
Sample records for berkelium 238

  1. New berkelium isotope: 242Bk

    International Nuclear Information System (INIS)

    A new isotope of berkelium, 242Bk, was produced with a cross section of approx. 10 μb in reactions of boron on uranium and nitrogen on thorium. It decays by electron capture with a half-life of 7 +- 1.3 minutes. The branching ratio for this isotope for alpha decay is less than 1% and that for spontaneous fission is less than 0.03%. 2 figures, 2 tables

  2. Characterization of berkelium(III) dipicolinate and borate compounds in solution and the solid state. (United States)

    Silver, Mark A; Cary, Samantha K; Johnson, Jason A; Baumbach, Ryan E; Arico, Alexandra A; Luckey, Morgan; Urban, Matthew; Wang, Jamie C; Polinski, Matthew J; Chemey, Alexander; Liu, Guokui; Chen, Kuan-Wen; Van Cleve, Shelley M; Marsh, Matthew L; Eaton, Teresa M; van de Burgt, Lambertus J; Gray, Ashley L; Hobart, David E; Hanson, Kenneth; Maron, Laurent; Gendron, Frédéric; Autschbach, Jochen; Speldrich, Manfred; Kögerler, Paul; Yang, Ping; Braley, Jenifer; Albrecht-Schmitt, Thomas E


    Berkelium is positioned at a crucial location in the actinide series between the inherently stable half-filled 5f(7) configuration of curium and the abrupt transition in chemical behavior created by the onset of a metastable divalent state that starts at californium. However, the mere 320-day half-life of berkelium's only available isotope, (249)Bk, has hindered in-depth studies of the element's coordination chemistry. Herein, we report the synthesis and detailed solid-state and solution-phase characterization of a berkelium coordination complex, Bk(III)tris(dipicolinate), as well as a chemically distinct Bk(III) borate material for comparison. We demonstrate that berkelium's complexation is analogous to that of californium. However, from a range of spectroscopic techniques and quantum mechanical calculations, it is clear that spin-orbit coupling contributes significantly to berkelium's multiconfigurational ground state. PMID:27563098

  3. Extraction of tetravalent berkelium and cerium by aliquate-336-S-NO3 quaternary ammonium salt

    International Nuclear Information System (INIS)

    Extraction of tetravalent berkelium and cerium by aliquate-336-S-NO3 quaternary ammonium salt from nitric acid solutions is investigated. The effect of concentrations of nitric acid and extracting agent, nature of an oxidant (potassium bromate, potassium bichromate, mixture of AgNO3 and (NH4)2S2O8) and solvent on the distribution coefficient of berkelium(4) and cerium(4) is studied. It is established that solutions of aliquate-336-S-NO3 in carbon tetrachloride and dichloroethane extract quantitatively tetravalent berkelium from 10-12 M nitric acid solutions and cerium - from 1-10 M nitric acid solutions containing potassium bichromate as an oxidant. It is shown that the value of distribution coefficient for berkelium and cerium depends on the nature of an oxidant and extracting agent concentration. It is established that in the case of extraction by quaternary ammonium salt with one berkelium(4) mole four aliquate-336-SNO3 moles are associated and 1.5-1.6 mole of extracting agent are associated with one cerium(4) mole. It permits to make a conclusion that stoichiometry of extraction reactions by quaternary ammonium salt is not the same for tetravalent berkelium and cerium. It is shown that trivalent transplutonium and rare earth elements are not practically extracted by aliquate-336-S-NO3 from nitric acid solutions

  4. WEB 238 courses/snaptutorial


    Kat Martin


    For more classes visit   WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs WEB 238 Week 5DQs  

  5. WEB 238 Courses Tutorial / indigohelp




    WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs WEB 238 Week 5DQs  

  6. WEB 238 UOP Tutorial Course/Uoptutorial




    For More Course Tutorials Visit     WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs   WEB 238 Week 5DQs  

  7. WEB 238 Course tutorial/uophelp




    WEB 238 Entire Course For more course tutorials visit     WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs WEB 238 Week 5DQs

  8. Standardization of 238Pu

    International Nuclear Information System (INIS)

    An ion-implanted Si-detector and NaI(Tl) scintillation detector were employed for the standardization of 238Pu using the coincidence method. The low-energy discrimination method was applied to the degraded alpha spectrum for the efficiency variation, and an energy gate was provided for the X-rays between 7 and 35 keV. Two signals were compared to check their coincidence and counted if they were coincident. Three counts of alphas, X-rays and their coincidences were corrected for their dead times and/or the accidental coincidences between them before being extrapolated to the zero discrimination level of alphas. The resultant specific radioactivity is compared with that of the liquid scintillation counting method, and its evaluated uncertainty is given item by item. The impurity checks of the original solution source were described in brief too

  9. Economical Production of Pu-238

    Energy Technology Data Exchange (ETDEWEB)

    Steven D. Howe; Douglas Crawford; Jorge Navarro; Terry Ring


    All space exploration missions traveling beyond Jupiter must use radioisotopic power sources for electrical power. The best isotope to power these sources is plutonium-238. The US supply of Pu-238 is almost exhausted and will be gone within the next decade. The Department of Energy has initiated a production program with a $10M allocation from NASA but the cost is estimated at over $100 M to get to production levels. The Center for Space Nuclear Research has conceived of a potentially better process to produce Pu-238 earlier and for significantly less cost. The new process will also produce dramatically less waste. Potentially, the front end costs could be provided by private industry such that the government only had to pay for the product produced. Under a NASA Phase I NIAC grant, the CSNR has evaluated the feasibility of using a low power, commercially available nuclear reactor to produce at least 1.5 kg of Pu-238 per year. The impact on the neutronics of the reactor have been assessed, the amount of Neptunium target material estimated, and the production rates calculated. In addition, the size of the post-irradiation processing facility has been established. In addition, a new method for fabricating the Pu-238 product into the form used for power sources has been identified to reduce the cost of the final product. In short, the concept appears to be viable, can produce the amount of Pu-238 needed to support the NASA missions, can be available within a few years, and will cost significantly less than the current DOE program.

  10. 16 CFR 238.2 - Initial offer. (United States)


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Initial offer. 238.2 Section 238.2... § 238.2 Initial offer. (a) No statement or illustration should be used in any advertisement which..., or origin of the product offered, or which may otherwise misrepresent the product in such a...

  11. 47 CFR 90.238 - Telemetry operations. (United States)


    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Telemetry operations. 90.238 Section 90.238... MOBILE RADIO SERVICES Non-Voice and Other Specialized Operations § 90.238 Telemetry operations. The use of telemetry is authorized under this part on the following frequencies. (a) 72-76 MHz (in...

  12. 46 CFR 153.238 - Required materials. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Required materials. 153.238 Section 153.238 Shipping... BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Design and Equipment Cargo Containment Systems § 153.238 Required materials. When one of the following paragraphs of this section...

  13. 40 CFR 238.30 - Requirement. (United States)


    ...) and 1 CFR part 51. Copies are available from the American Society of Testing and Materials, 1916 Race... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 238.30 Section 238.30... CARRIERS Requirement § 238.30 Requirement. (a) No processor or person shall manufacture or import, in...

  14. 49 CFR 238.231 - Brake system. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Brake system. 238.231 Section 238.231... Equipment § 238.231 Brake system. Except as otherwise provided in this section, on or after September 9... train's primary brake system shall be capable of stopping the train with a service application from...

  15. 49 CFR 238.227 - Suspension system. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Suspension system. 238.227 Section 238.227 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... Equipment § 238.227 Suspension system. On or after November 8, 1999— (a) All passenger equipment...

  16. 49 CFR 238.225 - Electrical system. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Electrical system. 238.225 Section 238.225... Equipment § 238.225 Electrical system. All passenger equipment shall comply with the following: (a... derated for grouping and for operating temperature. (b) Main battery system. (1) The main...

  17. 49 CFR 238.427 - Suspension system. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Suspension system. 238.427 Section 238.427... Equipment § 238.427 Suspension system. (a) General requirements. (1) Suspension systems shall be designed to... equipment. (2) Passenger equipment shall meet the safety performance standards for suspension...

  18. 49 CFR 238.425 - Electrical system. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Electrical system. 238.425 Section 238.425... Equipment § 238.425 Electrical system. (a) Circuit protection. (1) The main propulsion power line shall be.... (b) Main battery system. (1) The main batteries shall be isolated from the cab and passenger...

  19. 33 CFR 238.3 - References. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false References. 238.3 Section 238.3 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE WATER RESOURCES POLICIES AND AUTHORITIES: FLOOD DAMAGE REDUCTION MEASURES IN URBAN AREAS § 238.3 References....

  20. 16 CFR 238.1 - Bait advertisement. (United States)


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Bait advertisement. 238.1 Section 238.1 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES AGAINST BAIT ADVERTISING § 238.1 Bait advertisement. No advertisement containing an offer to sell a product should be published when the offer is not a bona fide...

  1. Dicty_cDB: SLA238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA238 (Link to dictyBase) - - - Contig-U16382-1 SLA238Z (Link... to Original site) - - SLA238Z 648 - - - - Show SLA238 Library SL (Link to library) Clone ID SLA238 (Link Representative seq. ID SLA23...8Z (Link to Original site) Representative DNA sequence >SLA238 (SLA238Q) /CSM/SL/SLA2-B/SLA238Q.Seq.d/ XXXXX...ATATTTAAAT GTATAATAATAATAAAATATAATTATTTTTAATGGTTGTTGATCTTTATCCGACTATC sequence update 1997. 5. 7 Translated

  2. Identification of new isotope 238Th

    International Nuclear Information System (INIS)

    Unreported heavy neutron-rich nuclide 238Th has been produced via a multinucleon transfer reaction by 60 MeV/u 18O ions bombardment of natural uranium. Thorium was radiochemically separated from the mixture of uranium and reaction products. 238Pa as a daughter nucleus of 238Th has been identified according to the growth and decay of 238Pa γ rays which has been observed. The half-life of 238Th was determined to be (9.4 +- 2.0) min. At the same time, a new γ ray of (89.0 +- 0.3) keV with T1/2 = (8.9±1.5) min was found in the γ spectrum gated with the Kα1 X ray of Pa and assigned to 238Th decay based on the measurements of its transition energy and the half-life

  3. 49 CFR 238.429 - Safety appliances. (United States)


    ... strength. (2) All safety appliances shall be securely fastened to the car body structure with mechanical... 49 Transportation 4 2010-10-01 2010-10-01 false Safety appliances. 238.429 Section 238.429..., DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Specific Requirements for Tier II...

  4. MGA Analysis on Elevated 238 Pu Samples (United States)

    Wang, T. F.; Moody, K. J.; Raschke, K. E.; Ruhter, W. D.


    Plutonium gamma-ray data analysis, in the 100-keV region, using MGA has been improved to overcome the original maximum limit of 2% 238Pu relative plutonium content in a sample in order to perform an analysis. MGA analysis results of elevated 238Pu samples are compared to the results from mass spectrometry.

  5. 33 CFR 238.9 - Local cooperation. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Local cooperation. 238.9 Section 238.9 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF... Local cooperation. (a) Cost sharing and other provisions of local cooperation shall be in...

  6. 49 CFR 238.103 - Fire safety. (United States)


    ..., 1999 (see 49 CFR parts 200-399, revised as of October 1, 1999), if prior to June 25, 2002 the material... 49 Transportation 4 2010-10-01 2010-10-01 false Fire safety. 238.103 Section 238.103..., DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Safety Planning and General...

  7. The Doppler effect measurement on 238U

    International Nuclear Information System (INIS)

    The UO2 sample was irradiated in the RB zero power reactor in order to determine the Doppler effect on the 238 U by measuring the change in the 238 capture cross section with temperature. The measurement was meant to verify the indigenous developed computer codes and nuclear data library

  8. Dicty_cDB: SSI238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSI238 (Link to dictyBase) - G00811 DDB0185146 Contig-U10256-1 SSI...238Z (Link to Original site) - - SSI238Z 724 - - - - Show SSI238 Library SS (Link to library) Clone ID SSI...riginal site URL ...Representative seq. ID SSI238Z (Link to Original site) Representative DNA sequence >SSI238 (SSI238Q) /CSM/SS/SSI2-B/SSI...(All Frames) Frame A: ---hyhlctir*fiiifqissilcikyysnik*kwpqpked*teknhl*f*vknklln*

  9. On an investigation of the dynamics of ternary fission for the system 238U + 238U

    International Nuclear Information System (INIS)

    With the three center model we have studied the dynamics of ternary fission for the system 238U + 238U by solving the one-dimensional collective Schroedinger equation with the potential energy surface given by the liquid-drop model and the mass parameters given by the Werner-Wheeler method

  10. Redefining design criteria for Pu-238 gloveboxes

    Energy Technology Data Exchange (ETDEWEB)

    Acosta, S.V.


    Enclosures for confinement of special nuclear materials (SNM) have evolved into the design of gloveboxes. During the early stages of glovebox technology, established practices and process operation requirements defined design criteria. Proven boxes that performed and met or exceeded process requirements in one group or area, often could not be duplicated in other areas or processes, and till achieve the same success. Changes in materials, fabrication and installation methods often only met immediate design criteria. Standardization of design criteria took a big step during creation of ``Special-Nuclear Materials R and D Laboratory Project, Glovebox standards``. The standards defined design criteria for every type of process equipment in its most general form. Los Alamos National Laboratory (LANL) then and now has had great success with Pu-238 processing. However with ever changing Environment Safety and Health (ES and H) requirements and Ta-55 Facility Configuration Management, current design criteria are forced to explore alternative methods of glovebox design fabrication and installation. Pu-238 fuel processing operations in the Power Source Technologies Group have pushed the limitations of current design criteria. More than half of Pu-238 gloveboxes are being retrofitted or replaced to perform the specific fuel process operations. Pu-238 glovebox design criteria are headed toward process designed single use glovebox and supporting line gloveboxes. Gloveboxes that will house equipment and processes will support TA-55 Pu-238 fuel processing needs into the next century and extend glovebox expected design life.

  11. Plutonium-238 as a heat source for the artificial heart

    International Nuclear Information System (INIS)

    A total artificial heart system powered for 10 years or more by a 238Pu heat source appears feasible in the near future. However, hypothetical risks and injury and apparent misunderstanding surround the application 238Pu. The consequences of 238Pu already released to the environment, the modes of human uptake of 238Pu and biological responses, the criticality aspects of 238Pu and the magnitude and effects of operational radiation exposures upon the recipient of a 238Pu heat source and the recipient's personal contacts is studied

  12. 33 CFR 238.5 - Comprehensive planning. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Comprehensive planning. 238.5... Comprehensive planning. Coordinated comprehensive planning at the regional or river basin level, or for an urban.... This planning is particularly important in areas where significant portions of a watershed are...

  13. 43 CFR 23.8 - Approval of mining plan. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Approval of mining plan. 23.8 Section 23.8 Public Lands: Interior Office of the Secretary of the Interior SURFACE EXPLORATION, MINING AND RECLAMATION OF LANDS § 23.8 Approval of mining plan. (a) Before surface mining operations may commence...

  14. 49 CFR 238.319 - Running brake test. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Running brake test. 238.319 Section 238.319... Requirements for Tier I Passenger Equipment § 238.319 Running brake test. (a) As soon as conditions safely permit, a running brake test shall be performed on each passenger train after the train has received,...

  15. 16 CFR 238.0 - Bait advertising defined. 1 (United States)


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Bait advertising defined. 1 238.0 Section 238.0 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES AGAINST BAIT ADVERTISING § 238.0 Bait advertising defined. 1 1 For the purpose of this part...

  16. 49 CFR 238.321 - Out-of-service credit. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Out-of-service credit. 238.321 Section 238.321... Requirements for Tier I Passenger Equipment § 238.321 Out-of-service credit. When a passenger car is out of... out-of-service credit....

  17. 49 CFR 238.403 - Crash energy management. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Crash energy management. 238.403 Section 238.403... Equipment § 238.403 Crash energy management. (a) Each power car and trailer car shall be designed with a crash energy management system to dissipate kinetic energy during a collision. The crash...

  18. Pu-238 Supply Program Project Execution Plan

    International Nuclear Information System (INIS)

    This Pu-238 Supply Program Project Execution Plan (PEP) summarizes critical information and processes necessary to manage the program. The PEP is the primary agreement regarding planning and objectives between The Department of Energy Office of Nuclear Energy (DOE NE-75), Oak Ridge National Laboratory Site Office (OSO) and the Oak Ridge National Laboratory (ORNL). The acquisition executive (AE) will approve the PEP. The PEP is a living document that will be reviewed and revised periodically until the project is complete. The purpose of the project is to reestablish the capability to produce plutonium-238 (Pu-238) domestically. This capability consists primarily of procedures, processes, and design information, not capital assets. As such, the project is not subject to the requirements of DOE O 413.3B, but it will be managed using the project management principles and best practices defined there. It is likely that some capital asset will need to be acquired to complete tasks within the project. As these are identified, project controls and related processes will be updated as necessary. Because the project at its initiation was envisioned to require significant capital assets, Critical Decision 0 (CD-0) was conducted in accordance with DOE O 413.3B, and the mission need was approved on December 9, 2003, by William Magwood IV, director of the Office of Nuclear Energy (NE), Science and Technology, DOE. No date was provided for project start-up at that time. This PEP is consistent with the strategy described in the June 2010 report to Congress, Start-up Plan for Plutonium-238 Production for Radioisotope Power Systems.

  19. FIND: Standard Safety Analysis Report (GESSAR-238)

    International Nuclear Information System (INIS)

    This index is presented as a guide to microfiche items in Docket STN-50447, which was assigned to the BWR/6 STANDARD SAFETY ANALYSIS REPORT (GESSAR-238) submitted by General Electric Company, San Jose, California. The report describes and analyzes a standard BWR/6 boiling water reactor with a Mark III containment system designed for initial operation at approximately 3579 MW(t) with a net electrical output of approximately 1220 megawatts

  20. 238U + n resolved resonance energies

    International Nuclear Information System (INIS)

    Neutron transmission measurements from 100 eV to 170 keV at 150 m through four 238U samples are reported. The energy calibration is described, and the resultant 233U resolved resonance energies are found to be intermediate between those from other workers. In addition, some energies for sharp resonances in 23Na, 27Al, 32S, and 206Pb are given

  1. Search for surviving actinides and superheavy nuclei in damped collisions of 238U with 238U and 248Cm

    International Nuclear Information System (INIS)

    In the present talk aspects of the reaction mechanism related to the survival probability of the heaviest fragments in 238U + 238U collisions are discussed first. This is followed by a description of the experiments that have been performed to search for surviving superheavy fragments in the 238U + 238U reaction and by a presentation of the results obtained so far. In a third section our recent first attempts with the 238U + 248Cm reaction are described and preliminary results are discussed. (orig.)


    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Christopher J [ORNL; Wham, Robert M [ORNL; Hobbs, Randall W [ORNL; Owens, R Steven [ORNL; Chandler, David [ORNL; Freels, James D [ORNL; Maldonado, G Ivan [ORNL


    A new supply chain is planned for plutonium-238 using existing reactors at the Oak Ridge National Laboratory (ORNL) and Idaho National Laboratory (INL) and existing chemical recovery facilities at ORNL. Validation and testing activities for new irradiation target designs have been conducted in three phases over a 2 year period to provide data for scale-up to production. Target design, qualification, target fabrication, and irradiation of fully-loaded targets have been accomplished. Data from post-irradiation examination (PIE) supports safety analysis and irradiation of future target designs.

  3. Delayed neutron yield of 238U and 241Pu

    International Nuclear Information System (INIS)

    The total delayed neutron yield for 238U and 241Pu were observed as a function of the incident neutron energy. The measurements extend from 2.5 to 5 MeV for 238U and from 0.15 to 5 MeV for 241Pu. The average ratio of the 241Pu delayed neutron yield to that of 238U is 0.292 +- 0.022

  4. 49 CFR 238.311 - Single car test. (United States)


    ... Director of the Federal Register in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. You may obtain a... 49 Transportation 4 2010-10-01 2010-10-01 false Single car test. 238.311 Section 238.311... Requirements for Tier I Passenger Equipment § 238.311 Single car test. (a) Except for self-propelled...

  5. 238Pu surface contamination of MHW impact shell assembly

    International Nuclear Information System (INIS)

    238PuO2 contamination of the grit blasted surface of the primary impact shell assembly (PISA) of the multi-hundred watt isotopic heat source was measured. The study determined the amount and distribution of the 238PuO2 and characterization of its behavior during aging at 13500C. The results concluded that normal decontamination effectively removes the superficial 238PuO2 but does not extract the 238PuO2 which is deep within the grit blasted structure. Subsequent heating results in migration of microcurie amounts of plutonium out of the grit blasted structure

  6. Study on the formation of the composite system of 238U+238U

    Institute of Scientific and Technical Information of China (English)

    WU Xi-Zhen; TIAN Jun-Long; ZHAO Kai; ZHANG Ying-Xun; LI Zhu-Xia


    Strongly damped reactions of 238U+238U, at Ecm = 680-1880 MeV have been studied based on the improved quantum molecular dynamics model. We find that at a certain energy region the entrance channel potential is weakly repulsive and the dissipation is very strong after touching configuration, these two effects make the time delay of re-separation for colliding system. The single particle potential well of the transiently formed composite system has Coulomb barrier about 15-20 MeV high at the surface, which makes the excited unbound protons being still embedded in the potential well and moving in a common mono-single particle potential for a period of time and thus restrains from quick decay of the composite system.

  7. Dynamical Effects of Orientations on reaction 238U+238U near Coulomb Barrier

    International Nuclear Information System (INIS)

    The dynamical effects of three orientations (nose-nose, nose-side, and side-side) on reaction 238U+238U have been investigated by using Improved Quantum Molecular Dynamics(ImQMD) model. Due to Coulomb repulsive interaction, the change of the deformations or orientations of colliding nuclei is found even before touching configuration, especially for nose-nose. The average lifetime of the giant system and the probability producing super-heavy fragments (SHF) with Z>110 are found to be dependent on the orientations of two nuclei. At the time of 1000fm/c after re-separation of giant system, side-side orientation provide a larger probability of producing SHF than nose-nose case. And the maximum value of the probability locates a smaller incident energy for side-side orientation compared with nose-nose.

  8. Nuclear alignment: classical dynamic model for 238U- 238U system

    International Nuclear Information System (INIS)

    Dynamical properties of 238U- 238U system at the classical turning point, specifically the distance of closest approach, the relative orientations of the nuclei and deformations have been studied at sub-coulomb energy of Elab = 6.07 MeV/nucleon using a classical dynamical model with a variable moment of inertia. Probability of favorable alignment for anomalous positron-electron pair emission through vacuum decay is calculated. The calculated small favorable alignment probability value of 0.116 is found to be enhanced by about 16% in comparison with the results of a similar study using a fixed moment of inertia as well as the results from a semiquantal calculation reported earlier. (author)

  9. Containment of nitric acid solutions of Plutonium-238 (United States)

    Reimus, M. A. H.; Silver, G. L.; Pansoy-Hjelvik, L.; Ramsey, K. B.


    The corrosion of various metals that could be used to contain nitric acid solutions of Pu-238 has been studied. Tantalum and tantalum/2.5% tungsten resisted the test solvent better than 304L stainless steel and several INCONEL alloys. The solvent used to imitate nitric acid solutions of Pu-238 contained 70% nitric acid, hydrofluoric acid, and ammonium hexanitratocerate.

  10. Dicty_cDB: SFL238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFL238 (Link to dictyBase) - - - Contig-U16463-1 SFL238P (Link to Original ... r preparing catalase using the genetic engineering technology . 86 1e-31 4 AX536932 |AX536932.1 Sequence 533 from ...

  11. Dicty_cDB: SFJ238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFJ238 (Link to dictyBase) - - - Contig-U12087-1 SFJ238Z (Link to Original ... CP000901_1027( CP000901 |pid:none) Yersinia pestis Angola , complet... 34 3.4 BC167318_1( BC167318 |pid:none) ...

  12. MGA Analysis on Elevated {sup 238}Pu Samples

    Energy Technology Data Exchange (ETDEWEB)

    Wang, T F; Moody, K J; Raschke, K E; Ruhter, W D


    Plutonium gamma-ray data analysis, in the 100-keV region, using MGA has been improved to overcome the original maximum limit of 2% {sup 238}Pu relative plutonium content in a sample in order perform an analysis. MGA analysis results of elevated {sup 238}Pu samples are compared to the results from mass spectrometry.

  13. 49 CFR 238.413 - End structures of trailer cars. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false End structures of trailer cars. 238.413 Section... II Passenger Equipment § 238.413 End structures of trailer cars. (a) Except as provided in paragraph (b) of this section, the end structure of a trailer car shall be designed to include the...

  14. 49 CFR 238.233 - Interior fittings and surfaces. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Interior fittings and surfaces. 238.233 Section... I Passenger Equipment § 238.233 Interior fittings and surfaces. (a) Each seat in a passenger car... determined by the railroad: (1) Longitudinal: 8g; (2) Vertical: 4g; and (3) Lateral: 4g. (c) Other...

  15. 49 CFR 238.435 - Interior fittings and surfaces. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Interior fittings and surfaces. 238.435 Section... II Passenger Equipment § 238.435 Interior fittings and surfaces. (a) Each seat back and seat.... (d)(1) Other interior fittings shall be attached to the passenger car body with sufficient...

  16. New heavy neutron—rich isotope 238Th

    Institute of Scientific and Technical Information of China (English)

    XUYanbing; YUANShuanggui; 等


    A new nuclide 238Th has been produced via multinucleon transfer reaction by 60MeV/u 18O ion irradiation of the natural uranium.The thorium was radiochemically separated from the mixture of uranium and reaction products.The activity of thorium was mneasured by using an HPGe detector and a planar HPGe detector.The 238Th has been identified for the first time by measuring the growth and decay of the γ-rays from its daughter 238Pa.The half-life of 238Th was determined to be 9.4±2.0min .Inaddition a new γ-ray of 89.0±0.3keV with T1/2=8.9±1.5min was found in the γ spectrum gated with X-rays of Pa and assigned to 238Th β- decay based on measurements of transition energy and half life.

  17. A new heavy neutron-rich isotope 238Th

    International Nuclear Information System (INIS)

    A new nuclide 238Th has been produced via multinucleon transfer reaction induced by 60 MeV/u 18O ion irradiation of natural uranium. The thorium was radiochemically separated from the mixture of uranium and its reaction products. The activity of thorium was measured by using a HPGe detector and a planar HPGe detector. The 238Th has been identified for the first time by measuring the growth and decay of the γ-rays from its daughter 238Pa. The half-life of 238Th was determined to be (9.4 +- 2.0) min. In addition a new (89.0 +- 0.3) keV γ-ray with T1/2 = (8.9 +- 1.5) min was observed and assigned to 238Th decay based on the measurement of transition energy and half life

  18. 238U issues resolved and unresolved

    International Nuclear Information System (INIS)

    The interaction of 1 eV to 20 MeV neutrons with 238U is discussed. In the region from 1.5 to 4 keV there are differences of the order of 15% between the values of the neutron widths of the main resonances reported by several experimenters or obtained by different evaluators. Above a 4 keV there are only sparse results of resonance analysis and most evaluations adopt a statistical treatment of the resonance structure. However, an inspection of good resolution data suggests that the energy and neutron width of the most prominent resonances could be determined with reasonable accuracy at least up to 10 keV. Some factors affecting the determination of the average properties of the resonance parameters are discussed. Above the inelastic-scattering threshold, energy-averaged neutron total, scattering, capture and fission cross sections are reviewed in a unified manner integrating measurement, calculation and evaluation. (n;n') and (n;2n') energy-transfer mechanisms are addressed. Particular attention is given to neutron capture, stressing precisions consistent with applied need. Fission properties are discussed including: prompt and delayed fission-neutron spectra and nubar, and fission-product yields. (Auth.)

  19. Determination of Doppler Effect on nuclear resonances of uranium-238

    International Nuclear Information System (INIS)

    This paper deals with theoretical and experimental study of Doppler effect on 238U resonances. The chosen experimental method was based on measuring gamma activities of irradiated UO2 samples with natural uranium since this activity depends on the total absorption in 238U dependent on the temperature of the sample. Special electrical heater was used for heating the samples irradiated in the core of RB reactor. Due to significant perturbation of neutron flux caused by the presence of the heater it was necessary to develop a model for calculation of Doppler effect on 238U in the used sample. Scintillation NaI(Tl) detector was used for gamma activity measurements

  20. 7 CFR 1280.238 - OMB Control Numbers. (United States)


    ... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE LAMB PROMOTION, RESEARCH, AND INFORMATION ORDER Lamb Promotion, Research, and Information Order Miscellaneous § 1280.238 OMB Control Numbers... control number for the nominee background form is 0505-0001....

  1. Neutron Capture and Fission Measurement on ^238Pu at DANCE (United States)

    Chyzh, Andrii; Wu, Ching-Yen; Kwan, Elaine; Henderson, Roger; Gostic, Jolie; Couture, Aaron; Young, Hye; Ullmann, John; O'Donnell, John; Jandel, Marian; Haight, Robert; Bredeweg, Todd


    Neutron capture and fission reactions on actinides are important in nuclear engineering and physics. DANCE (Detector for Advanced Neutron Capture Measurement, LANL) combined with PPAC (avalanche technique based fission tagging detector, LLNL) were used to study the neutron capture reactions in ^238Pu. Because of extreme spontaneous α-radioactivity in ^238Pu and associated safety issues, 3 separate experiments were performed in 2010-2012. The 1st measurement was done without fission tagging on a 396-μg thick target. The 2nd one was with PPAC on the same target. The 3rd final measurement was done on a thin target with a mass of 40 μg in order to reduce α-background load on PPAC. This was the first such measurement in a laboratory environment. The absolute ^238Pu(n,γ) cross section is presented together with the prompt γ-ray multiplicity in the ^238Pu(n,f) reaction.

  2. New heavy neutron-rich isotope 238Th

    International Nuclear Information System (INIS)

    A new nuclide 238Th has been produced via multinucleon transfer reaction by 60 MeV/u 18O ion irradiation of the natural uranium. The thorium was radiochemically separated from the mixture of uranium and reaction products. The activity of thorium was measured by using an HPGe detector and a planar HPGe detector. The 238Th has been identified for the first time by measuring the growth and decay of the γ-rays from its daughter 238Pa. The half-life of 238Th was determined to be 9.4 +- 2.0 min. In addition, a new γ-ray of 89.0 +- 0.3 keV with T1/2 = 8/.9 +- 1.5 min was found in the γ spectrum gated with X-rays of Pa and assigned to 239Th β-decay based on measurements of transition energy and half life

  3. Separation and identification of a new isotope 238Th

    International Nuclear Information System (INIS)

    Natural uranium targets are irradiated with 60 MeV/u 18O ions. A new heavy neutron-rich isotope 238Th is produced by the multinucleon transfer reaction. Thorium is radiochemically separated from the uranium and mixture of reaction products. The γ singles spectra tine sequence spectra are measured by using a HPGe detector. Based on the observation of the growth and decay for the 1060.5 keV γ-ray of 238Pa, a daughter of 238Th in measuring of γ-spectra for the separated thorium fraction, a new neutron-rich isotope 238Th is identified at the first time. Its half-life is 9.4 +- 2.0 min

  4. Containment of nitric acid solutions of Plutonium-238

    International Nuclear Information System (INIS)

    The corrosion of various metals that could be used to contain nitric acid solutions of Pu-238 has been studied. Tantalum and tantalum/2.5% tungsten resisted the test solvent better than 304L stainless steel and several INCONEL alloys. The solvent used to imitate nitric acid solutions of Pu-238 contained 70% nitric acid, hydrofluoric acid, and ammonium hexanitratocerate. copyright 1999 American Institute of Physics

  5. Economical Production of Pu-238: NIAC Phase I Final Report (United States)

    Howe, Steven D.; Crawford, Douglas; Navarro, Jorge; O'Brien, Robert C.; Katalenich, Jeff; Ring, Terry


    All space exploration missions traveling beyond Jupiter must use radioisotopic power sources for electrical power. The best isotope to power these sources is plutonium-238 (Pu-238). The US supply of Pu-238 is almost exhausted and will be gone within the next decade. The Department of Energy has initiated a production program with a $10M allocation from NASA but the cost is estimated at over $100M to get to production levels. The Center for Space Nuclear Research (CSNR) has conceived of a potentially better process to produce Pu-238 earlier and for significantly less cost. Potentially, the front end capital costs could be provided by private industry such that the government only had to pay for the product produced. In the Phase I NIAC (NASA Innovative Advanced Concepts) grant, the CSNR has evaluated the feasibility of using a low power, commercially available nuclear reactor to produce 1.5 kg of Pu-238 per year. The impact on the neutronics of the reactor have been assessed, the amount of Neptunium target material estimated, and the production rates calculated. In addition, the size of the post-irradiation processing facility has been established. Finally, as the study progressed, a new method for fabricating the Pu-238 product into the form used for power sources has been identified to reduce the cost of the final product. In short, the concept appears to be viable, can produce the amount of Pu-238 needed to support the NASA missions, can be available within a few years, and will cost significantly less than the current DOE program.

  6. Observation of the new heavy neutron-rich isotope 238Th

    International Nuclear Information System (INIS)

    A new nuclide 238Th was produced via multinucleon transfer reaction by 60 MeV/u 18O ion irradiation of the natural uranium. The thorium was radiochemically separated from the mixture of uranium and reaction products. The growth and decay of 238Pa gamma rays was observed, identifying the 238Pa parent as 238Th. The half-life of 238Th was determined to be 9.4±2.0 min

  7. Interception and retention of 238Pu deposition by orange trees

    International Nuclear Information System (INIS)

    Radioisotope thermoelectric generators (RTG) transform the heat produced during the alpha decay of 238Pu into electrical energy for use by deep-space probes, such as the Voyager spacecraft, which have returned images and other data from Jupiter, Saturn and Uranus. Future missions involving RTGs may be launched aboard the space shuttle, and there is a remote possibility that an explosion of liquid-hydrogen and liquid-oxygen fuel could rupture the RTGs and disperse 238Pu into the atmosphere over central Florida. Research was performed to determine the potential transport to man of atmospherically dispersed Pu via contaminated orange fruits. The results indicate that the major contamination of oranges would result from the interception and retention of 238Pu deposition by fruits. The resulting surface contamination could enter human food chains through transfer to internal tissues during peeling or in the reconstituted juices and flavorings made from orange skins. The interception of 238Pu deposition by fruits is especially important because the results indicate no measurable loss of Pu from fruit surfaces through time or with washing. Approximately 1% of the 238Pu deposited onto an orange grove would be harvested in the year following deposition

  8. Neutron Capture Cross Section Measurement on 238Pu at DANCE

    International Nuclear Information System (INIS)

    The proposed neutron capture measurement for 238Pu was carried out in Nov-Dec, 2010, using the DANCE array at LANSCE, LANL. The total beam-on-target time is about 14 days plus additional 5 days for the background measurement. The target was prepared at LLNL with the new electrplating cell capable of plating the 238Pu isotope simultaneously on both sides of the 3-(micro)m thick Ti backing foil. A total mass of 395 (micro)g with an activity of 6.8 mCi was deposited onto the area of 7 mm in diameter. The 238Pu sample was enriched to 99.35%. The target was covered by 1.4 (micro)m double-side aluminized mylar and then inserted into a specially designed vacuum-tight container, shown in Fig. 1, for the 238Pu containment. The container was tested for leaks in the vacuum chamber at LLNL. An identical container without 238Pu was made as well and used as a blank for the background measurement.

  9. Neutron Capture Cross Section Measurement on $^{238}$Pu at DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Chyzh, A; Wu, C Y


    The proposed neutron capture measurement for {sup 238}Pu was carried out in Nov-Dec, 2010, using the DANCE array at LANSCE, LANL. The total beam-on-target time is about 14 days plus additional 5 days for the background measurement. The target was prepared at LLNL with the new electrplating cell capable of plating the {sup 238}Pu isotope simultaneously on both sides of the 3-{micro}m thick Ti backing foil. A total mass of 395 {micro}g with an activity of 6.8 mCi was deposited onto the area of 7 mm in diameter. The {sup 238}Pu sample was enriched to 99.35%. The target was covered by 1.4 {micro}m double-side aluminized mylar and then inserted into a specially designed vacuum-tight container, shown in Fig. 1, for the {sup 238}Pu containment. The container was tested for leaks in the vacuum chamber at LLNL. An identical container without {sup 238}Pu was made as well and used as a blank for the background measurement.

  10. Simultaneous evaluation for (n,f) cross section of 235U, 239Pu, 238U and (n,γ) cross sections of 238U

    International Nuclear Information System (INIS)

    The fission cross sections for 235U, 238U, 239Pu, the capture cross sections for 238U and the ratios for 239Pu(n,f)/235U(n,f), 238U(m,f)/235U(n,f), 238U(n,γ)/235U(n,f) were firstly evaluated respectively. The experimental data were collected, analysed, selected and corrected. The data were fitted with spline fit program

  11. Technology and fabrication of plutonium-238 radionuclide heat sources (United States)

    Malikh, Y. A.; Aldoshin, A. I.; Danilkin, E. A.


    This paper outlines a brief technical description of the facility for production of plutonium-238 and fabrication of Radionuclide Heat Sources (RHS) containing Pu-238. Technical capabilities of the RHS fabrication facility are presented. The results of development of the RHS design for sea application are discussed. RHS fuel pellet comprises the tantalum shell with an annular slot intended for release of radiogenic helium and the Pu-238 dioxide core with reinforcing elements inside which contact with the shell. RHS is a double encapsulation consisting of the inner ``power'' capsule and the outer corrosion-resistant capsule. The chromium-nickel-molybdenum XH65MB alloy which is equivalent to Hastelloy-C alloy has been selected as a material for both capsules. Upon expiration of working life, RHS design is capable of withstanding the internal pressure of radiogenic helium at 1073 K within 30 minutes and the external hydrostatic pressure of 100 MPa at normal temperature.

  12. Plutonium-236 traces determination in plutonium-238 by α spectrometry

    International Nuclear Information System (INIS)

    Two methods are described in this report for the determination of plutonium-236 traces in plutonium-238 by a spectrometry using semi-conductor detectors. The first method involves a direct comparison of the areas under the peaks of the α spectra of plutonium-236 and plutonium-238. The electrolytic preparation of the sources is carried out after preliminary purification of the plutonium. The second method makes it possible to determine the 236Pu/238Pu ratio by comparing the areas of the α peaks of uranium-232 and uranium-234, which are the decay products of the two plutonium isotopes respectively. The uranium in the source, also deposited by electrolysis, is separated from a 1 mg amount of plutonium either by a T.L.A. extraction, or by the use of ion-exchange resins. The report ends with a discussion of the results obtained with plutonium of two different origins. (authors)

  13. Mass distribution in 238U(32S, f) reaction

    International Nuclear Information System (INIS)

    Nuclear fission is a complex process involving large scale collective rearrangement of nuclear matter. Detailed fission fragment mass distribution studies are important to understand the interplay of the structure and dynamics in the fission process. Conventional methods to study fission fragment mass distribution (by measuring the energy and/or the time of flight of the correlated fission fragments) are limited to a mass resolution of 4-5 units. We have carried out fission fragment mass distribution studies for 238U(32S, f) and 238U(12C,f) systems. In this paper, we report the isotopic yield distribution and the fragment mass distribution for the 238U(32S,f) reaction at incident energies 220 MeV and 185 MeV

  14. Toxicity of inhaled 238PuO2 II

    International Nuclear Information System (INIS)

    Studies are in progress to determine dose-response relationships for inhaled 238PuO2. Beagle dogs were given a single, brief, nose-only inhalation exposure to aerosols of monodisperse particles of 238PuO2. Aerosols of two sizes were used, 1.5 μm aerodynamic diameter (AD) and 3.0 μm AD. Dogs were exposed to achieve initial lung burdens of 0.56, 0.28, 0.14, 0.07, 0.03 or 0.01 μCi 238PuO2/kg body weight. Twelve dogs were exposed at each activity level to each aerosol particle size. The local dose around each 3.0 μm AD particle was 10 times higher than the local dose around 1.5 μm AD particles, but the dose averaged over the whole lung was the same at each activity level for both particle sizes. The lung retention of 238Pu was divided into two phases of clearance. During the first 100 days after exposure, the average retention half-time for 238Pu in the lung was 310 days. When the solubility changed due to particle breakup, the retention half-time decreased to 180 days during the period from 1OO to 1,500 days after exposure. The first biological effects observed were lymphopenia and neutropenia in peripheral blood. To date, 28 Beagle dogs have died at times from 536 to 1683 days after exposure. Initial lung burdens for the dead dogs ranged from 0.18 to 2.2 μCi 238Pu/kg body weight. Nine died with radiation pneumonitis and pulmonary fibrosis, 10 died with lung tumors and 19 dogs died with bone tumors. There are 116 exposed and 22 control dogs surviving and under observation. Current patterns of dose versus response are discussed. (author)

  15. 40 CFR 52.238 - Commitment to undertake rulemaking. (United States)


    ... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Commitment to undertake rulemaking. 52... (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS California § 52.238 Commitment to undertake rulemaking. (a) The Administrator shall undertake rulemaking, after the South Coast mobile source...

  16. Characterization of Pu-238 Heat Source Granule Containment

    Energy Technology Data Exchange (ETDEWEB)

    Richardson, Paul Dean II [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sanchez, Joey Leo [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wall, Angelique Dinorah [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Chavarria, Rene [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The Milliwatt Radioisotopic Themoelectric Generator (RTG) provides power for permissive-action links. Essentially these are nuclear batteries that convert thermal energy to electrical energy using a doped silicon-germanium thermopile. The thermal energy is provided by a heat source made of 238Pu, in the form of 238PuO2 granules. The granules are contained by 3 layers of encapsulation. A thin T-111 liner surrounds the 238PuO2 granules and protects the second layer (strength member) from exposure to the fuel granules. An outer layer of Hastalloy-C protects the T-111 from oxygen embrittlement. The T-111 strength member is considered the critical component in this 238PuO2 containment system. Any compromise in the strength member seen during destructive testing required by the RTG surveillance program is characterized. The T-111 strength member is characterized through Scanning Electron Microscopy (SEM), and Metallography. SEM is used in the Secondary Electron mode to reveal possible grain boundary deformation and/or cracking in the region of the strength member weld. Deformation and cracking uncovered by SEM are further characterized by Metallography. Metallography sections are mounted and polished, observed using optical microscopy, then documented in the form of microphotographs. SEM mat further be used to examine polished Metallography mounts to characterize elements using the SEM mode of Energy Dispersive X-ray spectroscopy (EDS).

  17. Structure effects in 238U-induced dissipative collisions

    International Nuclear Information System (INIS)

    A high resolution kinematic coincidence set-up using position sensitive gas detectors was developed to study 238U - induced reactions on 110Pd and 124Sn targets between 5.70 and 6.02 MeV/u bombarding energies. Nuclear structure effects were observed in the distribution of binary reaction products possibly caused by enhanced multinucleon transfer matrix elements. (orig.)

  18. 49 CFR 238.407 - Anti-climbing mechanism. (United States)


    ... power car constructed with a crash energy management design is permitted to crush in a controlled manner... Equipment § 238.407 Anti-climbing mechanism. (a) Each power car shall have an anti-climbing mechanism at its... yielding. (c) The forward coupler of a power car shall be attached to the car body to resist a...

  19. 33 CFR 238.7 - Decision criteria for participation. (United States)


    ... alternative. Water damage associated with inadequate carrying capacity of man-made structures should be..., natural storage (wetlands) or detention basins or diversions with limited capacity. Other conditions could... in § 238.4(b) and must be justified based on Corps of Engineers evaluation procedures in use at...

  20. Pu-238 fuel form activities, January 1-31, 1981

    Energy Technology Data Exchange (ETDEWEB)


    This monthly report for /sup 238/Pu Fuel Form Activities has two main sections: SRP-PuFF facility and SRL Fuel Form Activities. The program status, budget information, and milestone schedules are discussed in each main section. The Work Breakdown Structure (WBS) for this program is shown. Only one monthly report per year is processed for EDB.

  1. 49 CFR 238.21 - Special approval procedure. (United States)


    ..., DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS General § 238.21 Special approval procedure.... (Requests for approval of programs for the inspection, testing, and maintenance of Tier II passenger... designated representatives of its employees, together with a list of the names and addresses of the...

  2. Precise measurement and calculation of 238U neutron transmissions

    International Nuclear Information System (INIS)

    The total neutron cross section of 238U has been measured above 0.5 eV in precise transmission experiments and results are compared with ENDF/B-IV. Emphasis has been on measuring transmissions through thick samples in order to obtain accurate total cross sections in the potential-resonance interference regions between resonances. 4 figures, 1 table

  3. 42 CFR 455.238 - Conflict of interest. (United States)


    ... guidance, found under 48 CFR subpart 9.5. (2) The standards and requirements that are contained in each... 5 CFR 2635.203(b)), payment of expenses, offer of employment, or any other thing of value from any... 42 Public Health 4 2010-10-01 2010-10-01 false Conflict of interest. 455.238 Section...

  4. Flux of 238U and 232Th in Changjiang estuary

    International Nuclear Information System (INIS)

    The study of fluxes of the U, Th of Changjiang River into the East China Sea and its adjacent waters is basic work to understanding of U, Th tracer theirselves and their corresponding biogeochemical cycles process in estuaries, coastal. By sampling in the Xuliujing (i.e. the interface between fresh water and sea water) every month, 200 L water was filtered through 0.45μm fabric cartridge to collect particle nuclides. The dissolved nuclides were co-precipitated using Fe(OH)3 and MnO2. The range of 238U activity in water is 2.30-10.32 Bq·m-3, with an average of 5.48±1.19 Bq·m-3; the activity of 232Th is 1.08-2.32 Bq·m-3, with an average of 1.75±0.29 Bq·m-3. Changjiang River conveyed 238U 4.06 x 1012Bq, 232Th 1.54 x 1012 Bq into the estuary every year. Further study of the seasonal variations 238U, 232Th input to the sea, indicating that: the activity of 238U and Changjiang River estuary water flux have a certain degree of negative correlation (R2=0.65, n=12); the main source of 232Th is the weathering of the river. The activity of 232Th is large on the spring and autumn because of strong weathering in Changjiang Basin comparison with other seasons. Compared with the other estuaries in the world, the flux of 238U and 232Th of the Changjiang River estuary is large because of its large fluxes of sediments and runoff in the world. (authors)

  5. 238Pu fuel form processes. Final report, January-September 1983

    International Nuclear Information System (INIS)

    Progress is reported on the following: analytical studies of weld-quench cracking in DOP-26 iridium alloy, iridium/238PuO2 compatibility test, surface area measurements of 238PuO2 using the Blaine air permeability apparatus, and helium release from 238PuO2

  6. 28 CFR 2.38 - Community supervision by U.S. Probation Officers. (United States)


    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Community supervision by U.S. Probation Officers. 2.38 Section 2.38 Judicial Administration DEPARTMENT OF JUSTICE PAROLE, RELEASE, SUPERVISION AND... § 2.38 Community supervision by U.S. Probation Officers. (a) Pursuant to sections 3655 and...

  7. 49 CFR 238.207 - Link between coupling mechanism and car body. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Link between coupling mechanism and car body. 238.207 Section 238.207 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL... Requirements for Tier I Passenger Equipment § 238.207 Link between coupling mechanism and car body....

  8. Development of AN Active 238UF6 Gas Target (United States)

    Eckardt, C.; Enders, J.; Freudenberger, M.; Göök, A.; von Neumann-Cosel, P.; Oberstedt, A.; Oberstedt, S.


    Detailed studies of the fission process, e.g., the search for parity nonconservation (PNC) effects, the energy dependence of fission modes or the population of fission isomers, depend on high quality data, therefore requiring high luminosities. An active gas target containing uranium may overcome the deterioration of energy and angular resolution caused by large solid target thicknesses. A single Frisch-grid ionization chamber has been built to test a mixture of standard counting gases (e.g., argon) with depleted uranium hexafluoride (238UF6), utilizing a triple alpha source to evaluate signal quality and drift velocity. For mass fractions of up to 4 percent of 238U the drift velocity increases with rising UF6 content, while a good signal quality and energy resolution is preserved.

  9. Measurement of the fission cross section of 238Pu

    International Nuclear Information System (INIS)

    The fission cross sections of 238Pu have been measured from 0.1 eV to 80 keV energy range using the Rensselaer Intense Neutron Spectrometer. The cross sections were normalized to the 235U ENDF/B-V data broadened to the resolution of the Rensselaer Intense Neutron Spectrometer system. The fission areas and widths were determined for the resolved low-energy resonances. The ENDF/B-V fission cross sections for the 238Pu isotope are, in general, not in good agreement with the measured cross sections and a new evaluation is recommended. The observations of structure in the unresolved fission cross sections is suggestive of the existence of intermediate structure. 18 refs., 1 fig., 1 tab

  10. Verification of uranium 238 quantity calculated using waste assay systems

    International Nuclear Information System (INIS)

    The amount of 238U in uranium-contaminated waste drums generated in the decommissioning of nuclear facilities is evaluated from γ-ray measurement. We used the γ-ray measurement system made from CANBERRA(Qualitative and Quantitative (Q2) Low Level Waste Assay Systems) and measured the waste drums. This system assumes uniform distribution of uranium. But, homogeneity can not be checked with real waste drums. Authors developed the new analysis technique which calculates the amount of uranium by correcting the influence of uneven distribution of the uranium. As a result of evaluating using the new analysis technique, the error which influences quantitative value of 238U has been evaluated. (author)

  11. Design of a Pu-238 waste incineration process

    International Nuclear Information System (INIS)

    Combustible 238Pu waste is generated as a result of normal operation and decommissioning activity at the Savannah River Plant and is being retrievably stored at the Plant. As part of the long-term plan to process the stored waste and current waste in preparation for future disposition, a 238Pu incinceration process is being cold-tested at SRL. The incineration process consists of a continuous-feed preparation system, a two-stage, electrically fired incinerator, and a filtration off-gas system. Process equipment has been designed, fabricated, and installed for nonradioactive testing and cold run-in. Design features to maximize the ability to remotely maintain the equipment were incorporated into the process. Interlock, alarm, and control functions are provided by a programmable controller. Cold testing is scheduled to be completed in 1986


    International Nuclear Information System (INIS)

    The Bok globule CB238 has been investigated in 13CO (220.4 GHz), C18O (109.7 GHz), CS (97.9 and 146.7 GHz), and SO (99.3 GHz) lines, and mapped with half-power beamwidths of 11'', 22'', 38'', 16'', and 36'', respectively. The two dense cores previously found in NH3 are presently confirmed in CS. The cores exhibit similar physical and chemical characteristics. The lack of outflows, the limited chemical content, and the very modest depletion in the ammonia cores provide evidence that CB238 is not an evolved object. Molecular abundances and density ratios constrain chemical modeling whose results provide a chemical age close to the free-fall timescale.

  13. Delayed fission of the 238U muonic atom

    International Nuclear Information System (INIS)

    The time distributions of fission and muon free decay events with respect to the moment of the muon-stop event have been measured for double and triple coincidences between these three events. The triple-coincidence time distributions give an indication of the o-curence of two new effects: the delayed fission of muonic 238U atom and conversion of muons from the fission fragments

  14. Recovery and purification of uranium-234 from aged plutonium-238

    International Nuclear Information System (INIS)

    The current production methods used to recover and purify uranium-234 from aged plutonium-238 at Mound Laboratory are presented. The three chemical separation steps are described in detail. In the initial separation step, the bulk of the plutonium is precipitated as the oxalate. Successively lower levels of plutonium are achieved by anion exchange in nitrate media and by anion exchange in chloride media. The procedures used to characterize and analyze the final U3O8 are given

  15. Pu-238 assay performance with the Canberra IQ3 system

    International Nuclear Information System (INIS)

    Canberra Industries has recently completed a demonstration project at the Westinghouse Savannah River Site (WSRC) to characterize 55-gallon drums containing Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 waste to detection limits of less than 50 nCi/g using gamma assay techniques. This would permit reclassification of these drums from transuranic (TRU) waste to low-level waste (LLW). The instrument used for this assay was a Canberra IQ3 high sensitivity gamma assay system, mounted in a trailer. The results of the measurements demonstrate achievement of detection levels as low as 1 nCi/g for low density waste drums, and good correlation with known concentrations in several test drums. In addition, the data demonstrates significant advantages for using large area low-energy germanium detectors for achieving the lowest possible MDAs for gamma rays in the 80-250 keV range. 1 fig., 2 tabs

  16. Pu-238 assay performance with the Canberra IQ3 system

    Energy Technology Data Exchange (ETDEWEB)

    Booth, L.; Gillespie, B.; Seaman, G.


    Canberra Industries has recently completed a demonstration project at the Westinghouse Savannah River Site (WSRC) to characterize 55-gallon drums containing Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 waste to detection limits of less than 50 nCi/g using gamma assay techniques. This would permit reclassification of these drums from transuranic (TRU) waste to low-level waste (LLW). The instrument used for this assay was a Canberra IQ3 high sensitivity gamma assay system, mounted in a trailer. The results of the measurements demonstrate achievement of detection levels as low as 1 nCi/g for low density waste drums, and good correlation with known concentrations in several test drums. In addition, the data demonstrates significant advantages for using large area low-energy germanium detectors for achieving the lowest possible MDAs for gamma rays in the 80-250 keV range. 1 fig., 2 tabs.

  17. Polonium 210Po, uranium (234U, 238U and plutonium (238Pu, 239+240Pu bioaccumulation in marine birds

    Directory of Open Access Journals (Sweden)

    Strumińska-Parulska D. I.


    Full Text Available The aim of this work was the determination of 210Po, 234U, 238U, 238Pu and 239+240Pu concentration in marine birds which permanently or temporally live in the southern Baltic Sea coast. We chose 11 species of seabirds: three species permanently residing at southern Baltic Sea, four species of wintering birds and three species of migrating birds. The results show that analyzed radionuclides are non-uniformly distributed in the marine birds. The highest activities of 210Po were observed in feathers, muscles and liver. The highest uranium content was found in liver, rest of viscera and feathers, while plutonium in the digestion organs and feathers. Omnivore seabirds accumulated more polonium, plutonium than species that feed on fish, while herbivore seabirds accumulated more uranium than carnivore.

  18. Radiochemical measurements of the formation cross sections of actinide isotopes in the reaction of 238U ions with 238U

    International Nuclear Information System (INIS)

    The method of high-pressure liquid chromatography was used to separate metal cations and anions. Thereby the influence of different parameters on the separation of lanthanides by cation exchange and extraction chromatography was systematically investigated. The results were used to optimize that separation cycle, in which the elements from Z = 26 to Z = 101 were separated taking into account especially the group of actinides. These separations and the subsequent spectroscopy of gamma radiation, alpha particles and spontaneous fission fragments were used to determine formation cross sections in heavy ion reactions as a function of the atomic charge and the mass number. The most important point was the investigation of the collision of 238U ions at different bombarding energies. On the basis of the measured formation cross sections conclusions can be drawn on the reaction mechanism and the excitation function of the formation of transplutonium elements. According to the results it seems to be reasonable to use transfer reactions between 238U and 238U or 248Cm to synthesize superheavy nuclei around Z = 114. Until now that has been tried only with the help of fusion reactions and the results were negative. (orig.)

  19. Phosphate fertilizer influence on {sup 238} U content in vegetables

    Energy Technology Data Exchange (ETDEWEB)

    Lauria D, C.; Rodrigues S, J.I. [Instituto de Radioprotecao e Dosimetria (IRD/CNEN), Av. Salvador Allende s/n, Rio de Janeiro-RJ (Brazil); Ribeiro, F.C.A. [Centro Regional de Ciencias Nucleares (CRCN/CNEN) Av. Prof. Luiz Freire 200 Cidade Universitaria Recife-PE (Brazil)]. e-mail:


    Uranium is a naturally radioactive element, which is usually found in soils, superficial and ground water, vegetables and animals. After ingestion by human beings, most is excreted in few days by feces and urine, without reaching the bloodstream. However, a small part circulates through the body, being accumulated in the soft tissues, as kidneys. A minor fraction can remain in bones per some years, being able through the radioactive decay to irradiate adjacent tissues. Phosphate fertilizers used in conventional crop management can present variable amounts of uranium. In accordance with origin and use, the fertilizer can raise the content of this element in vegetables, and consequently to increase the human exposure for radiation due the consumption of vegetables. It is estimated that the use of phosphate fertilizer has at least doubled the prolonged exposure of humans from ingestion of food. This work aims to evaluate the contribution of organic and chemical fertilizer on the concentration of {sup 238} U in vegetable samples. An experiment with black beans (a very important vegetable for Brazilian people) was conducted in a field which soil has never been fertilized with any sort of fertilizer, located near to the Rio de Janeiro city. On the organic management, bovine manure was used, while on conventional management urea, potassium chloride and superphosphate were used. Simultaneously, black bean samples from not fertilized management were collected. In addition, lettuce and carrot samples from organic and conventional managements were collected in Nova Friburgo farms (the most important vegetable supplier of Rio de Janeiro city market). The analyses of {sup 238} U have been carried out by conventional fluorimetric method. The geometric mean of {sup 238} U concentrations in the carrot and lettuce samples from conventional management were similar with those from organic management, while for beans the conventional samples had higher values than those ones found in

  20. Phosphate fertilizer influence on 238 U content in vegetables

    International Nuclear Information System (INIS)

    Uranium is a naturally radioactive element, which is usually found in soils, superficial and ground water, vegetables and animals. After ingestion by human beings, most is excreted in few days by feces and urine, without reaching the bloodstream. However, a small part circulates through the body, being accumulated in the soft tissues, as kidneys. A minor fraction can remain in bones per some years, being able through the radioactive decay to irradiate adjacent tissues. Phosphate fertilizers used in conventional crop management can present variable amounts of uranium. In accordance with origin and use, the fertilizer can raise the content of this element in vegetables, and consequently to increase the human exposure for radiation due the consumption of vegetables. It is estimated that the use of phosphate fertilizer has at least doubled the prolonged exposure of humans from ingestion of food. This work aims to evaluate the contribution of organic and chemical fertilizer on the concentration of 238 U in vegetable samples. An experiment with black beans (a very important vegetable for Brazilian people) was conducted in a field which soil has never been fertilized with any sort of fertilizer, located near to the Rio de Janeiro city. On the organic management, bovine manure was used, while on conventional management urea, potassium chloride and superphosphate were used. Simultaneously, black bean samples from not fertilized management were collected. In addition, lettuce and carrot samples from organic and conventional managements were collected in Nova Friburgo farms (the most important vegetable supplier of Rio de Janeiro city market). The analyses of 238 U have been carried out by conventional fluorimetric method. The geometric mean of 238 U concentrations in the carrot and lettuce samples from conventional management were similar with those from organic management, while for beans the conventional samples had higher values than those ones found in organic management

  1. Neutron Induced Capture and Fission Processes on 238U


    Oprea Cristiana; Oprea Alexandru


    Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit – Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present...

  2. Dicty_cDB: SLD238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Value N ( AU052389 ) Dictyostelium discoideum slug cDNA, clone SLD238. 533 e-156... 2 ( AU052473 ) Dictyostelium discoideum slug cDNA, clone SLD384. 533 e-156 2 ( AU053348 ) Dictyostelium discoideum slug... cDNA, clone SLI436. 533 e-156 2 ( AU052949 ) Dictyostelium discoideum slug cDNA, clone SLF368. ...533 e-156 2 ( AU033974 ) Dictyostelium discoideum slug cDNA, clone SLB679. 533 e-...156 2 ( AU052416 ) Dictyostelium discoideum slug cDNA, clone SLD280. 533 e-156 2 ( AU052488 ) Dictyostelium discoideum slug

  3. Evaluation of the 238U neutron total cross section

    International Nuclear Information System (INIS)

    Experimental energy-averaged neutron total cross sections of 238U were evaluated from 0.044 to 20.0 MeV using regorous numerical methods. The evaluated results are presented together with the associated uncertainties and correlation matrix. They indicate that this energy-averaged neutron total cross section is known to better than 1% over wide energy regions. There are somwewhat larger uncertainties at low energies (e.g., less than or equal to 0.2 MeV), near 8 MeV and above 15 MeV. The present evaluation is compard with values given in ENDF/B-V

  4. Database for 238U inelastic scattering cross section evaluation

    International Nuclear Information System (INIS)

    There are discrepancies among evaluated neutron inelastic scattering cross sections for 238U in the evaluated nuclear data files, JENDL-3, ENDF/B-VI, JEF-2, BROND-2 and CENDL-2. Re-evaluating them is internationally being discussed to obtain the best outcome which can be accepted in common at the present by experts in the world. This report has been compiled to review the discrepancies among the evaluations in the present data files and to provide a common database for the re-evaluation work (author)

  5. Charge-pickup of 238U at relativistic energies

    International Nuclear Information System (INIS)

    Cross sections for the charge-pickup of 238U projectiles were measured at E/A=600 and 1000 MeV for seven different targets (Be, C, Al, Cu, In, Au and U). Events with two fission fragments with a sum charge of 93 in the exit channel were selected. Due to the significant excitation energy, the dominant part of produced Np nuclei fission instead of decaying to the ground state by evaporation. The observed cross sections can be well reproduced by intranuclear-cascade-plus-evaporation calculations and, therefore, confirm recent results that no exotic processes are needed to explain charge-pickup processes. (orig.)

  6. A study on physical characteristics of supercritical light - water reactor loaded with (232U-238Th-238U) oxide fuel

    International Nuclear Information System (INIS)

    The attractiveness of using (U-Th)-fuel in supercritical light water reactor is considered. The dilution of 233U in 238U is proposed with the purpose of increasing non-proliferation of this fissile isotope. Comparison of different fuel compositions is accomplished from the point of view of fissile isotope breeding and achieved burn-up; parasitic neutron absorption cross-sections are also compared. It is analyzed the impact for neutron balance of both cladding materials: zirconium alloy and stainless steel

  7. Intermediate structure in the 238U neutron capture cross section

    International Nuclear Information System (INIS)

    Recent measurements of the 238U neutron capture cross section show large fluctuations in the unresolved resonance region. To test whether or not the observed long-range fluctuation of the neutron capture represent departures from the compound nuclear model, the Wald-Wolfowitz runs and correlation tests were applied to the 238U neutron capture data obtained at ORELA. The Wald-Wolfowitz runs test deals with the statistic, R, which is the number of unbroken sequences of data points above or below a given reference line. This statistic is to be compared with the expected value of runs E(R) +- sigma(R) arising from randomly distributed data. In the correlation test we have computed the first serial correlation coefficient of the data as well as its expected value and variance for a set of random data. In both tests one computes the probability, P, for the given statistical entity to depart from its expected value by more than epsilon standard deviations. Both tests confirm the presence of intermediate structure between 5 and 100 keV. The range of the structure far exceeds the width of the experimental resolution and level widths. 3 tables, 2 figures

  8. 238UF6 and 235UF6 spectra measurement in mid IR spectral range

    International Nuclear Information System (INIS)

    Making use of a diode laser one measured the absorption spectra of 238UF6 and 235UF6 molecules within v1+v3 combined oscillation band at λ=7.68 μm wavelength. To determine the possibility to measure 235UF6/ 238UF6 isotope ratio with the required accuracy one measured the absorption factors of 235UF6 and 238UF6 isotope specimens and determined the sources of the errors and the ways to minimize them

  9. The production of unknown neutron-rich isotopes in $^{238}$U+$^{238}$U collisions at near-barrier energy

    CERN Document Server

    Zhao, Kai; Zhang, Yingxun; Wang, Ning; Li, Qingfeng; Shen, Caiwan; Wang, Yongjia; Wu, Xizhen


    The production cross sections for primary and residual fragments with charge number from $Z$=70 to 120 produced in the collision of $^{238}$U+$^{238}$U at 7.0 MeV/nucleon are calculated by the improved quantum molecular dynamics (ImQMD) model incorporated with the statistical evaporation model (HIVAP code). The calculation results predict that about sixty unknown neutron-rich isotopes from element Ra ($Z$=88) to Db ($Z$=105) can be produced with the production cross sections above the lower bound of $10^{-8}$ mb in this reaction. And almost all of unknown neutron-rich isotopes are emitted at the laboratory angles $\\theta_{lab}\\leq$ 60$^\\circ$. Two cases, i.e. the production of the unknown uranium isotopes with $A\\geq$ 244 and that of rutherfordium with $A\\geq$ 269 are investigated for understanding the production mechanism of unknown neutron-rich isotopes. It is found that for the former case the collision time between two uranium nuclei is shorter and the primary fragments producing the residues have smaller...

  10. National low-level waste management program radionuclide report series, Volume 15: Uranium-238

    International Nuclear Information System (INIS)

    This report, Volume 15 of the National Low-Level Waste Management Program Radionuclide Report Series, discusses the radiological and chemical characteristics of uranium-238 (238U). The purpose of the National Low-Level Waste Management Program Radionuclide Report Series is to provide information to state representatives and developers of low-level radioactive waste disposal facilities about the radiological, chemical, and physical characteristics of selected radionuclides and their behavior in the waste disposal facility environment. This report also includes discussions about waste types and forms in which 238U can be found, and 238U behavior in the environment and in the human body

  11. Some physico-chemical and radiation properties of plutonium-238 metal prepared by electrochemical amalgamation

    International Nuclear Information System (INIS)

    Pu-238 metal was prepared by electrolytic amalgamation from Pu(III) acetate aqueous solution and by followed by the thermal decomposition of the Pu amalgam. The density, specific heat power, γ-spectra, neutron flux, and corrosion kinetics in dry air at ambient temperature of the prepared 238Pu metal were measured. The neutron flux and γ-spectra from 238Pu metal have been attributed to spontaneous and induced fission and to (α,α'γ), (α,pγ), and (α,nγ) nuclear reactions on light nuclei. The electrochemically prepared 238Pu metal was shown to generate fewer neutrons, produce less gamma radiation, and contains lower 10B, 19F, and 28Si impurities in comparison with biomedical 238PuO2. The increase of neutron flux from the sample due to the reaction 18O(α,nγ) 21Ne was shown to be proportional to the increase of the mass of the 238Pu metal with time due to corrosion in dry air. 238Pu metal corrosion rate maximum and average values (1.1 x 10-2 and 4.7 x 10-3 mg cm-2 h-1, respectively) obtained in dry air were an order of magnitude higher than the rates published for 239Pu under similar experiment conditions. The difference between the 239Pu and 238Pu metal corrosion rate and mechanism is proposed to be due to the greater radiation effects and temperature on the 238Pu surface

  12. Radioactive secular equilibrium in 238U and 232Th series in granitoids from Greece

    International Nuclear Information System (INIS)

    Granitoid rocks belonging to plutons of Greece, covering a wide range of compositions and rock-types, have been studied for their specific activity (Bq/kg) of 238U and 226Ra from 238U radioactive series and 228Ra and 228Th from 232Th radioactive series by using gamma-ray spectroscopy. Results on the radioactive secular equilibrium of both 238U and 232Th radioactive series are presented by studying the 226Ra/238U and 228Ra/228Th ratios. The majority of the samples are in radioactive secular equilibrium for 226Ra/238U±1σ. However, several samples exhibit 226Ra/238U ratios significantly different from 1. The distortion of the secular equilibrium in the 226Ra–238U isotopic system of those samples has occurred over the last 1 Ma, and can be associated with post-magmatic processes, mainly rock–water interactions. All studied samples have 228Ra/228Th ratios equal to unity ±1σ. Consequently, they can be considered to be in secular equilibrium for the last 40 a. - Highlights: ► Generally, a strong correlation between 238U and 226Ra is obvious. ► Post-magmatic processes caused radioactive disequilibrium in the 238U isotopic system. ► All samples are in radioactive secular equilibrium in the 232Τh isotopic system. ► There is no correlation between mineralogy, texture, colour, age and the isotopic ratios studied

  13. Dose effect for South Serbians due to {sup 238}U in natural drinking water

    Energy Technology Data Exchange (ETDEWEB)

    Sahoo, S.K.; Matsumoto, M.; Shiraishi, K.; Fujimoto, K. [Department of Radiation Dosimetry, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Cuknic, O.; Zunic, Z.S. [Institute of Nuclear Sciences, VINCA, PO Box 522, 11001 Belgrade (Serbia)


    The use of depleted uranium ammunition in South Serbia during the 1999 Kosovo conflict raised a great deal of public concern in the Balkans. Radioactivity levels of {sup 238}U in 20 wells and lake water samples were checked from the viewpoint of internal radiation exposure for South Serbian subjects. We have measured {sup 238}U concentration using inductively coupled plasma mass spectrometry, whereas thermal ionisation mass spectrometry has been used for the measurement of isotope ratios, e.g. {sup 234}U/{sup 238}U and {sup 235}U/{sup 238}U. The concentration of uranium in water samples varies in the range 1.37-63.18 mBq/L. {sup 234}U belongs to the {sup 238}U natural radioactive decay series, and at secular equilibrium, the abundance ratio, {sup 234}U/{sup 238}U, corresponds to the ratio of their half-lives. The {sup 234}U/{sup 238}U activity ratio varies in the range 0.88-2.2 and {sup 235}U/{sup 238}U isotope ratio varies from 0.00698 to 0.00745. These findings indicate that uranium in water was a mixture of natural and anthropogenic origin. The annual effective dose due to {sup 238}U was estimated to be in the range 9.2 x 10{sup -5} - 2.1 x 10{sup -3} mSv. (authors)

  14. Neutron Induced Capture and Fission Processes on 238U

    Directory of Open Access Journals (Sweden)

    Oprea Cristiana


    Full Text Available Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit – Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present evaluations are necessary in order to obtain the field of neutrons in the design of nuclear reactors and they are compared with experimental data from literature obtained from capture and (n,xn processes.

  15. Neutron Induced Capture and Fission Processes on 238U (United States)

    Oprea, Cristiana; Oprea, Alexandru


    Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit - Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present evaluations are necessary in order to obtain the field of neutrons in the design of nuclear reactors and they are compared with experimental data from literature obtained from capture and (n,xn) processes.

  16. Resonant upscattering effects on 238U absorption rates

    International Nuclear Information System (INIS)

    The new requirements of accuracy in reactor physics calculations justify a review of the current models, like that one adopted in the cross-section processing, for a better evaluation of the keff and the resonant absorption rates. In this context, the aim of this paper is to investigate the effects of the free gas kernel developed by Sanchez on the 238U absorption rates. Homogeneous medium tests point out the increase of the absorption rates in the left wing of the resonances due to the upscattering produced by the new kernel. Heterogeneous tests show that the absorption in the left wing of the resonances is mostly affected by the scattering anisotropy in the laboratory system. (author)

  17. New evaluation of 238U neutron resonance parameters

    International Nuclear Information System (INIS)

    The neutron resonance parameters of 238U were obtained in the energy range 1 keV to 20 keV from a SAMMY Reich-Moore analysis of high resolution transmission measurements performed at ORELA. In the energy range 1 keV to 10 keV, the analysis used as prior values the ENDF/B-VI resonance parameters. The analysis in the energy range 10 keV to 20 keV resulted in the creation of a set of resonance parameters for the representation of the cross section in this energy range. The results are compared to the ENDF/B-VI evaluation. Some statistical properties of the new resonance parameters are examined. (author)

  18. Measurement and resonance analysis of neutron transmission through uranium-238

    International Nuclear Information System (INIS)

    Neutron transmissions through 0.076-, 0.254-, 1.080-, and 3.620-cm-thick samples of isotopically enriched 238U were measured from 0.88 to 100.0 keV by means of a time-of-flight technique over a path length of 150 m, the ORELA pulsed neutron source, and a 13-mm-thick lithium-glass detector. To obtain resonance parameters, these transmissions from 0.88 to 4.00 keV were simultaneously least-squares shape-fitted with a multilevel Breil--Wigner cross-section formalism. In general, large neutron widths were obtained, resulting in an s-wave strength function of (1.208 +- 0.045) x 10-4 over the interval from 0.0 to 4.0 keV. An absolute energy scale accurate to 2 parts in 10,000 was established. 11 figures, 16 tables

  19. Helium release from 238PuO2 fuel particles

    International Nuclear Information System (INIS)

    Coated plutonia fuel particles have recently been proposed for potential use in future space exploration missions that employ radioisotope power systems and/or radioisotope heater units (RHUs). The design of this fuel form calls for full retention of the helium generated by the natural radioactive decay of 238Pu, with the aid of a strong zirconium carbide coating. This paper reviews the potential release mechanisms of helium in small-grain (7-40 μm) plutonia pellets currently being used in the General Purpose Heat Source (GPHS) modules and RHUs, during both steady-state and transient heating conditions. The applicability of these mechanisms to large-grain and polycrystalline 238PuO2 fuel kernels is examined and estimates of helium release during a re-entry heating pulse up to 1723 K are presented. These estimates are based on the reported data for fission gas release from granular and monocrystal UO2 fuel particles irradiated at isothermal conditions up to 6.4 at.% burnup and 2030 K. It is concluded that the helium release fraction from large-grain (≥300 μm) plutonia fuel kernels heated up to 1723 K could be less than 7%, compared to ∼80% from small-grain (7-40 μm) fuel. The helium release fraction from polycrystalline plutonia kernels fabricated using Sol-Gel techniques could be even lower. Sol-Gel fabrication processes are favored over powder metallurgy, because of their high precision and excellent reproducibility and the absence of a radioactive dust waste stream, significantly reducing the fabrication and post-fabrication clean-up costs

  20. Summary of Plutonium-238 Production Alternatives Analysis Final Report

    Energy Technology Data Exchange (ETDEWEB)

    James Werner; Wade E. Bickford; David B. Lord; Chadwick D. Barklay


    The Team implemented a two-phase evaluation process. During the first phase, a wide variety of past and new candidate facilities and processing methods were assessed against the criteria established by DOE for this assessment. Any system or system element selected for consideration as an alternative within the project to reestablish domestic production of Pu-238 must meet the following minimum criteria: Any required source material must be readily available in the United States, without requiring the development of reprocessing technologies or investments in systems to separate material from identified sources. It must be cost, schedule, and risk competitive with existing baseline technology. Any identified facilities required to support the concept must be available to the program for the entire project life cycle (notionally 35 years, unless the concept is so novel as to require a shorter duration). It must present a solution that can generate at least 1.5 Kg of Pu-238 oxide per year, for at least 35 years. It must present a low-risk, near-term solution to the National Aeronautics and Space Administration’s urgent mission need. DOE has implemented this requirement by eliminating from project consideration any alternative with key technologies at less than Technology Readiness Level 5. The Team evaluated the options meeting these criteria using a more detailed assessment of the reasonable facility variations and compared them to the preferred option, which consists of target irradiation at the Advanced Test Reactor (ATR) and the High Flux Isotope Reactor (HFIR), target fabrication and chemical separations processing at the ORNL Radiochemical Engineering Development Center, and neptunium 237 storage at the Materials and Fuels Complex at INL. This preferred option is consistent with the Records of Decision from the earlier National Environmental Policy Act (NEPA) documentation

  1. Precise measurement and analysis of neutron transmission through 238U

    International Nuclear Information System (INIS)

    The transmissions of 0.52- to 4000-eV neutrons through 3.62, 1.08-, 0.254-, 0.0762-, 0.0254-, and 0.0127-, and 0.0036-cm-thick samples of uranium, enriched in the 238U isotope, have been measured at 42 m with a 1.0-mm-thick 6Li glass detector using the Oak Ridge Electron Linear Accelerator pulsed neutron source. To obtain resonance parameters, the seven transmissions of neutrons having energies ranging from 0.52 to 1086.8 eV have been shape-fitted by least-squares analysis to a multilevel Breit-Wigner cross-section formalism with ''picket-fence'' terms to account for truncation effects. This simultaneous fit yielded a chi2 per degree of freedom near unity. Averaged over this energy range, an s-wave strength function of (0.968 +- 0.036) x 10-4 cm and an effective radius of (0.944 +- 0.005) x 10-12 cm were obtained. In addition, these transmission data yielded an average radiation width of 23.1 +- 1.0 meV for the 12 lowest energy s-wave resonances with radiation widths of 23.0 +- 0.8, 22.8 +- 0.8, and 22.9 +- 0.8 meV for the 6,67-, 20.9-, and 36.8-eV resonances, respectively. The derived radiation widths for these three resonances are shown to depend on the cross-section formalism employed. This work suggests that a multilevel formalism with truncation compensation is required to adequately represent the 238U total cross section


    Energy Technology Data Exchange (ETDEWEB)

    Fuller, Kenneth S. Jr.; Smith, Robert H. Jr.; Goergen, Charles R.


    Plutonium-238 is used in Radioisotope Thermoelectric Generators (RTGs) to generate electrical power and in Radioisotope Heater Units (RHUs) to produce heat for electronics and environmental control for deep space missions. The domestic supply of Pu-238 consists of scrap material from previous mission production or material purchased from Russia. Currently, the United States has no significant production scale operational capability to produce and separate new Pu-238 from irradiated neptunium-237 targets. The Department of Energy - Nuclear Energy is currently evaluating and developing plans to reconstitute the United States capability to produce Pu-238 from irradiated Np-237 targets. The Savannah River Site had previously produced and/or processed all the Pu-238 utilized in Radioisotope Thermoelectric Generators (RTGs) for deep space missions up to and including the majority of the plutonium for the Cassini Mission. The previous full production cycle capabilities included: Np-237 target fabrication, target irradiation, target dissolution and Np-237 and Pu-238 separation and purification, conversion of Np-237 and Pu-238 to oxide, scrap recovery, and Pu-238 encapsulation. The capability and equipment still exist and could be revitalized or put back into service to recover and purify Pu-238/Np-237 or broken General Purpose Heat Source (GPHS) pellets utilizing existing process equipment in HB-Line Scrap Recovery, and H-anyon Frame Waste Recovery processes. The conversion of Np-237 and Pu-238 to oxide can be performed in the existing HB-Line Phase-2 and Phase-3 Processes. Dissolution of irradiated Np-237 target material, and separation and purification of Np-237 and Pu-238 product streams would be possible at production rates of ~ 2 kg/month of Pu-238 if the existing H-Canyon Frames Process spare equipment were re-installed. Previously, the primary H-Canyon Frames equipment was removed to be replaced: however, the replacement project was stopped. The spare equipment is

  3. Capability to Recover Plutonium-238 in H-Canyon/HB-Line - 13248

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, Kenneth S. Jr.; Smith, Robert H. Jr.; Goergen, Charles R. [Savannah River Nuclear Solutions, LLC, Savannah River Site, Aiken, SC 29802 (United States)


    Plutonium-238 is used in Radioisotope Thermoelectric Generators (RTGs) to generate electrical power and in Radioisotope Heater Units (RHUs) to produce heat for electronics and environmental control for deep space missions. The domestic supply of Pu-238 consists of scrap material from previous mission production or material purchased from Russia. Currently, the United States has no significant production scale operational capability to produce and separate new Pu-238 from irradiated neptunium-237 targets. The Department of Energy - Nuclear Energy is currently evaluating and developing plans to reconstitute the United States capability to produce Pu-238 from irradiated Np-237 targets. The Savannah River Site had previously produced and/or processed all the Pu-238 utilized in Radioisotope Thermoelectric Generators (RTGs) for deep space missions up to and including the majority of the plutonium for the Cassini Mission. The previous full production cycle capabilities included: Np- 237 target fabrication, target irradiation, target dissolution and Np-237 and Pu-238 separation and purification, conversion of Np-237 and Pu-238 to oxide, scrap recovery, and Pu-238 encapsulation. The capability and equipment still exist and could be revitalized or put back into service to recover and purify Pu-238/Np-237 or broken General Purpose Heat Source (GPHS) pellets utilizing existing process equipment in HB-Line Scrap Recovery, and H-Canyon Frame Waste Recovery processes. The conversion of Np-237 and Pu-238 to oxide can be performed in the existing HB-Line Phase-2 and Phase- 3 Processes. Dissolution of irradiated Np-237 target material, and separation and purification of Np-237 and Pu-238 product streams would be possible at production rates of ∼2 kg/month of Pu-238 if the existing H-Canyon Frames Process spare equipment were re-installed. Previously, the primary H-Canyon Frames equipment was removed to be replaced: however, the replacement project was stopped. The spare equipment

  4. 37 CFR 2.38 - Use by predecessor or by related companies. (United States)


    ... related companies. 2.38 Section 2.38 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... Use by predecessor or by related companies. (a) If the first use of the mark was by a predecessor in title or by a related company (sections 5 and 45 of the Act), and the use inures to the benefit of...

  5. 49 CFR 238.105 - Train electronic hardware and software safety. (United States)


    ... all hardware and software components and their interfaces; and comprehensive hardware and software... 49 Transportation 4 2010-10-01 2010-10-01 false Train electronic hardware and software safety. 238... and General Requirements § 238.105 Train electronic hardware and software safety. The requirements...

  6. 49 CFR 238.119 - Rim-stamped straight-plate wheels. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Rim-stamped straight-plate wheels. 238.119 Section... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Safety Planning and General Requirements § 238.119 Rim-stamped straight-plate wheels. (a)(1) Except as provided in paragraph (a)(2) of...

  7. 48 CFR 552.238-70 - Identification of Electronic Office Equipment Providing Accessibility for the Handicapped. (United States)


    ... PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 552.238-70 Identification of Electronic Office.... “Handicapped individuals” mean qualified individuals with impairments as cited in 29 CFR 1613.702(f) who can... Electronic Office Equipment Providing Accessibility for the Handicapped. 552.238-70 Section...

  8. 49 CFR 238.111 - Pre-revenue service acceptance testing plan. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Pre-revenue service acceptance testing plan. 238... and General Requirements § 238.111 Pre-revenue service acceptance testing plan. (a) Passenger equipment that has previously been used in revenue service in the United States. For passenger...

  9. 49 CFR 238.411 - Rear end structures of power car cabs. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Rear end structures of power car cabs. 238.411... II Passenger Equipment § 238.411 Rear end structures of power car cabs. The rear end structure of the cab of a power car shall be designed to include the following elements, or their structural...

  10. 49 CFR 238.409 - Forward end structures of power car cabs. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Forward end structures of power car cabs. 238.409... II Passenger Equipment § 238.409 Forward end structures of power car cabs. This section contains requirements for the forward end structure of the cab of a power car. (A conceptual implementation of this...

  11. Spatiotemporal variation of dissolved 238U in the Gironde fluvial-estuarine system (France)

    International Nuclear Information System (INIS)

    Dissolved uranium (238UD) was measured within the Gironde fluvial-estuarine system (France), which is well known for its heavy metal pollution and its subsequent environmental effects. Dissolved 238U activities exhibit the highest levels and variability in the small watersheds of the Isle and Riou-Mort rivers, ascribed to low discharges and the occurrence of peculiar features (local U ore deposits; Permian layers). The major tributaries of the Gironde Estuary: Garonne, Lot and Dordogne, show rather stable 238UD, higher than the global mean riverine uranium activity. In the Gironde Estuary 238UD behaves conservatively along the river-estuary-ocean transect. Dissolved 238U distribution in the Gironde fluvial-estuarine system can be explained by the characteristics of considered drainage basins. There is no evidence of anthropogenic pollution

  12. Studying nuclear level densities of 238U in the nuclear reactions within the macroscopic nuclear models

    International Nuclear Information System (INIS)

    In this work the nuclear level density parameters of 238U have been extracted in the back-shifted Fermi gas model (BSFGM), as well as the constant temperature model (CTM), through fitting with the recent experimental data on nuclear level densities measured by the Oslo group. The excitation functions for 238U(p,2nα)233Pa, and 238U(p,4n)235Np reactions and the fragment yields for the fragments of the 238U(p,f) reaction have been calculated using obtained level density parameters. The results are compared to their corresponding experimental values. It was found that the extracted excitation functions and the fragment yields in the CTM coincide well with the experimental values in the low-energy region. This finding is according to the claim made by the Oslo group that the extracted level densities of 238U show a constant temperature behaviour.

  13. Development program to recycle and purify plutonium-238 oxide fuel from scrap

    International Nuclear Information System (INIS)

    Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory (LANL) has initiated a development program to recover and purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. Our initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The most notable non-actinide impurity was silicon, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. 234U was by far the largest actinide impurity observed in the feed material because it is the daughter product of 238Pu by alpha decay. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was finely milled, then dissolved in refluxing HNO3/HF and the solution filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glove box environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values

  14. Development program to recycle and purify plutonium-238 oxide fuel from scrap (United States)

    Schulte, Louis D.; Silver, Gary L.; Avens, Larry R.; Jarvinen, Gordon D.; Espinoza, Jacob; Foltyn, Elizabeth M.; Rinehart, Gary H.


    Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory (LANL) has initiated a development program to recover & purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. Our initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The most notable non-actinide impurity was silicon, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. 234U was by far the largest actinide impurity observed in the feed material because it is the daughter product of 238Pu by alpha decay. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was finely milled, then dissolved in refluxing HNO3/HF and the solution filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glove box environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values.

  15. 234U/238U signatures associated with uranium ore bodies: part 3 Koongarra

    International Nuclear Information System (INIS)

    The Koongarra ore body is an early Proterozoic U ore body in the Alligator Rivers U province, Northern Territory, Australia. It has surface expression with a redox front located ∼30 m below the surface. The 234U/238U activity ratios (AR) for the ground water and the amorphous phase of the solid have been analysed for the ore zone and dispersion halo as a function of depth. The results display a 234U/238U AR signature with depth which may be common to all U ore bodies. The 234U/238U AR is depressed below secular equilibrium in the weathered material above the redox front; rises significantly above secular equilibrium in the vicinity of the redox front; and is followed by a gradual decrease with depth below the redox front. The amplitude of the profile is a function of local conditions. A model is proposed for the signature in which oxidising waters preferentially leach the 234U sites at the redox front due to preconditioning of the 234U sites by α recoil during the decay of 238U to 234U. Mass balance requires the solid material left behind the redox front to have a 234U/238U AR reduced below 1. Local second order effects may be superimposed on the signature. The signature may have application to calibrating scenarios for nuclear waste repositories, assisting in understanding historical climates, economic evaluation of U ore bodies and U exploration. -- Highlights: ► The 234U/238U AR data of the Koongaara U deposit was re-examined. ► The 234U/238U AR was depressed below 1 above the redox front. ► The 234U/238U AR was elevated above 1 at the redox front. ► The 234U/238U AR was decreased beyond the redox front. ► The data indicates that U ore bodies have a generic 234U/238U AR signature

  16. Determination of 234U/238U, 235U/238U and 236U/238U Isotope Ratios in Urine Using Sector Field Inductively Coupled Plasma Mass Spectrometry (SF-ICP-MS) (United States)

    Xiao, Ge; Jones, Robert L.; Saunders, David; Caldwell, Kathleen L.


    Quantification of the isotopic composition of uranium in urine at low levels of concentration is important for assessing both military and civilian populations’ exposures to uranium. However, until now there has been no convenient, precise method established for rapid determination of multiple uranium isotope ratios. Here we report a new method to measure 234U/238U, 235U/238U and 236U/238U. It uses solid phase chelation extraction (via TRU columns) of actinides from the urine matrix, followed by measurement using a magnetic sector field inductively coupled plasma mass spectrometer (SF-ICP-MS - Thermo Element XR) equipped with a high efficiency nebulizer (Apex PFA microflow) and coupled with a membrane desolvating introduction system (Aridus II™). This method provides rapid and reliable results, and has been used successfully to analyze Certified Reference Materials (CRM). PMID:24563523

  17. Elastic and inelastic scattering of neutrons on 238U nucleus

    Directory of Open Access Journals (Sweden)

    Capote R.


    Full Text Available Advanced modelling of neutron induced reactions on the 238U nucleus is aimed at improving our knowledge of neutron scattering. Capture and fission channels are well constrained by available experimental data and neutron standard evaluation. A focus of this contribution is on elastic and inelastic scattering cross sections. The employed nuclear reaction model includes – a new rotational-vibrational dispersive optical model potential coupling the low-lying collective bands of vibrational character observed in even-even actinides; – the Engelbrecht-Weidenmüller transformation allowing for inclusion of compound-direct interference effects; – and a multi-humped fission barrier with absorption in the secondary well described within the optical model for fission. Impact of the advanced modelling on elastic and inelastic scattering cross sections including angular distributions and emission spectra is assessed both by comparison with selected microscopic experimental data and integral criticality benchmarks including measured reaction rates (e.g. JEMIMA, FLAPTOP and BIG TEN. Benchmark calculations provided feedback to improve the reaction modelling. Improvement of existing libraries will be discussed.

  18. Experimental investigations of /sup 238/Pu behavior in soil columns

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, G.B.; Herrera, B.; Stalnaker, N.D.; Coffelt, K.P.; Patterson, J.H.; Heaton, R.C.; Matlack, G.M.


    Two series of experiments were conducted to study the transport of plutonium through soils. The first series involved deposition of small quantities (2.0 to 3.5 mg) of particulate /sup 238/Pu oxide on soil columns containing silt loam soil. When deionized water was allowed to percolate through the columns, plutonium was released into the drainage at the rate of 8 to 15 pg/day. During the 6.8-y experiment, the total amount of plutonium released into the soil drainage amounted to less than 0.01% of the original source. Analysis of the soil as a function of depth at the end of the experiment revealed that more than 99% of the deposited source remained in the uppermost fraction (2.8 cm) of the column. The second series of experiments was performed by pumping water containing plutonium through columns of soil and comparing the amount of plutonium in the column effluents to that in the feed. For a loamy sand soil, the plutonium content of the effluent reached a steady state of 5% of the feed after 500 days. Analysis of the soil at the end of the experiment (1200 days) showed the columns to be approximately 50% saturated. Saturation of the soil with plutonium would require 13 and 6.6 y at the feed rate used (averaged of 1.2 into 300 g of soil).

  19. Experimental investigations of 238Pu behavior in soil columns

    International Nuclear Information System (INIS)

    Two series of experiments were conducted to study the transport of plutonium through soils. The first series involved deposition of small quantities (2.0 to 3.5 mg) of particulate 238Pu oxide on soil columns containing silt loam soil. When deionized water was allowed to percolate through the columns, plutonium was released into the drainage at the rate of 8 to 15 pg/day. During the 6.8-y experiment, the total amount of plutonium released into the soil drainage amounted to less than 0.01% of the original source. Analysis of the soil as a function of depth at the end of the experiment revealed that more than 99% of the deposited source remained in the uppermost fraction (2.8 cm) of the column. The second series of experiments was performed by pumping water containing plutonium through columns of soil and comparing the amount of plutonium in the column effluents to that in the feed. For a loamy sand soil, the plutonium content of the effluent reached a steady state of 5% of the feed after 500 days. Analysis of the soil at the end of the experiment (1200 days) showed the columns to be approximately 50% saturated. Saturation of the soil with plutonium would require 13 μg/g and 6.6 y at the feed rate used (averaged of 1.2 μg/g into 300 g of soil)

  20. Early endosteal bone response to incorporated plutonium-238 in mice

    International Nuclear Information System (INIS)

    Ten Swiss albino ICR SPF female mice 110 days old (weight about 30 g) were exposed for 48 hours to a solution of plutonium-238 nitrate (spec. act. 5 MBq/1 ml, pH 2.7) injected in amounts of 0.01 ml into the popliteal area of the right femur, each thus receiving about 500 kBq per 30 g body weight. Of the injected activity, 50% was retained in the right femur, 2% in the left femur and approximately 2 to 3% in the excrements collected separately from each animal during the whole exposure period. Ultrastructurally, electron micrographs revealed a variety of changes, including hypertrophy and destruction of endosteal cell organelles (primary damage), deformation and hypertrophy of osteocytes (secondary damage) and the irregularities in the osteocyte self-burial process leading to an abnormal formation of bone tissue structure (tertiary damage). Qualitatively, these changes in the irradiated bone ultrastructure were analogous to those occurring with age. This was confirmed by comparing two groups of control mice 110 and 330 days old. Assessed quantitatively, the changes due to irradiation were more pronounced than those associated with aging. (author). 6 figs., 6 tabs., 18 refs

  1. Dismantlement and decontamination of a plutonium-238 facility at SRS

    International Nuclear Information System (INIS)

    There has been very little, documented decontamination and decommissioning (D ampersand D) experience on which to project cleanup costs and schedules for plutonium facilities at SRS and other DOE sites. A portion of the HB-Line, a plutonium-238 processing facility at SRS, has been undergoing D ampersand D intermittently since 1984. Although this cleanup effort was not originally intended to quantify results, some key data have been project has demonstrated effective methods of accumulated, and the performing D ampersand D work, and has demonstrated cleanup equipment and techniques under conditions of high contamination. Plutonium facilities where D ampersand D is already underway provide an opportunity for' timely field testing of characterization, size reduction, and decontamination techniques. Some data are presented here; however, more specific tests and data may be obtained during the remainder of this project. This project has been recommended as a candidate test facility for a DOE planned ''Integrated D ampersand D Demonstration'' managed by EM-50 to develop and demonstrate technology for D ampersand D and surplus facilities deactivation. Both the remainder of this project and the Integrated D ampersand D Demonstration Program can benefit from a joint effort, and the, overall costs should be reduced

  2. Elastic and inelastic scattering of neutrons on 238U nucleus

    International Nuclear Information System (INIS)

    Advanced modelling of neutron induced reactions on the 238U nucleus is aimed at improving our knowledge of neutron scattering. Capture and fission channels are well constrained by available experimental data and neutron standard evaluation. A focus of this contribution is on elastic and inelastic scattering cross sections. The employed nuclear reaction model includes - a new rotational-vibrational dispersive optical model potential coupling the low-lying collective bands of vibrational character observed in even-even actinides; - the Engelbrecht-Weidenmüller transformation allowing for inclusion of compound-direct interference effects; - and a multi-humped fission barrier with absorption in the secondary well described within the optical model for fission. Impact of the advanced modelling on elastic and inelastic scattering cross sections including angular distributions and emission spectra is assessed both by comparison with selected microscopic experimental data and integral criticality benchmarks including measured reaction rates (e.g. JEMIMA, FLAPTOP and BIG TEN). Benchmark calculations provided feedback to improve the reaction modelling. Improvement of existing libraries will be discussed. (author)

  3. Double beta decay of Uranium-238: Proton reactions of 238U in 5--12 MeV range. Final report, April 15, 1987--March 31, 1992

    International Nuclear Information System (INIS)

    This report is in two parts. The first part reports on the experimental work determining the half-life for double beta decay of 238U to 238PU to be (2.0 ± 0.6) x 1021 years. This is the first evidence for a third mode of decay of this heaviest naturally occurring nucleus. This rate is about 106 times slower than spontaneous fission, which itself is about 106 times slower than alpha decay. The implication of this double beta decay to neutrino masses depends on uncertain theoretical calculations of the rate for such a heavy nucleus. The second part reports on yields of principal fission products from 5.6, 7.3, 9.4, and 11.5 MeV proton interactions with 238U. The yields at 11.5 MeV are similar to those from 14 MeV neutron fission of 238U. At the same time, the production cross sections of 238Np at the same energies are determined. This nuclide is produced as often as fission at the lowest energy but only 3.8% as often at the highest energy

  4. Barrier function of the placenta and microdistribution of 238Pu in the feto-placental complex of the rat

    International Nuclear Information System (INIS)

    Investigation materials, methods and results are presented. The aim of the investigation was to determine mechanisms of 238Pu transfer through pregnant rats depending on pregnancy time and to determine peculiarities of 238Pu microdistribution in feature tissues and placenta structures. 238Pu distribution in amnious, fetal placenta labyrinthine part and maternal placenta is shown

  5. 40 CFR 23.8 - Timing of Administrator's action under Uranium Mill Tailings Radiation Control Act of 1978. (United States)


    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Timing of Administrator's action under Uranium Mill Tailings Radiation Control Act of 1978. 23.8 Section 23.8 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL JUDICIAL REVIEW UNDER EPA-ADMINISTERED STATUTES § 23.8 Timing of Administrator's action under Uranium...

  6. Development program to recycle and purify plutonium-238 oxide fuel from scrap

    International Nuclear Information System (INIS)

    Nuclear Materials Technology (NMT) Division has initiated a development program to recover and purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. The initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The notable non-actinide impurities were silicon and phosphorus, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. Among actinide impurities, uranium is of paramount concern because 234U is the daughter of 2238Pu by alpha decay, and is the largest actinide impurity. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was first dissolved in refluxing HNO3/HF and then the solution was filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glovebox environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values

  7. Preconceptual Feasibility Study to Evaluate Alternative Means to Produce Plutonium-238

    Energy Technology Data Exchange (ETDEWEB)

    John D. Bess; Matthew S. Everson


    There is currently no large-scale production of 238Pu in the United States. Feasibility studies were performed at the Idaho National Laboratory to assess the capability of developing alternative 238Pu production strategies. Initial investigations indicate potential capability to provision radioisotope-powered systems for future space exploration endeavors. For the short term production of 238Pu, sealed canisters of dilute 237Np solution in nitric acid could be irradiated in the Advanced Test Reactor (ATR). Targets in the large and medium “I” positions of the ATR were irradiated over a simulated period of 306 days and analyzed using MCNP5 and ORIGEN2.2. Approximately 0.5 kg of 238Pu could be produced annually in the ATR with purity greater than 92%. Optimization of the irradiation cycles could further increase the purity to greater than 98%. Whereas the typical purity of space batteries is between 80 to 85%, the higher purity 238Pu produced in the ATR could be blended with existing lower-purity inventory to produce useable material. Development of irradiation methods in the ATR provides the fastest alterative to restart United States 238Pu production. The analysis of 238Pu production in the ATR provides the technical basis for production using TRIGA® (Training, Research, Isotopes, General Atomics) nuclear reactors. Preliminary analyses envisage a production rate of approximately 0.7 kg annually using a single dedicated 5-MW TRIGA reactor with continuous flow loops to achieve high purity product. Two TRIGA reactors represent a robust means of providing at over 1 kg/yr of 238Pu annually using dilute solution targets of 237Np in nitric acid. Further collaboration and optimization of reactor design, radiochemical methods, and systems analyses would further increase annual 238Pu throughput, while reducing the currently evaluated reactor requirements.

  8. Measurement and calculation of 238U fission reaction rates induced by neutrons reflected by carbon material

    International Nuclear Information System (INIS)

    To check the data of carbon material reflecting neutrons, the distribution of 238U fission reaction rates induced by D-T fusion neutrons reflected by carbon material was measured by using the small depleted uranium fission chamber and the capturing detector. For comparison, 238U fission rates without carbon material was measured too. The combined standard uncertainty of 238U fission reaction rate is 5.1%-6.4%. The measured results are consistent with the calculated ones with MCNP/4A code and ENDF/B-IV library data in the range of the error

  9. Experimental Determination of the Antineutrino Spectrum of the Fission Products of $^{238}$U

    CERN Document Server

    Haag, N; Hofmann, M; Oberauer, L; Potzel, W; Schreckenbach, K; Wagner, F M


    An experiment was performed at the scientific neutron source FRM II in Garching to determine the cumulative antineutrino spectrum of the fission products of $^{238}$U. This was achieved by irradiating target foils of natural uranium with a thermal and a fast neutron beam and recording the emitted $\\beta$-spectra with a gamma-suppressing electron-telescope. The obtained $\\beta$-spectrum of the fission products of $^{235}$U was normalized to the data of the magnetic spectrometer BILL of $^{235}$U. This method strongly reduces systematic errors in the $^{238}$U measurement. The $\\beta$-spectrum of $^{238}$U was converted into the corresponding antineutrino spectrum. The final $\\bar\

  10. Radiochemical measurement of 10-15 MeV proton induced fission yields for U-238

    International Nuclear Information System (INIS)

    The production of realistic nuclear forensics debris requires an accurate knowledge of cross sections and fission yields for large number of systems. Proton induced fission of U-238 was examined for incident energies in the range of 10-15 MeV. Fission yields were first measured directly from the irradiated materials. The valley and wing fission products were then isolated in various chemical fractions in order to increase the counting statistics leading to improvements in the fission yields. In addition to the total fission cross section and the fission mass yields for U-238, proton based reaction cross sections on U-238 and U-235 were also measured. (author)

  11. Deposition of air-borne 238Pu near a chemical separation facility

    International Nuclear Information System (INIS)

    Three methods were compared to measure deposition of 238Pu released from a chemical separation facility at the Savannah River Plant, Aiken, SC. The following methods were used: adhesive paper; a collector of rain and dryfall; and soil samples. Excellent agreement among the three methods was found. The measured deposition for the particular source term and meteorological conditions at the Savannah River Plant is described by y proportional to x/sup -1.36/ where y is the pCi of 238Pu deposited per square meter per mC: 238Pu released, and x is distance in meters from the source

  12. 10 CFR 72.238 - Issuance of an NRC Certificate of Compliance. (United States)


    ... STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of Spent Fuel Storage Casks § 72.238 Issuance of an NRC Certificate of Compliance....

  13. Understanding of 234U/238U activity ratio in groundwater of agricultural ecosystem

    International Nuclear Information System (INIS)

    This study was carried out to clarify the natural variation of 234U/238U ratio in groundwater of an agricultural ecosystem. Water samples were collected from 21 locations from Bathinda and Mansa districts, of Punjab state and analysed for uranium concentration and activity ratio of its isotopes. The activity concentration ratio of 234U/238U in the groundwater samples varied between 0.39-0.98 with a mean value of 0.86. The lower isotopic ratio (less than 1) of 234U/238U indicates higher dissolution rate of parent 238U. The results suggest that, most of the dissolved uranium in groundwater is derived from the surrounding host soil or bed rock rather than from anthropogenic input. (author)

  14. Dissolution behaviour of 238U, 234U and 230Th deposited on filters from personal dosemeters

    International Nuclear Information System (INIS)

    Kinetics of dissolution of 238U, 234U and 230Th dust deposited on filters from personal alpha dosemeters was studied by means of a 26-d in vitro dissolution test with a serum ultra-filtrate simulant. Dosemeters had been used by miners at the uranium mine 'Dolni Rozinka' at Rozna, Czech Republic. The sampling flow-rate as declared by the producer is 4 l h-1 and the sampling period is typically 1 month. Studied filters contained 125 ± 6 mBq 238U in equilibrium with 234U and 230Th; no 232Th series nuclides were found. Half-time of rapid dissolution of 1.4 d for 238U and 234U and slow dissolution half-times of 173 and 116 d were found for 238U and 234U, respectively. No detectable dissolution of 230Th was found. (authors)

  15. Mound Laboratory Plutonium-238 Study Off-Site Analytical Data May-December 1974

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, Bob; Rogers, D. R.; Westendorf, W. H.; Black, H. A.


    Preliminary samples collected from off-site sediment in the Miami-Erie Canal Area near Mound Laboratory indicated that plutonium-238 concentrations are substantially above baseline levels. As a result an extensive sampling and analysis program was performed to determine the plutonium-238 concentrations as a function of depth and location in a drainage ditch, the canal, two ponds, a run-off hollow, a canal overflow creek and the Great Miami River. The plutonium-238 concentration data was used to estimate the total inventory of 238Pu deposited in these waterways, to determine the extent of the contamination, and to evaluate the potential health hazards to the general population of the area. The scope of this report is to present the data collected during this study. Detailed interpretation of the data will be presented in subsequent reports.

  16. Identification of a new heavy neutron-rich isotope 238Th

    International Nuclear Information System (INIS)

    A new heavy neutron-rich thorium isotope was produced via a multinucleon transfer reaction by irradiation of natural uranium targets with 60 MeV/u 18O ions. The Th activities was radiochemically separated from the uranium and mixture of reaction products by the rapid solvent extraction method. Measurements of the gamma-ray spectra were performed with HPGe detectors. The new neutron-rich isotope 238Th was identified for the first time based on the observation of the growth and decay of the gamma-ray with energy of 1060.5 keV from the decay of 238Pa. The half-life of 238Th has been determined to be 9.4±2.0 minutes. Further, a gamma-ray of 89.0 keV with the 8.9-minute half-life was found, which may be due to the decay of the new isotope 238Th. (author)

  17. Recycle of scrap plutonium-238 oxide fuel to support future radioisotope applications

    International Nuclear Information System (INIS)

    The Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory has initiated a development program to recover ampersand purify plutonium-238 oxide from impure feed sources in a glove box environment. A glove box line has been designed and a chemistry flowsheet developed to perform this recovery task at large scale. The initial demonstration effort focused on purification of 238PuO2 fuel by HNO3/HF dissolution, followed by plutonium(III) oxalate precipitation and calcination to an oxide. Decontamination factors for most impurities of concern in the fuel were very good, producing 238PuO2 fuel significantly better in purity than specified by General Purpose Heat Source (GPHS) fuel powder specifications. A sufficient quantity of purified 238PuO2 fuel was recovered from the process to allow fabrication of a GPHS unit for testing. The results are encouraging for recycle of relatively impure plutonium-238 oxide and scrap residue items into fuel for useful applications. The high specific activity of plutonium-238 magnifies the consequences and concerns of radioactive waste generation. This work places an emphasis on development of waste minimization technologies to complement the aqueous processing operation. Results from experiments on neutralized solutions of plutonium-238 resulted in decontamination to about 1 millicurie/L. Combining ultrafiltration treatment with addition of a water-soluble polymer designed to coordinate Pu, allowed solutions to be decontaminated to about 1 microcurie/L. Efforts continue to develop a capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel. copyright 1998 American Institute of Physics

  18. Purification of 238PuO2 scrap for heat source fuel

    International Nuclear Information System (INIS)

    The Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory has initiated a development program to recover and purify plutonium-238 oxide from impure feed sources in a glove box environment. A glove box line has been designed and a chemistry flowsheet developed to perform this recovery task at large scale. The initial demonstration effort focused on purification of 238PuO2 fuel by HNO3/HF dissolution, followed by plutonium(III) oxalate precipitation and calcination to an oxide. Decontamination factors for most impurities of concern in the fuel were very good, producing 238PuO2 fuel significantly better in purity than specified by General Purpose Heat Source (GPHS) fuel powder specifications. A sufficient quantity of purified 238PuO2 fuel was recovered from the process to allow fabrication of a GPHS unit for testing. The results are encouraging for recycle of relatively impure plutonium-238 oxide and scrap residue items into fuel for useful applications. The high specific activity of plutonium-238 magnifies the consequences and concerns of radioactive waste generation. This work places an emphasis on development of waste minimization technologies to complement the aqueous processing operation. Results from experiments on neutralized solutions of plutonium-238 resulted in decontamination to about 1 millicurie/L. Combining ultrafiltration treatment with addition of a water soluble polymer designed to coordinate Pu, allowed solutions to be decontaminated to about 1 microcurie/L. Efforts continue to develop a capability for efficient, safe, cost effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel

  19. 234U/238U signatures associated with uranium ore bodies: part 2 Manyingee

    International Nuclear Information System (INIS)

    The Manyingee ore body is a roll-front U ore body located at depth in the Cretaceous sandstone sediments of a Proterozoic palaeo valley. It is located in a confined aquifer. The aquifer is recharged 4 km upstream by the Ashburton River. Groundwater samples were collected at and up to 4.7 km downstream of the ore body. The ground water 234U/238U activity ratios (AR) were elevated to 1.86 in the vicinity of the ore body and then declined to 1.06 over the 4.7 km transect. The elevated 234U/238U ARs are attributed to selective leaching of 234U sites by oxidising waters, with α recoil as a necessary precursor to produce activated 234U sites. Direct ejection into another phase following α recoil is considered to be a minor contributor to 234U –238U disequilibrium in this environment. The profile is considered to be typical of the 234U/238U AR profile at and down gradient of the redox front of a U ore body. -- Highlights: ► The 234U/238U AR of the ground water of a roll-front U deposit was determined. ► The ground water was sampled at and beyond the redox front. ► The 234U/238U AR was elevated to 1.8 at the redox front. ► The 234U/238U AR was decreased down gradient of the redox front. ► A generic 234U/238U AR signature is proposed for U ore bodies

  20. Experimental determination of the antineutrino spectrum of the fission products of 238U

    International Nuclear Information System (INIS)

    Fission of 238U contributes about 10 % to the antineutrino emission of a pressurized water reactor. In the present thesis, the beta spectrum of the fission products of 238U was determined in an experiment at the neutron source FRM II. This beta spectrum was subsequently converted into an antineutrino spectrum. This first measurement of the antineutrino spectrum supports all current and future reactor antineutrino experiments.

  1. Application of molten salt oxidation for the minimization and recovery of plutonium-238 contaminated wastes

    International Nuclear Information System (INIS)

    Molten salt oxidation (MSO) is proposed as a 238Pu waste treatment technology that should be developed for volume reduction and recovery of 238Pu and as an alternative to the transport and permanent disposal of 238Pu waste to the WIPP repository. In MSO technology, molten sodium carbonate salt at 800--900 C in a reaction vessel acts as a reaction media for wastes. The waste material is destroyed when injected into the molten salt, creating harmless carbon dioxide and steam and a small amount of ash in the spent salt. The spent salt can be treated using aqueous separation methods to reuse the salt and to recover 99.9% of the precious 238Pu that was in the waste. Tests of MSO technology have shown that the volume of combustible TRU waste can be reduced by a factor of at least twenty. Using this factor the present inventory of 574 TRU drums of 238Pu contaminated wastes is reduced to 30 drums. Further 238Pu waste costs of $22 million are avoided from not having to repackage 312 of the 574 drums to a drum total of more than 4,600 drums. MSO combined with aqueous processing of salts will recover approximately 1.7 kilograms of precious 238Pu valued at 4 million dollars (at $2,500/gram). Thus, installation and use of MSO technology at LANL will result in significant cost savings compared to present plans to transport and dispose 238Pu TRU waste to the WIPP site. Using a total net present value cost for the MSO project as $4.09 million over a five-year lifetime, the project can pay for itself after either recovery of 1.6 kg of Pu or through volume reduction of 818 drums or a combination of the two. These savings show a positive return on investment

  2. Analysis of transmission experiments for 238U in the unresolved resonance region

    International Nuclear Information System (INIS)

    From analysis of experimental data on transmission in the region of unresolved resonances, an evaluation of the mean resonance parameters for 238U is obtained. These parameters do not contradict the corresponding evaluations from the region of resolved resonances. On the basis of this evaluation, the group constants for 238U are determined, for the region of unresolved resonances. A comparison is made with data tables

  3. Experimental determination of the antineutrino spectrum of the fission products of {sup 238}U

    Energy Technology Data Exchange (ETDEWEB)

    Haag, Nils-Holger


    Fission of {sup 238}U contributes about 10 % to the antineutrino emission of a pressurized water reactor. In the present thesis, the beta spectrum of the fission products of {sup 238}U was determined in an experiment at the neutron source FRM II. This beta spectrum was subsequently converted into an antineutrino spectrum. This first measurement of the antineutrino spectrum supports all current and future reactor antineutrino experiments.

  4. Evaluation of neutron-induced reactions in 48Ti and 238U

    International Nuclear Information System (INIS)

    Preliminary results of the evaluation of neutron-induced reactions in 48Ti and 238U are presented. Calculated cross sections for the reactions (n,γ), (n,n'), (n, 2n) and (n,p) as well as for (n,f) in 238U are given. Comparisons with available experimental data are made and possible changes in the parameters are discussed. (Author)

  5. Application of molten salt oxidation for the minimization and recovery of plutonium-238 contaminated wastes

    Energy Technology Data Exchange (ETDEWEB)

    Wishau, R.


    Molten salt oxidation (MSO) is proposed as a {sup 238}Pu waste treatment technology that should be developed for volume reduction and recovery of {sup 238}Pu and as an alternative to the transport and permanent disposal of {sup 238}Pu waste to the WIPP repository. In MSO technology, molten sodium carbonate salt at 800--900 C in a reaction vessel acts as a reaction media for wastes. The waste material is destroyed when injected into the molten salt, creating harmless carbon dioxide and steam and a small amount of ash in the spent salt. The spent salt can be treated using aqueous separation methods to reuse the salt and to recover 99.9% of the precious {sup 238}Pu that was in the waste. Tests of MSO technology have shown that the volume of combustible TRU waste can be reduced by a factor of at least twenty. Using this factor the present inventory of 574 TRU drums of {sup 238}Pu contaminated wastes is reduced to 30 drums. Further {sup 238}Pu waste costs of $22 million are avoided from not having to repackage 312 of the 574 drums to a drum total of more than 4,600 drums. MSO combined with aqueous processing of salts will recover approximately 1.7 kilograms of precious {sup 238}Pu valued at 4 million dollars (at $2,500/gram). Thus, installation and use of MSO technology at LANL will result in significant cost savings compared to present plans to transport and dispose {sup 238}Pu TRU waste to the WIPP site. Using a total net present value cost for the MSO project as $4.09 million over a five-year lifetime, the project can pay for itself after either recovery of 1.6 kg of Pu or through volume reduction of 818 drums or a combination of the two. These savings show a positive return on investment.

  6. Recovery of 238PuO2 by Molten Salt Oxidation Processing of 238PuO2 Contaminated Combustibles (Part II)

    International Nuclear Information System (INIS)

    Pu-238 heat sources are used to fuel radioisotope thermoelectric generators (RTG) used in space missions. The demand for this fuel is increasing, yet there are currently no domestic sources of this material. Much of the fuel is material reprocessed from other sources. One rich source of Pu-238 residual material is that from contaminated combustible materials, such as cheesecloth, ion exchange resins and plastics. From both waste minimization and production efficiency standpoints, the best solution is to recover this material. One way to accomplish separation of the organic component from these residues is a flameless oxidation process using molten salt as the matrix for the breakdown of the organic to carbon dioxide and water. The plutonium is retained in the salt, and can be recovered by dissolution of the carbonate salt in an aqueous solution, leaving the insoluble oxide behind. Further aqueous scrap recovery processing is used to purify the plutonium oxide. Recovery of the plutonium from contaminated combustibles achieves two important goals. First, it increases the inventory of Pu-238 available for heat source fabrication. Second, it is a significant waste minimization process. Because of its thermal activity (0.567 W per gram), combustibles must be packaged for disposition with much lower amounts of Pu-238 per drum than other waste types. Specifically, cheesecloth residues in the form of pyrolyzed ash (for stabilization) are being stored for eventual recovery of the plutonium

  7. Recovery of 238PuO2 by Molten Salt Oxidation Processing of 238PuO2 Contaminated Combustibles (Part II) (United States)

    Remerowski, Mary Lynn; Dozhier, C.; Krenek, K.; VanPelt, C. E.; Reimus, M. A.; Spengler, D.; Matonic, J.; Garcia, L.; Rios, E.; Sandoval, F.; Herman, D.; Hart, R.; Ewing, B.; Lovato, M.; Romero, J. P.


    Pu-238 heat sources are used to fuel radioisotope thermoelectric generators (RTG) used in space missions. The demand for this fuel is increasing, yet there are currently no domestic sources of this material. Much of the fuel is material reprocessed from other sources. One rich source of Pu-238 residual material is that from contaminated combustible materials, such as cheesecloth, ion exchange resins and plastics. From both waste minimization and production efficiency standpoints, the best solution is to recover this material. One way to accomplish separation of the organic component from these residues is a flameless oxidation process using molten salt as the matrix for the breakdown of the organic to carbon dioxide and water. The plutonium is retained in the salt, and can be recovered by dissolution of the carbonate salt in an aqueous solution, leaving the insoluble oxide behind. Further aqueous scrap recovery processing is used to purify the plutonium oxide. Recovery of the plutonium from contaminated combustibles achieves two important goals. First, it increases the inventory of Pu-238 available for heat source fabrication. Second, it is a significant waste minimization process. Because of its thermal activity (0.567 W per gram), combustibles must be packaged for disposition with much lower amounts of Pu-238 per drum than other waste types. Specifically, cheesecloth residues in the form of pyrolyzed ash (for stabilization) are being stored for eventual recovery of the plutonium.

  8. Coulomb fission of 238U in the interaction of 24.3 MeV/nucleon 238U with 197Au

    International Nuclear Information System (INIS)

    Coulomb fission of 238U has been studied in the interaction of a 24.3 MeV/nucleon U beam with an Au target. A novel experimental approach is followed, allowing to isolate the Coulomb fission from the nuclear fission on an event by event basis. The Z distribution of the fragments is studied for both fission processes. (author)

  9. Mechanical behavior of 238UO2, 238PuO2, and 239PuO2 as a function of strain rate and temperature

    International Nuclear Information System (INIS)

    The mechanical response of 238UO2 was measured as a function of strain rate and temperature. We evaluated material produced by two processing schedules: hot pressing followed by a grain stabilization; and cold pressing plus a sintering treatment. The response of these two materials was identical, within the scatter of our data. We complemented our data with that published in the literature, after having made the appropriate corrections for grain size, porosity, and stoichiometry. The entire collection of data was used to evaluate the Follansbee-Kocks mechanical threshold stress (MTS) model for the prediction of yield stress as a function of strain rate and temperature. We used this model to predict the yield stress of 238UO2 for strain rates between var-epsilon = 10-5 and 103 s-1 and temperatures from 800 to 1600C. These predictions provided the basis for constructing a deformation/fracture map for both urania and plutonia. Examination of the maps indicates that for compressive loading and impact strain rates, the 238UO2 will be an excellent mock material for 238PuO2. Under these conditions both the strength and deformation and the fracture modes are consistent between these two materials

  10. Fractionation of 238U/235U by reduction during low temperature uranium mineralisation processes (United States)

    Murphy, Melissa J.; Stirling, Claudine H.; Kaltenbach, Angela; Turner, Simon P.; Schaefer, Bruce F.


    Investigations of ‘stable’ uranium isotope fractionation during low temperature, redox transformations may provide new insights into the usefulness of the 238U/235U isotope system as a tracer of palaeoredox processes. Sandstone-hosted uranium deposits accumulate at an oxidation/reduction interface within an aquifer from the low temperature reduction of soluble U(VI) complexes in groundwaters, forming insoluble U(IV) minerals. This setting provides an ideal environment in which to investigate the effects of redox transformations on 238U/235U fractionation. Here we present the first coupled measurements of 238U/235U isotopic compositions and U concentrations for groundwaters and mineralised sediment samples from the same redox system in the vicinity of the high-grade Pepegoona sandstone-hosted uranium deposit, Australia. The mineralised sediment samples display extremely variable 238U/235U ratios (herein expressed as δUCRM145238, the per-mil deviation from the international NBL standard CRM145). The majority of mineralised sediment samples have δUCRM145238 values between -1.30±0.05 and 0.55±0.12‰, spanning a ca. 2‰ range. However, one sample has an unusually light isotopic composition of -4.13±0.05‰, which suggests a total range of U isotopic variability of up to ca. 5‰, the largest variation found thus far in a single natural redox system. The 238U/235U isotopic signature of the mineralised sediments becomes progressively heavier (enriched in 238U) along the groundwater flow path. The groundwaters show a greater than 2‰ variation in their 238U/235U ratios, ranging from δUCRM145238 values of -2.39±0.07 to -0.71±0.05‰. The majority of the groundwater data exhibit a clear systematic relationship between 238U/235U isotopic composition and U concentration; samples with the lowest U concentrations have the lowest 238U/235U ratios. The preferential incorporation of 238U during reduction of U(VI) to U(IV) and precipitation of uranium minerals leaves

  11. Settling standards for body content of 238Pu in man based on animal experimentation

    International Nuclear Information System (INIS)

    The paper is devoted to an urgent problem of radiation medicine, that of setting standards for body content of 238Pu which is of great practical significance. The analysis is based on literature and experimental findings of the authors on the 238Pu metabolism and biological effect for a wide range of doses on 4 animal species: mice, rats, rabbits and monkey. The report consists of two parts. The first deals with experimental results on body distribution of 238Pu, its elimination kinetics, and microdistribution in organs and tissues following intratracheal administration. In the second, characteristics of the radionuclide's biological effect are considered. General regularities for different animal species, as well as some specific peculiarities are established. Some interest are data on 238Pu microdistribution, on mechanisms and consequences of damage relative to changes in the lung tumour spectrum as influenced by the activity administered. Data for the damaging effect of α-radiation on the thymus structure due to relatively low absorbed doses are presented. Late effects of the incorporated 238Pu are studied in detail blastomogenic effect being the most significant. The incidence, latent period, and tumour spectrum are shown to depend on the activity administered. The analysis of experimental evidence suggests that damage of bone marrow stem cells due to low doses of 238Pu results in haematopoietic and lymphoid tissues tumours at late times. The significance of regulatory system damage for tumour genesis is discussed. The data obtained by the authors and clinical observations of lung tumours in uranium miners served as a basis for comparison of lung and bone radiosensitivities, and conclusion that susceptibilities of the rat and human lung tissues to α-radiation are similar, thus permitting direct extrapolation to man of experimental findings on carcinogenic effect of the incorporated 238Pu. From the analysis made, the authors conclude that safety factors of the

  12. 49 CFR Figure 2 to Subpart B of... - Example of a Multi-Level Car Complying with Window Location and Staggering Requirements-§§ 238... (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Example of a Multi-Level Car Complying with Window Location and Staggering Requirements-§§ 238.113 and 238.114 2 Figure 2 to Subpart B of Part 238... Window Location and Staggering Requirements—§§ 238.113 and 238.114 ER01FE08.005...

  13. Radiationless transition probabilities in muonic 208Pb, 232Th, and 238U

    International Nuclear Information System (INIS)

    The probabilities for non-radiative (n.r.) excitations Pn.r. in the muonic nuclides 208Pb, 232Th, and 238U have been determined for (μ-, γγ)-measurements by comparing the intensities of muonic X-ray transitions in single and coincidence spectra. The value of Pn.r. (3p→1s), measured for the first time, is about 90% for the actinides 232Th and 238U, but only about 8% for 208Pb. The value of Pn.r. (3d→1s) is found to be 10% for 233Th, 13% for 238U, and about 4% for 208Pb. For 208Pb a vanishing strength of the n.r. decay of the 2p-level is found, while for 232Th and for 238U n.r. strengths of about 20% and 26%, respectively, are observed. By regarding two subcomplexes of the 2p→1s transitions leading to different mean excitation energies the n.r. transition probabilities were found to be different for 238U only, 21.6% and 31.1%, respectively. (orig.)

  14. Fission fragment mass and angular distribution in 6,7Li+235,238U reactions

    International Nuclear Information System (INIS)

    Fission fragment (FF) angular distributions for 6,7Li+235,238U reactions and mass distributions for 6,7Li+ 238U reactions have been measured at energies near and above the Coulomb barrier. The angle integrated fission cross sections for 6Li induced reactions at sub-barrier energies are found to be higher than 7Li induced reactions possibly due to larger contribution of breakup induced fission in case of the former compared to the latter. The FF anisotropy for 6,7Li+235U was found to be smaller than 6,7Li+238U, manifesting the effect of target ground state spin. The statistical saddle point (SSP) model predictions were found to be consistent with the measured FF anisotropy for 6,7Li+235U, however they were under-estimated for 6,7Li+238U particularly at lower energies. Observation of larger FWHM of FF folding angle distribution and sharp increase in peak to valley ratio for FF mass distribution with the decrease in bombarding energy in 6,7Li+238U reactions confirms the presence of breakup induced fission. (authors)

  15. Fission fragment mass and angular distribution in 6,7Li+235,238U reactions

    Directory of Open Access Journals (Sweden)

    Santra S.


    Full Text Available Fission fragment (FF angular distributions for 6,7Li+235,238U reactions and mass distributions for 6,7Li+238U reactions have been measured at energies near and above the Coulomb barrier. The angle integrated fission cross sections for 6Li induced reactions at sub-barrier energies are found to be higher than 7Li induced reactions possibly due to larger contribution of breakup induced fission in case of the former compared to the latter. The FF anisotropy for 6,7Li+235U was found to be smaller than 6,7Li+238U, manifesting the effect of target ground state spin. The statistical saddle point (SSP model predictions were found to be consistent with the measured FF anisotropy for 6,7Li+235U, however they were under-estimated for 6,7Li+238U particularly at lower energies. Observation of larger FWHM of FF folding angle distribution and sharp increase in peak to valley ratio for FF mass distribution with the decrease in bombarding energy in 6,7Li+238U reactions confirms the presence of breakup induced fission.

  16. Summary of the work of the NEANDC task force on U-238

    International Nuclear Information System (INIS)

    The work of the Nuclear Energy Agency Nuclear Data Committee (NEANDC) Task Force on U-238 is summarised. The Task Force was set up in 1982 to consider two discrepancies in U-238 data - the neutron widths of the resolved resonance above 1.4 keV and the capture cross-section in the resolved and unresolved resonance regions. The work is summarised historically and to put the activities of the Task Force into context the paper starts with a brief description of the methods and data used to determine U-238 resonance parameters. It follows with a description of the state of the data in 1982 and then describes the work of the Task Force in the period up to 1985, the period during which the Task Force found the reasons for the discrepancies. Consideration is then given to the period following 1985 during which resonance analysis on U-238 has been performed and a recommended set of parameters covering the energy range 0-10 keV produced. These are listed in an appendix to the paper and are now included in the U-238 evaluations contained in JEF-2 and ENDF/B-VI. Finally a review is given of the main conclusions of the Task Force followed by a list of work still requiring to be done. (author). 15 figs., 10 tabs., 49 refs., 3 appendix

  17. (234)U/(238)U signatures associated with uranium ore bodies: part 3 Koongarra. (United States)

    Lowson, Richard T


    The Koongarra ore body is an early Proterozoic U ore body in the Alligator Rivers U province, Northern Territory, Australia. It has surface expression with a redox front located ∼30 m below the surface. The (234)U/(238)U activity ratios (AR) for the ground water and the amorphous phase of the solid have been analysed for the ore zone and dispersion halo as a function of depth. The results display a (234)U/(238)U AR signature with depth which may be common to all U ore bodies. The (234)U/(238)U AR is depressed below secular equilibrium in the weathered material above the redox front; rises significantly above secular equilibrium in the vicinity of the redox front; and is followed by a gradual decrease with depth below the redox front. The amplitude of the profile is a function of local conditions. A model is proposed for the signature in which oxidising waters preferentially leach the (234)U sites at the redox front due to preconditioning of the (234)U sites by α recoil during the decay of (23)(8)U to (23)(4)U. Mass balance requires the solid material left behind the redox front to have a (234)U/(238)U AR reduced below 1. Local second order effects may be superimposed on the signature. The signature may have application to calibrating scenarios for nuclear waste repositories, assisting in understanding historical climates, economic evaluation of U ore bodies and U exploration. PMID:23142336

  18. Application of a canine 238Pu biokinetics/dosimetry model to human bioassay data. (United States)

    Hickman, A W; Griffith, W C; Roessler, G S; Guilmette, R A


    Associated with the use of 238Pu in thermoelectric power sources for space probes is the potential for human exposure, primarily by inhalation and most likely as 238PuO2. Several models have been developed for assessing the level of intake and predicting the resulting radiation dose following human exposure to 239Pu. However, there are indications that existing models do not adequately describe the disposition and dosimetry of 238Pu following human exposure. In this study, a canine model that accounts for these differences has been adapted for use with human excretion data. The model is based on existing knowledge about organ retention of plutonium. An analysis of the sensitivity of the model to changes in aerosol-associated properties indicated that predictions of urinary excretion are most sensitive to changes in particle solubility and diameter and in the ratio of fragment:particle surface area. Application of the model to urinary excretion data from seven workers exposed to a 238Pu ceramic aerosol gave estimated intakes of 390-8,200 Bq and associated initial pulmonary burdens of 80-1,700 Bq. The resulting 50-y dose commitments to critical organs per Bq of 238Pu intake were estimated to be 0.5 mSv for the thoracic region, 0.2 mSv for the liver, and 1 mSv for the bone surfaces. PMID:7860307

  19. Hematological responses after inhaling {sup 238}PuO{sub 2}: An extrapolation from beagle dogs to humans

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.; Muggenburg, B.A.; Welsh, C.A.; Angerstein, D.A.


    The alpha emitter plutonium-238 ({sup 238}Pu), which is produced in uranium-fueled, light-water reactors, is used as a thermoelectric power source for space applications. Inhalation of a mixed oxide form of Pu is the most likely mode of exposure of workers and the general public. Occupational exposures to {sup 238}PuO{sub 2} have occurred in association with the fabrication of radioisotope thermoelectric generators. Organs and tissue at risk for deterministic and stochastic effects of {sup 238}Pu-alpha irradiation include the lung, liver, skeleton, and lymphatic tissue. Little has been reported about the effects of inhaled {sup 238}PuO{sub 2} on peripheral blood cell counts in humans. The purpose of this study was to investigate hematological responses after a single inhalation exposure of Beagle dogs to alpha-emitting {sup 238}PuO{sub 2} particles and to extrapolate results to humans.

  20. Generation of 238U Covariance Matrices by Using the Integral Data Assimilation Technique of the CONRAD Code


    Privas E.; Archier P.; Bernard D.; Jean C. De Saint; Destouche C.; Leconte P.; Noguère G.; Peneliau Y.; Capote R.


    A new IAEA Coordinated Research Project (CRP) aims to test, validate and improve the IRDF library. Among the isotopes of interest, the modelisation of the 238U capture and fission cross sections represents a challenging task. A new description of the 238U neutrons induced reactions in the fast energy range is within progress in the frame of an IAEA evaluation consortium. The Nuclear Data group of Cadarache participates in this effort utilizing the 238U spectral indices measurements and Post I...

  1. Adsorption of Cs-137 and U-238 in semi-arid soils; Adsorcion de Cs-137 y U-238 en suelos semiaridos

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez T, U. O. [Instituto Tecnologico de Toluca, Av. Tecnologico s/n, 52140 Metepec, Estado de Mexico (Mexico); Monroy G, F.; Anguiano A, J. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Fernandez R, E., E-mail: [Universidad Politecnica del Valle de Toluca, Carretera Toluca-Almoloya de Juarez Km. 5.6, Santiaguito Tlalcilalcali, Estado de Mexico (Mexico)


    Is of great importance to determine the adsorption properties of the soils where radioactive wastes are stored, fundamentally of the radioisotopes contained in these wastes, with the purpose of knowing like will be their behavior in the event of happening radionuclide migration toward the surrounding means. Therefore, in this work the adsorption properties of {sup 137}Cs{sup +} and {sup 238}UO{sub 2}{sup 2+} in soils coming from the Storage Center of Radioactive Wastes are studied. Was studied the effect of the soil type and the particle size of the soil in the adsorption properties of Cs (I) and U (Vi). 13 soil samples and six different particle sizes were analyzed. The adsorption studies were carried out by the radiotracers technique in static way. The results indicate an important adsorption affinity toward the Cs-137 and a very vulnerable affinity for the {sup 238}UO{sub 2}{sup 2+}. (author)

  2. 238U, 226Ra and 210Pb in some vent waters of the Galapagos spreading center

    International Nuclear Information System (INIS)

    The concentrations of 226Ra, 238U and 210Pb have been measured in waters from the Mussel Bed and the Rose Garden thermal fields at the Galapagos spreading center over a temperature range of approx.2.5--16 0C. The 226Ra-T plots yield slopes of 0.112 and 0.036 dpm/kg 0C for the Mussel Bed and the Rose Garden respectively yielding a global hydrothermal 226Ra flux less than 5% of that required to sustain the oceanic inventory. 238U concentration in waters 0C is the same as that in ambient sea water whereas water hotter than approx.9 0C shows a decreasing trend with temperature to zero 238U at approx.29 0C. 210Pb concentration in Mussel Bed increases with temperature, and extrapolated to approx.350 0C yields a 210Pb concentration considerably less than that expected from 222Rn decay and basalt alteration

  3. Fabrication of gamma sources using the neutron-gamma reactions of 238Pu13C

    International Nuclear Information System (INIS)

    A production campaign for 238Pu13C sources with gamma fluence ranging from 2500 to 4500 gamma/s/4π at 6.13 MeV was carried out in 2002 in Atalante. An experimental study was undertaken to prepare the 238PuC mixture, which is the most delicate step. This procedure is described together with the other steps in the source fabrication process: purification of a plutonium oxide batch, preparation of a nitric solution of 238Pu, measurement of the gamma fluence of the PuC mixture before and after insertion into each of the two stainless steel capsules that constitute a PuN2O package, welding of the second envelope followed by leak testing, final measurement of the gamma fluence of the sealed source. This PuC sources fabrication procedure is effective: all the sources include the required gamma activity with an uncertainty on the gamma fluence of less than 10%. (authors)

  4. Transmission Nuclear Resonance Fluorescence Measurements of 238U in Thick Targets

    Energy Technology Data Exchange (ETDEWEB)

    Quiter, Brian J.; Ludewigt, Bernhard A.; Mozin, Vladimir V.; Wilson, Cody; Korbly, Steve


    Transmission nuclear resonance fluorescence measurements were made on targets consisting of Pb and depleted U with total areal densities near 86 g/cm2. The 238U content n the targets varied from 0 to 8.5percent (atom fraction). The experiment demonstrates the capability of using transmission measurements as a non-destructive technique to identify and quantify the presence of an isotope in samples with thicknesses comparable to he average thickness of a nuclear fuel assembly. The experimental data also appear to demonstrate the process of notch refilling with a predictable intensity. Comparison of measured spectra to previous backscatter 238U measurements indicates general agreement in observed excited states. Two new 238U excited states and possibly a third state have also been observed.

  5. 238PuO2 Fuel and Dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Mayo, Douglas R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rawool-Sullivan, Mohini [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garner, Scott Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wenz, Tracy R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    238Pu is an ideal material for use as a heat source with its half-life of 87.7 years and copious particle emissions. 238Pu radioisotope thermoelectric generators (RTGs) have found use for pacemakers, Apollo Space missions, Mars rovers, and Voyager spacecraft. In evaluating the dose to personnel and components near a 238Pu-based RTG, a number of additional nuclides and their daughter products must be considered to get an accurate estimate for γ-dose, and the amount of 17O and 18O for the neutron-dose must be considered. This paper looks at the contributing nuclides and their daughter products that add the most to the dose rates.

  6. Radiological impact from atmospheric releases of 238U and 226Ra from phosphate rock processing plants

    International Nuclear Information System (INIS)

    Phosphate rocks are used extensively, mainly as a source of phosphorus for fertilizers and secondly for phosphoric acid and gypsum (phosphogypsum). Phosphates are, therefore one of the sources of technologically enhanced exposure to man from natural radionuclides (TENR). Emissions from phosphate rocks processing plants in gaseous and particulate form contain radioisotopes, such as 238U and 226Ra, which are discharged into the environment causing radiation exposures to the population. About 10 MBq of 238U and 226Ra, respectively, are discharged to the environment each year from a phosphate rocks processing plant in Thessaloniki area, Northern Greece. The collective dose commitment to lung tissue resulting from atmospheric release was estimated to be ∼2x10-9 man Gy t-1 for 238U and ∼0.1x10-9 Plan Gy t-1 for 226Ra, i.e. about 2 times higher than that reported in UNSCEAR 1992 Report. (author)

  7. Recent measurements of 234U/238U isotope ratio in spring waters from the Hadzici area. (United States)

    Vidic, Alfred; Ilić, Zorana; Benedik, Ljudmila


    The Hadzici area has become interesting for investigation since depleted uranium ammunition had been employed in 1995 during the NATO air strike campaign in Bosnia and Herzegovina. The purpose of this study is to determine uranium concentration and (234)U/(238)U activity ratio in the spring waters of this area and to investigate their relationship, as well as spatial variations. The spring water samples were taken at 18 sites in total. For the determination of uranium radioisotopes, radiochemical separation procedure followed by alpha-particle spectrometry was applied. Uranium concentration in analyzed waters range from 0.15 to 1.12 μg/L. Spring waters from carbonate based sediments have a lower uranium concentration of between 0.15 and 0.43 μg/L, in comparison to waters sampled within sandstone-based sediments ranging from 0.53 to 1.12 μg/L. Dissolved uranium shows significant spatial variability and correlation with bedrock type confirmed by Principal Component Analysis and Hierarchical Cluster Analysis. The majority of the analyzed waters have a (234)U/(238)U activity ratio ranging from 1.02 to 1.90, of which half of the results range between 1.02 and 1.16. No apparent depleted uranium (DU) contamination was observed, as (234)U/(238)U activity ratio is dependent on geochemical conditions in the environment. Even though the tested spring waters demonstrate significant variability in uranium concentration, (234)U/(238)U activity ratio and (234)U excess, waters with similar uranium isotopic signatures are observable within the region. The guidelines on the spatial redistribution of dissolved uranium (corresponding to (238)U mass concentration), along with (234)U/(238)U activity ratios were provided by the Inverse Distance Weighting (IDW) method. Waters having similar isotopic signature have been delineated. PMID:23410592

  8. Activity disequilibrium between 234U and 238U isotopes in natural environment

    International Nuclear Information System (INIS)

    The aim of this work was to calculate the values of the 234U/238U activity ratio in natural environment (water, sediments, Baltic organisms and marine birds from various regions of the southern Baltic Sea; river waters (the Vistula and the Oder River); plants and soils collected near phosphogypsum waste heap in Wislinka (Northern Poland) and deer-like animals from Northern Poland. On the basis of the studies it was found that the most important processes of uranium geochemical migration in the southern Baltic Sea ecosystem are the sedimentation of suspended material and the vertical diffusion from the sediments into the bottom water. Considerable values of the 234U/238U are characterized for the Vistula and Oder Rivers and its tributaries. The values of the 234U/238U activity ratio in different tissues and organs of the Baltic organisms, sea birds and wild deer are varied. Such a large variation value of obtained activity ratios indicates different behavior of uranium isotopes in the tissues and organisms of sea birds and wild animals. This value shows that uranium isotopes can be disposed at a slower or faster rate. The values of the 234U/238U activity ratio in the analyzed plants, soils and mosses collected in the vicinity of phosphogypsum dumps in Wislinka are close to one and indicate the phosphogypsum origin of the analyzed nuclides. Uranium isotopes 234U and 238U are not present in radioactive equilibrium in the aquatic environment, which indicates that their activities are not equal. The inverse relationship is observed in the terrestrial environment, where the value of the of the 234U/238U activity ratio really oscillates around unity. (author)

  9. Application of a canine {sup 238}Pu dosimetry model to human bioassay data

    Energy Technology Data Exchange (ETDEWEB)

    Hickman, A.W. Jr. [Florida Univ., Gainesville, FL (United States)


    Associated with the use of 2{sup 238}Pu in thermoelectric power sources for space probes and power supplies for cardiac devices is the potential for human exposure to {sup 238}Pu, primarily by inhalation. In the event of human internal exposure, a means is needed for assessing the level of intake and calculating radiation doses. Several bioassay/dosimetry models have been developed for {sup 239}Pu. However, results from studies with laboratory animals have indicated that the biokinetics, and therefore the descriptive models, of {sup 238}Pu are significantly different from those for {sup 239}Pu. A canine model accounting for these differences has been applied in this work to urinary excretion data from seven humans occupationally exposed to low levels of an insoluble {sup 238}Pu compound. The modified model provides a good description of the urinary excretion kinetics observed in the exposed humans. The modified model was also used to provide estimates of the initial intakes of {sup 238}Pu for the seven individuals; these estimates ranged from 4.5 nCi (170 Bq) to 87 nCi (3200 Bq). Autopsy data on the amount and distribution of {sup 238}Pu retained in the organs may be used in the future to validate or refute both these estimates and the assumptions used to formulate the human model. Modification of the human model to simulate an injection exposure to {sup 239}Pu gave patterns of retention in the organs and urinary excretion comparable to those seen previously in humans; further modification of the model using fecal data (unavailable for the subjects of this study) is indicated.

  10. Development of an Efficient Approach to Perform Neutronics Simulations for Plutonium-238 Production

    Energy Technology Data Exchange (ETDEWEB)

    Chandler, David [ORNL; Ellis, Ronald James [ORNL


    Conversion of 238Pu decay heat into usable electricity is imperative to power National Aeronautics and Space Administration (NASA) deep space exploration missions; however, the current stockpile of 238Pu is diminishing and the quality is less than ideal. In response, the US Department of Energy and NASA have undertaken a program to reestablish a domestic 238Pu production program and a technology demonstration sub-project has been initiated. Neutronics simulations for 238Pu production play a vital role in this project because the results guide reactor safety-basis, target design and optimization, and post-irradiation examination activities. A new, efficient neutronics simulation tool written in Python was developed to evaluate, with the highest fidelity possible with approved tools, the time-dependent nuclide evolution and heat deposition rates in 238Pu production targets irradiated in the High Flux Isotope Reactor (HFIR). The Python Activation and Heat Deposition Script (PAHDS) was developed specifically for experiment analysis in HFIR and couples the MCNP5 and SCALE 6.1.3 software quality assured tools to take advantage of an existing high-fidelity MCNP HFIR model, the most up-to-date ORIGEN code, and the most up-to-date nuclear data. Three cycle simulations were performed with PAHDS implementing ENDF/B-VII.0, ENDF/B-VII.1, and the Hybrid Library GPD-Rev0 cross-section libraries. The 238Pu production results were benchmarked against VESTA-obtained results and the impact of various cross-section libraries on the calculated metrics were assessed.

  11. The AS-76 interlaboratory experiment on the alpha spectrometric determination of Pu-238. Pt. 3

    International Nuclear Information System (INIS)

    Four plutonium samples containing 0.2, 0.8, 1.6 and 0.9 Atom% of 238Pu have been prepared for the Interlaboratory Experiment AS-76. Of these, three were input solutions from a reprocessing plant. The fourth sample was from a plutonium product solution. These samples have been characterized by two alpha spectrometry laboratories and two mass spectrometry laboratories to certify the ratio of alpha activities 238Pu/(239Pu + 240Pu) and the isotopic composition, respectively. (orig.) 891 HP/orig. 892 MKO

  12. Preparation of a 238Pu standard source . II. Source preparation and standardization (United States)

    Nobuo, Shinohara; Nobuaki, Kohno


    A standard source of 238Pu was prepared for calibrating the counting efficiency of alpha-ray detector. The plutonium was electrodeposited on a platinum or tantalum disk using isopropyl alcohol-hydrochloric acid solution as an electrolyte. The absolute activity was certified by isotope dilution alpha-ray spectrometry. Several types of the source, whose areas 238Pu-deposited are from 2.0 to 25.0 mm in diameter, were also prepared by the method. The overall uncertainties of the certified values for the standard sources prepared are estimated to be within 0.15 to 0.25% (1σ).

  13. Effects of nuclear orientation on fusion and fission in the reaction using 238U target nucleus


    Hirose K.; Hofmann S.; Ohtsuki T.; Nagame Y.; Nishinaka I.; Mitsuoka S.; Ikezoe H.; Nishio K.


    Fission fragment mass distributions in the reaction of 30Si+238U were measured around the Coulomb barrier. At the above-barrier energies, the mass distribution showed a Gaussian shape. At the subbarrier energies, triple-humped distribution was observed, which consists of symmetric fission and asymmetric fission peaked at AL/AH ≈ 90/178. The asymmetric fission should be attributed to quasifission from the results of the measured evaporation residue (ER) cross-sections for 30Si+238U. Th...

  14. Radionuclides of 210Po, 234U and 238U in drinking bottled mineral water in Poland

    International Nuclear Information System (INIS)

    A study of the radioactive content of drinking mineral bottled water in Poland was carried out. 210Po, 238U and 234U activity concentrations were determined by alpha-spectrometry with low-level-activity silicon detectors. The results revealed that the mean concentration of 210Po, 238U and 234U in analyzed water sample were 1.28, 0.80 and 0.80 mBq x dm-3, respectively. The effective doses due to the polonium and uranium emissions were calculated for bottled drinking water. (author)

  15. An isotopic analysis system for plutonium samples enriched in 238Pu

    International Nuclear Information System (INIS)

    We have designed and built a gamma-ray spectrometer system that measures the relative plutonium isotopic abundances of plutonium oxide enriched in 238Pu. The first system installed at Westinghouse Savannah River Company was tested and evaluated on plutonium oxide in stainless steel EP60/61 containers. 238Pu enrichments ranged from 20% to 85%. Results show that 200 grams of plutonium oxide in an EP60.61 container can be measured with ±0.3% precision and better than ±1.0% accuracy in the specific power using a counting time of 50 minutes. 3 refs., 2 figs

  16. Gastrointestinal absorption and retention of plutonium-238 and uranium-233 in neonatal swine

    International Nuclear Information System (INIS)

    Newborn swine absorbed as much as one-half of a gavaged dose of 238Pu nitrate within 6 to 12 hr, and another one-fourth of the dose was retained in the stomach for up to 24 hr after intragastric administration. The small intestine accumulated one-third of the dose within 36 hr. Animals gavaged between 5 and 21 days of age absorbed decreasing amounts, especially at 14 and 21 days. Absorption of 233Pu (gavaged as the nitrate) by day-old pigs was similar to that of 238Pu

  17. Inhalation exposure of ponies to aerosols of 169Yb-labeled 238PuO2

    International Nuclear Information System (INIS)

    Techniques and apparatus were developed for the exposure, maintenance, and profile scanning of Shetland-type ponies. Two ponies were exposed to monodisperse aerosols of 169Yb-labeled 238PuO2. One pony was maintained for 36 days after exposure, but had an abnormal lung which made projections about early distribution and translocation of 238Pu difficult. The ability to achieve substantial lung burdens of inhaled particulates and to perform meaningful linear profile scans in the pony was demonstrated. (U.S.)

  18. Absorption and retention of plutonium-238 nitrate and oxide in neonatal swine after inhalation

    International Nuclear Information System (INIS)

    Measurements of retention of plutonium in swine exposed to either 238Pu nitrate or oxide at 1 day of age and killed at 1 hr postexposure indicated that 38% and 52%, respectively, of the administered dose was initially deposited in the lung. Less than one-half that amount remained in the lung after 1 or 2 wk. At 7 days, most of the 238Pu inhaled as the nitrate was retained in the gut. Retention of the oxide in gut at 7 days was about 10% of the inhaled dose

  19. Measurement of resonance self-shielding factors of neutron capture cross section by 238U

    International Nuclear Information System (INIS)

    Resonance self-shielding factors fsub(c) of neutron capture cross section by 238U in the 20-100 keV energy range are measured. The method for determining the fsub(c) factor consists in measuring partial transmission and transmission in the total cross section at different 238U filter thickness. The fsub(c) factor values in the 46.5-100 and 21.5-46.5 keV energy ranges are equal to 0.89+-0.03 and 0.81+-0.04, respectively

  20. Metals for the containment of nitric acid solutions of plutonium-238

    International Nuclear Information System (INIS)

    Results of a study of the corrosion of various transition-metal alloys, tantalum, and tantalum/2.5% tungsten are reported. The solvent contained nitric acid, hydrofluoric acid, and ammonium hexanitratocerate. It was designed to imitate the corrosiveness of the nitric acid, hydrofluoric acid mixture used to dissolve 238-plutonium dioxide. (author)

  1. Photo fission cross-section of 232Th, 238U and 237Np

    International Nuclear Information System (INIS)

    In the present work, photo fission cross-section of 232Th, 238U and 237Np evaluated with the help of fission fragment angular distribution measurements by using Bremsstrahlung radiation from 7.4 MeV to 9.0 MeV have been carried out by employing high efficiency SSNTD technique

  2. 49 CFR 238.447 - Train operator's controls and power car cab layout. (United States)


    ... employee regularly assigned to occupy a power car cab and any floor-mounted seat in the cab shall be: (1... 49 Transportation 4 2010-10-01 2010-10-01 false Train operator's controls and power car cab layout... Specific Requirements for Tier II Passenger Equipment § 238.447 Train operator's controls and power car...

  3. Radiochemical measurement of mass distribution in 16O+238U reaction at sub-barrier energy

    International Nuclear Information System (INIS)

    In the present, radiochemical study of the mass distribution in 16O+238U has been carried out at sub-barrier energy to investigate the nature of mass distribution in CFF and TF channels. In addition, cross sections of evaporation residues formed in one nucleon transfer/pick-up reactions have also been measured

  4. Some important aspects of fragment angular momentum in medium energy fission of 238U

    International Nuclear Information System (INIS)

    Independent isomeric yield ratios of 131Te, 133Te and 134I have been determined at five different energies in the range of 25-44 MeV alpha particle induced fission of 238U using radiochemical and gamma spectrometric techniques. From the independent isomeric yield ratios, fragment angular momenta (Jrms) have been deduced using a statistical model analysis. The Jrms were also calculated theoretically based on thermal equilibration of various collective modes after considering the occurrence of multichance fission. These data and the literature data for various fragments in the mass region 126-136 in 238U (α,f), 238U (p,f) and 238U (γ,f) show the following important features: (i) Both the entrance channel excitation energy and input angular momentum affect the fragment angular momentum in the exit channel. (ii) There are two groups of fission products from the point of view of change of fragment angular momentum with increase in excitation energy and input angular momentum. (iii) Fragment angular momentum depends on nuclear structure effect such as shell closure proximity and odd-even effect. (iv) The fragment angular momentum calculated theoretically based on statistical equilibration of various collective modes are in good agreement with the experimental values indicating the validity of such an assumption

  5. Late effects of inhaled 238PuO2 in beagles

    International Nuclear Information System (INIS)

    Osteosarcomas were the primary cause of death in beagle dogs 4 to 8 years after inhalation of 238PuO2. The plutonium body burden at death ranged from 0.4 to 2.6 μCi with 32 to 55 percent of the plutonium in the skeleton. Pulmonary neoplasia was observed in three of the bone-tumor-bearing dogs

  6. Determination of 238U nucleus number using grid ionization chamber method and small solid angle method

    International Nuclear Information System (INIS)

    Using the grid ionization chamber method and small solid angle method, the number of 238U nucleus in the highly pure U3O8 sample is determined. Although the ratio of efficiency for the two methods is as high as 484, the results are in good agreement

  7. Biokinetics aand dosimetry of inhaled 238PuO2 in the beagle dog: An update

    International Nuclear Information System (INIS)

    The temporal and spatial distributions of 238Pu have been measured during the course of a dose-response study of the biological effects of inhaled 238PuO2 in Beagle dogs. These measurements were done on the dose-response study animals, as well as a separate group of dogs exposed to similar aerosols and killed serially out to 4 y after exposure. The data from this latter group provided the basis for the development of a biokinetic/dosimetric model for 238PuO2 in dogs. Since the publication of this model, several important findings have been made that affected the dosimetric evaluations. The first involved the discovery of significant quantities of natural uranium (U) in the feces samples. The U was measured with the plutonium (Pu), which inflated the values for purported Pu in feces. The second finding involved the addition of Pu biokinetics data from the dose-response dogs, which increased the period of observation from 4 y to 15 y; these later data were not consistent with the earlier model predictions. The purpose of this investigation was (1) to remove the analytical bias in the 238Pu radiochemical data due to the U and (2) to modify the original model of Mewhinney and Diel, taking into account all data from both studies

  8. Conceptual designs for a long term 238PuO2 storage vessel

    International Nuclear Information System (INIS)

    This is a report on conceptual designs for a long term, 250 years, storage container for plutonium oxide ([sup 238]PuO[sub 2]). These conceptual designs are based on the use of a quartz filter to release the helium generated during the plutonium decay. In this report a review of filter material selection, design concepts, thermal modeling, and filter performance are discussed

  9. Spatial distribution of U-238, Ra-226 and Pb-210 at Urgeirica uranium mill tailings

    International Nuclear Information System (INIS)

    The extensive exploitation and treatment of the uranium ore in the Urgeirica mine, Portugal, where exists a chemical treatment plant, led to an accumulation of large amounts of solid wastes (tailings) deposited in piles or dams. The objective of this work is to investigate the extent of the contamination at the oldest dams (more than 40 years old) taking into account the U-238, Ra-226 and Pb-210 distribution at those dams. Tailings core and surface samples were randomly collected at the dams. Tailings samples were dried and the activity in U-238 (through the peaks of Th-234), Ra-226 (through the progenies Pb-214 and Bi-214) and Pb-210 were determined by gamma spectrometry. The results show a big variability (by a factor of 5 to 10) if the U-238, Ra-226 and Pb-210 concentrations at the surface tailings, which indicates a heterogeneity of the radionuclides distribution at the dams area. A good correlation between Ra-226 and U-238 concentrations at the sampling site (dam D2) that presents lower Ra-226 concentrations was obtained. As expected, the most important contribution to the high natural radioactivity at the oldest dams is due to the radium rejected as a waste product from the uranium ore treatment (author)

  10. Characterization and testing of a 238Pu loaded ceramic waste form

    International Nuclear Information System (INIS)

    This paper will describe the preparation and progress of the effort at Argonne National Laboratory-West to produce ceramic waste forms loaded with 238Pu. The purpose of this study is to determine the extent of damage, if any, that alpha decay events will play over time to the ceramic waste form under development at Argonne. The ceramic waste form is glass-bonded sodalite. The sodalite is utilized to encapsulate the fission products and transuranics which are present in a chloride salt matrix which results from a spent fuel conditioning process. 238Pu possesses approximately 250 times the specific activity of 239Pu and thus allows for a much shorter time frame to address the issue. In preparation for production of 238Pu loaded waste forms 239Pu loaded samples were produced. Data is presented for samples produced with typical reactor grade plutonium. X-ray diffraction, scanning electron micrographs and durability test results will be presented. The ramifications for the production of the 238Pu loaded samples will be discussed

  11. Gastrointestinal absorption and retention of plutonium-238 in neonatal rats and swine

    International Nuclear Information System (INIS)

    Neonatal rats gavaged with 237Pu or 238Pu retained a substantial quantity in gut mucosa for a week but absorbed only 2.9% of the 237Pu. After 140 days the amount retained fell to half that initially deposited. Newborn swine also retained large amounts in the gut and absorbed about 40% of the dose

  12. 238U spontaneous fission half-life and a new probable radioactivity mode

    International Nuclear Information System (INIS)

    The 238U spontaneous fission half-life is reinvestigated using a special nuclear emulsion technique previously developed in our laboratory. A perfect visualisation of the fission fragments tracks in the absence of alpha particle tracks was obtained with the present method that also avoids the fading of the latent image. Under these conditions, two well defined peaks are observed experimentaly: one corresponding to the well-known range (approx 24 μm) of the 238U fission fragments tracks and the other showing evidence of short range tracks (approx 10 μm). For the 238U spontaneous fission half-life our result is (6.0+-0.4) x1015 y, in good agreement with the values obtained by some other workers using different experimental methods. A systematic theoretical analysis shows that the 238U spontaneous emission of nuclides with mass number between approx 20 e 70 is possible. The Kinetic energies calculated for these nuclides are found to fit the short range tracks observed in our experiment. From the experimental data, we attribute a (2 +- 1) x 1015 y half-life for all modes of emission involved in this process. (Author)

  13. Two types of adakites revealed by 238U-230Th disequilibrium from Daisen volcano, southwestern Japan

    International Nuclear Information System (INIS)

    Daisen volcano is located on the Quaternary volcanic front in southwestern Japan. The volcano is composed mainly of andesite and dacite, which chemically resemble adakites, with high Al2O3 and Sr/Y, steep REE patterns, and no negative Eu anomaly. (238U/230Th) disequilibrium (herein, a ratio in parentheses denotes the activity ratio) and trace element analyses of adakites from two volcanic domes, Karasugasen and Misen, indicate two adakite types. Adakite from Karasugasen is characterized by excess (230Th) over (238U), typical of most adakites, whereas adakite from Misen is characterized by excess (238U) over (230Th). The latter is consistent with enrichment in fluid-mobile elements relative to fluid immobile elements compared to rocks from Karasugasen. The values of (230Th/232Th) of adakites from Karasugasen and Misen are, respectively, around 0.75 and 0.81. These low (230Th/232Th) ratios result from the incorporation of subducted sedimentary material. The ratios, nevertheless, are higher than that for the estimate of lower crustal material suggesting significant incorporation of lower crust is unlikely. As adakites from Misen have (238U) excess over (230Th), adakite magma must have interacted with wedge mantle metasomatized by a slab-derived fluid, confirming the presence of a fluid-metasomatized mantle beneath Daisen volcano. (author)

  14. Uses of uranium isotopes 234U and 238U in hydrology and hydrogeology

    International Nuclear Information System (INIS)

    This work describes the application of the uranium isotopes 234U, 238U as a practically usuable indicator in hydrology and hydrogeology as well as its value in scientific research. The emphasis is laid on the methods of interpretation of U-data and the application of these methods to special hydrologic and hydrogeologic problems in the GDR. (author)

  15. Determination of 235U/238U Ratio on Urine by ICP-MS

    International Nuclear Information System (INIS)

    LLNL Internal Dosimetry Program - The new procedure satisfies the requirement to determine 235U/238U ratio in bioassay urine samples. MDA - The LC and MDA95 for 235U are well below the required detection limit of 0.00035 μg/L. Turn around time - Analysis of 10 samples plus 2 QCs can be completed in one work day (8 hours).

  16. 238U(n,γ) cross section above the resonance region

    International Nuclear Information System (INIS)

    A number of measurements of the 238U(n,γ) cross section above the resonance region have been completed in the past few years. In the keV range, these measurements suggest a considerable amount of intermediate structure. Comparisons are made of pre-1970 and more recent evaluations with ENDF/B-IV results. Discrepancies and uncertainties are discussed

  17. Study of fusion-fission dynamics in 19F+238U reaction (United States)

    Dubey, R.; Sugathan, P.; Jhingan, A.; Kaur, Gurpreet; Mukul, Ish; Siwal, Davinder; Saneesh, N.; Banerjee, Tathagata; Yadav, Abhishek; Thakur, Meenu; Mahajan, Ruchi; Chaterjee, M. B.


    Mass angle distribution measurements for 19F+238U reaction were carried out around the sub barrier energies. Mass angle correlation has not been observed at above and below the fusion barrier in present reaction. This infer the minimal presence of non compound like events at these bombarding energies range.

  18. 49 CFR 238.209 - Forward end structure of locomotives, including cab cars and MU locomotives. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Forward end structure of locomotives, including... SAFETY STANDARDS Specific Requirements for Tier I Passenger Equipment § 238.209 Forward end structure of locomotives, including cab cars and MU locomotives. (a)(1) The skin covering the forward-facing end of...

  19. Energy dependence of 238U fission yields investigated in inverse kinematics

    Directory of Open Access Journals (Sweden)

    Veselsky M.


    Full Text Available The production cross sections of neutron-rich fission residues produced in reactions induced by a 238U beam impinging onto Pb and Be targets were investigated at the Fragment Separator (FRS at GSI using the inverse kinematic technique. These data allowed us to discuss the optimum energies in fission for producing the most neutron-rich residues.

  20. Recent measurements of 234U/238U isotope ratio in spring waters from the Hadzici area

    International Nuclear Information System (INIS)

    The Hadzici area has become interesting for investigation since depleted uranium ammunition had been employed in 1995 during the NATO air strike campaign in Bosnia and Herzegovina. The purpose of this study is to determine uranium concentration and 234U/238U activity ratio in the spring waters of this area and to investigate their relationship, as well as spatial variations. The spring water samples were taken at 18 sites in total. For the determination of uranium radioisotopes, radiochemical separation procedure followed by alpha-particle spectrometry was applied. Uranium concentration in analyzed waters range from 0.15 to 1.12 μg/L. Spring waters from carbonate based sediments have a lower uranium concentration of between 0.15 and 0.43 μg/L, in comparison to waters sampled within sandstone-based sediments ranging from 0.53 to 1.12 μg/L. Dissolved uranium shows significant spatial variability and correlation with bedrock type confirmed by Principal Component Analysis and Hierarchical Cluster Analysis. The majority of the analyzed waters have a 234U/238U activity ratio ranging from 1.02 to 1.90, of which half of the results range between 1.02 and 1.16. No apparent depleted uranium (DU) contamination was observed, as 234U/238U activity ratio is dependent on geochemical conditions in the environment. Even though the tested spring waters demonstrate significant variability in uranium concentration, 234U/238U activity ratio and 234U excess, waters with similar uranium isotopic signatures are observable within the region. The guidelines on the spatial redistribution of dissolved uranium (corresponding to 238U mass concentration), along with 234U/238U activity ratios were provided by the Inverse Distance Weighting (IDW) method. Waters having similar isotopic signature have been delineated. -- Highlights: ► Uranium concentration in analyzed spring waters ranges from 0.15 to 1.12 μg/L. ► Dissolved uranium shows correlation with bedrock type. ► Low 234U/238U

  1. Definition of a process for the recovery of ultra traces of Pu238 from a 300 Kg depleted uranium batch

    International Nuclear Information System (INIS)

    In order to measure the half life of the double beta decay of U238, a process for the recovery of trace amounts of Pu238 (about 30 000 atoms) from a 300 kg batch of depleted uranium has been studied and tested. The process includes a Pu (IV) valency adjustment step with nitrous oxide, followed by nine chromatographic cycles (plutonium decontamination factor up to 1011 have been achieved for Th, Pa and U). The procedure to realize the alpha spectrometry measurement has also been defined. Full scale apparatus have been set in the CRN facility near STRASBOURG. The first part of the experiment (U238 purification before one year aging and measurement of the extracted Pu238 traces) has been realized. The results of the Pu traces counting allows the validation of the chemical process but also show an important Pu238 contamination certainly a consequence of the TCHERNOBYL accident. (author). 76 refs., 63 tabs., 49 figs

  2. Studying nuclear level densities of {sup 238}U in the nuclear reactions within the macroscopic nuclear models

    Energy Technology Data Exchange (ETDEWEB)

    Razavi, Rohallah; Aghajani, Maghsood; Khooy, Asghar [Imam Hossein Comprehensive Univ., Tehran (Iran, Islamic Republic of). Dept. of Physics; Rahmatinejad, Azam; Taheri, Fariba [Univ. of Zanjan (Iran, Islamic Republic of). Dept. of Physics; Kakavand, Tayeb [Imam Khomeini International Univ., Qazvin (Iran, Islamic Republic of). Dept. of Physics


    In this work the nuclear level density parameters of {sup 238}U have been extracted in the back-shifted Fermi gas model (BSFGM), as well as the constant temperature model (CTM), through fitting with the recent experimental data on nuclear level densities measured by the Oslo group. The excitation functions for {sup 238}U(p,2nα){sup 233}Pa, and {sup 238}U(p,4n){sup 235}Np reactions and the fragment yields for the fragments of the {sup 238}U(p,f) reaction have been calculated using obtained level density parameters. The results are compared to their corresponding experimental values. It was found that the extracted excitation functions and the fragment yields in the CTM coincide well with the experimental values in the low-energy region. This finding is according to the claim made by the Oslo group that the extracted level densities of {sup 238}U show a constant temperature behaviour.

  3. Large scale production of Pu-238 to 'denature' weapons-grade plutonium. Rev. 0

    International Nuclear Information System (INIS)

    The concept of open-quote denaturing close-quote weapons-grade or reactor-grade plutonium through the addition of Pu-238 has been proposed recently by Dr. Mel Coops of Lawrence Livermore National Laboratory. He indicates that on the order of 2-3 wt.% plutonium-238 (Pu-238) may be sufficient to render the plutonium impractical for weapons use due to excessive heat generation. This would significantly reduce or eliminate proliferation concerns for use of plutonium in commercial nuclear fuels. This report presents a high-level assessment of the potential for producing large quantities of Pu-238 for the purpose of open-quote denaturing close-quote the weapons-grade or reactor-grade plutonium that may be used in commercial reactors as mixed-oxide (MOX) fuels. Pu-238 production can be done by two methods. The traditional method employed in the U.S. was to irradiate targets of neptunium-237 (Np-237), this isotope being produced from neutron capture in U-236. Recycling enriched uranium fuels in the defense production reactor fuel cycle increased the U-236 content, increasing the subsequent yield of Np-237. Production by this method thus involves significant reactor irradiation time, and reprocessing of fuel to recover uranium and Np-237 for fabrication into new fuel and targets, respectively. The second method would be to irradiate targets of Am-241, recovered as a decay product from aged plutonium. This method again would require processing of plutonium or spent fuel to recover Am-241. Either method would require processing of targets after irradiation, and a facility for fabricating targets and processing the plutonium to a final pure oxide form

  4. Experimental study of 238U Doppler reactivity worth in FCA XVI-1 and XVI-2 cores

    International Nuclear Information System (INIS)

    Doppler reactivity worths of natural uranium samples were measured in metallic fueled cores, FCA XVI-1 and XVI-2, using a sample heating technique. In a metallic fueled LMFBR, the neutron spectrum is generally harder than a similar size oxide fueled LMFBR owing to the luck of oxygen. The accuracy of Doppler effect calculation for a harder neutron spectrum was evaluated by comparing C/E values of Doppler reactivity worth in oxide fueled cores and in metallic fueled cores using FCA experiments. It was found that calculation using 70-group constant set JFS-3-J2 underestimates 238U Doppler reactivity worth in metallic fueled cores. An inadequate treatment of resonance parameters of 238U above 50 keV in JENDL-2 is one of the reasons for this underestimation. In JENDL-2 the resonance parameters of 238U above 50 keV are not included, and hence JFS-3-J2 which is processed from JENDL-2 does not have a self-shielding factor table above 40.9 keV of 238U. When the contribution of this energy region for Doppler reactivity worth was corrected using ENDF/B-VI, which includes resonance parameters of 238U up to 149 keV, the JFS-3-J2 based calculation gave 13% higher values for metallic sample experiments and 8% for oxide samples. Even after this correction, the calculation still gave smaller Doppler reactivity worths than the measurements, and the ratios of calculated value to experimental one vary widely from 0.6 to 1.0. (author)

  5. Energy distribution of neutrons from the (n,2n) reaction in 238U

    International Nuclear Information System (INIS)

    Energy distribution of the first and second neutrons from (n,2n) scattering event in 238U was evaluated according to the consistent compound nucleus model recently proposed by Segev. The law for deriving the energy distribution of secondary neutrons from a (n,2n) scattering event, depends on whether the reaction is considered as a simultaneous emission of two neutrons from one compound nucleus, or a successive emission of neutrons from different compound nuclei. Segev has presented a means of calculating the energy distribution assuming the latter model. The laws presented in the ENDF/B data files suggest the former model. The evaluation was based on inelastic level excitation and evaporation data for 238U and 237U. Data was retrieved from ENDF/B files. The evaporation data for 237U was based on (γ,n) reaction 238U. The inelastic level excitation data for 237U was evaluated at the Soreq Nuclear Research Centre. It is concluded from the application of Segev's model to 238U, that the energetic spectrum of secondary neutrons, is harder in the high range of energy than the one predicted by the use of the distribution law presented in ENDF/B data files. The spectrum of secondary (n,2n) neutrons, resulting from the interaction of 14 MeV neutrons in 238U calculated with Segev's model, is compared with the corresponding spectrum of the LLL library, ENDF/B library and the recent evaluation of BNWL. It is found that the spectrum evaluated by LLL and BNWL is harder than that evaluated with Segev's model

  6. 238U, and its decay products, in grasses from an abandoned uranium mine (United States)

    Childs, Edgar; Maskall, John; Millward, Geoffrey


    Bioaccumulation of radioactive contaminants by plants is of concern particularly where the sward is an essential part of the diet of ruminants. The abandoned South Terras uranium mine, south west England, had primary deposits of uraninite (UO2) and pitchblende (U3O8), which contained up to 30% uranium. When the mine was active uranium and radium were extracted but following closure it was abandoned without remediation. Waste rock and gangue, consisting of inefficiently processed minerals, were spread around the site, including a field where ruminants are grazed. Here we report the activity concentrations of 238U, 235U 214,210Pb, and the concentrations of selected metals in the soils, roots and leaves of grasses taken from the contaminated field. Soil samples were collected at the surface, and at 30 cm depth, using an auger along a 10-point transect in the field from the foot of a waste heap. Whole, individual grass plants were removed with a spade, ensuring that their roots were intact. The soils and roots and grass leaves were freeze-dried. Activity concentrations of the radionuclides were determined by gamma spectroscopy, following 30 days incubation for development of secular equilibrium. Dried soils, roots and grasses were also digested in aqua regia and the concentrations of elements determined by ICP techniques. Maximum activity concentrations of 238U, 235U, 214Pb and 210Pb surface soils were 63,300, 4,510, 23,300 and 49,400 Bq kg‑1, respectively. The mean 238U:235U ratio was 11.8 ± 1.8, an order of magnitude lower than the natural value of 138, indicating disequilibrium within the decay chain due to mineral processing. Radionuclides in the roots had 5 times lower concentration and only grass leaves in the vicinity of the waste heap had measureable values. The mean soil to root transfer factor for 238U was 36%, the mean root to leaf was 3% and overall only 0.7% of 238U was transferred from the soil to the leaves. The roots contained 0.8% iron, possibly as

  7. 49 CFR Figure 1a to Subpart B of... - Example of Location of Rescue Access Windows-§ 238.114 (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Example of Location of Rescue Access Windows-§ 238.114 1A Figure 1A to Subpart B of Part 238 Transportation Other Regulations Relating to... B of Part 238—Example of Location of Rescue Access Windows—§ 238.114 ER01FE08.002...

  8. 49 CFR Figure 1 to Subpart B of... - Example of Location and Staggering of Emergency Window Exits-§ 238.113 (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Example of Location and Staggering of Emergency Window Exits-§ 238.113 1 Figure 1 to Subpart B of Part 238 Transportation Other Regulations Relating to... of Part 238—Example of Location and Staggering of Emergency Window Exits—§ 238.113 ER01FE08.001...

  9. The inflow of 234U and 238U from the River Odra drainage basin to the Baltic Sea

    Directory of Open Access Journals (Sweden)

    Bogdan Skwarzec


    Full Text Available In this study the activity of uranium isotopes 234U and 238U in Odra river water samples, collected from October 2003 to July2004, was measured using alpha spectrometry. The uranium concentrations were different in each of the seasons analysed; the lowest values were recorded in summer. In all seasons, uranium concentrations were the highest in Bystrzyca river waters (from 27.81 ± 0.29Bq m-3 of 234U and 17.82 ± 0.23 Bq m-3 of 238U in spring to 194.76 ± 3.43 Bq m-3 of 234U and 134.88 ± 2.85 Bq m-3 of 238U in summer. The lowest concentrations were noted in the Mała Panew (from 1.33 ± 0.02 Bq m-3 of 234U and 1.06 ± 0.02 Bq m-3 of 238U in spring to 3.52 ± 0.05 Bq m-3 of 234U and 2.59± 0.04 Bq m-3 of 238U in autumn. The uranium radionuclides 234U and 238U in the water samples were not in radioactive equilibrium. The 234U / 238U activity ratios were the highest in Odra water samples collected at Głogów (1.84 in autumn, and the lowest in water from the Noteć (1.03 in winter and spring. The 234U / 238U activity ratio decreases along the main stream of the Odra, owing to changes in the salinity of the river's waters. Annually, 8.19 tons of uranium (126.29 G Bq of 234U and 100.80 G Bq of 238U flow into the Szczecin Lagoon with Odra river waters.

  10. 238U self-indication ratio measurement in the resonance region

    International Nuclear Information System (INIS)

    An accurate representation of the 238U cross-section structures in the resonance region is required to compute the resonance self-shielded effective cross sections used in the calculation of thermal and fast-reactor performance parameters. Several authors have demonstrated the usefulness of self-indication and average transmission measurements to investigate the resonance structure of the 238U cross sections. This paper compares measured self-indication ratios with calculations based on ENDF/B-V, in the resolved energy range from 100 eV to 4 keV. In that energy range the ENDF/B-V evaluation is chiefly based on high resolution transmission measurements. The immediate purpose of the comparison presented is not to generate a new set of improved resonance parameters but to provide an additional test of the adequacy of the ENDF/B-V representation for the calculation of resonance self-shielding

  11. Effects of nuclear orientation on fusion and fission in the reaction using 238U target nucleus

    Directory of Open Access Journals (Sweden)

    Hirose K.


    Full Text Available Fission fragment mass distributions in the reaction of 30Si+238U were measured around the Coulomb barrier. At the above-barrier energies, the mass distribution showed a Gaussian shape. At the subbarrier energies, triple-humped distribution was observed, which consists of symmetric fission and asymmetric fission peaked at AL/AH ≈ 90/178. The asymmetric fission should be attributed to quasifission from the results of the measured evaporation residue (ER cross-sections for 30Si+238U. The cross-section for 263Sg at the abovebarrier energy agree with the statistical model calculation which assumes that the measured fission cross-section originates from fusion-fission, whereas the one for 264 Sg measured at the sub-barrier energy is smaller than the calculation, which suggests the presence of quasifission.

  12. Neutron and fragment yields in proton-induced fission of 238U at intermediate energies

    International Nuclear Information System (INIS)

    The primary fission fragment mass and kinetic energy distributions, and neutron multiplicities as function of fragment mass have been measured in the proton-induced fission of 238U at energies Ep=20, 35, 50 and 60 MeV using time-of-flight technique. Pre-scission and post-scission neutron multiplicities have been extracted from double differential distributions. The fragment mass dependence of the post-scission neutron multiplicities reveals the gross nuclear shell structure effect even at the higher proton energies we measured. The yields of neutron-rich fission products in the fission of 238U by 25 MeV protons were measured using an ion guide-based isotope separator technique. The results indicate enhancement for superasymmetric mass division at intermediate excitation energy of the fissioning nucleus. The experimental results have been analysed in the framework of a time-dependent statistical model with inclusion of nuclear friction effects in the fission process

  13. Comparison of Yields of neutron rich nuclei in Proton and Photon induced $^{238}$U fission

    CERN Document Server

    Khan, F A; Basu, D N; Farooq, M; Chakrabarti, Alok


    A comparative study of fission of actinides specially $^{238}$U, by proton and bremsstrahlung photon is performed. Relative mass distribution of $^{238}$U fission fragments have been explored theoretically for both proton and photon induced fission. The integrated yield along with charge distribution of the products are calculated to find out the neutron richness in comparison to the nuclei produced by r-process in nucleosynthesis. Some r-process nuclei in intermediate mass range for symmetric fission mode are found to be produced almost two order of magnitude more for proton induced fission than photofission, although rest of the neutron rich nuclei in the asymmetric mode are produced in comparable proportion for both the processes.

  14. Studies of Neutron-Induced Fission of 235U, 238U, and 239Pu (United States)

    Duke, Dana; TKE Team


    A Frisch-gridded ionization chamber and the double energy (2E) analysis method were used to study mass yield distributions and average total kinetic energy (TKE) release from neutron-induced fission of 235U, 238U, and 239Pu. Despite decades of fission research, little or no TKE data exist for high incident neutron energies. Additional average TKE information at incident neutron energies relevant to defense- and energy-related applications will provide a valuable observable for benchmarking simulations. The data can also be used as inputs in theoretical fission models. The Los Alamos Neutron Science Center-Weapons Neutron Research (LANSCE - WNR) provides a neutron beam from thermal to hundreds of MeV, well-suited for filling in the gaps in existing data and exploring fission behavior in the fast neutron region. The results of the studies on 238U, 235U, and 239Pu will be presented. LA-UR-14-24921.

  15. Radiation exposure due to implanted pacemakers with 238Pu-nuclide batteries

    International Nuclear Information System (INIS)

    The radiation exposure of patients and environment due to neutron and γ-radiation was determined using the results of outdoor and model measurements and direct measurements carried out on 7 patients with implanted 238Pu-pacemakers. For measuring the neutron dose equivalent a directly recording proportional counter was used, which was calibrated with a 238Pu-neutron source for various tissue depths. The distribution of fluence in the tissue surrounding the neutron source was determined by means of 0,3 mm thick nuclear track etching detectors in a phantom. Corresponding measurings of γ-doses were carried out with LiF-dosimeters. The dose equivalent of neutrons and gamma radiation is determined as function of the distance from the source; the build-up and the attenuation in the tissue being taken into account. The radiation exposure of the patient and environment is compared with the long-term radiation exposure due to natural and civilizing factors. (orig.)

  16. Effect of carbides on erosion resistance of 23-8-N steel

    Indian Academy of Sciences (India)

    Aniruddha A Gadhikar; Ashok Sharma; D B Goel; C P Sharma


    Microstructure is one of the most important parameters influencing erosion behaviour of materials. The role of carbides in the matrix is very complicated in controlling the erosion rate of the materials. Conflicting results have been reported in the literature about the effect of carbides on erosion resistance. Carbides are of great importance especially as obstacles against the penetration of erosive particles into the material surface. However, they are susceptible to cracking and causing matrix decohesion which may increase the overall erosion rate. In 23-8-N nitronic steel, carbides present in the form of bands are observed to accelerate the erosion rate. Coarse carbides cause depletion of carbon in the austenite matrix which adversely affects the strain hardening tendency thus causing deterioration in erosion resistance of the bulk material. The dissolution of carbides in the austenitic matrix after solution annealing is observed to improve the erosion resistance of 23-8-N nitronic steel.

  17. Exploring the multi-humped fission barrier of 238U via sub-barrier photofission

    CERN Document Server

    Csige, L; Glodariu, T; Gulyás, J; Günther, M M; Habs, D; Karwowski, H J; Krasznahorkay, A; Rich, G C; Sin, M; Stroe, L; Tesileanu, O; Thirolf, P G


    The photofission cross-section of 238U was measured at sub-barrier energies as a function of the gamma-ray energy using, for the first time, a monochromatic, high-brilliance, Compton-backscattered gamma-ray beam. The experiment was performed at the High Intensity gamma-ray Source (HIgS) facility at beam energies between E=4.7 MeV and 6.0 MeV and with ~3% energy resolution. Indications of transmission resonances have been observed at gamma-ray beam energies of E=5.1 MeV and 5.6 MeV with moderate amplitudes. The triple-humped fission barrier parameters of 238U have been determined by fitting EMPIRE-3.1 nuclear reaction code calculations to the experimental photofission cross section.

  18. Exploring the multihumped fission barrier of 238U via sub-barrier photofission (United States)

    Csige, L.; Filipescu, D. M.; Glodariu, T.; Gulyás, J.; Günther, M. M.; Habs, D.; Karwowski, H. J.; Krasznahorkay, A.; Rich, G. C.; Sin, M.; Stroe, L.; Tesileanu, O.; Thirolf, P. G.


    The photofission cross section of 238U was measured at sub-barrier energies as a function of the γ-ray energy using a monochromatic, high-brilliance, Compton-backscattered γ-ray beam. The experiment was performed at the High Intensity γ-ray Source (HIγS) facility at beam energies between Eγ=4.7 MeV and 6.0 MeV and with ˜3% energy resolution. Indications of transmission resonances have been observed at γ-ray beam energies of Eγ=5.1 MeV and 5.6 MeV with moderate amplitudes. The triple-humped fission barrier parameters of 238U have been determined by fitting empire-3.1 nuclear reaction code calculations to the experimental photofission cross section.

  19. Direct alpha-recoil as a process to generate U-234/U-238 disequilibrium in groundwater

    International Nuclear Information System (INIS)

    We discuss quantitatively the capability of direct α-recoil to create observable radioactive disequilibrium (U-234/U-238 activity ratio > 1) in flowing groundwater. Coupled equations for radioactive decay chain are formulated for the solid U source and for the corresponding groundwater receiving the recoiling U-234 atoms. U-rich fracture coating material and the water flowing in the fracture are discussed in detail. The novel modelling approach worked well and provides a useful tool for more detailed site-specific studies with more detailed input data. The approach appears feasible because the equations are based on straightforward mass balance considerations. α-recoil -induced enrichment of U-234 in groundwater is a slow process: the increase of U-234/U-238 activity ration to notable values above unity will take hundreds to thousands of years. Strong groundwater flow prevents any local recoil-induced U-234 enrichment in the water. (author)

  20. Certification of a uranium-238 dioxide reference material for neutron dosimetry (EC nuclear reference material 501)

    International Nuclear Information System (INIS)

    Uranium-238 oxide of 99.999% isotopic and 99.98% chemical purity was transformed into dioxide spheres of nominal 0.5 and 1.0 mm diameter by gel precipitation and subsequent calcination under carbon dioxide and under argon containing 5% hydrogen at 1 125 K. The spheres were analysed by thermal ionization mass spectrometry, including isotope dilution, by gravimetry and by potentiometric titration. On the basis of these analyses, the uranium mass fraction was certified at 879.4 ± 2.8, and the 235U/U - and 238U/U abundances at 10.4 ± 0.5 and 999.9896 ± 0.0005, respectively. The material is intended to be used as a reference material in neutron metrology

  1. Annual environmental monitoring report: calender year 1977. [/sup 238/Pu, /sup 3/H, Mound Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Farmer, B.M.; Carfagno, D.G.


    The local environment surrounding Mound Facility was monitored for tritium and plutonium-238. The results are reported for calendar year 1977. The environmental parameters analyzed included air, water, foodstuffs, soil and silt. The average concentrations of plutonium-238 and tritium were within the applicable stringent standards for radioactive species adopted by the U.S. DOE. Mound Facility drinking water has been brought into compliance with the new EPA standard for tritium in community drinking water systems, and Mound has undertaken a program to achieve compliance for nine private wells adjacent to the Facility site. The program has partially achieved its objective by bringing Mound wells and some of the nine affected private wells in the vicinity of Mound Facility into compliance with the U.S. EPA standard and significantly reducing tritium concentration in the remaining wells. Data concerning nonradioactive species in air and water are also presented and compared to federal, state, and local standards, where applicable.

  2. Adsorption of Cs-137 and U-238 in semi-arid soils

    International Nuclear Information System (INIS)

    Is of great importance to determine the adsorption properties of the soils where radioactive wastes are stored, fundamentally of the radioisotopes contained in these wastes, with the purpose of knowing like will be their behavior in the event of happening radionuclide migration toward the surrounding means. Therefore, in this work the adsorption properties of 137Cs+ and 238UO22+ in soils coming from the Storage Center of Radioactive Wastes are studied. Was studied the effect of the soil type and the particle size of the soil in the adsorption properties of Cs (I) and U (Vi). 13 soil samples and six different particle sizes were analyzed. The adsorption studies were carried out by the radiotracers technique in static way. The results indicate an important adsorption affinity toward the Cs-137 and a very vulnerable affinity for the 238UO22+. (author)

  3. Measurement and resonance analysis of neutron transmissions through four samples of 238U

    International Nuclear Information System (INIS)

    Accurate total and partial cross sections for 238U are important for nuclear reactor design. In the resolved resonance region, energies below 4.0 keV, these cross sections are described in terms of individual resonance parameters of which the neutron widths in the 1.5 to 4.0 keV region from various workers appear discrepant. In order to determine these widths, (0.880 to 100.0 keV) neutron transmissions through 0.076, 0.254, 1.080, and 3.620 cm thick enriched 238U samples were measured, and (0.880 to 100.0 keV) range transmissions were analyzed

  4. Preparation of 237U in photonuclear reaction 238U(γ,n) in electron accelerator - microtron MT-25

    International Nuclear Information System (INIS)

    237U are obtained in 238U(γ,n) reaction in electron accelerator - microtron MT-25 FLYaR. Radiation yield of 237U is 1 kBq/(mcA h mg 238U). Purification of 237U from fission products is carried out using extraction and ion exchange. Preparation of 237U with specific radioactivity 49500 kBq/mg 238U is prepared. Content of radioactive impurities in preparation does not exceed 10-5. Chemical yield of 237U is 70 %

  5. Prompt γ-rays from the Fast Neutron Induced Fission on 235,238U and 232Th (United States)

    Lebois, M.; Wilson, J. N.; Halipré, P.; Leniau, B.; Matea, I.; Oberstedt, A.; Oberstedt, S.; Verney, D.

    Preliminary results from the first experiment using the LICORNE neutron source at the IPN Orsay are presented. Prompt fission gamma rays from fast-neutron induced fission of 238U, 232Th and 235U were detected. Thick samples of around 50 g of 238U and 232Th are used for the first part of the experiment. An ionisation chamber containing ∼ 10 mg samples of 238U and 235U to provide a fission trigger is used for the second part of the experiment. Gamma rays have been detected using 17 high efficiency BaF2 detectors and 6 LaBr3 scintillator detectors.

  6. Uranium content and 235U/238U isotopic ratio in dental porcelain powders determined by neutron activation analysis

    International Nuclear Information System (INIS)

    The uranium contents and 235U/238U isotopic ratios in 48 dental porcelain powders of 8 brands marketed in Japan were determined by non-destructive neutron activation analysis. The photopeak counts of 277.6 keV of 239Np formed by the 238U(n,γ)239U (yield to)239Np + β- reaction and at 1.595.2 keV of 140La produced by 235U fission were measured with a Ge(Li) semiconductor detector system to determine the uranium content and 235U/238U isotopic ratio. The results of the analysis are tabulated and their significance discussed. (author)

  7. Sensitivity coefficients for the 238U neutron-capture shielded-group cross sections

    International Nuclear Information System (INIS)

    In the unresolved resonance region cross sections are represented with statistical resonance parameters. The average values of these parameters are chosen in order to fit evaluated infinitely dilute group cross sections. The sensitivity of the shielded group cross sections to the choice of mean resonance data has recently been investigated for the case of 235U and 239Pu by Ganesan and by Antsipov et al; similar sensitivity studies for 238U are reported

  8. Design improvements for gloveboxes used [in] 238PuO2 process operations

    International Nuclear Information System (INIS)

    238PuO2 process operations are housed in a complex of 76 gloveboxes and introductory hoods connected by means of an overhead trolley housed in a tunnel. Because a significant number of the gloveboxes used for 238PuO2 processing were installed before the original startup of the facility in 1978, they have been in service for nearly 20 years. During a recent heat source production campaign, numerous contamination releases in the 238PuO2 processing area were traced to degraded elastomer gaskets used for glovebox connections, and attachment of feed-throughs, service panels, and windows. Evaluation of the degraded gaskets revealed that a combination of radiolytic degradation related to the high specific activity of 238Pu, and extended service at high altitude in a low (to extremely low) humidity environment had resulted in accelerated gasket aging. However, it was also apparent that gasket design was the most important factor in actual contamination release. All of the contamination releases that were traced to degraded gaskets occurred in variations of a design that used a spline to expand an elastomeric gasket into the space between a connecting flange, window, or service panel, and a glovebox opening. No contamination releases were traced to the gasket design that employed bolted clamps to compress the gasket between a connecting flange, window, or panel, and the exterior surface of a glovebox opening. As a result of these findings, the Actinide Ceramics group at LANL (NMT-9) has initiated a routine replacement and upgrade program to replace aging gloveboxes. All of the new gloveboxes will utilize the preferred gasket design, which is expected to reduce the number and frequency of contamination releases

  9. Design improvements for gloveboxes used [in] {sup 238}PuO{sub 2} process operations

    Energy Technology Data Exchange (ETDEWEB)

    George, T.G. [Los Alamos National Lab., NM (United States). Nuclear Materials Technology Div.


    {sup 238}PuO{sub 2} process operations are housed in a complex of 76 gloveboxes and introductory hoods connected by means of an overhead trolley housed in a tunnel. Because a significant number of the gloveboxes used for {sup 238}PuO{sub 2} processing were installed before the original startup of the facility in 1978, they have been in service for nearly 20 years. During a recent heat source production campaign, numerous contamination releases in the {sup 238}PuO{sub 2} processing area were traced to degraded elastomer gaskets used for glovebox connections, and attachment of feed-throughs, service panels, and windows. Evaluation of the degraded gaskets revealed that a combination of radiolytic degradation related to the high specific activity of {sup 238}Pu, and extended service at high altitude in a low (to extremely low) humidity environment had resulted in accelerated gasket aging. However, it was also apparent that gasket design was the most important factor in actual contamination release. All of the contamination releases that were traced to degraded gaskets occurred in variations of a design that used a spline to expand an elastomeric gasket into the space between a connecting flange, window, or service panel, and a glovebox opening. No contamination releases were traced to the gasket design that employed bolted clamps to compress the gasket between a connecting flange, window, or panel, and the exterior surface of a glovebox opening. As a result of these findings, the Actinide Ceramics group at LANL (NMT-9) has initiated a routine replacement and upgrade program to replace aging gloveboxes. All of the new gloveboxes will utilize the preferred gasket design, which is expected to reduce the number and frequency of contamination releases.

  10. Measurement and analysis of anti ν energy dependence for 233U, 238U, 239Pu

    International Nuclear Information System (INIS)

    The energy dependence of the average yield of prompt neutrons per fission (anti ν) for U233, U238 and Pu239 in the incident neutron energy range (Esub(n)) up to 5 MeV has been studied using an electrostatic accelerator. The recommended curves for anti ν (Esub(n)) has been obtained with the help of the polynomial least square method fitting. The resons of deviations from the linear dependence have been analysed

  11. Microscopic approach of fission dynamics applied to fragment kinetic energy and mass distributions in 238U


    Goutte, H.; Berger, J.F.; Casoli, P.; Gogny, D.


    The collective dynamics of low energy fission in 238U is described within a time-dependent formalism based on the Gaussian Overlap Approximation of the time-dependent Generator Coordinate Method. The intrinsic deformed configurations of the nucleus are determined from the self-consistent Hartree-Fock-Bogoliubov procedure employing the effective force D1S with constraints on the quadrupole and octupole moments. Fragment kinetic energy and mass distributions are calculated and compared with exp...

  12. Late effects of inhaled 238PuO2 in beagles

    International Nuclear Information System (INIS)

    Bone tumors were the primary cause of death in beagle dogs 4 to 6 years after inhalation of 238PuO2. The plutonium body burden at death ranged from 0.5 to 2.6 μCi with 32 to 55 percent of the plutonium in the skeleton. Pulmonary neoplasia was observed in three of the bone-tumor-bearing dogs. (U.S.)

  13. Determination of 235U/238U Ratio on Urine by ICP-MS

    Energy Technology Data Exchange (ETDEWEB)

    Collins, L; Gobaleza, A; Langston, R; Radev, R; Than, C; Wong, C; Wood-Zika, A


    LLNL Internal Dosimetry Program - The new procedure satisfies the requirement to determine {sup 235}U/{sup 238}U ratio in bioassay urine samples. MDA - The L{sub C} and MDA{sub 95} for {sup 235}U are well below the required detection limit of 0.00035 {mu}g/L. Turn around time - Analysis of 10 samples plus 2 QCs can be completed in one work day (8 hours).

  14. Interactions of 238PuO2 heat sources with terrestrial and aquatic environments. Interim summary

    International Nuclear Information System (INIS)

    Observations and some conclusions made of the interactions of 238PuO2 heat sources with terrestrial and aquatic environments may be used in predicting heat source behavior in the event of contact of these heat sources with land or ocean and in assessing the risk to the environment. These studies indicate that plutonium transport from the heat sources is mostly a physical process involving the movement of extremely fine particles rather than the chemical migration of plutonium ions

  15. Spontaneous 238U fission half-life measurements based on fission-track techniques

    International Nuclear Information System (INIS)

    In the last recommendation of the International Union of Pure and Applied Chemistry (I.U.P.A.C.) on spontaneous fission half-lives for ground-state nuclides, a number of measurements of 238U based on fission-track techniques were discarded. The arguments given by the authors are not clear. A more detailed discussion of these determinations is given, considering the possible systematical errors inherent in fission-track approaches. (author)

  16. Depth profile of 236U/238U in soil samples in La Palma, Canary Islands


    Srncik, M.; P. Steier; Wallner, G.


    The vertical distribution of the 236U/238U isotopic ratio was investigated in soil samples from three different locations on La Palma (one of the seven Canary Islands, Spain). Additionally the 240Pu/239Pu atomic ratio, as it is a well establish tool for the source identification, was determined. The radiochemical procedure consisted of a U separation step by extraction chromatography using UTEVA® Resin (Eichrom Technologies, Inc.). Afterwards Pu was separated from Th and Np by anion exchange ...

  17. Disintegration constant of uranium-238 by spontaneous fission redetermined by glass track method

    International Nuclear Information System (INIS)

    The disintegration constant of U238 by spontaneous fission using glass as fission fragment detector was redetermined. A film of natural uranium (UO3) prepared by chemical methods on the glass lamina was used in a long time experience of exposure (about 16 years). The good conditions of sample preparation and storage allow to observe, after chemical etching, fission fragment tracks. (M.C.K.)

  18. 238PuO2 fines generation in radioisotopic heat sources

    International Nuclear Information System (INIS)

    Fuel aging studies were performed on the fuel form (plutonium-238 dioxide and yttrium) used in the Milliwatt Generator Radioisotopic Heat Source to determine the possibility of fuel degradation and of the resultant generation of respirable fines. In addition to long-term thermal aging of the fuel, evaluations included the effects of thermal ramping of the aged fuel to 10000C and of impacting thermally hot (4500C) heat sources at 150 m/sec after thermal aging

  19. Capture width of the 6.67 eV level in 238U

    International Nuclear Information System (INIS)

    In a comparison between a Monte Carlo calculation and a measurement of the capture probability in a thick sample of 238U it has been suggested that the width of the 6.67 eV level might be appreciably smaller than the value 25.6 MeV, evaluated in Version III and IV of ENDF/B. A few comments are made on this topic. (SDF)

  20. Proton-induced fission on 241Am, 238U and 237Np at intermediate energies


    Deppman, A.; Andrade-II, E.; Guimaraes, V; Karapetyan, G. S.; Balabekyan, A. R.; Demekhina, N. A.


    Intermediate energy data of proton-induced fission on 241Am, 238U and 237Np targets were analysed and investigated using the computational simulation code CRISP. Inelastic interactions of protons on heavy nuclei and both symmetric and asymmetric fission are regarded. The fission probabilities are obtained from the CRISP code calculations by means of the Bohr-Wheeler model. The fission cross sections, the fissility and the number of nucleons evaporated by the nuclei, before and after fission, ...

  1. Measurement of neutron inelastic scattering cross section of {sup 238}U

    Energy Technology Data Exchange (ETDEWEB)

    Miura, Takako; Baba, Mamoru; Ibaraki, Masanobu; Sanami, Toshiya; Win, Than; Hirasawa, Yoshitaka; Matsuyama, Shigeo; Hirakawa, Naohiro [Tohoku Univ., Sendai (Japan)


    Neutron scattering from the 0{sup +}, 2{sup +} (1-st) and 4{sup +} (2nd) levels of {sup 238}U was measured for incident energies between 0.4 and 0.85 MeV at the Tohoku University 4.5 MV Dynamitron facility, using the time-of-flight (TOF) method with monoenergetic pulsed neutrons by the {sup 7}Li(p,n) reaction. The results are presented in comparison with other experimental data and evaluated data. (author)

  2. Photofission cross section of 238U in the quasi-deuteron region

    International Nuclear Information System (INIS)

    The photofission cross section of 238U induced by monochromatic and polarized photons has been measured using LADON facility at the Frascati National Laboratory. The experiment has been performed at six different energies in the range 46-72 Mev by detecting the fission fragments either in uranium-loaded nuclear-track emulsion plates or in uranium-mica sandwiches. Results are consistent with existing data, however they suggest the opportunity of further investigation in this energy range. (author)

  3. Studies of positron electron pair production in {sup 238}U + {sup 232}Th

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, I.; Back, B.B.; Betts, R.R. [and others


    Following the non-observation of sharp sum-energy lines in our earlier {sup 238}U + {sup 181}Ta measurements, it was decided to pursue measurements of the {sup 238}U + {sup 232}Th system which, in the previously published work, showed the most striking evidence for near-equal-energy back-to-back pairs leading to sharp sum-energy lines. Following the refurbishing of the APEX silicon arrays and extensive tests of the rotating target wheel assembly, a major positron run took place in November 1994. Rolled 1-mg/cm{sub 2} {sup 232}Th targets were bombarded with 5.95-MeV/u {sup 238}U. The target rotation allowed up to 2 pnA of beam to be used without serious deterioration of the targets. Over 300,000 pairs were accumulated, representing an order-of-magnitude improvement in statistics over the previously published results. Preliminary analysis shows no evidence for the sharp lines at a cross section level orders of magnitude below those previously reported. The analysis of these data is currently being completed in preparation for publication.

  4. Isotope fractionation of 238U and 235U during biologically-mediated uranium reduction (United States)

    Stirling, Claudine H.; Andersen, Morten B.; Warthmann, Rolf; Halliday, Alex N.


    A series of laboratory-controlled microbial experiments using gram-negative sulphate-reducing bacteria (Desulfovibrio brasiliensis) inoculated with natural uranium were performed to investigate 238U/235U fractionation during bacterially-mediated U reduction. Control experiments, without bacteria to drive U reduction, were conducted in parallel. Paired measurements of 238U/235U and U concentration for both the residual growth medium solution and the accumulated biologically-mediated precipitate were obtained using multiple-collector inductively coupled plasma mass spectrometry (MC-ICPMS). The control experiments show that only minor (similar α values. Competing processes such as U co-precipitation (e.g. adsorption) may act to lower the apparent value for α and possibly play a secondary role both in the microbial experiments of this study and in natural U reduction settings where variable α values are found. These results may suggest that microbes adept at inducing U(VI) reduction play a crucial role in facilitating significant 238U/235U isotope fractionation in nature.

  5. Bone tumors induced by inhalation of 238PuO2 in dogs

    International Nuclear Information System (INIS)

    Plutonium-238, an alpha-emitting radionuclide, is used as a heat source in thermoelectric power generators such as have been employed on lunar expeditions of communications satellites and in cardiac pacemakers. It has an 86.4 year half-life and emits 5.5 MeV alpha particles. Beagle dogs were given single 10 to 30 minute exposures to 238PuO2 aerosols to study the long-term translocation of plutonium and biologicl effects. Dogs with a terminal body burden ranging from 7 to 260 MuCi were euthanized due to respiratory insufficiency related to plutonium-induced pneumonitis during the first 3 years after exposure. Nine of the 11 dogs euthanized during the 4 to 6 year postexposure period had osteosarcomas. The terminal plutonium body burden in the tumor-bearing dogs ranged from 0.5 to 2.6 muCi with 30 to 55 percent of the plutonium in the skeleton. Experiments are in progress to further define the dose-effect relationship of inhaled 238PuO2 and investigate the mechanisms of plutonium-induced neoplasia

  6. 234U/238U activity ratio in groundwater - an indicator of past hydrogeological processes

    International Nuclear Information System (INIS)

    In this report we describe the long-term behaviour of the uranium isotopes, U-234 and U-238 in groundwater systems. U is a redox sensitive element what for its behaviour is largely controlled by changes in the environmental conditions. A striking feature in U isotope geochemistry is seemingly different behaviour of U-238 and U-234. U isotopes fractionate at the rock-groundwater interface depending on chemical and radiological factors. Changes of the redox conditions in groundwater may thus affect the behaviour of U and its isotopes resulting in variable U concentration and U-234/U-238 activity ratios (AR). We examined the formation of ARs in different groundwater types from a geochemical and a physical/radiological point of view. It was envisaged that AR in groundwater is the consequence of radiological, chemical and hydrological processes. Groundwater condition (redox, flow, etc.) play a very important role in controlling the mass flow of U isotopes. Quantitative α-recoil modelling showed that α-recoil induced flux can be considered insignificant in cases of high-flow. This was an important finding because the exclusion of direct a-recoil means that it is groundwater chemistry and its variations which controls the U-234 mass flow and the formation of AR. Therefore, AR values could be used more confidently to indicate past redox changes and possibly flow paths. (orig.)

  7. Distribution of 137Cs, 40K, 238U and 232Th in soils from Northern Venezuela

    International Nuclear Information System (INIS)

    More than one hundred undisturbed soil samples form Northern Venezuela and the islands of Margarita and Los Roques have been analyzed for 137Cs, 40K, 238U and 232Th by γ-ray spectroscopy. The specimens were taken from between 5-10 cm below the earth's surface. Thus, they are valid not only for the 137Cs deposition studies but also for the estimation of the natural γ-ray dose from primordial radionuclides that form the terrestrial component. The concentrations of 40K was directly determined from its 1461 keV γ-ray, while those of 137Cs, 238U and 232Th were performed using a γ-ray from one of their daughter radionuclides: the 661 keV γ-ray of 137mBa for 137Cs, the 1760 keV γ-ray of 214Bi for 238U and the 2620 keV γ-ray of 208Tl for 232Th. Finally, the concentration values were compared with those of global estimates. (author) 15 refs.; 4 figs.; 2 tabs

  8. 232Th and 238U neutron emission cross section calculations and analysis of experimental data

    International Nuclear Information System (INIS)

    In this study, pre-equilibrium neutron-emission spectra produced by (n,xn) reactions on nuclei 232Th and 238U have been calculated. Angle-integrated cross sections in neutron induced reactions on targets 232Th and 238U have been calculated at the bombarding energies up to 18 MeV. We have investigated multiple pre-equilibrium matrix element constant from internal transition for 232Th (n,xn) neutron emission spectra. In the calculations, the geometry dependent hybrid model and the cascade exciton model including the effects of pre-equilibrium have been used. In addition, we have described how multiple pre-equilibrium emissions can be included in the Feshbach-Kerman-Koonin (FKK) fully quantum-mechanical theory. By analyzing (n,xn) reaction on 232Th and 238U, with the incident energy from 2 Me V to 18 Me V, the importance of multiple pre-equilibrium emission can be seen cleady. All calculated results have been compared with experimental data. The obtained results have been discussed and compared with the available experimental data and found agreement with each other

  9. Changes in plant availability of 238Pu with time as indications of changes in speciation

    International Nuclear Information System (INIS)

    A short description is given of the changes observed in the plant availability of Pu-238 in eight soils during a nine-year experimental period. It was found that during the first 4-year period with clover as test crop the plant uptake of Pu-238 was reduced with availability half-times ranging from 0.8 to 2.0 years. The reduction rate seemed proportional to the initial uptake levels except for lime rich clay soils, where the reduction rate was high regardless of the uptake level. The availability half-time was reduced from 2.0 years in the control to 0.8 years when the nuclide was placed at 10 and 20 cm depth. In 1980, when the test crop clover was replaced by spring wheat the necessary soil management operations caused intense aeration and drying in one block of the replicates. As a consequence, the Pu-uptake in that block became considerably higher than in the others. This event can be interpreted as an indirect evidence for the reversibility of that process in soil, which caused the reduction of the plant availability of Pu-238. (author)

  10. Validity of the generalized Brink-Axel hypothesis in $^{238}$Np

    CERN Document Server

    Guttormsen, M; Görgen, A; Renstrøm, T; Siem, S; Tornyi, T G; Tveten, G M


    We have analyzed primary $\\gamma$-ray spectra of the odd-odd $^{238}$Np nucleus extracted from $^{237}$Np($d,p\\gamma$)$^{238}$Np coincidence data measured at the Oslo Cyclotron Laboratory. The primary $\\gamma$ spectra cover an excitation-energy region of $0 \\leq E_i \\leq 5.4$ MeV, and allowed us to perform a detailed study of the $\\gamma$-ray strength as function of excitation energy. Hence, we could test the validity of the generalized Brink-Axel hypothesis, which, in its strictest form, claims no excitation-energy dependence on the $\\gamma$ strength. In this work, using the available high-quality $^{238}$Np data, we show that the $\\gamma$-ray strength function is to a very large extent independent on the initial and final states. Thus, for the first time, the generalized Brink-Axel hypothesis has been experimentally verified for $\\gamma$ transitions between states in the quasi-continuum region, not only for specific collective resonances, but also for the full strength below the neutron separation energy. B...

  11. 238U removal and accumulation in Concepción bay sediments, Chile

    Directory of Open Access Journals (Sweden)

    Laura Farías


    Full Text Available Activity profiles of 234U, 238U and 210Pb, as well as the 234U/238U ratio, and 210Pb xs radiochemical parameters and macrobenthic abundance in sediments were measured and calculated at different times during a year (1991, along a transect between the head and the mouth of Concepción Bay, Chile. This bay is a semi-enclosed shallow embayment with a strong seasonality in its hydrographic and biological characteristics due to wind driven upwelling. Upwelling of oxygen-poor and nutrient-rich water occurs and organic detritus reaches the seabed, creating a sub-oxic and anoxic environment during, at least, 57% of the year. 238U and 234U activities in the sediments show a gradual increase from 1.57 to 6.07 dpm g-1 from the surface to 15 cm depth in the sediments. Under suboxic-anoxic conditions, this pattern is consistent with a reduction of U(VI to U(IV and its subsequent removal from pore-water. A 234U/238U ratio of 1.10 ±0.08 indicates an authigenic origen. The 238U accumulation rate and inventory show a significant increase from Station 1 (head of the bay to Station 3 (mouth of the bay from 348 to 794 dpm cm-2 kyr-1 and of 14 to 32 dpm cm-2, respectively. The organic-rich and highly reducing sediments also show an increase in sulphate-reduction rates, sulfur speciation and bioturbation activities of macrobenthos. These patterns suggest that the extent of U enrichment in these sediments is regulated by bacterial sulphate reduction rate and bioturbation and bioirrigation activities. The estimated 238U accumulation rates are higher than those reported for other anoxic environments, representing an important U sink in marine sediments. The geochemical behaviour of U seems to be very sensitive to the redox condition and this characteristic could become an important paleoceanographic tool to identify changes in oceanographic conditions during the last millenniumRemoción y acumulación de 328U en los sedimentos de la bahía de Concepción, Chile. Las

  12. Changes in plant availability of /sup 238/Pu with time as indications of changes in speciation

    International Nuclear Information System (INIS)

    A short description is given of the changes observed in the plant availability of Pu-238 in eight soils during a nine-year experimental period. It was found that during the first 4-year period with clover as test crop the plant uptake of Pu-238 was reduced with availability half-times ranging from 0.8 to 2.0 years. The reduction rate seemed proportional to the initial uptake levels except for lime rich clay soils, where the reduction rate was high regardless of the uptake level. The availability half-time was reduced from 2.0 years in the control to 0.8 years when the nuclide was placed at 10 and 20 cm depth. In 1980, when the test crop clover was replaced by spring wheat the necessary soil management operations caused intense aeration and drying in one block of the replicates. As a consequence, the Pu-uptake in that block became considerably higher than in the others. This event can be interpreted as an indirect evidence for the reversibility of that process in soil, which caused the reduction of the plant availability of Pu-238

  13. Radiolysis and corrosion of 238Pu-doped UO2 pellets in chloride brine

    Indian Academy of Sciences (India)

    M Kelm; E Bohnert


    Deaerated 5 M NaCl solution is irradiated in the presence of UO2 pellets with a-radiation from 238Pu. Experiments are conducted with 238Pu doped pellets and others with 238Pu dissolved in the brine. The radiolysis products and yields of mobilized U and Pu from the oxidative dissolution of UO2 are determined. Results found for radiolysis products and for the oxidation/dissolution of pellets immersed in Pu containing brine are similar to results for Pu doped pellets, where the radiation chemical processes occur only in the liquid layer of some 10 m thickness adjacent to the pellet. The yield of radiolysis products is comparable to earlier results, that of mobilized U from the pellets is < 1% of the total amount of oxidized species. Thus, the radiation chemical yield (-value) for mobilized hexavalent U is < 0.01 ions/100 eV. In spite of the low radiation yield for the corrosion, the rate of UO2 dissolution is higher than expected for the concentrations of long-lived oxidizing radiolysis compounds found in the solutions.

  14. Sensitivity analysis of U238 cross sections in fast nuclear systems-SENSEAV-R computer code

    International Nuclear Information System (INIS)

    For many performance parameters of reactors the tabulated ratio calculation/experiment indicate that some potential problems may exist either in the cross section data or in the calculation models used to investigate the critical experimental data. A first step toward drawing a more definite conclusion is to perform a selective analysis of sensitivity profiles and covariance data files for the cross section data used in the calculation. Many works in the current literature show that some of these uncertainties come from uncertainties in 238U(n,γ), 238U(n,f) 239Pu(n,f). Perturbation methods were developed to analyze the effects of finite changes in a large number of cross sections and summarize the investigation by a group dependent sensitivity coefficient. As an application, the results of this investigation indicates that improvements should be done only on the medium and low energy ranges of 238U(n,γ) based on an analysis of cost and economic benefits. (Author)

  15. Activation Doppler Measurements on U 238 and U 235 in Some Fast Reactor Spectra

    International Nuclear Information System (INIS)

    Measurements of the Doppler effect in U-238 capture and U-235 fission have been made by means of the activation technique in three different neutron spectra in the fast critical assembly FR0. The experiments involved the irradiation of thin uranium metal foils or oxide disks, which were heated in a small oven located at the core centre. The measurements on U-238 were extended to 1780 deg K and on U-235 to 1470 deg K. A core region surrounding the oven was homogenized in order to facilitate the interpretation of results. The reaction rates in the uranium samples were detected by gamma counting. The experimental method was checked with regard to systematic errors by irradiations in a thermal spectrum. The data obtained for U-238 capture were corrected for the effect of neutron collisions in the oven wall, and were extrapolated to zero sample thickness. In the softest spectrum (core 5) a Doppler effect (relative increase in capture rate) of 0.260 ± 0.018 was obtained on heating from 343 to 1780 deg K, and in the hardest spectrum (core 3) the corresponding value was 0.030 ± 0.003. An appreciable Doppler effect in U-235 fission was obtained only in the softest spectrum, in which the measured increase in fission rate on heating from 320 to 1470 deg K was 0.007 ± 0.003

  16. Hard X-ray Tail Discovered in the Clocked Burster GS 1826-238

    CERN Document Server

    Rodi, James; Roques, Jean-Pierre


    The LMXB NS GS 1826-238 was discovered by Ginga in 1988 September. Due to the presence of quasi-periodicity in the type I X-ray burst rate, the source has been a frequent target of X-ray observations for almost 30 years. Though the bursts were too soft to be detected by INTEGRAL/SPI, the persistent emission from GS 1826-238 was detected over 150 keV during the ~10 years of observations. Spectral analysis found a significant high-energy excess above a Comptonization model that is well fit by a power law, indicating an additional spectral component. Most previously reported spectra with hard tails in LMXB NS have had an electron temperature of a few keV and a hard tail dominating above ~50 keV with an index of \\Gamma ~ 2-3. GS 1826-238 was found to have a markedly different spectrum with $ kT_e \\sim 20 $ keV and a hard tail dominating above ~150 keV with an index of \\Gamma ~ 1.8, more similar to BHXRB. We report on our search for long-term spectral variability over the 25-370 keV energy range and on a compariso...

  17. Helium bubbles at grain boundaries of high-density 238PuO2 shards

    International Nuclear Information System (INIS)

    Hydroxide- and oxalate-base 238PuO2 shards that were sintered to high density at 1200 or 16000C and then aged for 6 months or more exhibited grain-boundary gas bubbles due to agglomeration of alpha-decay helium when heated to 12000C and above. Conditions for bubble formation depended markedly on shard microstructure; large-grained shards with few large residual sintering pores formed gas bubbles at lower temperatures than small-grained shards with many pores. This behavior was especially apparent in oxalate-base 238PuO2, in which small-grained shards resisted bubble formation to above 15000C; small-grained hydroxide-base shards with less internal porosity than oxalate-base shards formed bubbles at lower temperatures. Helium is apparently released from aged 238PuO2 shards at high temperatures by bulk diffusion within grains to the grain boundaries, where bubbles are formed and interconnect into networks which permit helium escape. It is postulated that helium is released by grain boundary diffusion at temperatures below thresholds for grain boundary bubble formation. Small grain size and high residual porosity within grains inhibit the formation of the grain-boundary gas bubbles by reducing the concentration of helium gas at the grain boundaries. (10 fig)

  18. Isotope fractionation of 238U and 235U during biologically-mediated uranium reduction (United States)

    Stirling, Claudine H.; Andersen, Morten B.; Warthmann, Rolf; Halliday, Alex N.


    A series of laboratory-controlled microbial experiments using gram-negative sulphate-reducing bacteria (Desulfovibrio brasiliensis) inoculated with natural uranium were performed to investigate 238U/235U fractionation during bacterially-mediated U reduction. Control experiments, without bacteria to drive U reduction, were conducted in parallel. Paired measurements of 238U/235U and U concentration for both the residual growth medium solution and the accumulated biologically-mediated precipitate were obtained using multiple-collector inductively coupled plasma mass spectrometry (MC-ICPMS). The control experiments show that only minor (<0.1‰), if any 238U/235U fractionation occurs during co-precipitation with calcite. This implies that carbonate sediments are capable of faithfully recording the signature of the global ocean during Earth's major climatic events, including oxygenation and de-oxygenation transitions in the marine environment. The results for the microbial experiments demonstrate that the 238U/235U composition of the unreacted growth medium containing U(VI) is isotopically lighter than the composition of the U(IV)-bearing precipitate as U(VI) is consumed, in agreement with field-based observations of microbially-mediated U reduction. Uranium isotopic shifts of up to 0.8‰ were observed between the liquid and solid phases. These observations can be modelled using a Rayleigh distillation approach describing kinetic uptake in a closed system, which yields a fractionation factor α of 0.99923 ± 0.00004 (ε = -0.77 ± 04‰) for U(VI)-U(IV) reduction mediated by the D. brasiliensis microbe. This fractionation behaviour is consistent with that observed in field-based redox environments, which give rise to similar α values. Competing processes such as U co-precipitation (e.g. adsorption) may act to lower the apparent value for α and possibly play a secondary role both in the microbial experiments of this study and in natural U reduction settings where

  19. Generation of 238U Covariance Matrices by Using the Integral Data Assimilation Technique of the CONRAD Code (United States)

    Privas, E.; Archier, P.; Bernard, D.; De Saint Jean, C.; Destouche, C.; Leconte, P.; Noguère, G.; Peneliau, Y.; Capote, R.


    A new IAEA Coordinated Research Project (CRP) aims to test, validate and improve the IRDF library. Among the isotopes of interest, the modelisation of the 238U capture and fission cross sections represents a challenging task. A new description of the 238U neutrons induced reactions in the fast energy range is within progress in the frame of an IAEA evaluation consortium. The Nuclear Data group of Cadarache participates in this effort utilizing the 238U spectral indices measurements and Post Irradiated Experiments (PIE) carried out in the fast reactors MASURCA (CEA Cadarache) and PHENIX (CEA Marcoule). Such a collection of experimental results provides reliable integral information on the (n,γ) and (n,f) cross sections. This paper presents the Integral Data Assimilation (IDA) technique of the CONRAD code used to propagate the uncertainties of the integral data on the 238U cross sections of interest for dosimetry applications.

  20. Generation of 238U Covariance Matrices by Using the Integral Data Assimilation Technique of the CONRAD Code

    Directory of Open Access Journals (Sweden)

    Privas E.


    Full Text Available A new IAEA Coordinated Research Project (CRP aims to test, validate and improve the IRDF library. Among the isotopes of interest, the modelisation of the 238U capture and fission cross sections represents a challenging task. A new description of the 238U neutrons induced reactions in the fast energy range is within progress in the frame of an IAEA evaluation consortium. The Nuclear Data group of Cadarache participates in this effort utilizing the 238U spectral indices measurements and Post Irradiated Experiments (PIE carried out in the fast reactors MASURCA (CEA Cadarache and PHENIX (CEA Marcoule. Such a collection of experimental results provides reliable integral information on the (n,γ and (n,f cross sections. This paper presents the Integral Data Assimilation (IDA technique of the CONRAD code used to propagate the uncertainties of the integral data on the 238U cross sections of interest for dosimetry applications.

  1. The inflow of uranium 234U and 238U from the Vistula River catchment area to the Baltic Sea

    International Nuclear Information System (INIS)

    In the study, the activities of uranium 234U and 238U in the Vistula River water samples which were collected from November 2002 to October 2003, were measured using alpha spectrometry. In winter, the highest concentration of uranium isotopes and total uranium was in the Vistula River water from Malbork (13.13 ± 0.22 Bq m-3 for 234U, 12.45 ± 0.21 Bq m-3 for 238U and 1.02 ± 0.30 mg m-3 for total uranium), and the lowest was in water from Deblin (1.73 ± 0.07 Bq m-3 for 234U, 1.55 ± 0.07 Bq m-3 for 238U and 0.13 ± 0.09 mg m-3 for total uranium). In analyzed river samples uranium isotopes 234U and 238U are not in the radioactive equilibrium state. The values of 234U/238U activity ratio lie between 1.05-1.70. During spring, the highest concentration of uranium isotopes and total uranium was found in the Vistula River water from Malbork (12.36 ± 0.19 Bq m-3 for 234U, 10.77 ± 0.17 Bq m-3 for 238U and 0.88 ± 0.25 mg m-3 for total uranium), and the lowest was in water taken from Sandomierz (5.77 ± 0.14 Bq m-3 for 234U) and Krakow (4.08 ± 0.11 Bq m-3 for 238U and 0.33 ± 0.18 mg m-3 for total uranium). The values of 234U/238U activity ratio lie between 1.15-1.64. In summer, the highest concentration of uranium isotopes and total uranium was found in the Vistula River water samples taken from Malbork (8.22 ± 0.21 Bq m-3 for 234U, 7.60 ± 0.21 Bq m-3 for 238U and 0.62 ± 0.29 mg m-3 for total uranium), and the lowest was in water from Sandomierz (6.37 ± 0.12 Bq m-3 for 234U) and Krakow (3.56 ± 0.19 Bq m-3 for 238U and 0.29 ± 0.33 mg m-3 for total uranium). The values of 234U/238U activity ratio lie between 1.08-1.95. In autumn the highest concentration of uranium isotopes and total uranium was in the Vistula River water from Malbork (17.80 ± 0.25 Bq m-3 for 234U, 15.12 ± 0.23 Bq m-3 for 238U and 1.23 ± 0.34 mg m-3 for total uranium) and the lowest was in water from Torun (8.15 ± 0.49 Bq m-3 for 234U) and Krakow (6.34 ± 0.47 Bq m-3 for 238U and 0.52 ± 0

  2. Resorption of 238Pu in case of impact on skin in acid solutions and its decontamination efficiency

    International Nuclear Information System (INIS)

    Absorption coefficient is studied and decontamination efficiency of skin in case of 238Pu impact on skin in acid solutions. Experiments were carried out on rats and swines. The following 238Pu compounds were investigated: oxalic acid (oxalate) and nitric acid (nitrate) ones in 0.1, 0.5, 1, 2.5 or 10 n. nitric acid. Isotope content in animal body was determined 1, 3, 6 hours, 1-5 days later. Data on 238Pu resorption for rats and swines were extrapolated to man. Extrapolation coefficient constituted 0.5. While estimating decontamination efficiency it is stated that in case of impact of 238Pu in 0.5 and 1 n. acid on human skin it should be treated the first 5 minutes after contamination using 2% sodium solution and ''Lashchita'' preparation that is used when there is no evident skin pathology


    Energy Technology Data Exchange (ETDEWEB)

    Duncan, A.; Kane, M.


    This report was prepared to document the physical, chemical and radiological properties of plutonium oxide materials that were processed in the Plutonium Fuel Form Facility (PuFF) in building 235-F at the Savannah River Plant (now known as the Savannah River Site) in the late 1970s and early 1980s. An understanding of these properties is needed to support current project planning for the safe and effective decontamination and deactivation (D&D) of PuFF. The PuFF mission was production of heat sources to power Radioisotope Thermoelectric Generators (RTGs) used in space craft. The specification for the PuO{sub 2} used to fabricate the heat sources required that the isotopic content of the plutonium be 83 {+-} 1% Pu-238 due to its high decay heat of 0.57 W/g. The high specific activity of Pu-238 (17.1 Ci/g) due to alpha decay makes this material very difficult to manage. The production process produced micron-sized particles which proved difficult to contain during operations, creating personnel contamination concerns and resulting in the expenditure of significant resources to decontaminate spaces after loss of material containment. This report examines high {sup 238}Pu-content material properties relevant to the D&D of PuFF. These relevant properties are those that contribute to the mobility of the material. Physical properties which produce or maintain small particle size work to increase particle mobility. Early workers with {sup 238}PuO{sub 2} felt that, unlike most small particles, Pu-238 oxide particles would not naturally agglomerate to form larger, less mobile particles. It was thought that the heat generated by the particles would prevent water molecules from binding to the particle surface. Particles covered with bound water tend to agglomerate more easily. However, it is now understood that the self-heating effect is not sufficient to prevent adsorption of water on particle surfaces and thus would not prevent agglomeration of particles. Operational

  4. Spins of resonances in reactions of neutrons with (238)U and (113)Cd. Doctoral thesis; Spins van resonanties in reacties van neutronen met (238)u en (113)cd

    Energy Technology Data Exchange (ETDEWEB)

    Gunsing, F.


    In this thesis experiments are described that have lead to the assignments of spins to a large number of resonances in reactions of epithermal neutrons with the nuclei (238)U and (113)Cd. When a neutron is captured by an atomic nucleus, a compound nucleus is formed which is in a highly excited state with an energy of the order of the neutron binding energy. If the kinetic neutron energy is varied around a state of the compound nucleus, one observes a peak in the cross section. This is called a resonance in the reaction. Dependent on the amount or orbital momentum l that the neutron adds to the system, the resonances are indicated with spectroscopic notations as s- and p-waves for l = 0 and 1 respectively. The purpose of this thesis is to determine the spins of such resonances.

  5. Statistics and analysis of 238 cases of infection in hospital%238例院内感染情况统计与分析

    Institute of Scientific and Technical Information of China (English)

    牛向平; 唐亚娟


    目的 了解医院院内感染现状,有效预防和控制医院院内感染的发生和流行,降低院内感染率.方法 对2014年1月~2014年12月院内感染进行回顾性的调查分析.结果 发生院内感染的人数为238例,院内感染率为2.66%,发生院内感染的例次是357例,例次院内感染发生率为3.98%;院内感染的发生与患者的性别、年龄、病原菌分布、抗菌药物的使用等都有关系.结论 加强院内感染的管理,提高手卫生的依从性,坚持目标性检测,合理选择和使用抗菌药物是控制院内感染的关键.%Objective To understand the nosocomial infection status, effective prevention and control of nosocomial infection and epidemic, reduce the nosocomial infection rate.Methods from January December to 2014 in hospital infection were retrospectively investigated and analyzed.Results the incidence of nosocomial infection in 238 cases, the hospital infection rate was 2.66%, nosocomial infection cases is 357 cases, the incidence rate of 3.98% infection cases in Hospital; infection in hospital and patient sex, age, distribution of pathogens, antimicrobial drug use and so on.Conclusion to strengthen the management of nosocomial infections, improve hand hygiene compliance, adhere to the target detection, the reasonable selection and use of antimicrobial agents is the key to control nosocomial infection.

  6. The AS-76 interlaboratory experiment on the alpha spectrometric determinaion of Pu-238. Part 3: Preparation and characterization of samples

    International Nuclear Information System (INIS)

    Four plutonium samples containing 0.2, 0.8, 1.6 and 0.9 atom % of 238Pu have been prepared for the Interlaboratory Experiment AS-76. Of these three were input solutions from a reprocessing plant. The fourth sample was from a plutonium product solution. These samples have been characterized by two alpha spectrometry laboratories and two mass spectrometry laboratories to certify the ratio of alpha activities 238Pu/(239Pu + 240Pu) and the isotopic composition, respectively

  7. {\\alpha}-accompanied cold ternary fission of $^{238-244}$Pu isotopes in equatorial and collinear configuration


    Santhosh, K P; Krishnan, Sreejith; Priyanka, B.


    The cold ternary fission of $^{238}$Pu, $^{240}$Pu, $^{242}$Pu and $^{244}$Pu isotopes, with $^{4}$He as light charged particle, in equatorial and collinear configuration has been studied within the Unified ternary fission model (UTFM). The fragment combination $^{100}$Zr+$^{4}$He+$^{134}$Te possessing the near doubly magic nuclei $^{134}$Te (N=82, Z=52) gives the highest yield in the alpha accompanied ternary fission of $^{238}$Pu. For the alpha accompanied ternary fission of $^{240}$Pu, $^{...

  8. Absolute fission rate measurement of 238U induced by 14 MeV neutrons penetrated composite material

    International Nuclear Information System (INIS)

    In order to prove the model calculation method and parameter, the 238U absolute fission rate in the case of 14 MeV neutrons penetrating through the special composite material was measured by minitype slab uranium fission chambers. The measuring spots are distributed in the surface of iron ball hull along the different position of equator. The calculated results are compared with the experiment results. The total error of measured 238U absolute fission rate is 6.1%. (author)

  9. Neutron inelastic-scattering cross sections of 232Th, 233U, 235U, 238U, 239Pu and 240Pu

    International Nuclear Information System (INIS)

    Differential-neutron-emission cross sections of 232Th, 233U, 235U, 238U, 239Pu and 240Pu are measured between approx. = 1.0 and 3.5 MeV with the angle and magnitude detail needed to provide angle-integrated emission cross sections to approx. 232Th, 233U, 235U and 238U inelastic-scattering values, poor agreement is observed for 240Pu, and a serious discrepancy exists in the case of 239Pu

  10. Transition from asymmetric to symmetric fission in 45-69 MeV proton induced fission of 238U


    H. Noshad


    Thin targets of 238U were bombarded with 45, 55, 65 and 69 MeV protons at the Cyclotron and Radioisotope Center (CYRIC) of Tohoku University in Japan. Gamma rays emitted from the fission products were recorded and analyzed by using gamma spectroscopy. Then, the cross sections for the formation of fission products, fragment mass distributions, and total fission cross sections were measured. Special care was taken to make this measurement precisely. The experimental results show that for 238U(p...

  11. Studies on 232Th and 238U levels in marine algae collected from the coast of Niigata Prefecture

    International Nuclear Information System (INIS)

    To evaluate the properties of algae to concentrate radioactive elements, 14 species of algae like Sargassum were collected in the Prefecture and analyzed for their 232Th and 238U levels with Yokogawa HP4500 ICP-MS apparatus. The places of collection included those near the water discharge of an atomic power station. Mean 232Th and 238U levels were found to be 120 and 260 ng/g dry wt, respectively, and Phaeophyta showed more than several times higher 238U level than Chlorophyta and Rhodophyta. There was no clear difference in 232Th levels. No difference between places of collection was observed in Sargassum 232Th or 238U level. Adsorption of 232Th particle to and incorporation of soluble 238U into algae body were suggested. Mean 232Th and 238U radioactivities were found 73 and 510 μBq/g wet wt, respectively, and the respective annual committed effective doses, 0.2 and 0.3 μSv, calculated from those values were confirmed to be enough lower than the annual public dose limit, 1 mSv. (K.H.)

  12. Acceptable knowledge summary report for combustible/noncombustible, metallic, and HEPA filter waste resulting from 238Pu fabrication activities

    International Nuclear Information System (INIS)

    All transuranic (TRU) waste must be sufficiently characterized and certified before it is shipped to the Waste Isolation Pilot Plant (WIPP). The US Environmental Protection Agency (EPA) allows use of acceptable knowledge (AK) for waste characterization. EPA uses the term AK in its guidance document and defines AK and provides guidelines on how acceptable knowledge should be obtained and documented. This AK package has been prepared in accordance with Acceptable Knowledge Documentation (TWCP-QP-1.1-021,R.2). This report covers acceptable knowledge information for five waste streams generated at TA-55 during operations to fabricate various heat sources using feedstock 238Pu supplied by the Savannah River Site (SRS). The 238Pu feedstock itself does not contain quantities of RCRA-regulated constituents above regulatory threshold limits, as known from process knowledge at SRS and as confirmed by chemical analysis. No RCRA-regulated chemicals were used during 238Pu fabrication activities at TA-55, and all 238Pu activities were physically separated from other plutonium processing activities. Most of the waste generated from the 238Pu fabrication activities is thus nonmixed waste, including waste streams TA-55-43, 45, and 47. The exceptions are waste streams TA-55-44, which contains discarded lead-lined rubber gloves used in the gloveboxes that contained the 238Pu material, and TA-55-46, which may contain pieces of discarded lead. These waste streams have been denoted as mixed because of the presence of the lead-containing material

  13. Plutonium-238 alpha-decay damage study of the ceramic waste form.

    Energy Technology Data Exchange (ETDEWEB)

    Frank, S M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Barber, T L [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Cummings, D G [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; DiSanto, T [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Esh, D W [U.S. Nuclear Regulatory Commission, Washington, DC 20555-0001; Giglio, J J [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Goff, K M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Johnson, S G [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Kennedy, J R [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Jue, J-F [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Noy, M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; O' Holleran, T P [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Sinkler, W [UOP LLC, 25 E Algonquin Road, Des Plaines, IL 60017


    An accelerated alpha-decay damage study of a glass-bonded sodalite ceramic waste form has recently been completed. The purpose of this study was to investigate the physical and chemical durability of the waste form after significant exposure to alpha decay. This accelerated alpha-decay study was performed by doping the ceramic waste form with {sup 238}Pu which has a much greater specific activity than {sup 239}Pu that is normally present in the waste form. The alpha-decay dose at the end of the four year study was approximately 1 x 10{sup 18} alpha-decays/gram of material. An equivalent time period for a similar dose of {sup 239}Pu would require approximately 1100 years. After four years of exposure to {sup 238}Pu alpha decay, the investigation observed little change to the physical or chemical durability of the ceramic waste form (CWF). Specifically, the {sup 238}Pu-loaded CWF maintained it's physical integrity, namely that the density remained constant and no cracking or phase de-bonding was observed. The materials chemical durability and phase stability also did not change significantly over the duration of the study. The only significant measured change was an increase of the unit-cell lattice parameters of the plutonium oxide and sodalite phases of the material and an increase in the release of salt components and plutonium of the waste form during leaching tests, but, as mentioned, these did not lead to any overall loss of waste form durability. The principal findings from this study are: (1) {sup 238}Pu-loaded CWF is similar in microstructure and phase composition to referenced waste form. (2) Pu was observed primarily as oxide comprised of aggregates of nano crystals with aggregates ranging in size from submicron to twenty microns in diameter. (3) Pu phases were primarily found in the intergranular glassy regions. (4) PuO phase shows expected unit cell volume expansion due to alpha decay damage of approximately 0.7%, and the sodalite phase unit cell

  14. Estimation of initial lung deposition of inhaled 238PuO2 in beagles

    International Nuclear Information System (INIS)

    Studies to determine the life-span dose-effect relationship of inhaled 238PuO2 in dogs require an estimate of initial lung deposition (ILD) to calculate the radiation dose to several organs. Ideally, this estimate of ILD is obtained by a summation of plutonium body burden at death plus all the plutonium excreted during the life of the dog. However, the high costs of excreta collection and of plutonium analyses for all excreta from each dog made it necessary to approximate the ILD by other less expensive methods. These methods could introduce error into the estimate of ILD and, consequently, into the radiation dose calculation. The objective of this work was to evaluate the potential error for several methods of estimating ILD. Thirteen beagle dogs were given a single 5- to 30-min exposure to 238PuO2 aerosols, resulting in estimated ILD of 0.85 to 11.7 μCi of plutonium-238. Plutonium analyses of the tissues at death and of all excreta from these dogs were used for this evaluation. The estimate of ILD, obtained by summation of the plutonium body burden at death plus all the plutonium excreted, was compared to the estimated ILD obtained by the plutonium whole-body retention function for each dog, using all excreta data; the mean plutonium whole-body retention function for each dog, using all excreta data; the plutonium whole-body retention function for each dog, using partial excreta data; and a mean plutonium whole-body retention function for all dogs, using partial excreta data. 4 refs., 3 figs., 4 tabs

  15. Safety analysis report for the 238PuO2 fuel form facility

    International Nuclear Information System (INIS)

    The Plutonium Fuel Form (PuFF) Facility has been constructed at the Savannah River Plant to manufacture 30 to 60 kg/yr of 238Pu fuel forms for space power applications. This facility is located in the existing Building 235-F near the geographical center of the Savannah River Plant (SRP) site. Pilot production is scheduled to begin in July 1977, with full-scale production in April 1978. The process line of the facility consists of nine separate, interconnected shielded cells; five shielded wing cabinets or glove boxes; three hoods; and contained auxiliary equipment. These process enclosures will be, for the most part, under an atmosphere of recirculating inert gas. The products of the facility will be dense fuel forms manufactured from PuO2 powder with a nominal isotopic composition of 80% 238Pu-20% 239Pu. This powder, made from calcined oxalate, has been produced safely at a rate of about 20 kg 238Pu/yr in the H-Area B-Line in Building 221-H for approximately ten years. This report describes design objectives, nature of operations, potential hazards and limiting factors, facility response to postulated accidents and failures, and environmental effects. The results of the analyses described in this report indicate that the facility has the capacity to prevent or sufficiently reduce accidents that represent potential risks to health and safety. The safety analysis in conjunction with process requirements provides the bases for Technical Standards for operation. The analysis also documents the degree of conformance of the facility design with the General Design Criteria - Plutonium Facilities and the Environmental Statement

  16. Direct reduction of 238PuO2 and 239PuO2 to metal

    International Nuclear Information System (INIS)

    The process for reducing 700 g 239PuO2 to metal is a standard procedure at Los Alamos National Laboratory. This process is based on research for reducing 200 g 238PuO2 to metal. This report describes in detail the experiments and development of the 200-g process. The procedure uses calcium metal as the reducing agent in a molten CaCl2 solvent system. The process to convert impure plutonia to high-purity metal by oxide reduction followed by electrorefining is also described

  17. Sensitivity analysis of U238 cross section in thermal nuclear systems

    International Nuclear Information System (INIS)

    A sensitivity analysis system is developed for assessing the implication of uncertainties in nuclear data and related computational methods for light water power reactor. Sensitivies, at equilibrium cycle condition, are carried out for the few group macroscopic cross section of the U238 with respect to their 35 group microscopic absorption cross section using the batch depletion code SENTEAV similar to those calculation methods used in the industry. This investigation indicates that improvements are requested on specific range of energy. These results point out the direction for worth while experimental measurements based on an analysis of costs and economic benefits. (Author)

  18. Photo-fission of 232Th and 238U at intermediate energies


    Deppman, A.(Universidade de São Paulo (USP), São Paulo, Brazil); Andrade-II, E.; Guimaraes, V.; Demekhina, N. A.; Karapetyan, G. S.


    In this work we present an analysis of the yields of fission fragments induced by bremsstrahlung photons with endpoint energies of 50 and 3500 MeV on 232Th and 238U targets using the simulation code CRISP. A multimodal fission option was added to this code and an extension of the calculation to the properties of the fission products is presented. By dividing the fissioning nuclei according to their fissionability, an approach is introduced which accounts for the contribution of symmetric and ...

  19. The evaluation of the mass distribution data for 238U, 239Pu and 242Pu fission

    International Nuclear Information System (INIS)

    The mass distribution data for 238U at En=1.5, 5.5, 8.3, 11.3, 14.9, 22.0, 27.5, 50.0, 99.5, 160.0 MeV, Ep=20.0, 60.0 MeV 239Pu at En=0.17, 7.9, 14.5 MeV and 242Pu at En=15.1 MeV were evaluated and recommended based on the main available experimental data up to now. The experimental data were make necessary corrections and their errors were also made necessary adjustments. The problems concerned were discussed

  20. Cross section of the 238 U photofission in the quasi-deuteron region

    International Nuclear Information System (INIS)

    The U-238 photofission cross section was measured ranging six different energies in the quasi-deuteron region using nearly photo chromatic photons. Fission fragments tracks detection in nuclear emulsion K O-Ilford and mica foils were used. In the first case a loading was made resulting in a very thin film containing 8 x 1018 uranium atoms per cm2. In the second case, very thin uranium oxide layers were deposited on the mica foils resulting in effective densities of 15 x 1018 uranium atoms per cm2 for each sample. (L.C.J.A.)

  1. 238U-series radionuclides in Finnish groundwater-based drinking water and effective doses

    International Nuclear Information System (INIS)

    The thesis deals with the occurrence of 238U-series radionuclides and particle-bound 210Pb and 210Po in Finnish groundwater-based drinking water, methods used for removing 234U, 238U, 210Pb and 210Po, and the annual effective doses caused by 238U-series radionuclides in drinking water. In order to reduce radiation exposure and avoid high doses, it is important to examine the activity levels of natural radionuclides in groundwater. In this work, the activity concentrations of radon (222Rn), radium (226Ra), uranium (238U and 234U), lead (210Pb) and polonium (210Po) were determined from 472 private wells, which were selected randomly from across Finland. On the basis of the results, the activity concentrations in groundwater and the radiation exposure from drinking water of people living outside the public water supply in Finland was specified. The efficiency of 238U, 234U, 210Pb and 210Po removal from drinking water was examined at ten private homes. In order to obtain accurate results and correct estimates of effective doses, attention was paid to the sampling of 222Rn and 210Pb, and the determination of 210Pb. The results revealed that the median activity concentrations of natural radionuclides were as much as ten times higher in drilled wells than in wells dug in soil. The average activity concentration of 222Rn in drilled wells was 460 Bq/l and in dug wells 50 Bq/l. The highest activity concentrations were found in Southern Finland. In addition, occasional high activity concentrations were found all over Finland. The average activity concentrations of 234U and 238U in drilled wells were 0.35 and 0.26 Bq/l and in dug wells 0.020 and 0.015 Bq/l, respectively. The spatial distribution of 234U, 238U, 210Pb and 210Po was essentially similar to that of 222Rn. In contrast to other natural radionuclides, the highest 226Ra activity concentrations were found in coastal areas, since drilled well water near the sea has a higher salinity than water in drilled wells inland

  2. 238Pu and 239240Pu distribution in fish and invertebrates from the Great Miami River, Ohio

    International Nuclear Information System (INIS)

    Samples of minnows, shad, goldfish, carp, crayfish, and clams were taken from the Great Miami River in the vicinity of Miamisburg, Ohio. Activities of 238Pu and 239,240Pu are reported for these organisms. In addition, distributions were determined for plutonium between the gastrointestinal tract and the remainder of the organism in carp and between the shell and soft parts of crayfish. The results are discussed with regard to the spatial distribution of the organisms around Miamisburg and the tissue distribution within the animals

  3. Multifragmentation for 36Ar+238U treated as statistical dynamic interaction processes

    International Nuclear Information System (INIS)

    The exclusive multifragment multiplicities for the system 36Ar+238U at 35 MeV/nucleon incident energy are calculated using the Boltzmann master equation for the fast cascade, and the Weisskopf-Ewing evaporation model for successive binary decay of the equilibrated residues. These calculated results are consistent with the experimental results of Kim et al. We show that the multiplicity distribution in such a model has a sensitivity to the equilibrated excitation, so that multiplicity could be an observable characteristic of excitation. This in turn may be used to infer time delay for fragment emission (in a model dependent way)

  4. Angular distribution of photofission fragments in 238U at 5.43 MeV

    International Nuclear Information System (INIS)

    The angular distribution of photofission fragments of 238U, produced by 5.43 MeV monochromatic photons from the η,γ reaction in sulphur, has been measured using glass plates as detectors. In the analysis of the results only the contributions from the (Jπ, K) 1= (1-,0), (1-,1) and (2+,0) terms were considered. The coefficients of the angular distributions of the fission fragments were obtained. An analysis of the data available in the literature on the angular distribution near the photofission threshold is also presented. (author)

  5. Evaluation of resonance self-shielding factors for 238U in the unresolved resonance region

    International Nuclear Information System (INIS)

    On the basis of a theoretical model of identical equidistant resonances for the energy dependence of cross-sections in the unresolved resonance region, the authors have parametrized the values of the resonance self-shielding factors and their Doppler increments for 238U. They have proposed a method by which the Doppler increments of the self-shielding factors can be calculated from simple analytical formulae by redetermination of the model parameters. Analysing the experimental data on direct and capture transmissions in the unresolved resonance region, they demonstrate the possibility of describing those data as a whole and of deriving from them the cross-section group functionals. (author)

  6. Fission product yields from 19.1 MeV neutron induced fission of 238U

    International Nuclear Information System (INIS)

    36 chain yields were determined for the fission of 238U induced by 19.1 MeV neutrons for the first time. Absolute fission rate was monitored with a double-fission chamber. Fission product activities were measured by HPGe γ-ray spectrometry. Threshold detector method was used to measure the neutron spectrum in order to estimate the fission events induced by break-up neutrons and scattering neutrons. A mass distribution curve was obtained and the dependence of fission yield on neutron energy was discussed

  7. 238Pu based energy micro-generation sources for medical applications

    International Nuclear Information System (INIS)

    Pace-makers are frequently implanted in the human body. The existing apparatus are, actually, equipped with chemical piles with a lifetime of about 15 months. The use of 238Pu will provide a pace-maker with an autonomy of 10 years at least. Principal problems of security due to the use of plutonium are considered. It is advisable to improve the properties of pure plutonium by small additions of elements such as cerium, scandium, indium, gallium or americium. A number of the most important properties for a pace-maker source are presented. Finally, the fabrication and canning of the source are surveyed. (author)

  8. Clinical Analysis of 238 Cases of Patients With Placental Abruption%238例胎盘早剥的临床分析

    Institute of Scientific and Technical Information of China (English)



    目的:分析探讨胎盘早剥的诱发因素、临床特点、漏诊误诊及处理方法,以期提高诊断率、降低并发症。方法利用回顾性病例分析法,对我院自2003年1月~2012年12月收治的238例胎盘早剥病例进行分析。结果胎盘早剥的发生率是0.53%,其中,有明确诱因者占44%,通过急诊入院者占46.3%。除此之外,胎盘异常、脐带异常、羊水过多和妊娠期高血压也是胎盘早剥的诱发因素。结论胎盘早剥诱因多样、发病隐匿、症状不典型,容易导致B超漏诊,孕妇定期进行体检、预防孕期高血压等对预防和尽早处理胎盘早剥有重要的作用。%Objective To study the inducing factors, clinical features, misdiagnosis and treatment method about placental abruption, in order to improve the diagnostic rate and reduce the complication. Methods Retrospectively analyzed the 238 cases of patients with placental abruption in our hospital from January 2003 to December 2012. Results The incidence of placental abruption was 0.53%, among them, 44% with clear incentive, 63% through emergency admissions. In addition, the placenta, an abnormal umbilical cord, hydramnios and gestational hypertension were also causative factors of placental abruption. Conclusion Placental abruption with diverse causes, concealment and untypical symptoms, easily lead to misdiagnosis by ultrasound. So regular physical examination and prevention of high blood pressure during pregnancy play a key role in early treatment of placental abruption.

  9. Dose assessment of Bremsstrahlung induced by beta isotopes of Uranium-238 series in human tissues

    International Nuclear Information System (INIS)

    In the natural Uranium-238 decay series, pure beta isotopes such as 234Th, 234Pa, 214Pb, 214Bi, 210Pb and 210Bi are released. These beta isotopes having maximum beta energies and it induces the Bremsstrahlung radiation. The Bremsstrahlung component of these beta isotopes has been traditionally ignored in dosimetry calculations. This may be due to a lack of available methods for including this component in the calculations or to the belief that the contribution of this component is negligible compared to that of other emissions. The resulting hazard of Bremsstrahlung radiation may therefore be some of concern, at least theoretically, and should be systematically evaluated. In the present investigation, it has been estimated that the Bremsstrahlung dose of beta isotopes of Uranium-238 series such as 234Th, 234Pa, 214Pb, 214Bi, 210Pb and 210Bi in various body organs (Adrenals, Brain, Breasts, Gallbladder Wall, LLI Wall, Small Intestine, Stomach, ULI Wall, Heart Wall, Kidneys, Liver, Lungs, Muscle, Ovaries, Pancreas, Red Marrow, Bone Surfaces, Skin, Spleen, Testes, Thymus, Thyroid, Urine Bladder Wall, Uterus, Fetus, Placenta and Total Body). We have considered bone and muscle is target organs. These estimated values shows that the Bremsstrahlung radiation absorbed dose contribution from an organ to itself is very small compared to that from the beta source, but contribution to other organs is not always negligible. Hence the component of Bremsstrahlung dose to total dose should be considered in the environmental radioactivity dose calculations. (author)

  10. Total kinetic energy distribution of fission fragments in 6,7Li + 238U reactions

    International Nuclear Information System (INIS)

    The shape and width of fission-fragment (FF) mass and kinetic energy distribution provides a lot of information on the fission reaction mechanism and the structure of the compound nucleus (CN), the fragments as well as the interacting nuclei. The shape of the mass distribution of the fission fragments for the actinides induced by the proton or neutron is known to change with the incident energy. At low energies, it shows a double humped distribution which changes slowly to a single humped distribution as energy increases. However, for a reaction involving a weakly bound projectile (i.e., 6Li + 232Th), a sharp change in the shape of the mass distribution with energy was observed. The sharp increase in the peak to valley ratio (P:V) in the fission-fragment mass distribution in 6Li + 232Th reaction by Itkis et al. and in 6,7Li + 238U reactions by Santra et al. was concluded to be due to the reduced energy transfer to the composite system caused by incomplete fusion (ICF) of alpha or deuteron/triton followed by fissions. Total Kinetic Energy (TKE) distribution of fission fragments is another important observable on which the effect of projectile breakup is not explored yet. In this contribution, the study of breakup/transfer effect on average TKE distribution for 6,7Li + 238U reactions is presented

  11. The dependence of cumulative 238U(n,f) fission yield on incident-neutron energy

    Institute of Scientific and Technical Information of China (English)

    ZHENG Na; ZHONG Chunlai; MA Liyong; CHEN Zhongjing; LI Xiangqing; LIU Tingjin; CHEN Jinxiang; FAN Tieshuan


    This work is aim at studying the dependence of fission yields on incident neutron energy,so as to produce evaluated yield sets of the energy dependence.Experimental data at different neutron energies for gas fission products 85m,87,88Kr and 138Xe resulting from the 238U(n,f) reaction are processed using codes AVERAGE for weighed average and ZOTT for simultaneous evaluation.Energy dependence of the cumulative fission product yields on the incident neutron is presented.The evaluated curve of product yield is compared with the results calculated by the TALYS-0.64 code.The present evaluation is consistent with other main libraries in error permission.The fit curve of 87,88Kr can be recommended to predict the unmeasured fission yields.Comparisons of the evaluated energy dependence curves with theoretical calculated results show that the predictions using purely theoretical model for the fission process are not sufficiently accurate and reliable for the calculations of the cumulative fission yields for the 238U(n,f).

  12. Experimental determination of the antineutrino spectrum of the fission products of U238

    International Nuclear Information System (INIS)

    Accurate predictions of the antineutrino spectrum emitted by a nuclear reactor are of paramount importance for current and future reactor neutrino experiments. The antineutrinos are produced in the β - decays of the fission daughters of the four main fuel isotopes 235U, 238U, 239Pu, and 241Pu. One way to calculate the total anti νe - spectrum emitted by a fuel assembly is to experimentally determine the cumulative β-spectra emitted after fission of these four main fuel isotopes and to convert these into the corresponding anti νe-spectra. Three of the four spectra could already be determined in the 1980's, but only recently an experiment at the scientific neutron source FRM II in Garching could be performed to measure the anti νe-spectrum of 238U which contributes 10 % to the total antineutrino output of a standard PWR. With this spectrum, it is now possible to predict the antineutrino output of a reactor without the use of theoretical calculations for the contributing spectra. This talk describes the results of the experiment and discusses the impact on the current analysis of reactor neutrino experiments and the reactor antineutrino anomaly, which may give a hint on the possible existence of light sterile neutrinos.

  13. Natural activities of 238U, 232Th and 40K in building materials

    International Nuclear Information System (INIS)

    Seven kinds of building materials were analysed for 238U, 232Th and 40K using a direct γ-counting method. The activity concentrations measured for 238U (30-448 Bq kg-1) and 40K (328-7541 Bq kg-1) were greater than the world average activity for soil (25 and 370 Bq kg-1, respectively) for all building materials analysed, while the activity concentrations of 232Th were found to exceed the average of 25 Bq kg-1 (soil) for red-clay brick (51 Bq kg-1) and ceiling asbestos sheet materials (162 Bq kg-1). The calculated Ra equivalent activities (Raeq) for all materials are higher than the world average value for soil (89 Bq kg-1). For red-clay brick and ceiling asbestos, the Raeq values are found to exceed the limit of 370 Bq kg-1, equivalent to a γ-dose of 1.5 mSv yr-1. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  14. Role of tumour necrosis factor gene polymorphisms (-308 and -238) in breast cancer susceptibility and severity

    International Nuclear Information System (INIS)

    Genetic polymorphisms in the promoter region of the tumour necrosis factor (TNF) gene can regulate gene expression and have been associated with inflammatory and malignant conditions. We have investigated two polymorphisms in the promoter of the TNF gene (-308 G>A and -238 G>A) for their role in breast cancer susceptibility and severity by means of an allelic association study. Using a case–control study design, breast cancer patients (n = 709) and appropriate age-matched and sex-matched controls obtained from the Breast Screening Unit (n = 498) were genotyped for these TNF polymorphisms, using a high-throughput allelic discrimination method. Allele frequencies for both polymorphisms were similar in both breast cancer cases and controls. However, the -308 polymorphism was found to be associated with vascular invasion in breast tumours (P = 0.024). Comparison with other standard prognostic indices did not show any association for either genotype. We demonstrated no association between the -308G>A polymorphism and the -238G>A polymorphism in the promoter region of TNF and susceptibility to breast cancer, in a large North European population. However, the -308 G>A polymorphism was found to be associated with the presence of vascular invasion in breast tumours

  15. Determination of specific concentrations of 40K, 238U and 232Th in mineral fertilizer samples

    International Nuclear Information System (INIS)

    The use of fertilizer is an established practice worldwide to promote agricultural productivity increased without increasing the planted area, resulting in native forests protection and increase of the food availability. Some kinds of fertilizer have in their chemical composition some radionuclides due the origin of its feedstock, such as 238U, the 232Th, and their descendants, beyond 40K. Knowledge of the radioactivity levels in the environment is great importance to know the gamma radiation dose that the human being is exposed. For identification and quantitation of radionuclides, it was used gamma spectrometry where HPGe detector was used to obtain the spectra, and LabSOCS software for calculating the detection efficiency for each energy. The values of 232Th specific concentrations ranged from 4.1 to 368.1 Bq.Kg-1, the values of 238U specific concentrations ranged from 16.0 to 647.7 Bq.Kg-1 and 40K specific concentrations ranged from 19.1 to 12713 Bq.Kg-1. Concentrations of values are consistent with those found in literature. (author)

  16. Averaged U238 fission cross section measurement in Cf-252 neutron spectrum

    International Nuclear Information System (INIS)

    With regard to the standardization of Cf-252 neutron spectrum, the averaged U-238 fission cross section was measured over the Cf-252 neutron spectrum using foil activation technique. The gamma spectra of the fission products were obtained on a pure germanium detector at different decay times in order to identify the gamma rays of short, medium and long half-life radioisotopes. Analyzing the gamma spectra of the irradiated uranium foils several distinct photopeaks of several fission products were identified. The pure activity of Te-132 was determined from the net area under 228.2 kev photopeak after correcting it for neighbouring photopeaks of Np-239 and Pa-234. The averaged U238 fission cross section was calculated from the corrected counts of Te-132 photopeak to be 329±10 mb. The main sources of errors in the measurements are mainly due to inaccuracy of location of foils, neutron flux, counting statistics, weight of foils, impurity of foils and interference from neighbouring photopeaks. The contribution of fission neutrons from spontaneous fission of Cm-248, daughter of Cf-252, to the total flux density was estimated at 0.13%. (orig.)

  17. Photofission product yields of 238U and 239Pu with 22-MeV bremsstrahlung (United States)

    Wen, Xianfei; Yang, Haori


    In homeland security and nuclear safeguards applications, non-destructive techniques to identify and quantify special nuclear materials are in great demand. Although nuclear materials naturally emit characteristic radiation (e.g. neutrons, γ-rays), their intensity and energy are normally low. Furthermore, such radiation could be intentionally shielded with ease or buried in high-level background. Active interrogation techniques based on photofission have been identified as effective assay approaches to address this issue. In designing such assay systems, nuclear data, like photofission product yields, plays a crucial role. Although fission yields for neutron-induced reactions have been well studied and readily available in various nuclear databases, data on photofission product yields is rather scarce. This poses a great challenge to the application of photofission techniques. In this work, short-lived high-energy delayed γ-rays from photofission of 238U were measured in between linac pulses. In addition, a list-mode system was developed to measure relatively long-lived delayed γ-rays from photofission of 238U and 239Pu after the irradiation. Time and energy information of each γ-ray event were simultaneously recorded by this system. Cumulative photofission product yields were then determined using the measured delayed γ-ray spectra.

  18. 238PuO2 heat sources: An enabling technology for space exploration

    International Nuclear Information System (INIS)

    Surprisingly, during the 35 yr that 238PuO2-fueled radioisotope power systems have been demonstrated and continuously improved in terms of safety, reliability, and efficiency, US capabilities to produce 238PuO2 have significantly decreased. At the same time, progress in the efficiency and longevity of chemical and solar power systems has reduced the suite of potential applications for radioisotope power systems remain a viable option for deep space exploration and planetary missions that must survive hostile operating environments. The enabling aspect of radioisotope power supplies for deep space exploration missions can best be illustrated by a comparative analysis of power supply options available for the National Aeronautics and Space Administration's most recent planetary explorer, the Cassini mission to Saturn. A comparative evaluation of currently available power supply options for the Cassini mission, demonstrates the significant mass and maneuverability penalties that would result from the use of chemical or solar energy sources in place of the RTGs and heater units. Absent additional nuclear power options, such as a spacecraft reactor, radioisotope power sources were clearly the only viable option for providing electrical and thermal power to the Cassini spacecraft

  19. Effect of energy self-shielding methods on 238U for criticality safety problems

    International Nuclear Information System (INIS)

    Multigroup cross sections are obtained by weighting point-wise nuclear data with a flux spectrum. For nuclides having a resonance structure, energy self-shielding calculations are performed to calculate a more detailed flux spectrum. Subsequently, self-shielded multigroup cross sections are generated. Different methods exist for energy self-shielding calculations. Among them are the Bondarenko method, the NJOY flux calculator, and the CENTRM method. The CENTRM method is a more advanced technique that utilizes both multigroup and point-wise cross sections in a one-dimensional transport calculation to solve for a point-wise flux distribution. The method of energy self-shielding is one of the elements in a multigroup cross-section generation that may have a significant impact on the multiplication factor in criticality safety calculations. This paper compares the three aforementioned self-shielding methods applied to 238U. A criticality problem having 23 cases is considered. This system includes water-moderated, low-enriched UO2 fuel rods in square-pitched array, with a thermal flux spectrum. Multiplication factors obtained from transport calculations that use multigroup and continuous energy data are compared. It is observed that multiplication factors calculated with multigroup data containing different self-shielding methods for 238U have less than 500 pcm difference with continuous energy results. (authors)

  20. Measurements of 234U, 238U and 230Th in excreta of uranium-mill crushermen

    International Nuclear Information System (INIS)

    Uranium and thorium levels in excreta of uranium mill crushermen who are routinely exposed to airborne uranium ore dust were measured. The purpose was to determine whether 230Th was preferentially retained over either 234U or 238U in the body. Urine and fecal samples were obtained from fourteen active crushermen with long histories of exposure to uranium ore dust, plus four retired crushermen and three control individuals for comparison. Radiochemical procedures were used to separate out the uranium and thorium fractions, which were then electroplated on stainless steel discs and assayed by alpha spectrometry. Significantly greater activity levels of 234U and 238U were measured in both urine and fecal samples obtained from uranium mill crushermen, indicating that uranium in the inhaled ore dust was cleared from the body with a shorter biological half-time than the daughter product 230Th. The measurements also indicated that uranium and thorium separate in vivo and have distinctly different metabolic pathways and transfer rates in the body. The appropriateness of current ICRP retention and clearance parameters for 230Th in ore dust is questioned

  1. Excited levels of 238Np from spectroscopic measurements of the 237Np(n,γ)238Np reaction and /sup 242m/Am alpha decay

    International Nuclear Information System (INIS)

    The gamma rays and conversion electrons emitted following neutron capture in a 237Np target have been measured by use of the GAMS and BILL spectrometers at Grenoble. Gamma ray and alpha particle measurements of /sup 242m/Am alpha decay (Ge(Li)γ singles, γ-γ coincidences, α singles) have been made at Livermore. The data from these measurements have been combined with earlier measurements (Ionescu 1979, Asaro 1964) to produce a more detailed level scheme for 238Np. Approximately 36 levels have been identified from all of the experimental evidence. The experimentally-observed bandhead energies can be compared with predicted values derived from a simple linear addition of excitation energies observed in neighboring odd-mass nuclei. Values for the Gallagher-Moszkowski splitting of each configurational pair were obtained from theoretical calculations (Piepenbring 1978). We have assigned configurations to ten rotational bands whose bandhead energies range from 0 to 342 keV and which represent all but one of the configurations predicted to occur below 385 keV

  2. State of disequilibrium between 238U, 234U, 226Ra and 222Rn in groundwater from bedrock

    International Nuclear Information System (INIS)

    Approximately one thousand drilled wells were investigated for their natural radioactivity. The determinations of 238U, 234U, 226Ra and 222Rn from 310 samples showed a high state of radioactive disequilibrium between the members of the uranium series present in water. The 238U/226Ra activity ratio usually fell in the range 1 to 20 and the 238U/222Rn activity ratio in the range 1 to 20 x 10-4, the highest activity ratios being from samples with an elevated uranium content. The 234U/238U activity ratio varied between 0.76 and 4.67, the most frequent values showing a 60% excess of 234U in the samples. Most of the 234U/238U activity ratios near unity were found in samples with a high uranium content. Several drilled wells with anomalously high uranium contents were found in southern Finland. The average 226Ra and 222Rn contents of these wells were not exceptionally high, which suggests high mobility of uranium in groundwater from the areas involved. (author)

  3. Measurement of the neutron-induced fission cross sections of /sup 242/Cm and /sup 238/Pu

    International Nuclear Information System (INIS)

    The neutron-induced fission cross sections of /sup 242/Cm and /sup 238/Pu have been measured from 0.1 eV to 100 keV using the Rensselaer Intense Neutron Spectrometer. Fission areas and widths were determined for several resolved low-energy resonances of /sup 242/Cm and /sup 238/Pu. The fission resonance integrals for /sup 242/Cm and /sup 238/Pu were found to be 12.9 +- 0.7 and 15.9 +- 0.6 b, respectively. The gross structure observed in the unresolved energy region of the /sup 242/Cm and /sup 238/Pu fission cross sections is suggestive of intermediate structure, and is consistent with the second well lying 2 to 3 MeV above the first well. The ENDF/B-V library fission cross section of /sup 238/Pu is, in general, not in good agreement with this measurement and a new evaluation is recommended. This is the first reported fission measurement of /sup 242/Cm in the 0.1-eV through 100-keV energy range

  4. High-precision determination of 234U/238U activity ratios in natural waters and carbonates by ICPMS

    International Nuclear Information System (INIS)

    A method has been developed for precise measurement of 234U/238U activity ratios in natural waters and carbonates using quadrupole inductively coupled plasma mass spectrometry. A recovery of 80--85% of seawater U is achieved by Fe(III) coprecipitation followed by extraction chromatography with a supported dipentyl pentane phosphonate material; 90--95% of U is recovered from carbonates, which are dissolved in HNO3 and subjected to the same extraction chromatographic preparation. Isotopic measurements are made via recirculating pneumatic nebulization of small volumes of solutions containing 0.5--5 mg/L U. 234U/235U is measured as a proxy for determination of 234U/238U; iridium is added to sample solutions and the ion ratio 191Ir40Ar+/193Ir40Ar+ is measured for internal mass discrimination correction 234U/238U activity ratios in the range 1.143--1.154 are observed for 13 seawater and contemporary corals, in agreement with the established marine 234U/238U activity ratio. For samples sizes of 5--25 microg U, ICPMS uncertainties of ± 0.2--0.5% relative, 2θ standard error, approach those obtained for 234U/238U activity ratios in bottled waters, Lake Erie surface waters, mollusk fossils, and fertilizers are also demonstrated

  5. Modeling of Selected Ceramic Processing Parameters Employed in the Fabrication of 238PuO 2 Fuel Pellets (United States)

    Brockman, R. A.; Kramer, D. P.; Barklay, C. D.; Cairns-Gallimore, D.; Brown, J. L.; Huling, J. C.; Van Pelt, C. E.

    Recent deep space missions utilize the thermal output of the radioisotope plutonium-238 as the fuel in the thermal to electrical power system. Since the application of plutonium in its elemental state has several disadvantages, the fuel employed in these deep space power systems is typically in the oxide form such as plutonium-238 dioxide (238PuO2). As an oxide, the processing of the plutonium dioxide into fuel pellets is performed via "classical" ceramic processing unit operations such as sieving of the powder, pressing, sintering, etc. Modeling of these unit operations can be beneficial in the understanding and control of processing parameters with the goal of further enhancing the desired characteristics of the 238PuO2 fuel pellets. A finite element model has been used to help identify the time-temperature-stress profile within a pellet during a furnace operation taking into account that 238PuO2 itself has a significant thermal output. Results of the modeling efforts will be discussed.

  6. Measurement of radiative capture cross section on 238U at the nTOF CERN facility

    International Nuclear Information System (INIS)

    The need of sources of energy different from fossil fuels is nowadays a crucial point. As the EU-SET Plan points out, it is necessary to investigate new concepts for nuclear systems to improve the sustainability of nuclear energy. These concepts cover from energy production, through both advanced light water reactors and fast reactors foreseen in generation IV, to minimization and discharge of nuclear waste through subcritical fast systems (ADS). Despite many previous measurements and recent efforts, the present knowledge of basic nuclear data is still inadequate to fulfill the precision and accuracy required for the design and development of these new technologies. In this context the Nuclear Energy Agency addresses the most relevant isotopes, decay data, nuclear reaction channels and energy ranges that have to be investigated in more detail in the NEA High Priority Request List. The measurement of 238U(n,g) reaction cross section falls within this list because of its importance for the security of operating light water reactors and the design of generation IV reactors. Even if the number of measurements present in the EXFOR database is large, inconsistencies are still present for the 238U capture cross section both in the low energy and in the unresolved resonance region. This uncertainty influences both fast and thermal reactor systems, and contributes to the uncertainty on Pu isotope density at the end of fuel cycles. As such, there is a proposal of three independent measurement of the 238U(n,g) cross section in order to reach the required precision of 2% within an energy range from few eV to hundreds of keV. One measurement was performed at the EC-JRC-IRMM facility GELINA, while the other two at the nTOF facility at CERN. Combined together they should lead to the desired accuracy. Here the preliminary results of the 238U(n,g) cross section measurement are presented, which was performed at nTOF with C6D6 scintillation detectors on April 2012 and covers an

  7. Pre-neutron-emission Mass Distributions for Neutron-induced 238U Fission at Low and Intermediate Energies%中低能中子诱发238U裂变的碎片质量分布

    Institute of Scientific and Technical Information of China (English)

    孙小军; 余呈刚; 王宁


    乏燃料中238U含量最多(高达95%),研究中子诱发238U裂变产物的分布特性对乏燃料的循环后处理具有非常重要的意义.本文基于微观和唯象方法的裂变势模型理论,研究入射能量从0.9 MeV-60.0 MeV能区的中子诱发238U裂变反应的发射中子前碎片质量分布,结果表明:在中能区,理论计算结果能很好地重现实验数据,甚至比国际著名的TALYS理论计算的结果要好;在低能区,理论计算结果也较为合理,并分析了与实验数据有所偏差的原因.%238Utof which abundance is almost 95% ,is one of the most important isotopes of the spent nuclear fuel. The study of neutron-induced 238U fission is in favor of the cycle processing of the spent fuel. Based on the microscopic and phenomenological approach,the pre-neutron-emission mass distributions of neutron-induced 238U fission at incident energies from 0. 9 to 60 MeV have been studied with the fission potential theory proposed in previous paper. The calculated results could well reproduce the experimental data,and are even better than that of the famous TALYS code at intermediate energies.The results can also reasonably predict the distributions at the vibrational resonances,and the deviation between the experimental and the theoretical data is also analyzed.

  8. 238U-230Th-226Ra radioactive disequilibria in the products from 1707 eruption of Fuji volcano, Japan

    International Nuclear Information System (INIS)

    Time scale of magmatic processes in the 1707 eruptive activity of Fuji volcano, Japan, was estimated by the 238U-230Th-226Ra disequilibria observed in the 1707 volcanic products. The activity ratios of 226Ra/230Th in the products were larger than unity, being enriched in 226Ra relative to 230Th. The decay-corrected 226Ra/230Th activity ratio to the time of the eruption versus 238U/230Th activity ratio diagram for the 1707 volcanic products showed a positive correlation, suggesting that the 238U/230Th-226Ra disequilibria occurred during the magma genesis of Fuji volcano. The 230Th-226Ra disequilibria in the 1707 volcanic products suggested that the time scale from the magma genesis to the eruption, including the melting of the mantle wedge, magma storage and magmatic differentiation from basalt to andesite, was less than 8000 years. (author)

  9. 238U, 234U, 226Ra, 210Po concentrations of bottled mineral waters in Italy and their dose contribution

    International Nuclear Information System (INIS)

    Due to the importance of bottled mineral water in human diet with special regard to children in lactation period, a monitoring of natural radioactivity in some bottled mineral waters produced in Italy was performed. Gross alpha and beta activities and 226Ra, 238U, 234U, and 210Po concentrations were measured. Gross alpha and beta activities were determined by standards ISO 9696 and ISO 9697; for 226Ra determination liquid scintillation was used. The 238U and 234U concentrations were determined by alpha spectrometry after their separation from matrix by extraction chromatography and electroplating. 210Po was measured by alpha spectrometry. The results revealed that the concentrations (mBq L-1) of 226Ra, 238U, 234U, and 210Po ranged from -1; for infants (-1

  10. Analysis of 209 Bi and 238 U photofission cross section in the quasi-deuteron region of photonuclear absorption

    International Nuclear Information System (INIS)

    An analysis of the photofission reactions in the quasi-deuteron energy range of photonuclear absorption (∼ 30-140 MeV) has been performed for 209 Bi and 238 U nuclei. Experimental cross section data available in the literature have been compared with calculated values obtained from a model in which the incoming photon is assumed to be absorbed by a neutron-proton pair (Levinger's quasi-deuteron photoabsorption), followed by a mechanism of evaporation-fission competition for the excited residual nuclei. The model has been shown to reproduce the main experimental features of 209 Bi and 238 U photofission cross section, although unexplained differences still remain in the case of 238 U-fission by 30-50 MeV incident photons. (author). 49 refs, 10 figs, 2 tabs

  11. Production of $^{237}$U in the $^{238}$U ($\\gamma, n$) photonuclear reaction at the electron accelerator MT-25 microtron

    CERN Document Server

    Sabelnikov, A V; Gustova, M V; Belov, A G; Dmitriev, S N


    $^{237}$U was obtained in the $^{238}$U($\\gamma, n$) reaction at the electron accelerator MT-25 microtron of the FLNR of the JINR. The $^{237}$U radiation yield under experimental conditions amounted to 1 kBq/$\\mu $A$\\cdot $h$\\cdot$mg $^{238}$U. Capture of recoil atoms in a solid-solid system was used for isolation of $^{237}$U from the target material. Fluorides of chemical elements from I-III series of the Periodic Table of the Elements were used as $^{237}$U acceptors. The $^{237}$U isolation from radioactive impurities was realized by means of extraction and ion exchange. Specific activity of the $^{237}$U preparation was equal to 49500 kBq/mg $^{238}$U. The radioactive impurity content did not exceed 10$^{-6}$ Bq/Bq. The $^{237}$U chemical yield amounted to 70{\\%}.

  12. Verification tests on nondestructive assay for 238U content in uranium-contaminated waste drums using gamma method

    International Nuclear Information System (INIS)

    We have proposed a new theory on gamma assay for 238U determination of uranium-contaminated waste drums. According to this theory, regardless of the inhomogeneity of waste matrix density or uranium source distribution, we can accurately determine the amount of 238U contained in drums nondestructively using count rates of gamma rays of two energies(1001keV and 766keV) emitted from 238U progeny nuclide 234mPa. In this paper, we have verified the theory by tests under various waste conditions made by simulated waste drums. We have estimated the relative error to be less than 20%, and the detection limit to be 1.2Bq/g when the specific activity of uranium is 25000Bq/g, in these cases. We have confirmed that this new assay system is efficient for the rational classification of uranium wastes to be disposed of. (author)

  13. Performance evaluation of indigenous thermal ionization mass spectrometer for determination of 235U/238U atom ratios

    International Nuclear Information System (INIS)

    A magnetic sector based Thermal Ionization Mass Spectrometer (TIMS) designed and developed at Technical Physics Division, B.A.R.C., was evaluated for its performance for the determination of 235U/238U atom ratios in uranium samples. This consisted of evaluating the precision and accuracy on the 235U/238U atom ratios in various isotopic reference materials as well as indigenously generated uranium samples. The results obtained by the indigenous TIMS were also compared with those obtained using a commercially available TIMS system. The internal and external precision were found to be around 0.1% for determining 235U/238U atom ratios close to those of natural uranium ( i.e. 0.00730). (author)

  14. Precise measurements of 234U/238U and U concentrations in profiles of Pacific and Atlantic waters

    International Nuclear Information System (INIS)

    High precision measurement of 234U/238U ratios and U concentrations in profiles of Atlantic and Pacific waters have been made in order to determine the degree of heterogeneity of these parameters in the open ocean. The measurements were made possible by the development of mass spectrometric techniques to measure 234U/238U to +/- ∼ 5 per thousand (2σ) and U concentrations to +/- 2 per thousand with 2-5 x 109 atoms of 234U. A 233U-236U double spike is used to correct for instrumental mass fractionation. The average 234U/238U for 4 samples from the Pacific profile is 144 +/- 4 per thousand higher than the equilibrium atomic 234U/238U ratio (5.47 x 10-5). The average for 5 samples in the Atlantic profile is identical (144 +/- 4 per thousand). A comparison of 234U/238U values for samples above and below the thermocline shows similar homogeneity. U concentrations normalized to 35 per thousand salinity are the same within ∼ 1% (3.215 +/- 6 to 3.257 +/- 6 ppb) but clearly show variation greater than the +/- 2 per thousand error. The reason for this fine scale variation requires further investigation. The authors data suggest that 234U/238U in the open ocean is homogeneous to within 8 per thousand. This is consistent with the long residence time of U and the long 234U half life compared to the residence time of water in the deep ocean. Similar measurements on marine pore fluids which can easily be done using the authors technique should provide constraints on the U flux across the sediment-water interface

  15. 239Pu(n,2n) 238Pu cross section inferred from IDA calculations and GEANIE measurements

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H; Ormand, W E; Dietrich, F S


    This report presents the latest {sup 239}Pu(n,2n){sup 238}Pu cross sections inferred from calculations performed with the nuclear reaction-modeling code system, IDA, coupled with experimental measurements of partial {gamma}-ray cross sections for incident neutron energies ranging from 5.68 to 17.18 MeV. It is found that the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section peaks at E{sub inc} {approx} 11.4 MeV with a peak value of approximately 326 mb. At E{sub inc} {approx} 14 MeV, the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section is found to be in good agreement with previous radio-chemical measurements by Lockheed. However, the shape of the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section differs significantly from previous evaluations of ENDL, ENDF/B-V and ENDF/B-VI. In our calculations, direct, preequilibrium, and compound reactions are included. Also considered in the modeling are fission and {gamma}-cascade processes in addition to particle emission. The main components of physics adopted and the parameters used in our calculations are discussed. Good agreement of the inferred {sup 239}Pu(n,2n){sup 238}Pu cross sections derived separately from IDA and GNASH calculations is shown. The two inferences provide an estimate of variations in the deduced {sup 239}Pu(n,2n){sup 238}Pu cross section originating from modeling.

  16. A reactivity hold-down strategy for soluble boron free operation by introducing Pu-238 added fuel

    International Nuclear Information System (INIS)

    A new concept of Pu-238 added fuel is introduced to control the reactivity and power distribution in soluble boron free (SBF) pressurized water reactor (PWR) core. Though extensive use of burnable poison and control rods is inevitable for reactivity suppression in SBF core, it causes the core power distribution control to be so difficult that a practical SBF operation is far distant. In this work, it is confirmed that the excess reactivity can be greatly suppressed by introducing the Pu-238 added fuel. As a result of the conceptual core design of the 600 MWe SBF PWR using Pu-238 added fuel, the core reactivity is well controlled in comparison with the results obtained from the earlier 600 MWe SBF core design works. Especially, the axial power shape control is performed successfully with the aid of simple axial zoning scheme, developed in this study, by using Pu-238 enrichment zoning. The Pu-238 added fuel is also tested for 1300 MWe SBF PWR core design, in which the power distribution control can be more difficult than that of smaller plants if soluble boron control is not available. The results show that the core excess reactivity and the power distribution can be well controlled without using soluble boron even in a large-sized PWR. Hence, one of the difficult control problems arising in SBF core design can be greatly mitigated by introducing the new fuel concept. It is further expected that the Pu-238 added fuel, the simple axial zoning scheme, and the control bank operation strategy introduced in this study are directly applicable to practical SBF core design

  17. Acceptable knowledge summary report for combustible/noncombustible, metallic, and HEPA filter waste resulting from {sup 238}Pu fabrication activities

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, P.S.Z.; Foxx, C.L.


    All transuranic (TRU) waste must be sufficiently characterized and certified before it is shipped to the Waste Isolation Pilot Plant (WIPP). The US Environmental Protection Agency (EPA) allows use of acceptable knowledge (AK) for waste characterization. EPA uses the term AK in its guidance document and defines AK and provides guidelines on how acceptable knowledge should be obtained and documented. This AK package has been prepared in accordance with Acceptable Knowledge Documentation (TWCP-QP-1.1-021,R.2). This report covers acceptable knowledge information for five waste streams generated at TA-55 during operations to fabricate various heat sources using feedstock {sup 238}Pu supplied by the Savannah River Site (SRS). The {sup 238}Pu feedstock itself does not contain quantities of RCRA-regulated constituents above regulatory threshold limits, as known from process knowledge at SRS and as confirmed by chemical analysis. No RCRA-regulated chemicals were used during {sup 238}Pu fabrication activities at TA-55, and all {sup 238}Pu activities were physically separated from other plutonium processing activities. Most of the waste generated from the {sup 238}Pu fabrication activities is thus nonmixed waste, including waste streams TA-55-43, 45, and 47. The exceptions are waste streams TA-55-44, which contains discarded lead-lined rubber gloves used in the gloveboxes that contained the {sup 238}Pu material, and TA-55-46, which may contain pieces of discarded lead. These waste streams have been denoted as mixed because of the presence of the lead-containing material.

  18. Fission Distribution in Neutron-Induced Fission of Th230, Pu238 and Am241

    International Nuclear Information System (INIS)

    The angular distribution of fragments in the neutron-induced fission of Th230, Pu238 and Am241 was measured in-the neutron energy range 100 - 1200 keV. Measurements were also made for Am241 at neutron energies of 4 and 5 MeV, and the dependence of the fission cross-section of Pu238 on neutron energy in the 50 -1400 keV range was likewise determined. The partial fission cross-sections for the different K-bands were derived for Th230 on the basis of the angular distributions obtained, using fission cross-sections taken from another paper, and also the neutron capture cross-sections of the neutron permeabilities calculated by the optical coefficients of adhesion. The following band sequence was established: 1/2-, 3/2-, 3/2+ the energy interval between the bands is ∼ 100 keV. The pattern of the cross-section for band shows in the sub-barrier region (at a neutron energy of 860keV) the same dip as the total fission cross-section. This pattern in the sub-barrier region cannot be explained by the normal change in neutron width, as it can be in the case of fission above the barrier, and gives grounds for assuming the presence of some other mechanism powerfully affecting the fission cross-section. The angular distributions of the fragments can be explained satisfactorily only on the assumption that there is an energy shift between the individual states within the bands. This indicates that the widths of the levels at the saddle are probably less than the distances between the levels themselves. Assuming that the levels are rotatory, a value of about 4 keV is obtained for h2/2J. From analysing the anisotropy of Pu238 fission, we may assume the band sequence 1/2+, 3/2-, 1/2-. In the case of Am241 fission, the angular distributions show a weak energy dependence and little anisotropy; this is explained by the large number of participating states. The measurements at 4 and 5 MeV made it possible to determine the value of K20, and to compare it with the data for Np237. This

  19. Post-Irradiation Examination of 237Np Targets for 238Pu Production

    Energy Technology Data Exchange (ETDEWEB)

    Morris, Robert Noel [ORNL; Baldwin, Charles A [ORNL; Hobbs, Randy W [ORNL; Schmidlin, Joshua E [ORNL


    Oak Ridge National Laboratory is recovering the US 238Pu production capability and the first step in the process has been to evaluate the performance of a 237Np target cermet pellet encased in an aluminum clad. The process proceeded in 3 steps; the first step was to irradiate capsules of single pellets composed of NpO2 and aluminum power to examine their shrinkage and gas release. These pellets were formed by compressing sintered NpO2 and aluminum powder in a die at high pressure followed by sintering in a vacuum furnace. Three temperatures were chosen for sintering the solution precipitated NpO2 power used for pellet fabrication. The second step was to irradiate partial targets composed of 8 pellets in a semi-prototypical arrangement at the two best performing sintering temperatures to determine which temperature gave a pellet that performed the best under the actual planned irradiation conditions. The third step was to irradiate ~50 pellets in an actual target configuration at design irradiation conditions to assess pellet shrinkage and gas release, target heat transfer, and dimensional stability. The higher sintering temperature appeared to offer the best performance after one cycle of irradiation by having the least shrinkage, thus keeping the heat transfer gap between the pellets and clad small minimizing the pellet operating temperature. The final result of the testing was a target that can meet the initial production goals, satisfy the reactor safety requirements, and can be fabricated in production quantities. The current focus of the program is to verify that the target can be remotely dissembled, the pellets dissolved, and the 238Pu recovered. Tests are being conducted to examine these concerns and to compare results to code predictions. Once the performance of the full length targets has been quantified, the pellet 237Np loading will be revisited to determine if it can be

  20. 238U/235U determinations of some commonly used reference materials and U-bearing accessory minerals (Invited) (United States)

    Condon, D.; Noble, S.; McLean, N.; Bowring, S. A.


    We have determined 238U/235U ratios for a suite of commonly used natural (CRM 112a, SRM 950a, HU-1) and synthetic (IRMM 184 and CRM U500) uranium reference materials in addition to several U-bearing accessory phases (zircon and monazite) by thermal ionisation mass-spectrometry (TIMS) using the IRMM 3636 233U-236U double spike to accurately correct for mass fractionation. The 238U/235U values for the natural uranium reference materials differ, by up to 0.1%, from the widely used ‘consensus’ value (137.88) with all having 238U/235U values less than 137.88. Similarly, initial 238U/235U data from zircon and monazite yield 238U/235U values that are lower than the ‘consensus’ value. The data obtained from U-bearing minerals is used to assess how the uncertainty in the 238U/235U ratio contributes to the systematic discordance observed in 238U/206Pb and 235U/207Pb dates (Mattinson, 2000; Schoene et al., 2006) which has traditionally been wholly attributed to error in the U decay constants. The 238U/235U determinations made on the synthetic reference materials yield results that are considerably more precise and accurate than the certified values (0.02% vs. 0.1% for CRM U500). The calibration of isotopic tracers used for U-daughter geochronology that are partially based upon these reference materials, and the resultant age determinations, will benefit from increased accuracy and precision. Mattinson, J.M., 2000. Revising the “gold standard”—the uranium decay constants of Jaffey et al., 1971. Eos Trans. AGU, Spring Meet. Suppl., Abstract V61A-02. Schoene B., Crowley J.L., Condon D.C., Schmitz M.D., Bowring S.A., 2006, Reassessing the uranium decay constants for geochronology using ID-TIMS U-Pb data. Geochimica et Cosmochimica Acta 70: 426-445

  1. Transition from asymmetric to symmetric fission in 45-69 MeV proton induced fission of 238U

    Directory of Open Access Journals (Sweden)

    H. Noshad


    Full Text Available Thin targets of 238U were bombarded with 45, 55, 65 and 69 MeV protons at the Cyclotron and Radioisotope Center (CYRIC of Tohoku University in Japan. Gamma rays emitted from the fission products were recorded and analyzed by using gamma spectroscopy. Then, the cross sections for the formation of fission products, fragment mass distributions, and total fission cross sections were measured. Special care was taken to make this measurement precisely. The experimental results show that for 238U(p, f reaction at Ep > 65 MeV, the asymmetry component in the mass distribution is eliminated, and the symmetric fission remains the dominant fission mode.

  2. Radioactivity of Natural Nuclides (40K, 238U, 232Th, 226Ra) in Coals from Eastern Yunnan, China


    Xin Wang; Qiyan Feng; Ruoyu Sun; Guijian Liu


    The naturally occurring primordial radionuclides in coals might exhibit high radioactivity, and can be exported to the surrounding environment during coal combustion. In this study, nine coal samples were collected from eastern Yunnan coal deposits, China, aiming at characterizing the overall radioactivity of some typical nuclides (i.e., 40K, 238U, 232Th, 226Ra) and assessing their ecological impact. The mean activity concentrations of 238U, 232Th, 40K and 226Ra are 63.86 (17.70–92.30 Bq· kg-...

  3. Assesment of Plutonium 238 and Plutonium 239+240 in soils of different agricultural regions of Guatemala

    International Nuclear Information System (INIS)

    In this report an assesment and measurement of PLUTONIUM 238, PLUTONIUM 239, and PLUTONIUM 240 are made. Samples of cultivated soils in 15 provinces of Guatemala were taken. To separate plutonium isotopes a radiochemical method was made using extraction, precipitation and ionic interchange. By electrodeposition the plutonium was measured using an alpha spectroscopy by PIPS method. The radioactivity ranges from 2.84 mBq/Kg to 36.38 mBq/Kg for plutonium 238, and 8.46 mBq/Kg to 26.61 mBq/Kg for plutonium 239+240

  4. Quantitative determination of 235U and 238U by measuring the gamma radiation from short-lived fission products

    International Nuclear Information System (INIS)

    On the basis of two successive activations of the sample by neutrons of different energy distribution and of measuring the gamma radiation from the resulting short-lived fission products the masses of uranium 235 and 238, the enrichment and the uranium concentration have been determined. The procedure can only be used for unirradiated uranium. The analysis takes 50 min. The method has been tested with samples of 10 g and up to 90% enrichment. The minimum detectable amounts were 1 mg 235U and 1 g 238U, respectively, with the random error of measurement being 4%. (author)

  5. Measurement of nuclide cross-sections of spallation residues in 1 A GeV 238U + proton collisions

    International Nuclear Information System (INIS)

    The production of heavy nuclides from the spallation-evaporation reaction of 238U induced by 1 GeV protons was studied in inverse kinematics. The evaporation residues from tungsten to uranium were identified in-flight in mass and atomic number. Their production cross-sections and their momentum distributions were determined. The data are compared with empirical systematics. A comparison with previous results from the spallation of 208Pb and 197Au reveals the strong influence of fission in the spallation of 238U. (orig.)

  6. Assessment of environmental radioactivity (238U, 232Th and 40K) and radiological mapping of Tata Nagar city (Jharkhand), India

    International Nuclear Information System (INIS)

    Study on the natural radioactivity concentration levels (238U, 232Th and 40K) in soil samples of Tata Nagar city obtained from seven locations at Tata Nagar city, India was undertaken and the results of the same are reported. In addition, radiological mapping of natural background gamma radiation levels was carried out throughout Tata Nagar city using vehicle based Mobile monitoring technique and the same is presented here. The activity concentrations were assayed and estimated for 238U, 232Th and 40K isotopes in Bq/Kg, using gamma ray spectrometry and the radiation dose rates were estimated. (author)

  7. Isotopic resolution of fission fragments from 238U + 12C transfer and fusion reactions

    International Nuclear Information System (INIS)

    Recent results from an experiment at GANIL, performed to investigate the main properties of fission-fragment yields and energy distributions in different fissioning nuclei as a function of the excitation energy, in a neutron-rich region of actinides, are presented. Transfer reactions in inverse kinematics between a 238U beam and a 12C target produced different actinides, within a range of excitation energy below 30 MeV. These fissioning nuclei are identified by detecting the target-like recoil, and their kinetic and excitation energy are determined from the reconstruction of the transfer reaction. The large-acceptance spectrometer VAMOS was used to identify the mass, atomic number and charge state of the fission fragments in flight. As a result, the characteristics of the fission-fragment isotopic distributions of a variety of neutron-rich actinides are observed for the first time over the complete range of fission fragments. (authors)

  8. An overview of plutonium-238 decontamination and decommissioning (D and D) projects at Mound

    International Nuclear Information System (INIS)

    Mound is currently decontaminating for restricted reuse and/or decommissioning for conditional release four major plutonium-238 contaminated facilities that contained 1700 linear feet of gloveboxes and associated equipment and services. Several thousand linear feet of external underground piping, associated tanks, and contaminated soil are being removed. Two of the facilities contain ongoing operations and will be reused for both radioactive and nonradioactive programs. Two others will be completely demolished and the land area will become available for future DOE building sites. An overview of the successful techniques and equipment used in the decontamination and decommissioning of individual pieces of equipment, gloveboxes, services, laboratories, sections of buildings, entire buildings, and external underground piping, tanks, and soil in a highly populated residential area is described and pictorially presented

  9. Dose-to-the-population exposure estimates for use of plutonium-238-powered artificial hearts

    Energy Technology Data Exchange (ETDEWEB)

    McKee, R.W.; Clark, L.L.; Cole, B.M.


    Estimates of dose to the population from /sup 238/Pu-powered artificial hearts were developed using a calculational model called REPRIEVE. This model develops the projected user population by incorporating assumptions regarding future heart disease death rates, the fraction dying who would be eligible candidates for artificial hearts, population projections, beginning implant rates, death rates after implant due to natural causes, and deaths caused by device failure. The user population was characterized by age, sex, household description, employment status and occupation. Census data on household descriptions and special surveys in selected cities provided the information necessary to describe persons exposed during both household and public activities. These surveys further defined distance and time of contact factors for these persons. Calculations using a dosemetry computer code defined the relationships between distance and dose. The validity of these calculations has been substantiated by experimental measurements.

  10. Dielectric constant/ loss behaviour of high energy 238U ion irradiated polymer liquid crystal

    International Nuclear Information System (INIS)

    Dielectric constant/loss behaviour in high energy 238U (11.6 MeV/n) ion irradiated poly (P-hydroxy benzoic acid-co-ethylene terephthalate) PET/ x.PHB (x is the molar concentration) has been investigated. The observations were made at temperature ranging from 20 to 250 degC at the frequencies 120Hz, 1kHz, 10kHz and 100kHz by using Keithley precession LCZ meter. PET rich phase has been affected drastically by high energy heavy ion irradiation as the dielectric constant is suppressed in contrast to sharp increase in dielectric constant between 40 to 100 degC in pristine PET. The appearance of few kinks in the low temperature region due to decomposition of carboxyl group is evident in high energy heavy ion irradiated 0.7 PHB. (author)

  11. Nuclear model calculation on neutron induced fission fragment mass yields of 238U

    International Nuclear Information System (INIS)

    The fission fragment mass yield is one of the most important characteristics of the fission process in both applications and basic nuclear physics. In nuclear energy applications, the configuration of fission products must be known because they are accumulated during the operation of a nuclear reactor. In theoretical physics, the ability to describe and predict fission yields is required for an effective nuclear fission model. Since the nuclear fission process is described by a great number of parameters, and the existing theoretical models fail to describe the fission process completely, the fission yields are amongst the most important consequences to benchmark the validity of fission models. In the present study, two different approaches to predict the neutron-induced fission fragment mass distribution of 238U has been applied. The first approach is temperature dependent Brosa model, and the other based on GEF model. The model-based predicted results are in good agreement with the experimental data

  12. Angular Distributions of U238 Fission Fragments Produced by Mono-Energetic Gamma Rays

    International Nuclear Information System (INIS)

    The angular distribution of U238 fission fragments has been measured using mica plates as detectors. The fission process was induced by mono-energetic gamma rays of the following discrete energies: 6.07, 6.75, 6.80, 7.38, 7.64, 7.73 and 9.00 MeV. The sources of mono-energetic gamma-rays were (n, γ ) reactions on seven different target elements in the SAPHIR reactor of the E.T.H. in Zurich. The gamma-ray line absolute intensities were of the order of 106 photons/cm2s. The neutron and gamma-ray backgrounds were estimated with a bismuth target. (author)

  13. Effect of storage temperature on self-irradiation damage of 238Pu-substituted zirconolite

    International Nuclear Information System (INIS)

    238Pu-substituted cubic zirconolite (CaPuTi2O7) was stored at ambient temperature, 5750 K, and 8750 K until alpha decay doses of 2.4 to 3.6 x 1025/m3 had been accumulated. The ambient temperature material swelled to a saturation value of 5.5 vol %, and the originally crystalline structure was transformed to one with an amorphous matrix and small domains that had retained their crystallinity. At 5750 K, lesser amounts of swelling (4.1 vol %) and transformation were observed, reflecting concurrent partial recovery. The material held at 8750 K remained crystalline, swelled only 0.4 vol %, and exhibited formation of isolated defect clusters. 5 figures

  14. An evaluation of alternate production methods for Pu-238 general purpose heat source pellets

    Energy Technology Data Exchange (ETDEWEB)

    Mark Borland; Steve Frank


    For the past half century, the National Aeronautics and Space Administration (NASA) has used Radioisotope Thermoelectric Generators (RTG) to power deep space satellites. Fabricating heat sources for RTGs, specifically General Purpose Heat Sources (GPHSs), has remained essentially unchanged since their development in the 1970s. Meanwhile, 30 years of technological advancements have been made in the applicable fields of chemistry, manufacturing and control systems. This paper evaluates alternative processes that could be used to produce Pu 238 fueled heat sources. Specifically, this paper discusses the production of the plutonium-oxide granules, which are the input stream to the ceramic pressing and sintering processes. Alternate chemical processes are compared to current methods to determine if alternative fabrication processes could reduce the hazards, especially the production of respirable fines, while producing an equivalent GPHS product.

  15. 238Pu and 239+240Pu activities in lower Rhone valley in cultivated soils

    International Nuclear Information System (INIS)

    Measured 238Pu and 239+240Pu activities in French soils can be explained by the fallout from atmospheric nuclear tests and the disintegration of a US nuclear reactor satellite in 1964. However, some soil samples from the lower Rhone valley show higher mass activities, due to the Marcoule nuclear fuel reprocessing plant discharges. Soil samples from the Camargue, flooded in 1993 and 1994, where Rhone River sediments have been deposited, contain Pu from liquid effluents released by the nuclear plant. Seven samples taken near the nuclear facility show a direct influence by its atmospheric releases. Samples from soils irrigated with Rhone River water for 30 years do not show any activity significantly higher than regional means. (authors)

  16. The hard X-ray shortages prompted by the clock bursts in GS 1826-238

    International Nuclear Information System (INIS)

    We report on a study of GS 1826-238 using all available Rossi X-Ray Timing Explorer observations, concentrating on the behavior of the hard X-rays during type-I bursts. We find a hard X-ray shortage at 30-50 keV prompted by the shower of soft X-rays coming from type-I bursts. This shortage happens with a time delay after the peak of the soft flux of 3.6 ± 1.2 s. The behavior of hard X-rays during bursts indicates cooling and reheating of the corona, during which a large amount of energy is required. We speculate that this energy originates from the feedback of the type-I bursts to the accretion process, resulting in a rapid temporary increase of the accretion rate.

  17. Analysis of (n,2n) cross-section measurements for nuclei up to mass 238

    International Nuclear Information System (INIS)

    All suitable measurements of the energy dependence of (n,2n) cross sections of all isotopes up to mass 238 have been analyzed. The objectives were to display the quality of the measured data for each isotope and to examine the systematic dependence of the (n,2n) cross section upon N, Z, and A. Graphs and tables are presented of the ratio of the asymptotic (n,2n) and nonelastic cross section to the neutron-asymmetry parameter (N--Z)/A. Similar data are presented for the derived nuclear temperature, T, and level-density parameter, α, as a function of N, Z, and A. This analysis of the results of over 145 experiments on 61 isotopes is essentially a complete review of the current status of (n,2n) cross-section measurements

  18. Charge-stripping system for 238U ion beam with recirculating He gas

    International Nuclear Information System (INIS)

    Recent developments in a charge-stripping system employing high-flow rate He gas circulation (∼200 L/min) for 238U35+ beams injected at 10.8 MeV/u are reported. He gas is confined in a target section and is separated from a vacuum duct using five-stage differentially-pumped sections. To minimize the gas leakage rate via beam apertures, a high-performance differential pumping was required. To avoid huge gas consumption, a clean gas recycling with high-flow rate was simultaneously required. To realize these, we developed multi-stage mechanical booster pump array. The recycling rate of He gas was achieved as more than 99 %. The system performance has been checked with the present maximum beam current up to 13 eμA (∼1 kW beam power). (author)

  19. Environmental aspects of the transuranics: a selected, annotated bibliography. [Pu-238, Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Ensminger, J.T.; Martin, F.M.; Fore, C.S. (comps.)


    This eighth published bibliography of 427 references is compiled from the Nevada Applied Ecology Information Center's Data Base on the Environmental Aspects of the Transuranics. The data base was built to provide information support to the Nevada Applied Ecology Group (NAEG) of ERDA's Nevada Operations Office. The general scope covers environmental aspects of uranium and the transuranic elements, with emphasis on plutonium. This bibliography highlights literature on plutonium 238 and 239 and americium in the critical organs of man and animals. Supporting information on ecology of the Nevada Test Site and reviews and summarizing literature on other radionuclides have been included at the request of the NAEG. The references are arranged by subject category with leading authors appearing alphabetically in each category. Indexes are provided for author(s), geographic location, keyword(s), taxon, title, and publication description.

  20. Measurement of capture cross sections of 238U on the filtered keV-neutron beams

    International Nuclear Information System (INIS)

    Capture cross sections for the 238U(n,γ) reaction were measured related to that of the 197Au(n,γ) reaction on the filtered keV-neutron beams at the Dalat reactor using the activation method. Radioactivities of samples after irradiation were measured with HPGe detectors (50 mm2 sensitive area, FWHM = 150 eV for 55Fe and 70 cc volume, FWHM = 2.5 keV at 1332 keV γ-transition of 60Co). The data obtained by the authors were compared with the evaluations in ENDF/B-VI and JEF-2 and also with the results from recent experimental works. (author). 12 refs, 1 fig., 4 tabs

  1. Dose-to-the-population exposure estimates for use of plutonium-238-powered artificial hearts

    International Nuclear Information System (INIS)

    Estimates of dose to the population from 238Pu-powered artificial hearts were developed using a calculational model called REPRIEVE. This model develops the projected user population by incorporating assumptions regarding future heart disease death rates, the fraction dying who would be eligible candidates for artificial hearts, population projections, beginning implant rates, death rates after implant due to natural causes, and deaths caused by device failure. The user population was characterized by age, sex, household description, employment status and occupation. Census data on household descriptions and special surveys in selected cities provided the information necessary to describe persons exposed during both household and public activities. These surveys further defined distance and time of contact factors for these persons. Calculations using a dosemetry computer code defined the relationships between distance and dose. The validity of these calculations has been substantiated by experimental measurements

  2. Two-phonon giant resonances in 136Xe, 208Pb, and 238U

    International Nuclear Information System (INIS)

    The excitation of the double-phonon giant dipole resonance was observed in heavy projectile nuclei impinging on targets of high nuclear charge with energies of 500-700 MeV/nucleon. New experimental data are presented for 136Xe and 238U together with further analysis of earlier data on 208Pb. Differential cross sections dσ/dE* and dσ/dθ for electromagnetic excitations were deduced. Depending on the isotope, cross sections appear to be enhanced in comparison to those expected from a purely harmonic nuclear dipole response. The cumulative effect of excitations of two-phonon states composed of one dipole and one quadrupole phonon, of predicted anharmoniticies in the double-phonon dipole response, and of damping of the dipole resonance during the collision may account for the discrepancy. In addition, decay properties of two-phonon resonances were studied and compared to that of a statistical decay. (orig.)

  3. Charge stripping of U238 ion beam by helium gas stripper (United States)

    Imao, H.; Okuno, H.; Kuboki, H.; Yokouchi, S.; Fukunishi, N.; Kamigaito, O.; Hasebe, H.; Watanabe, T.; Watanabe, Y.; Kase, M.; Yano, Y.


    Development of a nondestructive, efficient electric-charge-stripping method is a key requirement for next-generation high-intensity heavy-ion accelerators such as the RIKEN Radioactive-Isotope Beam Factory. A charge stripper employing a low-Z gas is an important candidate applicable to high-intensity uranium beams for replacing carbon-foil strippers. In this study, a high-beam-transmission charge-stripping system employing helium gas for U238 beams injected at 10.8MeV/u was developed and demonstrated for the first time. The charge-state evolution measured using helium in a thickness range of 0.24-1.83mg/cm2 is compared with theoretical predictions. Energy attenuation and energy spread due to the helium stripper are also investigated.

  4. Structural analysis of a completely amorphous 238Pu-doped zircon by neutron diffraction

    International Nuclear Information System (INIS)

    The structure of a completely amorphous zircon was determined by time-of-flight neutron diffraction at Argonne's Intense Pulsed Neutron Source (IPNS). The sample of metamict zircon (ZrSiO4),initially doped to 8.85 weight percent 238Pi, had been completely amorphized by alpha-recoil damage since its synthesis in 1981 at the Pacific Northwest National Laboratory (PNNL). The measured diffraction structure factor, S(Q), indicated a completely amorphous sample, with no signs of residual zircon microcrystallinity. The pair distribution function obtained indicated that the structure was that of an oxide glass, retaining the Si-0, Zr-0, and O-O bond lengths of crystalline zircon

  5. Structural analysis of a completely amorphous 238Pu-doped zircon by neutron diffraction

    International Nuclear Information System (INIS)

    The structure of a completely amorphous zircon was determined by time-of-flight neutron diffraction at Argonne's Intense Pulsed Neutron Source (IPNS). The sample of metamict zircon (ZrSiO4), initially doped to 8.85 wt.% 238Pu, had been completely amorphized by alpha-recoil damage since its synthesis in 1981 at the Pacific Northwest National Laboratory (PNNL). The measured diffraction structure factor, S(Q), indicated a completely amorphous sample, with no signs of residual zircon micro-crystallinity. The pair distribution function obtained indicated that the structure was that of an oxide glass, retaining the Si-O, Zr-O, and O-O bond lengths of crystalline zircon

  6. Tests of the 238U+n evaluation for JEF-2 in the unresolved resonance region

    International Nuclear Information System (INIS)

    During the JEF-2 test phase the new evaluation for 238U+n in the unresolved resonance region (adopted for JEF-2 up to 200 keV, for ENDF/B-VI up to 149 keV) has been checked against recent capture cross section measurements and against thick-sample transmission data and capture self-indication ratios. Effects of the unresolved resonance structure on self-shielding and multiple scattering were treated by Monte Carlo techniques based on resonance statistics and average resonance parameters. It was found that the average cross sections and the average resonance parameters given in the new evaluation permit very satisfactory reproduction of all the test data. The resonance-averaged capture cross sections below 200 keV appear now to be known with roughly 2% uncertainty. (orig.)

  7. Microstructural damage produced by helium release from 238PuO2 pellets

    International Nuclear Information System (INIS)

    Grain separations and larger holes found in 90 percent-dense 238PuO2 pellets heated after aging indicated the pellets did not have sufficient interconnected porosity to release helium without microstructural damage. In contrast, 80 percent-dense pellets showed grain separations due to helium in only a few high-density regions. The damage in the 80 percent-dense pellets became evident after about 6 months aging and increased with increasing aging time. Confinement of the damage to the interiors of the high-density regions suggested a depletion of helium at the edges, possibly caused by grain boundary diffusion in the small-grained oxide at temperatures below thresholds for grain separation. 14 figs

  8. Studies of positron electron pair production in {sup 238}U + {sup 181}Ta

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, I.; Back, B.B.; Betts, R.R. [and others


    Following the completion of APEX in late 1993, a two-week run on the {sup 238}U + {sup 181}Ta system at 6.1 and 6.3 MeV/u with 1 mg/cm{sup 2} targets provided, for the first time, data in which the expected sharp sum-energy lines should appear. Data from previous experiments show evidence for sharp sum-energy lines at 625, 748 and 805 keV, observed at bombarding energies from 5.9 to 6.3 MeV/u. The 625- and 809-keV lines display the characteristics of equal-energy back-to-back emission whereas the 748-keV line shows a rather different behavior. In our measurements, average beam currents of 2-3 pnA from the ATLAS accelerator were used to bombard 1-mg/cm{sup 2} rolled {sup 181}Ta targets, the energy loss in which corresponds to the ranges of bombarding energies over which the sharp sum-energy lines were previously reported. A run at 5.95 MeV/u for {sup 238}U + {sup 181}Ta followed in May 1994. These data were analyzed extensively. Sum-energy spectra measured in coincidence with scattered ions in the range 20{degrees} < {theta} < 68{degrees}. No evidence is found for the sharp sum-energy lines reported previously and, depending on the scenario assumed for the production mechanism and kinematics of the pairs, upper limits on cross sections at the 90% confidence limit range from 10-100 times smaller than the values that can be deduced from the earlier reports. We are in the process of refining the data analysis and simulations of the apparatus in order to finalize these numbers for publication.

  9. 238 U, 232 Th and 40 K in wheat flour samples of Iraq markets

    Directory of Open Access Journals (Sweden)

    Ali Abid Abojassim


    Full Text Available Introduction. Wheat flour is a nutritious type of food that is widely consumed by various age groups in Iraq. This study investigates the presence of long-lived gamma emitters in different type of wheat flour in Iraqi market. Materials and methods. Uranium (238 U, Thorium (232 Th and Potassium (40 K specific activity in (Bq/kg were measured in (12 different types of wheat flours that are available in Iraqi markets. The gamma spectrometry method with a NaI(Tl detector has been used for radiometric measurements. Also in this study we have calculated the internal hazard index, radium equivalent and absorbed dose rate in all samples. Results and discussion. It is found that the specific activity in wheat flour samples were varied from (1.086±0.0866 Bq/kg to (12.532±2.026 Bq/kg with an average (6.6025 Bq/kg for 238 U, For 232 Th From (0.126±0.066 Bq/kg to (4.298±0.388 Bq/kg with an average (1.9465Bq/kg and for 40 K from (41.842±5.875 Bq/kg to (264.729±3.843 Bq/kg with an average (133.097 Bq/kg. Also, it is found that the radium equivalent and the internal hazard index in wheat flour samples ranged from (3.4031 Bq/kg to (35.1523 Bq/kg with an average (19.6346 Bq/kg and from (0.0091 to (0.1219 with an average (0.0708 respectively. Conclusion. This study prove that the natural radioactivity and radiation hazard indices were lower than the safe.

  10. Neutron capture cross section measurements for 238U in the resonance region at GELINA (United States)

    Kim, H. I.; Paradela, C.; Sirakov, I.; Becker, B.; Capote, R.; Gunsing, F.; Kim, G. N.; Kopecky, S.; Lampoudis, C.; Lee, Y.-O.; Massarczyk, R.; Moens, A.; Moxon, M.; Pronyaev, V. G.; Schillebeeckx, P.; Wynants, R.


    Measurements were performed at the time-of-flight facility GELINA to determine the 238U(n, γ) cross section in the resonance region. Experiments were carried out at a 12.5 and 60m measurement station. The total energy detection principle in combination with the pulse height weighting technique was applied using C6D6 liquid scintillators as prompt γ-ray detectors. The energy dependence of the neutron flux was measured with ionisation chambers based on the 10B(n, α) reaction. The data were normalised to the isolated and saturated 238U resonance at 6.67 eV. Special procedures were applied to reduce bias effects due to the weighting function, normalization, dead time and background corrections, and corrections related to the sample properties. The total uncertainty due to the weighting function, normalization, neutron flux and sample characteristics is about 1.5%. Resonance parameters were derived from a simultaneous resonance shape analysis of the GELINA capture data and transmission data obtained previously at a 42m and 150m station of ORELA. The parameters of resonances below 500 eV are in good agreement with those resulting from an evaluation that was adopted in the main data libraries. Between 500 eV and 1200 eV a systematic difference in the neutron width is observed. Average capture cross section data were derived from the experimental capture yield in the energy region between 3.5 keV and 90 keV. The results are in good agreement with an evaluated cross section resulting from a least squares fit to experimental data available in the literature prior to this work. The average cross section data derived in this work were parameterised in terms of average resonance parameters and included in a least squares analysis together with other experimental data reported in the literature.

  11. 238 U, 232 Th and 40 K in wheat flour samples of Iraq markets

    Directory of Open Access Journals (Sweden)

    A. A.


    Full Text Available Introduction. Wheat flour is a nutritious type of food that is widely consumed by various age groups in Iraq. This study investigates the presence of long-lived gamma emitters in different type of wheat flour in Iraqi market. Materials and methods. Uranium ( 238 U, Thorium ( 232 Th and Potassium ( 40 K specific activity in (Bq/kg were measured in (12 different types of wheat flours that are available in Iraqi markets. The gamma spectrometry method with a NaI(Tl detector has been used for radiometric measurements. Also in this study we have calculated the internal hazard index, radium equivalent and absorbed dose rate in all samples. Results and discussion. It is found that the specific activity in wheat flour samples were varied from (1.086±0.0866 Bq/kg to (12.532±2.026 Bq/kg with an average (6.6025 Bq/kg for 238 U, For 232 Th From (0.126±0.066 Bq/kg to (4.298±0.388 Bq/kg with an average (1.9465Bq/kg and for 40 K from (41.842±5.875 Bq/kg to (264.729±3.843 Bq/kg with an average (133.097 Bq/kg. Also, it is found that the radium equivalent and the internal hazard index in wheat flour samples ranged from (3.4031 Bq/kg to (35.1523 Bq/kg with an average (19.6346 Bq/kg and from (0.0091 to (0.1219 with an average (0.0708 respectively. Conclusion. This study prove that the natural radioactivity and radiation hazard indices were lower than the safe.

  12. 234Th/238U disequilibrium and particulate organic carbon export in the northern South China Sea

    International Nuclear Information System (INIS)

    We utilized 234Th, a naturally occurring radionuclide, to quantify the particulate organic carbon (POC) export rates in the northern South China Sea (SCS) based on data collected in July 2000 (summer), May 2001 (spring) and November 2002 (autumn). Th-234 deficit was enhanced with depth in the euphotic zone, reaching a sub-surface maximum at the Chl-a maximum in most cases, as commonly observed in many oceanic regimes. Th-234 was in general in equilibrium with 238U at a depth of ∼100 m, the bottom of the euphotic zone. In this study the 234Th deficit appeared to be less significant in November than in July and May. A surface excess of 234Th relative to 238U was found in the summer over the shelf of the northern SCS, most likely due to the accumulation of suspended particles entrapped by a salinity front. Comparison of the 234Th fluxes from the upper 10 m water column between 2-D and traditional 1-D models revealed agreement within the errors of estimation, suggesting the applicability of the 1-D model to this particular shelf region. 1-D model-based 234Th fluxes were converted to POC export rates using the ratios of bottle POC to 234Th. The values ranged from 5.3 to 26.6 mmol C m-2d-1 and were slightly higher than those in the southern SCS and other oligotrophic areas. POC export overall showed larger values in spring and summer than in autumn, the seasonality of which was, however, not significant. The highest POC export rate (26.6 mmol C m-2d-1) appeared at the shelf break in spring (May), when Chl-a increased and the community structure changed from pico-phytoplankton (<2 μm) dominated to nano-phytoplankton (2-20 μm) and micro-phytoplankton (20-200 μm) dominated. (author)

  13. Application of Energy Window Concept in Doppler Broadening of 238U Cross Section

    International Nuclear Information System (INIS)

    Currently, the NJOY code is used for construction and Doppler broadening of microscopic cross sections. There exist several methods or formalisms to produce microscopic cross sections and there are also different methods of Doppler broadening. In this paper, Multi-Level Breit-Wigner (MLBW) formalism and the Psi method are used for generation and Doppler broadening of the resonance cross section. Accuracy of the energy window concept applied MLBW (EW MLBW) Doppler broadened cross section was compared with that of the cross section generated by conventional MLBW (Con MLBW) formalism for 238U isotope using MATLAB. The conventional method requires Doppler broadening of all resonances, including resonances far from the target energy point, which do not change much with respect to the temperature change. The energy window concept makes Doppler broadening possible with a smaller number of resonances neighboring to the energy point we are interested in, and just adds up 0 K temperature cross sections of other resonances. Multi-level Breit-Wigner formalism and the Doppler broadening method were used to construct microscopic cross sections of 238U at different temperatures. The energy window concept was applied only for the 1st resonance energy region (4.5∼11.2 eV). The energy window concept demonstrates high competitiveness because the relative differences were less than 0.0016% for all types of cross sections. The advantage of the energy window concept is that the number of resonances broadened for every energy point is significantly reduced, which allows a reduction of computation time by almost 45 % of Doppler broadening time of the cross section generation at temperatures higher than 0 K

  14. Development of an active 238uranium(VI)-fluoride detector chamber for precision experiments in photon-induced fission at the S-DALINAC

    International Nuclear Information System (INIS)

    The polarized injector SPIN at the S-DALINAC provides spin polarized electrons for circularly polarized bremsstrahlung with a high degree of polarization near the endpoint energy of the spectrum, enabling the search for forward-backward asymmetries of the light and heavy fission fragment originating from parity non-conservation in the photon-induced fission process of 238U. An active 238uranium(VI)-fluoride gas target has been developed along the lines of a simple Frisch grid ionization chamber to raise the luminosity and to study the properties of an 238uranium(VI)-fluoride/argon gas mixture. The active 238uranium(VI)-fluoride gas target has been filled with argon and 238uranium(VI)-fluoride using mass flow controllers. At different settings data has been acquired and interpreted. Instantly after filling the chamber with some 238uranium(VI)-fluoride the anode and cathode signal are severely lowered and gain only slowly. Apparently the 238uranium(VI)-fluoride acts as a very efficient electron collector because of its complexity and the high amount of fluorine and its electronegativity. Over time, the amount of gaseous 238uranium(VI)-fluoride is reduced and different processes are possible to explain this effect. In the present configuration of the active 238uranium(VI)-fluoride gas target no sound quantitative information on the properties of an 238uranium(VI)-fluoride/argon gas mixture can be given. Raising the luminosity for precision experiments in photon-induced fission at the S-DALINAC with an active 238uranium(VI)-fluoride gas target appears to be impossible.

  15. Final report on production of Pu-238 in commercial power reactors: target fabrication, postirradiation examination, and plutonium and neptunium recovery

    International Nuclear Information System (INIS)

    Considerable interest has been generated in more extensive applications of radioisotope thermoelectric generator (RTG) systems. This raises questions concerning the availability of 238Pu to supply an expanding demand. The development of much of this demand will depend upon a considerable reduction in cost of 238Pu. Two neptunia--zirconia--fuel target rods, containing four sections each of different NpO2 concentrations, were irradiated in the Connecticut Yankee Reactor for approximately one year. Following irradiation both target rods were subjected to nondestructive examination. One rod was chosen for destructive testing and analysis. Post-irradiation chemical analyses included total Pu and Np, ppM 236Pu/238Pu, and Pu isotopic abundance. The results of these analyses and of electron microprobe analysis which provided the relative Pu concentration across the pellet diameters are tabulated. It was concluded that the feasibility of all operations involved in the production of 238Pu by irradiation of 237NpO2 targets in commercial nuclear power reactors was demonstrated and that the demonstration should be extended to a pilot-scale leading to installation of a full production capacity. (U.S.)

  16. Time-dependent Hartree-Fock calculations for multinucleon transfer and quasifission processes in the 238U+64Ni reaction (United States)

    Sekizawa, Kazuyuki; Yabana, Kazuhiro


    Background: Multinucleon transfer (MNT) and quasifission (QF) processes are dominant processes in low-energy collisions of two heavy nuclei. They are expected to be useful to produce neutron-rich unstable nuclei. Nuclear dynamics leading to these processes depends sensitively on nuclear properties such as deformation and shell structure. Purpose: We elucidate reaction mechanisms of MNT and QF processes involving heavy deformed nuclei, making detailed comparisons between microscopic time-dependent Hartree-Fock (TDHF) calculations and measurements for the 238U+64Ni reaction. Methods: Three-dimensional Skyrme-TDHF calculations are performed. Particle-number projection method is used to evaluate MNT cross sections from the TDHF wave function after collision. Results: Fragment masses, total kinetic energy (TKE), scattering angle, contact time, and MNT cross sections are investigated for the 238U+64Ni reaction. They show reasonable agreements with measurements. At small impact parameters, collision dynamics depends sensitively on the orientation of deformed 238U. In tip (side) collisions, we find a larger (smaller) TKE and a shorter (longer) contact time. In tip collisions, we find a strong influence of quantum shells around 208Pb. Conclusions: It is confirmed that the TDHF calculations reasonably describe both MNT and QF processes in the 238U64Ni reaction. Analyses of this system indicate the significance of the nuclear structure effects such as deformation and quantum shells in nuclear reaction dynamics at low energies.

  17. The effect of the 238U neutron strength function uncertainty on resonance structure calculations in unresolved regions

    International Nuclear Information System (INIS)

    The effects of the neutron strength function uncertainties on the calculated values of the self-shielding factors and energy dependence of the total and capture 238U cross-sections in the unresolved resonance region are investigated. (author). 26 refs, 5 figs

  18. Feasibility study of measuring the 238U fission rates by neutrons of 14 MeV in specifical experiment condition

    International Nuclear Information System (INIS)

    Using uranium fission chambers of minitype slab in the case of 14 MeV neutrons penetrating through the special experiment model, the pure 238U absolute fission rates are measured. Comparing the measurement results with and without reflect shell, the reflect coefficient of shell is gained. The calculate results are compared with experiment results, to prove the model calculate method and parameter. (author)

  19. Concentration of 238U and 232Th among constituent minerals of two igneous plutonic rocks exhibiting elevated natural radioactivity levels

    International Nuclear Information System (INIS)

    The concentrations of 238U and 232Th of the constituent minerals in two plutonic rock samples, from N. Greece, exhibiting elevated levels of bulk rock natural radioactivity were determined by using LA-ICP-MS. The available data of whole rock 238U and 232Th concentrations were also used. The minerals were separated using a combination of heavy liquids of various densities, shaking table and magnetic separation techniques. The great variation in the concentrations of 238U and 232Th is probably indicative of the different distribution of U and Th within the same rock, as well as to secondary post-magmatic processes that were responsible for the redistribution of U and Th. An estimation of the contribution of each mineral constituent to the natural radioactivity levels of the bulk rock is attempted. Thorite and zircon contribute the most to the whole rock 238U and 232Th content, while the contribution of apatite is moderate. The contribution of the rest of the minerals examined (fluorite, quartz, plagioclase, K-feldspar, amphibole, pyroxene, magnetite and biotite) is not important. (author)

  20. Measurement of Fragment Mass Distributions in Neutron-induced Fission of 238U and 232Th at Intermediate Energies

    International Nuclear Information System (INIS)

    Conceptual analysis of accelerator-driven systems assumes extensive use of nuclear data on neutron-induced reactions at intermediate energies. In particular, information about the fission fragment yields from the 238U(n,f) and 232Th(n,f) reactions is of particular interest at neutron energies from 10 to 200 MeV. However, there is a lack of such data for both 238U and 232Th. Up to now, the intermediate energy measurements have been performed for 238U only, and there are no data for the 232Th(n,f) reaction. The aim of the work is to provide such data. Fission fragment mass distributions for the 232Th(n,f) and 238U(n,f) reactions have been measured for the incident neutron energies 32.8 MeV, 45.3 MeV and 59.9 MeV. The experiments have been performed at the neutron beam facility of the Universite Catholique de Louvain, Belgium. A multi-section Frisch-gridded ionization chamber has been used as a fission fragment detector. The data obtained have been interpreted in terms of the multimodal random neck-rupture model (MMRNRM). (authors)

  1. A dispersive optical model potential for nucleon induced reactions on 238U nucleus with 15 coupled levels

    International Nuclear Information System (INIS)

    A new dispersive coupled-channel optical model potential (OMP) for 238U nucleus is presented. The derived OMP couples almost all 238U excited levels below 1 MeV of excitation energy, including the ground state, octupole, beta, gamma, and non-axial bands. The coupled-channel potential is based on a vibrational-rotational description of the target nucleus structure, where dynamic vibrations are considered as perturbations of the rigid rotor underlying structure. OMP parameters that show a smooth energy dependence and energy independent geometry were determined from fits to the available experimental database (including strength functions and scattering radius) for neutron and proton scattering. The energy range 0.001-200 MeV is covered. Derived high-quality OMP is used to calculate the reaction cross section and corresponding theoretical uncertainties in nucleon-induced reactions on U-238. Theoretical calculations are compared with available results derived from existing experimental data on total cross-sections and angular distributions measurements based on the Wick's limit. Reduction of the uncertainty of the calculated reaction cross-section for neutron-induced reactions on 238U is discussed. (author)

  2. U-238, Th-232, K-40 along the main 3 km adit of the Baksan Neutrino Observatory

    International Nuclear Information System (INIS)

    Results of the U-238, Th-232, K-40 contents in the mountain rock samples along 3 km adit of the Baksan Neutrino Observatory are presented. Recommendations on selection of suitable site for the low-background underground laboratory are given

  3. Field analyses of 238U and 226Ra in two uranium mill tailings piles from Niger using portable HPGe detector

    International Nuclear Information System (INIS)

    The radioactivities of 238U and 226Ra in mill tailings from the U mines of COMINAK and SOMAÏR in Niger were measured and quantified using a portable High-Purity Germanium (HPGe) detector. The 238U and 226Ra activities were measured under field conditions on drilling cores with 600s measurements and without any sample preparation. Field results were compared with those obtained by Inductive Coupled Plasma Atomic Emission Spectroscopy (ICP-AES) and emanometry techniques. This comparison indicates that gamma-ray absorption by such geological samples does not cause significant deviations. This work shows the feasibility of using portable HPGe detector in the field as a preliminary method to observe variations of radionuclides concentration with the aim of identifying samples of interest. The HPGe is particularly useful for samples with strong secular disequilibrium such as mill tailings. - Highlights: • A portable HPGe was used in the field to quantify 238U and 226Ra in mill tailings. • 238U and 226Ra quantification was performed on samples with strong radioactive disequilibrium. • HPGe measurements are compared with results obtained on the same samples by ICP-AES and emanometry. • We show the vertical distributions of U and 226Ra measured in two ∼30 m mill tailings piles. • Portable HPGe can be used directly in the field to observe slight variations of content

  4. Cross sections of barium isotopes in the interaction of 60 MeV/nucleon 18O with 238U

    International Nuclear Information System (INIS)

    Barium isotopes were produced by 60 MeV/u 18O ion bombardment of natural uranium via 238U (18O, X) reactions. Ba sources were prepared by radiochemical separation, and measured by a HPGe detector. The cumulative cross sections were obtained by analysis of measured time sequence γ-ray spectra. A double peak phenomenon in Ba isotope distribution was observed. (author)

  5. Speciation of 226Ra, 238U and 228Ra in an upland organic soil overlying a uraniferous granite

    International Nuclear Information System (INIS)

    A sequential chemical extraction procedure was implemented in order to ascertain the chemical speciation of 226Ra, 238U and 228Ra within fractions of an upland organic soil. A number of samples and depth cores were taken from a region where the soil contains elevated levels of these radionuclides. Sequential chemical extractions were employed to identify within which of the three soil phases, namely exchangeable cations, easily oxidisable organic matter or iron oxides, the radionuclides were incorporated. The primary analytical technique was high-resolution gamma ray spectrometry. A number of other chemical parameters likely to affect the mode of occurrence of the radionuclides were also analysed. These included humic acid content, iron and manganese content and cation exchange capacity. Results indicate that the average amount of radionuclides bound as exchangeable cations, expressed as a percentage of the specific activities of each radionuclide, are: 226Ra - 2.13% (S.D. 2.15), 238U - 5.2% (S.D. 4.6) and 228Ra - 12.2% (S.D. 7.0). For easily oxidisable organic matter, the average percentages are: 236Ra - 3.2% (S.D. 3.2), 238U - 21.9% (S.D. 18.4), and 228Ra - 8.5% (S.D. 8.7). Percentages for iron oxides are 226Ra - 8.7% (S.D. 7.5), 238U - 54.8% (S.D. 22.2) and 228Ra - 19.7% (S.D. 12.9). N equals 17 in all cases. The results indicate that the primary factor controlling U238 accumulation, and to a lesser extent 226Ra and 228Ra, is the redox condition of the peat. Release of radionuclides from the peat could possibly occur via changes in the redox status as a result of activities such as forestry or drainage of the peat. (orig.)

  6. The analysis of U in a Korean total diet sample by 238Np tracer and RNAA

    International Nuclear Information System (INIS)

    In order to estimate the degree of intake of U through daily diet, a Korean total diet sample was prepared after the investigation of the amount of consumption of daily diet which is dependent on the age of 20's to 50's. For the analysis of U, RNAA method was applied and NIST SRM 1566a, Oyster Tissue was used as a quality control material. The result of SRM analysis was compared with certified value, the relative error was 15%. The determination of U in a Korean total diet sample was carried out under the same analytical condition and procedure with SRM. It is found that the concentration of U in synthetic Korean total diet was 35.4 ± 4.4 ppb and the amount of daily intake of 238U by diet is 6.98 μg per day. Radioactivity due to the intake of U was estimated to be about 86.7 mBq per person per day and the annual dose equivalent was revealed as 2.11 μSv per person

  7. Chandra and RXTE Spectra of the Burster GS 1826-238

    CERN Document Server

    Thompson, T W J; Tomsick, J A; Marshall, H L


    Using simultaneous observations from Chandra and RXTE, we investigated the LMXB GS 1826-238 with the goal of studying its spectral and timing properties. The uninterrupted Chandra observation captured 6 bursts (RXTE saw 3 of the 6), yielding a recurrence time of 3.54 +/- 0.03 hr. Using the proportional counter array on board RXTE, we made a probable detection of 611 Hz burst oscillations in the decaying phases of the bursts with an average rms signal amplitude of 4.8%. The integrated persistent emission spectrum can be described as the dual Comptonization of ~ 0.3 keV soft photons by a plasma with kT_e ~ 20 keV and an optical depth of about 2.6 (interpreted as emission from the accretion disk corona), plus the Comptonization of hotter ~ 0.8 keV seed photons by a ~ 6.8 keV plasma (interpreted as emission from or near the boundary layer). We discovered evidence for a neutral Fe K\\alpha emission line, and we found interstellar Fe L_II and Fe L_III absorption features. The burst spectrum can be fit by fixing the ...

  8. Derivation of ingestion dose conversion factors for the U-238 decay series

    International Nuclear Information System (INIS)

    Dose conversion factors (DCF's) for the U-238 decay series were derived for use in the assessment of potential doses to man, through several ingestion pathways, by radionuclide deposition from radioactive airborne effluents. The methodology used, although similar to that outlined in the U.S. Nuclear Regulatory Commission's Regulatory Guide 1.109, is complicated by consideration of the ingrowth of decay products. Eight ingestion pathways were considered: (1) fresh vegetables, (2) stored vegetables, (3) milk from cows that eat pasture grass, (4) milk from cows that eat stored feed, (5) goat milk - pasture grass, (6) goat milk - stored feed, (7) beef - pasture grass, and (8) beef - stored feed. Radionuclide deposition was assumed to occur for the entire operational lifetime of the facility. Because the expected operational lifetime may vary from facility to facility, DCF's were calculated for six lifetimes: 10, 15, 20, 25, 30, and 35 years. DCF's were calculated for each of 13 'parent' nuclides in the decay series, with each DCF considering the ingrowth of all subsequent nuclides in the series. The methodology used to derive the DCF's is detailed, and DCF's normalized to a deposition rate of the parent nuclide of 1 μCi m-2 s-1 are reported. (author)

  9. Determination of the isotopic ratio 235U/238U in UF6 using quadrupole mass spectrometry

    International Nuclear Information System (INIS)

    In this work measurements of isotope ratios 235U / 23'8U in uranium hexafluoride are carried out using a quadrupole mass spectrometer. The operational parameters, which affect the final precision of the results, are standardized. Optimized procedures for the preparation of uranium hexafluoride samples by fluorination of uranium oxides using cobalt trifluoride method are established. Careful attention is given to the process of purification of uranium hexafluoride samples by fractional distillation. Adequate statistical methods for analysing the results obtained for single ratio measurements as well as the ratio ' of isotopic ratios of sample and standard ar.e developed. A precision of about 10-4 for single ratio measurements and accuracy of about 0,3% for the ratio of sample and standard ratios are obtained. These results agree with the values which have been obtained using magnetic mass spectrometers. The procedures and methods established in this work can be employed in the systematic uranium isotope analysis in UF6 form. (author)

  10. Evaluation of correlating factors between 238U concentration measured in fine and course atmospheric particles

    International Nuclear Information System (INIS)

    Air quality is ever more important in function of the enormous proportion of human actions that have affected the environment over the last two centuries. Particulate material is one among many pollutants that can cause great risk to human health and the environment. It can be classified as: Total Suspended Particles (TSP), defined simply as particles with less than 50 μm aerodynamic diameter (one group of these particles can be inhaled and may cause health problems, while others may unfavorably affect the population's quality of life, interfering in environmental conditions and impairing normal community activities); and Inhalable Particles (PM10), defined as those particles with less than 10 μm aerodynamic diameter. These particles penetrate the respiratory system and can reach pulmonary alveoli due to their small size, causing serious health damage. The Nuclear Technology Development Center (CDTN) has monitored air quality around its installations since 2000. CDTN's Environmental Monitoring Program (EMP) includes monitoring radioactivity levels contained in atmospheric TSP. In order to optimize its program, CDTN is carrying out a study to estimate the correlation between concentrations of particulate material measured in TSP and those measured in PM10, PI2.5 and PI1, as well as determination of activity concentration for each controlled radionuclide in all parts. The objective of this study is to present preliminary results and report 238U activity concentration results. (author)

  11. Effect of 222Rn emanation from crystals on their 206Pb/238U age dating

    International Nuclear Information System (INIS)

    The escape of radon from certain minerals with high uranium is of particular interest to those concerned with the determination of ages of rocks, minerals and tectonic events. To the extent that radon escapes, these minerals are not closed systems from the thermodynamic point of view and, more particularly, from the geochronological point of view. This investigation aimed to determine the radon escape from zircon crystals and how this fit into the severe isotopic constraints of the concordia dating model. To evaluate the consequences of radon loss on 238U/ 206Pb age dating methods, 20 zircon concentrates were analyzed. The observed range of relative percentage of radon loss was of 0.2-12 % and correlations with weathering of the crystals with natural alpha dose and with U-Pb age discordances were found. These correlations indicate relationships between the amount of lattice damage by radiation, the radon leakage out of the crystal and Pb mobility. Some of the stochastic complexities in specific age determinations are also discussed. (author)

  12. Long-term exposure of 238PuO2 to a terrestrial environment. Volume III

    International Nuclear Information System (INIS)

    A plutonium oxide source consisting of a single piece of 83% 238PuO2 and weighing 38 g was exposed for 2.9 years to a humid, temperate terrestrial environment in an environmental simulation chamber. The soil tray of the chamber was divided into four compartments so that different soil types could be studied under identical conditions. Soils examined in this experiment included loam, silt loam, sand, and humus. Plutonium released into the soils, the soil drainages, and the condensates from the dehumidifier was monitored throughout the experiment. The total plutonium release rate from the PuO2 source was approximately 2 ng/m2/s. The generation of short-ranged airborne plutonium, able to travel from a few centimeters to half a meter, was one of the most significant release pathways. The amount of plutonium released in this way was 10 times that washed directly off the source by rainwater and 20 times that from the fully airborne (longer ranged) release. Of the 200 μg of plutonium deposited in the soils, less than 0.1 μg was released into the soil percolates. In fact, the soil percolates constituted the least significant release pathway. Within the uncertainties in deriving the plutonium inventories of the soil compartments, we found no discernible differences among the behaviors of the four soil types towards plutonium. There was little or no seasonal effect on the release of plutonium from the soil

  13. Long-term exposure of (238) PuO2 to a terrestrial environment, volume 3 (United States)

    Heaton, R. C.; Patterson, J. H.; Steinkruger, F. J.; Coffelt, K. P.


    A plutonium oxide source consisting of a single piece of 83% (238)PuO2 and weighing 38 q was exposed for 2.9 years to a humid, temperate terrestrial environment in an environmental simulation chamber. The soil tray of the chamber was divided into four compartments so that different soil types could be studied under identical conditions. Soils examined in this experiment included loam, silt loam, sand, and humus. Plutonium released into the soils, the soil drainages, and the condensates from the dehumidifier was monitored throughout the experiment. The total plutonium release rate from the PuO2 source was approximately 2 ng/sq m/s. The generation of short-ranged airborne plutonium, able to travel from a few centimeters to half a meter, was one of the most significant release pathways. The amount of plutonium released in this way was 10 times that washed directly off the source by rainwater and 20 times that from the fully airborne (longer ranged) release. Of the 200 (MU)q of plutonium deposited in the soils, less than 0.1 (MU)g was released into the soil percolates.

  14. Evaluation of correlating factors between {sup 238}U concentration measured in fine and course atmospheric particles

    Energy Technology Data Exchange (ETDEWEB)

    Peixoto, Claudia Marques; Jacomino, Vanusa Maria Feliciano; Barreto, Alberto Avelar; Dias, Vagner Silva, E-mail: cmp@cdtn.b, E-mail: vmfj@cdtn.b, E-mail: aab@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Dias, Fabiana Ferrari, E-mail: [Brazilian Nuclear Energy Commission (CNEN-/MG), Pocos de Caldas, MG (Brazil). Lab. de Pocos de Caldas (LAPOC)


    Air quality is ever more important in function of the enormous proportion of human actions that have affected the environment over the last two centuries. Particulate material is one among many pollutants that can cause great risk to human health and the environment. It can be classified as: Total Suspended Particles (TSP), defined simply as particles with less than 50 mum aerodynamic diameter (one group of these particles can be inhaled and may cause health problems, while others may unfavorably affect the population's quality of life, interfering in environmental conditions and impairing normal community activities); and Inhalable Particles (PM{sub 10}), defined as those particles with less than 10 mum aerodynamic diameter. These particles penetrate the respiratory system and can reach pulmonary alveoli due to their small size, causing serious health damage. The Nuclear Technology Development Center (CDTN) has monitored air quality around its installations since 2000. CDTN's Environmental Monitoring Program (EMP) includes monitoring radioactivity levels contained in atmospheric TSP. In order to optimize its program, CDTN is carrying out a study to estimate the correlation between concentrations of particulate material measured in TSP and those measured in PM{sub 10}, PI{sub 2.5} and PI{sub 1}, as well as determination of activity concentration for each controlled radionuclide in all parts. The objective of this study is to present preliminary results and report {sup 238}U activity concentration results. (author)

  15. Long-term exposure of 238PuO2 to a terrestrial environment. Volume 2

    International Nuclear Information System (INIS)

    Two environmental simulation chambers were used to study the behavior of a 238PuO2 heat source deposited in a humid, temperate environment. Large fragments from an impact-tested source were deposited in the first chamber, and fines from the source were placed in the second. Plutonium released into the soil, the soil drainages, and the condensates from the dehumidifiers were monitored throughout the experiment. The concentration of plutonium released into the soil drainages increased with time, obeying an apparent exponential growth curve over the duration of the experiment (5.7 yr). The bulk of the released plutonium, up to 0.3% of the source, was retained in the soil. A simulated cleanup operation at the conclusion of the experiment, which included removal of the source and the top inch of soil, resulted in an increased rate of plutonium release into the soil drainage and essentially no observable change of release rate into the air. Large chunks of PuO2 deposited in one of the chambers underwent spontaneous disintegration into smaller pieces; after 2 yr the deposited material could barely be distinguished from the fines deposited in the other chamber

  16. High resolution photofission measurements in 238U and 232Th. Final report

    International Nuclear Information System (INIS)

    A novel technique for measuring the photofission cross section with very high photon energy resolution has been developed. The photons are obtained from selected resonances in the (p,γ) reaction on various light nuclei. The photon energy resolution approaches 200 eV in favorable cases. The photon energy spread at each (p,γ) resonance is approx.20 keV on the average. Measurements of the photo-fission cross sections of 232Th and 238U have been carried out in the energy range from 5.8 to 12 MeV. Intermediate structure has been found in both nuclei at excitation energies around 6 MeV. Various properties of this structure, such as average areas of resonances, their spacing, width, and the underlying bakground, as well as the experimental fission probability averaged over the intermediate structure have been found to agree with theoretical predictions based on a double-humped fission barrier. In the case of 232Th, the feature of this barrier, a rather high first hump and a deep secondary well, are quite different from those predicted by current theoretial barrier calculations. 13 refs., 4 figs., 3 tabs

  17. Standard Test Method for Measuring Reaction Rates by Radioactivation of Uranium-238

    CERN Document Server

    American Society for Testing and Materials. Philadelphia


    1.1 This test method covers procedures for measuring reaction rates by assaying a fission product (F.P.) from the fission reaction 238U(n,f)F.P. 1.2 The reaction is useful for measuring neutrons with energies from approximately 1.5 to 7 MeV and for irradiation times up to 30 to 40 years. 1.3 Equivalent fission neutron fluence rates as defined in Practice E 261 can be determined. 1.4 Detailed procedures for other fast-neutron detectors are referenced in Practice E 261. 1.5 The values stated in SI units are to be regarded as standard. No other unites of measurement are included in this standard. 1.6 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  18. Individual design of the anterolateral thigh flap for functional reconstruction after hemiglossectomy: experience with 238 patients. (United States)

    Wang, L; Liu, K; Shao, Z; Shang, Z-J


    The aim of this study was to evaluate tongue function in patients with oral cancer treated surgically and reconstructed with anterolateral thigh free flaps (ALTFs). Patients (N=238) underwent primary reconstruction after hemiglossectomy between September 2012 and October 2014. Patients were divided into two groups according to the flap design: 'individual design' (ABC flap) and 'common design'. Patients were followed postoperatively and assessed after 6 months for the following functional outcomes: speech, deglutition, tongue mobility, and donor site morbidity. Intelligibility and deglutition were each scored by an independent investigator. Data were analyzed using SPSS version 16.0 software. No differences in mean speech intelligibility scores were observed between the two groups (good: P=0.908; acceptable: P=0.881). However, the ABC flap offered recovery advantages for swallowing capacity compared to the common design flap (MTF classification good: P=0.028; acceptable: P=0.001). The individualized ABC flap not only provides volume but also preserves mobility, speech intelligibility, and swallowing capacity. ALTFs require further improvement for the individualized functional reconstruction of the tongue after hemiglossectomy, but this work lays the foundation for these improvements. PMID:26826782

  19. Structure of 4He and 4Li and decay of the giant resonances in 238U

    International Nuclear Information System (INIS)

    With the p(α, 3He p)n reaction it has been succeeded for the first time to produce 4Li really. The total cross section of this reaction could be described consistently regarding the sequential decay of states in the α particle, in 4Li, and the p-n final-state interaction for all measured spectra. For the excitation of the low-lying L=1 1- and 2- states in the α(p, p')α and the α(p, n)4Li reaction cross sections were extracted. These values are consistent with predictions from DWBA calculations for a one-particle transition from the s into the p shell. The found values for the resonance energies and the widths for the 2- ground state and the first excited 1- state of 4Li amount to Er = 3.4 MeV, γ2 = 1.0 MeV respectively Er = 5.7 MeV, γ2=1.5 MeV. With the coincident measurement of the 238U(α, α'f) reaction the decay of the giant quadrupole resonance was detected in the fission channel. (orig./HSI)

  20. Tectonic and radioactivity impacts of 238U on groundwater-based drinking water at Gosa and Lugbe areas of Abuja, North Central Nigeria

    International Nuclear Information System (INIS)

    Tectonic contribution of activity level of 238U in groundwater-based drinking water in Gosa and Lugbe areas of Abuja was measured using inductively coupled plasma mass spectrometry (ICP-MS). The highest activity level of 2736 µBq L-1 reported in Lugbe borehole, whereas the lowest value of 443 µBq L-1 reported at Gosa borehole. The inhabitants permanently used water from the boreholes for daily consumption. The group receives 5.55 × 10-5 mSv of the annual collective effective dose due to 238U in drinking water. The radiological risks of 238U in the water samples were found to be low, typically in magnitude of 10-7 with cancer mortality value of 1.03 × 10-7 and morbidity value of 1.57 × 10-7. The chemical toxicity risk of 238U in drinking water over a lifetime consumption has a mean value of 4.0 × 10-3 μg kg-1 day-1. It could be that the human risk due to 238U content in groundwater supplies from ingestion may likely be the chemical toxicity of 238U as a heavy metal rather than radiological risk. Significantly, Lugbe subsurface may have developed some fractions of granitic strata that contributed to the distribution of radioactive of 238U in tectonically weak zones. (author)

  1. Solubility of 238U radionuclide from various types of soil in synthetic gastrointestinal fluids using “US in vitro” digestion method

    International Nuclear Information System (INIS)

    238U radionuclide is a naturally occuring radioactive material that can be found in soil. In this study, the solubility of 238U radionuclide obtained from various types of soil in synthetic gastrointestinal fluids was analysed by “US P in vitro” digestion method. The synthetic gastrointestinal fluids were added to the samples with well-ordered, mixed throughly and incubated according to the human physiology digestive system. The concentration of 238U radionuclide in the solutions extracted from the soil was measured using Induced Coupling Plasma Mass Spectrometer (ICP-MS). The concentration of 238U radionuclide from the soil samples in synthetic gastrointestinal fluids showed different values due to different homogenity of soil types and chemical reaction of 238U radionuclide. In general, the solubility of 238U radionuclide in gastric fluid was higher (0.050 – 0.209 ppm) than gastrointestinal fluids (0.024 – 0.050 ppm). It could be concluded that the US P in vitro digestion method is practicle for estimating the solubility of 238U radionuclide from soil materials and could be useful for monitoring and risk assessment purposes applying to environmental, health and contaminated soil samples

  2. Emission of light and energetic medium masses in multiparticle exit channels in the reactions 238U+sup(nat)U and 238U+Au at 16.7 MeV/N energy

    International Nuclear Information System (INIS)

    Employing the 2π-geometry technique, two Solid State Nuclear Track Detectors (SSNTD) of different registration threshold have been used for studying the interaction of 16.7 MeV/N 238U with sup(nat)U and Au targets. The abundant production of five-pronged fission events, together with other experimental results show the emission of considerable amount of light (40 with respect to the beam direction

  3. Development of an active {sup 238}uranium(VI)-fluoride detector chamber for precision experiments in photon-induced fission at the S-DALINAC; Entwicklung einer aktiven {sup 238}Uran(VI)-fluorid-Detektor-Kammer fuer Praezisionsexperimente in der photoneninduzierten Spaltung am S-DALINAC

    Energy Technology Data Exchange (ETDEWEB)

    Eckardt, Christian


    The polarized injector SPIN at the S-DALINAC provides spin polarized electrons for circularly polarized bremsstrahlung with a high degree of polarization near the endpoint energy of the spectrum, enabling the search for forward-backward asymmetries of the light and heavy fission fragment originating from parity non-conservation in the photon-induced fission process of {sup 238}U. An active {sup 238}uranium(VI)-fluoride gas target has been developed along the lines of a simple Frisch grid ionization chamber to raise the luminosity and to study the properties of an {sup 238}uranium(VI)-fluoride/argon gas mixture. The active {sup 238}uranium(VI)-fluoride gas target has been filled with argon and {sup 238}uranium(VI)-fluoride using mass flow controllers. At different settings data has been acquired and interpreted. Instantly after filling the chamber with some {sup 238}uranium(VI)-fluoride the anode and cathode signal are severely lowered and gain only slowly. Apparently the {sup 238}uranium(VI)-fluoride acts as a very efficient electron collector because of its complexity and the high amount of fluorine and its electronegativity. Over time, the amount of gaseous {sup 238}uranium(VI)-fluoride is reduced and different processes are possible to explain this effect. In the present configuration of the active {sup 238}uranium(VI)-fluoride gas target no sound quantitative information on the properties of an {sup 238}uranium(VI)-fluoride/argon gas mixture can be given. Raising the luminosity for precision experiments in photon-induced fission at the S-DALINAC with an active {sup 238}uranium(VI)-fluoride gas target appears to be impossible.

  4. Comparison of measured and calculated 238U capture self-indication ratios from 4 to 10 keV

    International Nuclear Information System (INIS)

    From 4 keV to 149 keV the 238U cross sections are represented in ENDF/B-V by unresolved-resonance parameters (URP). The purpose of this representation is to enable the calculation of resonance self-protection as a function of temperature and dilution. Since the URPs are not defined unambiguously by the cross-section data, it is important that the unresolved representation be tested with appropriate experiments, such as capture self-indication ratio (SIR) measurements. In this paper we compare 238U capture SIR measurements in the 4- to 10-keV energy range with calculations done with ENDF/B-V and with recently published resolved resonance parameters

  5. Effect of heat treatment on microstructure, mechanical properties and erosion resistance of cast 23-8-N nitronic steel

    International Nuclear Information System (INIS)

    Effects of heat treatment on microstructure, mechanical properties and erosion behavior of cast 23-8-N nitronic steel were studied. A series of heat treatments were carried out in the temperature range of 1180–1240 °C to observe the effect on microstructure. Optimum heat treatment cycle was obtained at 1220 °C for holding time of 150 min, which leads to dissolution of carbides, formation of equiaxed grains and twins. Heat treatment has shown improvement in tensile strength, toughness, impact strength and work hardening capacity, however at the cost of marginal reduction in hardness and yield strength. This resulted in improvement of erosion resistance of cast 23-8-N nitronic steel. The microstructures, fractured surfaces and phases were studied by optical microscopy, field emission scanning electron microscopy (FESEM) and X-ray diffraction (XRD) analysis respectively

  6. Measurement and analysis of the 238U (n, 2n) reaction rate in depleted uranium/polyethylene shells

    International Nuclear Information System (INIS)

    In order to check the conceptual design of the subcritical blanket in a fusion-fission hybrid reactor, a depleted uranium/polyethylene simulation device with alternate shells has been established. The measurement of the 238U (n, 2n) reaction rate was carried out using an activation technique, by measuring the 208 keV γ rays emitted from 237U. The self-absorption of depleted uranium foils with different thicknesses was experimentally corrected. The distribution of the 238U (n, 2n) reaction rate at 90° to the incident D+ beam was obtained, with uncertainty between 5.3% and 6.0%. The experiment was analyzed using MCNP5 code with the ENDF/BVI library, and the calculated results are all about 5% higher than the measured results. (authors)

  7. Fragment Characteristics from Photofission of 234U and 238U Induced by 6.0 - 9.0 Mev Bremsstrahlung (United States)

    Göök, A.; Barday, R.; Chernykh, M.; Eckardt, C.; Enders, J.; Neumann-Cosel, P. Von; Poltoratska, Y.; Wagner, M.; Richter, A.; Oberstedt, S.; Hambsch, F.-J.; Oberstedt, A.


    As a preparatory experiment for a search for parity violation in photofission, fission of 238U and 234U induced by 6 - 9 MeV bremsstrahlung has been investigated at the superconducting Darmstadt electron linear accelerator S-DALINAC. Using a twin Frisch grid ionization chamber fission fragment energy and mass distributions have been determined by means of the double kinetic energy technique. The experiment was performed in order to test the ionization chamber's performance in a bremsstrahlung environment. Results on the fission fragment characteristics from the 238U(γ,f) reaction are found to be in good agreement with literature values. In addition results on fission fragment mass and energy distributions from the 234U(γ,f) reaction are presented for the first time in this energy region.

  8. Study of some modern carbonated marine organisms, using U234/U238 activities and its uranium concentration

    International Nuclear Information System (INIS)

    Several types of alive carbonated organisms of marine fluvial or mixed environment origin were analized in its concentrations of Uranium and about its activity ratio U234/U238. In the same way measurements were made from the water of these three types of environments. The results indicate that the mollusks shells show a very low concentration compared with corals. Its concentration varies from 0.04 to 0.33 ppm. Inside the limit of errors we can say that the several types of carbonated organisms show the same disequilibrium U234/U238 which was found in associated waters. An analysis of a piece of wood from long time immersed in the sea water was made. The result indicates that there was a marked high in concentration of Uranium due to chelatation with organic matter. (C.D.G.)

  9. Effect of heat treatment on microstructure, mechanical properties and erosion resistance of cast 23-8-N nitronic steel

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Avnish, E-mail: [Department of Metallurgical and Materials Engineering, Malaviya National Institute of Technology, Jaipur 302017 (India); Sharma, Ashok, E-mail: [Department of Metallurgical and Materials Engineering, Malaviya National Institute of Technology, Jaipur 302017 (India); Goel, S.K. [Star Wire India Ltd., Ballabgarh, Haryana 121404 (India)


    Effects of heat treatment on microstructure, mechanical properties and erosion behavior of cast 23-8-N nitronic steel were studied. A series of heat treatments were carried out in the temperature range of 1180–1240 °C to observe the effect on microstructure. Optimum heat treatment cycle was obtained at 1220 °C for holding time of 150 min, which leads to dissolution of carbides, formation of equiaxed grains and twins. Heat treatment has shown improvement in tensile strength, toughness, impact strength and work hardening capacity, however at the cost of marginal reduction in hardness and yield strength. This resulted in improvement of erosion resistance of cast 23-8-N nitronic steel. The microstructures, fractured surfaces and phases were studied by optical microscopy, field emission scanning electron microscopy (FESEM) and X-ray diffraction (XRD) analysis respectively.

  10. Natural activities of 40K, 238U and 232Th in elephant grass (Pennisetum purpureum) in Ibadan metropolis, Nigeria

    International Nuclear Information System (INIS)

    Samples of elephant grass collected at some pasturing farmlands across different locations in Ibadan metropolis were analyzed for their natural radioactivity concentrations due to 40K, 238U and 232Th radionuclides. Radioactivity measurements were carried out using γ-ray spectroscopy. The average radioactivity concentration of 40K was found to be 64.5±8.1 Bq kg-1, 25.7±5.5 Bq kg-1 for 238U and 33.4±3.9 Bq kg-1 for 232Th. The radiological health implication to the population that may result from these values is found to be very low and almost insignificant. No artificial radionuclide, however, was detected in any of the samples, hence, measurements have been taken as representing baseline values of these radionuclides in the grass in the metropolis

  11. Covariance analyses of self-shielding factor and its temperature gradient for uranium-238 neutron capture reaction

    International Nuclear Information System (INIS)

    Covariances of the self-shielding factor and its temperature gradient for the uranium-238 neutron capture reaction have been evaluated from the resonance parameter covariance matrix and the sensitivity of the self-shielding factor and its temperature gradient to the resonance parameters. The resonance parameters and their covariance matrix for uranium-238 were taken from JENDL-3.3, while the sensitivity coefficients were calculated by varying resonance parameters and temperature. A set of computer code modules has been developed for the calculation of the sensitivity coefficients at numerous resonance levels. The present result shows that the correlation among resonance parameters yields a substantial contribution to the standard deviations of the self-shielding factor and its temperature gradient. In addition to the standard deviations of these quantities, their correlation matrices in the JFS-3 70 group structure are also obtained. (author)

  12. Assessment of 238Pu and 239+240Pu, in marine sediments of the oceans Atlantic and Pacific of Guatemala

    International Nuclear Information System (INIS)

    In this investigation samples of marine sediments were taken from 14 places representatives of the oceans coast of Guatemala. For the assesment of 238Pu and 239+240Pu in sediments a radiochemical method was used to mineralize sediments and by ionic interchange it was separated from other elements, after that an electrodeposition of plutonium was made in metallic discs. The radioactivity of plutonium was measured by alpha spectrometry system and the alpha spectrums were obtained. The levels of plutonium are not higher than other countries that shown contamination. The contamination of isotope of 239+240Pu is higher than 238Pu and the contamination by two isotopes of plutonium is higher in the Atlantic than the Pacific ocean

  13. Evaluation of Aqueous and Powder Processing Techniques for Production of Pu-238-Fueled General Purpose Heat Sources

    Energy Technology Data Exchange (ETDEWEB)


    This report evaluates alternative processes that could be used to produce Pu-238 fueled General Purpose Heat Sources (GPHS) for radioisotope thermoelectric generators (RTG). Fabricating GPHSs with the current process has remained essentially unchanged since its development in the 1970s. Meanwhile, 30 years of technological advancements have been made in the fields of chemistry, manufacturing, ceramics, and control systems. At the Department of Energy’s request, alternate manufacturing methods were compared to current methods to determine if alternative fabrication processes could reduce the hazards, especially the production of respirable fines, while producing an equivalent GPHS product. An expert committee performed the evaluation with input from four national laboratories experienced in Pu-238 handling.

  14. Report to the 238U discrepancy task force on SIOB fits to the ORNL, CBNM, and JAERI transmission data

    International Nuclear Information System (INIS)

    The computer code SIOB has been used to obtain least-squares simultaneous-sample shape fits to the recent 238U transmission data of ORNL, CBNM, and JAERI over the energy regions 1460 to 1820 eV, 2470 to 2740 eV, and 3820 to 4000 eV. The fits indicate that much of the systematic discrepancy in the published neutron widths from these data arose in the data analysis procedure. Except for the 3820- to 4000-eV JAERI data, the systematic differences in the resulting neutron widths from the present widths are larger than those contained in any existing evaluation. These fits were performed as part of the work for the NEANDC ad hoc 238U Discrepancy Task Force. 20 references

  15. Measurement and analysis of the 238U(n, 2n) reaction rate in depleted uranium/polyethylene shells

    Institute of Scientific and Technical Information of China (English)

    YAN Xiao-Song; LIU Rong; LU Xin-Xin; JIANG Li; WEN Zhong-Wei; HAN Zi-Jie


    In order to check the conceptual design of the subcritical blanket in a fnsion-fission hybrid reactor,a depleted uranium/polyethylene simulation device with alternate shells has been established.The measurement of the 238U(n,2n) reaction rate was carried out using an activation technique,by measuring the 208 keV γ rays emitted from 237 U.The self-absorption of depleted uranium foils with different thicknesses was experimentally corrected.The distribution of the 238U(n,2n) reaction rate at 90° to the incident D+ beam was obtained,with uncertainty between 5.3% and 6.0%.The experiment was analyzed using MCNP5 code with the ENDF/BVI library,and the calculated results are all about 5% higher than the measured results.

  16. Measurement of the fast neutron capture cross section of 238U relative to 235U(n,f)

    International Nuclear Information System (INIS)

    The capture cross section of 238U was measured using the activation technique and 235U(n,f) as a reference cross section. Capture events were measured by detection of two prominent γ-transitions in the decay of the 239U daughter nuclide, 239Np, employing a high resolution Ge(Li) detector. The system was calibrated with samples activated in a thermal neutron flux relative to the capture cross section of gold, and with an absolutely calibrated α-emitter, 243Am, which decays to 239Np. Cross section measurements were carried out in the neutron energy range from 30 keV to 3 MeV. Emphasis was on absolute values between 150 keV and 1 MeV where the 238U(n,γ) cross section and its cross section is small. Background from fission products was found to restrict the accuracy of the measured data at energies > 1.5 MeV

  17. Time-dependent Hartree-Fock calculations for multinucleon transfer and quasifission processes in $^{64}$Ni+$^{238}$U reaction

    CERN Document Server

    Sekizawa, Kazuyuki


    Background: Multinucleon transfer (MNT) and quasifission (QF) processes are dominant processes in low-energy collisions of two heavy nuclei. They are expected to be useful to produce neutron-rich unstable nuclei. Nuclear dynamics leading to these processes depends sensitively on nuclear properties such as deformation and shell structure. Purpose: We elucidate reaction mechanisms of MNT and QF processes involving heavy deformed nuclei, making detailed comparisons between microscopic TDHF calculations and measurements for $^{64}$Ni+$^{238}$U reaction. Methods: Three-dimensional Skyrme-TDHF calculations are performed. Particle-number projection method is used to evaluate MNT cross sections from the TDHF wave function after collision. Results: Fragment masses, total kinetic energy (TKE), scattering angle, contact time, and MNT cross sections are investigated for $^{64}$Ni+$^{238}$U reaction. They show reasonable agreements with measurements. At small impact parameters, collision dynamics depends sensitively on th...

  18. Binary fission studies in 24 MeV/u 238U induced reactions on C, Si, Ni and Au

    International Nuclear Information System (INIS)

    Fission is often used to analyse intermediate energy heavy ion reactions or probe the properties of formed nuclei. In our work, the neutron multiplicity is used to measure the violence of a 238U beam on 12C, 28Si, 58Ni or 197Au targets. We present preliminary results concerning the events in which two charged fragments (in addition to neutrons) were detected in coincidence. (D.L.). 5 refs., 5 figs

  19. Absolute absorption cross-section measurements of ozone in the wavelength region 238-335 nm and the temperature dependence (United States)

    Yoshino, K.; Freeman, D. E.; Esmond, J. R.; Parkinson, W. H.


    The absolute absorption cross-section of ozone has been experimentally determined at the temperatures 195, 228, and 295 K at several discrete wavelengths in the 238-335-nm region. The present results for ozone at 295 K are found to be in agreement with those of Hearn (1961). Absolute cross-section measurements of ozone at 195 K have confirmed previous (Freeman et al., 1984) relative cross-section measurements throughout the 240-335-nm region.

  20. Fission-Residues Produced in the Spallation Reaction 238U+p at 1 A GeV


    Bernas, M.; Armbruster, P.; Benlliure, J.; Boudard, A.; Casarejos, E.; Czajkowski, S.; Enqvist, T.; Legrain, R.; Leray, S.; Mustapha, B.; Napolitani, P.; Pereira, J; Rejmund, F.; Ricciardi, M.-V.; Schmidt, K. -H.


    Fission fragments from 1 A GeV 238U projectiles irradiating a hydrogen target were investigated by using the fragment separator FRS for magnetic selection of reaction products including ray-tracing and DE-ToF techniques. The momentum spectra of 733 identified fragments were analysed to provide isotopic production cross sections, fission-fragment velocities and recoil momenta of the fissioning parent nuclei. Besides their general relevance, these quantities are also demanded for applications. ...

  1. Fission Fragment Angular Distribution measurements of 235U and 238U at CERN n_TOF facility

    Directory of Open Access Journals (Sweden)

    Leal-Cidoncha E.


    In order to measure the FFAD of neutron-induced reactions, a fission detection setup based on parallel-plate avalanche counters (PPACs has been developed and successfully used at the CERN-n_TOF facility. In this work, we present the preliminary results on the analysis of new 235U(n,f and 238U(n,f data in the extended energy range up to 200 MeV compared to the existing experimental data.

  2. Measurement of 238U, 232Th and 40K in boreholes at Gosa and Lugbe, Abuja, north central Nigeria

    International Nuclear Information System (INIS)

    The purpose of this project is to evaluate the suitability of different sites as locations for obtaining underground water for consumption. The analysis of 238U, 232Th and 40K from rock samples from each layer of borehole at a depth of ∼50 m at Site A borehole, S3L1-S3L6 in Gosa and 40 m at Site B borehole, S4L1-S4L5 in Lugbe, Abuja, north central Nigeria is presented. The gamma-ray spectrometry was carried out using a high-purity germanium detector coupled to a computer-based high-resolution multichannel analyzer. The activity concentrations at Site A borehole for 238U have a mean value of 26±3, ranging from 23±2 to 30±3 Bq kg-1, 232Th a mean value of 63±5, ranging from 48±4 to 76±6 Bq kg-1 and 40K a mean value of 573±72, ranging from 437±56 to 821±60 Bq kg-1. The activity concentrations at Site B borehole for 238U have a mean value of 20±2, ranging from 16±2 to 23±2 Bq kg-1, 232Th a mean value of 46±4, ranging from 43±4 to 49±4 Bq kg-1, 40K a mean value of 915±116 and ranging from 817±103 Bq kg-1 to 1011±128 Bq kg-1. It is noted that the higher activity concentrations of 232Th and 238U are found in Site A at Gosa. Site B has lower radioactivity, and it is recommended that both sites are suitable for underground water consumption. (authors)

  3. Determination of Photofission Fragment Characteristics of 234,238U and 232Th in the Barrier Region


    GÖÖK Alf


    The photofission of 232Th, 234U and 238U at excitation energies in the barrier region has been studied. The goal has been to extract information on the mass, total kinetic energy (TKE) and angular distributions of the fission fragments. The experiments were performed using bremsstrahlung, produced by an electron beam in a copper radiator at the injector of the Superconducting Darmstadt linear accelerator (S-DALINAC). Mass and TKE distributions were determined by means of the double kinet...

  4. Estimation of uncertainties in resonance parameters of {sup 56}Fe, {sup 239}Pu, {sup 240}Pu and {sup 238}U

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Tsuneo; Shibata, Keiichi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment


    Uncertainties have been estimated for the resonance parameters of {sup 56}Fe, {sup 239}Pu, {sup 240}Pu and {sup 238}U contained in JENDL-3.2. Errors of the parameters were determined from the measurements which the evaluation was based on. The estimated errors have been compiled in the MF32 of the ENDF format. The numerical results are given in tables. (author)

  5. Theoretical modeling of traveling wave reactor fed with non-irradiated and pre-irradiated 238U fuels

    International Nuclear Information System (INIS)

    This paper deals with a traveling wave reactor theoretically. The breeding/burning wave is generated by a continuous radial fuel shuffling. Two-dimensional cylindrical core geometry is considered and the fuel is assumed to drift in the radial direction, which corresponds to a continuous radial fuel shuffling in practice. A one-group diffusion equation coupled with a burn-up solution is set up. The burn-up solution is obtained numerically, where the actinide inventories are simplified as functions of neutron fluence only. The uranium-plutonium (U-Pu) conversion cycle with pure 238U or 238U with its irradiation descendants as fresh fuel is considered under conditions of a typical sodium cooled fast reactor with uranium metallic fuel loaded. The asymptotic problems are solved by a time-stepping iteration scheme and the radial stationary wave solution is obtained together with certain eigenvalue keff. As a particular feature of this paper, the 238U pre-irradiated fuel is distributed with different irradiation doses along the axial axis. The purpose of this treatment is to remedy the power shape deformation in the uniform fresh fuel case. The results of both non-irradiated and pre-irradiated fuel, as examples for the inward fuel drifting motion, are compared and discussed. (author)

  6. 238U/235U variations in meteorites: extant 247Cm and implications for Pb-Pb dating. (United States)

    Brennecka, G A; Weyer, S; Wadhwa, M; Janney, P E; Zipfel, J; Anbar, A D


    The 238U/235U isotope ratio has long been considered invariant in meteoritic materials (equal to 137.88). This assumption is a cornerstone of the high-precision lead-lead dates that define the absolute age of the solar system. Calcium-aluminum-rich inclusions (CAIs) of the Allende meteorite display variable 238U/235U ratios, ranging between 137.409 +/- 0.039 and 137.885 +/- 0.009. This range implies substantial uncertainties in the ages that were previously determined by lead-lead dating of CAIs, which may be overestimated by several million years. The correlation of uranium isotope ratios with proxies for curium/uranium (that is, thorium/uranium and neodymium/uranium) provides strong evidence that the observed variations of 238U/235U in CAIs were produced by the decay of extant curium-247 to uranium-235 in the early solar system, with an initial 247Cm/235U ratio of approximately 1.1 x 10(-4) to 2.4 x 10(-4). PMID:20044543

  7. Alpha Spectrometry for Determination of 238U, 235U, 234U, 232Th and 230Th in Soil Sample

    International Nuclear Information System (INIS)

    Monitoring of radioactivity in soil around the nuclear power plant is important. In this study, the radioactivity of uranium and thorium isotopes in soil (NIST SRM 2709a) is analyzed by alpha spectrometry. Alpha spectrometry is a powerful analytical tool for the identification and assay of the alpha-emitting sources primarily due to its high counting efficiency, high sensitivity and low price. Another aim of this study is to present the extent of disequilibrium of 238U/234U and 238U/230Th. The soil sample was decomposed by a fusion technique, and the source for the alpha spectrometry was prepared by electrodeposition of an alpha-emitting nuclides onto a metallic substrate. In this work, uranium and thorium isotopes were chemically separated from a soil sample (NIST SRM 2709a) using chromatographic columns, and electrodeposited on a stainless steel disc to measure the radioactivity concentration of the isotopes with an alpha spectrometer. The ratio of 238U/234U for the soil sample was ca. 1 which is considered to be in secular equilibrium

  8. {\\alpha}-accompanied cold ternary fission of $^{238-244}$Pu isotopes in equatorial and collinear configuration

    CERN Document Server

    Santhosh, K P; Priyanka, B


    The cold ternary fission of $^{238}$Pu, $^{240}$Pu, $^{242}$Pu and $^{244}$Pu isotopes, with $^{4}$He as light charged particle, in equatorial and collinear configuration has been studied within the Unified ternary fission model (UTFM). The fragment combination $^{100}$Zr+$^{4}$He+$^{134}$Te possessing the near doubly magic nuclei $^{134}$Te (N=82, Z=52) gives the highest yield in the alpha accompanied ternary fission of $^{238}$Pu. For the alpha accompanied ternary fission of $^{240}$Pu, $^{242}$Pu and $^{244}$Pu isotopes, the highest yield was found for the fragment combination with doubly magic nuclei $^{132}$Sn (N=82, Z=50) as the heavier fragment. The deformation and orientation of fragments have also been taken into account for the alpha accompanied ternary fission of $^{238-244}$Pu isotopes, and it has been found that in addition to closed shell effect, ground state deformation also plays an important role in determining the isotopic yield in the ternary fission process. The emission probability and ki...

  9. A dispersive optical model potential for nucleon induced reactions on 238U and 232Th nuclei with full coupling

    Directory of Open Access Journals (Sweden)

    Chiba Satoshi


    Full Text Available A dispersive coupled-channel optical model potential (DCCOMP that couples the ground-state rotational and low-lying vibrational bands of 238U and 232Th nuclei is studied. The derived DCCOMP couples almost all excited levels below 1 MeV of excitation energy of the corresponding even-even actinides. The ground state, octupole, beta, gamma, and non-axial bands are coupled. The first two isobar analogue states (IAS populated in the quasi-elastic (p,n reaction are also coupled in the proton induced calculation, making the potential approximately Lane consistent. The coupled-channel potential is based on a soft-rotor description of the target nucleus structure, where dynamic vibrations are considered as perturbations of the rigid rotor underlying structure. Matrix elements required to use the proposed structure model in Tamura coupled-channel scheme are derived. Calculated ratio R(U238/Th232 of the total cross-section difference to the averaged σT for 238U and 232Th nuclei is shown to be in excellent agreement with measured data.

  10. Investigation of fission properties and evaporation residue measurement in the reactions using 238U target nucleus

    Directory of Open Access Journals (Sweden)

    Saro S.


    Full Text Available Fragment mass distributions for fission after full momentum transfer were measured in the reactions of 30Si,34,36 S,31P,40Ar + 238U at bombarding energies around the Coulomb barrier. Mass distributions change significantly as a function of incident beam energy. The asymmetric fission probability increases at sub-barrier energy. The phenomenon is interpreted as an enhanced quasifission probability owing to orientation effects on fusion and/or quasifission. The evaporation residue (ER cross sections were measured in the reactions of 30Si + 238U and 34S + 238U to obtain information on fusion. In the latter reaction, significant suppression of fusion was implied. This suggests that fission events different from compound nucleus are included in the masssymmetric fragments. The results are supported by a model calculation based on a dynamical calculation using Langevin equation, in which the mass distribution for fusion-fission and quasifission fragments are separately determined.

  11. Long-term exposure of 238PuO2 to an arid terrestrial environment

    International Nuclear Information System (INIS)

    Two environmental simulation chambers were used to study the behavior of a 238PuO2 heat source deposited in an arid, temperate environment. Large fragments from an impact-tested source were deposited in the first chamber, and fines from the source were placed in the second. Plutonium released into the soil, the soil drainages, and the condensates from the dehumidifiers were monitored throughout the experiment. The bulk of the released plutonium, up to 0.04% of the source, was retained in the soil. Of the remainder, larger amounts of plutonium were released to the condensates (to the air) than to the soil percolates. Release rates to the condensates and percolates increased with time for both chambers. Condensate release rates averaged 23 nCi/day for the fines chamber and 90 nCi/day for the chamber with the large fragments. Percolate release rates averaged 224 nCi/rain for the fines chamber and 170 nCi/rain for the other chamber. Spalling of particles from the surface of the plutonium oxide to the air, caused by the action of rain on the hot source fragments, seemed to be a significant release mechanism for the large source fragments but not for the fines. A simulated cleanup operation, involving removal of the source and a small amount of soil, had little effect on the continuing release of plutonium to the soil percolates and to the dehumidifier condensates, except that the condensate release rates from the chamber that had contained the large source fragments dropped to a value equal to that of the other chamber. The large source fragments remained virtually unchanged after 8.5 yr of exposure, in contrast to one previous experiment in which fragments of similar size disintegrated into fines

  12. Study of the production of fission fragments from neutron induced fission on uranium 238

    International Nuclear Information System (INIS)

    This work is devoted to the study of the mass and charge distributions of fission fragments from the fission induced on uranium 238 by neutrons from 1 to 150 MeV. An experimental program allowed us to gather and analyse new data. The obtained results were interpreted by an original model, based on a microscopic description of the reaction. Data were taken at the LANSCE laboratory of Los Alamos (USA) where we used the neutron source WNR and the germanium array GEANIE. The aim was to measure secondary fission fragment production yields from a spectroscopic analysis of the prompt gamma and x-rays. A device with photovoltaic cells used as fission fragment detectors was developed. The trigger created with this device allowed us to reduce the background from the other neutron induced reactions. Close to one hundred fragments were identified and excitation functions were extracted for about thirty of them. Mass and charge distributions at different incident energies were extracted from these measurements. These results were then compared to evaluated reference data (Wahl systematics). It showed that the calculations are consistent with the measurements at low energies (below 20 MeV) but partially fail to reproduce the data at higher energy. To go into more detail about the obtained results, the reaction was studied using an original model. It provided a dynamic and totally microscopic description of the fission from constrained self-consistent Hartree-Fock-Bogoliubov calculations. This work was completed in two parts. First, a potential energy surface of the fissioning system was calculated in a deformation plane defined by the elongation and asymmetry variables. The second part was to use the resolution of the dynamic Schroedinger equation on this surface giving us a fragment mass distribution which we then compared to the low energy data. (author)

  13. Production of unknown neutron-rich isotopes in 238U collisions at near-barrier energy (United States)

    Zhao, Kai; Li, Zhuxia; Zhang, Yingxun; Wang, Ning; Li, Qingfeng; Shen, Caiwan; Wang, Yongjia; Wu, Xizhen


    The production cross sections for primary and residual fragments with charge number from Z =70 to 120 produced in the collision of 238U at 7.0 MeV/nucleon are calculated by the improved quantum molecular dynamics (ImQMD) model incorporated with the statistical evaporation model (hivap code). The calculation results predict that about 60 unknown neutron-rich isotopes from elements Ra (Z =88 ) to Db (Z =105 ) can be produced with the production cross sections above the lower bound of 10-8 mb in this reaction. And almost all of the unknown neutron-rich isotopes are emitted at the laboratory angles θlab≤60°. Two cases, i.e., the production of the unknown uranium isotopes with A ≥244 and that of rutherfordium with A ≥269 , are investigated to understand the production mechanism of unknown neutron-rich isotopes. It is found that for the former case the collision time between two uranium nuclei is shorter and the primary fragments producing the residues have smaller excitation energies of ≤30 MeV and the outgoing angles of those residues cover a range of 30°-60°. For the latter case, a longer collision time is needed for a large number of nucleons being transferred and thus it results in higher excitation energies and smaller outgoing angles of primary fragments, and eventually results in a very small production cross section for the residues of Rf with A ≥269 which have a small interval of outgoing angles of θlab=40°-50°.

  14. Electromagnetic dissociation of 238U in heavy-ion collisions at 120 MeV/A

    International Nuclear Information System (INIS)

    This thesis describes a measurement of the heavy-ion induced electromagnetic dissociation of a 120 MeV/A 238U beam incident on five targets: 9Be, 27Al, natCu, natAg, and natU. Electromagnetic dissociation at this beam energy is essentially a two step process involving the excitation of a giant resonance followed by particle decay. At 120 MeV/A there is predicted to be a significant contribution of the giant quadrupole resonance to the EMD cross sections. The specific exit channel which was looked at was projectile fission. The two fission fragments were detected in coincidence by an array of solid-state ΔE-E detectors, allowing the changes of the fragments to be determined to within ± .5 units. The events were sorted on the basis of the sums of the fragments' charges, acceptance corrections were applied, and total cross sections for the most peripheral events were determined. Electromagnetic fission at the beam energy of this experiment always leads to a true charge sum of 92. Due to the imperfect resolution of the detectors, charge sums of 91 and 93 were included in order to account for all of the electromagnetic fission events. The experimentally observed cross sections are due to nuclear interaction processes as well as electromagnetic processes. Under the conditions of this experiment, the cross sections for the beryllium target are almost entirely due to nuclear processes. The nuclear cross sections for the other four targets were determined by extrapolation from the beryllium data using a geometrical scaling model. After subtraction of the nuclear cross sections, the resulting electromagnetic cross sections are compared to theoretical calculations based on the equivalent photon approximation. Systematic uncertainties are discussed and suggestions for improving the experiment are given

  15. The metrological activity determination of 238 U and 230 Th by gamma spectrometry to industrial fuel-cycle application

    International Nuclear Information System (INIS)

    This work describes the difficulty for determining the activity of 238 U and 230 Th using gamma spectrometry due to the low gamma-ray emission probabilities of 92 and 67 keV, and, mainly, the associated high uncertainties about 13 and 11%, respectively. 230 Th is a 238 U daughter and it is product from uranium mills and refineries. 230 Th decays to 226 Ra and this decay has to be measured because these radionuclides are not in secular equilibrium with their daughter products, besides the gamma-energies have high uncertainties in the emission probabilities. These radionuclides, mostly 238 U, are important in the nuclear fuel-cycle, since the mining of uranium ore, where the nominal isotopic content of natural uranium is 99.27% of 238 U, until the irradiated fuel reprocessing, where this isotope, a fertile material, is recovered to be used again. The uranium and thorium are considered safeguarded nuclear materials and the metrology tries to calibrate and standardize these materials to improve the activity determination techniques applied in different fuel-cycle scopes. The essential characteristics of the safeguarded materials are low gamma energies (less than 100 keV) and emission probabilities but with high uncertainties. In this way, the metrology can contribute to homeland security defense against illicit nuclear trafficking with the identification and quantification of the safeguarded radionuclides such as uranium and thorium, using specific gamma window energy and high resolution planar or coaxial germanium detector. The efficiency curve is obtained from the reference source spectrum considering the photopeak areas corresponding the standard activities. This curve depends on radiation energy, sample geometry, photon attenuation (sample absorption and material absorption between sample-detector), dead time and sample-detector position. The metrological activity determinations of 238 U solid sources, and of 230 Th, in solution (5 ml flask), were performed using

  16. Uranium separation by solvent extraction and determination of 234U/238U isotopic ratios using liquid scintillation spectrometry

    International Nuclear Information System (INIS)

    Liquid Scintillation Spectrometer (LSS) coupled with Pulse Shape Analysis has proved to be useful tool for determination of alpha emitting radionuclide, providing high counting efficiency, low background but only moderate energy resolution. Application of solvent extraction significantly reduces the extensive chemical separation needed for alpha spectroscopy technique using surface barrier detectors which allows many simple and effective nuclide separations as a part of sample preparation. LSS provides a nearly total rejection of β-γ emissions by means of pulse shape discrimination combined with counting efficiency higher than 99%. Liquid scintillation coupled with solvent extraction is a reliable, specific, very attractive and quick technique for the determination of U. In the present study, radiochemical separation method was used for the analysis of total uranium concentration as well as determination of 234U/238U isotopic ratios in standard U-ores by LSS. Measurements were carried out using Ultra Low Level LKB Wallac Quantulus 1220 LSS which has built-in Pulse Shape Discriminator and external standard 152Eu which allows the measurement of External Quench Parameter (SQP(E)). For determination of Uranium content in the ores, the direct extraction method by extractive cocktail was used. Liquid scintillation technique was successfully tested on the standard ores with total digestion of the samples to assess the possibility of faster analysis. Results was achieved as an effect of total digestion of the ores followed by extraction of Uranium by Toluene scintillator. Peak fitting procedure available in spectroscopy software was utilized for resolving the α peaks due to 4.17 MeV and 4.77MeV of 238U and 234U. It is seen that the 238U and 234U peaks are well resolved, allowing assessment of their ratio. The Uranium activity determined in the reference U ores is exemplified. The activity concentrations and isotopic Uranium activity ratios derived from LSS indicates

  17. Analysis and comparison of monoenergetic fast neutron fluence determination using {sup 238}U samples at different positions with respect to the neutron source

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Guohui, E-mail: [State Key Laboratory of Nuclear Physics and Technology, Institute of Heavy Ion Physics, School of Physics, Peking University, Beijing 100871 (China); Liu Xiang; Gao Zhiqi; Wu Hao; Liu Jiaming [State Key Laboratory of Nuclear Physics and Technology, Institute of Heavy Ion Physics, School of Physics, Peking University, Beijing 100871 (China)


    Using two {sup 238}U samples placed in a gridded ionization chamber and a parallel-plate fission chamber, fluence of monoenergetic fast neutrons was determined. Four runs of measurements were performed. Analysis showed that although the neutron fluences for the two {sup 238}U samples differ by 20-33 times in the present work, the fluences at the position of the sample in the gridded ionization chamber determined by the two ways are in agreement within experimental uncertainties. - Highlights: Black-Right-Pointing-Pointer Fluences of monoenergetic fast neutrons were determined in four runs. Black-Right-Pointing-Pointer One {sup 238}U sample was placed in a gridded ionization chamber. Black-Right-Pointing-Pointer Another {sup 238}U sample was placed in a parallel-plate fission chamber. Black-Right-Pointing-Pointer Results are in agreement for different runs and different detectors.

  18. On uncertainties and fluctuations of averaged neutron cross sections in unresolved resonance energy region for 235U, 238U, 239Pu

    International Nuclear Information System (INIS)

    This paper analyses the reasons for the differences which exist between group-averaged evaluated cross-section data from different evaluated data files for U235, U238 and Pu239 in the unresolved resonance energy region. (author)

  19. Some questions concerning safety on emergency landing in dense layers of the atmosphere of radionuclide energy sources based on plutonium-238 for autonomous station ``MARS-94/96'' (United States)

    Makhorin, Oleg I.; Pustovalov, Alexey A.; Zhabin, Vladimir N.; Greenberg, Edward I.; Nilolaev, Vadim S.; Sokolov, Nikolay A.


    This paper describes results of investigations of questions concerning integrity keeping for an ampula containing radionuclide fuel (Pu-238) under conditions of emergency landing in dense layers of the atmosphere and under conditions of fire on launching pad.

  20. High energy resolution measurement of the 238U neutron capture yield in the energy region between 1 and 100 keV

    International Nuclear Information System (INIS)

    A measurement of the 238U neutron capture yield was performed at the 150 meter flight-path of the ORELA facility on two 238U samples (0.01224 and 0.0031 atomsbarn). The capture yeild data were normalized by Moxon's small resonance method. The energy resolution achieved in this measurement frequently resulted in doublet and triplet splittings of what appeared to be single resonance in previous measurements. This resolution should allow extension of the resolved resonance energy region in 238U from the present 4-keV limit up to 15 or 20 keV incident neutron energy. Some 200 small resonances of the (238U /plus/ n) compound nucleus have been observed which had not been detected in transmission measurement, in the energy range from 250 eV to 10 keV

  1. High energy resolution measurement of the 238U neutron capture yield in the energy region between 1 and 100 keV

    International Nuclear Information System (INIS)

    A measurement of the 238U neutron capture yield was performed at the 150 meter flight-path of the ORELA facility on two 238U samples (0.0124 and 0.0031 atoms/barn). The capture yield data were normalized by Moxon's small resonance method. The energy resolution achieved in this measurement frequently resulted in doublet and triplet splittings of what appeared to be single resonances in previous measurements. This resolution should allow extension of the resolved resonance energy region in 238U from the present 4-keV limit up to 15 or 20 keV incident neutron energy. Some 200 small resonances of the (238U + n) compound nucleus have been observed which had not been detected in transmission measurements, in the energy range from 250 eV to 10 keV. (author)

  2. Analysis and comparison of monoenergetic fast neutron fluence determination using 238U samples at different positions with respect to the neutron source. (United States)

    Zhang, Guohui; Liu, Xiang; Gao, Zhiqi; Wu, Hao; Liu, Jiaming


    Using two (238)U samples placed in a gridded ionization chamber and a parallel-plate fission chamber, fluence of monoenergetic fast neutrons was determined. Four runs of measurements were performed. Analysis showed that although the neutron fluences for the two (238)U samples differ by 20-33 times in the present work, the fluences at the position of the sample in the gridded ionization chamber determined by the two ways are in agreement within experimental uncertainties. PMID:22398325

  3. Tumour necrosis factor alpha promoter polymorphism, TNF-238 is associated with severe clinical outcome of falciparum malaria in Ibadan southwest Nigeria. (United States)

    Olaniyan, Subulade A; Amodu, Olukemi K; Bakare, Adekunle A; Troye-Blomberg, Marita; Omotade, Olayemi O; Rockett, Kirk A


    Tumour necrosis factor (TNF) - α has been shown to play an important role in the pathogenesis of falciparum malaria. Two TNF promoter polymorphisms, TNF-308 and TNF-238 have been associated with differential activity and production of TNF. In order to investigate the association between TNF-308 and TNF-238 and the clinical outcome of malaria in a Nigerian population, the two TNF polymorphisms were analysed using Sequenom iPLEX Platform. A total of 782 children; 283 children with uncomplicated malaria, 255 children with severe malaria and 244 children with asymptomatic infection (controls) were studied. The distribution of TNF-308 and TNF-238 genotypes were consistent with the Hardy-Weinberg equilibrium. Distribution of both TNF polymorphisms differed significantly across all clinical groups (TNF-308: p=0.007; TNF-238: p=0.001). Further tests for association with severe malaria using genotype models controlling for age, parasitaemia and HbAS showed a significant association of the TNF-238 polymorphism with susceptibility to severe malaria (95% CI=1.43-6.02, OR=2.94, p=0.003237) The GG genotype of TNF-238 significantly increased the risk of developing cerebral malaria from asymptomatic malaria and uncomplicated malaria (95% CI=1.99-18.17, OR=6.02, pmalaria outcome. These results show thegenetic association of TNF-238 in the clinical outcome of malaria in Ibadan, southwest Nigeria. These findings add support to the role of TNF in the outcome of malaria infection. Further large scale studies across multiple malaria endemic populations will be required to determine the specific roles of TNF-308 and TNF-238 in the outcome of falciparum malaria infection. PMID:27178813

  4. Dietary 232Th and 238U intakes for Japanese as obtained in a market basket study and contributions of imported foods to internal doses

    International Nuclear Information System (INIS)

    Thorium-232 and 238U contents in four food groups were measured by inductively coupled plasma mass spectrometry (ICP-MS). Daily intakes of 232Th and 238U for Japanese were estimated to 2.22 mBq and 15.5 mBq per person, respectively. Furthermore, preliminary estimations were made for the effects of imported foods on internal exposures for Japanese. (author). 16 refs., 1 fig., 3 tabs

  5. Effects on elevating cancer risk in population exposed to natural radionuclide 226Ra if parent radionuclide 238U is entered the body by inhalation or ingestion

    International Nuclear Information System (INIS)

    People have always been exposed to ionizing radiation originating from natural radionuclides including 238U, 40K, 232Th that exist in earths crust. Although received doses are small, due to the fact that threshold does not exist, there is a certain risk of developing cancer. Purpose of this study was to measure 238U concentrations in soil of Bela Crkva territory. Based on these measurements, risks of developing cancers are calculated using Monte Carlo method.(author)

  6. Estimation of radiation doses to member of the public in northern corridor of India from intake of naturally occurring radionuclide (238U) in drinking water

    International Nuclear Information System (INIS)

    In the present paper radiological quality in drinking water collected from northern corridor of India has been evaluated on the basis of 238U activity. Places considered under present study are distinctive for their geological point of view. Adsorptive stripping voltammetric (AdSV) technique has been used to estimate the total uranium content of water samples and then converted to 238U activity concentration using specific activity of 238U (12.356 mBq μg-1 of 238U) and used accordingly. The uranium concentration in water samples varies in a wide range from 0.15-251 μg L-1. These values are compared with safe limit values recommended for drinking water by WHO and USEPA. Most of the water samples are found to have uranium concentration below the safe limit of 30 μg L-1 (USEPA, 2003). Annual committed effective doses due to 238U was evaluated for the adult member of the public through the ingestion of the drinking water samples studied and compared with the reference level of the committed effective dose (100 μSv yr-1 recommended by the WHO. The dose due to 238U for all analysed samples of drinking water are in the range of 0.06-18.74 μSv yr-1 and found to be well below the reference level recommended by the WHO. (author)

  7. 1.4MeV-5MeV中子诱发238U裂变产额测量%Fission Product Yield Measurement of 238 U Induced by 1.4-5 MeV Neutrons

    Institute of Scientific and Technical Information of China (English)

    李映映; 肖军; 王攀; 李子越; 汪超; 罗小兵


    238 U fission yield measurement has a significant meaning in nuclear data measurement .This thesis a-dopts1.4 MeV-5 MeV mono -energetic neutrons generated by 2.5 MeV proton electrostatic accelerator to stimulate 238U fission, and then measures the yield of fission product nuclide 135I、133I、105Ru and 91Sr through measuring fission product radioactivity .Neutron flux during irradiation process is determined by activation meth-od .Subsequently , this thesis analyzes multiple components influencing experiment measurement , including cor-rection on neutron′s multiple scattering and self -shielding effect in target head and sample on the basis of MC-NPX program as well as correction on sample′s self-absorption of γ-ray.Typical deviation of yield data is concluded as 3.5%.Finally, this thesis compares measurement consequences with existing fission yield data .%238 U裂变产额测量工作在核数据测量中有着重要意义,本工作利用2.5MeV质子静电加速器产生的1.4MeV-5MeV单能中子诱发238 U裂变,通过对裂变产物放射性的测量对裂变产物核素135 I、133 I、105 Ru和91 Sr的产额进行了测定。照射过程中中子通量用活化法确定。分析了影响实验测量的多个因素,包括用MCNPX程序对中子在靶头及样品中的多次散射和自屏蔽效应进行了修正,对γ射线在样品中的自吸收进行修正等。得到产额数据典型误差为3.5%,最后把测量结果与已有的裂变产额数据进行比对。

  8. Experimental Cross Sections for Reactions of Heavy Ions and 208Pb, 209Bi, 238U, and 248Cm Targets

    International Nuclear Information System (INIS)

    The study of the reactions between heavy ions and 208Pb, 209Bi, 238U, and 248 Cm targets was performed to look at the differences between the cross sections of hot and cold fusion reactions. Experimental cross sections were compared with predictions from statistical computer codes to evaluate the effectiveness of the computer code in predicting production cross sections. Hot fusion reactions were studied with the MG system, catcher foil techniques and the Berkeley Gas-filled Separator (BGS). 3n- and 4n-exit channel production cross sections were obtained for the 238U(18O,xn)256-xFm, 238U(22Ne,xn)260-xNo, and 248Cm(15N,xn)263-xLr reactions and are similar to previous experimental results. The experimental cross sections were accurately modeled by the predictions of the HIVAP code using the Reisdorf and Schaedel parameters and are consistent with the existing systematics of 4n exit channel reaction products. Cold fusion reactions were examined using the BGS. The 208Pb(48Ca,xn)256-xNo, 208Pb(50Ti,xn)258-xRf, 208Pb(51V,xn)259-xDb, 209Bi(50Ti,xn)259-xDb, and 209Bi(51V,xn)260-xSg reactions were studied. The experimental production cross sections are in agreement with the results observed in previous experiments. It was necessary to slightly alter the Reisdorf and Schaedel parameters for use in the HIVAP code in order to more accurately model the experimental data. The cold fusion experimental results are in agreement with current 1n- and 2n-exit channel systematics

  9. V-bar in Neutron-Induced Fission of U235 and Th232, and in Photofission of U238

    International Nuclear Information System (INIS)

    The average number of prompt neutrons (v) emitted in the neutron-induced fission of U235 and Th232 and in the photofission of U238 has been measured with a large liquid scintillator as the fission neutron detector. The measurements were made relative to v for the spontaneous fission of Cf252. The v-values of U235 were measured at some different incident energies between 30 keV and 15 MeV, and the results are in agreement with measurements by Moat et al., and Hopkins and Diven. The measurements of Th232 were made for several incident neutron energies from the fission threshold at about 1.4 MeV to 15 MeV. Special interest was concentrated on the energy region near the fission threshold where the fission cross-section and the fragment angular distribution show strong variations with neutron energy. The measurements indicate that the energy dependence of b in this region may be non-linear. A measurement of v in the photofission of U238 at a gamma-ray energy of 7 MeV has been made. The result is not in agreement with measurements by Prokohorova et al. arid Lazareva et al. The spontaneous fission of Pu245 and the thermal-neutron-induced fission of Pu239 give a difference in v corresponding to 0.10 n/MeV. The result of the present investigation combined with the D-value for the spontaneous fission of U238 gives 0.10 ± 0.02 in agreement with the data obtained for the compound nucleus of Pu240. (author)

  10. Experimental Cross Sections for Reactions of Heavy Ions and 208Pb, 209Bi, 238U, and 248Cm Targets

    Energy Technology Data Exchange (ETDEWEB)

    Patin, Joshua B.


    The study of the reactions between heavy ions and {sup 208}Pb, {sup 209}Bi, {sup 238}U, and {sup 248} Cm targets was performed to look at the differences between the cross sections of hot and cold fusion reactions. Experimental cross sections were compared with predictions from statistical computer codes to evaluate the effectiveness of the computer code in predicting production cross sections. Hot fusion reactions were studied with the MG system, catcher foil techniques and the Berkeley Gas-filled Separator (BGS). 3n- and 4n-exit channel production cross sections were obtained for the {sup 238}U({sup 18}O,xn){sup 256-x}Fm, {sup 238}U({sup 22}Ne,xn){sup 260-x}No, and {sup 248}Cm({sup 15}N,xn){sup 263-x}Lr reactions and are similar to previous experimental results. The experimental cross sections were accurately modeled by the predictions of the HIVAP code using the Reisdorf and Schaedel parameters and are consistent with the existing systematics of 4n exit channel reaction products. Cold fusion reactions were examined using the BGS. The {sup 208}Pb({sup 48}Ca,xn){sup 256-x}No, {sup 208}Pb({sup 50}Ti,xn){sup 258-x}Rf, {sup 208}Pb({sup 51}V,xn){sup 259-x}Db, {sup 209}Bi({sup 50}Ti,xn){sup 259-x}Db, and {sup 209}Bi({sup 51}V,xn){sup 260-x}Sg reactions were studied. The experimental production cross sections are in agreement with the results observed in previous experiments. It was necessary to slightly alter the Reisdorf and Schaedel parameters for use in the HIVAP code in order to more accurately model the experimental data. The cold fusion experimental results are in agreement with current 1n- and 2n-exit channel systematics.

  11. Evaluation of covariances for resolved resonance parameters of 235U, 238U, and 239Pu in JENDL-3.2

    International Nuclear Information System (INIS)

    Evaluation of covariances for resolved resonance parameters of 235U, 238U, and 239Pu was carried out. Although a large number of resolved resonances are observed for major actinides, uncertainties in averaged cross sections are more important than those in resonance parameters in reactor calculations. We developed a simple method which derives a covariance matrix for the resolved resonance parameters from uncertainties in the averaged cross sections. The method was adopted to evaluate the covariance data for some important actinides, and the results were compiled in the JENDL-3.2 covariance file. (author)

  12. Fragment properties from fission of 234,238U induced by 6 -10 MeV bremsstrahlung

    International Nuclear Information System (INIS)

    Experiments to investigate the photon-induced fission of actinide nuclei at excitation energies in the vicinity of the fission barrier are carried out at the super conducting Darmstadt linear electron accelerator S-DALINAC. A twin Frisch grid ionization chamber is used to deduce mass, total kinetic energy, and angular distributions of the fission fragments. In this contribution results on fission fragment mass and total kinetic energy distributions from 234,238U are presented along with the currently on-going investigation of 234U and 232Th fragment angular distributions.

  13. Most probable charge of fission products in 24 MeV proton induced fission of 238U

    International Nuclear Information System (INIS)

    The charge distributions of fission products in 24 MeV proton-induced fission of 238U were measured by the use of an ion-guide isotope separator on line. The most probable charge (Zp) of the charge distribution was discussed in view of the charge polarization in the fission process. It was found that Zp mainly lies on the proton-rich side in the light mass region and on the proton-deficient side in the heavy mass region compared with the postulate of the unchanged charge distribution. The charge polarization was examined with respect to production Q values. copyright 1998 The American Physical Society

  14. Determination of 236Np(n,f) and 238Pu(n,f) cross-sections using surrogate reactions

    International Nuclear Information System (INIS)

    Cross sectional data for 236Np(n,f) reaction is not available for neutron energies beyond 4.32 MeV. In this work, we have determined the cross-section of the above reaction for the neutron energy range En=10-18 MeV using ‘Hybrid Surrogate Ratio’ method via 235U(6Li, α)237Np and 235U(6Li,d)239Pu reactions. The cross-sections for 238Pu(n,f) reaction available in literature have been used as a reference for the above surrogate method

  15. Determination of photofission fragment characteristics of {sup 234,238}U and {sup 232}Th in the barrier region

    Energy Technology Data Exchange (ETDEWEB)

    Goeoek, Alf


    The photofission of {sup 232}Th, {sup 234}U and {sup 238}U at excitation energies in the barrier region has been studied. The goal has been to extract information on the mass, total kinetic energy (TKE) and angular distributions of the fission fragments. The experiments were performed using bremsstrahlung, produced by an electron beam in a copper radiator at the injector of the Superconducting Darmstadt linear accelerator (S-DALINAC). Mass and TKE distributions were determined by means of the double kinetic energy technique using a twin Frisch grid ionization chamber. The angular distributions were derived simultaneously by measuring the drift time of ionization electrons. Results show that this drift-time method is comparable in accuracy to other more commonly used methods, but with a simplified procedure for setting up the experiment. Mass, TKE and angular distributions have been obtained from bremsstrahlung-induced fission of {sup 232}Th at average excitation energies left angle E{sub x} right angle =6.68 MeV and 7.26 MeV, for {sup 234}U at left angle E{sub x} right angle =5.80 MeV, 6.49 MeV and 7.23 MeV, and for {sup 238}U at left angle E{sub x} right angle =5.90 MeV, 6.11 MeV and 6.93 MeV. Results on fission fragment characteristics from {sup 238}U({gamma},f) show good agreement with literature data, which verifies the experimental procedure. The correlated mass and TKE data have been analyzed in terms of fission modes within the multi-modal random-neck-rupture model. The result exhibits a dominant yield of the mass asymmetric standard-2 mode in all the investigated fissioning nuclei, with a relative yield of {proportional_to}77 % in {sup 232}Th, {proportional_to}75 % in {sup 234}U and {proportional_to}67 % in {sup 238}U. No strong fluctuation of the mode yields were found as a function of the excitation energy. Correlations between mass, TKE and angular distributions have been investigated in {sup 232}Th and {sup 234}U. The correlation takes the form of an

  16. Constraints on mantle melting at mid-ocean ridges from global 238U-230Th disequilibrium data

    International Nuclear Information System (INIS)

    The extent of radioactive disequilibrium between 238U and its daughter product 230Th in mid-ocean-ridge basalts from around the world is negatively correlated with axial ridge depth; local positive correlations with inferred mantle source composition are also observed. The larger 230Th excesses seen in samples from shallow ridges reflect a larger melt contribution from a garnet-bearing source which may be explained by a deepening of the solidus in hotter mantle regions. These observations provide important constraints for modelling melt generation at mid-ocean ridges. (author)

  17. Determination of 238Pu and 239+240Pu in soils of different agricultural regions of Guatemala

    International Nuclear Information System (INIS)

    This study allowed to determine the concentration of radioactivity alpha, due to contamination for plutonium in cultivated soils of different regions of Guatemala. They were carried out samplings for convenience in cultivated soils of 15 departments of the republic, determined in each soils sample, the activity concentration for plutonium 238Plutonium and 239+240Plutonium expressed in mili-becquerel by kilogram (mBq/Kg), which has been caused from all over the world by the different provoked liberations or accidents of radioactive particles to the atmosphere

  18. Production of medium-weight isotopes by fragmentation in 750 A MeV 238U on 208Pb collisions

    International Nuclear Information System (INIS)

    Projectile fragmentation of 238U in a lead target was investigated at a bombarding energy of 750 A MeV. Isotopic production cross sections of about 250 different projectile fragments in the element range Z=30-53 were measured with the fragment separator (FRS). The magnetic selection and the kinematical analysis of the measured isotopes allowed to disentangle fission and fragmentation residues. The mass loss of these residues indicates a violent collision where a large amount of energy is dissipated. The position of the fragmentation corridor defined by the measured residues was used to determine an effective proton-evaporation barrier. (orig.)

  19. Transfer of 210Po, 210Pb and 238U from some medicinal plants to their essential oils

    International Nuclear Information System (INIS)

    Essential oils were extracted from 35 medicinal plants used by Syrians, organic compounds were determined in these oils and concentrations of 210Po 210Pb and 238U were determined in the original plants and in the essential oils. The results showed that the highest activity concentrations of 210Po and 210Pb were found in leaves with large surfaces and in Sage were as high as 73.5 Bq kg−1 and 73.2 Bq kg−1, respectively. The activity concentration of 238U was as high as 4.26 Bq kg−1 in Aloe. On the other hand, activity concentrations of 210Po ranged between 0.2 and 71.1 Bq kg−1 in extracted essential oils for Rosemary and False yellowhead, respectively. The activity concentration of 210Pb reached 63.7 Bq kg−1 in Aloe oil. The activity concentrations of 238U were very low in all extracted oils; the highest value was 0.31 Bq kg−1 in peel of Orange oil. The transfer of 210Po and 210Pb from plant to its oil was the highest for Eugenia; 7.1% and 5.5% for 210Po and 210Pb, respectively. A linear relationship was found between the transfer factor of radionuclides from plant to its essential oil and the chemical content of this oil. - Highlights: • Natural radionuclides 210Po, 210Pb and 238U were determined in 35 medicinal plants and their essential oils. • The highest activity concentration of 210Po and 210Pb were 73.5 Bq kg−1 and 73.2 Bq kg−1 in Sage, respectively. • The transfer of 210Po and 210Pb from Eugenia plant to its oil was the highest amongst other plants. • The data obtained in this study can be considered the first reported data for medicinal plants and their oils in Syria

  20. Uranium contents and 235U/238U atom ratios in soil and earthworms in western Kosovo after the 1999 war

    International Nuclear Information System (INIS)

    The uranium content and 235U/238U atom ratio were determined in soils and earthworms of an area of Kosovo (Djakovica garrison), heavily shelled with depleted uranium (DU) ammunition during the 1999 war. The aim of the study was to reconstruct the small-scale distribution of uranium and assess the influence of the DU added to the surface environment. The total uranium concentration and the 235U/238U ratio of topsoils showed great variability and were inversely correlated. The highest uranium levels (up to 31.47 mg kg-1) and lowest 235U/238U ratios (minimum 0.002147) were measured in topsoils collected inside, or very close to, the clusters of DU penetrator holes. Regarding the fractionation of uranium in the surface soils, the uranium concentrations in the soluble and exchangeable fractions increased as the total uranium concentration of the topsoils increased. High and rather uniform percentage contents of uranium (24-36%) were associated with the poorly crystalline iron oxide phases of soils. In the U-enriched soils the elevated levels of the element were probably due to the presence of very small, unevenly distributed oxidized DU particles. The total uranium concentration in earthworms was in the range 0.142-0.656 mg kg-1, with the highest concentrations in Lumbricus terrestris. The juveniles of all three studied species seemed to accumulate uranium more than adults, probably due to age-related differences in metabolism. The 235U/238U ratio in the earthworms was variable (0.005241-0.007266) and independent of both the total uranium contents in soils and the absolute uranium levels in the animals. Bioconcentration was greater at lower U concentrations in soil, probably due to an increasing rate of elimination of uranium by the earthworms as the soil contents of the element increase. The results of this study clearly indicate that DU was added to the soil of the study area. Nevertheless, the phenomenon was very limited spatially and the total uranium concentrations

  1. Absolute L X-ray intensities in the decays of 230Th, 234U, 238Pu and 244Cm

    International Nuclear Information System (INIS)

    The absolute L X-ray emission rates of 230Th, 234U, 238Pu and 244Cm have been measured. The rates were obtained by an alpha-particle gated photon spectrometry technique involving the use of a highly calibrated Ge(HP) detector in coincidence with a SiSB detector. The directional correlation between L X-rays and alpha-particles has been accounted for. The present results are compared with previous experimental values and theoretical estimates. Agreement with theoretical estimates is good, however few of the previous experimental values agree with the present work. Differences with previous work partly seem to lie with the detector calibration. (orig.)

  2. 238U, 232TH, AND 222RN concentration measured in various traditional medicinal plant preparation using nuclear track detectors

    International Nuclear Information System (INIS)

    Full text: 238U, 232Th, 222Rn concentrations were measured inside traditional medicinal plants preparations widely used by patients in classic and modern phyto therapy by using a technique based on the use of solid state nuclear track detectors. The intakes of these radionuclides have been determined for adult patients from the ingestion of the studied medical preparations. The influence of mass intake as well as pollution on the contents of the considered radionuclides was investigated. The resulting radiation doses to adult patients from the ingestion of the traditional medical preparations were evaluated.

  3. Evaluation of the 238U neutron cross-sections for incident neutron energies up to 4 keV

    International Nuclear Information System (INIS)

    An evaluation is described of the 238U cross-sections below 4 keV. Recent measurements and re-analyses of older data are discussed. Evaluated resonance parameters are obtained for 164 s-wave levels. The capture widths of the first three s-wave levels are significantly lower than in the ENDF/B-1V evaluation. The s-wave strength function above 1.5 keV is systematically larger than in ENDF/B-1V. Statistical and systematic uncertainties are evaluated for the resonance parameters and for the smooth backgrounds. The statistical distributions of the resonance parameters are compared with theoretically expected distributions. (author)

  4. Uranium isotopic ratio measurements (235U/238U) by laser ablation high resolution inductively coupled plasma mass spectrometry for environmental radioactivity monitoring - 235U/238U isotope ratio analysis by LA-ICP-MS-HR for environmental radioactivity monitoring

    International Nuclear Information System (INIS)

    The protection of the aquatic and terrestrial environments from a broad range of contaminants spread by nuclear activities (nuclear plants, weapon tests or mining) require continuous monitoring of long-lives radionuclides that were released into the environment. The precise determination of uranium isotope ratios in both natural and potential contaminated samples is of primary concern for the nuclear safeguards and the control of environmental contamination. As an example, analysis of environmental samples around nuclear plants are carried out to detect the traces in the environment originating from nuclear technology activities. This study deals with the direct analysis of 235U/238U isotope ratios in real environmental solid samples performed with laser ablation (LA)-HR-ICP-MS. A similar technique has already been reported for the analysis of biological samples or uranium oxide particles [1,2] but to our knowledge, this was never applied on real environmental samples. The high sensitivity, rapid acquisition time and low detection limits are the main advantages of high resolution ICP-MS for accurate and precise isotope ratio measurements of uranium at trace and ultra-trace levels. In addition, the use of laser ablation allows the analysis of solid samples with minimal preparation. A a consequence, this technique is very attractive for conducting rapid direct 235U/238U isotope ratio analysis on a large set of various matrix samples likely to be encountered in environmental monitoring such as corals, soils, sands, sediments, terrestrial and marine bio-indicators. For the present study, LA-ICP-MS-HR analyses are performed using a New Wave UP213 nano-second Nd:YAG laser coupled to a Thermo Element-XR high resolution mass spectrometer. Powdered samples are compacted with an hydraulic press (5 tons) in order to obtain disk-shaped pellet (10-13 mm in diameter and 2 mm in thickness). The NIST612 reference glass is used for LA-ICP-MS-HR tuning and as standard control during

  5. Uptake and clearance of plutonium-238 from liver cells transplanted into fat pads of F344 rats

    International Nuclear Information System (INIS)

    Animals injected with liver cells and control animals received a single intraperitoneal injection of 37 kBq (1 μCi) 238Pu citrate and were serially sacrificed. It was observed that the cells of the intact liver took up about twice as much 238Pu as liver cells transplanted into the fat pads of the same animal. The retention half-life was 8.3 days for the total activity in the liver, 20 days using tracks/cell measurements in the liver and 16 days for the tracks/cell measurements in the liver cells translocated to fat pads. When the data on tracks/cell were standardized relative to the amount of Pu present at 5 days after injection, there was no significant difference between the retention of Pu in liver cells from intact animals and liver cells transplanted into the fat pads. About 20% of the 5-day Pu liver burden in both liver cells and liver cells transplanted into fat pads was retained at 70 days. The smaller retention and clearance for liver cells in different environments indicate that uptake and clearance of Pu from the body is dependent, to a major extent, upon hepatocyte function. (author)

  6. Behaviour of 238U family radionuclides in continental environment: case of the U mining area near Limoges (France)

    International Nuclear Information System (INIS)

    The objectives of this work are to study the behaviour of 238U and its daughters in the continental environment and to determine the radiological impact of U mining past activities in the Haute-Vienne French department. The distribution of radionuclides among different size fraction was investigated upstream and downstream mines to better understand the transport of radionuclides in the Vienne river basin. Particulate (>0,45 ), colloidal (0,45μ-10 kD) and dissolved (238U, 234Th, 226Ra, 210Pb, 228Ra, 228Th, 7Be, 137Cs and 40 K activities. A preconcentration step by evaporation was elaborated and validated for liquid samples. Results indicate that radiological impact of U mines are the enhancement of radionuclides activities and a change of their distribution between particulate, colloidal and dissolved fraction. While activity levels depend on the input intensity, the distribution is controlled by the mine water treatment witch reduces drastically the contribution of mine radionuclides in streams. Analysis of particles from traps and sediments confirms that the distribution of mine radionuclides promote their accumulation in lacustrine sediments. Therefore, sediments have recorded the U mining history. Nevertheless, the impact of the past activities decreases over time and is very limited in space. Indeed, it becomes weak at 10 km downstream the inputs and it is no more detectable at 30 km downstream. (author)

  7. Primordial radioactivity ((238)U, (232)Th and (40)K) measurements for soils of Ludhiana district of Punjab, India. (United States)

    Badhan, K; Mehra, R


    The aim of the present work was to study the activity concentration and absorbed gamma dose rates due to primordial radionuclides ((238)U, (232)Th and (40)K) for the soil of different villages of Ludhiana district of Punjab, India using a high-purity germanium detector based on high resolution gamma-ray spectrometry. The average activity concentrations of (238)U, (232)Th and (40)K in the soil samples have been found to be 28.58, 50.95 and 569.59 Bq kg(-1), respectively, which gives the total gamma dose rate contribution of 68.50 nGy h(-1). To evaluate the radiological hazard of the natural radioactivity, the radium equivalent activity, the external hazard index, the absorbed dose rate and the effective dose rate have been calculated. The calculated radium equivalent activity values are on the lower side of the recommended safe limit value of 370 Bq kg(-1) by Organization of Economic and Control Department. The calculated value of external health hazard index is lower than unity. PMID:22899219

  8. Primordial radioactivity (238U, 232Th and 40K) measurements for soils of Ludhiana district of Punjab, India

    International Nuclear Information System (INIS)

    The aim of the present work was to study the activity concentration and absorbed gamma dose rates due to primordial radionuclides (238U, 232Th and 40K) for the soil of different villages of Ludhiana district of Punjab (India)) using a high-purity germanium detector based on high resolution gamma-ray spectrometry. The average activity concentrations of 238U, 232Th and 40K in the soil samples have been found to be 28.58, 50.95 and 569.59 Bq kg-1, respectively, which gives the total gamma dose rate contribution of 68.50 nGy h-1. To evaluate the radiological hazard of the natural radioactivity, the radium equivalent activity, the external hazard index, the absorbed dose rate and the effective dose rate have been calculated. The calculated radium equivalent activity values are on the lower side of the recommended safe limit value of 370 Bq kg-1 by Organization of Economic and Control Dept.. The calculated value of external health hazard index is lower than unity. (authors)

  9. Radiation dose patterns in beagle dogs following inhalation of monodisperse and polydisperse aerosols of 238PuO2. II

    International Nuclear Information System (INIS)

    The radiation dose patterns in organs and tissues of the Beagle dog are being determined after inhalation of monodisperse or polydisperse aerosols of 238PuO2. Aerosols employed in the study were 0.7, 1.4 and 2.7 μm aerodynamic diameter (AD) monodisperse aerosols and 1.4 μm activity median aerodynamic diameter (AMAD) polydisperse aerosol. Twenty-six Beagle dogs received inhalation exposure to each aerosol to achieve initial lung burdens (ILB) of 0.07 μCi/kg body weight with sacrifice of two animals at 4 hours, 4, 8, 16, 32, 64, 128, 365, 512 and 730 days and 4, 6 and 8 years after inhalation exposure. Excreta collections were performed on all animals for the first 21 days after inhalation exposure and then three-day collections were taken at 6, 12, 18 and 24 weeks and at six-month intervals thereafter. Information derived from this study will be instrumental in developing a description of the radiation dose to tissues and organs as related to particle size of the inhaled aerosol and will provide a basis for interpretation of biological response being measured in a companion dose-response study. The radiation dose pattern study is in progress with data now available on 238Pu in tissues of animals sacrificed through 64 days after inhalation. Work is continuing on radiochemical analysis of tissues and excreta preparatory to expression of the data in terms of initial lung burden for each animal

  10. Mass Yields and Average Total Kinetic Energy Release in Fission for 235U, 238U, and 239Pu (United States)

    Duke, Dana


    Mass yield distributions and average total kinetic energy (TKE) in neutron induced fission of 235U, 238U, and 239Pu targets were measured with a gridded ionization chamber. Despite decades of fission research, our understanding of how fragment mass yields and TKE depend on incident neutron energy is limited, especially at higher energies (above 5-10 MeV). Improved accuracy in these quantities is important for nuclear technology as it enhances our simulation capabilities and increases the confidence in diagnostic tools. The data can also guide and validate theoretical fission models where the correlation between the fragment mass and TKE is of particular value for constraining models. The Los Alamos Neutron Science Center - Weapons Neutron Research (LANSCE - WNR) provides a neutron beam with energies from thermal to hundreds of MeV, well-suited for filling in the gaps in existing data and exploring fission behavior in the fast neutron region. The results of the studies on target nuclei 235U, 238U, and 239Pu will be presented with a focus on exploring data trends as a function of neutron energy from thermal through 30 MeV. Results indicate clear evidence of structure due to multi-chance fission in the TKE . LA-UR-15-24761.

  11. Fission Fragment Angular Distribution measurements of 235U and 238U at CERN n_TOF facility (United States)

    Leal-Cidoncha, E.; Durán, I.; Paradela, C.; Tarrío, D.; Leong, L. S.; Tassan-Got, L.; Audouin, L.; Altstadt, S.; Andrzejewski, J.; Barbagallo, M.; Bécares, V.; Bečvář, F.; Belloni, F.; Berthoumieux, E.; Billowes, J.; Boccone, V.; Bosnar, D.; Brugger, M.; Calviani, M.; Calviño, F.; Cano-Ott, D.; Carrapiço, C.; Cerutti, F.; Chiaveri, E.; Chin, M.; Colonna, N.; Cortés, G.; Cortés-Giraldo, M. A.; Diakaki, M.; Domingo-Pardo, C.; Dressler, R.; Dzysiuk, N.; Eleftheriadis, C.; Ferrari, A.; Fraval, K.; Ganesan, S.; García, A. R.; Giubrone, G.; Gómez-Hornillos, M. B.; Gonçalves, I. F.; González-Romero, E.; Griesmayer, E.; Guerrero, C.; Gunsing, F.; Gurusamy, P.; Hernández-Prieto, A.; Jenkins, D. G.; Jericha, E.; Kadi, Y.; Käppeler, F.; Karadimos, D.; Kivel, N.; Koehler, P.; Kokkoris, M.; Krtička, M.; Kroll, J.; Lampoudis, C.; Langer, C.; Lederer, C.; Leeb, H.; Lo Meo, S.; Losito, R.; Mallick, A.; Manousos, A.; Marganiec, J.; Martínez, T.; Massimi, C.; Mastinu, P. F.; Mastromarco, M.; Meaze, M.; Mendoza, E.; Mengoni, A.; Milazzo, P. M.; Mingrone, F.; Mirea, M.; Mondelaers, W.; Pavlik, A.; Perkowski, J.; Plompen, A.; Praena, J.; Quesada, J. M.; Rauscher, T.; Reifarth, R.; Riego, A.; Robles, M. S.; Roman, F.; Rubbia, C.; Sabaté-Gilarte, M.; Sarmento, R.; Saxena, A.; Schillebeeckx, P.; Schmidt, S.; Schumann, D.; Tagliente, G.; Tain, J. L.; Tsinganis, A.; Valenta, S.; Vannini, G.; Variale, V.; Vaz, P.; Ventura, A.; Versaci, R.; Vermeulen, M. J.; Vlachoudis, V.; Vlastou, R.; Wallner, A.; Ware, T.; Weigand, M.; Weiß, C.; Wright, T.; Žugec, P.


    Neutron-induced fission cross sections of 238U and 235U are used as standards in the fast neutron region up to 200 MeV. A high accuracy of the standards is relevant to experimentally determine other neutron reaction cross sections. Therefore, the detection effciency should be corrected by using the angular distribution of the fission fragments (FFAD), which are barely known above 20 MeV. In addition, the angular distribution of the fragments produced in the fission of highly excited and deformed nuclei is an important observable to investigate the nuclear fission process. In order to measure the FFAD of neutron-induced reactions, a fission detection setup based on parallel-plate avalanche counters (PPACs) has been developed and successfully used at the CERN-n_TOF facility. In this work, we present the preliminary results on the analysis of new 235U(n,f) and 238U(n,f) data in the extended energy range up to 200 MeV compared to the existing experimental data.

  12. Erosion behaviour of WC-10Co-4Cr coating on 23-8-N nitronic steel by HVOF thermal spraying (United States)

    kumar, Avnish; Sharma, Ashok; Goel, S. K.


    WC-10Co-4Cr coating was deposited by high-velocity oxy-fuel (HVOF) process on cast and solution treated (1220 °C/150 min) 23-8-N nitronic steel substrates. Solution treated substrate has shown higher toughness, ductility and impact energy with a marginal reduction in hardness as compared to cast substrate. This influence the coating deposition efficiency and erosion behaviour. Erosion resistance of coatings was evaluated by air jet erosion tester on two different impact angles (30° and 90°). Phases, microstructure and eroded surface of the coating were characterised by X-ray diffraction (XRD) analysis and field-emission scanning electron microscopy (FESEM) respectively. It is observed that coating on solution treated substrate was superior to cast substrate. The reason being that coating has dense and well-bonded structure with low porosity, less decarburization and inter-splat oxidation. Higher erosion resistance of coated solution treated 23-8-N nitronic steel was attributed to combination of high fracture toughness and hardness of coating including optimum mechanical properties of the substrate. FESEM analysis reveals that erosion response of WC-10Co-4Cr coating also dependent on the relative size of the impact crater with respect to the WC grain size. Coating is removed by combined mode of ductile and brittle erosion.

  13. E1 transition probabilities from K/sup π/ = 0- and K/sup π/ = 1- states of 238Pu

    International Nuclear Information System (INIS)

    Levels of 238Pu were studied in the β- decay of 238Np and the α decay of 242Cm. Thirteen γ-ray transitions were observed for the first time, and additional information about multipolarities and mixing ratios was obtained. An analysis of the γ-ray branching ratios gives a measure of the E1 transition probabilities between octupole-vibrational states and the ground-state band, corresponding to F/sub W/ = 4.3 x 104 for ΔK = 1 transitions and F/sub W/ = 1.5 x 104 for ΔK = 0. The latter transitions are three orders of magnitude faster than those that occur in the isotone 236U, for which F/sub W/(ΔK = 0) = 2.2 x 107, from a direct measurement of the half-life of the 0,1- state. Estimates of the hindrance factors for E1 transitions from octupole states in other heavy nuclei are given, and the validity of the calculations on which they are based is discussed

  14. Determination of specific concentrations of {sup 40}K, {sup 238}U and {sup 232}Th in mineral fertilizer samples

    Energy Technology Data Exchange (ETDEWEB)

    Garcez, Ricardo W.D.; Lopes, Jose M.; Silva, Ademir X., E-mail:, E-mail: [Coordenacao dos Programas de Pos-Graduacao em Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Programa de Engenharia Nuclear; Domingues, Alessandro M.; Lima, Marco F. [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil)


    The use of fertilizer is an established practice worldwide to promote agricultural productivity increased without increasing the planted area, resulting in native forests protection and increase of the food availability. Some kinds of fertilizer have in their chemical composition some radionuclides due the origin of its feedstock, such as {sup 238}U, the {sup 232}Th, and their descendants, beyond {sup 40}K. Knowledge of the radioactivity levels in the environment is great importance to know the gamma radiation dose that the human being is exposed. For identification and quantitation of radionuclides, it was used gamma spectrometry where HPGe detector was used to obtain the spectra, and LabSOCS software for calculating the detection efficiency for each energy. The values of {sup 232}Th specific concentrations ranged from 4.1 to 368.1 Bq.Kg{sup -1}, the values of {sup 238}U specific concentrations ranged from 16.0 to 647.7 Bq.Kg{sup -1} and {sup 40}K specific concentrations ranged from 19.1 to 12713 Bq.Kg{sup -1}. Concentrations of values are consistent with those found in literature. (author)

  15. Resolved-resonance neutron widths from a consistent reanalysis of the most recent 238U transmission data

    International Nuclear Information System (INIS)

    The 238U neutron differential capture cross sections are one of the most important nuclear data for reactor physics calculations. Nevertheless, differential data have persistently over-predicted the ratio of the 238U capture rate relative to the 239Pu fission rate in fast-reactor spectra as measured by integral experiments. One of the possible ways of perhaps reducing this discrepancy is to extend the theoretically sound resolved-resonance range upwards in energy from the present 4 to 10 keV. One of the major obstacles to such an extension is the published discrepancies among the resolved-resonance region neutron widths from 1 to 4 keV from the three most recent transmission measurements and analysis: the 1978 results of Olsen from Oak Ridge National Laboratory (ORNL); the 1975 results of Poortmans from the Central Bureau of Nuclear Measurements (CBNM) in Belgium; and the 1975 results of Nakajima from the Japan Atomic Energy Research Institute (JAERI). In this paper, the results of a detailed reanalysis of the three recent transmission measurements over three narrow energy regions are reported: region 1, 3820 to 4000 eV, six large resonances; region 2, 2470 to 2740 eV, ten large resonances; and region 3, 1460 to 1820 eV, twelve large resonances

  16. Novel Method to Study Neutron Capture of U235 and U238 Simultaneously at keV Energies (United States)

    Wallner, A.; Belgya, T.; Bichler, M.; Buczak, K.; Dillmann, I.; Käppeler, F.; Lederer, C.; Mengoni, A.; Quinto, F.; Steier, P.; Szentmiklosi, L.


    The neutron capture cross sections of the main uranium isotopes, U235 and U238, were measured simultaneously for keV energies, for the first time by combining activation technique and atom counting of the reaction products using accelerator mass spectrometry. New data, with a precision of 3%-5%, were obtained from mg-sized natural uranium samples for neutron energies with an equivalent Maxwell-Boltzmann distribution of kT ˜25 keV and for a broad energy distribution peaking at 426 keV. The cross-section ratio of U235(n ,γ)/U238(n ,γ) can be deduced in accelerator mass spectrometry directly from the atom ratio of the reaction products U236/U239, independent of any fluence normalization. Our results confirm the values at the lower band of existing data. They serve as important anchor points to resolve present discrepancies in nuclear data libraries as well as for the normalization of cross-section data used in the nuclear astrophysics community for s-process studies.

  17. The inflow of 238Pu and 239+240Pu from the Vistula River catchment area to the Baltic Sea

    International Nuclear Information System (INIS)

    The aim of the work was to estimate plutonium inflow from the Vistula River's catchments area to the Baltic Sea. There were differences in plutonium activities depending on season and sampling site. The highest activities of 238Pu and 239+240Pu were transported from the Vistula River watershed to the Baltic Sea in spring and the lowest in summer. Annually, the southern Baltic Sea is enriched via the Vistula River with 10.3 MBq of 238Pu and 89.0 MBq of 239+240Pu. The enhanced concentration of plutonium in water from the Vistula River is the result of its runoff from the Vistula drainage area, mostly from snowmelt, enhanced rainfalls and leached materials from river bed. - Highlights: → We estimated plutonium inflow from the Vistula River catchment area to the Baltic Sea. → We found differences in Pu activities depending on season and sampling site. → The highest amount of 239 + 240Pu was transported in spring and the lowest in summer. → Annually, the southern Baltic Sea is enriched with 89.0 MBq of 239 + 240Pu. → Enhanced Pu amount in water came from snowmelt, rainfalls and leached materials.

  18. Origin and geochemical behavior of uranium in marine sediments. Utilization of the 234U/238U ratio in marine geochemistry

    International Nuclear Information System (INIS)

    The first part of this thesis presents the current situation of knowledge of uranium in marine environment. The second part describes the methods of analysis as well as the material support of the study, i.e., the sediments and marine deposits investigated. The third part is dedicated to the study of uranium mobility in marine sediments characterized by detrital terrigenous composition (pelagic clays). This approach allowed quantifying the entering and leaving flux of uranium after the sediment settling and, to discuss, on this basis, the consequences on the uranium oceanic balance. In the third part the origin and behavior of uranium in zones of high surface productivity is studied. The uranium enrichments observed in the hemi-pelagic sediments of the EUMELI (J.G.O.F.S.-France) programme will constitute a material of study adequate for measuring the variations in the 234U/238U ratio in solid phase, in response to the oxido-reducing characteristics of the sediment. Thus establishing the origin of the trapped uranium has been possible. Also, the nature of the sedimentary phases related to uranium in bio-genetic sediments in the Austral Ocean was determined. Thus a relationship between the variations in the 234U/238 and the diagenetic transformations was possible to establish. Finally in the fifth part a study of the behavior of uranium in a polymetallic shell characteristic for deposits of hydrogenized origin

  19. Fission Product Yields for 14 MeV Neutrons on 235U, 238U and 239Pu (United States)

    Mac Innes, M.; Chadwick, M. B.; Kawano, T.


    We report cumulative fission product yields (FPY) measured at Los Alamos for 14 MeV neutrons on 235U, 238U and 239Pu. The results are from historical measurements made in the 1950s-1970s, not previously available in the peer reviewed literature, although an early version of the data was reported in the Ford and Norris review. The results are compared with other measurements and with the ENDF/B-VI England and Rider evaluation. Compared to the Laurec (CEA) data and to ENDF/B-VI evaluation, good agreement is seen for 235U and 238U, but our FPYs are generally higher for 239Pu. The reason for the higher plutonium FPYs compared to earlier Los Alamos assessments reported by Ford and Norris is that we update the measured values to use modern nuclear data, and in particular the 14 MeV 239Pu fission cross section is now known to be 15-20% lower than the value assumed in the 1950s, and therefore our assessed number of fissions in the plutonium sample is correspondingly lower. Our results are in excellent agreement with absolute FPY measurements by Nethaway (1971), although Nethaway later renormalized his data down by 9% having hypothesized that he had a normalization error. The new ENDF/B-VII.1 14 MeV FPY evaluation is in good agreement with our data.

  20. Fission Product Yields for 14 MeV Neutrons on 235U, 238U and 239Pu

    International Nuclear Information System (INIS)

    We report cumulative fission product yields (FPY) measured at Los Alamos for 14 MeV neutrons on 235U, 238U and 239Pu. The results are from historical measurements made in the 1950s–1970s, not previously available in the peer reviewed literature, although an early version of the data was reported in the Ford and Norris review. The results are compared with other measurements and with the ENDF/B-VI England and Rider evaluation. Compared to the Laurec (CEA) data and to ENDF/B-VI evaluation, good agreement is seen for 235U and 238U, but our FPYs are generally higher for 239Pu. The reason for the higher plutonium FPYs compared to earlier Los Alamos assessments reported by Ford and Norris is that we update the measured values to use modern nuclear data, and in particular the 14 MeV 239Pu fission cross section is now known to be 15–20% lower than the value assumed in the 1950s, and therefore our assessed number of fissions in the plutonium sample is correspondingly lower. Our results are in excellent agreement with absolute FPY measurements by Nethaway (1971), although Nethaway later renormalized his data down by 9% having hypothesized that he had a normalization error. The new ENDF/B-VII.1 14 MeV FPY evaluation is in good agreement with our data.

  1. 238U, 232Th and 40K radioactivity level of soil and concrete floor in Zhuhai, Guangdong province, China

    International Nuclear Information System (INIS)

    In-situ gamma-ray spectrometer survey is carried out in Zhuhai, Guangdong province from 2002 to 2003 in order to estimate the radiation level of natural radionuclides. Measured area is more than 100 km2 and 970 sites with NaI(Tl) (φ75 mm x 75 mm) gamma-ray spectrometer. The specific activity of 40K, 238U and 232Th are 654.2 ± 338.0, 85.7 ± 31.6, and 159.9 ± 49.0 Bq·kg-1 in weathered granite, and 632.3 ± 75.1, 35.2 ± 14.6 and 70.2 ± 18.6 Bq·kg-1 in the sediments, respectively. Biotite Granite is the source of 40K, 238U and 232Th in the medium on ground in Zhuhai. The specific activity of natural radionuclides have significant dependence relation with geological background, such as lithology. (authors)

  2. Measurements of /sup 234/U, /sup 238/U and /sup 230/Th in excreta of uranium-mill crushermen

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, D.R.; Jackson, P.O.; Brodacynski, G.G.; Scherpelz, R.I.


    Uranium and thorium levels in excreta of uranium mill crushermen who are routinely exposed to airborne uranium ore dust were measured. The purpose was to determine whether /sup 230/Th was preferentially retained over either /sup 234/U or /sup 238/U in the body. Urine and fecal samples were obtained from fourteen active crushermen with long histories of exposure to uranium ore dust, plus four retired crushermen and three control individuals for comparison. Radiochemical procedures were used to separate out the uranium and thorium fractions, which were then electroplated on stainless steel discs and assayed by alpha spectrometry. Significantly greater activity levels of /sup 234/U and /sup 238/U were measured in both urine and fecal samples obtained from uranium mill crushermen, indicating that uranium in the inhaled ore dust was cleared from the body with a shorter biological half-time than the daughter product /sup 230/Th. The measurements also indicated that uranium and thorium separate in vivo and have distinctly different metabolic pathways and transfer rates in the body. The appropriateness of current ICRP retention and clearance parameters for /sup 230/Th in ore dust is questioned.

  3. Effect of U-238 and U-235 cross sections on nuclear characteristics of fast and thermal reactors

    Energy Technology Data Exchange (ETDEWEB)

    Akie, Hiroshi; Takano, Hideki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Kaneko, Kunio


    Benchmark calculation has been made for fast and thermal reactors by using ENDF/B-VI release 2(ENDF/B-VI.2) and JENDL-3.2 nuclear data. Effective multiplication factors (k{sub eff}s) calculated for fast reactors calculated with ENDF/B-VI.2 becomes about 1% larger than the results with JENDL-3.2. The difference in k{sub eff} is caused mainly from the difference in inelastic scattering cross section of U-238. In all thermal benchmark cores, ENDF/B-VI.2 gives smaller multiplication factors than JENDL-3.2. In U-235 cores, the difference is about 0.3%dk and it becomes about 0.6% in TCA U cores. The difference in U-238 data is also important in thermal reactors, while there are found 0.1-0.3% different v values of U isotopes in thermal energy between ENDF/B-VI.2 and JENDL-3.2. (author)

  4. Measurement of the fast neutron capture cross section of /sup 238/U relative to /sup 235/U(n,f)

    Energy Technology Data Exchange (ETDEWEB)

    Fawcett, L.R. Jr.; Poenitz, W.P.; Smith, D.L.


    The capture cross section of /sup 238/U was measured using the activation technique and /sup 235/U(n,f) as a reference cross section. Capture events were measured by detection of two prominent ..gamma..-transitions in the decay of the /sup 239/U daughter nuclide, /sup 239/Np, employing a high resolution Ge(Li) detector. The system was calibrated with samples activated in a thermal neutron flux relative to the capture cross section of gold, and with an absolutely calibrated ..cap alpha..-emitter, /sup 243/Am, which decays to /sup 239/Np. Cross section measurements were carried out in the neutron energy range from 30 keV to 3 MeV. Emphasis was on absolute values between 150 keV and 1 MeV where the /sup 238/U(n,..gamma..) cross section and its cross section is small. Background from fission products was found to restrict the accuracy of the measured data at energies > 1.5 MeV.

  5. Redundant 230Th/ 234U/ 238U, 231Pa/ 235U and 14C dating of fossil corals for accurate radiocarbon age calibration (United States)

    Chiu, Tzu-Chien; Fairbanks, Richard G.; Mortlock, Richard A.; Cao, Li; Fairbanks, Todd W.; Bloom, Arthur L.


    230Th/ 234U/ 238U dating of fossil corals by mass spectrometry is remarkably precise, but some samples exposed to freshwater over thousands of years may gain and/or lose uranium and/or thorium and consequently yield inaccurate ages. Although a δ 234U initial value equivalent to modern seawater and modern corals has been an effective quality control criterion, for samples exposed to freshwater but having δ 234U initial values indistinguishable from modern seawater and modern corals, there remains a need for additional age validation in the most demanding applications such as the 14C calibration (Fairbanks et al., 2005. Radiocarbon calibration curve spanning 0 to 50,000 years BP based on paired 230Th/ 234U/ 238U and 14C dates on pristine corals. Quaternary Science Reviews 24(16-17), 1781-1796). In this paper we enhance screening criteria for fossil corals older than 30,000 years BP in the Fairbanks0805 radiocarbon calibration data set (Fairbanks et al., 2005) by measuring redundant 230Th/ 234U/ 238U and 231Pa/ 235U dates via multi-collector magnetic sector inductively coupled plasma mass spectrometry (MC-MS-ICPMS) using techniques described in Mortlock et al. (2005. 230Th/ 234U/ 238U and 231Pa/ 235U ages from a single fossil coral fragment by multi-collector magnetic-sector inductively coupled plasma mass spectrometry. Geochimica et Cosmochimica Acta 69(3), 649-657.). In our present study, we regard paired 231Pa/ 235U and 230Th/ 234U/ 238U ages concordant when the 231Pa/ 235U age (±2 σ) overlaps with the associated 230Th/ 234U/ 238U age (±2 σ). Out of a representative set of 11 Fairbanks0805 (Fairbanks et al., 2005) radiocarbon calibration coral samples re-measured in this study, nine passed this rigorous check on the accuracy of their 230Th/ 234U/ 238U ages. The concordancy observed between 230Th/ 234U/ 238U and 231Pa/ 235U dates provides convincing evidence to support closed system behavior of these fossil corals and validation of their 230Th/ 234U/ 238U

  6. Trace metal cycling and 238U/235U in New Zealand's fjords: Implications for reconstructing global paleoredox conditions in organic-rich sediments (United States)

    Hinojosa, Jessica L.; Stirling, Claudine H.; Reid, Malcolm R.; Moy, Christopher M.; Wilson, Gary S.


    Reconstructing the history of ocean oxygenation provides insight into links between ocean anoxia, biogeochemical cycles, and climate. Certain redox-sensitive elements respond to changes in marine oxygen content through phase shifts and concomitant isotopic fractionation, providing new diagnostic proxies of past ocean hypoxia. Here we explore the behavior and inter-dependence of a suite of commonly utilized redox-sensitive trace metals (U, Mo, Fe, and Mn) and the emerging "stable" isotope system of U (238U/235U, or δ238U) in New Zealand fjords. These semi-restricted basins have chemical conditions spanning the complete redox spectrum from fully oxygenated to suboxic to intermittently anoxic/euxinic. In the anoxic water column, U and Mo concentrations decrease, while Fe and Mn concentrations increase. Similarly, signals of past euxinic conditions can be found by U, Mo, Fe, and Mn enrichment in the underlying sediments. The expected U isotopic shift toward a lower δ238U in the anoxic water column due to U(VI)-U(IV) reduction is not observed; instead, water column δ238U profiles are consistent in fjords of all oxygen content, falling within previously reported ranges for open ocean seawater (δ238U = -0.42 ± 0.07‰). Additionally, surface sediment δ238U results show evidence for competing U isotope fractionation processes. One site indicates increased export of 238U from seawater to the underlying sediments (fractionation between aqueous seawater U and particulate sediment U, or ΔU(aq)-U(solid) = -0.25‰), consistent with redox-driven fractionation. Another site suggests potential U(VI) adsorption-driven fractionation, reflecting increased export of 235U from seawater to sediments (ΔU(aq)-U(solid) = 0.25‰). We discuss several potential factors that could alter δ238U in waters and sediments beyond redox-driven shifts, including adsorption to organic matter in waters of high primary productivity, reaction rates for competing processes of U adsorption and

  7. Towards A Modern Calibration Of The 238U/235U Paleoredox Proxy: Apparent Uranium Isotope Fractionation Factor During U(VI)-U(IV) Reduction In The Black Sea (United States)

    Rolison, J. M.; Stirling, C. H.; Middag, R.; Rijkenberg, M. J. A.; De Baar, H. J. W.


    The isotopic compositions of redox-sensitive metals, including uranium (U), in marine sediments have recently emerged as powerful diagnostic tracers of the redox state of the ancient ocean-atmosphere system. Interpretation of sedimentary isotopic information requires a thorough understating of the environmental controls on isotopic fractionation in modern anoxic environments before being applied to the paleo-record. In this study, the relationship between ocean anoxia and the isotopic fractionation of U was investigated in the water column and sediments of the Black Sea. The Black Sea is the world's largest anoxic basin and significant removal of U from the water column and high U accumulation rates in modern underlying sediments have been documented. Removal of U from the water column occurs during the redox transition of soluble U(VI) to relatively insoluble U(IV). The primary results of this study are two-fold. First, significant 238U/235U fractionation was observed in the water column of the Black Sea, suggesting the reduction of U induces 238U/235U fractionation with the preferential removal of 238U from the aqueous phase. Second, the 238U/235U of underlying sediments is related to the water column through the isotope fractionation factor of the reduction reaction but is influenced by mass transport processes. These results provide important constraints on the use of 238U/235U as a proxy of the redox state of ancient oceans.

  8. Environmental geochemistry of 238U, 232Th, 40K and some heavy metals in River Nile sediments

    International Nuclear Information System (INIS)

    Environmental geochemistry is concerned with the abundance, distribution, and mobility of chemical elements in surface materials at the surface of earth crust. This study aimed at better understanding of geochemical behavior of 238U,23'2Th and 40K in river sediments and some heavy elements with emphasis on Mg, Ca, Mn, Fe, Ni, Cu, Zn and Pb. The analysis was conducted for a total of 33 bulk sediment samples from White Nile, Blue Nile and River Nile within Khartoum, the samples were fractionated into seven grain sizes each (2000-1000, 1000-500, 500-250, 250-200, 200-125, 125-100 and > 100 μm), using high resolution gamma spectrometer for radionuclides measurements, whereas Particle Induced X-ray Emission (PIXE) was used for heavy metals analysis. On the average, the activity concentration of 238U, 232Th and 40K were 17.90±5.23, 16.38±5.34 and 379.82±107.76 Bq -1Kg in White Nile, 19.56±5.04, 17.72±4.69, and 494.36±105.79 Bq -1Kg in Blue Nile and 19.27±2.88, 17.48±2.78, 359.50±83.15 Bq -1Kg in the River Nile sediments. Results revealed inverse relationship between activity concentration and grain size in White and Blue Nile, while the trend is not clear in the River Nile. In general, the variation of the measured values within single grain size was smaller in White Nile compare to Blue and River Nile sediments, and it was observed that the data are highly scattered in grain size (200-125μm). The ratio between 238U/232Th is grater than unity in the three rivers indicating that there is relative enrichment of 238U in the surface sediments. The activity concentration of the fallout radionuclide 137Cs is one order of magnitude lower in the White Nile sediments (0.89±0.96) Bq -1Kg compared to values in the Blue Nile sediments (3.60±1.55) Bq -1Kg. Comparison of the values obtained for natural radionuclides and the fallout radionuclide (137Cs in the three sites with the global data reflect low and /or insignificant difference. For heavy metal concentrations



    Fellone, Lucio


    Versione autorizzata in italiano del Comunicato Stampa della IARC N°238 pubblicato il 21 ottobre 2015: "L’ ESPOSIZIONE A BASSE DOSI DI RADIAZIONI IONIZZANTI AUMENTA IL RISCHIO DI MORTE A CAUSA DI TUMORI SOLIDI". Documento originale all'indirizzo: Authorized Italian version of the IARC Press Release N°238 published on 21 October 2015: Low doses of ionizing radiation increase risk of death from solid cancers...

  10. Effect of alternate administration of Ca-DTPA and Zn-DTPA for reducing incidence of 238Pu-induced osteosarcoma in rats

    International Nuclear Information System (INIS)

    For removing plutonium-238 from body and for reducing incidence of osteosarcoma in rats, Ca-DTPA and Zn-DTPA were alternately administered so as to decrease the side-effects of DTPA in this experiment. After a single intramuscular injection of 3.7 x 104 Bq/kg of plutonium-238 into rats, Ca-DTPA and Zn-DTPA were alternately injected intramuscularly for 90 days. The findings showed that the incidence of osteosarcoma in Ca-DTPA and Zn-DTPA treated rats was 10% against 40% in control rats. After 46 days of treatment with these chelating agents the retention activity of plutonium-238 in bone, liver and kidney was markedly lower than that for control rats

  11. Fragment characteristics from fission of 238U and 234U induced by 6.5-9.0 MeV bremsstrahlung (United States)

    Göök, A.; Chernykh, M.; Eckardt, C.; Enders, J.; von Neumann-Cosel, P.; Oberstedt, A.; Oberstedt, S.; Richter, A.


    Fission of 238U and 234U induced by bremsstrahlung of 6.5-9.0 MeV endpoint energy has been investigated at the superconducting Darmstadt electron linear accelerator S-DALINAC. Using a twin Frisch grid ionization chamber, fission-fragment energy and mass distributions have been determined by means of the double kinetic-energy technique. Results on the fission-fragment characteristics from U238(γ,f) are in agreement with results from the literature. In addition fission-fragment mass and energy distributions from U234(γ,f) are presented for the first time in this energy region. An analysis of fission modes within the Brosa model has been performed. The relative yield of the S1 mode was found to be (13±3)% in 234U and (35±2)% in 238U.

  12. BetaScintTM fiber-optic sensor for detecting strontium-90 and uranium-238 in soil. Innovative technology summary report

    International Nuclear Information System (INIS)

    Accurate measurements of radioactivity in soils contaminated with Strontium-90 (Sr-90) or Uranium-238 (U-238) are essential for many DOE site remediation programs. These crucial measurements determine if excavation and soil removal is necessary, where remediation efforts should be focused, and/or if a site has reached closure. Measuring soil contamination by standard EPA laboratory methods typically takes a week (accelerated analytical test turnaround) or a month (standard analytical test turnaround). The time delay extends to operations involving heavy excavation equipment and associated personnel which are the main costs of remediation. This report describes an application of the BetaScint trademark fiber-optic sensor that measures Sr-90 or U-238 contamination in soil samples on site in about 20 minutes, at a much lower cost than time-consuming laboratory methods, to greatly facilitate remediation. This report describes the technology, its performance, its uses, cost, regulatory and policy issues, and lessons learned


    Institute of Scientific and Technical Information of China (English)



    [ Objective] To understand the development of university graduates in love affair and its influencing factor,and to provide health education and reference for love affair among university students. [ Methods] By questionnaire investigation and in-depth interview, and we investigated the university students in grade four of different specialties in Neijiang Normal school, and followed up the love affair situation and its influencing factors. [Resutts] Among 238 university, the (marriage) rate of love affair was 33.6%, the lover of university students were mainly their classmates or alumnus, and accounted for 69.7%. Among 238 respondents, 79.4% had pre-marital sex, there was no significant difference in the incidence of premarital sex of marriage group and broken up group. After graduating from university, whether there was fixed work had influence on the marriage of college students, and the males graduates were lack of confidence in the establisbment of marriage and family, and their big psychological stress was higher than that of fematles [Conclusion] Carrying out health education of love and marriagefor the umversity students, it is advantageous in instructing university student reasonable heterosexual contacts, sensible to fall in love, seriously mate choice, and get married in a responsible manner.%[目的]了解大学毕业生的恋爱发展情况及其影响因素,为有针对性地对大学生们进行婚恋教育提供依据.[方法]采用问卷调查法及访谈法,对内江师范学院不同专业处于恋爱中的大四学生,跟踪调查其恋爱的发展情况及影响因素.[结果]238名大学毕业生恋爱结婚率为33.6%,大学毕业生的恋爱对象主要是中学和大学的同学或校友,共占69.7%.238名被调查者中有79.4%发生过婚前性行为,结婚组与分手组的婚前性行为的发生率无统计学差异.大学生们毕业后有无相对固定的工作对男女大学生的婚姻影响是有差异的,男毕业生对

  14. Application of 234U/238U isotope ratio data for the study of geochemical problems associated with local water sources from Aguas da Prata (SP, Brazil)

    International Nuclear Information System (INIS)

    The uranium-238, uranium-234 and radon content of spring waters of Aguas da Prata (SP) - Platina, Paiol, Villela, Sao Bento, Prata-Radioativa, Prata-Nova, Boi, Vitoria and Prata-Antiga - was found; the activity ratio AR (234U/238U) was applied to the geochemistry of local water sources. The uranium analysis procedure consisted of the following steps: adition of 232U-228Th spike to the samples, coprecipitation with iron, iron extraction with organic solvent, separation on anion-exchange resin, extraction with TTA, deposition on stainless steel disc and determination of uranium content by alpha spectrometry. The uranium-238 content changed from 0,10 to 11,56 ppb (average value = 2,3 ppb). The higher values were observed for the waters circulating through sandstones and the lower through volcanic rocks. The inverse correlation (r sub(s) =-0,76) between pH and uranium-238 content confirmed the contribution of this factor on its solubility. The significative correlation r sub(s) = 0,76 between dissolved oxygen and uranium-238 content also confirmed the higher uranium on the more oxidizing zones. The AR changed from 2,84 to 11,68 (average value = 6). These values defined the regional aquifer systems as mineralized in uranium. The higher AR were observed for the deep groundwaters and the lower for the shallow one. Because the 238U→234Th decay, the 234Th ejection to the solution was confirmed as the most important factor responsible for the extreme observed isotopic fractionation. (Author)

  15. The transfer of uranium isotopes 234U and 238U to the waters interacting with carbonates from Mendip Hills area (England)

    International Nuclear Information System (INIS)

    Laboratory time-scale experiments were conducted on limestone and dolomite gravels from the Mendip Hills area, England, with the purpose of evaluating the release of 238U and 234U to different aqueous solutions. The 234U/238U activity ratio (AR) lab data were reliable to interpret the field data. The obtained values do not indicate a reduction in the amount of dissolved U and an increase in the AR of the remaining dissolved U as commonly observed for groundwater systems close to redox boundaries

  16. The novel complex allele [A238V;F508del] of the CFTR gene: clinical phenotype and possible implications for cystic fibrosis etiological therapies. (United States)

    Diana, Anna; Polizzi, Angela Maria; Santostasi, Teresa; Ratclif, Luigi; Pantaleo, Maria Giuseppina; Leonetti, Giuseppina; Iusco, Danila Rosa; Gallo, Crescenzio; Conese, Massimo; Manca, Antonio


    Few mutations in cis have been annotated for F508del homozygous patients. Southern Italy patients who at a first analysis appeared homozygous for the F508del mutation (n=63) or compound heterozygous for the F508del and another mutation in the cystic fibrosis transmembrane conductance regulator gene (n=155) were searched for the A238V mutation in exon 6. The allelic frequency of the complex allele [A238V;F508del] was 0.04. When the whole data set was used (comprised also of 56 F508del/F508del and 34 F508del/other mutation controls), no differences reached the statistical significance in the clinical parameters, except chloride concentrations which were lower in [A238V;F508del]/other mutation compared with F508del/other mutation (P=0.03). The two study groups presented less complications than the control groups. Within the minimal data set (34 F508del/F508del, 27 F508del/other mutation, 4 [A238V;F508del]/F508del cases and 5 [A238V;F508del]/other mutation cases); that is, presenting all the variables in each patient, forced expiratory volume in 1 s and forced vital capacity presented a trend to lower levels in the study groups in comparison with the F508del/F508del group, and C-reactive protein approximated statistically significant higher levels in the [A238V;F508del]/other mutation as compared with F508del/F508del patients (P=0.09). The analysis of statistical dependence among the variables showed a significant anticorrelation between chloride and body mass index in the [A238V;F508del]/other mutation group. In conclusion, the complex allele [A238V;F508del] seems to be associated with less general complications than in the control groups, on the other hand possibly giving a worse pulmonary phenotype and higher systemic/local inflammatory response. These findings have implications for the correct recruitment and clinical response of F508del patients in the clinical trials testing the new etiological drugs for cystic fibrosis. PMID:26911355

  17. Radioactivity of 238U, 232Th, 40K, and 137Cs and assessment of depleted uranium in soil of the Musandam Peninsula, Sultanate of Oman


    SALEH, Ibrahim Hindawy


    238U, 232Th, 40K, and 137Cs radioactivities were determined in soil samples collected from the Musandam Peninsula, Sultanate of Oman, using a high resolution gamma-ray spectroscopy system. In addition, total uranium was measured in selected soil samples by inductively coupled plasma optical emission spectroscopy (ICP-OES). The averages of radioactivity levels in the soil for 238U, 232Th, and 40K were 14.42 Bq kg-1, 9.95 Bq kg-1, 158.21 Bq kg-1, and 2770 Bq m-2 for 137Cs, respectively...

  18. Association between -238 but not -308 polymorphism of Tumor necrosis factor alpha (TNF-alpha)v and unexplained recurrent spontaneous abortion (URSA) in Chinese population


    Zhou Sirui; Wang Jing; Liu Chunmei; Wang Binbin; Ma Xu


    Abstract Objectives TNF-alpha is a critical cytokine produced by Th1 cells while altered T helper 1 (Th1)-Th2 balance is found crucial for a successful pregnancy. Study Design A cohort of 132 Southern Chinese Han RSA patients and 152 controls constituted the subjects of this study. Two functional polymorphisms -308 and -238 of TNF-alpha were studied by association analysis. Results lack of association was found in TNF-alpha -308 SNP yet a significant difference was discovered in -238 polymorp...

  19. Resonance parameters of the 6.67-, 20.9-, and 36.8-eV levels in 238U

    International Nuclear Information System (INIS)

    The ENDF/B-IV 238U cross sections (MAT-1262) yield an effective capture resonance integral in strongly self-shielded situations which is too high. This situation suggests that the ENDF/B capture widths for the first few s-wave levels may be too large. Recent ORELA measurements of transmission through 238U have been analyzed with a multilevel formula to determine the parameters of the 6.67-, 20.9-, and 36.6-eV levels. These three levels provide 86 percent of the infinitely dilute capture resonance integral

  20. Production of new superheavy Z=108-114 nuclei with $^{238}$U, $^{244}$Pu and $^{248,250}$Cm targets

    CERN Document Server

    Feng, Zhao-Qing; Li, Jun-Qing


    Within the framework of the dinuclear system (DNS) model, production cross sections of new superheavy nuclei with charged numbers Z=108-114 are analyzed systematically. Possible combinations based on the actinide nuclides $^{238}$U, $^{244}$Pu and $^{248,250}$Cm with the optimal excitation energies and evaporation channels are pointed out to synthesize new isotopes which lie between the nuclides produced in the cold fusion and the $^{48}$Ca induced fusion reactions experimentally, which are feasible to be constructed experimentally. It is found that the production cross sections of superheavy nuclei decrease drastically with the charged numbers of compound nuclei. Larger mass asymmetries of the entrance channels enhance the cross sections in 2n-5n channels.