rate of 0,3 threats and announcements per 1 000 student and year. During the observation time span a steady increase of threats and announcements – year by year, influenced by imitation effects after school shootings – has been observed.
Driver or passenger effects of augmented c-Myc and Cdc20 in gliomagenesis.
Ji, Ping; Zhou, Xinhui; Liu, Qun; Fuller, Gregory N; Phillips, Lynette M; Zhang, Wei
2016-04-26
Cdc20 and c-Myc are commonly overexpressed in a broad spectrum of cancers, including glioblastoma (GBM). Despite this clear association, whether c-Myc and Cdc20 overexpression is a driver or passenger event in gliomagenesis remains unclear. Both c-Myc and Cdc20 induced the proliferation of primary glial progenitor cells. c-Myc also promoted the formation of soft agar anchorage-independent colonies. In the RCAS/Ntv-a glia-specific transgenic mouse model, c-Myc increased the GBM incidence from 19.1% to 47.4% by 12 weeks of age when combined with kRas and Akt3 in Ntv-a INK4a-ARF (also known as CDKN2A)-null mice. In contrast, Cdc20 decreased the GBM incidence from 19.1% to 9.1%. Moreover, cell differentiation was modulated by c-Myc in kRas/Akt3-induced GBM on the basis of Nestin/GFAP expression (glial progenitor cell differentiation), while Cdc20 had no effect on primary glial progenitor cell differentiation. We used glial progenitor cells from Ntv-a newborn mice to evaluate the role of c-Myc and Cdc20 in the proliferation and transformation of GBM in vitro and in vivo. We further determined whether c-Myc and Cdc20 have a driver or passenger role in GBM development using kRas/Akt3 signals in a RCAS/Ntv-a mouse model. These results suggest that the driver or passenger of oncogene signaling is dependent on cellular status. c-Myc is a driver when combined with kRas/Akt3 oncogenic signals in gliomagenesis, whereas Cdc20 overexpression is a passenger. Inhibition of cell differentiation of c-Myc may be a target for anti-glioma therapy.
Thermal Properties of Jojoba Oil Between 20°C and 45°C
Lara-Hernández, G.; Flores-Cuautle, J. J. A.; Hernandez-Aguilar, C.; Suaste-Gómez, E.; Cruz-Orea, A.
2017-08-01
Vegetable oils have been widely studied as biofuel candidates. Among these oils, jojoba ( Simmondsia chinensis) oil has attracted interest because it is composed almost entirely of wax esters that are liquid at room temperature. Consequently, it is widely used in the cosmetic and pharmaceutical industries. To date, research on S. chinensis oil has focused on to its use as a fuel and its thermal stability, and information about its thermal properties is scarce. In the present study, the thermal effusivity and conductivity of jojoba oil between 20°C and 45°C were obtained using the inverse photopyroelectric and hot-ball techniques. The feasibility of an inverse photopyroelectric method and a hot-ball technique to monitor the thermal conductivity, and the thermal effusivity of the S. chinensis is demonstrated. The thermal effusivity decreased from 538 W\\cdot s^{1/2}\\cdot m^{-2}\\cdot K^{-1} to 378 W\\cdot s^{1/2}m^{-2}\\cdot K^{-1} as the temperature increased, whereas the thermal conductivity remained the same over the temperature range investigated in this study. The obtained results provide insight into the thermal properties of S. chinensis oil between 20°C and 45°C.
Energy Technology Data Exchange (ETDEWEB)
Szepansky, T.; Ziemann, O.
2001-09-01
The Berlin pilot project comprises three aspects. (1) 'Generator simulation': Modelling of power generation systems in BoFiT was validated by means of existing calculation programs (Bewag) and measurements (HEW, HKW Hafen). (2) 'Optimization of pump use'. (3) 'Centralization of pressure maintenance'. The two latter aspects serve for optimized hydraulic control and supply assurance for validating network simulation in offline and online operation, including network data acquisition. [German] In KWK-Anlagen wird wirtschaftlich Strom und Waerme erzeugt. Der Aufwand fuer den Waermetransport ist vergleichsweise hoch. Automatisch geregelte und gesteuerte Umwaelzpumpen mit grossen Umwaelzwassermassenstroemen und Druckhoehen bieten ein hohes Optimierungspotential fuer die hydraulische Betriebsfuehrung von Fernwaermeversorgungsunternehmen. Der Einsatz von modular aufgebauten EDV-Systemen zur Betriebsoptimierung ist Gegenstand von staendig weiterfuehrenden Untersuchungen. Das Pilotprojekt Berlin 'Optimierung der Waermeverteilung' gliedert sich in drei Arbeitspunkte. Beim Arbeitspunkt 'Erzeugersimulation' wurde ausgehend von existierenden Kreislauf-Rechenprogrammen (Bewag) und Betriebsmessungen (HEW, HKW Hafen) die Modellbildung von Erzeugungsanlagen im Programmsystem BoFiT ueberprueft. Die Arbeitspunkte 'Pumpen-Einsatzoptimierung' und 'Zentralisierung der Druckhaltung' dienten der Optimierung der hydraulischen Betriebsfuehrung unter Einhaltung der Versorgungssicherheit zur Ueberpruefung der Netzsimulation sowohl im Offline- als auch im Online-Betrieb gekoppelt mit der Netzdatenerfassung. (orig.)
Directory of Open Access Journals (Sweden)
Cornelia Vonhof
2015-12-01
Full Text Available Der Beitrag skizziert den Weg der Staatsbibliothek zu Berlin bei der Implementierung eines systematischen Prozessmanagements. Basierend auf den Erfahrungen aus einem Pilotprojekt werden Vorgehensweisen und Methoden reflektiert und weiterentwickelt, die sich eignen, in einer großen, arbeitsteiligen Organisation eingesetzt zu werden. Beleuchtet werden Motivationsfaktoren für Prozessmanagement sowie neue Ansätze wie Service Blueprint und Adaptiv Case Management, die das klassische Verständnis von Prozessmanagement erweitern. The article outlines the path of the Berlin State Library working towards the implementation of a systematic process management. Based on the experience of a pilot project procedures and methods are reflected and further developed to be suitable for a large, work-sharing organization. Motivating factors for process management as well as new approaches such as Service Blueprint and Adaptive Case Management, that expand the classical understanding of process management, are covered.
Not what we expected: the Jewish Museum Berlin in practice
Directory of Open Access Journals (Sweden)
Peter Chametzky
2008-11-01
Full Text Available An extensive existing literature studies Daniel Libeskind’s deconstructivist design for the Jewish Museum Berlin (JMB. This article focuses instead on the museum’s exhibits from 2001 to today, their evolution in response to visitor criticisms, and their discursive setting, all of which exhibit museum and marketing professionals’ attempts to deal with, and to an extent to overcome, the theory driven and Holocaust-laden architectural programme. The JMB, in practice, while including the Holocaust as one component of visitors’ experiences, instead emphasizes Jews and things Jewish as a positive component of a ‘postnational’ version of the German national narrative.
Directory of Open Access Journals (Sweden)
Müge ARSLAN KARABULUT
2017-06-01
Full Text Available This paper is intended to introduce Nana Rademacher, one of the contemporary female science fiction writers in Germany, and to study her work Wir Waren Hier (We Were Here, 2016 which has been seen as an anti-utopian fiction by different critics. In this study, the focus is on anti-utopia which has become a popular literary genre as a result of social, economic and political disappointment experienced in the 20th and 21st centuries. The protagonist, fifteen-year-old Anna, lives in a devastated Berlin which lies in ruins following several years of inter-state conflict which has now been under the hegemony of civil war and military rule. Self-preservation and lawlessness has become the order of the day. Anna’s perspective on her broken world is passionate, strange, harsh and desperate, but also full of hope. This is the story of a girl searching for a way forward in spite of all the obstacles, and who is fighting for life, love and freedom. The struggle for existence/survival in an authoritarian-totalitarian system, as an important characteristic of an anti-utopian society, is one of the basic topics which is fictionalized by Rademacher and narrated by Anna within the work. Extremities, hopelessness, violence, war and the end of the mankind as a result of technology take place in this work. This study aims to determine whether and to what extent the work of Rademacher occurs as an anti-utopian book and how it makes Berlin a part of anti-utopian world.
AgMIP Coordinated Global and Regional Assessments for 1.5°C and 2.0°C
Rosenzweig, C.
2017-12-01
The Agricultural Model Intercomparison and Improvement Project (AgMIP) has developed novel methods for Coordinated Global and Regional Assessments (CGRA) of agriculture and food security in a changing world. The present study performs a proof-of-concept of the CGRA to demonstrate advantages and challenges of the framework. This effort responds to the request by UNFCCC for the implications of limiting global temperature increases to 1.5°C and 2.0°C above pre-industrial conditions. The protocols for the 1.5°C/2.0°C assessment establish explicit and testable linkages across disciplines and scales, connecting outputs and inputs from the Shared Socio-economic Pathways (SSPs), Representative Agricultural Pathways (RAPs), HAPPI and CMIP5 ensemble scenarios, global gridded crop models, global agricultural economic models, site-based crop models, and within-country regional economic models. CGRA results show that at the global scale, mixed areas of positive and negative simulated yield changes, with declines in some breadbasket regions led to overall declines in productivity at both 1.5°C and 2.0°C. These projected global yield changes resulted in increases in prices of major commodities in a global economic model. Simulations for 1.5°C and 2.0°C using site-based crop models had mixed results depending on region and crop, but with more negative effects on productivity at 2.0°C than at 1.5°C for the most part. In conjunction with price changes from the global economics models, these productivity declines resulted generally in small positive effects on regional farm livelihoods, showing that farming systems should continue to be viable under high mitigation scenarios. CGRA protocols focus on how mitigation actions and effects differ across scales, with main mechanisms studied in the integrated assessment models being policies and technologies that reduce direct non-CO2 emissions from agriculture, reduce CO2 emissions from land use change and forest sink enhancement
Isaiah Berlin and the role of education: from Riga to Oxford
Silva, Elisabete Mendes
2014-01-01
Being the result of a lecture to Latvian students in May 2011, this article aims at introducing Isaiah Berlin, who was born in Riga in 1909. The focus will be on the man and the intellectual, how his life experience (his childhood in Russia and the fact that he was an emigrant in Britain) affected his intellectual route, and how he became a defender of liberalism and value-pluralism. Furthermore, special attention will also be given to Berlin’s opinions on Education, the way...
May, Karen M; Paldi, Flora; Hardwick, Kevin G
2017-04-24
During mitosis, cells must segregate the replicated copies of their genome to their daughter cells with extremely high fidelity. Segregation errors lead to an abnormal chromosome number (aneuploidy), which typically results in disease or cell death [1]. Chromosome segregation and anaphase onset are initiated through the action of the multi-subunit E3 ubiquitin ligase known as the anaphase-promoting complex or cyclosome (APC/C [2]). The APC/C is inhibited by the spindle checkpoint in the presence of kinetochore attachment defects [3, 4]. Here we demonstrate that two non-essential APC/C subunits (Apc14 and Apc15) regulate association of spindle checkpoint proteins, in the form of the mitotic checkpoint complex (MCC), with the APC/C. apc14Δ mutants display increased MCC association with the APC/C and are unable to silence the checkpoint efficiently. Conversely, apc15Δ mutants display reduced association between the MCC and APC/C, are defective in poly-ubiquitination of Cdc20, and are checkpoint defective. In vitro reconstitution studies have shown that human MCC-APC/C can contain two molecules of Cdc20 [5-7]. Using a yeast strain expressing two Cdc20 genes with different epitope tags, we show by co-immunoprecipitation that this is true in vivo. MCC binding to the second molecule of Cdc20 is mediated via the C-terminal KEN box in Mad3. Somewhat surprisingly, complexes containing both molecules of Cdc20 accumulate in apc15Δ cells, and the implications of this observation are discussed. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Die Verfassung der Berliner Republik
Directory of Open Access Journals (Sweden)
Julian Krüper
2015-01-01
Full Text Available Contemporary constitutional history faces a methodological dilemma: Historiography traditionally calls for scientific dissociation, both temporal and individual, from its objects of research. Yet, changes in constitutional normativity are typically of an incremental nature and can best be studied through a close approach of the contemporaries. Given such a dilemma, this essay undertakes to analyze key features of constitutional law and science of the »Berlin Republic«. Its main thesis is that contemporary constitutional history in Germany can be seen as a »farewell to the interim«, which the »Bonn Republic« can be construed to have been. Several leitmotifs can be identified: The concept of constitutional identity gains attention and influences the discourses implicitly and explicitly. Among them are debates about the scope of constitutional rights (human dignity, freedom of speech as well as about the structure of the democratic and federal polity. Simultaneously, social change gives rise to fundamental constitutional questions such as religious pluralism or same-sex marriage. At the same time, the science of German public law, both within the dimensions of constitutional and administrative law, undergoes a profound process of self-ascertainment. This process brings about a renaissance of fundamental research in the fields of constitutionalism and theory of state.
Ideologies, Policies and Practices in East Berlin before and after the Fall of the Wall.
Calder, Pamela
1996-01-01
Examines changes in practices of two nurseries in East Berlin following reunification of Germany. Notes that after reunification, the extensive nursery school coverage for children under 3, and near universal coverage for children 3-6 was drastically reduced, and the ideological justification for coverage was systematically rejected. Discusses…
Energy Technology Data Exchange (ETDEWEB)
Brensing, Christian
2012-11-01
Between 1955 and 1959, the housing estate at the Schiller park in Berlin-Wedding (Federal Republic in Germany) established in the 1920ies was expanded by four-storey house lines, the so-called Glas-Hoffmann buildings. Since 2008, this ensemble belongs to the Unesco World Heritage. In improving the thermal insulation of the building envelope and the adaptation of the building services to today's standards, therefore the architectural aesthetics of these buildings should not be endangered. The retrofitting was a pilot project of the research project ''Monument and energy - Postwar Modernism''.
Using Machine learning method to estimate Air Temperature from MODIS over Berlin
Marzban, F.; Preusker, R.; Sodoudi, S.; Taheri, H.; Allahbakhshi, M.
2015-12-01
Land Surface Temperature (LST) is defined as the temperature of the interface between the Earth's surface and its atmosphere and thus it is a critical variable to understand land-atmosphere interactions and a key parameter in meteorological and hydrological studies, which is involved in energy fluxes. Air temperature (Tair) is one of the most important input variables in different spatially distributed hydrological, ecological models. The estimation of near surface air temperature is useful for a wide range of applications. Some applications from traffic or energy management, require Tair data in high spatial and temporal resolution at two meters height above the ground (T2m), sometimes in near-real-time. Thus, a parameterization based on boundary layer physical principles was developed that determines the air temperature from remote sensing data (MODIS). Tair is commonly obtained from synoptic measurements in weather stations. However, the derivation of near surface air temperature from the LST derived from satellite is far from straight forward. T2m is not driven directly by the sun, but indirectly by LST, thus T2m can be parameterized from the LST and other variables such as Albedo, NDVI, Water vapor and etc. Most of the previous studies have focused on estimating T2m based on simple and advanced statistical approaches, Temperature-Vegetation index and energy-balance approaches but the main objective of this research is to explore the relationships between T2m and LST in Berlin by using Artificial intelligence method with the aim of studying key variables to allow us establishing suitable techniques to obtain Tair from satellite Products and ground data. Secondly, an attempt was explored to identify an individual mix of attributes that reveals a particular pattern to better understanding variation of T2m during day and nighttime over the different area of Berlin. For this reason, a three layer Feedforward neural networks is considered with LMA algorithm
Su, X.; Takahashi, K.; Fujimori, S.; Hasegawa, T.; Tanaka, K.; Shiogama, H.; Emori, S.; LIU, J.; Hanasaki, N.; Hijioka, Y.; Masui, T.
2017-12-01
Large uncertainty exists in the temperature projections, including contributions from carbon cycle, climate system and aerosols. For the integrated assessment models (IAMs), like DICE, FUND and PAGE, however, the scientific uncertainties mainly rely on the distribution of (equilibrium) climate sensitivity. This study aims at evaluating the emission pathways by limiting temperature increase below 2.0 ºC or 1.5 ºC after 2100 considering scientific uncertainties, and exploring how socioeconomic indicators are affected by such scientific uncertainties. We use a stochastic version of the SCM4OPT, with an uncertainty measurement by considering alternative ranges of key parameters. Three climate cases, namely, i) base case of SSP2, ii) limiting temperature increase below 2.0 ºC after 2100 and iii) limiting temperature increase below 1.5 ºC after 2100, and three types of probabilities - i) >66% probability or likely, ii) >50% probability or more likely than not and iii) the mean of the probability distribution, are considered in the study. The results show that, i) for the 2.0ºC case, the likely CO2 reduction rate in 2100 ranges from 75.5%-102.4%, with mean value of 88.1%, and 93.0%-113.1% (mean 102.5%) for the 1.5ºC case; ii) a likely range of forcing effect is found for the 2.0 ºC case (2.7-3.9 Wm-2) due to scientific uncertainty, and 1.9-3.1 Wm-2 for the 1.5 ºC case; iii) the carbon prices within 50% confidential interval may differ a factor of 3 for both the 2.0ºC case and the 1.5 ºC case; iv) the abatement costs within 50% confidential interval may differ a factor of 4 for both the 2.0ºC case and the 1.5 ºC case. Nine C4MIP carbon cycle models and nineteen CMIP3 AOGCMs are used to account for the scientific uncertainties, following MAGICC 6.0. These uncertainties will result in a likely radiative forcing range of 6.1-7.5 Wm-2 and a likely temperature increase of 3.1-4.5 ºC in 2100 for the base case of SSP2. If we evaluate the 2 ºC target by limiting the
Meta Isæus-Berlin: De animerade installationerna /The Animated Installations
Weimarck, Torsten
2006-01-01
Meta Isæus-Berlin: The Animated Installations Torsten Weimarck At about the same time that I saw Meta Isæus-Berlin’s remarkable installation Ett vattenhem (A Water Home) at the Bo01 Housing Fair in Malmö I also happened to see Johannes Stjärne Nilsson and Ola Simonsson’s film Music for one appartment and six drummers which was shown as a supporting film in the cinema. It struck me that these works had interesting things to say about each other; that in spite of their manife...
Ebrahimi, Sirous; Gabus, Sébastien; Rohrbach-Brandt, Emmanuelle; Hosseini, Maryam; Rossi, Pierre; Maillard, Julien; Holliger, Christof
2010-07-01
Two bubble column sequencing batch reactors fed with an artificial wastewater were operated at 20 degrees C, 30 degrees C, and 35 degrees C. In a first stage, stable granules were obtained at 20 degrees C, whereas fluffy structures were observed at 30 degrees C. Molecular analysis revealed high abundance of the operational taxonomic unit 208 (OTU 208) affiliating with filamentous bacteria Leptothrix spp. at 30 degrees C, an OTU much less abundant at 20 degrees C. The granular sludge obtained at 20 degrees C was used for the second stage during which one reactor was maintained at 20 degrees C and the second operated at 30 degrees C and 35 degrees C after prior gradual increase of temperature. Aerobic granular sludge with similar physical properties developed in both reactors but it had different nutrient elimination performances and microbial communities. At 20 degrees C, acetate was consumed during anaerobic feeding, and biological phosphorous removal was observed when Rhodocyclaceae-affiliating OTU 214 was present. At 30 degrees C and 35 degrees C, acetate was mainly consumed during aeration and phosphorous removal was insignificant. OTU 214 was almost absent but the Gammaproteobacteria-affiliating OTU 239 was more abundant than at 20 degrees C. Aerobic granular sludge at all temperatures contained abundantly the OTUs 224 and 289 affiliating with Sphingomonadaceae indicating that this bacterial family played an important role in maintaining stable granular structures.
Pluralism v. relativism : an appraisal of Isaiah Berlin´s defence of pluralism
Martins, Ana Vasconcelos
2015-01-01
Isaiah Berlin’s conception of pluralism is often confused with relativism. The purpose of this thesis is to assess the solidity of his arguments concerning the distinction between the two theories against the backdrop of two interpretations by two very different thinkers that similarly approximate pluralism to relativism: John Gray, the radical pluralist, and Leo Strauss, the steward of naturalism. Berlin tendered a conception of pluralism whereby the inevitable conflict among ...
Emission pathways to achieve 2.0°C and 1.5°C climate targets
Su, Xuanming; Takahashi, Kiyoshi; Fujimori, Shinichiro; Hasegawa, Tomoko; Tanaka, Katsumasa; Kato, Etsushi; Shiogama, Hideo; Masui, Toshihiko; Emori, Seita
2017-06-01
We investigated the feasibilities of 2.0°C and 1.5°C climate targets by considering the abatement potentials of a full suite of greenhouse gases, pollutants, and aerosols. We revised the inter-temporal dynamic optimization model DICE-2013R by introducing three features as follows. First, we applied a new marginal abatement cost curve derived under moderate assumptions regarding future socioeconomic development—the Shared Socioeconomic Pathways 2 (SSP2) scenario. Second, we addressed emission abatement for not only industrial CO2 but also land-use CO2, CH4, N2O, halogenated gases, CO, volatile organic compounds, SOx, NOx, black carbon and organic carbon. Third, we improved the treatment of the non-CO2 components in the climate module based on MAGICC 6.0. We obtained the following findings: (1) It is important to address the individual emissions in an analysis of low stabilization scenarios because abating land-use CO2, non-CO2 and aerosol emissions also contributes to maintaining a low level of radiative forcing and substantially affects the climate costs. (2) The 2.0°C target can be efficiently reached under the assumptions of the SSP2 scenario. (3) The 1.5°C target can be met with early deep cuts under the assumption of a temperature overshoot, and it will triple the carbon price and double the mitigation cost compared with the 2.0°C case.
Cartotto, Robert; Li, Zeyu; Hanna, Steven; Spano, Stefania; Wood, Donna; Chung, Karen; Camacho, Fernando
2016-11-01
The Berlin definition of Acute Respiratory Distress Syndrome (ARDS) has been applied to military burns resulting from combat-related trauma, but has not been widely studied among civilian burns. This study's purpose was to use the Berlin definition to determine the incidence of ARDS, and its associated respiratory morbidity, and mortality among civilian burn patients. Retrospective study of burn patients mechanically ventilated for ≥48h at an American Burn Association-verified burn center. The Berlin criteria identified patients with mild, moderate, and severe ARDS. Logistic regression was used to identify variables predictive of moderate to severe ARDS, and mortality. The outcome measures of interest were duration of mechanical ventilation and in-hospital mortality. Values are shown as the median (Q1-Q3). We included 162 subjects [24% female, age 48 (35-60), % total body surface area (TBSA) burn 28 (19-40), % body surface area (BSA) full thickness (FT) burn 13 (0-30), and 62% with inhalation injury]. The incidence of ARDS was 43%. Patients with ARDS had larger %TBSA burns [30.5 (23.1-47.0) vs. 24.8 (17.1-35), p=0.007], larger FT burns [20.5(5.4-35.5) vs. 7 (0-22.1), p=0.001], but had no significant difference in the incidence of inhalation injury (p=0.216), compared to those without ARDS. The % FT burn predicted the development of moderate to severe ARDS [OR 1.034, 95%CI (1.013-1.055), p=0.001]. ARDS developed in the 1st week after burn in 86% of cases. Worsening severity of ARDS was associated with increased days of mechanical ventilation in survivors (p=0.001), a reduction in ventilator-free days/1st 30 days in all subjects (p=0.004), and a strong indication of increased mortality (0% in mild ARDS vs. 50% in severe ARDS, unadjusted p=0.02). Neither moderate ARDS nor severe ARDS were significant predictors of death. ARDS is common among mechanically ventilated civilian burn patients, and develops early after burn. The extent of full thickness burn predicted
International Nuclear Information System (INIS)
Chun-Mei, Tang; Wei-Hua, Zhu; Kai-Ming, Deng
2010-01-01
This paper uses the generalised gradient approximation based on density functional theory to analyse the geometric structure and properties of the 3d transition metal atom doped endohedral fullerene M@C 20 F 20 (M = Sc–Ni). The geometric optimization shows that the cage centre is the most stable position for M, forming the structure named as M@C 20 F 20 -4. The inclusion energy, zero-point energy, and energy gap calculations tell us that N@C 20 F 20 -4 should be thermodynamically and kinetically stablest. M@C 20 F 20 -4 (M = Sc–Co) possesses high magnetic moments varied from 1 to 6 μ B , while Ni@C 20 F 20 -4 is nonmagnetic. The Ni–C bond in Ni@C 20 F 20 -4 contains both the covalent and ionic characters
Schröter, Michael
2005-01-01
The Verein Jugendheim in Berlin-Charlottenburg was a holding organisation of welfare institutions and of training facilities for members of the caring professions. In 1928 it founded a Soziales Institute that offered various courses for advanced vocational training. In those courses depth psychology - mainly represented by the Adlerians, least by the Jungians and increasingly by the Freudians - had a prominent place. The role of the Freudian school was supported by the fact that two staff members of the Jugendheim (Hildegard Buder-Schenck, Ursula Graf [Laessig]) started their analytic training at that time. The main teachers of psychoanalysis at the Institute were Siegfried Bernfeld, Edith Jacobson and Steffi Bornstein; notes take by a student at one of Jacobson's seminars are documented in this paper. In general, in the psychoanalytic courses there seems to have been a shift from academic teaching of theory to case oriented supervision. The presence of psychoanalysis in the training program of the Jugendheim indicates the beginning of an institutional rapprochement between pedagogy or social work and psychoanalysis in Berlin, analogous to earlier developments in Vienna. The rise of the Nazis put a stop to this promising, yet hitherto completely unknown, chapter of history.
Five years of proton therapy of tumours of the eye at Hahn-Meitner Institute, Berlin
International Nuclear Information System (INIS)
Heufelder, J.; Cordini, D.; Heese, J.; Homeyer, H.; Kluge, H.; Morgenstern, H.; Fuchs, H.; Hoecht, S.; Nausner, M.; Hinkelbein, W.; Bechrakis, N.E.; Foerster, M.H.
2004-01-01
Eye tumors (choroidal melanomas, iris melanomas, and choroidal hemangiomas) are being treated with 68 MeV protons since 1998 at the Ion Beam Laboratory of the Hahn-Meitner Institute of Berlin (Germany's first proton therapy center), in cooperation with the Charite University Hospital in Berlin, Campus Benjamin Franklin. The proton beam, generated via a combination of Van de Graaff accelerator and cyclotron, is prepared by passive shaping for conformal tumor irradiation. A digital X-ray verification of the tumor location with the patient in sitting position limits the position uncertainties to a maximum of 0,3 mm. The treatment planning is performed using the program EYEPLAN. OCTOPUS, a CT-based planning program developed in cooperation with the German Cancer Research Center of Heidelberg, is under pre-clinical testing. Thus far, more than 400 patients have been irradiated. The first results are comparable to those obtained in other proton therapy centers. At the end of 2002, the University Hospital of Essen has also become a cooperation partner of the Hahn-Meitner Institute. (orig.) [de
Directory of Open Access Journals (Sweden)
Haeusler Karl
2012-08-01
Full Text Available Abstract Background Regular exercise is beneficial for cardiovascular health but a recent meta-analysis indicated a relationship between extensive endurance sport and a higher risk of atrial fibrillation, an independent risk factor for stroke. However, data on the frequency of cardiac arrhythmias or (clinically silent brain lesions during and after marathon running are missing. Methods/ Design In the prospective observational “Berlin Beat of Running” study experienced endurance athletes underwent clinical examination (CE, 3 Tesla brain magnetic resonance imaging (MRI, carotid ultrasound imaging (CUI and serial blood sampling (BS within 2-3 days prior (CE, MRI, CUI, BS, directly after (CE, BS and within 2 days after (CE, MRI, BS the 38th BMW BERLIN-MARATHON 2011. All participants wore a portable electrocardiogram (ECG-recorder throughout the 4 to 5 days baseline study period. Participants with pathological MRI findings after the marathon, troponin elevations or detected cardiac arrhythmias will be asked to undergo cardiac MRI to rule out structural abnormalities. A follow-up is scheduled after one year. Results Here we report the baseline data of the enrolled 110 athletes aged 36-61 years. Their mean age was 48.8 ± 6.0 years, 24.5% were female, 8.2% had hypertension and 2.7% had hyperlipidaemia. Participants have attended a mean of 7.5 ± 6.6 marathon races within the last 5 years and a mean of 16 ± 36 marathon races in total. Their weekly running distance prior to the 38th BMW BERLIN-MARATHON was 65 ± 17 km. Finally, 108 (98.2% Berlin Beat-Study participants successfully completed the 38th BMW BERLIN-MARATHON 2011. Discussion Findings from the “Berlin Beats of Running” study will help to balance the benefits and risks of extensive endurance sport. ECG-recording during the marathon might contribute to identify athletes at risk for cardiovascular events. MRI results will give new insights into the link
Computer-aided system for diabetes care in Berlin, G.D.R.
Thoelke, H; Meusel, K; Ratzmann, K P
1990-01-01
In the Centre of Diabetes and Metabolic Disorders of Berlin, G.D.R., a computer-aided care system has been used since 1974, aiming at relieving physicians and medical staff from routine tasks and rendering possible epidemiological research on an unselected diabetes population of a defined area. The basis of the system is the data bank on diabetics (DB), where at present data from approximately 55,000 patients are stored. DB is used as a diabetes register of Berlin. On the basis of standardised criteria of diagnosis and therapy of diabetes mellitus in our dispensary care system, DB facilitates representative epidemiological analyses of the diabetic population, e.g. prevalence, incidence, duration of diabetes, and modes of treatment. The availability of general data on the population or the selection of specified groups of patients serves the management of the care system. Also, it supports the computer-aided recall of type II diabetics, treated either with diet alone or with diet and oral drugs. In this way, the standardised evaluation of treatment strategies in large populations of diabetics is possible on the basis of uniform metabolic criteria (blood glucose plus urinary glucose). The system consists of a main computer in the data processing unit and of personal computers in the diabetes centre which can be used either individually or as terminals to the main computer. During 14 years of experience, the computer-aided out-patient care of type II diabetics has proved efficient in a big-city area with a large population.
The 16th International Conference on X-ray Absorption Fine Structure (XAFS16)
Grunwaldt, J.-D.; Hagelstein, M.; Rothe, J.
2016-05-01
This preface of the proceedings volume of the 16th International Conference on X- ray Absorption Fine Structure (XAFS16) gives a glance on the five days of cutting-edge X-ray science which were held in Karlsruhe, Germany, August 23 - 28, 2015. In addition, several satellite meetings took place in Hamburg, Berlin and Stuttgart, a Sino-German workshop, three data analysis tutorials as well as special symposia on industrial catalysis and XFELs were held at the conference venue.
Culture and comorbidity in East and West berliners.
Fechner, Mary J
2010-03-01
Following the collapse of socialism, fluctuations in cardiac mortality rates in East Germany and a West-to-East cardiac health gradient became topics of interest. Researchers suggested possible causes for these phenomena, including stress from postsocialism. I proposed that a cultural investigation of heart disease comorbid with depression could inform our understanding of the potential health effects of the postsocialist transition. I conducted ethnographic and survey research. In the study described here, I administered a depression scale (CES-D) and an ethnographically derived measure of cultural stress (Good Life Survey) to over 200 East and West Berliners with cardiovascular disease. Comparison of the groups' depression means revealed no difference. However, correlation of the Good Life Survey and the CES-D revealed unique profiles of cultural variables associated with depression in the two groups, suggesting that culture shapes depression and cardiac risk. I discuss the value of cultural studies to comorbidity research.
Cold and heat storage in downtown Berlin; Kaelte und Waermespeicherung im Zentrum Berlins
Energy Technology Data Exchange (ETDEWEB)
Seibt, P; Brandt, W; Kabus, F; Moellmann, G; Poppei, J [Geothermie Neubrandenburg GmbH (Germany)
1997-12-01
The concept of energy supply for the seat of the German Parliament is based on self-sufficiency by using motor-driven district heating power stations. Esterified vegetable oil (bio-diesel) serves as fuel. These motor-driven power stations are operated depending on the amount of power required actually. The heat energy which is released when generating power at the temperature level >100 C - which is favourable for heating purposes - serves directly for heat supply or the driving a refrigerating machine/heat pump for the supply of cooling energy in summer and low-temperature heat in winter. As the demand on heat and power supply often will not be parallel, there will be a temporary surplus of heat offered by the motor-driven power station, and at other times it will be deficient. That is why surplus heat from the motor-driven power station is stored in a deep aquifer heat reservoir for recovery and utilisation for heating in winter. By using a geothermal saline water reservoir, the waste heat from the motor-driven power station can be fed into it at a temperature level ranging from 60.. 80 C and recovered and utilised at a temperature level ranging from 60.. 20 C. A shallow groundwater aquifer cold storing reservoir serves for cooling: the cold stored in winter is supplied in summer to the cooling equipment of the building by direct cooling with the cold water form the aquifer (heat exchange) at a temperature level of 14/15 C. The cooling demand in case of air dehumidification at a temperature level of 6/12 C is covered by a cooling machine which is also cooled with the cold water from the aquifer. As cooling machine/heat pump an environment-friendly, CFC-free absorption machine is used working on a combination of water and lithium bromide. The machine is driven by the waste heat from the motor-driven power plant. (orig.) [Deutsch] Im Zentrum des Systems der Energieversorgung der Parlamentsbauten steht die autarke Energiebereitstellung durch den Einsatz von
TAO/TRITON, RAMA, and PIRATA Buoys, Daily, 1977-present, 20C Isotherm Depth
National Oceanic and Atmospheric Administration, Department of Commerce — This dataset has daily 20C Isotherm Depth data (the depth at which the ocean temperature is 20C) from the TAO/TRITON (Pacific Ocean, https://www.pmel.noaa.gov/gtmba/...
Olympics in Berlin in 1936 thougth the eyes of czech and german newspapers
Nevšímalová, Aneta
2013-01-01
The bachelor thesis aims to introduce the reader to the difference between Czech and German journalism and the manner of informing about sport events during the eleventh Olympic Games in Berlin in 1936. These Olympic Games were the first games in their modern history used for the purposes of propaganda. The thesis compares three significant Czech periodicals (Lidové noviny, České slovo and Venkov), with the German ones - Fehrbelliner Zeitung, Schwedter Tageblatt, Prager Tagblatt, and Deutsch-...
Schwemin, Friedhelm
Johann Elert Bode (1747-1826), long-time director of Berlin Observatory, earned his merits by editing the “Astronomisches Jahrbuch” for many years, for producing a immaculate star atlas, and for writing a series of popular books. Today, astronomers still know the “Titius-Bode law” of planetary distances, which had been publicized by him. The author traces the life of this Hamburg-born scholar. He analyzes his works and tries to determine his place in the history of astronomy. The volume comprises texts of original documents from Bode's life, a bibliography of his works, as well as numerous historical illustrations, often published here for the first time.
Experimental study of radiative pion capture on 13C, 20Ne, 90Zr, 19F and 12C
International Nuclear Information System (INIS)
Martoff, C.J.
1980-11-01
Photon spectra for 50 13 C, 19 F, 20 Ne, and 90 Zr. The e + e - pair spectrometer system used has resolution 850 keV fwhm and photon detection efficiency 5 x 10 -6 . The total radiative capture branching ratios measured are 13 C (1.66 +- 0.25)%, 19 F (2.40 +- 0.48)%, 20 Ne (1.60 +- 0.24)%, and 90 Zr (2.1 +- 0.5)%. The partial radiative capture branching ratios to four bound states and two resonances in 20 F, and two bound states and three resonances in 13 B have also been measured. The branching ratio for 13 C(π - ,γ) 13 B g.s. is (6.1 +- 1.2) x 10 -4 . Comparison of this result with the beta decay rate of 13 B shows that (84 +- 16)% of the pion capture amplitude is accounted for by the Gamow-Teller matrix element. Further analysis suggests that much of the remaining strength is E2. The measured branching ratios to resonant states in 13 C(π - ,γ) 13 B are shown to be in agreement with detailed shell model calculations. The total single-particle strength in these transitions is shown to be approximately half as large as that of the T = 3/2 part of the E1 photoresonance (the Giant Dipole Resonance) in 13 C. The branching ratio for 20 Ne(π - ,γ) 20 F (T = 1, J/sup π/ = 1 + , E/sub x/ = 1.06 MeV) is 0.91 +- 0.52).10 -4 . Comparison with the electroexcitation of the analog giant M1 state in 20 Ne (11.24 MeV) shows that the M1 transition amplitude is less than (46 +- 14)% Gamow-Teller. This result is in agreement with detailed shell model calculations of the M1 transition. The photon spectrum for radiative pion capture from flight (reaction 12 C(π + T = 44 MeV, γ at 90 0 )) has been measured. 13 figures, 12 tables
Interphase APC/C-Cdc20 inhibition by cyclin A2-Cdk2 ensures efficient mitotic entry
DEFF Research Database (Denmark)
Hein, Jamin B; Nilsson, Jakob
2016-01-01
Proper cell-cycle progression requires tight temporal control of the Anaphase Promoting Complex/Cyclosome (APC/C), a large ubiquitin ligase that is activated by one of two co-activators, Cdh1 or Cdc20. APC/C and Cdc20 are already present during interphase but APC/C-Cdc20 regulation during...... this window of the cell cycle, if any, is unknown. Here we show that cyclin A2-Cdk2 binds and phosphorylates Cdc20 in interphase and this inhibits APC/C-Cdc20 activity. Preventing Cdc20 phosphorylation results in pre-mature activation of the APC/C-Cdc20 and several substrates, including cyclin B1 and A2......, are destabilized which lengthens G2 and slows mitotic entry. Expressing non-degradable cyclin A2 but not cyclin B1 restores mitotic entry in these cells. We have thus uncovered a novel positive feedback loop centred on cyclin A2-Cdk2 inhibition of interphase APC/C-Cdc20 to allow further cyclin A2 accumulation...
Directory of Open Access Journals (Sweden)
C. Bickelmann
2009-02-01
Full Text Available Crocodylian material from late Pleistocene localities around Antsirabe, Madagascar, stored in the collection of the Museum für Naturkunde, Berlin, was surveyed. Several skeletal elements, including skull bones, vertebrae, ribs, osteoderms, and limb bones from at least three large individuals could be unambiguously assigned to the genus Voay Brochu, 2007. Furthermore, the simultaneous occurrence of Voay robustus Grandidier & Vaillant, 1872 and Crocodylus niloticus Laurenti, 1768 in Madagascar is discussed. Voay robustus and Crocodylus niloticus are systematically separate but similar in stature and size, which would make them direct rivals for ecological resources. Our hypothesis on the extinction of the species Voay, which was endemic to Madagascar, suggests that C. niloticus invaded Madagascar only after V. robustus became extinct. doi:10.1002/mmng.200800007
Marble Deterioration and Climate: Examples from the Schlossbrücke Berlin
Pirskawetz, S.; Siegesmund, S.; Weise, F.; Rieffel, Y.; Plagge, R.
2012-04-01
Protective structures for works of art or antique artefacts have a long architectural tradition and have been known in Germany since the 19th century. The effect of such covers on the microclimate around artworks of natural stone, and hence, their protective capability are insufficiently documented and understood. In 2007, an inter-disciplinary model project and part of a pilot study coordinated by the Berlin State Office for the Protection of Monuments was planned with the aim of developing an innovative winter covering system for marble statuaries located on the Schlossbrücke in Berlin. Such a system would need to fulfil the various requirements for structural stability, aesthetics, climate and practical use. This applied research represents the first complex scientific study of the sustainability of a winter covering system. A climate monitoring system was designed to create a dense database for the numerical prediction of the effect of protective systems, and to compare the given climate conditions to the known factors influencing the marble deterioration. Based on these findings a prototype of an innovative shelter was designed and tested. The project shows, that beside a temporary covering regular inspection and maintenance combined with regular cleaning ensures an effective and sustainable protection of marble sculptures. Such a maintenance program is the precondition for preserving the sculptures of the Schlossbrücke as a historical ensemble. Important scientific results of the project are transferable to similar objects of Carrara marble. The results throw a new light on the conventional protection of such objects and leads to a discussion on the necessity of an all-season protection.
Directory of Open Access Journals (Sweden)
Sibylle Hermann
2017-12-01
The added value of the Academic Publication Management PUMA at the University of Stuttgart compared to a bibliographic cataloguing environment lies in the direct processing of data by scientists without an interim step via the library. For the university content management system, a plugin is available, which dynamically integrates publication lists into employees’ web pages. The metadata is loaded directly from PUMA, filtered, sorted and can be put out in the citation style desired. PUMA offers many interfaces and display possibilities.
Xanthobacter sp. C20 contains a novel bioconversion pathway for limonene
Werf, M.J. van der; Keijzer, P.M.; Schaft, P.H. van der
2000-01-01
Xanthobacter sp. C20 was isolated from sediment of the river Rhine using cyclohexane as sole source of carbon and energy. Xanthobacter sp. C20 converted both enantiomers of limonene quantitatively into limonene-8,9-epoxide, a not previously described bioconversion product of limonene. With (4R)-limonene, (4R,8R)-limonene-8,9-epoxide was formed as the only reaction product, while (4S)-limonene was converted into a (78:22) mixture of (4S,8R)- and (4S,8S)-limonene-8,9-epoxide. Cytochrome P-450 w...
Directory of Open Access Journals (Sweden)
Maria Amalia Brunini
2003-12-01
Full Text Available Neste estudo, goiabas da cultivar 'Paluma' foram cortadas em duas partes e submetidas a diferentes processos de conservação antes do armazenamento a -20ºC. No primeiro processo a polpa dura foi triturada, acondicionada em sacos de polietileno, com espessura de 40 µm, congelada e armazenada a -20°C°, e no segundo processo a polpa dura foi cortada ao meio, branqueada em água quente a 98ºC por quatro minutos, seca e acondicionada em sacos de polietileno, com espessura de 40 µm, congelada e armazenada a -20ºC. A qualidade da polpa foi avaliada através do pH, teor de ácido ascórbico, sólidos solúveis totais, acidez total titulável, aparência, textura e coloração. As duas formas de conservação mostraram-se adequadas para preservação da polpa com boa aparência até 18 semanas. Houve redução no conteúdo de ácido ascórbico, principalmente na polpa triturada. A textura e o sabor da polpa foram afetados pelo tempo de armazenamento. Os dois procedimentos, como técnicas de preservação de goiabas pelas indústrias de alimentos, podem ser usados durante o período de safra, sendo uma boa alternativa para evitar perdas pós-colheita.In this study, guava fruits cv. Paluma were cut in two parts and submitted to different processing condition before storage at -20ºC. In the first process the fruit pulp were tritured and conditioned in polyethylene bags with 40µm of thickness, frozen and stored at -20ºC in refrigerated chamber; and in the second process the slices of the pulp fruit were treated with hot-water at 98ºC by four minutes, dried and conditioned in polyethylene bags with 40µm of thickness, frozen and stored at -20ºC. The pulp quality was avaliable throught the pH, ascorbic acid content, total soluble solids, titrable acidity, general appearance, firmness and color. The two process used were able to preserve the pulp with good aspect until 18 week. The content of ascorbic acid decreased, principally, in the tritured
Directory of Open Access Journals (Sweden)
A. Buettner
2013-08-01
Full Text Available The UAS "Stuttgarter Adler" was designed as a flexible and cost-effective remote-sensing platform for acquisition of high quality environmental data. Different missions for precision agriculture applications and BRDF-research have been successfully performed with a multispectral camera system and a spectrometer as main payloads. Currently, an imaging spectrometer is integrated in the UAS as a new payload, which enables the recording of hyperspectral data in more than 200 spectral bands in the visible and near infrared spectrum. The recording principle of the hyperspectral instrument is based on a line scanner. Each line is stored as a matrix image with spectral information in one axis and spatial information in the other axis of the image. Besides a detailed specification of the system concept and instrument design, the calibration procedure of the hyperspectral sensor system is discussed and results of the laboratory calibration are presented. The complete processing chain of measurement data is described and first results of measurement-flights over agricultural test sites are presented.
Directory of Open Access Journals (Sweden)
Xiaoli Li
Full Text Available CONTEXT: Graves' disease (GD is a common autoimmune disease involving the thyroid gland. The altered balance of pro- and anti-inflammatory cytokines plays an important role in the pathogenesis of GD. Chemokine (C-C motif ligand 20 (CCL20 is important for interleukin-17 (IL-17 signal activation and a potent chemoattractant for Th17 cells. Meanwhile, Osteopontin (OPN, a broadly expressed pleiotropic cytokine, has been implicated in GD through inducing Th1-involved response to enhance the production of proinflammatory cytokines and chemokines, but little is known about the role of OPN in regulating CCL20 and IL-17 signaling. OBJECTIVE: This study sought to explore the possibility of CCL20 level as a biomarker for GD, as well as investigate the role of OPN in regulating CCL20 production. METHODS: Fifty untreated GD patients, fifteen euthyroid GD patients, twelve TRAb-negative GD patients and thirty-five healthy control donors were recruited. OPN, CCL20 and other clinical GD diagnosis parameters were measured. CD4+T cells were isolated from peripheral blood mononuclear cells (PBMCs using antibody-coated magnetic beads. Enzyme-linked immune-sorbent assay and quantitative polymerase chain reaction were used to determine CCL20 expression level. RESULTS: We found that the plasma CCL20 level was enhanced in GD patients and decreased in euthyroid and TRAb-negative GD patients. In addition, CCL20 level correlated with GD clinical diagnostic parameters and plasma OPN level. Moreover, we demonstrated that recombinant OPN and plasma from untreated GD patients increased the expression of CCL20 in CD4+T cells, which could be blocked by OPN antibody. Furthermore, we found that the effect of OPN on CCL20 expression was mediated by β3 integrin receptor, IL-17, NF-κB and MAPK pathways. CONCLUSIONS: These results demonstrated that CCL20 might serve as a biomarker for GD and suggested the possible role of OPN in induction of CCL20 expression.
Patricios, JS; Ardern, CL; Hislop, MD; Aubry, M; Bloomfield, P; Broderick, C; Clifton, P; Echemendia, RJ; Ellenbogen, RG; Falvey, ÉC; Fuller, GW; Grand, J; Hack, D; Harcourt, PR; Hughes, D
2018-01-01
The 2017 Berlin Concussion in Sport Group Consensus Statement provides a global summary of best practice in concussion prevention, diagnosis and management, underpinned by systematic reviews and expert consensus. Due to their different settings and rules, individual sports need to adapt concussion guidelines according to their specific regulatory environment. At the same time, consistent application of the Berlin Consensus Statement's themes across sporting codes is likely to facilitate super...
Deformation effects in the 20Ne+12C reaction
International Nuclear Information System (INIS)
Dey, A.; Bhattacharya, C.; Banerjee, K.; Kundu, S.; Mukhopadhyay, S.; Gupta, D.; Saha, R.; Bhattacharya, S.
2004-01-01
The present work has been performed with the aim to investigate the possible occurrence of highly deformed configurations of the 32 S di-nuclear systems which may be formed in the 20 Ne+ 12 C reaction by studying the properties of emitted light charged particles
Psychrotrophic bacteria isolated from -20°C freezer | Ahmad ...
African Journals Online (AJOL)
Three psychrotrophic bacteria, morpho-physiologically, identified as Bacillus subtilis MRLBA7, Bacillus licheniformis MRLBA8 and Bacillus megaterium MRLBA9 were isolated from -20°C freezer of the Microbiology Research Laboratory (MRL), Quaid-i-Azam University, Islamabad, Pakistan. These strains were able to grow ...
Avoiding Extremes: Benefits of Staying below +1.5 °C Compared to +2.0 °C and +3.0 °C Global Warming
Directory of Open Access Journals (Sweden)
Claas Teichmann
2018-03-01
Full Text Available The need to restrict global mean temperature to avoid irreversible climate change is supported by scientific evidence. The need became political practice at the Conference of the Parties in 2015, where the participants decided to limit global warming to not more than +2.0 °C compared to pre-industrial times and to rather aim for a limit of +1.5 °C global warming. Nevertheless, a clear picture of what European climate would look like under +1.5 °C, +2.0 °C and +3.0 °C global warming level (GWL is still missing. In this study, we will fill this gap by assessing selected climate indices related to temperature and precipitation extremes, based on state of the art regional climate information for Europe taken from the European branch of the World Climate Research Program Coordinated Regional Downscaling Experiment (EURO-CORDEX ensemble. To assess the impact of these indices under climate change, we investigate the spatial extent of the area of the climate change signal in relation to the affected population. This allows us to demonstrate which climate extremes could be avoided when global warming is kept well below +2.0 °C or even +1.5 °C compared to higher GWLs. The European north–south gradient of tropical nights and hot days is projected to be intensified with an increasing global warming level. For precipitation-related indices, an overall increase in precipitation extremes is simulated, especially under +3.0 °C GWL, for mid- and northern Europe, whereas an increase in dry days is projected for many regions in southern Europe. The benefit of staying below +1.5 °C GWL compared to +2.0 °C GWL is the avoidance of an additional increase in tropical nights and hot days parallel to an increase in dry days in parts of southern Europe as well as an increase in heavy precipitation in parts of Scandinavia. Compared to +3.0 °C GWL, the benefit of staying at +1.5 °C GWL is to avoid a substantial increase (i.e., an increase of more than five dry
Energy Technology Data Exchange (ETDEWEB)
Krems, Josef F.; Weinmann, Oliver; Weber, Julian; Westermann, Dirk; Albayrak, Sahin (eds.)
2013-04-01
One promising option of the reduction of the emission of greenhouse gases and the promotion of the climate protection is the utilization of electric-powered vehicles. The customer acceptance and practical suitability of electric-powered vehicles are essential factors of success which are investigated within the Berlin field test 'MINI E 1.0 powered by Vattenfall' from the perspective of energy industry, vehicle manufacturer and the science. Beside the hurdles up to the establishment in the mass market, it is shown how the users with aspects specific for electric-powered vehicles interact, and how the controlled loading facilitates the optimal integration of wind power. The comprehensive collection of subjective and objective data as well as detailed information on the conception of the case study complete the contribution under consideration.
Directory of Open Access Journals (Sweden)
Friedemann Kunst
2016-10-01
Full Text Available Transport and its side effects are major problems in rapidly growing cities. Car traffic dominates these cities and pollutes the environment without being able to sufficiently secure the mobility of the urban population and goods. A paradigm shift in urban and transport policy will be necessary to change this situation. In spite of its different development dynamics, Berlin is an interesting example to discuss development strategies for rapidly growing cities because in the course of more than 100 years, a twofold paradigm shift has occurred in the city both conceptually and practically: Berlin has shifted from a city dominated by rail traffic to an automobile-oriented city, and has then gradually transformed back into a city in which an intertwined system of public and non-motorized individual means of transport secures the mobility of the urban population. The interdependencies on the conceptual level between urban planning and transport policies as well as on a practical level between urban structures and transport systems can be studied using the example of Berlin. Experiences with the implementation of automobile-oriented planning and the special conditions in the first decade after reunification led to protests, reflection, and a revision of the transport policy. A strategically designed process of integrated planning has brought about a trend reversal, and steered the development of transport in the direction of clearly formulated sustainability-oriented objectives. In this process, the reintegration of transport and spatial planning and a reorganization of institutional structures at the administrative level was of particular importance. Compact, rail-oriented settlement structures like in the metropolitan region of Berlin make it easier to dispense with automobiles than sprawled structures. The residual role that qualitatively improved automobiles will take in the cities of the future will have to be determined by research and
Kuusk, Priit, 1938-
2001-01-01
Festivalist Berliner Festwochen. Wagneri tetraloogia "Nibelungide sõrmus" etendustest USA festivalil "Seattle'i suveooper". Hispaanias San Sebastianis toimunud festivalist "Quincena Musical". T. Tshuhhadzhjani ooperi "Arshak II" maailmaesiettekandest San Francisco Ooperis. Lühidalt I. Rebroffist
Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project
Lifescience Database Archive (English)
Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT
Neuroprotective Efficacy of an Aminopropyl Carbazole Derivative P7C3-A20 in Ischemic Stroke.
Wang, Shu-Na; Xu, Tian-Ying; Wang, Xia; Guan, Yun-Feng; Zhang, Sai-Long; Wang, Pei; Miao, Chao-Yu
2016-09-01
NAMPT is a novel therapeutic target of ischemic stroke. The aim of this study was to investigate the effect of a potential NAMPT activator, P7C3-A20, an aminopropyl carbazole derivative, on ischemic stroke. In vitro study, neuron protection effect of P7C3-A20 was investigated by co-incubation with primary neurons subjected to oxygen-glucose deprivation (OGD) or oxygen-glucose deprivation/reperfusion (OGD/R) injury. In vivo experiment, P7C3-A20 was administrated in middle cerebral artery occlusion (MCAO) rats and infarct volume was examined. Lastly, the brain tissue nicotinamide adenine dinucleotide (NAD) levels were detected in P7C3-A20 treated normal or MCAO mice. Cell viability, morphology, and Tuj-1 staining confirmed the neuroprotective effect of P7C3-A20 in OGD or OGD/R model. P7C3-A20 administration significantly reduced cerebral infarction in MCAO rats. Moreover, brain NAD levels were elevated both in normal and MCAO mice after P7C3-A20 treatment. P7C3-A20 has neuroprotective effect in cerebral ischemia. The study contributes to the development of NAMPT activators against ischemic stroke and expands the horizon of the neuroprotective effect of aminopropyl carbazole chemicals. © 2016 John Wiley & Sons Ltd.
Cadelis, G; Fayad Y Monteagudo, O E
2016-12-01
Few data exist on the prevalence of symptoms and risk of obstructive sleep apnea syndrome (OSAS) among professionals of a health facility, or they often work in shift schedule and night. Under these conditions, an undetected OSAS may affect alertness and attention in professional acts. The purpose of this study was to determine the prevalence and risk factors of OSAS among professionals of a health facility. It is a descriptive cross-sectional study conducted among 773 participants working at the university hospital of Pointe-à-Pitre and volunteers to answer the Berlin questionnaire. We also collected among respondents, abdominal and neck circumference and medical history. Women accounted for 67% (n=520) of the sample and men 32.7% (n=253). The mean age was 42±11.1 years. We noted a high prevalence of OSAS symptoms (snoring at 69% to 26% daytime sleepiness) and SAS risk factors (hypertension reported to 18%, BMI>30kg/m 2 to 13%). The prevalence of subjects at high OSAS risk was 23.5% (20.6-26.6%) in the overall study population; it was 22.4% in nursing staff, and 21.4% (17-26%) among in the shift schedule workers. The factors significantly associated with a high risk of OSAS in this population were: age>51 years (adjusted odds ratio [aOR]: 8.1, P41cm (aOR: 2.9, Phealth workers who have risk factors for sleep apnea syndrome identified in this study, OSAS screening by the Berlin Questionnaire. This could be implemented for example as part of occupational medicine. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
20 CFR 410.561c - Defeat the purpose of title IV.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Defeat the purpose of title IV. 410.561c Section 410.561c Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY..., accident, and health insurance including premiums for supplementary medical insurance benefits under title...
Hass, Ulrike; Duennbier, Uwe; Massmann, Gudrun
2012-11-15
The occurrence and distribution of six psychoactive compounds (primidone, phenobarbital, oxazepam, diazepam, meprobamate, and pyrithyldione) and a metabolite of primidone (phenylethylmalonamide) were investigated in wastewater treatment plant (WWTP) effluents, surface water, groundwater of a bank filtration site, raw and final drinking water, and in groundwater affected by former sewage irrigation. Primidone and its metabolite phenylethylmalonamide were found to be ubiquitous in environmental water samples in Berlin. Maximum concentrations of 0.87 and 0.42 μg/L, respectively, were encountered in WWTP effluents. Both compounds are apparently not removed when passaging through the different compartments of the water cycle and concentrations are only reduced by dilution. Phenobarbital was present at nearly every stage of the Berlin water cycle with the exception of raw and final drinking water. The highest concentrations of phenobarbital (up to 0.96 μg/L) were measured in groundwater influenced by former sewage irrigation. Oxazepam was only present in WWTP effluents and surface waters (up to 0.18 μg/L), while diazepam was not detected in any matrix. Due to their withdrawal from the German market years ago, the pharmaceuticals meprobamate and pyrithyldione were only found in sewage farm groundwater (up to 0.50 and 0.04 μg/L, respectively) and, in case of meprobamate, also in decade old bank filtrate (0.03 μg/L). Our results indicate a high persistence of some of the investigated compounds in the aquatic system. As a consequence, these pollutants may potentially reach drinking water resources via bank filtration if present in WWTP effluents and/or surface waters in partly closed water cycles such as Berlin's. Copyright © 2012 Elsevier Ltd. All rights reserved.
High Levels of Chemokine C-C Motif Ligand 20 in Human Milk and Its Production by Oral Keratinocytes.
Lourenço, Alan G; Komesu, Marilena C; Duarte, Geraldo; Del Ciampo, Luiz A; Mussi-Pinhata, Marisa M; Yamamoto, Aparecida Y
2017-03-01
Chemokine C-C motif ligand 20 (CCL20) is implicated in the formation and function of mucosal lymphoid tissues. Although CCL20 is secreted by many normal human tissues, no studies have evaluated the presence of CCL20 in human milk or its production by oral keratinocytes stimulated by human milk. To evaluate the presence of CCL20 in breast milk and verify CCL20 secretion in vitro by oral keratinocytes stimulated with human and bovine milk, as well as its possible association with breast milk lactoferrin levels. The levels of CCL20 and lactoferrin were measured by enzyme-linked immunosorbent assay in human milk at three different stages of maturation from 74 healthy breastfeeding mothers. In vitro, oral keratinocytes were stimulated with human and bovine milk, and CCL20 was measured in their supernatant. High concentrations of CCL20 were detected in the human breast milk samples obtained during the first week (1,777.07 pg/mL) and second week postpartum (1,523.44 pg/mL), with a significantly low concentration in samples at 3-6 weeks postpartum (238.42 pg/mL; p stimulated higher CCL20 secretion by oral keratinocytes compared with bovine milk (p stimulation had no association with breast milk lactoferrin concentration. CCl20 is present at high levels in human milk, predominantly in the first and second week postpartum, but at significantly lower levels at 3-6 weeks postpartum. Human milk is capable of stimulating CCL20 secretion by oral keratinocytes, and this induction had no association with breast milk lactoferrin concentration.
20th Joint Workshop on Sustained Simulation Performance
Bez, Wolfgang; Focht, Erich; Patel, Nisarg; Kobayashi, Hiroaki
2016-01-01
The book presents the state of the art in high-performance computing and simulation on modern supercomputer architectures. It explores general trends in hardware and software development, and then focuses specifically on the future of high-performance systems and heterogeneous architectures. It also covers applications such as computational fluid dynamics, material science, medical applications and climate research and discusses innovative fields like coupled multi-physics or multi-scale simulations. The papers included were selected from the presentations given at the 20th Workshop on Sustained Simulation Performance at the HLRS, University of Stuttgart, Germany in December 2015, and the subsequent Workshop on Sustained Simulation Performance at Tohoku University in February 2016.
DEFF Research Database (Denmark)
Maresca, Julia A; Gomez Maqueo Chew, Aline; Ponsatí, Marta Ros
2004-01-01
that restores the correct reading frame in bchU. The bchU gene was inactivated in C. tepidum, a BChl c-producing species, and the resulting mutant produced only BChl d. Growth rate measurements showed that BChl c- and d-producing strains of the same organism (C. tepidum or C. vibrioforme) have similar growth...... rates at high and intermediate light intensities but that strains producing BChl c grow faster than those with BChl d at low light intensities. Thus, the bchU gene encodes the C-20 methyltransferase for BChl c biosynthesis in Chlorobium species, and methylation at the C-20 position to produce BChl c...
The Berlin definition of ARDS: an expanded rationale, justification, and supplementary material.
Ferguson, Niall D; Fan, Eddy; Camporota, Luigi; Antonelli, Massimo; Anzueto, Antonio; Beale, Richard; Brochard, Laurent; Brower, Roy; Esteban, Andrés; Gattinoni, Luciano; Rhodes, Andrew; Slutsky, Arthur S; Vincent, Jean-Louis; Rubenfeld, Gordon D; Thompson, B Taylor; Ranieri, V Marco
2012-10-01
Our objective was to revise the definition of acute respiratory distress syndrome (ARDS) using a conceptual model incorporating reliability and validity, and a novel iterative approach with formal evaluation of the definition. The European Society of Intensive Care Medicine identified three chairs with broad expertise in ARDS who selected the participants and created the agenda. After 2 days of consensus discussions a draft definition was developed, which then underwent empiric evaluation followed by consensus revision. The Berlin Definition of ARDS maintains a link to prior definitions with diagnostic criteria of timing, chest imaging, origin of edema, and hypoxemia. Patients may have ARDS if the onset is within 1 week of a known clinical insult or new/worsening respiratory symptoms. For the bilateral opacities on chest radiograph criterion, a reference set of chest radiographs has been developed to enhance inter-observer reliability. The pulmonary artery wedge pressure criterion for hydrostatic edema was removed, and illustrative vignettes were created to guide judgments about the primary cause of respiratory failure. If no risk factor for ARDS is apparent, however, objective evaluation (e.g., echocardiography) is required to help rule out hydrostatic edema. A minimum level of positive end-expiratory pressure and mutually exclusive PaO(2)/FiO(2) thresholds were chosen for the different levels of ARDS severity (mild, moderate, severe) to better categorize patients with different outcomes and potential responses to therapy. This panel addressed some of the limitations of the prior ARDS definition by incorporating current data, physiologic concepts, and clinical trials results to develop the Berlin definition, which should facilitate case recognition and better match treatment options to severity in both research trials and clinical practice.
A Local Dimension of Integration Policies? A Comparative Study of Berlin, Malmö, and Rotterdam
Dekker, Rianne; Emilsson, Henrik; Krieger, Bernhard; Scholten, Peter
2015-01-01
textabstractThis study examines three theses on local integration policies by a qualitative comparative case study of integration policies in three cities in three different countries (Berlin, Malmö, and Rotterdam). We found little evidence of a congruent local dimension of integration policies. Local policies resemble their national policy frameworks fairly well in terms of policy approaches and domains. Our multi-level perspective shows that this is not the result of top-down hierarchical g...
Engineering Macaca fascicularis cytochrome P450 2C20 to reduce animal testing for new drugs.
Rua, Francesco; Sadeghi, Sheila J; Castrignanò, Silvia; Di Nardo, Giovanna; Gilardi, Gianfranco
2012-12-01
In order to develop in vitro methods as an alternative to P450 animal testing in the drug discovery process, two main requisites are necessary: 1) gathering of data on animal homologues of the human P450 enzymes, currently very limited, and 2) bypassing the requirement for both the P450 reductase and the expensive cofactor NADPH. In this work, P450 2C20 from Macaca fascicularis, homologue of the human P450 2C8 has been taken as a model system to develop such an alternative in vitro method by two different approaches. In the first approach called "molecular Lego", a soluble self-sufficient chimera was generated by fusing the P450 2C20 domain with the reductase domain of cytochrome P450 BM3 from Bacillus megaterium (P450 2C20/BMR). In the second approach, the need for the redox partner and also NADPH were both obviated by the direct immobilization of the P450 2C20 on glassy carbon and gold electrodes. Both systems were then compared to those obtained from the reconstituted P450 2C20 monooxygenase in presence of the human P450 reductase and NADPH using paclitaxel and amodiaquine, two typical drug substrates of the human P450 2C8. The K(M) values calculated for the 2C20 and 2C20/BMR in solution and for 2C20 immobilized on electrodes modified with gold nanoparticles were 1.9 ± 0.2, 5.9 ± 2.3, 3.0 ± 0.5 μM for paclitaxel and 1.2 ± 0.2, 1.6±0.2 and 1.4 ± 0.2 μM for amodiaquine, respectively. The data obtained not only show that the engineering of M. fascicularis did not affect its catalytic properties but also are consistent with K(M) values measured for the microsomal human P450 2C8 and therefore show the feasibility of developing alternative in vitro animal tests. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Dierk Schmidt
2014-10-01
Full Text Available Is pictorial language able to convey a juridical abstraction? This co-authored text addresses that question in the context of the geo-political division of Africa after the Berlin Africa Conference (Congo Conference, as a means to conceptualise colonial rule in 1884/85 – and its manifold grave consequences – as a historical by-product of Europe’s political and aesthetic modernity. Is there any value in representing the image of genocide, (while acknowledging the ‘impossibility’ of its representation? With these issues in mind, lawyer Malte Jaguttis and artist Dierk Schmidt offer a commentary based on their project, ‘The division of the earth — Tableaux on the legal synopses of the Berlin Africa Conference’.
Energy Technology Data Exchange (ETDEWEB)
Henne, R. (ed.)
1973-07-15
This report compiles papers concerning especially recent developments in work function theory and work function measurements, which were given at a round table conference about surface phenomena in thermionic research, arranged by the 'Deutsche Forschungs- und Versuchsanstalt fuer Luft- und Raumfahrt' in Stuttgart on Nov. 20 and Dec. 1, 1972. 9 papers are printed completely, 4 others in form of a summary. Two of them concern the work function of uncovered surfaces, 2 others show the influence of adsorbed electropositive elements (Cs, Sr) on work function. In 4 papers the coadsorption of electropositive (Cs, Sr, resp. Ba) and electronegative (O {sub 2}) elements and their influence on work function of different surfaces are discussed. Finally a paper is added, describing the development of Sr-Cs-alloys, which are of interest for the generation of the atmosphere of a Sr-Cs-converter by means of one single reservoir. (auth)
Energy Technology Data Exchange (ETDEWEB)
Henne, R [ed.
1973-07-15
This report compiles papers concerning especially recent developments in work function theory and work function measurements, which were given at a round table conference about surface phenomena in thermionic research, arranged by the 'Deutsche Forschungs- und Versuchsanstalt fuer Luft- und Raumfahrt' in Stuttgart on Nov. 20 and Dec. 1, 1972. 9 papers are printed completely, 4 others in form of a summary. Two of them concern the work function of uncovered surfaces, 2 others show the influence of adsorbed electropositive elements (Cs, Sr) on work function. In 4 papers the coadsorption of electropositive (Cs, Sr, resp. Ba) and electronegative (O {sub 2}) elements and their influence on work function of different surfaces are discussed. Finally a paper is added, describing the development of Sr-Cs-alloys, which are of interest for the generation of the atmosphere of a Sr-Cs-converter by means of one single reservoir. (auth)
Rohmann, Gabriele
2013-01-01
Ende der 1980er Jahre entwickelte sich in Deutschland die Jugendkulturarbeit. Seither sind eine Reihe von Angeboten in der außerschulischen Bildung entstanden, die die Interessen junger Menschen in den Mittelpunkt ihrer Arbeit stellen. Das Berliner Archiv der Jugendkulturen verbindet als eine der wenigen Einrichtungen Subjektorientierung, jugendkulturelle Themen und politische Bildung im Kontext der Gewalt- und Rechtsextremismusprävention und von Diskriminierungen. Anhand von Einblicken in di...
Alchemy: The Great Art, exhibition at Kulturforum, Berlin, Germany 06.04.2017 – 23.07.2017
Directory of Open Access Journals (Sweden)
Lisa Gordon
2017-11-01
Full Text Available This temporary exhibition at Kulturforum, part of the Staatliche Museen zu Berlin, presented a selection of around 200 objects from its collection, alongside loans from prominent cultural institutions, including the Getty Research Institute in California with whom they have collaborated. In 2016, the Institute itself ran an exhibition entitled The Art of Alchemy which appears to have laid out the curatorial objectives for this recent show.
Caliskan, Serkan
2018-05-01
Using first principles study, through Density Functional Theory combined with Non Equilibrium Green's Function Formalism, electronic properties of endohedral N@C20 fullerene molecule joining Au electrodes (Au-N@C20) was addressed in the presence of spin property. The electronic transport behavior across the Au-N@C20 molecular junction was investigated by spin resolved transmission, density of states, molecular orbitals, differential conductance and current-voltage (I-V) characteristics. Spin asymmetric variation was clearly observed in the results due to single N atom encapsulated in the C20 fullerene cage, where the N atom played an essential role in the electronic behavior of Au-N@C20. This N@C20 based molecular bridge, exhibiting a spin dependent I-V variation, revealed a metallic behavior within the bias range from -1 V to 1 V. The induced magnetic moment, spin polarization and other relevant quantities associated with the spin resolved transport were elucidated.
Langerbein, Helmut
2009-01-01
This article presents an analysis of the Great Wall of China and the Berlin Wall which reveals that both grew from unique political, historical, geographical, cultural, and economic circumstances. The purpose of this article is to provide new arguments for a debate that all too often has been waged with emotions, polemics, and misinformation. The…
Kröner, Dietmar; Resch, Michael
2016-01-01
This book presents the state-of-the-art in supercomputer simulation. It includes the latest findings from leading researchers using systems from the High Performance Computing Center Stuttgart (HLRS) in 2016. The reports cover all fields of computational science and engineering ranging from CFD to computational physics and from chemistry to computer science with a special emphasis on industrially relevant applications. Presenting findings of one of Europe’s leading systems, this volume covers a wide variety of applications that deliver a high level of sustained performance. The book covers the main methods in high-performance computing. Its outstanding results in achieving the best performance for production codes are of particular interest for both scientists and engineers. The book comes with a wealth of color illustrations and tables of results.
Recent Reanalysis Activities at ECMWF: Results from ERA-20C and Plans for ERA5
Dragani, R.; Hersbach, H.; Poli, P.; Pebeuy, C.; Hirahara, S.; Simmons, A.; Dee, D.
2015-12-01
This presentation will provide an overview of the most recent reanalysis activities performed at the European Centre for Medium-Range Weather Forecasts (ECMWF). A pilot reanalysis of the 20th-century (ERA-20C) has recently been completed. Funded through the European FP7 collaborative project ERA-CLIM, ERA-20C is part of a suite of experiments that also includes a model-only integration (ERA-20CM) and a land-surface reanalysis (ERA-20CL). Its data assimilation system is constrained by only surface observations obtained from ISPD (3.2.6) and ICOADS (2.5.1). Surface boundary conditions are provided by the Hadley Centre (HadISST2.1.0.0) and radiative forcing follows CMIP5 recommended data sets. First-guess uncertainty estimates are based on a 10-member ensemble of Data Assimilations, ERA-20C ensemble, run prior to ERA-20C using ten SST and sea-ice realizations from the Hadley Centre. In November 2014, the European Commission entrusted ECMWF to run on its behalf the Copernicus Climate Change Service (C3S) aiming at producing quality-assured information about the past, current and future states of the climate at both European and global scales. Reanalysis will be one of the main components of the C3S portfolio and the first one to be produced is a global modern era reanalysis (ERA5) covering the period from 1979 onwards. Based on a recent version of the ECMWF data assimilation system, ERA5 will replace the widely used ERA-Interim dataset. This new production will benefit from a much improved model, and better characterized and exploited observations compared to its predecessor. The first part of the presentation will focus on the ERA-20C production, provide an overview of its main characteristics and discuss some of the key results from its assessment. The second part of the talk will give an overview of ERA5, and briefly discuss some of its challenges.
Vogt, Tobias C
2013-01-01
In the two decades since reunification, East Germans have experienced a large increase in life expectancy and a convergence with the West German mortality level. This gain in life expectancy appears even more impressive if we assume a different scenario in which the Berlin Wall did not fall, and the old East Germany still existed. This analysis takes into account that East German mortality would not have remained static without reunification. Thus, it shows how many years of life expectancy were actually added by the fall of the Berlin Wall. The analysis shows the improvements for single age groups by projecting life expectancy based on mortality levels during the 1970s and 1980s using the Lee-Carter method. I use national-level data for both sexes for East Germany before reunification. I find that, without reunification, current life expectancy at birth among East Germans would be 4.0 years lower for females and 5.7 years lower for males. I also show that older East Germans were the main demographic beneficiaries of reunification. Female and male mortality improvements in the age groups above 60 contributed up to 80% to the actual gains in life expectancy. Had the Berlin Wall not fallen, East German mortality would not have remained static but improved at a far slower rate. Thus, this counterfactual approach shows for the first time how many years of life were actually gained by reunification and how much of these gains were attributable to mortality improvements among the elderly. Copyright © 2013 S. Karger AG, Basel.
Hansen, Werner
2016-12-01
The beginnings of modern western medicine reach to about 1800 when under the liberating influence of French Revolution observation of diseases was started to follow more scientifically justified criteria. At that time speculative doctrines prevailed, e. g. those set up natural philosopher Schelling. In this context Internist Friedrich Theodor von Frerichs at Berlin Charité University Hospital gained great merits because of his struggle for a scientifically-based experimental clinical medicine. This is demonstrated nicely in a recently found autograph document. © Georg Thieme Verlag KG Stuttgart · New York.
International Nuclear Information System (INIS)
Tepe, N.; Romero, M.; Bau, M.
2014-01-01
Highlights: • Monitoring study Berlin-2012 confirms tap water contamination with gadolinium. • Contamination confined to western districts of Berlin. • Strong increase of anthropogenic gadolinium from 2009 to 2012. • Anthropogenic gadolinium is tracer for wastewater-derived substances. - Abstract: The distribution of rare earth elements (REE) in tap water sampled in December 2012 in Berlin, Germany, is characterized by anomalously high levels of gadolinium (Gd). While the western districts of the city show strong anthropogenic positive Gd anomalies in REE distribution patterns, the eastern districts are (almost) unaffected. This contamination with anthropogenic Gd results from Gd-based contrast agents used in Magnetic Resonance Imaging, that enter rivers, groundwater and eventually tap water via the clear water effluent from wastewater treatment plants. While the spatial distribution of anthropogenic Gd in 2012 confirms results of an earlier study in 2009 (Kulaksiz and Bau, 2011a), anthropogenic Gd concentrations have increased between 1.5- and 11.5-fold in just three years. This confirms predictions based upon the increase of anthropogenic Gd concentrations in the Havel River over the past two decades and the time it takes the water to migrate from the Havel River to the groundwater production wells. Anomalously high levels of anthropogenic Gd in tap water, which are not confined to Berlin but have also been observed in London, U.K., and in German cities in the Ruhr area and along the Rhine River, reveal that high-technology metals have become emerging contaminants. While non-toxic at the observed concentrations, the anthropogenic Gd is a microcontaminant that may be used as a conservative pseudo-natural tracer for wastewater-derived xenobiotics such as pharmaceuticals, food additives and personal care products. Our results suggest that monitoring the concentrations of such substances in Berlin’s drinking water can be restricted to a few central and
Ab initio I-V characteristics of short C-20 chains
DEFF Research Database (Denmark)
Roland, C.; Larade, B.; Taylor, Jeremy Philip
2002-01-01
We have calculated the I-V characteristics of short chains of C-20 molecular cages between Al and Au leads with an ab initio formalism. The results indicate that a linear chain of such molecules acts primarily as metallic nanowires. The transmission, however, depends sensitively both...
International Nuclear Information System (INIS)
ElBaradei, M.
2000-01-01
In his address at the German Atomic Forum (Berlin, 27 January 2000), the Director General of the IAEA presented a survey of the prospects for nuclear power as seen from the perspective of the IAEA. The speech focussed on the following aspects: nuclear power and world energy requirements, nuclear and radiation safety, competitiveness of nuclear power, and public support
Mothers of the Kiez: Values and cultural change in immigrant communities in Neukölln, Berlin
Toukolehto, Saara
2015-01-01
The thesis takes up the current anthropological topics of policy, values and morality, combining them with more classic theoretical discussions on cultural continuity, change and interaction between cultures. The aim of the research is to conceptualize how values and morality structure the lives of immigrant women living in Neulkölln, Berlin, and their work in a 'Neighborhood mothers' social integration project. The underlying hypothesis takes values and morality to be significant in understa...
Structural and optical properties of the M@C59X cages (X=N, B and ...
Indian Academy of Sciences (India)
energy and the charge is transferred to the carbon cage of M@C60. ... Here, (εn2 −εn1 ) is the transition energy which is obtained with respect to the ..... [22] E Osawa, Perspectives in fullerene nanotechnology (Springer, Berlin, Germany, 2002).
Energy Technology Data Exchange (ETDEWEB)
Heinisch, E.; Kettrup, A.; Bergheim, W.; Wenzel, S.
2002-06-01
Primary data which were obtained on the basis of official surveys by the Senatsverwaltung fuer Stadtentwicklung/Fischereiamt des Landes Berlin for sDDT ({sigma} DDT, DDE, DDD, DDMU), sHCH ({sigma}{alpha}-, {beta}-, {gamma}-, {delta}-, {epsilon}-HCH), sPCB ({sigma} Cong. 28, 52, 101, 138, 153, 180) and HCB in surface water, surface sediment, suspended matter, breams (Abramis brama) and eels (Anguilla anguilla) a cause-oriented monitoring was elaborated concerning the load of waters of Berlin for the period 1983-2000. The structuring of the data consolidated statistically was made according to longitudinal profiles (Teltowkanal from the entrance to the Griebnitzsee, Spree-Oder-System from Seddinsee via Ober-, Stadt- and Unterspree to the mouth into the Havel in Spandau, the Havel from Niederneuendorfer See till Suedliche Unterhavel, the lakes in Grunewald till the city area in Charlottenburg, the lakes in the north of Berlin) as well as time series. The chemical enterprise in Adlershof/Gruenau which produced DDT containing preparations till 1985 and lindane containing preparations till 1989 was identified as the outstanding source of sDDT and sHCH loads. (orig.) [German] Auf der Basis amtlicher Erhebungen durch die Senatsverwaltung fuer Stadtentwicklung/Fischereiamt des Landes Berlin gewonnene Primaerdaten von sDDT ({sigma} DDT, DDE, DDD, DDMU), sHCH ({sigma}{alpha}-, {beta}-, {gamma}-, {delta}-, {epsilon}-HCH), sPCB ({sigma} Kong. 28, 52, 101, 138, 153, 180) und HCB in Oberflaechenwasser, Oberflaechensediment, Schwebstoffen, Brassen/Bleien (Abramis brama) und Aalen (Anguilla anguilla) wurde ein ursachenorientiertes Monitoring ueber die Belastung Berliner Gewaesser erarbeitet, das den Zeitraum von 1983-2000 umfasst. Die Strukturierung der statistisch aufgearbeiteten Werte erfolgte einmal nach Laengsprofilen (Teltowkanal von der Einfahrt bis zum Griebnitzsee, Spree-Oder-System vom Seddinsee ueber die Ober-, Stadt- und Unterspree bis zur Muendung in die Havel in
Development of Cr3C2-25(Ni20Cr) nanostructured coatings
International Nuclear Information System (INIS)
Cunha, Cecilio Alvares da
2012-01-01
This study is divided in two parts. The first part is about the preparation of nanostructured Cr 3 C 2 -25(Ni20Cr) powders by high energy milling followed by characterization of the milled and the as received powder. Analyses of some of the data obtained were done using a theoretical approach. The second part of this study is about the preparation and characterization of coatings prepared with the nanostructured as well as the as received Cr 3 C 2 -25(Ni20Cr) powders. The high temperature erosion-oxidation (E-O) behavior of the coatings prepared with the two types of powders has been compared based on a technological approach. The average crystallite size of the Cr 3 C 2 -25(Ni20Cr) powder decreased rapidly from 145 nm to 50 nm in the initial stages of milling and thereafter decreased slowly to a steady state value of around 10 nm with further increase in milling time. This steady state corresponds to the beginning of a dynamic recovery process. The maximum lattice strain (ε = 1,17%) was observed in powders milled for 16 hours, and this powders critical crystallite size was 28 nm. In contrast, the lattice parameter attained a minimum for powders milled for 16 hours. Upon reaching the critical crystallite size, the dislocation density attained a steady state regime and all plastic deformation introduced in the material there after was in the form of events occurring at the grain boundaries, due mainly to grain boundary sliding. The deformation energy stored in the crystal lattice of the Cr 3 C 2 -25(Ni20Cr) powders milled for different times was determined from enthalpy variation measurements. These results indicated that the maximum enthalpy variation (δH = 722 mcal) also occurred for powders milled for 16 hours. In a similar manner, the maximum specific heat variation (δC p = 0,278 cal/gK) occurred for powders milled for 16 hours. The following mechanical properties of Cr 3 C 2 -25(Ni20Cr) coatings prepared using the HVOF thermal spray process were determined
Lehmann, A; Scheffler, Ch; Hermanussen, M
2010-02-01
Recent progress in modelling individual growth has been achieved by combining the principal component analysis and the maximum likelihood principle. This combination models growth even in incomplete sets of data and in data obtained at irregular intervals. We re-analysed late 18th century longitudinal growth of German boys from the boarding school Carlsschule in Stuttgart. The boys, aged 6-23 years, were measured at irregular 3-12 monthly intervals during the period 1771-1793. At the age of 18 years, mean height was 1652 mm, but height variation was large. The shortest boy reached 1474 mm, the tallest 1826 mm. Measured height closely paralleled modelled height, with mean difference of 4 mm, SD 7 mm. Seasonal height variation was found. Low growth rates occurred in spring and high growth rates in summer and autumn. The present study demonstrates that combining the principal component analysis and the maximum likelihood principle enables growth modelling in historic height data also. Copyright (c) 2009 Elsevier GmbH. All rights reserved.
Heinonen, Martti; Zvizdic, Davor; Sestan, Danijel
2012-09-01
The first European humidity key comparison EURAMET-T.K6 was completed in 2008, and it covered the dew-point temperature range from -50 °C to + 20 °C. Both LPM and MIKES participated in the comparison, but a new low dew-point generator was introduced at LPM as a result of progress in the EUROMET P912 project. To extend the range of available comparison evidence down to -70 °C and to study the validity of improved uncertainties of LPM, a bilateral comparison was carried out between LPM and MIKES in 2009-2010. The applied comparison procedure was similar to that applied in EURAMET-T.K6. However, only one transfer standard was used instead of two units and the measurement point -70 °C was added in the measurement scheme. The results show that the bilateral equivalence between LPM and MIKES is between (0.00 ± 0.06) °C and (0.02 ± 0.08) °C in the range from -50 °C to + 20 °C and (0.01 ± 0.10) °C at -70 °C. Using MIKES results as the link to the EURAMET.T-K6, it is shown that the difference between the results obtained with the new LPM dew-point temperature standard and the EURAMET Comparison Reference Values is between (-0.02 ± 0.08) °C at 20 °C and (+ 0.02 ± 0.07) ° C at -50 °C.
De Luca, Daniele; Piastra, Marco; Chidini, Giovanna; Tissieres, Pierre; Calderini, Edoardo; Essouri, Sandrine; Medina Villanueva, Alberto; Vivanco Allende, Ana; Pons-Odena, Marti; Perez-Baena, Luis; Hermon, Michael; Tridente, Ascanio; Conti, Giorgio; Antonelli, Massimo; Kneyber, Martin
2013-01-01
A new acute respiratory distress syndrome (ARDS) definition has been recently issued: the so-called Berlin definition (BD) has some characteristics that could make it suitable for pediatrics. The European Society for Pediatric Neonatal Intensive Care (ESPNIC) Respiratory Section started a project to
Dijkstra, H.H.; Köhler, F.
2008-01-01
This paper lists 22 pectinoid types (21 primary and one secondary) and three potential syntypes in the Museum of Natural History (ZMB) in Berlin. Eight lectotypes are designated herein for the stabilization of taxonomic names: Pecten aequatorialis, Pecten australis, Pecten clathratus, Camptonectes
Ristau, Jörn-Arne
2013-01-01
The present paper shows in three chapters the creation of the sport and the development of the sports medicine in Germany of the years from 1933 to 1945, lights up their value and meaning under the influence of the national-socialist dictatorship. To indicate the relation of medicine and sport in that period, the Summer Olympics of 1936 in Berlin are especially considered .
The PP2AB56 phosphatase promotes the association of Cdc20 with APC/C in mitosis.
Lee, Sun Joo; Rodriguez-Bravo, Veronica; Kim, Hyunjung; Datta, Sutirtha; Foley, Emily A
2017-05-15
PP2A comprising B56 regulatory subunit isoforms (PP2A B56 ) is a serine/threonine phosphatase essential for mitosis. At the kinetochore, PP2A B56 both stabilizes microtubule binding and promotes silencing of the spindle assembly checkpoint (SAC) through its association with the SAC protein BubR1. Cells depleted of the B56 regulatory subunits of PP2A are delayed in activation of Cdc20-containing APC/C (APC/C Cdc20 ), which is an essential step for mitotic exit. It has been hypothesized that this delay arises from increased production of the mitotic checkpoint complex (MCC), an APC/C Cdc20 inhibitor formed at unattached kinetochores through SAC signaling. In contrast to this prediction, we show that depletion of B56 subunits does not increase the amount or stability of the MCC. Rather, delays in APC/C Cdc20 activation in B56-depleted cells correlate with impaired Cdc20 binding to APC/C. Stimulation of APC/C Cdc20 assembly does not require binding between PP2A B56 and BubR1, and thus this contribution of PP2A B56 towards mitotic exit is distinct from its functions at kinetochores. PP2A B56 associates with APC/C constitutively in a BubR1-independent manner. A mitotic phosphorylation site on Cdc20, known to be a substrate of PP2A B56 , modulates APC/C Cdc20 assembly. These results elucidate the contributions of PP2A B56 towards completion of mitosis. © 2017. Published by The Company of Biologists Ltd.
Czech Academy of Sciences Publication Activity Database
Wang, Weizhou; Hobza, Pavel
2008-01-01
Roč. 73, 6/7 (2008), s. 862-872 ISSN 0010-0765 R&D Projects: GA MŠk LC512; GA AV ČR IAA400550510 Institutional research plan: CEZ:AV0Z40550506 Keywords : Berlin's theorem * H-bonding * Blue -shifting H-bonding Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 0.784, year: 2008
Siadati, Seyyed Amir; Nami, Navabeh
2016-10-01
C20 fullerene, this novel species with all its pentagonal faces has displayed some unique operations in making fast pericyclic reactions. As an example, the high dienophile character of the C20 fullerene and the ability of this species in making an ultra-fast Diels-Alder reaction with 1,3-butadiene, has been recently reported. Moreover, new experimental reports claim that the C60 fullerene, one of the fullerene family, could make a Diels-Alder reaction with the central ring of anthracene and make the ring non-aromatic. These reports may encourage researchers to do more studies on the properties of this small carbon cage. To address this question, the present research has discussed all the reaction channels of the Diels-Alder cycloaddition of benzene molecule as a 1,3-diene with the C20 fullerene in order to answer this question: ;Is C20fullerene able to make a Diels-Alder reaction with this molecule?;.
Institute of Scientific and Technical Information of China (English)
Luo Zhuming; Lu Rong
2000-01-01
Background: Cognitive Abilities Screening Instrument C-2.0 (CASI C-2.0) is founded on Chinese culture apply to person with little or no formal education.Objective: In order to assess the reliability and validity of Cognitive Abilities Screening Instrument C-2.0 (CASI C-2.0), we surveyed 807 persons aged from 55 to 100 years and with little or no formal education in the town and country of Chengdu city. Methods: Phase I: 807 persona were assessed by different doctors with CASI C-2.0 and Mini mental State Examination (MMSE). Phase Ⅱ: The positive persons of phase I were assessed by trained field physicians who did not know the CASI C-2.0 and MMSE scores. The physicians assessment included a detail history, a systematic physical examination and a selected group of psychometric tests to ascertain the clinical diagnoses of dementia、 Alzheimer′s disease and vascular dementia utilizing the ICD-10 and NINCDS-ADRAD、 DSM-Ⅳ criteria respectively. Phase Ⅲ: 30 persons were retest with CASI C-2.0 randomly after 3--4 weeks. Results: Among the 807 persons, 55 cases of dementia were identified, including 50 cases of probable Alzheimer′s disease and 5 cases of vascular dementia. Discussion: On reliability, the test-retest reliability coefficient of CASI C-2.0 is 0.97,p<0.001, the person′s correlation coefficient between nine items scores and total scores are all above 0.66, the Cronback a is 0.9056, the split-half reliability coefficient is 0.8355. On validity, using ICD-10 criteria as ”Gold Criteria" and 50 as a cut-offscore, the sensitivity、 specificity、 accuracy of CASI C-2.0 are 94.5%、 89.5%、 89.8% respectively, kappa is 0.5123. Comparing with MMSE, CAS1 C-2.0 has a better specificity, x2 test, p<0.01; a same sensitivity; and a lower refusal answer ratio, x2 test, p<0.005. Conclusion: We consider that CASI C-2.0 has excellent reliability and validity. It is worthy of disseminating and applying for both clinical and epidemiological surveys.
Mackling, Tracey; Shah, Tejas; Dimas, Vivian; Guleserian, Kristine; Sharma, Mahesh; Forbess, Joseph; Ardura, Monica; Gross-Toalson, Jami; Lee, Ying; Journeycake, Janna; Barnes, Aliessa
2012-06-01
There are minimal data regarding chronic management of single-ventricle ventricular assist device (VAD) patients. This study aims to describe our center's multidisciplinary team management of single-ventricle patients supported long term with the Berlin Heart EXCOR Pediatric VAD. Patient #1 was a 4-year-old with double-outlet right ventricle with aortic atresia, L-looped ventricles, and heart block who developed heart failure 1 year after Fontan. She initially required extracorporeal membrane oxygenation support and was transitioned to Berlin Heart systemic VAD. She was supported for 363 days (cardiac intensive care unit [CICU] 335 days, floor 28 days). The postoperative course was complicated by intermittent infection including methicillin-resistant Staphylococcus aureus, intermittent hepatic and renal insufficiencies, and transient antithrombin, protein C, and protein S deficiencies resulting in multiple thrombi. She had a total of five pump changes over 10 months. Long-term medical management included anticoagulation with enoxaparin, platelet inhibition with aspirin and dipyridamole, and antibiotic prophylaxis using trimethoprim/sulfamethoxazole. She developed sepsis of unknown etiology and subsequently died from multiorgan failure. Patient #2 was a 4-year-old with hypoplastic left heart syndrome who developed heart failure 2 years after bidirectional Glenn shunt. At systemic VAD implantation, he was intubated with renal insufficiency. Post-VAD implantation, his renal insufficiency resolved, and he was successfully extubated to daytime nasal cannula and biphasic positive airway pressure at night. He was supported for 270 days (CICU 143 days, floor 127 days). The pump was upsized to a 50-mL pump in May 2011 for increased central venous pressures (29 mm Hg). Long-term medical management included anticoagulation with warfarin and single-agent platelet inhibition using dipyridamole due to aspirin resistance. He developed increased work of breathing requiring
Energy Technology Data Exchange (ETDEWEB)
Cunha, Cecilio Alvares da
2012-07-01
This study is divided in two parts. The first part is about the preparation of nanostructured Cr{sub 3}C{sub 2}-25(Ni20Cr) powders by high energy milling followed by characterization of the milled and the as received powder. Analyses of some of the data obtained were done using a theoretical approach. The second part of this study is about the preparation and characterization of coatings prepared with the nanostructured as well as the as received Cr{sub 3}C{sub 2}-25(Ni20Cr) powders. The high temperature erosion-oxidation (E-O) behavior of the coatings prepared with the two types of powders has been compared based on a technological approach. The average crystallite size of the Cr{sub 3}C{sub 2}-25(Ni20Cr) powder decreased rapidly from 145 nm to 50 nm in the initial stages of milling and thereafter decreased slowly to a steady state value of around 10 nm with further increase in milling time. This steady state corresponds to the beginning of a dynamic recovery process. The maximum lattice strain ({epsilon} = 1,17%) was observed in powders milled for 16 hours, and this powders critical crystallite size was 28 nm. In contrast, the lattice parameter attained a minimum for powders milled for 16 hours. Upon reaching the critical crystallite size, the dislocation density attained a steady state regime and all plastic deformation introduced in the material there after was in the form of events occurring at the grain boundaries, due mainly to grain boundary sliding. The deformation energy stored in the crystal lattice of the Cr{sub 3}C{sub 2}-25(Ni20Cr) powders milled for different times was determined from enthalpy variation measurements. These results indicated that the maximum enthalpy variation ({delta}H = 722 mcal) also occurred for powders milled for 16 hours. In a similar manner, the maximum specific heat variation ({delta}C{sub p} = 0,278 cal/gK) occurred for powders milled for 16 hours. The following mechanical properties of Cr{sub 3}C{sub 2}-25(Ni20Cr) coatings
Skuffende redegørelse fra C20-selskaberne om bestyrelsesmedlemmers uafhængighed
DEFF Research Database (Denmark)
Madsen, Marina Bitsch
2011-01-01
Sammensætningen af selskabers bestyrelse fylder meget i corporate governance-debatten i Danmark og er samtidig tillagt et helt afsnit i de gældende corporate governance-anbefalinger fra Komitéen for god Selskabsledelse. C20-selskaberne er de aktieselskaber i Danmark, der nyder størst...... mediebevågenhed. Det er derfor skuffende at måtte konstatere, at denne artikels undersøgelse af C20-selskabernes redegørelser om deres bestyrelsesmedlemmernes uafhængighed viser, at kvaliteten af de offentliggjorte oplysninger er så utilstrækkelige, at de ikke fortjener betegnelsen best practice....
Clean air litigation; Klagen fuer Saubere Luft
Energy Technology Data Exchange (ETDEWEB)
NONE
2016-11-11
The pollution of air by nitrogen dioxide (NO{sub 2}) in cities is one of the central challenges of air pollution in Germany, in addition to the pollution of particulate matter (PM10). In cooperation with the British non-governmental organization ClientEarth, the German Environmental Aid (DUH) filed a lawsuit in November 2015 for exceeding air quality limits for NO{sub 2}. The cities of Stuttgart, Frankfurt, Duesseldorf, Essen, Gelsenkirchen, Aachen, Cologne and Bonn are affected. Here, citizens are constantly exposed to high air pollution. Because of the excess of the NO{sub 2} limits at all traffic-related measuring stations in Berlin, the DUH initiated legal steps and filed a lawsuit too in June 2016. With the lawsuits, DUH wants to promote the implementation of measures to reduce NO{sub 2} in Germany. [German] Die Belastung der Luft durch Stickstoffdioxid (NO{sub 2}) in Staedten ist neben der Belastung durch Feinstaub (PM10) eine der zentralen Herausforderungen der Luftreinhaltung in Deutschland. In Zusammenarbeit mit der britischen Nichtregierungsorganisation ClientEarth legte die Deutsche Umwelthilfe (DUH) im November 2015 Klage wegen Ueberschreitung der Luftqualitaetsgrenzwerte fuer NO{sub 2}ein. Betroffen sind die Staedte Stuttgart, Frankfurt, Duesseldorf, Essen, Gelsenkirchen, Aachen, Koeln und Bonn. Hier sind Buergerinnen und Buerger anhaltend zu hoher Luftverschmutzung ausgesetzt. Wegen Ueberschreitung der NO{sub 2}-Grenzwerte an allen verkehrsnahen Messstationen in Berlin hat die DUH im Juni 2016 auch hier rechtliche Schritte eingeleitet und Klage eingereicht. Mit den Klagen will die DUH die Umsetzung von Massnahmen zur NO{sub 2}-Reduktion in Deutschland voranbringen.
Specialist nectar-yeasts decline with urbanization in Berlin
Wehner, Jeannine; Mittelbach, Moritz; Rillig, Matthias C.; Verbruggen, Erik
2017-03-01
Nectar yeasts are common inhabitants of insect-pollinated flowers but factors determining their distribution are not well understood. We studied the influence of host identity, environmental factors related to pollution/urbanization, and the distance to a target beehive on local distribution of nectar yeasts within Robinia pseudoacacia L. and Tilia tomentosa Moench in Berlin, Germany. Nectar samples of six individuals per species were collected at seven sites in a 2 km radius from each target beehive and plated on YM-Agar to visualise the different morphotypes, which were then identified by sequencing a section of the 26S rDNA gene. Multivariate linear models were used to analyze the effects of all investigated factors on yeast occurrence per tree. Yeast distribution was mainly driven by host identity. The influence of the environmental factors (NO2, height of construction, soil sealing) strongly depended on the radius around the tree, similar to the distance of the sampled beehive. Incidence of specialist nectar-borne yeast species decreased with increasing pollution/urbanization index. Given that specialist yeast species gave way to generalist yeasts that have a reduced dependency on pollinators for between-flower dispersal, our results indicate that increased urbanization may restrict the movement of nectar-specialized yeasts, via limitations of pollinator foraging behavior.
Gokay, Pervin; Tastan, Sevinc; Orhan, Mehmet Emin
2016-05-01
This study aimed to compare the efficiency of the STOP-BANG and Berlin Obstructive Sleep Apnoea Syndrome questionnaires for evaluating potential respiratory complications during the perioperative period. Questionnaires that are used to determine obstructive sleep apnoea risk are not widely used for surgical patients. Among the questionnaires that are commonly used for obstructive sleep apnoea screening, it remains unclear whether the STOP-BANG or Berlin Obstructive Sleep Apnoea Syndrome questionnaire is more effective in terms of ease of use, usage period and diagnosis of surgical patients with obstructive sleep apnoea risk. This study was designed as a descriptive and prospective study. The study included 126 patients over 18 years of age who were American Society of Anesthesiologists classification class I-II and underwent laparoscopic cholecystectomy. To determine the potential obstructive sleep apnoea syndrome risk, the STOP-BANG and Berlin questionnaires were administered. Respiratory complications were then observed during the perioperative period. During intubation and extubation, we observed statistically significant differences in difficult intubation, difficult facemask ventilation and desaturation frequency between the high- and low-risk groups for obstructive sleep apnoea syndrome, as determined by the STOP-BANG questionnaire. During extubation, statistically significant differences in coughing, breath-holding and desaturation frequency were observed between the high-risk and low-risk groups, according to the Berlin questionnaire. In the post-anaesthesia care unit, both questionnaires found statistically significant differences between the low- and high-risk groups. Obstructive sleep apnoea syndrome screening questionnaires administered during the preoperative period are useful for predicting perioperative respiratory complications. It may be most useful to administer the STOP-BANG questionnaire as the initial evaluation. Questionnaires may be used to
Thermography colloquium 2007; Thermografie-Kolloquium 2007
Energy Technology Data Exchange (ETDEWEB)
NONE
2007-07-01
The CD contains 16 contributions, mostly in the form of manuscripts or summaries, and two posters on the following subjects: 1. Environmental influences affecting the accuracy of building thermography (G. Dittie, Dittie Thermografie, Koenigswinter). 2. Energetic modernisation of older buildings: BlowerDoor inspection and IR thermography as decision aids for modernisation measures (K. Schwarz, Beratender Ingenieur, Ingenieurbuero Schwarz, Owingen / Baden). 3. Gas leak detection in the oil and gas industry using infrared optical imaging (J. Tegstam, FLIR Systems AB, Danderyd, Sweden; et al.). 4. The Medical Use of Infrared-Thermography; History and Recent Applications (R. Berz, Deutsche Gesellschaft fuer Thermographie und Regulationsmedizin, Hilders / Rhoen; et al.). 5. Dual-Band-QWIP IR Camera ''Geminis 110k ML'' Technology and applications (O. Schreer, IRCAM, Erlangen; et al.). 6. Quantitative Phase and Amplitude Evaluation in the Active Thermography Frequency Range using Rectangular Pulse Heating (R. Arndt, BAM Berlin; et al.). 8. Spatially resolved detection of fatigue processes in metals using IR thermography (J. Medgenberg, TU Braunschweig, Institut fuer Bauwerkserhaltung und Tragwerk, Braunschweig, et al.). 9. Active thermography for analysis of transport processes (C.S. Garbe, IWR und IUR, Universitaet Heidelberg et al.). 10. Frequency optimisation of ultrasonic thermography methods (C. Spiessberger, Institut fuer Kunststofftechnik (IKT), Universitaet Stuttgart et al.). 11. Detection of cracks near the tooths of toothed gears using thermography and eddy current testing (W. Reimche, Leibniz Universitaet Hannover, Garbsen et al.). 12. Spatially resolved solar cell characterisation using Lock-in thermography (K. Ramspeck, Institut fuer Solarenergieforschung, Hameln / Emmerthal et al.). 14. Puls-Phase Thermography of CFRPL components with defined damage and repair (T. Krell, WIWEB, Erding et al.). 15. Depth-resolved defect detection using
Directory of Open Access Journals (Sweden)
Paul Gundani
2018-04-01
Full Text Available The fall of the Berlin Wall in October 1989 bears a striking resonance with the biblical fracturing of the curtain in the Jerusalem temple. It presaged the death of the post-war dispensation of Church-state relations characterised by a Church that was, in the main, subservient, acquiescent and complicit to the apartheid regime in South Africa, as well as the oppressive one-party state regimes north of the Limpopo. As the Berlin Wall collapsed, the dispensation characterised by either neutrality or docility and co-option of the Church to the Apartheid and Independent states gave way to the birth of a ‘prophetic’ Church, which would not only gain a new lease on life, but would become a robust interlocutor of the post-Cold War state. The latter is exemplified by historical signposts such as the Rustenburg Declaration (1990, the Pastoral letter of the Zambia Catholic Bishops Conference (1990 and the Pastoral letter by the Catholic Bishops of Malawi (1992, among others. This paper is an analytical desktop study, which will be based on the published literature.
Berlin: Emergency shelters and contemporary border struggles
Directory of Open Access Journals (Sweden)
Žiga Podgornik-Jakil
2016-06-01
Full Text Available Researching the developments of present political economy must necessarily include investigating the tools of contemporary border regime. These are used for surveillance and control of populations in order to create new divisions of labour and enable extraction of rent by using peoples’ bodies. The article focuses on emergency shelters in Berlin, that is, on their function and ways in which the asylum seekers accommodated there spontaneously struggle against them. The research was done as a militant and cooperative work of the network Lager Mobilisation Network in Berlin’s district Wedding, which builds connections with people housed in the sports halls in the mentioned district. The author underlines that exhausting the aslyum seekers psychically is one of the strategies for filtering the ‘unwanted’ from the ‘wanted’, that is the ones that are interesting for the labour market. At the same time, the restriction of movement and limited access to civil rights confine asylum seekers in emergency shelters run by private companies, which seek profits on their account. Far from claiming that non-profit companies have a ‘better’ shelter administration, since the boundaries between them and profit-oriented companies are often blurred, the author rather speaks of new forms of anticolonial struggles by the people living inside. He understands these struggles as the struggles against the contemporary border regime in Germany and the EU and as a potential for building an inclusive society.
Walkability is Only Part of the Story: Walking for Transportation in Stuttgart, Germany
Directory of Open Access Journals (Sweden)
Maren Reyer
2014-05-01
Full Text Available In modern Western societies people often lead inactive and sedentary lifestyles, even though there is no doubt that physical activity and health are related. From an urban planning point of view it would be highly desirable to develop built environments in a way that supports people in leading more active and healthy lifestyles. Within this context there are several methods, predominantly used in the US, to measure the suitability of built environments for walking and cycling. Empirical studies show that people living in highly walkable areas are more physically active (for example, walk more or cycle more. The question is, however, whether these results are also valid for European cities given their different urban planning characteristics and infrastructure standards. To answer this question we used the Walkability-Index and the Walk Score to empirically investigate the associations between walkability and active transportation in the city of Stuttgart, Germany. In a sample of household survey data (n = 1.871 we found a noticeable relationship between walkability and active transportation—the more walkable an area was, the more active residents were. Although the statistical effect is small, the health impact might be of relevance. Being physically active is multi-determined and not only affected by the walkability of an area. We highlight these points with an excursion into research that the health and exercise sciences contribute to the topic. We propose to strengthen interdisciplinary research between the disciplines and to specifically collect data that captures the influence of the environment on physical activity in the future.
Walkability is only part of the story: walking for transportation in Stuttgart, Germany.
Reyer, Maren; Fina, Stefan; Siedentop, Stefan; Schlicht, Wolfgang
2014-05-30
In modern Western societies people often lead inactive and sedentary lifestyles, even though there is no doubt that physical activity and health are related. From an urban planning point of view it would be highly desirable to develop built environments in a way that supports people in leading more active and healthy lifestyles. Within this context there are several methods, predominantly used in the US, to measure the suitability of built environments for walking and cycling. Empirical studies show that people living in highly walkable areas are more physically active (for example, walk more or cycle more). The question is, however, whether these results are also valid for European cities given their different urban planning characteristics and infrastructure standards. To answer this question we used the Walkability-Index and the Walk Score to empirically investigate the associations between walkability and active transportation in the city of Stuttgart, Germany. In a sample of household survey data (n = 1.871) we found a noticeable relationship between walkability and active transportation-the more walkable an area was, the more active residents were. Although the statistical effect is small, the health impact might be of relevance. Being physically active is multi-determined and not only affected by the walkability of an area. We highlight these points with an excursion into research that the health and exercise sciences contribute to the topic. We propose to strengthen interdisciplinary research between the disciplines and to specifically collect data that captures the influence of the environment on physical activity in the future.
Stability and reliability of glycated haemoglobin measurements in blood samples stored at -20°C.
Venkataraman, Vijayachandrika; Anjana, Ranjit Mohan; Pradeepa, Rajendra; Deepa, Mohan; Jayashri, Ramamoorthy; Anbalagan, Viknesh Prabu; Akila, Bridgitte; Madhu, Sri Venkata; Lakshmy, Ramakrishnan; Mohan, Viswanathan
2016-01-01
To validate the stability of glycated haemoglobin (HbA1c) measurements in blood samples stored at -20°C for up to one month. The study group comprised 142 type 2 diabetic subjects visiting a tertiary centre for diabetes at Chennai city in south India. The HbA1c assay was done on a fasting blood sample using the Bio-Rad Variant machine on Day 0 (day of blood sample collection). Several aliquots were stored at -20°C and the assay was repeated on the 3rd, 7th, 15th, and 30th day after the sample collection. Bland-Altman plots were constructed and variation in the HbA1c levels on the different days was compared with the day 0 level. The median differences between HbA1c levels measured on Day 0 and the 3rd, 7th, 15th, and 30th day after blood collection were 0.0%, 0.2%, 0.3% and 0.5% respectively. Bland-Altman plot analysis showed that the differences between the day '0' and the different time points tend to get larger with time, but these were not clinically significant. HbA1c levels are relatively stable up to 2weeks, if blood samples are stored at -20°C. Copyright © 2016 Elsevier Inc. All rights reserved.
The origins of the Olympic Village: Los Angeles 1932 and Berlin 1936.
Directory of Open Access Journals (Sweden)
Massimo Bortolotti
2009-06-01
Full Text Available Regarding the transformations produced by the housing projects for the Olympic Games, the construction and following reuse of the Olympic Villages is an interesting studying matter. During the hundred-year-old history of the modern Olympics the realization of the Olympic Village, which finds reference in the de Coubertin’s writings, and the town planning transformations, to this correlated, have revealed in different ways. The essay mainly concerns the origins of the Olympic Village and the first settlements which characterized the Games in the thirties: Los Angeles 1932 and Berlin 1936. In these two cities, even though with different motivations, politico-economical stimulus and different images, the prototypes of the modern Olympic sport facilities, which find in the village an in the stadium the symbol of the event, were born.
Wirth, Ingo; Strauch, Hansjürg
2007-01-01
The second part of the study on homicides in East Berlin from 1980 to 1989 describes the solving of crimes, the usual features of offenders and the legal assessment according to East German law. Of the 139 homicides 126 crimes (= 90.6%) could be solved. Most of the offenders had a low social background and often belonged to the victim's circle of friends or family. Situational homicides and elimination crimes were the most common crimes. In the legal assessment sentences for murder were predominant.
Den 11. olympiade - Berlin 1936. De danske avisers syn på sport og politik i 1930erne
Jensen, Rasmus Camillo
2016-01-01
This masters-thesis will examine how the six big Danish newspapers Arbejderbladet, Berlingske Tidende, Fyns Tidende, Jyllands-Posten, Politiken and Social-Demokraten wrote about the 1936 Olympics. The 1936 Olympics was held in Berlin, Germany, in a time where the Nazis, with Adolf Hitler as its leader, had the power. The purpose of this masters-thesis is to examine whether the six chosen newspapers referred to Nazis legislation in their coverage of the Olympics, because this legislation had i...
Fuel from biologic wase materials; Kraftstoff aus biologischen Reststoffen
Energy Technology Data Exchange (ETDEWEB)
Braesel, Martina
2013-06-01
In Germany, annually about 770,000 tons of biological waste reach rubbish bins or composting plants. In order to recondition this biological waste, the Federal Ministry of Education and Research (Berlin, Federal Republic of Germany) has launched a research project with a funding of 4.3 million Euro limited to a period of time of five years. In cooperation with the Fraunhofer Institute for Interfacial Engineering and Biotechnology (Stuttgart, Federal Republic of Germany) easily fermentable, wet biomass with a low content of lignocellulosic material has to be completely transformed to biogas with maximum energy. Only some of the ash remains.
Energy Technology Data Exchange (ETDEWEB)
Huber, Klaus; Bollin, Elmar; Scheck, Eva [Hochschule Offenburg (HSO) (Germany); Wiemken, Edo; Wewior, Jakub [Fraunhofer-Institut fuer Solare Energiesysteme (ISE), Freiburg im Breisgau (Germany); Eicker, Ursula; Pietruschka, Dirk; Dalibard, Antoine [Hochschule fuer Technik (HFT), Stuttgart (Germany); Meissner, Rolf; Kettner, Christiane [Paradigma Deutschland GmbH, Karlsbad (Germany)
2010-07-01
Since July 2006 and in cooperation with the Fraunhofer Institute for Solar Energy (Freiburg) and the Stuttgart University of Applied Sciences, the University Offenburg accompanies the solar supported air conditioning of Festo AG and Co. KG in Esslingen (Federal Republic of Germany). The plant was promoted by the Federal Ministry of the Environment (Berlin, Federal Republic of Germany) in the context of the research project 'Solarthermie2000plus'. The already existing adsorption refrigerant plant which so far was operated with compressor warmth and gas-fuelled boilers, was supplemented by a solar plant as a third heat supplier.
20th and 21st Joint Workshop on Sustained Simulation Performance
Bez, Wolfgang; Focht, Erich; Kobayashi, Hiroaki; Qi, Jiaxing; Roller, Sabine
2015-01-01
The book presents the state of the art in high-performance computing and simulation on modern supercomputer architectures. It covers trends in hardware and software development in general, and the future of high-performance systems and heterogeneous architectures specifically. The application contributions cover computational fluid dynamics, material science, medical applications and climate research. Innovative fields like coupled multi-physics or multi-scale simulations are also discussed. All papers were chosen from presentations given at the 20th Workshop on Sustained Simulation Performance in December 2014 at the HLRS, University of Stuttgart, Germany, and the subsequent Workshop on Sustained Simulation Performance at Tohoku University in February 2015. .
Directory of Open Access Journals (Sweden)
Lilla Tőke
2016-01-01
Full Text Available Hock, Beáta. 2013. Gendered Artistic Positions and Social Voices - Politics, Cinema and the Visual Arts in State-Socialist and Post-Socialist Hungary. Stuttgart: Franz Steiner Verlag. 284 pp. illus. Reviewed by Lilla Tőke, Assistant Professor, City University of New York, LaGuardia Community College
Cabello C, Felipe
2013-04-01
Georg Friedrich Nicolai (1874-1964) was a German physician and physiologist whose pacifism during the First World War led him in 1914 to cosign with W. J. Foerster, A. Einstein and O. Bueck a "Manifesto to the Europeans" against the entry of Germany into the war and the invasion of Belgium. As a result of this appeal and his strong pacifism, Nicolai lost his positions as cardiologist to the German royal family, professor at the University of Berlin and chief of laboratory at the Charite hospital also in Berlin, and was sent as a garrison physician in Graundenz, in today's Poland. There he began to write his book, The Biology of War. It managed to avoid censorship and was published in Leipzig in 1916. He was court-martialed in Danzig in 1916 but escaped to Denmark. Nicolai was reinstated to his faculty positions by the Weimar Republic after the war but was subsequently forced to emigrate from Germany to South America by the pressure of right wing student groups who accused him of being a deserter and a traitor. From 1922 to 1932 Nicolai lived in Argentina, and from 1932 until his death in 1964, in Chile. In this later country Nicolai was professor in the University of Chile and interacted with members of the Chilean intelligentsia, including the poets Vicente Huidobro, Gonzalo Rojas and Pablo Neruda. Through his friendship with Chilean psychiatrist Agustin Tellez, Nicolai influenced the development of phenomenological psychiatric school in Chile. The Chilean novelist Fernando Alegria compared him favorably with Robert J. Oppenheimer and Linus Pauling.
Directory of Open Access Journals (Sweden)
Bitzer J
2015-05-01
Full Text Available Johannes Bitzer,1 Maria Jesusa Banal-Silao,2 Hans-Joachim Ahrendt,3 Jaime Restrepo,4 Marion Hardtke,5 Ulrike Wissinger-Graefenhahn,6 Dietmar Trummer7 1Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland; 2University of the Philippines College of Medicine, Manila, Philippines; 3Praxis für Frauenheilkunde, Klinische Forschung und Weiterbildung (Clinical Research and Further Education, Magdeburg, Germany; 4Centro de Investigación Clínica, Clinica Medellin Poblado, Medellin, Colombia; 5Global Clinical Development Operations, Bayer Pharma AG, Berlin, Germany; 6Global Medical Affairs Women’s Healthcare, Bayer Pharma AG, Berlin, Germany; 7Clinical Statistics Europe, Bayer Pharma AG, Berlin, Germany Objective: To assess whether the combined oral contraceptive (COC ethinylestradiol (EE 20 µg/drospirenone 3 mg taken in a 24/4-day regimen (ie, 4-day hormone-free interval is more effective than an EE 20 µg/desogestrel (DSG 150 µg COC taken in a 21/7-day regimen (ie, 7-day hormone-free interval in reducing hormone withdrawal-associated symptoms (HWAS.Methods: This double-blind, randomized study (NLM identifier: NCT01076582 was conducted at 34 centers in 12 countries. Otherwise healthy women who experienced ≥2 HWAS of headache, pelvic pain, and/or bloating when using their current COCs in a 21/7-day regimen were recruited. Subjects rated the severity of their HWAS daily on a seven-point Likert scale during a baseline cycle and during four 28-day cycles with EE/drospirenone 24/4 (n=290 or EE/DSG 21/7 (n=304. The primary variable was the mean change from baseline to cycle 4 in the composite HWAS score (sum of scores for all three symptoms during cycle days 22–28.Results: In the EE/drospirenone 24/4 group, the mean (standard deviation composite HWAS score during cycle days 22–28 was reduced from 42.2 (24.8 at baseline to 12.8 (13.4 at cycle 4 (change from baseline: -30.3 [22.9]. In the EE/DSG 21/7 group, the
Dredge, Dianne; Gyimóthy, Szilvia; Birkbak, Andreas; Jensen, Torben Elgaard; Madsen, Anders Koed
2016-01-01
This paper has been commissioned by the European Commission’s DG GROWTH to examine the impact of regulatory approaches targeting collaborative economy in the tourism accommodation sector in the cities of Barcelona, Berlin, Amsterdam and Paris. In relation to tourism, the growth of the collaborative economy peer-to-peer accommodation sector has significant impacts for traditional tourism industry structures and relationships. The growth of the collaborative economy peer-to-peer accommodation m...
Music Export from Helsinki to Berlin and vice versa. Case study: Face of God and Ill Kommodity
Kuhn, Jennifer
2013-01-01
This is a product - oriented thesis. The aim is to conclude a guidebook about music export for young bands that are interested in playing a show abroad. The project: Music export from Helsinki to Berlin and vice versa. Case study: Face of God and Ill Kommodity, was used to learn from the praxis. The thesis describes the responsibilities of the project manager and brings project management and event planning together. The music export history of Finland and Germany is taken in considerat...
Nilsson, David
2013-01-01
The international image of Sweden is one of a small, democratic and peace-loving country without the moral burden of a colonial past. This image has been reproduced in Swedish government policy as well as in most historical accounts. However, in this Current African Issues publication, the notion that “Sweden lacks a colonial past in Africa” is brought into question. The Berlin Conference 1884-85 is perhaps the most infamous political event in the history of European domination of Africa. At ...
Kestere, Iveta
2014-01-01
This study on a "new" history of education is written from the perspective of a participant in the process of discarding Soviet intellectual and physical boundaries. The fall of the Berlin Wall has, over the past two decades, become a continuous process in post-Soviet societies, when the now liberated historians of education were faced…
PREFACE: IUPAP C20 Conference on Computational Physics (CCP 2011)
Troparevsky, Claudia; Stocks, George Malcolm
2012-12-01
Increasingly, computational physics stands alongside experiment and theory as an integral part of the modern approach to solving the great scientific challenges of the day on all scales - from cosmology and astrophysics, through climate science, to materials physics, and the fundamental structure of matter. Computational physics touches aspects of science and technology with direct relevance to our everyday lives, such as communication technologies and securing a clean and efficient energy future. This volume of Journal of Physics: Conference Series contains the proceedings of the scientific contributions presented at the 23rd Conference on Computational Physics held in Gatlinburg, Tennessee, USA, in November 2011. The annual Conferences on Computational Physics (CCP) are dedicated to presenting an overview of the most recent developments and opportunities in computational physics across a broad range of topical areas and from around the world. The CCP series has been in existence for more than 20 years, serving as a lively forum for computational physicists. The topics covered by this conference were: Materials/Condensed Matter Theory and Nanoscience, Strongly Correlated Systems and Quantum Phase Transitions, Quantum Chemistry and Atomic Physics, Quantum Chromodynamics, Astrophysics, Plasma Physics, Nuclear and High Energy Physics, Complex Systems: Chaos and Statistical Physics, Macroscopic Transport and Mesoscopic Methods, Biological Physics and Soft Materials, Supercomputing and Computational Physics Teaching, Computational Physics and Sustainable Energy. We would like to take this opportunity to thank our sponsors: International Union of Pure and Applied Physics (IUPAP), IUPAP Commission on Computational Physics (C20), American Physical Society Division of Computational Physics (APS-DCOMP), Oak Ridge National Laboratory (ORNL), Center for Defect Physics (CDP), the University of Tennessee (UT)/ORNL Joint Institute for Computational Sciences (JICS) and Cray, Inc
Fitness as 'social heritage': a study of elementary school pupils in Berlin
DEFF Research Database (Denmark)
Pfister, Gertrud; Reeg, Annemarie
2006-01-01
information on attitudes towards the issue of sport and health as well as on sporting activities. In this contribution, we concentrate on the influence of parents and schools on the fitness and motor competencies of the children. The results of the test and the survey clearly showed correlations between...... the fitness level of the pupils and the education level of the parents. According to our results, fitness and physical skills are, at least to a certain extent, socially inherited. The fitness differences found in the different schools can be explained partly by the different social back ground......Health and fitness among children and adolescents is a subject currently receiving public attention. This article focuses on the fitness of German pupils (third and fourth grades) in five schools in Berlin with widely differing social catchment areas as well as children from differing social...
Detecting Mental States by Machine Learning Techniques: The Berlin Brain-Computer Interface
Blankertz, Benjamin; Tangermann, Michael; Vidaurre, Carmen; Dickhaus, Thorsten; Sannelli, Claudia; Popescu, Florin; Fazli, Siamac; Danóczy, Márton; Curio, Gabriel; Müller, Klaus-Robert
The Berlin Brain-Computer Interface Brain-Computer Interface (BBCI) uses a machine learning approach to extract user-specific patterns from high-dimensional EEG-features optimized for revealing the user's mental state. Classical BCI applications are brain actuated tools for patients such as prostheses (see Section 4.1) or mental text entry systems ([1] and see [2-5] for an overview on BCI). In these applications, the BBCI uses natural motor skills of the users and specifically tailored pattern recognition algorithms for detecting the user's intent. But beyond rehabilitation, there is a wide range of possible applications in which BCI technology is used to monitor other mental states, often even covert ones (see also [6] in the fMRI realm). While this field is still largely unexplored, two examples from our studies are exemplified in Sections 4.3 and 4.4.
Quality of Life in Patients With Brain Metastases Using the EORTC QLQ-BN20+2 and QLQ-C15-PAL
International Nuclear Information System (INIS)
Caissie, Amanda; Nguyen, Janet; Chen, Emily; Zhang Liying; Sahgal, Arjun; Clemons, Mark; Kerba, Marc; Arnalot, Palmira Foro; Danjoux, Cyril; Tsao, May; Barnes, Elizabeth; Holden, Lori; Danielson, Brita; Chow, Edward
2012-01-01
Purpose: The 20-item European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire–Brain Neoplasm (QLQ-BN20) is a validated quality-of-life (QOL) questionnaire for patients with primary brain tumors. The European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire–Core 15 Palliative (QLQ-C15-PAL) core palliative questionnaire is a 15-item version of the core 30-item QLQ-C30 and was developed to decrease the burden on patients with advanced cancer. The combination of the QLQ-BN20 and QLQ-C30 to assess QOL may be too burdensome for patients. The primary aim of this study was to assess QOL in patients before and after treatment for brain metastases using the QLQ-BN20+2 and QLQ-C15-PAL, a version of the QLQ-BN20 questionnaire with 2 additional questions assessing cognitive functioning that were not addressed in the QLQ-C15-PAL. Methods and Materials: Patients with brain metastases completed the QLQ-C15-PAL and QLQ-BN20+2 questionnaires to assess QOL before and 1 month after radiation. Linear regression analysis was used to assess changes in QOL scores over time, as well as to explore associations between the QLQ-BN20+2 and QLQ-C15-PAL scales, patient demographics, and clinical variables. Spearman correlation assessed associations between the QLQ-BN20+2 and QLQ-C15-PAL scales. Results: Among 108 patients, the majority (55%) received whole-brain radiotherapy only, with 65% of patients completing follow-up at 1 month after treatment. The most prominent symptoms at baseline were future uncertainty (QLQ-BN20+2) and fatigue (QLQ-C15-PAL). After treatment, significant improvement was seen for the QLQ-C15-PAL insomnia scale, as well as the QLQ-BN20+2 scales of future uncertainty, visual disorder, and concentration difficulty. Baseline Karnofsky Performance Status was negatively correlated to QLQ-BN20+2 motor dysfunction but positively related to QLQ-C15-PAL physical functioning and QLQ-BN20+2 cognitive functioning at
Quality of Life in Patients With Brain Metastases Using the EORTC QLQ-BN20+2 and QLQ-C15-PAL
Energy Technology Data Exchange (ETDEWEB)
Caissie, Amanda; Nguyen, Janet; Chen, Emily; Zhang Liying [Rapid Response Radiotherapy Program, Odette Cancer Centre, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada); Sahgal, Arjun [Rapid Response Radiotherapy Program, Odette Cancer Centre, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada); Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada); Clemons, Mark [Department of Medical Oncology, Ottawa Hospital Cancer Centre, Ottawa, Ontario (Canada); Kerba, Marc [Department of Radiation Oncology, Tom Baker Cancer Centre, Calgary, Alberta (Canada); Arnalot, Palmira Foro [Parc de Salut Mar Hospital de l' Esperanca, Barcelona (Spain); Danjoux, Cyril; Tsao, May; Barnes, Elizabeth; Holden, Lori [Rapid Response Radiotherapy Program, Odette Cancer Centre, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada); Danielson, Brita [Department of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Chow, Edward, E-mail: edward.chow@sunnybrook.ca [Rapid Response Radiotherapy Program, Odette Cancer Centre, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada)
2012-07-15
Purpose: The 20-item European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire-Brain Neoplasm (QLQ-BN20) is a validated quality-of-life (QOL) questionnaire for patients with primary brain tumors. The European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire-Core 15 Palliative (QLQ-C15-PAL) core palliative questionnaire is a 15-item version of the core 30-item QLQ-C30 and was developed to decrease the burden on patients with advanced cancer. The combination of the QLQ-BN20 and QLQ-C30 to assess QOL may be too burdensome for patients. The primary aim of this study was to assess QOL in patients before and after treatment for brain metastases using the QLQ-BN20+2 and QLQ-C15-PAL, a version of the QLQ-BN20 questionnaire with 2 additional questions assessing cognitive functioning that were not addressed in the QLQ-C15-PAL. Methods and Materials: Patients with brain metastases completed the QLQ-C15-PAL and QLQ-BN20+2 questionnaires to assess QOL before and 1 month after radiation. Linear regression analysis was used to assess changes in QOL scores over time, as well as to explore associations between the QLQ-BN20+2 and QLQ-C15-PAL scales, patient demographics, and clinical variables. Spearman correlation assessed associations between the QLQ-BN20+2 and QLQ-C15-PAL scales. Results: Among 108 patients, the majority (55%) received whole-brain radiotherapy only, with 65% of patients completing follow-up at 1 month after treatment. The most prominent symptoms at baseline were future uncertainty (QLQ-BN20+2) and fatigue (QLQ-C15-PAL). After treatment, significant improvement was seen for the QLQ-C15-PAL insomnia scale, as well as the QLQ-BN20+2 scales of future uncertainty, visual disorder, and concentration difficulty. Baseline Karnofsky Performance Status was negatively correlated to QLQ-BN20+2 motor dysfunction but positively related to QLQ-C15-PAL physical functioning and QLQ-BN20+2 cognitive functioning at
Multi-decadal survival of an Antarctic nematode, Plectus murrayi, in a -20°C stored moss sample.
Kagoshima, H; Kito, K; Aizu, T; Shin-i, T; Kanda, H; Kobayashi, S; Toyoda, A; Fujiyama, A; Kohara, Y; Convey, P; Niki, H
2012-01-01
It is not clear for how long Antarctic soil nematodes might tolerate freezing. Samples of the Antarctic moss, Bryum argenteum, were collected on 1 October 1983 at Langhovde, Soya coast, eastern Antarctica and were stored at -20°C. After 25.5 years of storage, living nematodes were recovered from the samples and were identified as Plectus murrayi by morphological examination and nucleotide sequencing of ribosomal RNA loci. The nematodes can grow and reproduce in a water agar plate with bacteria (mainly Pseudomonas sp.) cultured from the moss extract. They showed freezing tolerance at -20°C and -80°C and their survival rate after exposure to -20°C, but not -80°C, was increased if they were initially frozen slowly at a high sub-zero temperature. They also showed some ability to tolerate desiccation stress.
Coordinating AgMIP data and models across global and regional scales for 1.5°C and 2.0°C assessments
Rosenzweig, Cynthia; Ruane, Alex C.; Antle, John; Elliott, Joshua; Ashfaq, Muhammad; Chatta, Ashfaq Ahmad; Ewert, Frank; Folberth, Christian; Hathie, Ibrahima; Havlik, Petr; Hoogenboom, Gerrit; Lotze-Campen, Hermann; MacCarthy, Dilys S.; Mason-D'Croz, Daniel; Contreras, Erik Mencos; Müller, Christoph; Perez-Dominguez, Ignacio; Phillips, Meridel; Porter, Cheryl; Raymundo, Rubi M.; Sands, Ronald D.; Schleussner, Carl-Friedrich; Valdivia, Roberto O.; Valin, Hugo; Wiebe, Keith
2018-05-01
The Agricultural Model Intercomparison and Improvement Project (AgMIP) has developed novel methods for Coordinated Global and Regional Assessments (CGRA) of agriculture and food security in a changing world. The present study aims to perform a proof of concept of the CGRA to demonstrate advantages and challenges of the proposed framework. This effort responds to the request by the UN Framework Convention on Climate Change (UNFCCC) for the implications of limiting global temperature increases to 1.5°C and 2.0°C above pre-industrial conditions. The protocols for the 1.5°C/2.0°C assessment establish explicit and testable linkages across disciplines and scales, connecting outputs and inputs from the Shared Socio-economic Pathways (SSPs), Representative Agricultural Pathways (RAPs), Half a degree Additional warming, Prognosis and Projected Impacts (HAPPI) and Coupled Model Intercomparison Project Phase 5 (CMIP5) ensemble scenarios, global gridded crop models, global agricultural economics models, site-based crop models and within-country regional economics models. The CGRA consistently links disciplines, models and scales in order to track the complex chain of climate impacts and identify key vulnerabilities, feedbacks and uncertainties in managing future risk. CGRA proof-of-concept results show that, at the global scale, there are mixed areas of positive and negative simulated wheat and maize yield changes, with declines in some breadbasket regions, at both 1.5°C and 2.0°C. Declines are especially evident in simulations that do not take into account direct CO2 effects on crops. These projected global yield changes mostly resulted in increases in prices and areas of wheat and maize in two global economics models. Regional simulations for 1.5°C and 2.0°C using site-based crop models had mixed results depending on the region and the crop. In conjunction with price changes from the global economics models, productivity declines in the Punjab, Pakistan, resulted in
Rosenzweig, Cynthia; Ruane, Alex C; Antle, John; Elliott, Joshua; Ashfaq, Muhammad; Chatta, Ashfaq Ahmad; Ewert, Frank; Folberth, Christian; Hathie, Ibrahima; Havlik, Petr; Hoogenboom, Gerrit; Lotze-Campen, Hermann; MacCarthy, Dilys S; Mason-D'Croz, Daniel; Contreras, Erik Mencos; Müller, Christoph; Perez-Dominguez, Ignacio; Phillips, Meridel; Porter, Cheryl; Raymundo, Rubi M; Sands, Ronald D; Schleussner, Carl-Friedrich; Valdivia, Roberto O; Valin, Hugo; Wiebe, Keith
2018-05-13
The Agricultural Model Intercomparison and Improvement Project (AgMIP) has developed novel methods for Coordinated Global and Regional Assessments (CGRA) of agriculture and food security in a changing world. The present study aims to perform a proof of concept of the CGRA to demonstrate advantages and challenges of the proposed framework. This effort responds to the request by the UN Framework Convention on Climate Change (UNFCCC) for the implications of limiting global temperature increases to 1.5°C and 2.0°C above pre-industrial conditions. The protocols for the 1.5°C/2.0°C assessment establish explicit and testable linkages across disciplines and scales, connecting outputs and inputs from the Shared Socio-economic Pathways (SSPs), Representative Agricultural Pathways (RAPs), Half a degree Additional warming, Prognosis and Projected Impacts (HAPPI) and Coupled Model Intercomparison Project Phase 5 (CMIP5) ensemble scenarios, global gridded crop models, global agricultural economics models, site-based crop models and within-country regional economics models. The CGRA consistently links disciplines, models and scales in order to track the complex chain of climate impacts and identify key vulnerabilities, feedbacks and uncertainties in managing future risk. CGRA proof-of-concept results show that, at the global scale, there are mixed areas of positive and negative simulated wheat and maize yield changes, with declines in some breadbasket regions, at both 1.5°C and 2.0°C. Declines are especially evident in simulations that do not take into account direct CO 2 effects on crops. These projected global yield changes mostly resulted in increases in prices and areas of wheat and maize in two global economics models. Regional simulations for 1.5°C and 2.0°C using site-based crop models had mixed results depending on the region and the crop. In conjunction with price changes from the global economics models, productivity declines in the Punjab, Pakistan, resulted in
Westerhof, G.J.; Keyes, C.L.M.
2006-01-01
Objectives. This study empirically tested the self-systems theory of subjective change in light of the rapid change after the fall of the Berlin Wall. The theory predicts that individuals have a tendency to perceive stability and that perceived stability exerts a strong positive effect on subjective
International Nuclear Information System (INIS)
Kuczera, Bernhard
2013-01-01
A ground-breaking, scientific discovery made in the Berlin experiments of the year 1938 on neutron irradiation of uranium, was that atom nuclei can be fissured and, during the fission energy, so-called nuclear energy, is released. If further U-235 atoms are in the immediate vicinity, the released neutrons can trigger a chain reaction of the nuclear fission. The story of this ground-breaking discovery that led to the worldwide civil utilisation of nuclear energy is outlined here. The discovery of neutrons and their implementation in radiation experiments occurred in the 1930s. The research work followed the model of the Stockholm citizen Niels Bohr on the configuration of an atom. In 1930, Walther Bothe reported on the occurrence of a high-energy radiation when beryllium was irradiated with alpha-particles. James Chadwick could prove experimentally in 1932 that this is a current of high-energy, electrically neutral particles. He called these particles neutrons. In Berlin, the radio-chemist Otto Hahn is the Director at the Kaiser-Wilhelm-Institute for Chemistry and head of the chemical-radioactive department. In the years 1935 to 1938, the radiation experiments of uranium with neutrons were at the centre of the research in Berlin. In October 1938, Hahn and Strassmann responded with their own experiments to the scientific challenge of Irene Curie and Paul Savitch of 3.5-hours of activity when uranium was radiated with neutrons. The decisive discovery for the neutron radiation of uranium was made by Hahn and Strassmann on 17 December 1938. From the results of different experiments, they conclude: 'Our radium isotopes have the properties of barium.' On 19 December, Hahn informs Lise Meitner and speaking on the issue of 'Where does the barium come from?' addresses a possible 'bursting' of the uranium nucleus. That is Hahn's 'Heureka.' moment: He recognises that the neutron radiation does not only effect radiochemical transformations, but can also cause the uranium
Energy Technology Data Exchange (ETDEWEB)
Anon.
2004-07-15
After Bangkok in 2002 and Santiago de Chile in 2003, the World Forum of the World LP Gas Association (WLPGA) is returning to Europe for two and a half days of exhibition and two days of conferences from 29 September to 1 October at the Hotel lnterContinental in Berlin. As a Europe of 25 is now a reality, the Forum will obviously focus on this situation and the prospects for LP Gas in the new group without, however, neglecting the global issues which are why it exists. The WLPGA has a new Managing Director, James Rockall, since 2 August. He previously held the post of Director of Market Development for the Association from july 2003. The 2004 action plan of the World LP Gas Association forms part of the strategic decisions taken at the end of 2001 for the period 2002-2006. Its structure remains identical to that of the previous plan but with the continuous rise in 'the good industrial practices', there is one programme more than in 2003. There is particular emphasis on the programme for developing LP Gas markets in rural areas, at the core of which is the LP Gas Rural Energy Challenge launched 2 years ago in the framework of a partnership with the UNPD. Moreover, the WLPGA contribution to the preparation of the World Energy Outlook of the LEA is testimony to the reinforcement of relations with this agency, and the Association also took part in the World Energy Congress in Sydney. The other programmes are also progressing: GAIN, GLOTEC, without forgetting the preparation of the annual forum and the services provided directly to WLPGA members. Having decided on a change of direction in his career, Emmanuel Chantelot left the WLPGA and the LP Gas industry on 31 July 2004. He should be attending the Members' Dinner at the Berlin Forum. Emmanuel Chantelot has led the World Association for just over 7 years as Managing Director. (authors)
Uranium target fragmentation by intermediate and high energy 12C and 20Ne ions
International Nuclear Information System (INIS)
McGaughey, P.L.; Loveland, W.; Morrissey, D.J.; Aleklett, K.; Seaborg, G.T.
1985-01-01
Target fragment formation cross sections for nuclides with 24 12 C and 8.0 and 20.0 GeV 20 Ne with 238 U. Fragment isobaric yields were deduced from these data. The light fragment (A 12 C projectile energy of 1.0 GeV, the n-deficient fragments appear to originate primarily from a fission rather than a spallation process.) The excitation functions of the heavy fragments with 60 60, indicating that the general pattern of yields of these fragments is governed by the excitation energy deposited in the nucleus during the first step of the reaction and the geometry of the collision
Silver oxides. II. Specific heats of silver oxide and silver peroxide. [20 to 99 C
Energy Technology Data Exchange (ETDEWEB)
Jirsa, F
1949-01-01
Specific heats were determined in a water calorimeter over the temperature range 20 through 99 C. The specific heat of Ag/sub 2/O is given as 0.0803 +- 0.001 cal/g-C, and that of Ag/sub 2/O/sub 2/ is given as 0.0869 +- 0.0005 cal/g-C.
BOREAS RSS-20 POLDER C-130 Measurements of Surface BRDF
Leroy, Marc; Hall, Forrest G. (Editor); Nickerson, Jaime (Editor); Smith, David E. (Technical Monitor)
2000-01-01
This Boreal Ecosystem-Atmosphere Study (BOREAS) Remote Sensing Science (RSS)-20 data set contains measurements of surface bidirectional reflectance distribution function (BRDF) made by the polarization and Directionality of Earth reflectances (POLDER) instrument over several surface types (pine, spruce, fen) of the BOREAS southern study area (SSA) during the 1994 intensive field campaigns (IFCs). Single-point BRDF values were acquired either from the NASA Ames Research Center (ARC) C-130 aircraft or from a NASA Wallops Flight Facility (WFF) helicopter. A related data set collected from the helicopter platform is available as is POLDER imagery acquired from the C-130. The data are stored in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884) or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).
Projected Changes in the Asian-Australian Monsoon Region in 1.5°C and 2.0°C Global-Warming Scenarios
Chevuturi, Amulya; Klingaman, Nicholas P.; Turner, Andrew G.; Hannah, Shaun
2018-03-01
In light of the Paris Agreement, it is essential to identify regional impacts of half a degree additional global warming to inform climate adaptation and mitigation strategies. We investigate the effects of 1.5°C and 2.0°C global warming above preindustrial conditions, relative to present day (2006-2015), over the Asian-Australian monsoon region (AAMR) using five models from the Half a degree Additional warming, Prognosis and Projected Impacts (HAPPI) project. There is considerable intermodel variability in projected changes to mean climate and extreme events in 2.0°C and 1.5°C scenarios. There is high confidence in projected increases to mean and extreme surface temperatures over AAMR, as well as more-frequent persistent daily temperature extremes over East Asia, Australia, and northern India with an additional 0.5°C warming, which are likely to occur. Mean and extreme monsoon precipitation amplify over AAMR, except over Australia at 1.5°C where there is uncertainty in the sign of the change. Persistent daily extreme precipitation events are likely to become more frequent over parts of East Asia and India with an additional 0.5°C warming. There is lower confidence in projections of precipitation change than in projections of surface temperature change. These results highlight the benefits of limiting the global-mean temperature change to 1.5°C above preindustrial, as the severity of the above effects increases with an extra 0.5°C warming.
16 CFR Appendix C to Part 436 - Sample Item 20(2) Table-Transfers of Franchised Outlets
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Sample Item 20(2) Table-Transfers of Franchised Outlets C Appendix C to Part 436 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES DISCLOSURE REQUIREMENTS AND PROHIBITIONS CONCERNING FRANCHISING Pt. 436, App. C Appendix C to Part...
Managing Cultural Diversity in Federal Germany: Bavaria and Berlin as Classic Antagonists
Directory of Open Access Journals (Sweden)
Caroline Schultz
2015-11-01
Full Text Available Due to the type of federalism applied in Germany the level of analysis best suited for studying integration is that of the 16 Länder. For comparing the approaches of two of these - Bavaria and Berlin - in managing migration-related diversity, the paper uses a double differentiation as analytical starting point. The first refers to the bulk of literature of different national models of integration and proposes two ideal types of integration/diversity policy. The second differentiation seizes the suggestion that integration in some areas of life is socially much more consequential than in others with the consequence that state intervention in these areas is much easier to justify from a normative point of view. From the descriptive comparison it becomes clear that both Länder, though coming from rather diverging starting points, by now employ hybrid strategies to accommodate or manage different aspects of cultural diversity.
Heat wave exposure in India in current, 1.5 °C, and 2.0 °C worlds
Mishra, Vimal; Mukherjee, Sourav; Kumar, Rohini; Stone, Dáithí A.
2017-12-01
Heatwaves with large impacts have increased in the recent past and will continue to increase under future warming. However, the implication for population exposure to severe heatwaves remains unexplored. Here, we characterize maximum potential human exposure (without passive/active reduction measures) to severe heatwaves in India. We show that if the global mean temperature is limited to 2.0 °C above pre-industrial conditions, the frequency of severe heatwaves will rise by 30 times the current climate by the end-21st century. In contrast, the frequency is projected to be about 2.5 times more (than the low-warming scenario of 2 °C) under conditions expected if the RCP8.5 ‘business-as-usual’ emissions scenario is followed. Under the 2.0 °C low-warming target, population exposure to severe heatwaves is projected to increase by about 15 and 92 times the current level by the mid and end-21st century respectively. Strategies to reduce population growth in India during the 21st century may provide only limited mitigation of heatwave exposure mostly late in the century. Limiting global temperatures to 1.5 °C above preindustrial would reduce the exposure by half relative to RCP8.5 by the mid-21st century. If global temperatures are to exceed 1.5 °C then substantial measures will be required to offset the large increase in exposure to severe heatwaves in India.
Pressure dependence of the superconducting transition temperature of Rb3C60 up to 20 kbar
International Nuclear Information System (INIS)
Bud'ko, S.L.; Meng, R.L.; Chu, C.W.; Hor, P.H.
1991-01-01
AC susceptibility measurements of Rb 3 C 60 under hydrostatic pressure up to 20 kbar are reported. The superconducting transition temperature (T c ) decreases linearly under pressure with the pressure derivative dT c /dP = -0.78 K degrees/kbar
Boekhout, Michiel; Wolthuis, Rob
2015-04-15
Nek2 isoform A (Nek2A) is a presumed substrate of the anaphase-promoting complex/cyclosome containing Cdc20 (APC/C(Cdc20)). Nek2A, like cyclin A, is degraded in mitosis while the spindle checkpoint is active. Cyclin A prevents spindle checkpoint proteins from binding to Cdc20 and is recruited to the APC/C in prometaphase. We found that Nek2A and cyclin A avoid being stabilized by the spindle checkpoint in different ways. First, enhancing mitotic checkpoint complex (MCC) formation by nocodazole treatment inhibited the degradation of geminin and cyclin A, whereas Nek2A disappeared at a normal rate. Second, depleting Cdc20 effectively stabilized cyclin A but not Nek2A. Nevertheless, Nek2A destruction crucially depended on Cdc20 binding to the APC/C. Third, in contrast to cyclin A, Nek2A was recruited to the APC/C before the start of mitosis. Interestingly, the spindle checkpoint very effectively stabilized an APC/C-binding mutant of Nek2A, which required the Nek2A KEN box. Apparently, in cells, the spindle checkpoint primarily prevents Cdc20 from binding destruction motifs. Nek2A disappearance marks the prophase-to-prometaphase transition, when Cdc20, regardless of the spindle checkpoint, activates the APC/C. However, Mad2 depletion accelerated Nek2A destruction, showing that spindle checkpoint release further increases APC/C(Cdc20) catalytic activity. © 2015. Published by The Company of Biologists Ltd.
Razum, Oliver; Zeeb, Hajo
2017-11-01
In the age of globalization, few health issues remain "local". For example, neither infectious diseases nor climate change stop at national borders, and hence cannot be controlled only within the nation state. The same applies to smoking and nutritional behaviors that affect health and are influenced by multinational companies and transnational policies. Therefore, public health needs to develop strategies and interventions that are not restricted to the nation state alone. This also applies to public health in Germany that needs a stronger global health perspective. © Georg Thieme Verlag KG Stuttgart · New York.
Mechanisms controlling the temporal degradation of Nek2A and Kif18A by the APC/C-Cdc20 complex
DEFF Research Database (Denmark)
Sedgwick, G.G.; Hayward, D.G.; Nilsson, J.
2013-01-01
The Anaphase Promoting Complex/Cyclosome (APC/C) in complex with its co-activator Cdc20 is responsible for targeting proteins for ubiquitin-mediated degradation during mitosis. The activity of APC/C-Cdc20 is inhibited during prometaphase by the Spindle Assembly Checkpoint (SAC) yet certain...... substrates escape this inhibition. Nek2A degradation during prometaphase depends on direct binding of Nek2A to the APC/C via a C-terminal MR dipeptide but whether this motif alone is sufficient is not clear. Here, we identify Kif18A as a novel APC/C-Cdc20 substrate and show that Kif18A degradation depends...... by the APC/C. Nek2A and the mitotic checkpoint complex (MCC) have an overlap in APC/C subunit requirements for binding and we propose that Nek2A binds with high affinity to apo-APC/C and is degraded by the pool of Cdc20 that avoids inhibition by the SAC....
Hirschheydt, Monika von
2015-01-01
Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014
The X-ray microscopy beamline UE46-PGM2 at BESSY
International Nuclear Information System (INIS)
Follath, R.; Schmidt, J. S.; Weigand, M.; Fauth, K.
2010-01-01
The Max Planck Institute for Metal Physics in Stuttgart and the Helmholtz Center Berlin operate a soft X-ray microscopy beamline at the storage ring BESSY II. A collimated PGM serves as monochromator for a scanning X-ray microscope and a full field X-ray microscope at the helical undulator UE46. The selection between both instruments is accomplished via two switchable focusing mirrors. The scanning microscope (SM) is based on the ALS STXM microscope and fabricated by the ACCEL company. The full field microscope (FFM) is currently in operation at the U41-SGM beamline and will be relocated to its final location this year.
Directory of Open Access Journals (Sweden)
Andrew Bank
Full Text Available This article presents a case for the centrality of race and racism in the training and early ethnographic writings of Werner Eiselen (1899-1977. Together with further discussion in two other articles, it demonstrates that Eiselen was not the consolidator of the British functionalist anthropological tradition in South Africa nor a strong affiliate of the liberal school of African studies in South Africa as other scholars have proposed. On the contrary, he was the founder of a radically different ethnographic tradition: an anti-humanist and deeply racialised tradition of cultural study with its roots in Berlin Mission Society ideology and German Africanist linguistics. I track the origins of Eiselens volkekunde to his missionary background in a former Boer Republic, his Afrikaner nationalist schooling and university career, and especially to his training in African linguistics in Hamburg (and Berlin between 1921 and 1924 under the leading international figure in the field, the German linguist and ethnologist Carl Meinhof (1857-1944, whose racially informed theories and politics profoundly shaped Eiselen and the school of volkekunde that he would father during his decade-long tenure at Stellenbosch University.
Ehrlich, Edwin; Tischer, Anja; Maxeiner, H
2009-04-01
To expand the passive safety of automobiles protecting traffic participants technological innovations were done in the last decades. Objective of our retrospective analysis was to examine if these technical modifications led to a clearly changed pattern of injuries of pedestrians whose death was caused by the accidents. Another reduction concerns the exclusion of injured car passengers--only pedestrians walking or standing at the moment of collision were included. We selected time intervals 1975-1985 and 1991-2004 (=years of construction of the involved passenger cars). The cars were classified depending on their frontal construction in types as presented by Schindler et al. [Schindler V, Kühn M, Weber S, Siegler H, Heinrich T. Verletzungsmechanismen und Wirkabschätzungen der Fahrzegfrontgestaltung bei Pkw-Fussgänger-Kollisionen. Abschlussbericht im Auftrag der Deutschen Versicherungswirtschaft e.V. TU-Berlin Fachgebiet Kraftfahrzeuge (GDV) 2004:36-40]. In both periods more than 90% of all cars were from the usual types small/medium/large class. Hundred and thirty-four autopsy records of such cases from Department of Forensic Medicine (Charité Berlin) data were analysed. The data included technical information of the accidents and vehicles and the external and internal injuries of the victims. The comparison of the two periods showed a decrease of serious head injuries and femoral fractures but an increase of chest-, abdominal and pelvic injuries. This situation could be explained by an increased occurrence of soft-face-constructions and changed front design of modern passenger cars, resulting in a favourable effects concerning head impact to the car during accident. Otherwise the same kinetic energy was transferred to the (complete) victim - but because of a displacement of main focus of impact the pattern of injuries modified (went distally).
Krause, Manfred
2009-01-01
Das Forschungspapier entwirft ein Soll-Prozessmuster für die Verwaltung von Herbarbelegen im Botanischen Garten/ Botanischen Museum in Berlin-Dahlem im Rahmen des Forschungsvorhabens "Herbar Digital". Ausgangspunkt für die Erstellung des Soll- Modells sind die bereits dokumentierten Geschäftsprozesse. Die bestehenden Prozesse werden an die Ausbaustufe 1 von Herbar Digital angepasst, um die Kosten für die Digitalisierung eines Herbarbeleges zu senken. Als Grundlage für die Optimierung der Gesc...
Tourisme et espaces publics : de l'attractivité à la qualité d'accueil ? Paris au regard de Berlin
Fleury, Antoine
2013-01-01
Observing that metropolitan tourism takes place mostly in public spaces, the present article aims to shed light on the complex and dynamic relationship between tourism and public space policies. It analyzes how urban governments reconcile the diversity of issues and usages characterizing public spaces in city centres with the economic need of tourism development. Confronting Paris and Berlin it shows how cities have given priority to prestige developments and great events in the context of ur...
Neutron yield of thick {sup 12}C and {sup 13}C targets with 20 and 30 MeV deuterons
Energy Technology Data Exchange (ETDEWEB)
Lhersonneau, G.; Fadil, M. [GANIL, Caen (France); Malkiewicz, T. [CSC - IT Center for Science Ltd., Espoo (Finland); Gorelov, D.; Sorri, J.; Trzaska, W.H. [University of Jyvaskyla, Department of Physics, Jyvaskyla (Finland); Jones, P.; Ngcobo, P.Z. [iThemba Laboratory for Accelerator Based Science, Western Cape (South Africa)
2016-12-15
The neutron yield of thick targets of carbon, natural and enriched in {sup 13}C, bombarded by deuterons of 20 and 30 MeV has been measured by the activation method. The gain with respect to a {sup 12}C target is the same as with protons beams. The yield ratio is about 1.2 only and hardly can justify the use of a {sup 13}C target with deuteron beams. The data, apart from being of interest for the design of facilities where secondary neutron beams are used, provide a test case for calculations where both beam and target have a weakly bound neutron. The MCNPx code version 2.6.0, despite failing to reproduce some details of the experimental distributions, describes their global properties fairly well, especially the relative yields of the {sup 12}C and {sup 13}C targets. (orig.)
Positive and negative flashbulb memories of the fall of the Berlin Wall among East- and West Germans
DEFF Research Database (Denmark)
Bohn, Annette; Berntsen, Dorthe
2006-01-01
, rehearsal and the centrality of the memory to the person's identity and life story correlated positively with memory qualities. The results suggest that positive versus negative emotions have different effects on the processing and long-term retention of flashbulb memories.......Flashbulb memories for the fall of the Berlin Wall were examined among 103 East and West Germans who considered the event as either highly positive or highly negative. Participants in the positive group rated their memories higher on measures of reliving and sensory imagery, whereas memory...
Erosion-oxidation behavior of thermal sprayed Ni20Cr alloy and WC and Cr3C2 cermet coatings
Directory of Open Access Journals (Sweden)
Clarice Terui Kunioshi
2005-06-01
Full Text Available An apparatus to conduct high temperature erosion-oxidation studies up to 850 °C and with particle impact velocities up to 15 m.s-1 was designed and constructed in the Corrosion Laboratories of IPEN. The erosion-oxidation behavior of high velocity oxy fuel (HVOF sprayed alloy and cermet coatings of Ni20Cr, WC 20Cr7Ni and Cr3C2 Ni20Cr on a steel substrate has been studied. Details of this apparatus and the erosion-oxidation behavior of these coatings are presented and discussed. The erosion-oxidation behavior of HVOF coated Cr3C2 25(Ni20Cr was better than that of WC 20Cr7Ni, and the erosion-oxidation regimes have been identified for these coatings at particle impact velocity of 3.5 m.s-1, impact angle of 90° and temperatures in the range 500 to 850 °C.
Effect of VOC Emissions from Vegetation on Air Quality in Berlin during a Heatwave.
Churkina, Galina; Kuik, Friderike; Bonn, Boris; Lauer, Axel; Grote, Rüdiger; Tomiak, Karolina; Butler, Tim M
2017-06-06
The potential of emissions from urban vegetation combined with anthropogenic emissions to produce ozone and particulate matter has long been recognized. This potential increases with rising temperatures and may lead to severe problems with air quality in densely populated areas during heat waves. Here, we investigate how heat waves affect emissions of volatile organic compounds from urban/suburban vegetation and corresponding ground-level ozone and particulate matter. We use the Weather Research and Forecasting Model with atmospheric chemistry (WRF-Chem) with emissions of volatile organic compounds (VOCs) from vegetation simulated with MEGAN to quantify some of these feedbacks in Berlin, Germany, during the heat wave in 2006. The highest ozone concentration observed during that period was ∼200 μg/m 3 (∼101 ppb V ). The model simulations indicate that the contribution of biogenic VOC emissions to ozone formation is lower in June (9-11%) and August (6-9%) than in July (17-20%). On particular days within the analyzed heat wave period, this contribution increases up to 60%. The actual contribution is expected to be even higher as the model underestimates isoprene concentrations over urban forests and parks by 0.6-1.4 ppb v . Our study demonstrates that biogenic VOCs can considerably enhance air pollution during heat waves. We emphasize the dual role of vegetation for air quality and human health in cities during warm seasons, which is removal and lessening versus enhancement of air pollution. The results of our study suggest that reduction of anthropogenic sources of NOx, VOCs, and PM, for example, reduction of the motorized vehicle fleet, would have to accompany urban tree planting campaigns to make them really beneficial for urban dwellers.
Energy Technology Data Exchange (ETDEWEB)
Krischausky, Lutz [Wolf GmbH, Mainburg (Germany)
2009-07-01
The Anschutz Entertainment Group invested about 165 million Euros in their new multifunctional arena 'O{sub 2} World' in Berlin. The arena has 17,000 seats and is Germany's most state-of-the-art arena building. It can be converted over night into an ice arena, a basketball stadium, a concert hall, or an opera house as desired. The technical facilities are equipped with so-called set-ups that ensure that air conditioning systems follow a specific scenario for each type of event. (orig.)
Reduced size liver transplantation from a donor supported by a Berlin Heart.
Misra, M V; Smithers, C J; Krawczuk, L E; Jenkins, R L; Linden, B C; Weldon, C B; Kim, H B
2009-11-01
Patients on cardiac assist devices are often considered to be high-risk solid organ donors. We report the first case of a reduced size liver transplant performed using the left lateral segment of a pediatric donor whose cardiac function was supported by a Berlin Heart. The recipient was a 22-day-old boy with neonatal hemochromatosis who developed fulminant liver failure shortly after birth. The transplant was complicated by mild delayed graft function, which required delayed biliary reconstruction and abdominal wall closure, as well as a bile leak. However, the graft function improved quickly over the first week and the patient was discharged home with normal liver function 8 weeks after transplant. The presence of a cardiac assist device should not be considered an absolute contraindication for abdominal organ donation. Normal organ procurement procedures may require alteration due to the unusual technical obstacles that are encountered when the donor has a cardiac assist device.
The Cuban Scenario 25 Years after the Fall of the Berlin Wall
Directory of Open Access Journals (Sweden)
Onesimo Julian Moreira Seijos
2014-11-01
Full Text Available This paper examines the situation in Cuba after 25 years of the fall of the Berlin Wall. The Cuban political system has prevailed despite predictions foresaw its imminent end since the soviet-like socialism crumbled in East Europe and then in the USSR itself. Although the end of the cold war led to profound adjustments in the international system, the Cuban model remained almost unchanged; however, a Cuban repaired communism emerged in the nineties. Dollarization of the economy and permission for foreign investment affected the ideological purity as the main basis of the system persisted untouched. Nevertheless, since Raul Castro took over power from his brother Fidel in 2006 expectations for reform have increased. In fact, in 2011 the Sixth Congress of the Communist Party was held and some reforms have been implemented ever since. The paper focuses on the scope of those reforms as there are still many open questions about the future of the Cuban society.
ISN Nexus 2016 Symposia: Translational Immunology in Kidney Disease—The Berlin Roadmap
Directory of Open Access Journals (Sweden)
Hans-Joachim Anders
2016-11-01
Full Text Available To date, the treatment of immune-mediated kidney diseases has only marginally benefited from highly specific biological drugs that have demonstrated remarkable effects in many other diseases. What accounts for this disparity? In April 2016, the International Society of Nephrology held a Nexus meeting on Translational Immunology in Nephrology in Berlin, Germany, to identify and discuss hurdles that block the translational flow of target identification, and preclinical and clinical target validation in the domain of immune-mediated kidney disease. A broad panel of experts including basic scientists, translational researchers, clinical trialists, pharmaceutical industry drug developers, and representatives of the American and European regulatory authorities made recommendations on how to overcome such hurdles at all levels of the translational research process. The results of these discussions are presented here, which may serve as a roadmap for how to optimize the process of developing more innovative and effective drugs for patients with immune-mediated kidney diseases.
Enquêter sur la « diversité » à Berlin. Le cas de l’inspecteur Bobkowski
Directory of Open Access Journals (Sweden)
Barbara Thériault
2011-04-01
Full Text Available Comment traiter de diversité dans une organisation qui est réputée y être hostile ? Se réglant sur une démarche wébérienne, je présente dans cet article un cas, celui du commissaire Klaus Bobkowski, un enseignant responsable de la section « éducation politique » à l’Académie de police de Berlin et historien amateur. En considérant ce cas, ainsi que d’autres efforts pour composer avec la différence sous la République de Weimar (1918-1933 que j’ai enregistrés durant mon travail de terrain, je tente de faire saillir les motifs qui sous-tendent l’action des commissaires ayant contribué à la reconnaissance et à la promotion de la différence au sein des services policiers en Allemagne depuis les années 1990. En enquêtant sur ces motifs d’action, je suis en mesure de construire un idéaltype d’un « porteur de la diversité », qu’on peut lier, comme je le soutiens, à un programme libéral d’égalité civique.Investigate the “diversity” in Berlin. The case of the Inspector BobkowskiHow can one consider diversity in an organisation having a reputation for being against it? Following a weberian perspective, I present in this article such a case, that of Inspector Bobkowski, a teacher in charge of the “political education” section of the “Police Academy” of Berlin and amateur historian. In considering this case, along with other efforts to take differences into account during the Weimar Republic (1918-1933 that I recorded during my field work, I attempt to bring out the motifs which underline those actions of the police inspectors that contributed to the recognition and to the promotion of difference within the police services in Germany since the 1990s. By investigating these motifs of action, I am able to construct an ideal type of a “diversity messenger” that one can link, as I argue, to a liberal program of civic equality.Hacer encuestas en Berlín sobre la «diversidad». El caso del
Continuum of hepatitis C care in France: A 20-year cohort study.
Directory of Open Access Journals (Sweden)
Coralie Hermetet
Full Text Available Hepatitis C virus (HCV-infected patients require a specific continuum of care (CoC from HCV screening to treatment. We assessed CoC of HCV-infected patients in a longitudinal study.We established a cohort of subjects undergoing HCV screening (high alanine aminotransferase levels or risk factors during preventive consultations at a French regional medical center from 1993 to 2013. Patients were considered to be HCV-infected if HCV RNA was detected in their serum. CoC was assessed as described by Viner et al. (Hepatology 2015: Stage 1, HCV screening; Stage 2, HCV RNA testing; Stage 3, continuing care; Stage 4, antiviral treatment. Cox multivariate analysis was performed to identify factors favoring CoC, defined as at least one course of antiviral treatment.In total, 12,993 HCV tests were performed and 478 outpatients were found to be HCV-seropositive. We included 417 seropositive patients, after excluding false positives and patients lost to follow-up. The baseline characteristics of the patients were: sex ratio (M/F 1.4; mean age 38.5 years; intravenous drug use (IDU in 55%; and 28% in unstable social situations, estimated by the EPICES deprivation score. Antiviral treatment was initiated for 179 (42.9% of the 379 (90.9% patients attending specialist consultations. CoC was associated with screening after 1997 (HR 2.0, 95%CI 1.4-2.9, age > 45 years (HR 1.5, 95%CI 1.02-2.3, patient acceptance of care (HR 9.3, 95%CI 5.4-16.10, specialist motivation for treatment (HR 10.9, 95%CI 7.4-16.0, and absence of cancer (HR 6.7, 95%CI 1.6-27.9. Other comorbid conditions, such as depression and IDU, were not associated with CoC.Our 20-year cohort study reveals the real-life continuum of care for HCV-infected patients in France. The number of patients involved in HCV care after positive testing was substantial due to the organization of healthcare in France. An improved CoC along with new direct-acting antivirals should help to decrease chronic HCV infection.
Walker, Jaqui; Hutchison, Pippa; Ge, Junbo; Zhao, Dong; Wang, Yongjun; Rothwell, Peter M; Gaziano, J Michael; Chan, Andrew; Burn, John; Chia, John; Langley, Ruth; O'Donnell, Valerie; Rocca, Bianca; Hawkey, Chris
2018-01-01
Acetylsalicylic acid was first synthesised by Dr FeIix Hoffman on 10th August 1897 and Aspirin was born. It quickly became the best-known pain killer in the world and in the 120 years since this event, aspirin has continued to attract interest, innovation and excitement. Set within the walls of the preserved ruins of Rudolf Virchow's lecture hall at Charité, within Berlin's Museum of Medical History, the International Aspirin Foundation's 28th Scientific Conference served to facilitate international, multi-disease, multidisciplinary discussion about the current understanding of aspirin's mechanisms of action and its utility in modern medicine as well as ideas for future research into its multifaceted applications to enhance global health. In addition to the delegates in Berlin, 300 medical doctors at the 19th Annual Scientific Congress of the Chinese Society of Cardiology were able to join the cardiology sessions from Taiyuan, Shangxi province via a live streaming link to and from China. This led to useful discussion and allowed a truly international perspective to the meeting.
Singelmann, Joachim
2011-01-01
The Berlin Wall was one of the most visible symbols of two worlds that could not view each other. Thus, the fall of the Berlin Wall--and the fall of Communist regimes all over Eastern Europe, ultimately including the dissolution of the Soviet Union itself--removed the barrier to visibility. These events were revolutions that resulted in the end of…
Rasmussen, D. J.; Bittermann, Klaus; Buchanan, Maya K.; Kulp, Scott; Strauss, Benjamin H.; Kopp, Robert E.; Oppenheimer, Michael
2018-03-01
Sea-level rise (SLR) is magnifying the frequency and severity of extreme sea levels (ESLs) that can cause coastal flooding. The rate and amount of global mean sea-level (GMSL) rise is a function of the trajectory of global mean surface temperature (GMST). Therefore, temperature stabilization targets (e.g. 1.5 °C and 2.0 °C of warming above pre-industrial levels, as from the Paris Agreement) have important implications for coastal flood risk. Here, we assess, in a global network of tide gauges, the differences in the expected frequencies of ESLs between scenarios that stabilize GMST warming at 1.5 °C, 2.0 °C, and 2.5 °C above pre-industrial levels. We employ probabilistic, localized SLR projections and long-term hourly tide gauge records to estimate the expected frequencies of historical and future ESLs for the 21st and 22nd centuries. By 2100, under 1.5 °C, 2.0 °C, and 2.5 °C GMST stabilization, the median GMSL is projected to rise 48 cm (90% probability of 28-82 cm), 56 cm (28-96 cm), and 58 cm (37-93 cm), respectively. As an independent comparison, a semi-empirical sea level model calibrated to temperature and GMSL over the past two millennia estimates median GMSL rise within 7-8 cm of these projections. By 2150, relative to the 2.0 °C scenario and based on median sea level projections, GMST stabilization of 1.5 °C spares the inundation of lands currently home to about 5 million people, including 60 000 individuals currently residing in Small Island Developing States. We quantify projected changes to the expected frequency of historical 10-, 100-, and 500-year ESL events using frequency amplification factors that incorporate uncertainty in both local SLR and historical return periods of ESLs. By 2150, relative to a 2.0 °C scenario, the reduction in the frequency amplification of the historical 100 year ESL event arising from a 1.5 °C GMST stabilization is greatest in the eastern United States, with ESL event
Directory of Open Access Journals (Sweden)
Herbert Pieper
2000-10-01
Full Text Available Article in German, Abstracts in English and Spanish. On the 17th of July 1800 Alexander von Humboldt was elected as an extraordinary member of the Prussian Académie royale des sciences et belles-lettres at Berlin. The paper first deals with Humboldt’s scientific activities before his election and then goes into detail as far as his integration into the work of the Academy is concerned. Humboldt was elected as a chimiste célèbre, but as a member of the Academy he did not work as a chemist. When Humboldt proposed in 1837 to classify the members of each class in special fields, he chose for himself the field of "mineralogy-geology".
Alles muss man selber machen. Multi-Layer-Organizing für eine soziale Wohnraumversorgung in Berlin
Directory of Open Access Journals (Sweden)
Kotti & Co
2016-11-01
Full Text Available Kotti & Co protestieren seit 2011 gegen Mieterhöhungen im sozialen Wohnungsbau am Kottbusser Tor, Berlin Kreuzberg. Seitdem haben sie mit einem Gecekondu ihren eigenen Vorplatz besetzt, zahlreiche Lärmdemonstrationen veranstaltet, Expertise organisiert und selbst erworben, lokale und stadtweite Kampagnen initiiert, sich stadtweit und international vernetzt und gemeinsam mit anderen ein eigenes Gesetz zur Umstrukturierung der sozialen Wohnraumversorgung geschrieben. All diese Aktivitäten basieren auf dem Zusammenkommen als Mieter_innen, die wollen, dass ihre Miete sinkt, dass Familien, Freund_innen und Nachbar_innen am Kotti wohnen bleiben können und dass die rassistische Ausgrenzung vieler der Nachbar_innen endlich aufhört.
Measurements of T20 in backward elastic d p scattering at deuteron momenta 3.5 - 6 GeV/c
International Nuclear Information System (INIS)
Azhgirej, L.S.; Borzunov, Yu.T.; Chernykh, E.V.
1994-01-01
We present results of measurements of the tensor analyzing power T 20 in d p backward elastic scattering at initial deuterons momenta 3.5-6.0 GeV/c, which corresponds to the range of internal momentum of the deuteron constituents k = 0.5 - 0.8 GeV/c. New structure was observed at k = 0.65 GeV/c. Difference between behavior of T 20 for d p backward elastic scattering and for breakup reaction, which have a smooth behavior of T 20 at high k, is discussed. 12 refs.; 3 figs. (author)
Rau, Cheng-Shyuan; Wu, Shao-Chun; Kuo, Pao-Jen; Chen, Yi-Chun; Chien, Peng-Chen; Hsieh, Hsiao-Yun; Hsieh, Ching-Hua
2017-09-11
Background: Polytrauma patients are expected to have a higher risk of mortality than that obtained by the summation of expected mortality owing to their individual injuries. This study was designed to investigate the outcome of patients with polytrauma, which was defined using the new Berlin definition, as cases with an Abbreviated Injury Scale (AIS) ≥ 3 for two or more different body regions and one or more additional variables from five physiologic parameters (hypotension [systolic blood pressure ≤ 90 mmHg], unconsciousness [Glasgow Coma Scale score ≤ 8], acidosis [base excess ≤ -6.0], coagulopathy [partial thromboplastin time ≥ 40 s or international normalized ratio ≥ 1.4], and age [≥70 years]). Methods: We retrieved detailed data on 369 polytrauma patients and 1260 non-polytrauma patients with an overall Injury Severity Score (ISS) ≥ 18 who were hospitalized between 1 January 2009 and 31 December 2015 for the treatment of all traumatic injuries, from the Trauma Registry System at a level I trauma center. Patients with burn injury or incomplete registered data were excluded. Categorical data were compared with two-sided Fisher exact or Pearson chi-square tests. The unpaired Student t -test and the Mann-Whitney U -test was used to analyze normally distributed continuous data and non-normally distributed data, respectively. Propensity-score matched cohort in a 1:1 ratio was allocated using the NCSS software with logistic regression to evaluate the effect of polytrauma on patient outcomes. Results: The polytrauma patients had a significantly higher ISS than non-polytrauma patients (median (interquartile range Q1-Q3), 29 (22-36) vs. 24 (20-25), respectively; p Polytrauma patients had a 1.9-fold higher odds of mortality than non-polytrauma patients (95% CI 1.38-2.49; p polytrauma patients, polytrauma patients had a substantially longer hospital length of stay (LOS). In addition, a higher proportion of polytrauma patients were admitted to the intensive
International Nuclear Information System (INIS)
Pawson, S.; Labitzke, K.; Lenschow, R.; Naujokat, B.; Rajewski, B.; Wiesner, M.; Wohlfart, R.C.
1993-01-01
This work presents a climatology of the northern hemisphere lower and middle stratosphere derived from daily radiosonde observations subjectively analysed in the Stratospheric Research Group of the 'Meteorologisches Institut der Freien Universitaet Berlin'. Previous climatologies from these data were presented by Labitzke (1972), van Loon et al. (1972), and by Labitzke and Goretzki (1982). Although some more recent climatological fields have been presented in several works by members of the group, no complete atlas has been compiled for some time. The work is intended to serve as a reference for people interested in the stratosphere and, particularly, the climate analysis and modelling communities, which require contemporary analyses of the available data in order to interpret their products. In this first part of the climatological atlas, monthly mean data are presented. (orig./KW)
Energy Technology Data Exchange (ETDEWEB)
Pawson, S; Labitzke, K; Lenschow, R; Naujokat, B; Rajewski, B; Wiesner, M; Wohlfart, R C
1933-01-01
This work presents a climatology of the northern hemisphere lower and middle stratosphere derived from daily radiosonde observations subjectively analysed in the Stratospheric Research Group of the 'Meteorologisches Institut der Freien Universitaet Berlin'. Previous climatologies from these data were presented by Labitzke (1972), van Loon et al. (1972), and by Labitzke and Goretzki (1982). Although some more recent climatological fields have been presented in several works by members of the group, no complete atlas has been compiled for some time. The work is intended to serve as a reference for people interested in the stratosphere and, particularly, the climate analysis and modelling communities, which require contemporary analyses of the available data in order to interpret their products. In this first part of the climatological atlas, monthly mean data are presented. (orig./KW)
Rexroth, Ute; Kuhn, Joseph
2017-11-01
Steady changes in society present challenges to constructive cooperation between stakeholders in the diverse PH landscape of Germany through individualism, globalisation, medical progress, digitalisation, etc. Working group 8 therefore suggests that the PH community should build new internal structures, in order to be able to respond jointly to external challenges, facilitate networking amongst the actors and speak with one voice, when needed. The suggestion is to establish an office that has the task to organise further meetings, harmonize written joint statements and moderate the dialogue amongst peers. © Georg Thieme Verlag KG Stuttgart · New York.
Whyte, Michael P; McAlister, William H; Fallon, Michael D; Pierpont, Mary Ella; Bijanki, Vinieth N; Duan, Shenghui; Otaify, Ghada A; Sly, William S; Mumm, Steven
2017-04-01
In 1985, we briefly reported infant sisters with a unique, lethal, autosomal recessive disorder designated congenital sclerosing osteomalacia with cerebral calcification. In 1986, this condition was entered into Mendelian Inheritance In Man (MIM) as osteomalacia, sclerosing, with cerebral calcification (MIM 259660). However, no attestations followed. Instead, in 1989 Raine and colleagues published an affected neonate considering unprecedented the striking clinical and radiographic features. In 1992, "Raine syndrome" entered MIM formally as osteosclerotic bone dysplasia, lethal (MIM #259775). In 2007, the etiology emerged as loss-of-function mutation of FAM20C that encodes family with sequence similarity 20, member C. FAM20C is highly expressed in embryonic calcified tissues and encodes a kinase (dentin matrix protein 4) for most of the secreted phosphoproteome including FGF23, osteopontin, and other regulators of skeletal mineralization. Herein, we detail the clinical, radiological, biochemical, histopathological, and FAM20C findings of our patients. Following premortem tetracycline labeling, the proposita's non-decalcified skeletal histopathology after autopsy indicated no rickets but documented severe osteomalacia. Archival DNA revealed the sisters were compound heterozygotes for a unique missense mutation and a novel deletion in FAM20C. Individuals heterozygous for the missense mutation seemed to prematurely fuse their metopic suture and develop a metopic ridge sometimes including trigonocephaly. Our findings clarify FAM20C's role in hard tissue formation and mineralization, and show that Raine syndrome is congenital sclerosing osteomalacia with cerebral calcification. © 2016 American Society for Bone and Mineral Research. © 2016 American Society for Bone and Mineral Research.
11 CFR 104.20 - Reporting electioneering communications (2 U.S.C. 434(f)).
2010-01-01
... POLITICAL COMMITTEES AND OTHER PERSONS (2 U.S.C. 434) § 104.20 Reporting electioneering communications (2 U... 11 Federal Elections 1 2010-01-01 2010-01-01 false Reporting electioneering communications (2 U.S... electioneering communication is publicly distributed provided that the person making the electioneering...
Microstructure, Porosity and Mechanical Property Relationships of Calcium-Silicate-Hydrate
1991-02-15
synthesized. NaOH or KOH was added at a temperature of -100*C. Barrier (20) obtained chabazite from Na20-AI203-nSiO2 gels with the moles (n) of Si02...337-343 (1978). 19. Kuhl, Natural Zeolites, Springer-Verlag, Berlin Heidelberg, Germany (1985). 20. Barrier , Natural Zeolites, Springer-Verlag... Seefeldt (Eds.), Mat. Res. Soc., Pittsburgh, PA (1987). 28. Hoyle, S. and M.W. Grutzeck, "Effects of Phase Composition on the Cesium Leachability of
Sun, Hemin; Wang, Anqian; Zhai, Jianqing; Huang, Jinlong; Wang, Yanjun; Wen, Shanshan; Zeng, Xiaofan; Su, Buda
2018-05-01
Regional precipitation patterns may change in a warmer climate, thereby increasing flood and drought risks. In this paper, annual, annual maximum, intense, heavy, moderate, light, and trace precipitation are employed as indicators to assess changes in precipitation patterns under two scenarios in which the global mean temperature increases by 1.5 °C and 2.0 °C relative to pre-industrial levels using the regional climate model COSMO-CLM (CCLM). The results show that annual precipitation in China will be approximately 2.5% higher under 1.5 °C warming relative to the present-day baseline (1980-2009), although it will decrease by approximately 4.0% under an additional 0.5 °C increase in global mean temperature. This trend is spatially consistent for regions with annual precipitation of 400-800 mm, which has experienced a drying trend during the past half century; thus, limiting global warming to 1.5 °C may mitigate these drying conditions. The annual maximum precipitation continues to increase from present day levels to the 2.0 °C warming scenario. Relative to the baseline period, the frequency of trace and light precipitation days exhibits a negative trend, while that of moderate, heavy, and intense precipitation days has a positive trend under the 1.5 °C warming scenario. For the 2.0 °C warming world, the frequency of days is projected to decrease for all precipitation categories, although the intensity of intense precipitation increases. Spatially, a decrease in the number of precipitation days is expected to continue in central and northern China, where a drying trend has persisted over the past half century. Southeastern China, which already suffers greatly from flooding, is expected to face more heavy and intense precipitation with an additional 0.5 °C increase in global mean temperature. Meanwhile, the intensity of intense precipitation is expected to increase in northern China, and the contribution of light and moderate precipitation to the annual
Velasco, Edward; Ziegelmann, Antina; Eckmanns, Tim; Krause, Gérard
2012-01-01
To better understand physicians' views on factors of influence for the prescribing of antibiotics and on antibiotic resistance in the Berlin region, Germany. Qualitative study with focus groups. Outpatient care and hospital care practice in the Berlin region, Germany. 7 General practitioners, two urologists, one paediatrician from outpatient care and eight internists, two paediatricians, two ear, nose and throat specialists and two urologists from hospital care. Physicians showed differential interest in topics related to antibiotic prescribing and antibiotic resistance. Outpatient care physicians were interested in topics around their own prescribing, such as being able to diagnose and prescribe precisely, and topics about patient demand and non-compliance. Hospital care physicians were interested in hygiene challenges, limited consult time and multi-resistant pathogens. Physicians considered the development of resistance to be more in the domain of clinical treatment than that of the patient. Major challenges related to antibiotic resistance for this group of physicians are access to and clarity of treatment recommendations, implementation of hygienic measures, as well as increased outsourcing of laboratory services. Results raise questions about whether meeting physicians' expectations should be a focus when developing intervention that aims to influence antibiotic resistance in this and other areas of Germany.
DFT study of small fullerene dimer complexes C_2_0-N_m@C_n (m = 1-6 and n = 24, 28, 32, 36 and 40)
International Nuclear Information System (INIS)
Kaur, Sandeep; Sharma, Amrish; Mudahar, Isha
2016-01-01
First principle calculations based on density functional theory were performed to calculate the structural and electronic properties of C_2_0-N_m@C_n dimer complexes. The calculated binding energies of the complexes formed are comparable to C_6_0 dimer which ensures their stability. The bond lengths of these dimer complexes were found to be nearly same as pure complexes C_2_0-C_n. Further, nitrogen (N) atoms were encapsulated inside the secondary cage (C_n) of dimer complexes and the number of N atoms depends on diameter of the cage. The HOMO-LUMO gaps of new proposed complexes indicate the increase in gap as compared to pure complexes. Mulliken charge analysis of these complexes has been studied which shows the significant charge transfer from the N atoms to the secondary cage of these complexes. The study propose the formation of the new dimer complexes which are stable and are able to encapsulate atoms which are otherwise reactive in free space.
von Hoffen, Laura Pauline; Säumel, Ina
2014-03-01
Today's urban gardening focuses mainly on vegetable production and rarely includes fruit trees. Health effects of consuming urban crops are questioned due to high local pollution loads. Here, we determined cadmium and lead content in the edible parts of nuts, berries, pome, and stone fruits harvested from fruit trees and shrubs within inner city neighbourhoods of Berlin, Germany. We analysed how local settings at sampling sites shaped the trace metal content. We revealed significant differences in trace metal content depending on species, fruit type, local traffic, and parameters related to barriers between the sampling site and neighbouring roads. Higher overall traffic burden and proximity to roads increased whereas buildings or vegetation as barriers reduced trace metal content in the edible biomass. We demonstrate, that the consumption of non-vegetable fruits growing in inner city sites in Berlin does not pose a risk on human health as long as the fruits are thoroughly washed and it is provided that site pollutions and impacts are considered in garden concepts and guidelines. © 2013 Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Süleyman Durmaz
2012-03-01
Full Text Available Objectives: In the present study, it was aimed to compare results obtained by using VITEK 2 YST Card (bioMérieux, France with those obtained by using API 20C AUX (bioMérieux, France for identification of non- albicans Candida species, which was isolated from various clinical samples, at level of species.Materials and methods: Forty-one non-albicans Candida isolates, which were isolated from 28 urine, 10 blood and 3 vaginal swab specimens, and found to be negative by germ tube test, were identified by using VITEK 2 YST Card (bioMérieux, France. In addition, microscopic morphology was assessed in corn-meal Tween 80 agar, while carbohydrate assimilation was assessed by using commercially available API 20C AUX kit (bioMérieux, France.Results: Thirty-four isolates (82.9% were identified as identical species by these 2 systems, while different results were obtained in 7 isolates (17.1%. 5 isolates, identified as Candida glabrata by API 20C AUX system, were identified as Candida tropicalis (n=2, Candida krusei, Candida lipolitica and Candida kefyr by VITEK 2 YST Card. One other isolate, identified as C.tropicalis, was identified as Candida parapsilosis; and additional one isolate, identified as C.parapsilosis, was identified as C.tropicalis.Conclusion: It was concluded that one should be cautious in the identification of C.glabrata, in particular, C.tropicalis and C.parapsilosis, although between VITEK 2 YST Card and API 20C AUX system results was found largely similarity in identification of non-albicans Candida spp.
Kornelia Hagen
2012-01-01
Dokumentiert wird der Austausch über das Riester-Sparen, der auf dem Workshop des DIW Berlin stattfand. Teilnehmer dieser Veranstaltung waren Wissenschaftler sowie Vertreter aus Wirtschaft und Politik. Die Gespräche fanden entlang von Vorträgen statt. Kontrovers diskutiert wurde über die Förderung, über Auswirkungen der Freiwilligkeit und eines Obligatoriums der privaten Altersvorsorge, über die Akzeptanz des Riester-Sparens unter Geringverdienern, die Transparenz, Kalkulation und Rendite der...
Patricios, Jon S; Hislop, Michael David; Aubry, Mark; Bloomfield, Paul; Broderick, Carolyn; Clifton, Patrick; Ellenbogen, Richard G; Falvey, Éanna Cian; Grand, Julie; Hack, Dallas; Harcourt, Peter Rex; Hughes, David; McGuirk, Nathan; Meeuwisse, Willem; Miller, Jeffrey; Parsons, John T; Richiger, Simona; Sills, Allen; Moran, Kevin B; Shute, Jenny; Raftery, Martin
2018-01-01
The 2017 Berlin Concussion in Sport Group Consensus Statement provides a global summary of best practice in concussion prevention, diagnosis and management, underpinned by systematic reviews and expert consensus. Due to their different settings and rules, individual sports need to adapt concussion guidelines according to their specific regulatory environment. At the same time, consistent application of the Berlin Consensus Statement’s themes across sporting codes is likely to facilitate superior and uniform diagnosis and management, improve concussion education and highlight collaborative research opportunities. This document summarises the approaches discussed by medical representatives from the governing bodies of 10 different contact and collision sports in Dublin, Ireland in July 2017. Those sports are: American football, Australian football, basketball, cricket, equestrian sports, football/soccer, ice hockey, rugby league, rugby union and skiing. This document had been endorsed by 11 sport governing bodies/national federations at the time of being published. PMID:29500252
Energy Technology Data Exchange (ETDEWEB)
Anon.
1996-08-01
More than 700 attendants from 45 countries, 140 technical lectures, 6 plenary lectures, 220 poster presentations, 18 exhibitors from sectors such as high-performance electrolysis for hydrogen generation, fuel cells, hydrogen-powered motor cars and hydrogen filling stations - such is, in a few numbers, the statistics of the Hydrogen `96 Conference. The 11th world conference on energy from hydrogen took place in Stuttgart from 23 to 28 June 1996. The event was opened by Dr. Angela Merkel, the federal German minister for environmental affairs, nature conservancy and reactor safety. The organization of the conference was taken care of by DECHEMA (Deutsche Gesellschaft fuer Chemisches Apparatewesen, Chemische Technik und Biotechnologie), Frankfurt, who were assisted by experienced partners. To mention only a few: Deutsche Forschungsgesellschaft fuer Luft- und Raumfahrt, the VDI Energietechnik Society, the Center for Solar Energy and Hydrogen Research, and the European Federation of Chemical Engineering. (orig.) [Deutsch] Mehr als 700 Teilnehmer aus 45 Laendern, 140 Fachvortraege, 6 Plenarvortraege, 220 Posterpraesentationen, dazu 18 Aussteller aus Bereichen, wie Hochleistungselektrolysen zur Wasserstofferzeugung, Brennstoffzellen, wasserstoffgetriebene Autos und Tankstellen fuer Wasserstoff, das ist, in wenigen Zahlen aufgelistet, die Tagungsstatistik der Hydrogen `96. Die 11. Welt-Wasserstoffenergie-Konferenz fand vom 23. bis 28. Juni 1996 in Stuttgart statt. Eroeffnet wurde die Veranstaltung von der Bundesministerin fuer Umwelt, Naturschutz und Reaktorsicherheit, Dr. Angela Merkel. Die organisatorische Kompetenz lag bei der DECHEMA, der Deutschen Gesellschaft fuer Chemisches Apparatewesen, Chemische Technik und Biotechnologie in Frankfurt, die bei der Vorbereitung der Konferenz auf bewaehrte Partner zurueckgreifen konnte. Genannt seien nur die Deutsche Forschungsgesellschaft fuer Luft- und Raumfahrt, die VDI-Gesellschaft Energietechnik, das Zentrum fuer Sonnenenergie
Energy Technology Data Exchange (ETDEWEB)
Schubert, Sebastian; Grossmann-Clarke, Susanne [Potsdam Institute for Climate Impact Research, Potsdam (Germany)
2013-04-15
The mesoscale atmospheric model COSMO-CLM (CCLM) with the Double Canyon Effect Parametrization Scheme (DCEP) is applied to investigate possible adaption measures to extreme heat events (EHEs) for the city of Berlin, Germany. The emphasis is on the effects of a modified urban vegetation cover and roof albedo on near-surface air temperatures. Five EHEs with a duration of 5 days or more are identified for the period 2000 to 2009. A reference simulation is carried out for each EHE with current vegetation cover, roof albedo and urban canopy parameters (UCPs), and is evaluated with temperature observations from weather stations in Berlin and its surroundings. The derivation of the UCPs from an impervious surface map and a 3-D building data set is detailed. Characteristics of the simulated urban heat island for each EHE are analysed in terms of these UCPs. In addition, six sensitivity runs are examined with a modified vegetation cover of each urban grid cell by -25%, 5% and 15%, with a roof albedo increased to 0.40 and 0.65, and with a combination of the largest vegetation cover and roof albedo, respectively. At the weather stations' grid cells, the results show a maximum of the average diurnal change in air temperature during each EHE of 0.82 K and -0.48 K for the -25% and 15% vegetation covers, -0.50 K for the roof albedos of 0.65, and -0.63 K for the combined vegetation and albedo case. The largest effects on the air temperature are detected during midday. (orig.)
Belaghzal, Houda; Dekker, Job; Gibcus, Johan H
2017-07-01
Chromosome conformation capture-based methods such as Hi-C have become mainstream techniques for the study of the 3D organization of genomes. These methods convert chromatin interactions reflecting topological chromatin structures into digital information (counts of pair-wise interactions). Here, we describe an updated protocol for Hi-C (Hi-C 2.0) that integrates recent improvements into a single protocol for efficient and high-resolution capture of chromatin interactions. This protocol combines chromatin digestion and frequently cutting enzymes to obtain kilobase (kb) resolution. It also includes steps to reduce random ligation and the generation of uninformative molecules, such as unligated ends, to improve the amount of valid intra-chromosomal read pairs. This protocol allows for obtaining information on conformational structures such as compartment and topologically associating domains, as well as high-resolution conformational features such as DNA loops. Copyright © 2017 Elsevier Inc. All rights reserved.
Rearticulating the Experience of War in Anonyma: Eine Frau in Berlin
Directory of Open Access Journals (Sweden)
Holger Pötzsch
2012-10-01
Full Text Available Situating itself in the field of cultural memory studies, this article traces the slow emergence in German historical discourse of the narrative of an anonymous German woman who survived the Soviet occupation of Berlin in 1945. I will, firstly, conceptualize the historical condition of the Anonyma as a precarious liminal sphere of transition between competing sovereignties that dislodged her political status as citizen and reconstituted her as bare life in the sense of Agamben. Secondly, I direct focus to the relationship between the personal story of the Anonyma and a historical Master narrative pertaining to the period. The article argues for a close connection between the woman’s form of resistance that aimed at replacing unchecked rape with a form of coerced prostitution to reassert limited control over the borders of her body, and the negative reception her diary received after a first publication in Germany in 1959. Her story implicitly challenges a hegemonic discourse of war that treats mass rape as mainly an assault on the nation’s male defenders and that silences the victims’ traumatic experiences with reference to collective guilt and individual shame or treason.
Westerhof, Gerben J; Keyes, Corey L M
2006-09-01
This study empirically tested the self-systems theory of subjective change in light of the rapid change after the fall of the Berlin Wall. The theory predicts that individuals have a tendency to perceive stability and that perceived stability exerts a strong positive effect on subjective well-being. We would expect perceptions of decline and, to a lesser extent, perceptions of improvement to be related to lower levels of subjective well-being. Data were from respondents aged 40-85 years who participated in the German Aging Survey. We used measures of well-being and temporal comparisons during the past 10 years (1986-1996). West Germans reported more stability than East Germans, in particular in the public domain and in older age groups. Compared with perceptions of stability, perceptions of decline were related to less life satisfaction and more negative affect, and perceptions of growth to more negative affect. Temporal comparisons were unrelated to positive affect. Our findings both confirm and reject the self-systems theory of subjective change as it relates to the fall of the Berlin Wall. Studying temporal comparisons is important in understanding the effects of historical events and their timing within an individual life course.
The level structure of 13C around Esub(x)=20 MeV studied by polarised neutron scattering from 12C
International Nuclear Information System (INIS)
Tornow, W.; Woye, E.
1987-01-01
Analysing-power data for elastic scattering of neutrons from 12 C have been obtained at selected angles in small energy steps between incident energies of 15.55 and 17.35 MeV. The excitation energy, spin and parity of levels in 13 C have been determined for excitation energies around 20 MeV via a phase-shift analysis of these data and of previously measured n- 12 C total cross section data. In addition, an auxiliary phase-shift analysis has been performed in the neutron energy range from 12 to 15 MeV. All experimental data are well reproduced by the phase shifts obtained. The need for further experimental data is pointed out. (author)
Directory of Open Access Journals (Sweden)
Deodoro Magno Brighenti
2005-02-01
Full Text Available Objetivou-se avaliar a eficiência do Bacillus thuringiensis var. kurstaki (Berliner no controle de Galleria mellonella (Linnaeus. Os experimentos foram realizados no Laboratório de Biologia de Insetos do Departamento de Entomologia da Universidade Federal de Lavras - UFLA, Lavras, MG, a 28±2ºC, UR 70±10% e fotofase de 12 horas. Aplicou-se formulação comercial de B. thuringiensis var. kurstaki por meio de pulverização, imersão dos favos e também foi incorporada à dieta artificial fornecida às lagartas de terceiro ínstar da traça da cera. A aplicação do produto fitossanitário por meio da pulverização dos favos mostrou-se eficiente no controle de lagartas, atingindo níveis iguais ou superiores a 85% de mortalidade quando foram utilizados 5 g/100 mL de água. Na aplicação por imersão dos favos, todas as dosagens testadas foram eficientes atingindo até 100% de mortalidade. Adicionada à dieta artificial, a concentração com maior porcentagem de mortalidade foi de 10g/60g de dieta. Sintomas de infecção pelo B. thuringiensis foram identificados nas lagartas e o isolamento da bactéria, por meio de uma cultura de Bacillus, comprovou a causa da morte desses insetos em todas as dosagens da formulação comercial do B. thuringiensis var. kurstaki utilizadas.This research aim at evaluating the efficiency of Bacillus thruringiensis var. kurstaki (Berliner in the control of Galleria mellonella (Linnaeus.The experiments were conducted in the Insect Biology Laboratory of the Entomology Department of the Universidade Federal de Lavras - UFLA, Lavras, MG, Brazil, at 28±2ºC, RH 70±10% and 12-hour photophase. Commercial formulation of B. thuringiensis. var. kurstaki was applied through spraying, comb soaking and also incorporated into the artificial diet fed to third instar caterpillars of the greater wax moth. Application of B. thuringiensis var. kurstaki through the spraying of the combs was efficient for control, reaching levels
Berlin and nuclear power. Courage to assume responsibility?
International Nuclear Information System (INIS)
Knorr, Juergen
2009-01-01
On October 28, 2009, the Kerntechnische Gesellschaft e.V. (KTG) awarded to Professor Dr. Juergen Knorr its 32 nd honorary membership in recognition of his untiring commitment and his decades of work for the peaceful uses of, and research into, nuclear power in Germany. Between 1992 and 2006 the scientist, now retired, held the Nuclear Power Technology chair at the Technical University of Dresden and, temporarily, also headed the university's Institute for Power Technology at the same time. From 1990, Professor Knorr was a member of the Executive Board of the Kerntechnische Gesellschaft; he was KTG Chairman between 1993 and 2000. At the same time and beyond, until 2005, Professor Knorr was a member also of the Board of the Deutsches Atomforum. At the awarding ceremony in Berlin on October 28, KTG Chairman Dr. Helmut Blaesig welcomed the fact that, on the basis of the coalition agreement of CDU, CSU and FDP, the new federal government 'had clearly recognized the advantages of nuclear power.' It appreciated the safety of German plants and, in addition to the non-polluting characteristics due to CO 2 emissions saved and the security of supply, also the economic benefit of electricity generation from nuclear power. This supported the German economy in a situation which continued to be difficult. In his vote of thanks for the 32 nd honorary membership of KTG, Professor Knorr emphasized what he considered a key expectation of the re-evaluation of nuclear power by the new federal government: Creating framework conditions for a societal consensus that fair competition among conventional, renewable and nuclear power technologies will give rise to an optimum mix enabling sustainable development to be achieved. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Kerz, Nicolas; Rietz, Andreas [Bundesinstitut fuer Bau-, Stadt- und Raumforschung (BBSR), Berlin (Germany)
2011-07-01
Numerous research projects funded by the Federal Ministry of Transport, Building and Urban Development (Berlin, Federal Republic of Germany) are the essential basis for the emergence of a systematic sustainability assessment. After two years of cooperation with the German Sustainable Building Council (Stuttgart, Federal Republic of Germany) a scientifically substantiated and design based process of evaluation for the construction of administrative buildings was available. On the basis of a practical testing the system of evaluating of sustainability was refined to a ''rating system for sustainable building''. The contribution under consideration reports on the structure and methodology of this evaluation system as well as on working materials and tools for planning and evaluation.
Marsh, Herbert W.; Koller, Olaf
2004-01-01
Longitudinal data (five waves) from large cohorts of 7th grade students in East Germany ("n"=2,119) and West Germany ("n"=1,928) were collected from the start of the reunification of the school systems following the fall of the Berlin Wall. Here we integrate the two major theoretical models of relations between academic…
International Nuclear Information System (INIS)
Kaga, Motoaki; Iwata, Tomoyuki; Nakano, Hiromi; Fukuda, Koichiro
2010-01-01
A new quaternary layered oxycarbide, [Al 4.39(5) Si 0.61(5) ] Σ5 [O 1.00(2) C 2.00(2) ] Σ3 C, has been synthesized and characterized by X-ray powder diffraction, transmission electron microscopy and energy dispersive X-ray spectroscopy (EDX). The title compound was found to be hexagonal with space group P6 3 /mmc, Z=2, and unit-cell dimensions a=0.32783(1) nm, c=2.16674(7) nm and V=0.20167(1) nm 3 . The atom ratios Al:Si were determined by EDX, and the initial structural model was derived by the direct methods. The final structural model showed the positional disordering of one of the three types of Al/Si sites. The maximum-entropy methods-based pattern fitting (MPF) method was used to confirm the validity of the split-atom model, in which conventional structure bias caused by assuming intensity partitioning was minimized. The reliability indices calculated from the MPF were R wp =3.73% (S=1.20), R p =2.94%, R B =1.04% and R F =0.81%. The crystal was an inversion twin. Each twin-related individual was isostructural with Al 4 SiC 4 (space group P6 3 mc, Z=2). - Graphical abstract: A new oxycarbide discovered in the Al-Si-O-C system, Al 4 SiC 4 -homeotypic [Al 4.4 Si 0.6 ][O 1.0 C 2.0 ]C. The crystal is an inversion twin, and hence the structure is represented by a split-atom model. The three-dimensional electron density distributions are determined by the maximum-entropy methods-based pattern fitting, being consistent with the disordered structural model.
Directory of Open Access Journals (Sweden)
Lihong He
2012-06-01
Full Text Available An expressed sequence tag (EST obtained from a subtractive-suppression hybridization cDNA library constructed using Catharanthus roseus cell line C20hi and its parental cell line C20D was used to clone a full-length cytochrome P450 cDNA of cyp71d1. The encoded polypeptide contained 507 amino acids with 39–56% identity to other CYP71D subfamily members at the amino acid level. Expression characteristics of cyp71d1 were determined using semi-quantitative RT-PCR. The cyp71d1 transcript was expressed in all three cell lines with the highest level in the cell line C20hi. In the mature C. roseus plant, the cyp71d1 cDNA was highly expressed in petals, roots and stems, but very weakly expressed in young leaves. Its transcription level increased with the development of flowers. 2,4-D could down-regulate the transcription of cyp71d1, as did KT, but only to a minor degree. Neither light nor yeast elicitor could induce the transcription of cyp71d1.
Fractomechanical Properties of As-Cast and Austempered SG Cast Iron Between -40 °C and +20 °C
Directory of Open Access Journals (Sweden)
V.E. Fierro
2002-06-01
Full Text Available The spheroidal graphite (SG cast iron fractomechanical response varies with the test temperature and with the microstructure parameters. In the present paper, we analyze this variation performing fractomechanical tests in a temperature range from -40°C to +20°C, doing also Charpy and tensile tests for material characterization. The tests were carried out on as-cast samples and heat treated samples to obtain an ADI grade 1. In both cases, we studied samples taken from two well differentiated "Y" block sizes. The results obtained show that, for the chemical composition analyzed, both castings have a fractomechanical response decrease as the temperature diminishes. Besides, the block size enlargement produce a deterioration of the mechanical properties (the fracture toughness, mainly, for both castings.
Objective: A discrepancy exists between the preferred ambient temperature range for mice (26 to 32°C) and the current recommendations (20 to 26°C) that can result in mild hypothermia. As a consequence, animal welfare may be reduced and physiological state can be altered, which can impact research ...
The urban land use in the COSMO-CLM model: a comparison of three parameterizations for Berlin
Directory of Open Access Journals (Sweden)
Kristina Trusilova
2016-05-01
Full Text Available The regional non-hydrostatic climate model COSMO-CLM is increasingly being used on fine spatial scales of 1–5 km. Such applications require a detailed differentiation between the parameterization for natural and urban land uses. Since 2010, three parameterizations for urban land use have been incorporated into COSMO-CLM. These parameterizations vary in their complexity, required city parameters and their computational cost. We perform model simulations with the COSMO-CLM coupled to these three parameterizations for urban land in the same model domain of Berlin on a 1-km grid and compare results with available temperature observations. While all models capture the urban heat island, they differ in spatial detail, magnitude and the diurnal variation.
Measures of social segregation in the context of Warsaw, Berlin and Paris metropolitan areas
Directory of Open Access Journals (Sweden)
Grzegorczyk Anna
2015-09-01
Full Text Available Social segregation is a subject common in contemporary studies of metropolitan areas. Until recently, studies of segregation focused on the distribution of ethnic groups, immigrants, and the poor. Today, they also cover additional indicators such as demographic properties, education, and affiliation with social and professional categories, which can also serve to determine the causes of the segregation (including the self-segregation of the rich. This article aims to point out the measures of segregation that present the segregation levels in the most complete manner, along with their application in the context of three European metropolitan areas: Warsaw, Berlin, and Paris. The first part of the article is a review of the existing approaches to segregation measures, followed by the selection of research method, presentation of the analysis’ results, and evaluation of the applied methods; presenting the opportunities and limitations in research of the social segregation phenomenon.
Reiss, Katharina; Breckenkamp, Jürgen; Borde, Theda; Brenne, Silke; David, Matthias; Razum, Oliver
2015-10-01
Maternal excessive weight and smoking are associated with an increased risk of pregnancy complications and adverse pregnancy outcomes. In Germany, immigrant women have a higher prevalence of pre-pregnancy overweight/obesity compared with autochthonous women. We compared the contribution of pre-pregnancy overweight/obesity to adverse pregnancy outcomes among immigrant and autochthonous women in Berlin/Germany. Data from 2586 immigrant women (from Turkey, Lebanon, other countries of origin) and 2676 autochthonous women delivering in three maternity hospitals of Berlin within 12 months (2011/2012) was used. Cox regression models were applied to estimate the association between overweight/obesity and smoking with the outcomes large-for-gestational-age (LGA), small-for-gestational-age (SGA), preterm birth (PTB) and extreme preterm-birth (E-PTB). Population attributive fractions (PAF) were calculated to quantify the proportion of the outcomes attributable to overweight/obesity and smoking, respectively. Prevalence of overweight and obesity was 33.4% among autochthonous and 53.6% among Turkish women. Prevalence risk ratios of excessive weight were highest for LGA infants among immigrant and autochthonous women. The PAFs were -11.8% (SGA), +16.3% (LGA), +3.6% (PTB) and +16.5% (E-PTB) for the total study population. Overweight/obesity is strongly associated with an increased risk of delivering an LGA infant among both immigrant and autochthonous women. Compared with autochthonous women, the contribution of excessive weight to LGA is even higher among immigrant women, in whom PAFs of overweight/obesity even exceed those of smoking for some outcomes. © The Author 2015. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
NONE
2013-05-01
The Fachagentur Nachwachsende Rohstoffe e.V. (Guelzow, Federal Republic of Germany) presents an survey on the thematically widespread field of 'Renewable resources in Germany'. The main part of this magazine includes a specialist article of a guest author as well as a report to the main sub-themes: bio-energy, material use, and some superior aspects. The last part of this magazine is devoted to the Fachagentur Nachwachsende Rohstoffe e.V. and its history of origin, its structure and tasks in the course of time. A survey by the Federal Ministry of Food, Agriculture and Consumer Protection (Berlin, Federal Republic of Germany) completes this topic.
Energy Technology Data Exchange (ETDEWEB)
Tornow, W.; Woye, E.; Walter, R.L.
1987-02-01
Analysing-power data for elastic scattering of neutrons from /sup 12/C have been obtained at selected angles in small energy steps between incident energies of 15.55 and 17.35 MeV. The excitation energy, spin and parity of levels in /sup 13/C have been determined for excitation energies around 20 MeV via a phase-shift analysis of these data and of previously measured n-/sup 12/C total cross section data. In addition, an auxiliary phase-shift analysis has been performed in the neutron energy range from 12 to 15 MeV. All experimental data are well reproduced by the phase shifts obtained. The need for further experimental data is pointed out.
Collagen Type III and VI Turnover in Response to Long-Term Immobilization
DEFF Research Database (Denmark)
Sun, Shu; Henriksen, Kim; Karsdal, Morten A
2015-01-01
with immobilization and/or remobilization. METHODS: In the Berlin bed rest study, 20 young men were recruited and randomly assigned to 8-week's strict bed rest with or without resistive vibration exercise countermeasure. We measured three neo-epitope ELISA kits in the serum samples of this study: Pro-C3, measured...... to unloading or reloading, whereas C6M does not appear to respond to unloading. Pro-C3 and C6M levels correlate with LBM at baseline, while Pro-C6 is related to the anabolic and catabolic responses to unloading and reloading....
Su, Buda; Jian, Dongnan; Li, Xiucang; Wang, Yanjun; Wang, Anqian; Wen, Shanshan; Tao, Hui; Hartmann, Heike
2017-11-01
Actual evapotranspiration (ETa) is an important component of the water cycle. The goals for limiting global warming to below 2.0 °C above pre-industrial levels and aspiring to 1.5 °C were negotiated in the Paris Agreement in 2015. In this study, outputs from the regional climate model COSMO-CLM (CCLM) for the Tarim River basin (TRB) were used to calculate ETa with an advection-aridity model, and changes in ETa under global warming scenarios of 1.5 °C (2020 to 2039) and 2.0 °C (2040 to 2059) were analyzed. Comparison of warming at the global and regional scale showed that regional 1.5 °C warming would occur later than the global average, while regional 2.0 °C warming would occur earlier than the global average. For global warming of 1.5 °C, the average ETa in the TRB is about 222.7 mm annually, which represents an increase of 6.9 mm relative to the reference period (1986-2005), with obvious increases projected for spring and summer. The greatest increases in ETa were projected for the northeast and southwest. The increment in the annual ETa across the TRB considering a warming of 1.5 °C was 4.3 mm less than that for a warming of 2.0 °C, and the reduction between the two levels of warming was most pronounced in the summer, when ETa was 3.4 mm smaller. The reduction in the increment of annual ETa for warming of 1.5 °C relative to warming of 2.0 °C was most pronounced in the southwest and northeast, where it was projected to be 8.2 mm and 9.3 mm smaller, respectively. It is suggested that the higher ETa under a warming of 2.0 °C mainly results from an increase in the sunshine duration (net radiation) in the southwestern basin and an increase in precipitation in the northeastern basin. Vapor is removed from the limited surface water supplies by ETa. The results of this study are therefore particularly relevant for water resource planning in the TRB.
Cystatin C a marker for renal function after exercise.
Mingels, A; Jacobs, L; Kleijnen, V; Wodzig, W; Dieijen-Visser, M van
2009-09-01
Renal impairment is common during and after severe exercise. In clinical practice, renal function is evaluated using serum creatinine, urine parameters, and equations to estimate the Glomular Filtration Rate (GFR). However, creatinine levels may be biased by skeletal muscle damage and the GFR equations, requiring age, gender and body weight, are shown to be inadequate in normals. In the present study, we show that serum cystatin C and creatinine concentrations were elevated after marathon running in 26% and 46% of the 70 recreational male runners, respectively, possibly because of reduction in renal blood flow. The mean cystatin C increase was twice as low as compared to creatinine (21% and 41%, respectively), suggesting that cystatin C is indeed less biased by muscle damage. Future research has to reveal whether training diminishes the elevation in renal markers. Overall, cystatin C seems a more reliable method to establish renal function during and after extensive exercise. Georg Thieme Verlag KG Stuttgart.
Directory of Open Access Journals (Sweden)
P. Mieth
2004-09-01
Full Text Available We report the sensitivity of the Berlin Climate Middle Atmosphere Model (CMAM to different gravity-wave (GW parameterisations. We perform five perpetual January experiments: 1 Rayleigh friction (RF (control, 2 non-orographic GWs, 3 orographic GWs, 4 orographic and non-orographic GWs with no background stress, and 5 as for 4 but with background stress. We also repeat experiment 4 but for July conditions. Our main aim is to improve the model climatology by introducing orographic and non-orographic parameterisations and to investigate the individual effect of these schemes in the Berlin CMAM. We compare with an RF control to determine the improvement upon a previously-published model version employing RF. Results are broadly similar to previously-published works. The runs having both orographic and non-orographic GWs produce a statistically-significant warming of 4-8K in the wintertime polar lower stratosphere. These runs also feature a cooling of the warm summer pole in the mesosphere by 10-15K, more in line with observations. This is associated with the non-orographic GW scheme. This scheme is also associated with a heating feature in the winter polar upper stratosphere directly below the peak GW-breaking region. The runs with both orographic and non-orographic GWs feature a statistically-significant deceleration in the polar night jet (PNJ of 10-20ms-1 in the lower stratosphere. Both orographic and non-orographic GWs individually produce some latitudinal tilting of the polar jet with height, although the main effect comes from the non-orographic waves. The resulting degree of tilt, although improved, is nevertheless still weaker than that observed. Accordingly, wintertime variability in the zonal mean wind, which peaks at the edge of the vortex, tends to maximise too far polewards in the model compared with observations. Gravity-planetary wave interaction leads to a decrease in the amplitudes of stationary planetary waves 1 and 2 by up to 50% in
Directory of Open Access Journals (Sweden)
P. Mieth
2004-09-01
Full Text Available We report the sensitivity of the Berlin Climate Middle Atmosphere Model (CMAM to different gravity-wave (GW parameterisations. We perform five perpetual January experiments: 1 Rayleigh friction (RF (control, 2 non-orographic GWs, 3 orographic GWs, 4 orographic and non-orographic GWs with no background stress, and 5 as for 4 but with background stress. We also repeat experiment 4 but for July conditions. Our main aim is to improve the model climatology by introducing orographic and non-orographic parameterisations and to investigate the individual effect of these schemes in the Berlin CMAM. We compare with an RF control to determine the improvement upon a previously-published model version employing RF. Results are broadly similar to previously-published works. The runs having both orographic and non-orographic GWs produce a statistically-significant warming of 4-8K in the wintertime polar lower stratosphere. These runs also feature a cooling of the warm summer pole in the mesosphere by 10-15K, more in line with observations. This is associated with the non-orographic GW scheme. This scheme is also associated with a heating feature in the winter polar upper stratosphere directly below the peak GW-breaking region. The runs with both orographic and non-orographic GWs feature a statistically-significant deceleration in the polar night jet (PNJ of 10-20ms-1 in the lower stratosphere. Both orographic and non-orographic GWs individually produce some latitudinal tilting of the polar jet with height, although the main effect comes from the non-orographic waves. The resulting degree of tilt, although improved, is nevertheless still weaker than that observed. Accordingly, wintertime variability in the zonal mean wind, which peaks at the edge of the vortex, tends to maximise too far polewards in the model compared with observations. Gravity-planetary wave interaction leads to a decrease in the amplitudes of stationary planetary waves 1 and 2 by
Structures in 20O from the 14C(7Li, p) reaction at 44 MeV
International Nuclear Information System (INIS)
Bohlen, H.G.; Oertzen, W. von; Kokalova, T.; Wheldon, C.; Milin, M.; Dorsch, T.; Kruecken, R.; Faestermann, T.; Mahgoub, M.; Hertenberger, R.; Wirth, H.F.
2011-01-01
We have studied the multi-nucleon transfer reaction 14 C( 7 Li, p) at E Lab ( 7 Li) = 44 MeV populating states of the neutron-rich oxygen isotope 20 O. The experiments have been performed at the Munich Tandem accelerator using the high-resolution Q3D magnetic spectrometer, with an overall energy resolution of 45keV. States were populated up to 20MeV excitation energy -65 states have been identified in the analysis, among which 42 are new. Rotational bands are proposed in terms of underlying intrinsic reflection-asymmetric cluster and prolate molecular structures (namely 14 C x 2n x α) as parity doublet bands. A rectangular oblate structure is suggested for some very narrow states at high excitation energies. (orig.)
Lindenberger, U; Baltes, P B
1997-09-01
This study documents age trends, interrelations, and correlates of intellectual abilities in old and very old age (70-103 years) from the Berlin Aging Study (N = 516). Fourteen tests were used to assess 5 abilities: reasoning, memory, and perceptual speed from the mechanic (broad fluid) domain and knowledge and fluency from the pragmatic (broad crystallized) domain. Intellectual abilities had negative linear age relations, with more pronounced age reductions in mechanic than in pragmatic abilities. Interrelations among intellectual abilities were highly positive and did not follow the mechanic-pragmatic distinction. Sociobiographical indicators were less closely linked to intellectual functioning than sensory-sensorimotor variables, which predicted 59% of the total reliable variance in general intelligence. Results suggest that aging-induced biological factors are a prominent source of individual differences in intelligence in old and very old age.
Cluster-surface collisions: Characteristics of Xe55- and C20 - Si[111] surface bombardment
International Nuclear Information System (INIS)
Cheng, H.
1999-01-01
Molecular dynamics (MD) simulations are performed to study the cluster-surface collision processes. Two types of clusters, Xe 55 and C 20 are used as case studies of materials with very different properties. In studies of Xe 55 - Si[111] surface bombardment, two initial velocities, 5.0 and 10.0 km/s (normal to the surface) are chosen to investigate the dynamical consequences of the initial energy or velocity in the cluster-surface impact. A transition in the speed of kinetic energy propagation, from subsonic velocities to supersonic velocities, is observed. Energy transfer, from cluster translational motion to the substrate, occurs at an extremely fast rate that increases as the incident velocity increases. Local melting and amorphous layer formation in the surfaces are found via energetic analysis of individual silicon atoms. For C 20 , the initial velocity ranges from 10 to 100 km/s. The clusters are damaged immediately upon impact. Similar to Xe 55 , increase in the potential energy is larger than the increase in internal kinetic energy. However, the patterns of energy distribution are different for the two types of clusters. The energy transfer from the carbon clusters to Si(111) surface is found to be slower than that found in the Xe clusters. Fragmentation of the carbon cluster occurs when the initial velocity is greater than 30 km/s. At 10 km/s, the clusters show recrystallization at later times. The average penetration depth displays a nonlinear dependence on the initial velocity. Disturbance in the surface caused by C 20 is discussed and compared to the damage caused by Xe 55 . Energetics, structures, and dynamics of these systems are fully analyzed and characterized. copyright 1999 American Institute of Physics
van den Berg, Rosaline; de Hooge, Manouk; Rudwaleit, Martin; Sieper, Joachim; van Gaalen, Floris; Reijnierse, Monique; Landewé, Robert; Huizinga, Tom; van der Heijde, Désirée
2013-01-01
Objective To compare the original Berlin algorithm for diagnosing axial Spondyloarthritis (axSpA) with two modifications in the SPondyloArthritis Caught Early (SPACE)-cohort and the Assessment of SpondyloArthritis international Society (ASAS) axSpA criteria validation (ASAS)-cohort. Methods Patients
Energy Technology Data Exchange (ETDEWEB)
Blume, H.P.; Schleuss, U. [eds.
1997-12-31
The research project `Evaluation of Anthropogenic Urban Soils` was subsidized by the German Federal Ministry of Education, Science, Research and Technology and adviced by the working group `Stadtboeden` of the German Society of Soil Science. It was realized as a cooperation between the universities of Berlin (TU), Halle-Wittenberg, Hohenheim, Kiel and Rostock and had three objectives: - to characterize soils developed from anthropogenic substratums (`urban soils`), - to figure out distribution patterns of such soils and - to verify whether urban soils could be evaluated according to their filtering and habitat function in the same way as soils developed from natural parent material. Evaluation methods based on easily obtainable field data had to be adapted to `urban soils` respectively developed anew. For that reason some typical soils of anthropogenic lithogenesis had to be examined between 1993 and 1996 both on their importance as habitats for plants and soil organisms and on their filtering, buffering and transforming capacities for organic and inorganic pollutants. Accordingly representative `urban soils` were gathered in the towns of Berlin, Eckernfoerde, Essen, Halle, Kiel, Rostock and Stuttgart; these soils had developed from technogenic substratums (brick and mortar debris, municipal waste, ashes, slag, sludge) and redeposited alkaline resp. acidic natural substratums (mud, coal mine and coking plant deposits). Some of the soils were influenced by ground water, and all soils developed from the same kind of parent material belonged to different stages of development. (orig./SR) [Deutsch] Ziele des vom BMBF gefoerderten und vom Arbeitskreis Stadtboeden der Deutschen Bodenkundlichen Gesellschaft beratenen Verbundprojektes `Bewertung anthropogener Stadtboeden` waren die Charakterisierung von Boeden anthropogener Substrate, die exemplarische Ermittlung des Verteilungsmusters derartiger Boeden und die Pruefung, inwieweit sie sich aehnlich den Boeden natuerlicher
Patricios, Jon S; Ardern, Clare L; Hislop, Michael David; Aubry, Mark; Bloomfield, Paul; Broderick, Carolyn; Clifton, Patrick; Echemendia, Ruben J; Ellenbogen, Richard G; Falvey, Éanna Cian; Fuller, Gordon Ward; Grand, Julie; Hack, Dallas; Harcourt, Peter Rex; Hughes, David; McGuirk, Nathan; Meeuwisse, Willem; Miller, Jeffrey; Parsons, John T; Richiger, Simona; Sills, Allen; Moran, Kevin B; Shute, Jenny; Raftery, Martin
2018-05-01
The 2017 Berlin Concussion in Sport Group Consensus Statement provides a global summary of best practice in concussion prevention, diagnosis and management, underpinned by systematic reviews and expert consensus. Due to their different settings and rules, individual sports need to adapt concussion guidelines according to their specific regulatory environment. At the same time, consistent application of the Berlin Consensus Statement's themes across sporting codes is likely to facilitate superior and uniform diagnosis and management, improve concussion education and highlight collaborative research opportunities. This document summarises the approaches discussed by medical representatives from the governing bodies of 10 different contact and collision sports in Dublin, Ireland in July 2017. Those sports are: American football, Australian football, basketball, cricket, equestrian sports, football/soccer, ice hockey, rugby league, rugby union and skiing. This document had been endorsed by 11 sport governing bodies/national federations at the time of being published. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Acetanilide interaction with hydriodic acid in aqueous solutions at 20 and 40 deg C
International Nuclear Information System (INIS)
Erkasov, R.Sh.; Nurakhmetov, N.I.
1990-01-01
Isothermal method was used to study acetanilide solubility in aqueous solutions of hydriodic acid at 20 and 40 deg C. formation of two new anhydrous compounds of 2:1 and 1:1 compositions (anilide: acid molar ratio) was established. Temperature and concentration boundaries of solid phase formation were established for these compounds. Their IR spectroscopic investigation was conducted
Complete fusion 20Ne + 12C at 110 MeV
International Nuclear Information System (INIS)
Saulnier, J.-C.
1978-01-01
Identification in mass and charge of products of the reaction 20 Ne (Elab = 110 MeV) + 12 C has been obtained using a time-of-flight system and a ΔE-E telescope. Angular distributions and energy spectra have been measured between laboratory angles of 3,7 0 and 17 0 . The fusion cross-section has been measured to be 1270 +- 150 mb, with the reaction cross-section of 1700 +- 170 mb. Yields of evaporation residues are compared to predictions of the code GROGI2, using the Hauser-Feshbach angular momentum dependent formalism. Calculations of the laboratory energy and angular distributions of evaporation residues are carried out and compared with the experimental data for several center of mass angular distributions (isotropic, 1/sin theta, 1/sin 2 theta) [fr
Wisser, Ulrike, Ed.; Grootings, Peter, Ed.
1992-01-01
A "travelling" congress was conducted in five European cities (Berlin, Warsaw, Prague, Budapest, and Vienna) to promote a mutual exchange of views between east and west. The participants stressed the growing European Community interest in current examples of cooperation with neighbors in central and eastern Europe. In addition to…
International Nuclear Information System (INIS)
Smith, A.F.
1985-11-01
The friction and wear behaviour of 316 stainless steel in C0 2 has been investigated in the load range 8 - 5ON from 20 to 600 0 C. Wear transitions occurred at all temperatures but were load dependent. At and below 300 0 C wear transitions only took place at low leads whereas above 300 0 C transitions were seen al all loads. The low temperature wear transition, giving an order of magnitude decrease in wear rate was associated with a change in friction behaviour. The friction force across the specimen was initially widely fluctuating and varied from cycle to cycle. After a time, which did not necessarily coincide with the wear transition the cyclic variation in the friction force become much less. This smoother sliding is thought to indicate a trend to oxide -oxide contacts. At higher temperatures wear transitions result in a two orders of magnitude reduction in wear. The corresponding friction transition was similar to the low temperature friction change but also included a marked temporary drop in the coefficient of friction. (author)
The tensile properties of alloys 800H and 617 in the range 20 to 950deg C
International Nuclear Information System (INIS)
Abd El-Azim, M.E.; Ennis, P.J.; Schuster, H.; Nickel, H.
1990-01-01
The tensile properties of Alloy 800H and Alloy 617 in the solution treated condition and after ageing or carburization have been determined for the temperature range 20 to 950deg C. It was found that ageing at 900deg C prior to testing led to an increase in strength and a decrease in ductility at test temperatures up to 700deg C. Above 700deg C, there was no significant difference between the tensile properties of solution treated and aged material. Carburization caused a severe loss of ductility in both alloys at temperatures of 20 to around 800deg C, but the ductility increased sharply at test temperatures above 800deg C, accompanied by a change in the fracture mode from fracture of the carbide particles themselves to void formation and separation at the carbide/matrix interface. The correlation between tensile properties and creep data was investigated in tests carried out at different strain rates. Reasonable agreement was found at 800 to 950deg C for Alloy 617 and at 800 to 900deg C for Alloy 800H. Strain ageing effects were observed in both alloys at some temperatures and strain rates; these effects were serrated flow, negative strain rate sensitivity, peaks in the normalized UTS-temperature curves and plateaus in the elongation-temperature curves. The experimental results were interpreted in the light of two current models for strain ageing, the dislocation-dislocation interaction model and the dislocation-solute interaction model. (orig.) [de
Directory of Open Access Journals (Sweden)
Eunsook Ma
2011-12-01
Full Text Available The synthesis and evaluation of 5α-reductase inhibitory activity of some 4-azasteroid-20-ones and 20-oximes and 3β-hydroxy-, 3β-acetoxy-, or epoxy-substituted C21 steroidal 20-ones and 20-oximes having double bonds in the A and/or B ring are described. Inhibitory activity of synthesized compounds was assessed using 5α-reductase enzyme and [1,2,6,7-3H]testosterone as substrate. All synthesized compounds were less active than finasteride (IC50: 1.2 nM. Three 4-azasteroid-2-oximes (compounds 4, 6 and 8 showed good inhibitory activity (IC50: 26, 10 and 11 nM and were more active than corresponding 4-azasteroid 20-ones (compounds 3, 5 and 7. 3β-Hydroxy-, 3β-acetoxy- and 1α,2α-, 5α,6α- or 6α,7α-epoxysteroid-20-one and -20-oxime derivatives having double bonds in the A and/or B ring showed no inhibition of 5α-reductase enzyme.
Energy Technology Data Exchange (ETDEWEB)
Ottilinger, Werner [Sauter Deutschland, Freiburg im Breisgau (Germany)
2013-05-15
A feature of the central railway station in Berlin are the 46 meters high arched structures that span the railway station and accommodate more than 1,500 employees of the Deutsche Bahn AG (Berlin, Federal Republic of Germany). A total of 42,000 square meters of office space and a large business and conference center spread on twelve floors. Within the commissioning of this central railway station, this vast area should be designed technically variable in order to hold the time and cost as low as possible for the reconstruction or change of tenants.
Directory of Open Access Journals (Sweden)
Carol Anne Costabile-Heming
2004-01-01
Full Text Available Perhaps no site better embodies the juxtaposition of the German past with the challenges of the present and prospect for the future than Berlin. For the city of Berlin, the past (Third Reich, Holocaust is simultaneously present and absent from view…
Directory of Open Access Journals (Sweden)
Crnovčić I
2017-04-01
Full Text Available Ivana Crnovčić,1 Christian Rückert,2 Siamak Semsary,1 Manuel Lang,1 Jörn Kalinowski,2 Ullrich Keller1 1Institut für Chemie, Technische Universität Berlin, Berlin-Charlottenburg, 2Technology Platform Genomics, Center for Biotechnology, Bielefeld University, Bielefeld, Germany Abstract: Sequencing the actinomycin (acm biosynthetic gene cluster of Streptomyces antibioticus IMRU 3720, which produces actinomycin X (Acm X, revealed 20 genes organized into a highly similar framework as in the bi-armed acm C biosynthetic gene cluster of Streptomyces chrysomallus but without an attached additional extra arm of orthologues as in the latter. Curiously, the extra arm of the S. chrysomallus gene cluster turned out to perfectly match the single arm of the S. antibioticus gene cluster in the same order of orthologues including the the presence of two pseudogenes, scacmM and scacmN, encoding a cytochrome P450 and its ferredoxin, respectively. Orthologues of the latter genes were both missing in the principal arm of the S. chrysomallus acm C gene cluster. All orthologues of the extra arm showed a G +C-contents different from that of their counterparts in the principal arm. Moreover, the similarities of translation products from the extra arm were all higher to the corresponding translation products of orthologue genes from the S. antibioticus acm X gene cluster than to those encoded by the principal arm of their own gene cluster. This suggests that the duplicated structure of the S. chrysomallus acm C biosynthetic gene cluster evolved from previous fusion between two one-armed acm gene clusters each from a different genetic background. However, while scacmM and scacmN in the extra arm of the S. chrysomallus acm C gene cluster are mutated and therefore are non-functional, their orthologues saacmM and saacmN in the S. antibioticus acm C gene cluster show no defects seemingly encoding active enzymes with functions specific for Acm X biosynthesis. Both acm
Schuler, Jochen; Maier, Birga; Behrens, Steffen; Thimme, Walter
2006-07-01
Guidelines issued by European and German cardiology societies clearly define procedures for treatment of acute myocardial infarction (AMI). These guidelines, however, are based on clinical studies in which older patients are underrepresented. Older patients, on the other hand, represent a large and growing portion of the infarction population. It was our goal in the present paper to analyse the present treatment of AMI patients over 75 years of age in the city of Berlin, Germany, with data gained from the Berlin Myocardial Infarction Registry (BHIR). We prospectively collected data from 5079 patients (3311 men and 1768 women, mean age 65.6) with acute myocardial infarction who were treated in 25 hospitals in Berlin during the period 1999-2003. 1319 patients (25.9%) were older than 75 (mean age 82.5 years). Overall hospital mortality rate was 11.6%. In patients over 75, this rate was 23.9%; among the younger infarction population, it was 7.3%. In contrast to the younger AMI patients, the majority of those over 75 were female (62.5 vs 25.1% for the younger) and demonstrated a significantly higher frequency of all prognostically meaningful comorbidities (heart failure 14.4% vs. 3.5%; renal failure 11.5 vs 3.9%; diabetes 37.3 vs 24.3%). Clinical signs of severe infarction, moreover, were more common among the aged patients (pulmonary congestion 45.4 vs 19.7%; left bundle branch block 12.7 vs 3.6%). Pre-hospital time was prolonged (2.8 vs 2 h) and guideline-recommended therapy was applied significantly less frequently to AMI patients over 75 (reperfusion therapy 39.8 vs 71.7%, beta-blockers 62.8 vs 78.3%, statins 26.5 vs 45.5%). Multivariate analysis revealed the following factors to be independent predictors of hospital mortality in patients over 75: age (OR 1.05 per year), acute heart failure (OR 2.39), pre-hospital resuscitation (OR 10.6), cardiogenic shock (OR 2.73), pre-hospital delay >12 h (OR 1.68), and ST elevation in the first ECG (OR 2.09). Independent
Refinement of grain structure in 20 MnNiMo (SA508C) steel
International Nuclear Information System (INIS)
Sheng Zhongqi; Xiao Hong; Peng Feng; Zou Min
1997-04-01
The size of prior austenite grains and bainitic colonies of 20 MnNiMo (SA508C) steel (a reactor pressure vessel steel) after normal heat treatment is measured and its controlling factors are discussed. Results show that low aluminium content can induce serious mixed structure with fine and coarse grains in prior austenite. Fast cooling rate can promote refinement of bainitic colonies. Further refinement of grains can be obtained by inter-critical quenching. (5 figs., 1 tab.)
Directory of Open Access Journals (Sweden)
João Carlos Cantarelli Jr.
2009-06-01
Full Text Available CONTEXT: Barrett's esophagus is characterized by the presence of goblet cells. However, when alcian-blue is utilized, another type of cells, called columnar blue cells, is frequently present in the distal esophagus of patients with endoscopic evidence of Barrett's esophagus. Cytokeratin 7 and 20 immunoreactivity has been previously studied in areas of intestinal metaplasia at the esophagogastric junction. However, the expression of these cytokeratins in columnar blue cells has not been characterized. OBJECTIVE: To compare the expression of cytokeratin 7 and 20 in goblet cells and columnar blue cells in patients with endoscopic evidence of Barrett's esophagus. METHODS: Biopsies from 86 patients with endoscopic evidence of Barrett's esophagus were evaluated. The biopsies were stained for cytokeratin 7 and 20. RESULTS: Goblet cells were present in 75 cases and columnar blue cells in 50 cases. Overall, cytokeratin 7 expression was similar in goblet cells and columnar blue cells (P = 0.25, while cytokeratin 20 was more common in goblet cells (P CONTEXTO: Esôfago de Barrett é caracterizado pela presença de células caliciformes. Entretanto, quando "alcian blue" é utilizado, outro tipo de células, chamadas células colunares azuis, estão frequentemente presentes no esôfago distal de pacientes com evidência endoscópica de esôfago de Barrett. A imunoreatividade das citoqueratinas 7 e 20 tem sido estudada previamente em áreas de metaplasia intestinal na junção esôfago-gástrica. Entretanto, a expressão destas citoqueratinas nas células colunares azuis não foi caracterizada. OBJETIVO: Comparar a expressão das citoqueratinas 7 e 20 nas células caliciformes e células colunares azuis em pacientes com evidência endoscópica de esôfago de Barrett. MÉTODOS: Biopsias de 86 pacientes com evidência endoscópica de esôfago de Barrett foram avaliadas. Estas foram coradas com citoqueratinas 7 e 20. RESULTADOS: Células caliciformes estavam
Dierk Schmidt; Malte Jaguttis
2014-01-01
Is pictorial language able to convey a juridical abstraction? This co-authored text addresses that question in the context of the geo-political division of Africa after the Berlin Africa Conference (Congo Conference), as a means to conceptualise colonial rule in 1884/85 – and its manifold grave consequences – as a historical by-product of Europe’s political and aesthetic modernity. Is there any value in representing the image of genocide, (while acknowledging the ‘impossibility’ of its repres...
Energy Technology Data Exchange (ETDEWEB)
Meyer, Ulf
2013-06-01
If the ARD political talk show with Guenther Jauch starts on Sunday night after the crime thriller, only few viewers know that they are tele-guests on the former gasometer site in Berlin-Schoeneberg. Currently, this site is being transformed into an environmentally friendly campus called the 'European Energy Forum' (EUREF). According to the will of the owner and architect Reinhard Mueller, the campus will become the largest CO{sub 2} neutral office and business location in Europe. Totally 600 million Euro will be invested. All new buildings should be ecological 'green buildings' and received the LEED Gold certification.
[Child or career? Desire for a child in East and West Berlin].
Rauchfuss, M; Sperfeld, A
2001-01-01
In the Federal Republic of Germany the rate of the childless women rises. While the topic of unwanted childlessness among gynecologists receives broad attention among gynecologists, the question of (temporaryly?) intended renouncement of pregnancy and birth is of little interest. For the former GDR a low age with the firstborn and a high mother rate were typically. After the "turn" serious modifications of the birth rate in East Germany happened. The available study examined 1996 motives for and against a child with 554 up-to-date wanted childless women in East- and West-Berlin (population-referred sample). In the questionnaire, besides sociodemographic data, information was raised to own childhood, partnership, occupation, satisfaction with life and for child desire motivation. Apart from the school and vocational termination conceptions on the age with the firstborn, disadvantages for a life with child and value hierarchies for partnership and family were important for the description of the dilemma of compatibility of occupation and family. Eastsocialized women consider a compatibility rather possible. Targets for vocational development and responsible parenthood for young women come into conflict. Temporal delaying of the child desire leads to an increase of intended and unwanted childlessness with various (psychosomatic) effects on obstetrics and gynecology.
Monitoring system for assessment of prestressed railway bridges in the new Lehrter Bahnhof in Berlin
Habel, Wolfgang R.; Kohlhoff, H.; Knapp, J.; Helmerich, R.
2003-03-01
A new central railway station - Lehrter Bahnhof - is being built in Berlin. Because of construction activities in immediate vicinity and because of difficult soil conditions, vertical displacements will be expected. In order to avoid damage to the bridges and to a widely spanned glass roof which will be supported by two concrete bridges these two bridges have to be monitored right from the beginning of construction until commissioning as well as later on for several years. For this purpose, a long-term monitoring concept has been developed. Sensors with excellent long-term stabilty have been chosen to carry out the concept. This paper describes the measuring concept as well as components of the system. Especially techniques to monitor settlements and heaves and to measure strain and inclination of the prestressed concrete bridges are described. All measures are redundantly monitored. Measurements on-site are referenced by measurements on two large-scale beam models well-defined loaded under laboratory and field conditions.
Supporting lifelong competence development and employability using TENCompetence services
Manderveld, Jocelyn; Griffiths, Dai; Kew, Chris; Krekels, Bas
2009-01-01
Manderveld, J., Griffiths, D., Kew, C., & Krekels, B. (2008). Supporting lifelong competence development and employability using TENCompetence services. Presentation at Online Educa Berlin, December, 3, 2008, Berlin, Germany.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Percentage of Automatic Increases in Primary... ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Pt. 404, Subpt. C, App. VI Appendix VI to Subpart C of Part 404—Percentage of Automatic Increases in...
Directory of Open Access Journals (Sweden)
Élise Roche
2011-12-01
Full Text Available La participation institutionnelle est souvent présentée comme un espace de débat à une échelle très localisée ; on lui reproche souvent le manque d’enjeux et d’impact qu’elle peut comporter pour les projets urbains. En postulant que ces dispositifs naissent de conflits micro-locaux, nous essaierons d’interroger en quoi ce processus reflète au contraire des enjeux sociaux importants qui se jouent à l’échelle de quartiers. Ce questionnement s’appuiera notamment sur l’hypothèse que l’objet territorial de la participation masque bien souvent des tensions sociales, et donc des conflits d’ordre socio-spatiaux. En analysant deux conflits locaux de gestion urbaine, à Berlin et à Saint-Denis, nous analyserons l’articulation entre ceux-ci et les processus de participation locaux. Les quartiers en marge en constituent un bon cadre d’étude par les processus de ségrégation qui s’y exercent.Die Bürgerbeteiligung wird oft als ein Aktionsfeld ohne politische Wirkunskraft gesehen, in welchem nur lokale Themen behandelt werden; die Bürgerbeteiligung sei nicht fähig die Stadtplanung zu ändern. Das politische Engagement der Bürgerinnen und Bürger erweist sich hingegen als sehr wichtig, wenn man Konflikte der institutionellen Bürgerbeteiligung betrachtet, die sich auf einer mikro-geographischen Ebene abspielen. Die territoriale Verankerung der Bürgerbeteiligung tendiert allerdings dazu, die soziale Komponente der Konflikte zu verdecken. Der vorliegende Artikel untersucht, wie lokale Konflikte über Stadtplanung und -organisation in Berlin und Saint-Denis mit lokalen partizipativen Prozessen angegangen werden könnten. Stadtteile mit besonderem Entwicklungsbedarf wie Stadtrandgebiete, die von Stadterneuerung, Gentrifizierungs- sowie Segregationsprozessen betroffen sind, gelten hierfür als geeignete Untersuchungsgegenstände.
Water sorption isotherms of skimmed milk powder within the temperature range of 5–20 °C
Directory of Open Access Journals (Sweden)
Jitka Langová
2012-01-01
Full Text Available Moisture sorption isotherms (MSI’s of skimmed milk powder in the temperature range of 5–20 °C were determined using manometric method. MSI’s, which show the water content versus water activity (Aw at a constant temperature, are used to describe relationships between water content and equilibrium state relative vapour pressure (RVP. The equilibrium moisture content (EMC of skimmed milk powder samples is growing with an increase of Aw at a constant temperature both for water adsorption and desorption. Isotherms were found to be type II of Brunauer-Emmett-Teller classification. It is the type most common for foods. The shape of created isotherms was sigmoid. Structural modifications of crystals were observed during adsorption in the microscope, too. Critical value of EMC of tested samples corresponding to the Aw equal to 0.6 for adsorption was 6.50% MC (w.b. at temperature 5 °C, 9.15% MC (w.b. at temperature 10 °C, and 7.71% MC (w.b. at temperature 20 °C. These values determine optimal conditions for storage from the point of view microorganisms grow, Aw<0.6.
Meffe, Raffaella; Kohfahl, Claus; Hamann, Enrico; Greskowiak, Janek; Massmann, Gudrun; Dünnbier, Uwe; Pekdeger, Asaf
2014-01-01
This article reports on a field modelling study to investigate the processes controlling the plume evolution of para-toluenesulfonamide (p-TSA) in anoxic groundwater in Berlin, Germany. The organic contaminant p-TSA originates from the industrial production process of plasticisers, pesticides, antiseptics and drugs and is of general environmental concern for urban water management. Previous laboratory studies revealed that p-TSA is degradable under oxic conditions, whereas it appears to behave conservatively in the absence of oxygen (O2). p-TSA is ubiquitous in the aquatic environment of Berlin and present in high concentrations (up to 38 μg L(-1)) in an anoxic aquifer downgradient of a former sewage farm, where groundwater is partly used for drinking water production. To obtain refined knowledge of p-TSA transport and degradation in an aquifer at field scale, measurements of p-TSA were carried out at 11 locations (at different depths) between 2005 and 2010. Comparison of chloride (Cl(-)) and p-TSA field data showed that p-TSA has been retarded in the same manner as Cl(-). To verify the transport behaviour under field conditions, a two-dimensional transport model was setup, applying the dual-domain mass transfer approach in the model sector corresponding to an area of high aquifer heterogeneity. The distribution of Cl(-) and p-TSA concentrations from the site was reproduced well, confirming that both compounds behave conservatively and are subjected to retardation due to back diffusion from water stagnant zones. Predictive simulations showed that without any remediation measures, the groundwater quality near the drinking water well galleries will be affected by high p-TSA loads for about a hundred years.
Border cases between autonomy and relevance: Economic sciences in Berlin--A natural experiment.
Düppe, Till
2015-06-01
The faculty of economics at today's Humboldt University in Berlin, as no other institution of economics, has witnessed three radical ruptures in its history: in 1933, National Socialism replaced the pluralism prevailing in the Weimar Republic by imposing a "German economics"; after WWII, GDR authorities replaced this NS regime by imposing a Marxist imperative, which after the fall of the wall was replaced by the Western standards of neoclassical economics. In reconstructing these three reforms, institutional history can serve as a context in which questions about the political nature of economic knowledge can be answered that remain speculative in a conceptual context. I thus present a natural experiment in the political epistemology of economics: How do economists respond to, resist, and stabilize, changing political regimes? How do economists renegotiate the autonomy of economic knowledge given changing demands as of its social task? Among others, I show that contrary to Robert Merton's old, but still widely held thesis in political epistemology-that the values of science are compatible only with democratic regimes-the totalitarian and authoritarian regimes created better conditions for methodological pluralism in economics than democratic society. Copyright © 2015 Elsevier Ltd. All rights reserved.
The Berlin Inventory of Gambling behavior - Screening (BIG-S): Validation using a clinical sample.
Wejbera, Martin; Müller, Kai W; Becker, Jan; Beutel, Manfred E
2017-05-18
Published diagnostic questionnaires for gambling disorder in German are either based on DSM-III criteria or focus on aspects other than life time prevalence. This study was designed to assess the usability of the DSM-IV criteria based Berlin Inventory of Gambling Behavior Screening tool in a clinical sample and adapt it to DSM-5 criteria. In a sample of 432 patients presenting for behavioral addiction assessment at the University Medical Center Mainz, we checked the screening tool's results against clinical diagnosis and compared a subsample of n=300 clinically diagnosed gambling disorder patients with a comparison group of n=132. The BIG-S produced a sensitivity of 99.7% and a specificity of 96.2%. The instrument's unidimensionality and the diagnostic improvements of DSM-5 criteria were verified by exploratory and confirmatory factor analysis as well as receiver operating characteristic analysis. The BIG-S is a reliable and valid screening tool for gambling disorder and demonstrated its concise and comprehensible operationalization of current DSM-5 criteria in a clinical setting.
Franz, M.; Nowak, K.; Berner, U.; Heunisch, C.; Bandel, K.; Röhling, H.-G.; Wolfgramm, M.
2014-11-01
The deposition of the Stuttgart Formation ('Schilfsandstein'), commonly considered as a type-example of the Carnian Pluvial Event, was controlled by high frequent 4th order sequences that resulted in pre-, intra- and post-Schilfsandstein transgressions from Tethyan waters into the epicontinental Central European Basin (CEB). The pre-Schilfsandstein transgression flooded the CEB trough gates to the Southeast and resulted in a wide-spread inland sea that was characterised by increased biological productivity, predominantly oxic conditions and enabled the immigration of euryhaline marine fauna with plankton, ostracodes, fishes, bivalves and the gastropods Omphaloptychia suebica n. sp. and Settsassia stuttgartica n. sp. The rather short-term intra- and post-Schilfsandstein transgressions flooded the CEB from the Southwest and Southeast and established a shallow brackish inland sea that stretched up to North Germany. Both, the 4th and 3rd order sequences derived from the succession in the CEB correlate well with those derived from successions of Tethyan shelfs. Therefore pronounced circum-Tethyan eustatic cycles are evidenced and may have had considerable impact on prominent middle Carnian events: Reingraben turnover, Carnian Pluvial Event, Carnian Crisis and Mid Carnian Wet Intermezzo. The broad circum-Tethyan evidence of 106-year scale cycles suggests glacioeustatic sea-level changes even in the Triassic Greenhouse period.
Pteros 2.0: Evolution of the fast parallel molecular analysis library for C++ and python.
Yesylevskyy, Semen O
2015-07-15
Pteros is the high-performance open-source library for molecular modeling and analysis of molecular dynamics trajectories. Starting from version 2.0 Pteros is available for C++ and Python programming languages with very similar interfaces. This makes it suitable for writing complex reusable programs in C++ and simple interactive scripts in Python alike. New version improves the facilities for asynchronous trajectory reading and parallel execution of analysis tasks by introducing analysis plugins which could be written in either C++ or Python in completely uniform way. The high level of abstraction provided by analysis plugins greatly simplifies prototyping and implementation of complex analysis algorithms. Pteros is available for free under Artistic License from http://sourceforge.net/projects/pteros/. © 2015 Wiley Periodicals, Inc.
Web 2.0 Sites for Collaborative Self-Access: The Learning Advisor vs. Google®
Directory of Open Access Journals (Sweden)
Craig D. Howard
2011-09-01
Full Text Available While Web 2.0 technologies provide motivated, self-access learners with unprecedented opportunities for language learning, Web 2.0 designs are not of universally equal value for learning. This article reports on research carried out at Indiana University Bloomington using an empirical method to select websites for self-access language learning. Two questions related to Web 2.0 recommendations were asked: (1 How do recommended Web 2.0 sites rank in terms of interactivity features? (2 How likely is a learner to find highly interactive sites on their own? A list of 20 sites used for supplemental and self-access activities in language programs at five universities was compiled and provided the initial data set. Purposive sampling criteria revealed 10 sites truly represented Web 2.0 design. To address the first question, a feature analysis was applied (Herring, The international handbook of internet research. Berlin: Springer, 2008. An interactivity framework was developed from previous research to identify Web 2.0 design features, and sites were ranked according to feature quantity. The method used to address the second question was an interconnectivity analysis that measured direct and indirect interconnectivity within Google results. Highly interactive Web 2.0 sites were not prominent in Google search results, nor were they often linked via third party sites. It was determined that, using typical keywords or searching via blogs and recommendation sites, self-access learners were highly unlikely to find the most promising Web 2.0 sites for language learning. A discussion of the role of the learning advisor in guiding Web 2.0 collaborative self-access, as well as some strategic short cuts to quick analysis, conclude the article.
Biophysics of Water: A Working Conference.
1981-09-15
R.J.W. Hefford Royal Free Hospital Unilever Research London, England Port Sunlight, England C. Gabriel H.C. Hempling Queens College Med. Univ. of...Goodfellow J.F. Holzwarth Birkbeck College F. Haber Inst. Berlin London, England Berlin, W. Germany G.W. Gould E. Hagelberg Unilever Research Univ. of
Simon, Ute; Brüggemann, Rainer; Pudenz, Stefan
2004-04-01
Decisions about sustainable development demand spatially differentiated evaluations. As an example, we demonstrate the evaluation of water management strategies in the cities of Berlin and Potsdam (Germany) with respect to their ecological effects in 14 sections of the surface water system. Two decision support systems were compared, namely PROMETHEE, which is designed to obtain a clear decision (linear ranking), and Hasse Diagram Technique (HDT), normally providing more than one favourable solution (partial order). By PROMETHEE, the spatial differentiation had unwanted effects on the result, negating the stakeholders determined weighting of indicators. Therefore, the stakeholder can barely benefit from the convenience of obtaining a clear decision (linear ranking). In contrast, the result obtained by HDT was not influenced by spatial differentiation. Furthermore, HDT provided helpful tools to analyse the evaluation result, such as the concept of antagonistic indicators to discover conflicts in the evaluation process.
Varino, Filipa; Arbogast, Philippe; Joly, Bruno; Riviere, Gwendal; Fandeur, Marie-Laure; Bovy, Henry; Granier, Jean-Baptiste
2018-03-01
The multi-decadal variations of wintertime extra-tropical cyclones during the last century are studied using a vorticity-based tracking algorithm applied to the long-term ERA-20C reanalysis from ECMWF. The variability of moderate-to-deep extra-tropical winter cyclones in ERA-20C show three distinct periods. Two at the beginning and at the end of the century (1900-1935 and 1980-2010) present weak or no significant trends in the Northern Hemisphere as a whole and only some regional trends. The period in between (1935-1980) is marked by a significant increase in Northern Hemisphere moderate-to-deep cyclones frequency. During the latter period, polar regions underwent a significant cooling over the whole troposphere that increased and shifted poleward the mid-latitude meridional temperature gradient and the baroclinicity. This is linked to positive-to-negative shifts of the PDO between 1935 and 1957 and of the AMO between 1957 and 1980 which mainly reinforced the storm-track eddy generation in the North Pacific and North Atlantic regions respectively, as seen from baroclinic conversion from mean to eddy potential energy. As a result, both the North Pacific and North Atlantic extra-tropical storms increase in frequency during the two subperiods (1935-1957 and 1957-1980), together with other storm-track quantities such as the high-frequency eddy kinetic energy. In contrast, the first and third periods are characterized by a warming of the polar temperatures. However, as the stronger warming is confined to the lower troposphere, the baroclinicity do not uniformly increase in the whole troposphere. This may explain why the recent rapid increase in polar temperatures has not affected the behaviour of extratropical cyclones very much. Finally, the large magnitude of the positive trend found in moderate-to-deep cyclone frequency during the second period is still questioned as the period is marked by an important increase in the number of assimilated observations. However, the
Heinonen, Martti; Anagnostou, Miltiadis; Bell, Stephanie; Stevens, Mark; Benyon, Robert; Bergerud, Reidun Anita; Bojkovski, Jovan; Bosma, Rien; Nielsen, Jan; Böse, Norbert; Cromwell, Plunkett; Kartal Dogan, Aliye; Aytekin, Seda; Uytun, Ali; Fernicola, Vito; Flakiewicz, Krzysztof; Blanquart, Bertrand; Hudoklin, Domen; Jacobson, Per; Kentved, Anders; Lóio, Isabel; Mamontov, George; Masarykova, Alexandra; Mitter, Helmut; Mnguni, Regina; Otych, Jan; Steiner, Anton; Szilágyi Zsófia, Nagyné; Zvizdic, Davor
2012-09-01
In the field of humidity quantities, the first CIPM key comparison, CCT-K6 is at its end. The corresponding European regional key comparison, EUROMET.T-K6, was completed in early 2008, about 4 years after the starting initial measurements in the project. In total, 24 NMIs from different countries took part in the comparison. This number includes 22 EURAMET countries, and Russia and South Africa. The comparison covered the dew-point temperature range from -50 °C to +20 °C. It was carried out in three parallel loops, each with two chilled mirror hygrometers as transfer standards in each loop. The comparison scheme was designed to ensure high quality results with evenly spread workload for the participants. It is shown that the standard uncertainty due to the long-term instability was smaller than 0.008 °C in all loops. The standard uncertainties due to links between the loops were found to be smaller than 0.025 °C at -50 °C and 0.010 °C elsewhere. Conclusions on the equivalence of the dew-point temperature standards are drawn on the basis of calculated bilateral degrees of equivalence and deviations from the EURAMET comparison reference values (ERV). Taking into account 16 different primary dew-point realizations and 8 secondary realizations, the results demonstrate the equivalence of a large number of laboratories at an uncertainty level that is better than achieved in other multilateral comparisons so far in the humidity field.
Research value of 19th and 20th centuries unpublished diaries of ...
African Journals Online (AJOL)
mpho ngoepe
Berlin missionary stock who taught at Unisa from 1958 to 1972. Over the ... 3.2 Otto Posselt's Diary (1877-1884) & Carl Kadach's Diary (1877-1898). In 1962 .... forecast which he delivered at the Transvaal Missionary Association Conference.
Digital Repository Service at National Institute of Oceanography (India)
Ciavatta, M.L.; Gresa, M.P.L.; Manzo, E.; Gavagnin, M.; Wahidullah, S.; Cimino, G.
, m), 1.65 (H-8, m), 1.58 (H-16b, m), 1.28 (H-15b, m), 1.24 (H 3 -19, s), 1.10 (H-9, m), 1.08 (H-7b, m), 1.07 (H-12b, m), 1.02(H-14, m), 0.67 (H 3 -18, s); 13 C NMR (75.13MHz, CDCl 3 ): d 186.5 (C-3, s), 169.0 (C-5, s), 155.9 (C-1, d), 139.3 (C-20, d...), 127.5 (C- 2, d), 123.8 (C-4, d), 114.9 (C-21, t), 55.1 (C-17, d), 54.6 (C-14, d), 52.7 (C-9, d), 43.6 (C-10 and C-13, s·2), 37.1 (C-12, t), 35.7 (C-8, d), 33.7 (C-7, t), 32.9 (C-6, t), 27.1 (C-16, t), 24.9 (C-15, t), 22.5 (C-11, t), 18.7 (C-19, q), 12...
Ultrasonic measurement of elastic constants at temperatures from 20 to 11000C
International Nuclear Information System (INIS)
Moyer, M.W.; Hammond, J.P.
1976-09-01
Measurements of the elastic moduli at temperatures from 20 to 1100 0 C of a number of materials of interest in the Liquid Metal Fast Breeder Reactor and the High Temperature Gas Reactor were accomplished using acoustic techniques. A two-step process was required to complete the measurements. First, the acoustic velocities were measured accurately on bulk samples at room temperature, then a wire sample was used to make elevated-temperature measurements. A computer was used to calculate the moduli and plot the data. A detailed summary has been made of the sources of error and a calculation of the precision of the measurements is given
Directory of Open Access Journals (Sweden)
Clara M. Oberle
2010-11-01
Full Text Available This article examines the origins of what for years has been characterized as a European welfare consensus. It asks whether, indeed, there was a convergence of ideas, and if so, what led to it. Based on public health records from governmental, municipal, and international agencies in immediate postwar Europe, but also on sources reflecting public opinion, Allied military government discourses and policies, urban planners, medical professionals, and others, it argues that indeed there was a period in European history which generated something of a postwar convergence of ideas regarding public health and welfare. The postwar period witnessed a remarkable consensus about the importance of public planning, spending, and state involvement in the health and welfare sector. By examining the case of Berlin as one immediate postwar city and situating it in the larger European context of the time, one can point to common motivations and even actors involved. The root of this consensus was not any optimistic humanitarian ideology, nor even only a concern about public health or the spread of epidemics, though the latter was prominent. Equally important, it grew out of a shared setting marked by physical destruction and political instability. As a result, concerns about governability, social order, and political legitimacy came to the forefront, even of health and housing debates. In the case of Berlin, the public health debate was driven furthermore by a fear of the return of National Socialism.
Directory of Open Access Journals (Sweden)
Iulia Maria Onac
2012-07-01
Full Text Available The Romanian Parliamentary debate around the Congress of Berlin (1878-1879 offers a bird’s eye view of the evolution of antisemitic speech in Romania. Naturalization of the Jews - an issue raised by the Great European Powers during this Congress - came into conflict with the wishes of the Romania political class, which presently exploded into a violent antisemitic campaign in the political debates and public speeches. The “Jewish danger” presented by many intellectuals and politicians will be accompanied by the accusation that the Jews constitute a state within the state, a nation within the nation, both devoted to world conspiracy. Amidst this welter of accusations, antisemitic discourse grew heavy with racial arguments. But by far the main characteristic of the Romanian variant of antisemitic discourse was the rapidity of its adoption in the parliamentary debates.
U. Langematz; J. Grenfell; K. Matthes; P. Mieth; M. Kunze; B. Steil; C. Brühl;
2005-01-01
The impact of 11-year solar cycle variations on stratospheric ozone (O3) is studied with the Freie Universität Berlin Climate Middle Atmosphere Model with interactive chemistry (FUB-CMAM-CHEM). To consider the effect of variations in charged particle precipitation we included an idealized NO x source in the upper mesosphere representing relativistic electron precipitation (REP). Our results suggest that the NO x source by particles and its transport from the mesosphere to the stratosphe...
Measures to remove impediments to better utilization. Renewable energy sources
International Nuclear Information System (INIS)
Diekmann, J.; Eichelbroenner, M.; Langniss, O.
1997-01-01
The utilization of renewable energy sources meets with a number of obstacles created in particular by economic framework conditions, regulatory provisions, lengthy administrative procedures, insufficient information, and to some part also to the reluctance of bankers and utilities. This is why an action programme was put underway by the Forum fuer Zukunftsenergien, together with the Berlin-based DIW (German economic research institute) and the Stuttgart-based DLR (German aerospace research institute), financed from public funds of the Federal Ministry of Economics. Under this programme, almost 900 operators of systems for electricity generation from wind power, hydropower, biomass, ambient heat, solar thermal energy and by photovoltaic conversion have been interviewed. Based on the information obtained, the article reveals the existing impediments and proposed action for overcoming the obstacles. (orig.) [de
Impacts of 1.5 versus 2.0 °C on cereal yields in the West African Sudan Savanna
Faye, Babacar; Webber, Heidi; Naab, Jesse B.; MacCarthy, Dilys S.; Adam, Myriam; Ewert, Frank; Lamers, John P. A.; Schleussner, Carl-Friedrich; Ruane, Alex; Gessner, Ursula; Hoogenboom, Gerrit; Boote, Ken; Shelia, Vakhtang; Saeed, Fahad; Wisser, Dominik; Hadir, Sofia; Laux, Patrick; Gaiser, Thomas
2018-03-01
To reduce the risks of climate change, governments agreed in the Paris Agreement to limit global temperature rise to less than 2.0 °C above pre-industrial levels, with the ambition to keep warming to 1.5 °C. Charting appropriate mitigation responses requires information on the costs of mitigating versus associated damages for the two levels of warming. In this assessment, a critical consideration is the impact on crop yields and yield variability in regions currently challenged by food insecurity. The current study assessed impacts of 1.5 °C versus 2.0 °C on yields of maize, pearl millet and sorghum in the West African Sudan Savanna using two crop models that were calibrated with common varieties from experiments in the region with management reflecting a range of typical sowing windows. As sustainable intensification is promoted in the region for improving food security, simulations were conducted for both current fertilizer use and for an intensification case (fertility not limiting). With current fertilizer use, results indicated 2% units higher losses for maize and sorghum with 2.0 °C compared to 1.5 °C warming, with no change in millet yields for either scenario. In the intensification case, yield losses due to climate change were larger than with current fertilizer levels. However, despite the larger losses, yields were always two to three times higher with intensification, irrespective of the warming scenario. Though yield variability increased with intensification, there was no interaction with warming scenario. Risk and market analysis are needed to extend these results to understand implications for food security.
International Nuclear Information System (INIS)
Denker, A.; Kleinert, K.; Laurenze-Landsberg, C.; Reimelt, M.; Schroeder-Smeibidl, B.
2011-01-01
In collaboration with the research reactor of the Helmholtz-Zentrum Berlin fuer Materialien und Energie, the Gemaeldegalerie Berlin is the only institute worldwide, which systematically employs the method of Neutron-Activation-Autoradiography to analyze paintings and painting techniques. To date more than 70 paintings were investigated with this effective, non-destructive, and exceptional method. It allows the visualization of structures and layers beneath the top surface and, in addition, enables the identification of elements contained in the pigments. The instrument B8 at the research reactor BER II is dedicated to this research. Jan Steen is one of the prolific artists from the 17th century. Like other artists from that time he produced several versions of one specific topic during life-time. The topic 'As the old ones sing, so the young ones pipe' was painted by Jan Steen in 13 versions. The painting from the Gemaeldegalerie is an exception in this series as it differs in style and content from the other oeuvres. The question arises: why did the artist deviate from his usual scheme? The possible answer is provided by X-ray images and neutron autoradiographs made of the painting, allowing insight into hidden paint layers and, therefore, in the genesis of the painting. Jan Steen did not simply change the composition of the room and the figures. He originally intended an altogether different topic. Assumedly it was supposed to be a so-called merry company, located in a generous, stately room. Many pieces of this sophisticated ambiance have been eliminated from the version visible today; others were modified and integrated into the composition of the new painting. Thus, Jan Steen commenced the topic 'As the old ones sing, so the young ones pipe' from a different context.
German Foundation for International Development, Bonn (West Germany).
Two international meetings on distance education are summarized in this report. The first, a preparatory seminar on "Staff Development for Distance Education," was held in Berlin to give African participants an opportunity to meet prior to attending the 12th World Conference of the International Council for Correspondence Education…
Grote, Mathias; Keuck, Lara
2015-06-01
Historical analyses of what metabolism has been conceived of, how concepts of metabolism were related to disciplines such as nineteenth-century nutritional physiology or twentieth-century biochemistry, and how their genealogies relate to the current developments may be helpful to understand the various, at times polemic, ways in which the boundaries between metabolism and heredity have been re-drawn. Against this background, a small number of scholars gathered in Berlin for a workshop that equally aimed at bringing new stories to the fore, and at considering seemingly known ones in a new light. Some aspects of the discussions are summarized in this paper.
Gerhardt, Uta
2014-01-01
The article takes hedonism and revolution as a vantage point to discuss the Kommune 2, an experiment in collective living, the anti-authoritarian kindergardens for the under-fives, and, last but not least, a speech in 1968 that spurred the women's movement in Western Germany. The author's interest is on the materials documenting how the Berlin student movement saw psychoanalysis: One point was that the pleasure principle should replace the reality principle for the sake of humankind, another that the authoritarian character structure has its roots in the denial of sexuality. Kindergarden children supposedly need "de-individualized identification" to develop ego-strength, when boys and girls differ in their superego organization. An important accomplishment was a group analysis conducted without an analyst, an experiment that worked amazingly well in the Kommune 2. In all, these various experiments in emancipation, with psychoanalysis a guide to interpersonal understanding, may be deemed spectacular when their aftereffects on everyday life in Germany have been tremendous.
Grundmann, Siegfried
2004-01-01
In 1919 the Prussian Ministry of Science, Arts and Culture opened a dossier on "Einstein's Theory of Relativity." It was rediscovered by the author in 1961 and is used in conjunction with numerous other subsequently identified 'Einstein' files as the basis of this fascinating book. In particular, the author carefully scrutinizes Einstein's FBI file from 1950-55 against mostly unpublished material from European including Soviet sources and presents hitherto unknown documentation on Einstein's alleged contacts with the German Communist Party and the Comintern. Siegfried Grundmann's thorough study of Einstein's participation on a committee of the League of Nations, based on archival research in Geneva, is also new. This book outlines Einstein's image in politics and German science policy. It covers the period from his appointment as a researcher in Berlin to his fight abroad against the "boycott of German science" after World War I and his struggle at home against attacks on "Jewish physics" of which he was made...
Energy Technology Data Exchange (ETDEWEB)
Michaely, Petra [Werner Sobek Stuttgart GmbH und Co.KG, Stuttgart (Germany); Schroth, Juergen; Schuster, Heide; Thuemmler, Thomas [WSGreen Technologies GmbH, Stuttgart (Germany); Sobek, Werner [Werner Sobek Stuttgart GmbH und Co.KG, Stuttgart (Germany); Stuttgart Univ. (Germany). Inst. fuer Leichtbau Entwerfen und Konstruieren
2012-07-01
In the presence of Federal Chancellor Dr. Angela Merkel, the efficient house Plus was inaugurated in December 2011 in Berlin (Federal Republic of Germany). This building is a temporary dwelling with a floor space of approximately 130 square meters. This building generates all the necessary energy for the operation and comfort by itself. The generated energy also is sufficient for the annual energy demand of two electric cars and an electric bicycle. The building also serves as a showcase to inform the general public.
Moebus, Susanne; Kuhn, Joseph; Hoffmann, Wolfgang
2017-11-01
Big Data is a diffuse term, which can be described as an approach to linking gigantic and often unstructured data sets. Big Data is used in many corporate areas. For Public Health (PH), however, Big Data is not a well-developed topic. In this article, Big Data is explained according to the intention of use, information efficiency, prediction and clustering. Using the example of application in science, patient care, equal opportunities and smart cities, typical challenges and open questions of Big Data for PH are outlined. In addition to the inevitable use of Big Data, networking is necessary, especially with knowledge-carriers and decision-makers from politics and health care practice. © Georg Thieme Verlag KG Stuttgart · New York.
International Nuclear Information System (INIS)
Kotkata, M.F.; Mahmoud, E.A.; El-Mously, M.K.
1979-07-01
Curves of reaction rate versus temperature for constant heating rates (phi=1-10 0 C/min) constructed by analytical methods have been used to demonstrate the crystallization kinetics of amorphous solid TeSe 20 . The devitrification process takes place with predominance of random nucleation and one-dimensional growth, and is limited by combined switching and splitting of the chemical bonds. The mean value for the activation energy of the amorphous-crystal transformation, average E, is found to be 64 Kcal/mole. While, the quantity E calculated on the basis of d.c. conductivity changes during different isothermal crystallization (120-175 0 C) in supercooled liquid TeSe 20 , amounts to 11.5 Kcal/mole and suggests the existence of mixed chains in the liquid alloys. (author)
Hosnuter, Mubin; Aslan, Cem; Isik, Daghan; Caliskan, Gorkem; Arslan, Banu; Durgun, Mustafa
2017-08-01
Platelet-rich plasma (PRP) is increasingly being used in the treatment of chronic wounds, pathologies of the musculoskeletal system, and in cosmetic medicine; however, the preparation of platelet-rich plasma is both time-consuming and requires invasive intervention. Additional costs are introduced if special equipment is used during preparation. The aim of the present study is to test whether autologous platelet-rich plasma (PRP) preserves the feature of growth factor release when stored at -20 °C after preparation. Autologous PRP concentrates were prepared using whole blood samples obtained from 20 healthy subjects and divided into three parts to form three groups. Epidermal growth factor (EGF), vascular endothelial growth factor (VEGF), platelet derived growth factor-AB (PDGF-AB), insulin-like growth factor 1 (IGF-1), transforming growth factor-beta (TGF-β), and P-Selectin levels were immediately analysed in the control group. The other groups were defined as the experimental groups and were stored at -20 °C and analysed on the 7th and the 14th days. The same growth factors were tested in the experimental groups. The growth factors (EGF, VEGF, PDGF-AB, IGF-1, TGF-β) and P-selectin levels were significantly decreased in the autologous PRP samples stored at -20 °C compared to the control group. The growth factor levels on days 7 and 14 suggest that autologous PRP can be stored at -20 °C without preservative agents, although in vivo studies are required in order to evaluate the clinical efficacy of the detected growth factor levels.
Identification and return of a skull from Tasmania in the Berlin anatomical collection.
Winkelmann, Andreas; Teßmann, Barbara
2018-02-01
Following a request by the Australian government, human remains of Australian origin were identified in the anatomical collection of Charité, the medical faculty of Berlin. We initiated an interdisciplinary provenance research on such remains to ensure their identity, elucidate their history, and prepare for a possible return to Australia. Here, we present results regarding a skull in the collection labeled as stemming from Tasmania. The non-invasive anthropological investigation revealed the skull to stem from a girl of about 15 years of age who most likely died of a massive otitis/petrositis with subsequent meningitis. These results match the historical findings, which started from an inscription on the frontal bone giving a first name ("Nanny"), an ancestry ("native of Kangaroo Island"), a collector ("Schayer"), and a location ("van Diemensland", i.e. Tasmania). The collector, Adolph Schayer, was a German sheep breeder and botanical/zoological collector living in north-western Tasmania from 1831 to 1843. In archival sources, a girl named Nanny Allan could be identified, who was a native of Kangaroo Island and died in Launceston/Tasmania in 1836 at the age of about 14 years. As there were no doubts that these remains stem from a Tasmanian individual, they were handed over to representatives of the Tasmanian Aboriginal Centre in July 2014.
9th Transgenic Technology Meeting (TT2010) in Berlin, Germany: a meeting report.
Saunders, Thomas L; Sobieszczuk, Peter
2010-12-01
The first Transgenic Technology (TT) Meeting was organized in 1999 by Johannes Wilbertz, Karolinska Institute, Stockholm, Sweden as a regional meeting. The TT Meetings continued in this way, constantly gathering additional practitioners of transgenic methodologies until the breakthrough in 2005 when the 6th TT Meeting in Barcelona, Spain, hosted by Lluis Montoliu (Centro Nacional de Biotecnologia, Madrid, Spain), generated the momentum to establish the International Society for Transgenic Technologies (ISTT). Since 2006, the ISTT has continued to promote the TT Meetings and provide its membership with a forum to discuss best practices and new methods in the field. The TT2010 Meeting was held at the Max Delbrück Center for Molecular Medicine (Berlin, Germany). Participation at the TT2010 Meeting exceeded the registration capacity and set a new attendance record. Session topics included methods for the generation of rat and mouse models of human disease, fundamental and advanced topics in rodent embryonic stem cells, and the newest transgenic technologies. Short presentations from selected abstracts were of especial interest. Roundtable discussions on transgenic facility establishment and cryoarchiving of mouse lines were favorably received. Students, technical staff, and professors participated in numerous discussions and came away with practical methods and new ideas for research.
[Death caused by projectile guns--a retrospective analysis of 34 cases in Berlin and Hamburg].
Lignitz, E; Koops, E; Püschel, K
1988-01-01
The autopsy material of the institutes for forensic medicine in Berlin/GDR and Hamburg was analyzed retrospectively (period from 1961 till 1987; 70,000 autopsies) for fatalities caused by "humane killers" (n = 22) and stud guns (n = 12).-Epidemiological, criminological and morphological findings: The decreased were all men aged between 18 and 75 years (mean 48 years) except one 61 year-old paraplegic women who was killed by her husband with a humane killer. The great majority of cases consisted of suicides; two accidents at work were caused by stud guns. These unusual weapons are normally used by skilled people (i.e. butchers or constructional workers respectively). The fatal wounds were situated at the head, especially the forehead, seldom at the nape of the neck or in the mouth, or sometimes in the chest when using stud guns. Combined suicides (especially together with hanging) are not unusual. Survival periods (with or without acting capacity) can range between minutes or even months (after neurosurgical intervention).-The frequency of such unusual and overall rare cases did not raise during the investigation period.
Directory of Open Access Journals (Sweden)
Iris Klempert
2016-06-01
The “BMM Guide” is available for all visitors of the museum on lendable devices or for students (professional audience using their personal devices and installing the application manually via the web-access eduroam. The guide is connected to the internet. It is designed to easily expand, update or transfer the content catalogue data. At the moment there is a connection between the exhibit and text-, image-, video- or virtual microscope content via QR-Code. The offline mode is limited to the connection between text content and the exhibit. We also implemented a multi-language support for English and German. The application has information like room plans, opening times and latest news of the museum. The museum guide is an easy handable, selfexplaining blended learning tool that can be embedded in the general education. .This guide for the exhibitions of the Berliner Medizinhistorisches Museum opens a new branch for self-study of students. Nevertheless he still has a potential to be integrated in curricular lectures in the future.
Sandoval, S; Torres, A; Pawlowsky-Reusing, E; Riechel, M; Caradot, N
2013-01-01
The present study aims to explore the relationship between rainfall variables and water quality/quantity characteristics of combined sewer overflows (CSOs), by the use of multivariate statistical methods and online measurements at a principal CSO outlet in Berlin (Germany). Canonical correlation results showed that the maximum and average rainfall intensities are the most influential variables to describe CSO water quantity and pollutant loads whereas the duration of the rainfall event and the rain depth seem to be the most influential variables to describe CSO pollutant concentrations. The analysis of partial least squares (PLS) regression models confirms the findings of the canonical correlation and highlights three main influences of rainfall on CSO characteristics: (i) CSO water quantity characteristics are mainly influenced by the maximal rainfall intensities, (ii) CSO pollutant concentrations were found to be mostly associated with duration of the rainfall and (iii) pollutant loads seemed to be principally influenced by dry weather duration before the rainfall event. The prediction quality of PLS models is rather low (R² < 0.6) but results can be useful to explore qualitatively the influence of rainfall on CSO characteristics.
Junge, Karen; Eicken, Hajo; Swanson, Brian D; Deming, Jody W
2006-06-01
Direct evidence for metabolism in a variety of frozen environments has pushed temperature limits for bacterial activity to increasingly lower temperatures, so far to -20 degrees C. To date, the metabolic activities of marine psychrophilic bacteria, important components of sea-ice communities, have not been studied in laboratory culture, not in ice and not below -12 degrees C. We measured [3H]-leucine incorporation into macromolecules (further fractionated biochemically) by the marine psychrophilic bacterium Colwellia psychrerythraea strain 34H over a range of anticipated activity-permissive temperatures, from +13 to -20 degrees C, including expected negative controls at -80 and -196 degrees C. For incubation temperatures below -1 degrees C, the cell suspensions [all in artificial seawater (ASW)] were first quick-frozen in liquid nitrogen. We also examined the effect of added extracellular polymeric substances (EPS) on [3H]-leucine incorporation. Results showed that live cells of strain 34H incorporated substantial amounts of [3H]-leucine into TCA-precipitable material (primarily protein) down to -20 degrees C. At temperatures from -1 to -20 degrees C, rates were enhanced by EPS. No activity was detected in the killed controls for strain 34H (or in Escherichia coli controls), which included TCA-killed, heat-killed, and sodium azide- and chloramphenicol-treated samples. Surprisingly, evidence for low but significant rates of intracellular incorporation of [3H]-leucine into protein was observed for both ASW-only and EPS-amended (and live only) samples incubated at -80 and -196 degrees C. Mechanisms that could explain the latter results require further study, but the process of vitrification promoted by rapid freezing and the presence of salts and organic polymers may be relevant. Overall, distinguishing between intracellular and extracellular aspects of bacterial activity appears important to understanding behavior at sub-freezing temperatures.
Directory of Open Access Journals (Sweden)
Pascal Pragnère
2012-11-01
Full Text Available La chute du mur de Berlin et l’effondrement des régimes communistes eurent pour effet de discréditer et affaiblir de nombreux mouvements révolutionnaires, et de provoquer l’émergence ou la résurgence de mouvements nationalistes.En 1989-90, deux conflits violents faisaient rage au cœur de l’Europe occidentale démocratique, en Irlande du Nord et au Pays Basque.Dans ces deux territoires, des nationalistes, dont certains étaient des radicaux animés par des revendications nationalistes et révolutionnaires s’opposèrent à des états démocratiques par l’utilisation de la violence. Un processus de paix se développa à partir de 1998 en Irlande du Nord ; celui du Pays Basque est toujours dans l’impasse.Il semble au premier abord que ces conflits continuèrent sans bouleversement majeur dans la période qui suivit la chute du mur.Cet article examine les revendications des nationalistes en Irlande du Nord et au Pays Basque pour tenter de dévoiler dans quelle mesure ils furent affectés par ce choc historique.Une perspective comparative permet de comprendre que ces mouvements furent influencés différemment en fonction des contextes locaux. Certains acteurs politiques restèrent volontairement imperméables, alors que d’autres furent davantage affectés par le débat idéologique.
Stabilization of global temperature at 1.5°C and 2.0°C: implications for coastal areas.
Nicholls, Robert J; Brown, Sally; Goodwin, Philip; Wahl, Thomas; Lowe, Jason; Solan, Martin; Godbold, Jasmin A; Haigh, Ivan D; Lincke, Daniel; Hinkel, Jochen; Wolff, Claudia; Merkens, Jan-Ludolf
2018-05-13
The effectiveness of stringent climate stabilization scenarios for coastal areas in terms of reduction of impacts/adaptation needs and wider policy implications has received little attention. Here we use the Warming Acidification and Sea Level Projector Earth systems model to calculate large ensembles of global sea-level rise (SLR) and ocean pH projections to 2300 for 1.5°C and 2.0°C stabilization scenarios, and a reference unmitigated RCP8.5 scenario. The potential consequences of these projections are then considered for global coastal flooding, small islands, deltas, coastal cities and coastal ecology. Under both stabilization scenarios, global mean ocean pH (and temperature) stabilize within a century. This implies significant ecosystem impacts are avoided, but detailed quantification is lacking, reflecting scientific uncertainty. By contrast, SLR is only slowed and continues to 2300 (and beyond). Hence, while coastal impacts due to SLR are reduced significantly by climate stabilization, especially after 2100, potential impacts continue to grow for centuries. SLR in 2300 under both stabilization scenarios exceeds unmitigated SLR in 2100. Therefore, adaptation remains essential in densely populated and economically important coastal areas under climate stabilization. Given the multiple adaptation steps that this will require, an adaptation pathways approach has merits for coastal areas.This article is part of the theme issue 'The Paris Agreement: understanding the physical and social challenges for a warming world of 1.5°C above pre-industrial levels'. © 2018 The Authors.
Stabilization of global temperature at 1.5°C and 2.0°C: implications for coastal areas
Nicholls, Robert J.; Brown, Sally; Goodwin, Philip; Wahl, Thomas; Lowe, Jason; Solan, Martin; Godbold, Jasmin A.; Haigh, Ivan D.; Lincke, Daniel; Hinkel, Jochen; Wolff, Claudia; Merkens, Jan-Ludolf
2018-05-01
The effectiveness of stringent climate stabilization scenarios for coastal areas in terms of reduction of impacts/adaptation needs and wider policy implications has received little attention. Here we use the Warming Acidification and Sea Level Projector Earth systems model to calculate large ensembles of global sea-level rise (SLR) and ocean pH projections to 2300 for 1.5°C and 2.0°C stabilization scenarios, and a reference unmitigated RCP8.5 scenario. The potential consequences of these projections are then considered for global coastal flooding, small islands, deltas, coastal cities and coastal ecology. Under both stabilization scenarios, global mean ocean pH (and temperature) stabilize within a century. This implies significant ecosystem impacts are avoided, but detailed quantification is lacking, reflecting scientific uncertainty. By contrast, SLR is only slowed and continues to 2300 (and beyond). Hence, while coastal impacts due to SLR are reduced significantly by climate stabilization, especially after 2100, potential impacts continue to grow for centuries. SLR in 2300 under both stabilization scenarios exceeds unmitigated SLR in 2100. Therefore, adaptation remains essential in densely populated and economically important coastal areas under climate stabilization. Given the multiple adaptation steps that this will require, an adaptation pathways approach has merits for coastal areas. This article is part of the theme issue `The Paris Agreement: understanding the physical and social challenges for a warming world of 1.5°C above pre-industrial levels'.
Uranium target fragmentation by intermediate and high energy 12C and 20Ne
International Nuclear Information System (INIS)
McGaughey, P.L.; Loveland, W.; Morrissey, D.J.; Aleklett, K.; Seaborg, G.T.
1985-01-01
The authors report herein the final analysis of the measurement of the target fragment production cross sections for nuclides with 24 less than or equal to A less than or equal to 237 from the interaction of 1.0, 3.0, 4.8, and 12 GeV 12 C and 8.0 and 20.0 GeV 20 Ne with 238 U. Isobaric yield distributions deduced from the nuclidic formation cross sections along with predictions of these distributions made using the nuclear firestreak and intranuclear cascade models are shown. Contrary to a previous report no large yields of fragments with 160 less than or equal to A less than or equal to 200 are observed in any reaction. Both the intranuclear cascade model and the nuclear firestreak model satisfactorily predict the observed yields of fragments with A > 60 indicating the general pattern of yields of these fragments is governed by the excitation energy deposited in the nucleus during the initial projectile-target interaction and the geometry of the collision
Directory of Open Access Journals (Sweden)
Reinhild Kreis
2017-03-01
Full Text Available In the early 1980s, hundreds of men and women in many West German and West European cities resorted to a rather unusual form of protest. In order to express their dissatisfaction with the local housing situation and policies, they occupied empty apartment buildings and, under the eyes of an astonished public, began renovating them themselves. Focusing on West Berlin as the most prominent case, this article interprets the performance of DIY home improvement tasks in occupied buildings (Instandbesetzer, as they called themselves as a form of protest, thus drawing attention to the manual work done by squatters and its impact on the housing policies of the 1980s. The DIY measures undertaken publicly by the squatters drew attention to serious political and social shortcomings while at the same time demonstrating possible solutions. The visible (or at least announced transformation of the built environment forced politicians, the public, and experts alike to discuss both housing policy in general and the idea of self-help as suggested by the squatters. Squatters thus accelerated the readjustment of a housing policy which now incorporated manual self-help by tenants into West Berlin’s city planning, but by the same token also undermined the potential for protest and provocation of such practices. * * * Zu Beginn der 1980er-Jahre griffen Hunderte von Männern und Frauen in vielen westdeutschen und westeuropäischen Städten zu einem ungewöhnlichen Mittel, um gegen ihre Wohnsituation und die Wohnungspolitik zu protestieren: Sie begannen, leerstehende Häuser eigenhändig und öffentlichkeitswirksam zu renovieren, die sie vorher besetzt hatten. Am besonders markanten West-Berliner Fall untersucht der Beitrag diese »Instandbesetzer« (so schon die zeitgenössische Selbstbezeichnung als »Heimwerker aus Protest« und fragt nach der Funktion der handwerklichen Praxis im Häuserkampf der 1980er-Jahre. Die Selbsthilfe der Instandbesetzer machte auf Missst
Hydration kinetics study of class G oil-well cement and olivine nano-silica mixtures at 20–60 °C
Quercia Bianchi, G.; Brouwers, H.J.H.; Sobolev, K.; Shah, S.P.
2015-01-01
In this study the heat evolution of standard density slurries (1.89 g/cm3) of Class G oil-well cement and olivine nano-silica additions (0.5–2.0 % bwoc), cured under different temperatures (20–60 °C) and atmospheric pressure, were examined by isothermal calorimetry. Under isothermal and isobaric
Kuik, F.; Lauer, A.; von Schneidemesser, E.; Butler, T. M.
2016-12-01
Many European cities continue to struggle with exceedances of NO2 limit values at measurement sites near roads, of which a large contribution is attributed to emissions from traffic. In this study, we explore how urban air quality can be improved with different traffic measures using the example of the Berlin-Brandenburg region. In order to simulate urban background air quality we use the Weather Research and Forecasting model with chemistry (WRF-Chem) at a horizontal resolution of 1km. We use emission input data at a horizontal resolution of 1km obtained by downscaling TNO-MACC III emissions based on local proxy data including population and traffic densities. In addition we use a statistical approach combining the simulated urban background concentrations with information on traffic densities to estimate NO2 at street level. This helps assessing whether the emission scenarios studied here can lead to significant reductions in NO2 concentrations at street level. The emission scenarios in this study represent a range of scenarios in which car traffic is replaced with bicycle traffic. Part of this study was an initial discussion phase with stakeholders, including policy makers and NGOs. The discussions have shown that the different stakeholders are interested in a scientific assessment of the impact of replacing car traffic with bicycle traffic in the Berlin-Brandenburg urban area. Local policy makers responsible for city planning and implementing traffic measures can make best use of scientific modeling results if input data and scenarios are as realistic as possible. For these reasons, the scenarios cover very idealized optimistic ("all passenger cars are replaced by bicycles") and pessimistic ("all cyclists are replaced by cars") scenarios to explore the sensitivity of simulated urban background air quality to these changes, as well as additional scenarios based on city-specific data to analyze more realistic situations. Of particular interest is how these impact
Dicty_cDB: Contig-U16238-1 [Dicty_cDB
Lifescience Database Archive (English)
Full Text Available 5I14R Mouse 10kb plasmid UUGC2M library Mus ... 46 2.0 1 ( AZ954756 ) 2M0220N05R Mouse 10kb plasmid UUGC2M library...... 46 2.0 1 ( DT769112 ) EST1202962 Aquilegia cDNA library Aqui...legia formo... 46 2.0 1 ( DT765721 ) EST1199570 Aquilegia cDNA library Aquilegia formo... 46 2.0 1 ( DT76040...9 ) EST1194258 Aquilegia cDNA library Aquilegia formo... 46 2.0 1 ( DT753653 ) EST1187502 Aquilegia cDNA library... Aquilegia formo... 46 2.0 1 ( DR922919 ) EST1114458 Aquilegia cDNA library Aquilegia formo... 46 2.0 1
Directory of Open Access Journals (Sweden)
Carmen Lăcan
2012-12-01
Full Text Available Rezension zu / Review of:Jens Eder / Fotis Jannidis / Ralf Schneider (Hg.: Characters in Fictional Worlds. Understanding Imaginary Beings in Literature, Film, and Other Media. Berlin 2010
Effects of Sleep Disorders on Hemoglobin A1c Levels in Type 2 Diabetic Patients
Directory of Open Access Journals (Sweden)
Ahmet Keskin
2015-01-01
Full Text Available Background: Studies have reported the presence of sleep disorders in approximately 50-70% of diabetic patients, and these may contribute to poor glycemic control, diabetic neuropathy, and overnight hypoglycemia. The aim of this study was to determine the frequency of sleep disorders in diabetic patients, and to investigate possible relationships between scores of these sleep disorders and obstructive sleep apnea syndrome (OSAS and diabetic parameters (fasting blood glucose, glycated hemoglobin A1c [HbA1c], and lipid levels. Methods: We used the Berlin questionnaire (BQ for OSAS, the Epworth Sleepiness Scale (ESS, and the Pittsburgh Sleep Quality Index (PSQI to determine the frequency of sleep disorders and their possible relationships with fasting blood glucose, HbA1c, and lipid levels. Results: The study included 585 type 2 diabetic patients admitted to family medicine clinics between October and December 2014. Sleep, sleep quality, and sleep scores were used as the dependent variables in the analysis. The ESS scores showed that 54.40% of patients experienced excessive daytime sleepiness, and according to the PSQI, 64.30% experienced poor-quality sleep. The BQ results indicated that 50.20% of patients were at high-risk of OSAS. HbA1c levels correlated significantly with the ESS and PSQI results (r = 0.23, P < 0.001 and r = 0.14, P = 0.001, respectively, and were significantly higher in those with high-risk of OSAS as defined by the BQ (P < 0.001. These results showed that HbA1c levels were related to sleep disorders. Conclusions: Sleep disorders are common in diabetic patients and negatively affect the control of diabetes. Conversely, poor diabetes control is an important factor disturbing sleep quality. Addressing sleep disturbances in patients who have difficulty controlling their blood glucose has dual benefits: Preventing diabetic complications caused by sleep disturbance and improving diabetes control.
Burkart, Katrin; Canário, Paulo; Breitner, Susanne; Schneider, Alexandra; Scherber, Katharina; Andrade, Henrique; Alcoforado, Maria João; Endlicher, Wilfried
2013-12-01
There is substantial evidence that both temperature and air pollution are predictors of mortality. Thus far, few studies have focused on the potential interactive effects between the thermal environment and different measures of air pollution. Such interactions, however, are biologically plausible, as (extreme) temperature or increased air pollution might make individuals more susceptible to the effects of each respective predictor. This study investigated the interactive effects between equivalent temperature and air pollution (ozone and particulate matter) in Berlin (Germany) and Lisbon (Portugal) using different types of Poisson regression models. The findings suggest that interactive effects exist between air pollutants and equivalent temperature. Bivariate response surface models and generalised additive models (GAMs) including interaction terms showed an increased risk of mortality during periods of elevated equivalent temperatures and air pollution. Cold effects were mostly unaffected by air pollution. The study underscores the importance of air pollution control in mitigating heat effects. Copyright © 2013 Elsevier Ltd. All rights reserved.
Incomplete momentum transfer components in /sup 16/O + /sup 12/C Fusion at 20 MeV/A
Energy Technology Data Exchange (ETDEWEB)
Menchaca-Rocha, A.; Brandan, M.E. (Grenoble-1 Univ., 38 (France). Inst. des Sciences Nucleaires); Dacal, A.; Galindo, A.; Mahoney, J.; Murphy, M.; Rae, W.D.M. (California Univ., Berkeley (USA). Lawrence Berkeley Lab.)
1983-01-27
The energy spectra of Z = 3-9 particles from reactions induced by 20 MeV/A /sup 16/O on /sup 12/C have been measured. The systematics found from the fusion-like residues clearly deviate from those expected for complete fusion, giving evidence for important incomplete momentum transfer components.
Alió, Jorge L; Plaza-Puche, Ana B; Javaloy, Jaime; Ayala, María José; Vega-Estrada, Alfredo
2013-04-01
To compare the visual and intraocular optical quality outcomes with different designs of the refractive rotationally asymmetric multifocal intraocular lens (MFIOL) (Lentis Mplus; Oculentis GmbH, Berlin, Germany) with or without capsular tension ring (CTR) implantation. One hundred thirty-five consecutive eyes of 78 patients with cataract (ages 36 to 82 years) were divided into three groups: 43 eyes implanted with the C-Loop haptic design without CTR (C-Loop haptic only group); 47 eyes implanted with the C-Loop haptic design with CTR (C-Loop haptic with CTR group); and 45 eyes implanted with the plate-haptic design (plate-haptic group). Visual acuity, contrast sensitivity, defocus curve, and ocular and intraocular optical quality were evaluated at 3 months postoperatively. Significant differences in the postoperative sphere were found (P = .01), with a more myopic postoperative refraction for the C-Loop haptic only group. No significant differences were detected in photopic and scotopic contrast sensitivity among groups (P ⩾ .05). Significantly better visual acuities were present in the C-Loop haptic with CTR group for the defocus levels of -2.0, -1.5, -1.0, and -0.50 D (P ⩽.03). Statistically significant differences among groups were found in total intraocular root mean square (RMS), high-order intraocular RMS, and intraocular coma-like RMS aberrations (P ⩽.04), with lower values from the plate-haptic group. The plate-haptic design and the C-Loop haptic design with CTR implantation both allow good visual rehabilitation. However, better refractive predictability and intraocular optical quality was obtained with the plate-haptic design without CTR implantation. The plate-haptic design seems to be a better design to support rotational asymmetric MFIOL optics. Copyright 2013, SLACK Incorporated.
Löwen, H.
2008-10-01
(Edinburgh), D Y H Chui (Mainz), D Deb (Graz), C Dellago (Vienna), J Dhont (Jülich), P Dillmann (Konstanz), G Dominguez (Leipzig), M Duits (Enschede), B Dünweg (Mainz), F Ebert (Konstanz), S Egelhaaf (Düsseldorf), E Eggen (Utrecht), R Eichhorn (Bielefeld), E Eiser (Cambridge), H B Eral (Enschede), A Erbe (Konstanz), L Filion (Utrecht), G Foffi (Lausanne), J Fornleitner (Vienna), K Franzrahe (Konstanz), D Frenkel (Cambridge), M Fuchs (Konstanz), G Fytas (Heraklion), P Garstecki (Warsaw), I Gazuz (Konstanz), N Geerts (Amsterdam), G Gompper (Jülich), E Gonzalez-Tovar (San Luis Potosi), I Götze (Jülich), S Grandner (Berlin), L Gránásy (London), C Gutsche (Leipzig), D Hajnal (Mainz), R Hanes (Düsseldorf), A Härtel (Düsseldorf), P Henseler (Konstanz), C Hertlein (Stuttgart), C Holm (Mainz), J Hoogenboom (Barcelona), P Hopkins (Bristol), J Horbach (Cologne), C-C Huang (Jülich), K Huang (Göttingen), S Huißmann (Düsseldorf), M Humar (Ljubljana), S Iacopini (Mainz), A Imhof (Utrecht), A Ivlev (Garching), K Jacobs (Saarbrücken), J Jakobi (Hannover), O Jansen (Düsseldorf), M Jenkins (Düsseldorf), J Jordanovic (Berlin), S Jungblut (Mainz), M Kahn (Vienna), T Kalwarczyk (Warsaw), K Kegler (Leipzig), P Keim (Konstanz), Z Keqin (Singapore), U F Keyser (Leipzig), T Köller (Mainz), K Kremer (Mainz), M Krüger (Konstanz), A Kuijk (Utrecht), P Lang (Jülich), M Laurati (Düsseldorf), W Lechner (Vienna), H Lehle (Stuttgart), P Leiderer (Konstanz), H Lekkerkerker (Utrecht), P Lettinga (Jülich), A Libal (San Mart), B Lonetti (Jülich), N J Lorenz (Mainz), H Löwen (Düsseldorf), H Maleki (Mainz), J-G Malherbe (Paris), M Marechal (Utrecht), G Maret (Konstanz), C Mayer (Rome), S Mazoyer (Konstanz), M McPhie (Jülich), M Medina-Noyola (San Luis Potosi), A Melzer (Greifswald), A Menéndez-Manjón (Hannover), R Messina (Düsseldorf), H Michiel (Utrecht), P Mishra (Düsseldorf), J Mixteco (Guanajuato), B Moser (Düsseldorf), G Nägele (Jülich), R R Netz (Munich), P Nielaba (Konstanz
Inelastic hadron-nucleus interactions at 20 and 37 GeV/c
International Nuclear Information System (INIS)
Faessler, M.A.; Lynen, U.; Niewisch, J.; Pietrzyk, B.; Povh, B.; Schroeder, H.; Gugelot, P.C.
1979-01-01
The experiment studies charged particle production for π - , K - , and anti p interactions on nuclei at 20 and 37 GeV/c at the CERN SPS. A non-magnetic detector, consisting of CsI(Tl) scintillation and lucite Cerenkov counters, distinguishes between fast particles, mainly pions, and slow particles, mainly nucleons, with a cut at velocity β approximately 0.7. Angular distributions, multiplicity distributions and correlations of slow and fast particles were analysed. It is shown that the measurement of the correlations can provide a critical test for different theoretical models of the hadron-nucleus interaction. At the energies studied so far a systematic deviation from KNO scaling is observed. This gives further support to the 'standard picture' of the hadron-nucleus interaction and it contrasts with predictions of the coherent-tube model. The regularity observed for the angular distribution of fast secondaries as a function of the number of slow particles can only be explained by combining features predicted by different models. (Auth.)
Directory of Open Access Journals (Sweden)
Andreas Umland
2010-07-01
Biographical sketch: CertTransl (Leipzig, MA (Stanford, MPhil (Oxford, DipPolSci, DrPhil (FU Berlin, PhD (Cambridge. Visiting fellow at Stanford’s Hoover Institution in 1997–1999, and Harvard’s Weatherhead Center in 2001–2002. Bosch visiting lecturer at Yekaterinburg’s Urals State University in 1999–2001, and Kyiv’s Mohyla Academy in 2003/2005. In January-December 2004, temporary lecturer in Russian and East European studies at St. Antony’s College Oxford. In 2005–2008, German Academic Exchange Service (DAAD Lecturer Kyiv’s Shevchenko University. Papers in Problems of Post-Communism, East European Jewish Affairs, Osteuropa, Österreichische Zeitschrift für Politikwissenschaft, Politicheskie issledovaniya, European Political Science, Political Studies Review, The Journal of Slavic Military Studies, Voprosy filosofii, Obshchestvennye nauki i sovremennost’, Forum für osteuropäische Ideen- und Zeitgeschichte, Ab Imperio and other journals. Editor of The Implementation of the European Convention on Human Rights in Russia: Philosophical, Legal und Empirical Studies (Stuttgart: Ibidem 2004, Geistes- und Sozialwissenschaftliche Hochschullehre in Osteuropa. Vols. 1, 2, 3 & 4 (Frankfurt a.M. u.a.: Peter Lang 2005, 2006, 2007 & 2009, and, with Roger Griffin and Werner Loh, Fascism Past and Present, West and East: An International Debate on Concepts and Cases in the Comparative Study of the Extreme Right. With an afterword by Walter Laqueur (Stuttgart: Ibidem-Verlag 2006.
Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili
2017-01-01
CD20-based targeting of B-cells in hematologic malignancies and autoimmune disorders is associated with outstanding clinical outcomes. Isolation and characterization of VH and VL cDNAs encoding the variable regions of the heavy and light chains of monoclonal antibodies (MAb) is necessary to produce next generation MAbs and their derivatives such as bispecific antibodies (bsAb) and single-chain variable fragments (scFv). This study was aimed at cloning and characterization of the VH and VL cDNAs from a hybridoma cell line producing an anti-CD20 MAb. VH and VL fragments were amplified, cloned and characterized. Furthermore, amino acid sequences of VH, VL and corresponding complementarity-determining regions (CDR) were determined and compared with those of four approved MAbs including Rituximab (RTX), Ibritumomab tiuxetan, Ofatumumab and GA101. The cloned VH and VL cDNAs were found to be functional and follow a consensus pattern. Amino acid sequences corresponding to the VH and VL fragments also indicated noticeable homologies to those of RTX and Ibritumomab. Furthermore, amino acid sequences of the relating CDRs had remarkable similarities to their counterparts in RTX and Ibritumomab. Successful recovery of VH and VL fragments encourages the development of novel CD20 targeting bsAbs, scFvs, antibody conjugates and T-cells armed with chimeric antigen receptors.
Energy Technology Data Exchange (ETDEWEB)
Knabben, Lars [e2 - energieberatung GmbH, Duesseldorf (Germany); 4greenArchitecture, Duesseldorf (Germany); Fischer, Harald [REWE Markt GmbH (Germany). Bauwesen Vollsortiment national; Bruening, Martin [REWE-Zentral AG, Koeln (Germany). Unternehmenskommunikation der REWE GROUP; Koch, Juergen [Koch Architekten, Koch Projekt GmbH, Duesseldorf (Germany); 4greenArchitecture, Duesseldorf (Germany)
2010-07-01
At 5th November 2009, the REWE Group (Cologne, Federal Republic of Germany) started the first Green Building in Berlin-Rudow (Federal Republic of Germany). Thus, the REWE Group sets a standard for a sustainable construction and operation of commercial immovables. The German Sustainable Building Council (Stuttgart, Federal Republic of Germany) distinguished this pilot project with the certificate in gold. The building is operated CO{sub 2} neutrally by means of most modern heating systems, ventilation systems, lighting systems, air conditioning systems and refrigerant plants in combination with an optimum insulation. Compared with a standard building, the energy consumption is reduced by nearly 50 per cent. The practice realizations are to be used in order to define a strategy for the future rollout of the total concept or certain concept components on a long-term basis.
Caironi, Pietro; Carlesso, Eleonora; Cressoni, Massimo; Chiumello, Davide; Moerer, Onner; Chiurazzi, Chiara; Brioni, Matteo; Bottino, Nicola; Lazzerini, Marco; Bugedo, Guillermo; Quintel, Michael; Ranieri, V Marco; Gattinoni, Luciano
2015-04-01
The Berlin definition of acute respiratory distress syndrome has introduced three classes of severity according to PaO2/FIO2 thresholds. The level of positive end-expiratory pressure applied may greatly affect PaO2/FIO2, thereby masking acute respiratory distress syndrome severity, which should reflect the underlying lung injury (lung edema and recruitability). We hypothesized that the assessment of acute respiratory distress syndrome severity at standardized low positive end-expiratory pressure may improve the association between the underlying lung injury, as detected by CT, and PaO2/FIO2-derived severity. Retrospective analysis. Four university hospitals (Italy, Germany, and Chile). One hundred forty-eight patients with acute lung injury or acute respiratory distress syndrome according to the American-European Consensus Conference criteria. Patients underwent a three-step ventilator protocol (at clinical, 5 cm H2O, or 15 cm H2O positive end-expiratory pressure). Whole-lung CT scans were obtained at 5 and 45 cm H2O airway pressure. Nine patients did not fulfill acute respiratory distress syndrome criteria of the novel Berlin definition. Patients were then classified according to PaO2/FIO2 assessed at clinical, 5 cm H2O, or 15 cm H2O positive end-expiratory pressure. At clinical positive end-expiratory pressure (11±3 cm H2O), patients with severe acute respiratory distress syndrome had a greater lung tissue weight and recruitability than patients with mild or moderate acute respiratory distress syndrome (pBerlin definition of acute respiratory distress syndrome assessed at 5 cm H2O allows a better evaluation of lung recruitability and edema than at higher positive end-expiratory pressure clinically set.
International Nuclear Information System (INIS)
Rapisarda, G.G.; Spitaleri, C; Kiss, G.G.; La Cognata, M.; Pizzone, R.G.; Romano, S.; Tumino, A.; Bordeanu, C.; Nita, C.; Pantelica, D.; Petrascu, H.; Velisa, G.; Hons, Z.; Mrazek, J.; Szücs, T.; Trache, L.
2016-01-01
Carbon-carbon fusion reaction represents a nuclear process of great interest in astrophysics, since the carbon burning is connected with the third phase of massive stars (M > 8 M ☉ ) evolution. In spite of several experimental works, carbon-carbon cross section has been measured at energy still above the Gamow window moreover data at low energy present big uncertainty. In this paper we report the results about the study of the 16 O( 12 C,α 20 Ne)α reaction as a possible three-body process to investigate 12 C( 12 C,α) 20 Ne at astrophysical energy via Trojan Horse Method (THM). This study represents the first step of a program of experiments aimed to measure the 12 C+ 12 C cross section at astrophysical energy using the THM. (paper)
Directory of Open Access Journals (Sweden)
Puga eCH
2016-02-01
Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.
Correlation between the 12C+12C, 12C+13C, and 13C+13C fusion cross sections
Notani, M.; Esbensen, H.; Fang, X.; Bucher, B.; Davies, P.; Jiang, C. L.; Lamm, L.; Lin, C. J.; Ma, C.; Martin, E.; Rehm, K. E.; Tan, W. P.; Thomas, S.; Tang, X. D.; Brown, E.
2012-01-01
The fusion cross section for 12C+13C has been measured down to Ec.m.=2.6 MeV, at which the cross section is of the order of 20 nb. By comparing the cross sections for the three carbon isotope systems, 12C+12C, 12C+13C, and 13C+13C, it is found that the cross sections for 12C+13C and 13C+13C provide an upper limit for the fusion cross section of 12C+12C over a wide energy range. After calibrating the effective nuclear potential for 12C+12C using the 12C+13C and 13C+13C fusion cross sections, it is found that a coupled-channels calculation with the ingoing wave boundary condition (IWBC) is capable of predicting the major peak cross sections in 12C+12C. A qualitative explanation for this upper limit is provided by the Nogami-Imanishi model and by level density differences among the compound nuclei. It is found that the strong resonance found at 2.14 MeV in 12C+12C exceeds this upper limit by a factor of more than 20. The preliminary result from the most recent measurement shows a much smaller cross section at this energy, which agrees with our predicted upper limit.
Energy Technology Data Exchange (ETDEWEB)
Azhgirej, L S; Chernykh, E V [Laboratory of High Energies, Joint Institute for Nuclear Research, Dubna (Russian Federation); Kobushkin, A P [Institute of Theoretical Physics, Ukrainian Academy of Sciences, Kiev (Ukraine); and others
1998-12-01
Tensor analysing power T{sub 20} for inelastic (d, d`) X reaction at deuteron momentum from 4.2 to 9 GeV/c is presented. It is observed that T{sub 20} taken as a function of the four-momentum transfer squared t demonstrates an approximate scaling; its absolute value is small at |t| <{approx_equal} (0.05 - 0.1) GeV{sup 2}/c{sup 2} and has a maximum at -t {approx_equal}0.3 GeV{sup 2}/c{sup 2}. No significant dependence on the type of the target was observed 10 refs., 4 figs., 4 tabs.
Energy Technology Data Exchange (ETDEWEB)
Seidling, W.
1990-01-01
Within the framework of the multidisciplinary research project 'Forest ecosystems near agglomerations' carried out at the Technical University of Berlin, modifications of the herbaceous layer were investigated with regard to different spaces and times. Available results on factors of light, water, and nutrients, and regarding biotic, climatic, and logging-dependent disturbances of investigated stands were complemented by phytosociological, stand-sociological, population-biological and light-climatic investigations in experimental sites covering 400 m{sup 2} each. Here the direct relationship between relative light consumption and the closedness of the herbaceous layer could be confirmed. Cluster analyses of floristic similarity showed good agreement with floral-statistics and ecological parameters and correlations to the growth of trees and to the pH value of the upper soil. The expected zoning of vegetation near the stems of trees was confirmed. The stability of populations in relation to time seems to be a function of weather-dependent variations of nitrogen mineralization rates. The repetition of vegetation surveys from the fifties shows a stronger growth of more shadow-tolerant vegetation because of a now denser tree canopy and shrubbery. (JH).
Miyakawa, Takayasu; Miwa, Makiko; Obara, Michio
The 2nd International Conference on Japanese Information in Science Technology and Commerce was held on October 23-25, 1989 at Japanisch-Deutsches Zentrum Berlin, Federal Republic of Germany. During two years since previous Conference at Warwick, England, in 1987, much progresses were made in collecting, using and evaluating Japanese scientific, technological and industrial information in Western countries. On the other hands, overseas supply of Japanese databases and information by Japanese governmental and private organizations have been improved in many aspects. There occurred presentation of papers and valuable exchange of opinions and experiences. The Conference consisted of II Sessions which covered trends and policies, various information sources, analysis and distributions, Japanese language and Kanji processings and direct connection with Japan.
Kelimu, Alimujiang; Guo, Xia; Mamtimin, Batur; Abudula, Abuliz; Upur, Halmurat
2013-01-01
Riboflavin deficiency can cause a variety of metabolic problems that lead to skin and mucosal disorders. Limited evidence suggests that high intake of riboflavin may reduce overall risks of cancer. However, association of this deficiency with cervical cancer and precancerous lesions are still not definitively known. In this study, we characterized the relationship between plasma and tissue riboflavin levels and C20orf54 protein expression in patients with cervical intraepithelial neoplasia (CIN) and cervical squamous cell carcinoma (CSCC) as well as the relationship of these levels with human papillomavirus virus 16, 18 (HPV16/18) infections. High-performance liquid chromatography (HPLC) was used to measure blood riboflavin levels in patients with CIN and CSCC, and an enzyme-linked immunosorbent assay (ELISA) was used to determine tissue riboflavin levels in patients with CSCC and matched normal mucous epithelia. The expression of C20orf54 in fresh CSCC and matched tissues were detected by qRT-PCR and western blot, respectively. And it was further confirmed by immunohistochemistry (IHC) with formalin-fixed, paraffin-embedded CIN and CSCC. An HPV genotyping chip was used to analyze HPV infection and typing. The results showed that patients with CIN and CSCC had decreased plasma riboflavin levels as compared with normal controls. There was also significantly decreased riboflavin in tissues from CSCC patients, when compared with normal cervical epithelia. C20orf54 expression were significantly up-regulated in CSCC compared to matched control on both mRNA and protein level. Tissue riboflavin levels were significantly lower in HPV16/18 positive tissue compared with HPV16/18-negative tissue, and an inverse association was found between tissue riboflavin levels and C20orf54 mRNA and protein expression in CSCC. Additionally, C20orf54 was significantly correlated with tumor stages. In conclusion, C20orf54 tend to play a protective role in Uyghur cervical carcinogenesis of
/sup 16/O(/sup 16/O, /sup 12/C)/sup 20/Ne reaction in the framework of the coupled channel formalism
Energy Technology Data Exchange (ETDEWEB)
Krause, O; Scheid, W; Greiner, W [Frankfurt Univ. (Germany, F.R.). Inst. fuer Theoretische Physik
1974-01-01
The transfer reaction /sup 16/O(/sup 16/O, /sup 12/C)/sup 20/Ne is treated in the coupled channel formalism. The influence of the transfer channels on the intermediate structure in the elastic excitation function is discussed. The /sup 16/O and /sup 20/Ne-nuclei are described in an ..cap alpha..-cluster model.
International Nuclear Information System (INIS)
Asa'd, Z.; Coupland, M.; Davis, D.G.; Duff, B.G.; Gjerpe, I.; Heymann, F.F.; Imrie, D.C.; Lowndes, R.; Lush, G.J.; Phillips, M.; Baglin, C.; Poulet, M.; Yvert, M.; Benso, S.; Buzzo, A.; Ferroni, S.; Gracco, V.; Macri, M.; Santroni, A.; Brobakken, K.; Bugge, L.; Buran, T.; Fearnley, T.; Helgaker, P.; Kirsebom, K.; Moe, A.; Soerensen, S.O.; Hansen, J.D.; Myrheim, J.; Skjevling, G.
1982-01-01
Measurements of the differential elastic cross sections for π - p scattering at incident momenta of 20 and 50 GeV/c and π + p at 50 GeV/c in the momentum transfer range 0.7 2 are presented. The data are compared with various models of elastic scattering. (orig.)
High temperature aging structures of Ni-20Cr-20W alloys
International Nuclear Information System (INIS)
Ohmura, Taizo; Sahira, Kensho; Sakonooka, Akihiko; Yonezawa, Noboru
1977-01-01
High temperature aging structures and age hardening of Ni-20Cr-20W alloys developed as the superalloys for the nuclear energy steelmaking, and effects of C and Zr additions to the alloys and the effect of preheat treatment on these properties were studied. M 6 C, α-W and two kinds of M 23 C 6 having different lattice parameters were found as precipitates in the alloys. M 23 C 6 whose lattice parameter was around 10.7A precipitated in the early stage of aging at 700 0 C-1,150 0 C, and the carbide changed to M 6 C at higher temperature than 1,000 0 C, but it remained as a stable carbide at lower temperature than 900 0 C. α-W precipitated at 800 0 C-1,100 0 C after precipitation of M 23 C 6 and it disappeared with increase of M 6 C. M 23 C 6 having the larger lattice parameter (10.9A) precipitated transitionally in aging stage of 26 x 10 3 in Larson Miller parameter at 900 0 C and 1,000 0 C. Age hardening corresponded to the precipitation of M 23 C 6 and it was reduced by the double pre-heat-treatment. Zr addition and amount of C influenced on the aging structure and age hardening. Zr seemed to be a favorable element to stabilize the carbide. (auth.)
CSIR Research Space (South Africa)
Scott, L
2000-11-01
Full Text Available .elsevier.comrlocatergloplacha Evidence for environmental conditions during the last 20 000 years in Southern Africa from 13C in fossil hyrax dung L. Scott a,), J.C. Vogel b a Department of Botany and Genetics, Uni?ersity of the Orange Free State, PO Box 339, Bloemfontein 9300, South... in the studied hyrax middens, provide evidence that changes oc- curred on a regional scale. This is partly supported 13 by the d C sequences in stalagmite Talma and .Vogel, 1992 . In areas with summer-rains where AsweetB grass is likely to develop, d13C values...
Lu, Cong; Dong, Liming; Lv, Jingwei; Wang, Yan; Fan, Bei; Wang, Fengzhong; Liu, Xinmin
2018-01-05
20(S)-protopanaxadiol (PPD) possesses various biological properties, including anti-inflammatory, antitumor and anti-fatigue properties. Recent studies found that PPD functioned as a neurotrophic agent to ameliorate the sensory deficit caused by glutamate-induced excitotoxicity through its antioxidant effects and exhibited strong antidepressant-like effects in vivo. The objective of the present study was first to investigate the effect of PPD in scopolamine (SCOP)-induced memory deficit in mice and the potential mechanisms involved. In this study, mice were pretreated with PPD (20 and 40 μmol/kg) and donepezil (1.6 mg/kg) intraperitoneally (i.p) for 14 days. Then, open field test was used to assess the effect of PPD on the locomotor activity and mice were daily injected with SCOP (0.75 mg/kg) to induce cognitive deficits and then subjected to behavioral tests by object location recognition (OLR) experiment and Morris water maze (MWM) task. The cholinergic system function, oxidative stress biomarkers and protein expression of Egr-1, c-Fos, and c-Jun in mouse hippocampus were examined. PPD was found to significantly improve the performance of amnesia mice in OLR and MWM tests. PPD regulated cholinergic function by inhibiting SCOP-induced elevation of acetylcholinesterase (AChE) activity, decline of choline acetyltransferase (ChAT) activity and decrease of acetylcholine (Ach) level. PPD suppressed oxidative stress by increasing activities of antioxidant enzymes such as superoxide dismutase (SOD) and lowering maleic diadehyde (MDA) level. Additionally, PPD significantly elevated the expression of Egr-1, c-Fos, and c-Jun in hippocampus at protein level. Taken together, all these results suggested that 20(S)-protopanaxadiol (PPD) may be a candidate compound for the prevention against memory loss in some neurodegenerative diseases such as Alzheimer's disease (AD). Copyright © 2017. Published by Elsevier B.V.
Microstructural evaluation of the NbC-20Ni cemented carbides during sintering
International Nuclear Information System (INIS)
Rodrigues, D.; Cannizza, E.
2016-01-01
Full text: Fine carbides in a metallic matrix (binder) form the microstructure of the cemented carbides. Grain size and binder content are the main variables to adjust hardness and toughness. These products are produced by Powder Metallurgy, and traditional route involves mixing carbides with binder by high energy milling, pressing and sintering. During sintering, a liquid phase promotes densification, and a final relative density higher than 99% is expected. Sintering is carried out at high temperatures, and dissolution of the carbides changes the chemical composition of the binder. To control grain growth of the main carbide, which reduces hardness, small quantities of secondary carbides are used. These additives limit dissolution and precipitation of the main carbides reducing the final grain size. This paper focused the structural and chemical evolution during sintering using NbC-20Ni cermets. Mixtures of very fine NbC carbides and carbonyl Ni powders were produce by intense milling. These mixtures were pressed using uniaxial pressures from 50 to 200MPa. Shrinkage was evaluated using dilatometric measurements under an atmosphere of dynamic argon. Samples were also sintered under vacuum in high temperature industrial furnace. The sintered samples were characterized in terms of density hardness, toughness and microstructure. DRX was the main tool used to evaluate the structural evolution of the binder. In situ chemical analysis helped to understand the dissolution mechanisms. (author)
Mechanism of APC/CCDC20 activation by mitotic phosphorylation.
Qiao, Renping; Weissmann, Florian; Yamaguchi, Masaya; Brown, Nicholas G; VanderLinden, Ryan; Imre, Richard; Jarvis, Marc A; Brunner, Michael R; Davidson, Iain F; Litos, Gabriele; Haselbach, David; Mechtler, Karl; Stark, Holger; Schulman, Brenda A; Peters, Jan-Michael
2016-05-10
Chromosome segregation and mitotic exit are initiated by the 1.2-MDa ubiquitin ligase APC/C (anaphase-promoting complex/cyclosome) and its coactivator CDC20 (cell division cycle 20). To avoid chromosome missegregation, APC/C(CDC20) activation is tightly controlled. CDC20 only associates with APC/C in mitosis when APC/C has become phosphorylated and is further inhibited by a mitotic checkpoint complex until all chromosomes are bioriented on the spindle. APC/C contains 14 different types of subunits, most of which are phosphorylated in mitosis on multiple sites. However, it is unknown which of these phospho-sites enable APC/C(CDC20) activation and by which mechanism. Here we have identified 68 evolutionarily conserved mitotic phospho-sites on human APC/C bound to CDC20 and have used the biGBac technique to generate 47 APC/C mutants in which either all 68 sites or subsets of them were replaced by nonphosphorylatable or phospho-mimicking residues. The characterization of these complexes in substrate ubiquitination and degradation assays indicates that phosphorylation of an N-terminal loop region in APC1 is sufficient for binding and activation of APC/C by CDC20. Deletion of the N-terminal APC1 loop enables APC/C(CDC20) activation in the absence of mitotic phosphorylation or phospho-mimicking mutations. These results indicate that binding of CDC20 to APC/C is normally prevented by an autoinhibitory loop in APC1 and that its mitotic phosphorylation relieves this inhibition. The predicted location of the N-terminal APC1 loop implies that this loop controls interactions between the N-terminal domain of CDC20 and APC1 and APC8. These results reveal how APC/C phosphorylation enables CDC20 to bind and activate the APC/C in mitosis.
[A spatially explicit analysis of traffic accidents involving pedestrians and cyclists in Berlin].
Lakes, Tobia
2017-12-01
In many German cities and counties, sustainable mobility concepts that strengthen pedestrian and cyclist traffic are promoted. From the perspectives of urban development, traffic planning and public healthcare, a spatially differentiated analysis of traffic accident data is decisive. 1) The identification of spatial and temporal patterns of the distribution of accidents involving cyclists and pedestrians, 2) the identification of hotspots and exploration of possible underlying causes and 3) the critical discussion of benefits and challenges of the results and the derivation of conclusions. Spatio-temporal distributions of data from accident statistics in Berlin involving pedestrians and cyclists from 2011 to 2015 were analysed with geographic information systems (GIS). While the total number of accidents remains relatively stable for pedestrian and cyclist accidents, the spatial distribution analysis shows, however, that there are significant spatial clusters (hotspots) of traffic accidents with a strong concentration in the inner city area. In a critical discussion, the benefits of geographic concepts are identified, such as spatially explicit health data (in this case traffic accident data), the importance of the integration of other data sources for the evaluation of the health impact of areas (traffic accident statistics of the police), and the possibilities and limitations of spatial-temporal data analysis (spatial point-density analyses) for the derivation of decision-supported recommendations and for the evaluation of policy measures of health prevention and of health-relevant urban development.
Publications by doctoral candidates at Charité University Hospital, Berlin, from 1998-2008.
Ziemann, Esther; Oestmann, Jörg-Wilhelm
2012-05-01
One quality parameter of medical theses is the number of articles published by the doctoral candidates. Over the course of the past decade the Charité-Universitätsmedizin Berlin has taken steps to improve the quality of the theses completed by its doctoral students in medicine and increase their publication activity. This study was designed to verify the efficacy of these measures and to detect general trends. Medical theses completed in 1998, 2004 and 2008 (sample size >250 for each year) were retrospectively analyzed with regard to associated publications within a 7-year period (from 5 years before completion to 2 years thereafter). Quality and quantity were recorded. Publications found in the PubMed database were evaluated; the impact factor of the publishing journal was used as quality parameter. The sample sizes were 264 for 1998, 316 for 2004, and 316 for 2008. The number of publications per doctoral student increased from 0.78 to 1.39 over the course of the study period, and the average impact factor rose from 2.42 to 3.62. Analysis using the current impact factors of the publishing journals showed an increase from 3.13 to 3.85. The proportion of case reports fell from 12.7% to 8%. The proportion of first authorships remained about the same. The past decade has seen an increase in the number of publications by doctoral students at the Charité and a rise in the average impact factor of the journals concerned.
Architectural practice and theory: the case of Bruno Taut's house in Berlin-Dahlewitz
Directory of Open Access Journals (Sweden)
Paola Ardizzola
2017-06-01
Full Text Available In 1926 Bruno Taut built his own house in Berlin-Dahlewitz. The German architect had already declared his ideas of housing in the book Die neue Whonung (1924 exemplifying the new concept of modern living-style, according to Neues Bauen. In other theoretical writings he defines the Neues Bauen in relation with new needs, tendencies and aesthetics of architecture, referring to important issues as climate, topography and tradition. The book Ein Whonhaus (1927 stigmatizes the coeval construction process of his house: the thirteen chapters are a detailed analysis which give evidence to every technological and morphological choice. Taut focuses on the relationship between architecture and landscape, type of furniture, functional plan layout, use of glass; especially he enlightens the reader as to the use of colour as a construction material. The house has an unconventional shape, it is a quarter of a circle; in his writings the architect painstakingly explains the impressive plan. With the book Ein Whonhaus Taut delivers to memory his home design, transforming process and ideas related to the modern house. He breaks through conventions and changes the notions of what Modernism could produce. The paper highlights the theoretical production related to the architect’s own house as praxis for doing architecture, emphasizing Taut’s contribution to a dialectic mutual relationship between theoretical and architectural practice, in order to achieve a more conscious and effective design process.
International Nuclear Information System (INIS)
Pelz, J.
1991-01-01
Special precipitation measurements performed since September 1961 by the aerosol-laboratory of the (Berlin Free University) Meteorological Institut have been listed and are now present in tabular form. Artifical beta-radioactivity and solid residue have been registered since the beginning of these observations, measurements of the pH-value and of electrical conductivity have been carried out continuously since September 1983 and November 1988, respectively. Some statistical investigations, as trendchecks, are presented; it proved, however, that the registration periods of both, pH-values and conductivity-measurements were not sufficient (too short) for this purpose. The individual paragraphs are supposed to give a general view, special investigations will follow. Within the observation period from September 1961 to December 1990 a total of 17036 l precipitation has been collectet on 4824 days, containing about 776 g solid substances and 98385 Becquerel radioactiv deposits per square meter. (orig.) [de
Effects of whole body cryotherapy and cold water immersion on knee skin temperature.
Costello, J T; Donnelly, A E; Karki, A; Selfe, J
2014-01-01
This study sought to (a) compare and contrast the effect of 2 commonly used cryotherapy treatments, 4 min of -110 °C whole body cryotherapy and 8 °C cold water immersion, on knee skin temperature and (b) establish whether either protocol was capable of achieving a skin temperature (cryotherapy (19.0±0.9 °C) compared to cold water immersion (20.5±0.6 °C). However, from 10 to 60 min post, the average, minimum and maximum skin temperatures were lower (p<0.05) following the cold water treatment. Finally, neither protocol achieved a skin temperature believed to be required to elicit an analgesic effect. © Georg Thieme Verlag KG Stuttgart · New York.
20 CFR 655.1111 - Element I-What hospitals are eligible to participate in the H-1C program?
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Element I-What hospitals are eligible to participate in the H-1C program? 655.1111 Section 655.1111 Employees' Benefits EMPLOYMENT AND TRAINING... Internet website at http://www.access.gpo.gov. (d) To make a determination about information in the settled...
International Nuclear Information System (INIS)
Valicente, Fernando H.; Mourao, Andre H.C.
2008-01-01
The amount and sources of carbon and nitrogen used to produce Bacillus thuringiensis (Berliner)-based biopesticide may influence the quality of the fi nal product. The objective of this research was to test different levels of carbon and nitrogen: medium 1 - 1.5% maize glucose + 0.5% soy fl our, medium 2 - 3.0% maize glucose + 1.0% soy flour, medium 3 - 1.0% maize glucose + 3.0% soy fl our and medium 4 - Luria Bertani (LB) + salts (FeSO 4 , ZnSO 4 , MnSO 4 , MgSO 4 ). The seed culture was produced in LB medium plus salt, under agitation (200 rpm) for 18h at 30 deg C. The strain 344 of Bt was used (B. thuringiensis var tolworthi - belonging to the EMBRAPA's Bt Bank). The pH was measured at regular intervals, and After culturing for 96h, the pH of the four tested media was basified (6.91 and 8.15), the number of spores yielded 4.39 x 10 9 spores/ml in medium 3, where the amount of protein is high. The dry biomass weight accumulated in media 3 was 39.3 g/l. Mortality of 2-day-old larvae Spodoptera frugiperda (J.E. Smith) was 100% when using Bt produced in media 3 and 4. CL 50 for medium 3 was 8.4 x 10 6 spores/ml. All tested media were satisfactory to Bt growth, and medium 3 was the most promising to be used on a large scale Bt-based biopesticide production. (author)
Energy Technology Data Exchange (ETDEWEB)
Valicente, Fernando H. [EMBRAPA Milho e Sorgo, Sete Lagoas, MG (Brazil)]. E-mail: valicent@cnpms.embrapa.br; Mourao, Andre H.C. [Curso de Meio Ambiente, Sete Lagoas, MG (Brazil)
2008-11-15
The amount and sources of carbon and nitrogen used to produce Bacillus thuringiensis (Berliner)-based biopesticide may influence the quality of the fi nal product. The objective of this research was to test different levels of carbon and nitrogen: medium 1 - 1.5% maize glucose + 0.5% soy fl our, medium 2 - 3.0% maize glucose + 1.0% soy flour, medium 3 - 1.0% maize glucose + 3.0% soy fl our and medium 4 - Luria Bertani (LB) + salts (FeSO{sub 4}, ZnSO{sub 4}, MnSO{sub 4}, MgSO{sub 4}). The seed culture was produced in LB medium plus salt, under agitation (200 rpm) for 18h at 30 deg C. The strain 344 of Bt was used (B. thuringiensis var tolworthi - belonging to the EMBRAPA's Bt Bank). The pH was measured at regular intervals, and After culturing for 96h, the pH of the four tested media was basified (6.91 and 8.15), the number of spores yielded 4.39 x 10{sup 9} spores/ml in medium 3, where the amount of protein is high. The dry biomass weight accumulated in media 3 was 39.3 g/l. Mortality of 2-day-old larvae Spodoptera frugiperda (J.E. Smith) was 100% when using Bt produced in media 3 and 4. CL{sub 50} for medium 3 was 8.4 x 10{sup 6} spores/ml. All tested media were satisfactory to Bt growth, and medium 3 was the most promising to be used on a large scale Bt-based biopesticide production. (author)
D'Aurea, Carolina Vicaria Rodrigues; Cerazi, Bruno Gion de Andrade; Laurinavicius, Antonio Gabriele; Janovsky, Carolina Castro Porto Silva; Conceição, Raquel Dilguerian de Oliveira; Santos, Raul D; Bittencourt, Márcio Sommer
2017-01-01
To investigate the inter-relation between high sensitivity C-reactive protein and glycated hemoglobin in prediction of risk of obstructive sleep apnea. We included all individuals participating in a check-up program at the Preventive Medicine Center of Hospital Israelita Albert Einstein in 2014. The Berlin questionnaire for risk of obstructive sleep apnea was used, and the high sensitivity C-reactive protein and glycated hemoglobin levels were evaluated. The sample included 7,115 participants (age 43.4±9.6 years, 24.4% women). The Berlin questionnaire showed changes in 434 (6.1%) individuals. This finding was associated with high sensitivity C-reactive protein and glycated hemoglobin levels (papneia obstrutiva do sono. Foram incluídos todos os indivíduos participantes do programa de check-up do Centro de Medicina Preventiva Hospital Israelita Albert Einstein em 2014. Foi aplicado o questionário de Berlin sobre risco de apneia do sono, e avaliadas as dosagens de hemoglobina glicada e proteína C-reativa de alta sensibilidade. Foram incluídos 7.115 participantes (idade 43,4±9,6 anos, 24,4% mulheres). A prevalência de alteração no questionário de Berlin foi de 434 (6,1%). A alteração do questionário de Berlin associou-se positivamente aos resultados da proteína C-reativa de alta sensibilidade e da hemoglobina glicada (papneia obstrutiva do sono, mesmo após ajuste para obesidade e proteína C-reativa. Estes achados sugerem possível ligação fisiopatológica entre alterações na resistência insulínica e a síndrome da apneia obstrutiva do sono, que independe da obesidade ou inflamação de baixo grau.
Sources of oxygen flux in groundwater during induced bank filtration at a site in Berlin, Germany
Kohfahl, Claus; Massmann, Gudrun; Pekdeger, Asaf
2009-05-01
The microbial degradation of pharmaceuticals found in surface water used for artificial recharge is strongly dependent on redox conditions of the subsurface. Furthermore the durability of production wells may decrease considerably with the presence of oxygen and ferrous iron due to the precipitation of trivalent iron oxides and subsequent clogging. Field measurements are presented for oxygen at a bank filtration site in Berlin, Germany, along with simplified calculations of different oxygen pathways into the groundwater. For a two-dimensional vertical cross-section, oxygen input has been calculated for six scenarios related to different water management strategies. Calculations were carried out in order to assess the amount of oxygen input due to (1) the infiltration of oxic lake water, (2) air entrapment as a result of water table oscillations, (3) diffusive oxygen flux from soil air and (4) infiltrating rainwater. The results show that air entrapment and infiltrating lake water during winter constitute by far the most important mechanism of oxygen input. Oxygen input by percolating rainwater and by diffusive delivery of oxygen in the gas phase is negligible. The results exemplify the importance of well management as a determining factor for water oscillations and redox conditions during artificial recharge.
Rosol, Marit
2010-01-01
This article examines citizen participation in the governance of contemporary urban green space. Rather than exploring normative questions of ideal forms of participatory democracy, it focuses on changing roles and relationships between local state and non-state actors in order to identify and explain the changing nature of participation. I argue that neoliberal urban restructuring has changed the conditions for participation and thus participation itself in fundamental ways and that we need an account of changes in statehood and governance in order to capture this conceptually. Based on the case of community gardens in Berlin, the article discusses the extent to which this changed relationship is expressed by current citizen participation as well as the potential and problems that result from it. My empirical results show the emergence of a new political acceptance of autonomously organized projects and active citizen participation in urban green space governance. The central argument of this article is that this new acceptance can be conceptualized as an expression of the neoliberalization of cities. Nevertheless, this neoliberal strategy at the same time leads to complex and contradictory outcomes and the resulting benefits are also acknowledged.