WorldWideScience

Sample records for bereitstellung eines atmosphaerischen

  1. Automatisierte Ordnungs- und Kommissionierzelle zur hochflexiblen Bereitstellung von Werkstücken in der Montage

    OpenAIRE

    Schmid, Stefan

    2006-01-01

    Der zunehmende nationale und internationale Wettbewerb und die steigenden Ansprüche der Verbraucher führten in den vergangenen Jahren zu einer Zunahme der Produktvielfalt mit immer kürzeren Produktlebenszyklen bei gleichzeitiger Abnahme der Fertigungslosgrößen. Diese Entwicklung führte dazu, dass der flexibel automatisierten Montage in der Klein- und Mittelserienfertigung eine immer größere Bedeutung zukommt. Bei flexiblen Montageanlagen erfolgt die Bereitstellung von Werkstücken vorwiege...

  2. Konversion des kulturellen Erbes für die Forschung: Volltextbeschaffung und -bereitstellung als Aufgabe der Bibliotheken

    Directory of Open Access Journals (Sweden)

    Thomas Stäcker

    2014-12-01

    Full Text Available Mit der Transformation des gedruckten Buch zum elektronischen Text verändern sich zentrale Rahmenbedingungen der Bibliothek. Die theoretischen Grundlagen des ‚Buches‘ müssen unter dem Gesichtspunkt des Digitalen neu durchdacht und auf ihre praktischen Konsequenzen hin geprüft werden. Vor allem die Transitivität, spezifische Schriftlichkeit und Prozessierbarkeit elektronischer Texte sind Eigenschaften, die Konsequenzen für eine ganze Reihe bibliothekarischer Kernaufgaben haben. Mit Blick auf das kulturelle Erbe, das in Bibliotheken verwahrt wird, stellt sich die Aufgabe, auf diesen Paradigmenwechsel angemessen zu reagieren und Sorge dafür zu tragen, dass das schriftliche und gedruckte Kulturgut auch in einer adäquaten maschinenlesbaren Form zur Verfügung steht. Nach gut 10 Jahren erfolgreicher Imagedigitalisierung muss daher jetzt, nach der Entwicklung entsprechender Techniken der nächste Schritt zur Herstellung, Aufbereitung und Bereitstellung von Volltext getan werden, um neuen, sich aus der digitalen Wende ergebenden Forschungsanforderungen und Forschungsfragen, die sich mit Begriffen wie Stilometrie, Clusteranalyse, Topic Modeling etc. verbinden, zu genügen. Den Bibliotheken wächst vor diesem Hintergrund in der Transformation des schriftlichen Kulturgutes und Bereitstellung von Volltexten eine neue Aufgabe zu. Sie können darin einen wichtigen Beitrag zum Aufbau einer Infrastruktur für eine digital arbeitende Geistes- und Kultwissenschaft bzw. die Digital Humanities leisten. The transformation of the book into an electronic text has led to constitutive changes in the functional frameworks of the library. Basic concepts of the notion of the ‘book’ have to be reconsidered and to be evaluated in view of the practical consequences. Above all, the transitivity of such texts, the specific mode of writing employed, and their ability to be processed are aspects that have considerable impact on several core tasks of the library. In

  3. Präparation spezieller Biokatalysatoren für die chemisch-technische Nutzung zur Bereitstellung von Aromaten und chiralen α-Hydroxyketonen

    OpenAIRE

    Bieler, Nora Christiane

    2011-01-01

    Teil 1 Bereitstellung der Biokatalysatoren LAC, LiP und MnP für deren chemisch-technische Nutzung Die drei Oxidoreduktasen Laccase (LAC), Lignin- und Manganperoxidase (Li- und MnP) aus Weißfäulepilzen sind technisch sehr interessant, da sie unter Anderem Lignin abbauen können. Vor allem deren zeitaufwändige Produktion in den ligninolytischen Organismen limitiert jedoch industrielle Anwendungen. Daher wurden Möglichkeiten zur Bereitstellung dieser Biokatalysatoren überprüft. So war es Ziel, di...

  4. Bereitstellung von Umgebungsinformationen und Positionsdaten für ortsbezogene Dienste in Gebäuden

    OpenAIRE

    Kessel, Moritz

    2013-01-01

    Mit dem Aufkommen und der steigenden Verbreitung von Smartphones, haben ortsbezogene Dienste einen festen Platz im täglichen Leben vieler Nutzer erhalten. Dabei werden auf Basis des Aufenthaltsortes gezielt Informationen gefiltert, Umgebungsinformationen verfügbar gemacht oder Suchergebnisse nach Lokalität bewertet. Zudem werden bestimmte Dienste, wie mobile Routenfindung und Navigation, ermöglicht. Viele Dienste beziehen nicht nur die Position eines Nutzers mit ein, sondern erlauben es, die ...

  5. Delivery of parameterization schemes for the determination of the regional evapotranspiration of different land surfaces. Final report; Bereitstellung von Parameterisierungsverfahren zur Bestimmung der regionalen Verdunstung verschiedener Landoberflaechen. Abschlussbericht 1997

    Energy Technology Data Exchange (ETDEWEB)

    Haenel, H.D.; Loepmeier, F.J.

    1998-03-01

    The task was the delivery of parameterization schemes for the calculation of the regional evapotranspiration of different land surfaces. The main weight was on the discussion of existing approaches and on the development of new ones for the calculation of evapotranspiration. After consideration of different concepts the well-known Penman-Monteith equation proved to the optimal basis of calculation. The surface resistance, respectively the related bulk-stomata resistance, is an important part of the resistance pattern (analogous to Ohm`s law) on which the Penman-Monteith equation is based. Under consideration of the dependence of these resistances of the spatial scale (leaf, canopy) as well as of the time scale (hour, day) possibilities for their estimation were discussed. An important step to determine the surface resistances from literature data of vegetation evapotranspiration was the development of a converting scheme of Haude`s factors to surface resistances. For bare soil an approach was developed which allows approximately to give a new interpretation to surface resistances from evapotranspiration courses, described in literature as proportional to the square root of time. (orig.) [Deutsch] Die Aufgabenstellung bestand in der Bereitstellung von Parametrisierungsverfahren zur Bestimmung der regionalen Verdunstung verschiedener Landoberflaechen. Dabei lag das Schwergewicht auf der Diskussion bereits bestehender und der Entwicklung neuer Ansaetze zur Berechnung der Verdunstung. Nach der Betrachtung unterschiedlicher Konzepte erwies sich die bekannte Penman-Monteith-Gleichung als optimale Berechnungsgrundlage. Ein wesentlicher Bestandteil des der Penman-Monteith-Gleichung zugrundeliegenden Widerstandsschemas (Analogie zum Ohmschen Gesetz) ist der Oberflaechenwiderstand bzw. der damit verwandte Bulk-Stomatawiderstand. Unter Beruecksichtigung der Abhaengigkeit dieser Widerstaende sowohl von der raeumlichen Skala (Blatt/Bestand) als auch von der zeitlichen Skala

  6. Investigations of atmospheric input of polychlorinated dibenzo-p-dioxins and dibenzofurans into pasture. Pt. 1. Texts. Final report; Untersuchungen des atmosphaerischen Eintrags polychlorierter Dibenzo-p-dioxine und Dibenzofurane in Futterpflanzen. T. 1. Textband. Abschlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    McLachlan, M.S.; Welsch-Pausch, K.; Koemp, P.

    1998-07-01

    of a chemical in the plants as a function of time. A validation of this model for the less chlorinated PCBs showed, that the measured plant/air-partitioning and the corresponding components of the model can be extrapolated to environmental conditions. This model summarizes the results of this study and provides a valuable tool in understanding the enrichment of semivolatile lipophilic organic compounds in agricultural plants. (orig.) [Deutsch] Fuer die Exposition des Menschen gegenueber PCDD/F spielt die landwirtschaftliche Nahrungskette `Atmosphaere - Futterpflanze - Kuh - Milch/Rindfleisch - Mensch` die entscheidende Rolle. Das uebergreifende Ziel dieses Vorhabens war die Erstellung einer quantitativen Beziehung zwischen der Immissionsbelastung mit PCDDF/F und Futtermittelkonzentrationen. Die Identifizierung der wichtigsten atmosphaerischen Eintragswege von PCDD/F in Gruenlandpflanzen wurde unter naturnahen Bedingungen im Rahmen eines kombinierten Gewaechshaus-Freilandversuches durchgefuehrt. Es wurde deutlich, dass fuer die Cl{sub 4-6}DD/F die trockene gasfoermige und fuer die Cl{sub 7/8}DD/F die trockene partikelgebundene Deposition der Hauptaufnahmepfad ist. Aus einem weiteren Gewaechshausversuch ergaben sich deutliche Hinweise auf einen isomerenunspezifischen Photoabbau von PCDD/F auf Pflanzenoberflaechen. Die trockene gasfoermige Deposition, die den Haupteintragsweg fuer die niederchlorierten toxikologisch relevanten PCDD/F darstellt, kann als Verteilung einer Verbindung zwischen der Gasphase der Atmosphaere und der Vegetation angesehen werden. Es wurde eine Reihe von Laborversuchen mit PCT, die als Modellverbindungen fuer die PCDD/F dienten, durchgefuehrt. Es konnten wichtige Erkenntnisse hinsichtlich der Pflanzen/Luft-Verteilung, ihrer Abhaengigkeit von Temperatur und Pflanzenart, ihrer Kinetik und Reversibilitaet gewonnen werden. Fuer die PCDD/F konnte keine Gleichgewichtseinstellung zwischen Pflanze und Atmosphaere beobachtet werden. Die Anreicherung von

  7. Aufbau eines Wertermittlungsinformationssystems

    OpenAIRE

    Mürle, Michael

    2007-01-01

    Das Buch beschreibt die Konzeption eines Geo-Informationssystems zur Eingabe, Verwaltung, Analyse und Präsentation von Geofachdaten des Grundstücksmarktes. Die Entwicklung von Zielkomponenten für den Aufbau eines Wertermittlungsinformationssystems orientiert sich an dem gesetzlichen Aufgabenkatalog der Gutachterausschüsse nach dem Baugesetzbuch. Zur sukzes-siven Analyse von Grundstücksmarktdaten wird eine stufenweise Analysestrategie auf der Grundlage von Ausgleichungsmodellen vorgeschlag...

  8. Die Position eines Supervisors

    OpenAIRE

    Teichmann, Volker

    2002-01-01

    Aus der Sicht eines Supervisors ist die Frage nach Qualitätssicherung Eulen nach Athen tragen. Supervision ist eines der ältesten Mittel der Qualitätssicherung und seit jeher integraler Bestandteil sowohl der Klinischen Psychologie als auch anderer Bereiche wie ABO oder Verkehrspsychologie. Ebenso sind Zertifizierung/Akkreditierung Selbstverständlichkeiten. Damit als erstes ein klares JA bezüglich der oben gestellten Frage. Verstanden als Reflexion des eigenen Handelns zur Optimierung d...

  9. Rezension: Ameisengesellschaften. Eine Faszinationsgeschichter

    Directory of Open Access Journals (Sweden)

    Raffaela Rogy

    2015-03-01

    Full Text Available In der wissenshistorischen Studie „Ameisengesellschaften. Eine Faszinationsgeschichte“ gibt der Professor für Neuere Deutsche Literatur Niels Werber an Hand eines interdisziplinären Medienaustausches zwischen naturwissenschaftlicher Fachliteratur, Belletristik und ausgewählten Filmen, einen lohnenden Einblick auf den kollektiven Verbund von Ameisen, der als Spiegel für menschliche Gesellschaftsformen gesehen werden kann.

  10. Inverter integrated in module - a comparison of different circuit concepts regarding costs, volumes and efficiency; Modulintegrierte Wechselrichter - ein Vergleich verschiedener Schaltungskonzepte bezueglich Kosten, Volumen und Wirkungsgrad

    Energy Technology Data Exchange (ETDEWEB)

    Myrzik, J. [Kassel Univ. (Gesamthochschule) (Germany); Krieger, T.; Zacharias, P. [Institut fuer Solare Energieversorgungstechnik (ISET), Kassel (Germany); Nijs, J.; Mey, B. de [IMEC, Leuven (Belgium); O`Mathuna, S.; Meinhardt, M. [NMRC, Cork (Ireland); Held, E. de; Jantsch, M. [ECN, Petten (Netherlands); Hofkens, H. [SOLTECH, Leuven (Belgium)

    1998-12-01

    In the context of a project supported by the EU, a miniaturised PV inverter integrated in a module is being developed as a laboratory sample. The main aim of this project is the provision of know-how for the industry. In order to provide aids to decision-making for industrial manufacture, different lines of development are being worked out for this purpose. The systematic listing and judging of different inverter topologies has proved successful in the development of a string inverter. To determine a suitable inverter topology, a systematic procedure is shown in this article, which was carried out with the aid of different circuit calculations. [Deutsch] Im Rahmen eines von der EU gefoerderten Projektes wird ein modulintegrierter, miniaturisierter PV-Wechselrichter als Labormuster entwickelt. Uebergeordnetes Ziel dieses Projektes ist die Bereitstellung von Know-how fuer die Industrie. Hierzu werden verschiedene Entwicklungslinien erarbeitet, um Entscheidungshilfen fuer die industrielle Fertigung bereit zu stellen. Bereits bei der Entwicklung eines Stringwechselrichters hat sich die systematische Aufstellung und Beurteilung verschiedener Wechselrichtertopologien bewaehrt. Zur Ermittlung einer geeigneten Wechselrichtertopologie wird in diesem Beitrag eine systematische Vorgehensweise aufgezeigt, die mit der Hilfe verschiedener Schaltungskalkulationen durchgefuehrt wurde. (orig.)

  11. Die neue Weltordnung:eine unipolare Ordnung oder eine Unordnung?

    OpenAIRE

    Peng, T.

    2006-01-01

    Das verstärkte Streben der USA nach der globalen Vorherrschaft, das insbesondere durch den Krieg gegen den Irak im Jahr 2003 zum Ausdruck gebracht worden ist, löst in der Wissenschaft und Politik die Debatte um eine neue unipolare oder multipolare Weltordnung aus. In dieser Debatte sehen viele Autoren ein erkennbares Ordnungsmuster in der Weltpolitik. Diese Arbeit führt eine kritische Auseinandersetzung mit der aktuellen Debatte um eine neue Weltordnung aus. Die Untersuchung der Arbeit weist ...

  12. Temporal variation of the anthropogenic CO{sub 2} and CH{sub 4} contribution in Germany and its role in the global atmospheric carbon cycle; Zeitliche Entwicklung des anthropogenen CO{sub 2}- und CH{sub 4}-Anteils in Deutschland und dessen Bedeutung fuer den globalen atmosphaerischen Kohlenstoffkreislauf

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, M.; Cuntz, M.; Kromer, B.; Levin, I.

    1999-12-01

    Bilanzierung von anthropogenenen Treibhausgasemissionen aus atmosphaerischen Messungen. An den Stationen Schauinsland und Heidelberg (Suedwestdeutschland) sowie Neuglobsow und Zingst (Nordostdeutschland) wurden die CO{sub 2}-, CH{sub 4}-, N{sub 2}O- und {sup 222}Rn-Mischungsverhaeltnisse ueber mehrere Jahre gemessen. Unter Verwendung von {sup 222}Rn als Transporttracer konnten die CH{sub 4}- und N{sub 2}O-Emissionen bilanziert werden. Innerhalb der Unsicherheiten dieser Abschaetzung sind die mittleren CH{sub 4}-Quelldichten fuer die Einzungsgebiete der vier Stationen mit (0.23{+-}0.07)g CH{sub 4} km{sup -2} s{sup -1} identisch, was auf die relativ homogene Bestandsdichte von Milchkuehen, die mit fast 60% zu den CH{sub 4}-Emissionen der jeweiligen Regionen beitragen, zurueckgefuehrt wird. Bei der Auswertung der N{sub 2}O-Datensaetze in Heidelberg konnten die Einfluesse lokaler Punktquellen (Kliniken) eliminiert werden, und es wurde eine 50 prozentige Abnahme der N{sub 2}O-Quelldichte von 1996/97 auf 1998 nachgewiesen. Diese faellt zeitlich zusammen mit einer dramatischen Reduktion der N{sub 2}O-Emissionen aus der Adipinsaeureproduktion der BASF AG Ende 1997. Eine quantitative Auswertung der CO{sub 2}-Emissionen in Heidelberg und am Schauinsland konnte durch eine Analyse der CO{sub 2}-Konzentrations- und Isotopenmessreihen unter Verwendung der Radon-Tracer-Methode erreicht werden. Die aus den atmosphaerischen {delta}{sup 14}C-Messungen fuer die Jahre 1982 bis 1998 bestimmte fossile CO{sub 2}-Quelldichte betraegt in Heidelberg im Mittel (502{+-}23) t C km{sup -2} a{sup -1} und fuer Schauinsland (274{+-}8) t C km{sup -2} a{sup -1}, sie zeigt fuer diesen Zeitraum keinen Trend. Dagegen ist die Aenderung der Zusammensetzung der eingesetzten fossilen Energietraeger (Gas, Erdoel und Kohle) in Heidelberg deutlich an der {delta}{sup 13}C-Signatur des fossilen CO{sub 2}-Anteils von (-28.6{+-}0.6) permille fuer 1982/83 auf (-38.5{+-}1) permille fuer 1995 bis 1998 zu erkennen. (orig.)

  13. Optimisation of a bioindicator monitoring network using geostatic methods and a geographic information system; Optimierung eines Bioindikator-Messnetzes mit Hilfe geostatischer Methoden und eines Geographischen Informationssystems

    Energy Technology Data Exchange (ETDEWEB)

    Forster, E.M.

    1994-04-01

    Since 1981 the Bavarian State Authority for Environment Protection has used mosses (hypnum cupressiforme) as bioindicators for determining atmospheric background pollution. Covering all of Bavaria the monitoring network comprises more than 370 sampling sites spaced 8 km apart in urban regions and otherwise 16 km. The extremely labour-intensive and costly operation of the network led to the idea to thin it in such a way that the loss of information on regional background pollution would be kept as small as possible and remain within acceptable bounds. The geostatic methods used for this purpose permit an areal estimation of pollution load giving due consideration to local values as well as a calculation of the forecast error. The present report is divided into two sections: The first deals with the determination of spatial dependences, while the second concens the selection of sampling sites. (orig./KW) [Deutsch] Seit 1981 werden Moose (Hypnum cupressiforme) als Bioindikatoren zur Ermittlung der atmosphaerischen Hintergrundbelastung vom Bayerischen Landesamt fuer Umweltschutz eingesetzt. Das landesweite Messnetz umfasst mehr als 370 Probenahmestandorte, die 16 km bzw. in Verdichtungsregionen 8 km von einander entfernt liegen. Der erhebliche personelle und finanzielle Aufwand fuehrte zu der Ueberlegung das Messnetz mit moeglichst geringem, noch aktzeptablen Informationsverlust bezueglich der grossraeumigen Hintergrundbelastung zu reduzieren. Hierbei kamen geostatistische Methoden zum Einsatz, da sie eine flaechenhafte Schaetzung der Immissionsbelastung unter Beruecksichtigung der Umgebungswerte ermoeglichen. Zudem kann der Schaetzfehler berechnet werden. Die vorliegende Arbeit gliedert sich daher in zwei Bereiche: Einerseits das Feststellen raeumlicher Abhaengigkeiten und andererseits die Auswahl der Probenahmestandorte. (orig./KW)

  14. Entwicklung eines programmierbaren Restriktionsenzyms

    OpenAIRE

    Eisenschmidt, Kristin

    2005-01-01

    In der vorliegenden Arbeit sollte die Spezifität der Restriktionsendonuklease scPvuII durch Kopplung mit der Spezifität eines TFOs (triple-helix forming Oligonukletids) erweitert werden. Hierfür wurde zuerst die scPvuIIH6G4C-Variante exprimiert und über Affinitätschromatographie gereinigt. Die DNA-Bindungseigenschaften dieser Variante wurden anschließend mit und ohne den Kofaktor Mg2+ mit Hilfe von Fluoreszenz-Anisotropie-Messung bestimmt. Anschließend wurde ein TFO mit dem C-terminalen Ende ...

  15. Kulturalistische Unternehmensethik : ein Programm

    OpenAIRE

    Hanekamp, Gerd

    2001-01-01

    "Das Programm einer kulturalistischen Unternehmensethik wird vorgestellt. Es gründet auf einem philosophischen Ansatz, der sich als instrumentalistisch, kontextualistisch, transsubjektivistisch und individualistisch charakterisieren lässt. Hinsichtlich der ethischen Grundlagen werden starke Thesen durch den Rekurs auf eine kontextualistisch-normative Anthropologie vermieden." (Autorenreferat)

  16. RAAS - ein leichtgewichtiges Managementkonzept

    OpenAIRE

    Priemel, Annett

    2002-01-01

    Gemeinsamer Workshop von Universitaetsrechenzentrum und Professur Rechnernetze und verteilte Systeme der Fakultaet fuer Informatik der TU Chemnitz. RAAS ist ein Konzept um gleichlautende Aufgaben für und über mehrere Remote-Computer auszuführen. Das Konzept wird dargestellt und anhand von Beispielen erläutert. Das Admin-Tool wird im Anschluss mit Praxisaufgaben vorgestellt.

  17. Ein Horchposten ins Universum

    OpenAIRE

    Aufmuth, P.

    2004-01-01

    Erst seit wenigen Jahren ist es möglich, Gravitationswellen nachzuweisen. Ein neu entwickelter Gravitationswellendetektor zeichnet sich durch besondere Empfindlichkeit aus. Mit seiner Hilfe lassen sich wichtige Informationen über Schwarze Löcher, dunkle Materie und den Ursprung des Alls gewinnen

  18. Diagnose: Entwicklungsstillstand - Ein Therapiebericht

    OpenAIRE

    Bronder, Gisela; Böttcher, Käte; Rohlfs, Sigrid

    1980-01-01

    Es wird uber ein verhaltenstherapeutisches Programm mit einem geistig schwerbehinderten, lO jährigen Mädchen berichtet, das extreme Eßschwierigkeiten ? Unfähigkeit, die Nahrung zu schlucken ?, sowie weder Spiel- und Sozialverhalten, noch Sprachverständnis zeigte. Das therapeutische Vorgehen beinhaltete operantes Konditionieren und Lernen am Modell, wobei imitatives Verhalten erst aufgebaut werden mußte. Nach dem Aufbau erster, einfacher Verhaltensweisen zeigte die Patientin zunehmend spontane...

  19. Prostatitis - eine endlose Geschichte?

    Directory of Open Access Journals (Sweden)

    Riedl CR

    2001-01-01

    Full Text Available Aktuelle epidemiologische Daten aus den USA zeigen, daß der urogenitale Symptomenkomplex, der langläufig als "Prostatitis" bezeichnet wird, ein nicht unbeträchtliches volksgesundheitliches und volkswirtschaftliches Problem darstellt: dieses Krankheitsbild ist jährlich für 2 Millionen Arztbesuche und für 8% aller urologischen Konsulationen in den USA verantwortlich. Umgekehrt sieht jeder Urologe im Jahr zwischen 150 und 250 Patienten mit "Prostatitis".

  20. Gauß eine Biographie

    CERN Document Server

    Mania, Hubert

    2009-01-01

    Daniel Kehlmann hat ihn wiederentdeckt, den bedeutendsten Mathematiker der Neuzeit: Karl Friedrich Gauß (1777 1855). Seine überragenden wissenschaftlichen Leistungen waren schon seinen Zeitgenossen bewusst. Da Gauß jedoch nur einen Bruchteil seiner Entdeckungen veröffentlichte, erschloss sich erst der Nachwelt die Tiefgründigkeit und Reichweite seines Werks. Hubert Mania schildert in dieser ersten umfassenden Biographie die Geschichte eines genialen Wissenschaftlers und zugleich eine ganze Epoche. Gauß war ein Mann, der in einer Welt des Aufbruchs völlig zurückgezogen lebte. Dabei hat er wie kaum ein anderer unsere Sicht der Welt revolutioniert. Als Erster formulierte er eine nichteuklidische Geometrie und schuf damit die unentbehrliche Grundlage zu Einsteins Entwicklung der allgemeinen Relativitätstheorie. Eine glänzend geschriebene Biographie des weltberühmten und doch so unbekannten Genies Karl Friedrich Gauß.

  1. Rechnet sich ein kleiner Nordstaat?

    OpenAIRE

    Lammers, Konrad

    2006-01-01

    Für eine umfassende Reform der bundesstaatlichen Ordnung wird häufig auch eine Neugliederung des Bundesgebietes für erforderlich gehalten. Was spricht aus der Sicht einzelner Länder dafür oder dagegen, von sich aus eine Neugliederung anzustreben? Welche Effekte sind zu erwarten, wenn sich Schleswig-Holstein und Hamburg zu einem kleinen Nordstaat zusammentun würden.

  2. Entwicklung, Umsetzung und Evaluierung eines dezentralen Lagerverwaltungssystems

    OpenAIRE

    Jung, Matthias; Le, Trung Thanh; Atz, Thomas; Günthner, Willibald A.

    2014-01-01

    Im Rahmen eines von der Deutschen Forschungsgemeinschaft (DFG) geförderten Projekts wird ein detailliertes Konzept, bestehend aus einer Softwarearchitektur und Steuerungsalgorithmen, für ein dezentrales Lagerverwaltungssystem (LVS) vorgestellt und evaluiert.

  3. Klimawandel als kollektives Risiko : ein Experiment zum Einfluss der Verlustrisikofunktion auf die Zielerreichung

    OpenAIRE

    Wiegand, Luisa

    2010-01-01

    In dieser Arbeit wird der Einfluss verschiedener Risikoszenarien auf das Verhalten von Gruppen untersucht. Das Problem der Bereitstellung des Klimaschutzes wird als Kollektivgut-Spiel modelliert. Gruppen, die an einem Experiment teilnahmen, in dem nur die Erreichung einer bestimmten Beitragssumme für die Bereitstellung des Klimaschutzes entscheidend war (diskretes Experiment), werden mit solchen verglichen, in deren Experiment sich Beiträge, wenn bereits hohe Beiträge geleistet worden waren, ...

  4. Teilchenphysik ein Sachcomic

    CERN Document Server

    Whyntie, Tom

    2014-01-01

    Auf den Weg in immer Kleineres macht sich der Infocomics-Band „Teilchenphysik“. Der Weg beginnt bei der Atomtheorie im antiken Griechenland, führt vorbei an den Entdeckungen der Elektronen, des Atomkerns, der Positronen, und macht vorläufige Rast beim Higgs-Teilchen. Damit sind wir etwa an der Grenze unseres Wissenstandes angelangt: Dem Standardmodell. Hierin gibt es zwölf Teilchen (6 Quarks und 6 Leptonen) und drei elementare Wechselwirkungen, die wieder durch Teilchen (Bosonen) vermittelt werden. Viele Mitglieder dieser Elementarfamilie sind sehr scheu und können nur für kurze Momente und nur mit experimenteller Gewalt „beobachtet“ werden. Das nächste Traumziel unserer Reise wäre dann die „Supersymmetrie“ und die Einbeziehung der Gravitation. Dort würden sich die beiden noch getrennten Theorien vom ganz Großen und vom ganz Kleinen vereinen und die „Schwarzen Löcher“ im Weltall sowie unseren Wissensstand aufhellen. Eine spannende Reise, zu der uns ein ehemaliger Mitarbeiter des CERN...

  5. Marketing : eine fallstudienbasierte Einführung

    NARCIS (Netherlands)

    Griese, K.M.; Bröring, S.

    2011-01-01

    Studenten sowie Praktiker erhalten eine praxisorientierte Einführung in die zentralen Grundlagen des Marketing. Ausgangspunkt jedes Kapitels ist eine Fallstudie, die eine konkrete praktische Rahmenbedingung eines Unternehmens vorstellt. Diese Situation wird in den Ausführungen dann mit den theoretis

  6. Geschlechtertheorie und Gleichstellungspraxis : eine theoretische und eine empirische Perspektive

    OpenAIRE

    Vollmer, Lina; Mosel, Juliane

    2014-01-01

    "Seit einigen Jahren finden in der hochschulischen Gleichstellungsarbeit Entwicklungen statt, die als Professionalisierungsprozesse gedeutet werden. Während das traditionelle Professionsverständnis für die Analyse der Gleichstellungsarbeit wenig zielführend ist, bieten dynamische Konzepte der Professionalisierung eine fruchtbare Forschungsperspektive. Zentral für die Professionalisierung ist dabei das an der jeweiligen Wissenschaft eines Tätigkeitsbereichs orientierte Expert-Innenwissen. Mit ...

  7. Ein Jahr Zugelassener Wirtschaftsbeteiligter (AEO)

    OpenAIRE

    Weerth, Carsten

    2009-01-01

    Der Zugelassene Wirtschaftsbeteiligte (AEO) wurde mit Wirkung vom 1. Januar 2008 geschaffen. Ein Jahr ist vergangen, nach dem es nun gilt, eine Zwischenbilanz zu ziehen – wurden die Erwartungen und Antragszahlen erreicht, was gibt es an Neuerungen und welche Tendenzen sind erkennbar? Neue rechtliche Rahmenbedingungen gelten ab dem 1. Januar 2009 – die Kriterien für alle zollrechtlichen Bewilligungen von vereinfachten Anmeldeverfahren und Anschreibeverfahren (Einfuhr, Ausfuhr, Zollverfahren mi...

  8. Topiramat als Phasenprophylaktikum - ein Fallbericht

    Directory of Open Access Journals (Sweden)

    Letmaier M

    2001-01-01

    Full Text Available Topiramat ist ein neues Antiepileptikum mit einem breiten Wirkspektrum. Aktuelle klinische Studien geben Hinweise darauf, daß Topiramat stimmungsstabilisierende Eigenschaften besitzt und somit effizient in der Behandlung der bipolaren affektiven Störung sein könnte. Vor dem Hintergrund dieser Studienberichte, behandelten wir eine 41jährige, erstmals vor 10 Jahren erkrankte Patientin mit der Diagnose einer therapierefraktären, bipolaren affektiven Störung (Rapid-Cycling mit Topiramat. Im Rahmen ihrer Erkrankung wurde die Patientin insgesamt 12mal stationär aufgenommen und meist aufgrund von akuten manischen Episoden behandelt. Dabei kamen seit 1991 folgende Phasenprophylaktika zur Anwendung: Carbamazepin, Valproat und Lamotrigin ? zuletzt nur mit mäßigem Erfolg. Daraufhin wurde zu Beginn einer neuerlichen manischen Episode ambulant eine Therapie mit Topiramat begonnen. Acht Wochen nach Therapiestart kam die Patientin in stationäre Behandlung. Der Aufenthalt dauerte weniger als drei Wochen; Topiramat wurde von der Patientin gut vertragen. Infolge eines belastenden Lebensereignisses kam es unter kontinuierlicher Therapie mit Topiramat zu einer Destabilisierung des psychischen Zustandsbildes (manische Symptome. Durch eine ambulante Erhöhung der Topiramatdosis bei gleichzeitiger Gabe von Risperidon und Clonazepam konnte jedoch eine neuerliche manische Episode erstmals ambulant behandelt werden. Die Patientin erhält derzeit 200 mg Topiramat pro Tag und ist seit mehr als 20 Monaten nahezu beschwerdefrei.

  9. Simulation of the propagation and deposition of polycyclic aromatic hydrocarbons for a winter-time period in Baden-Wuerttemberg; Simulation der Ausbreitung und Deposition von polyzyklischen aromatischen Kohlenwasserstoffen fuer eine Winterepisode in Baden-Wuerttemberg

    Energy Technology Data Exchange (ETDEWEB)

    Nester, K. [Forschungzentrum Karlsruhe (Germany). Inst. fuer Meteorologie und Klimaforschung

    1997-12-31

    Polycyclic aromatic hydrocarbons (PAHs) belong to the group of environmentally hazardous substances because of their cancerogenous effect. They occur both as gases and in particulate form and are released by man into the atmosphere as combustion products. They play a role not only in the atmosphere but also in soil. An essential process permitting these substances to penetrate into the soil is by deposition from the atmosphere.- The study had the aim of assessing atmospheric PAH deposition to the soil. The outcome is used to simulate PAH behaviour in soil, a task which also forms part of the interlaboratory project `soil`. As PAHs are regularly measured only in a few places, PAH transfer from atmosphere to soil needs to be numerically modelled. That the model can do this was first of all to be demonstrated for a short period. The result is described in the paper. Subsequently, statements regarding long-term PAH transfer are attempted. (orig.) [Deutsch] Die Polycyklischen Aromatischen Kohlenwasserstoffe (PAK) gehoeren wegen ihrer kanzerogenen Wirkungen zu den umweltbelastenden Substanzen. Sie treten sowohl als Gase als auch als Partikel auf und werden antropogen als Verbrennungsprodukte in die Atmosphaere freigesetzt. Neben ihrer Wirkung in der Atmosphaere spielen sie im Boden eine Rolle. Ein wesentlicher Prozess, der diese Substanzen in den Boden gelangen laesst, ist die Deposition aus der Atmosphaere zum Boden. Ziel der Untersuchungen war es, den atmosphaerischen Eintrag der PAK in den Boden zu bestimmen. Dieser Eintrag dient der Simulation des Verhaltens der PAK im Boden, der ebenfalls Bestandteil des Verbundprojekts `Boden` war. Da es nur wenige Stellen gibt, an denen regelmaessig PAK`s gemessen werden, ist es notwendig, den PAK Eintrag aus der Atmosphaere zum Boden mittels Modellrechnungen abzuschaetzen. Dabei sollte zunaechst fuer eine kurze Episode gezeigt werden, dass das Modell in der Lage ist, dies zu leisten. Dieses Ergebnis wird im folgenden vorgestellt

  10. Ein Vorgehensmodell zur Einführung eines integrativen Umweltcontrollings auf Basis eines ERP-Systems

    OpenAIRE

    Lang-Koetz, Claus

    2006-01-01

    Umweltwirkungen entstehen durch den Verbrauch von Stoffen und Energien sowie durch die Abgabe von Emissionen. Sie können durch die Optimierung der betrieblichen Stoff- und Energieströme im Sinne eines ökoeffizienten Wirtschaftens vermindert werden. Als Grundlage hierfür dient die Erhöhung der Transparenz der betrieblichen Stoffströme. Sie kann mit der Einrichtung eines Umweltcontrollings erreicht werden. Als dessen praktikabelstes Instrument haben sich Umweltkennzahlen erwiesen. Sie dienen...

  11. Main: EIN3ATERF1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available nding site found in the promoter of the Arabidopsis (A.t.) ERF1 (Ethylene-Response-Factor 1); EIN3 recognize...s its target as a homodimer; EIN3 is necessary and sufficient for ERF1 expression; Consititutive expression of ER...EIN3ATERF1 S000332 7-Sep-2000 (last modified) seki EIN3 (Ethylene-insensitive 3) bi...F1 results in the activation of a variety of ethylene response genes and phenotype; ER...F1 is a GCC-box binding site; ERF1 acts downstream of EIN3; EIN3; ERF1; Ethylene; Arabidopsis thaliana GGATTCAAGGGGCATGTATCTTGAATCC ...

  12. Ein robuster Zustandsbeobachter für ein semiaktives Fahrwerkregelsystem

    OpenAIRE

    Fröhlich, Martin

    2008-01-01

    Zur Entschärfung des Zielkonflikts zwischen Fahrsicherheit und Fahrkomfort werden in Fahrzeugen der Ober- und Mittelklasse vermehrt semiaktive Verstelldämpfersysteme eingesetzt. Im Rahmen dieser Arbeit wird ein Sensor- und Beobachterkonzept für ein solches semiaktives Fahrwerkregelsystem entwickelt, mit dem es möglich ist, die für die Regelung benötigten Bewegungsgrößen mit einer hohen Güte zu ermitteln. Die Schätzung der Bewegungsgrößen erfolgt mit dem vorgestellten Konzept robust gegenüber ...

  13. Eine systemtheoretische Betrachtung der Produktentwicklung

    OpenAIRE

    Pulm, Udo

    2007-01-01

    Produktentwicklung findet vielfach in einem komplexen sozialen System statt, in dem vollständige Transparenz und Kontrolle nicht möglich sind. Dieses Paradigma stellt eine qualitativ neue Ebene dar, die über ein gemeinsames Verständnis im Team und individuelle Denk- und Problemlöseprozesse hinausgeht. Mit Hilfe der Systemtheorie werden Ansätze entwickelt, die die Komplexität der Produktentwicklung verarbeiten helfen. Zu diesen zählen z. B. evolutionäre Entwicklungsstrategien, eindeutige Diffe...

  14. Ein graphbasierter Formalismus zur Programmmanipulation

    OpenAIRE

    Stadler, Bernhard

    2013-01-01

    In dieser Arbeit wird ein Formalismus zur implementierungs-, sprach- und repräsentationsunabhängigen Beschreibung von Programmmanipulationen wie beispielsweise Merge, Featurekomposition und Interaktionsanalyse entwickelt. Dieser soll insbesondere der anwendungsnahen und wiederverwendbaren Definition von Programmanipulationen dienen. Programmmanipulationen werden auf repräsentationsunabhängige, deklarative Art mit Mitteln der Kategorientheorie beschrieben. Auf Grundlage einer Analyse des Text-...

  15. Development of a model to describe organic films on aerosol particles and cloud droplets. Final report; Entwicklung eines Modells zur Beschreibung organischer Filme auf Aerosolteilchen und Wolkentropfen. Abschlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Forkel, R. (ed.); Seidl, W.

    2000-12-01

    Organic substances with polar groups are enriched on water surfaces and can form monomolecular surface films which can reduce the surface tension. A new model to describe surface films is presented, which describes in detail the film forming properties of fatty acids with up to 22 carbon atoms. The model is applied to measured concentrations of fatty acids (from the literature) in rain water and on aerosol particles and cloud droplets. An investigation of the sources of fatty acids has shown, that abrasion of the wax layer on leaves and needles is the main sources for surface film material in the western USA. Anthropogenic sources in urban areas are meat preparation and cigarette smoke. The agreement between model results and measurements when the model was applied to rain water confirms the original assumption that fatty acids are a main compound of surface films in rain water. For humid aerosol particles the application of the model on measured concentrations of fatty acids only showed strongly diluted films. Only for remote forest areas in western USA concentrated films were found, with the surface tension reduced by 20 to 30%. On cloud droplets the surface films is still more diluted than on aerosol particles. For all investigated cases the films was too much diluted to have an effect on the activation process of cloud droplets. (orig.) [German] Organische Substanzen mit polaren Gruppen reichern sich an der Wasseroberflaeche an und koennen monomolekulare Oberflaechenfilme bilden, die zu einer Verringerung der Oberflaechenspannung fuehren. Es wird ein neues Modell zur Beschreibung eines Oberflaechenfilms beschrieben, das detailliert die filmbildenden Eigenschaften der Fettsaeuren mit bis zu 22 Kohlenstoffatomen erfasst. Dieses Modell ist auf gemessene Konzentrationen von Fettsaeuren (Literaturdaten) in Regenwasser und auf atmosphaerischen Aerosolteilchen und Wolkentropfen angewandt worden. Eine Betrachtung der Quellen der Fettsaeuren zeigte, dass der Abrieb der

  16. Numerical simulation of heavy precipitation events using mesoscale weather forecast models. Validation with radar data and diagnosis of the atmospheric moisture budget; Numerische Simulation von Starkniederschlagsereignissen mit mesoskaligen Wettervorhersagemodellen. Ueberpruefung mit Radar-Daten und Diagnose der atmosphaerischen Wasserbilanz

    Energy Technology Data Exchange (ETDEWEB)

    Keil, C.

    2000-07-01

    Convective precipitation systems contribute substantially to the summertime rainfall maximum in the northern Alpine region. The capability of mesoscale weather forecast models in capturing such heavy precipitation events is investigated. The complementary application of so far hardly used areal radar data and conventional rain gauge observations enables a case-study-type evaluation of summertime precipitation episodes. Different rainfall episodes are simulated with the former operational model (DM, meshsize 14 km) of Deutscher Wetterdienst (DWD). The influence of the horizontal resolution and the parameterization of moist convection is subsequently studied with a higher resolution atmospheric model (MC2, meshsize 2 km). Diagnostic studies on the atmospheric water budget regarding the rainfall episode, which instigated the Oder-flood in summer 1997, allow an examination of the origin of the moisture and the genesis of the copious precipitation. (orig.) [German] Konvektive Niederschlagssysterne tragen im Nordalpenraum wesentlich zum sommerlichen Niederschlagsmaximum bei. Die Faehigkeit mesoskaliger Wettervorhersagemodelle, solche Starkniederschlagsereignisse zu erfassen, wird in dieser Arbeit untersucht. Durch den komplementaeren Gebrauch von, bisher kaum genutzten, flaechendeckenden Radardaten und konventionellen Niederschlagsmessungen des Bodenmessnetzes werden Modellergebnisse sommerlicher Niederschlagssysteme fallstudienhaft detailliert ueberprueft. Fuer verschiedene Starkniederschlagsereignisse werden dazu Modellsimulationen mit dem in den 90er Jahren operationellen Modell (DM, Maschenweite 14 km) des Deutschen Wetterdienstes (DWD) durchgefuehrt. Zur Untersuchung des Einflusses der horizontalen Maschenweite und der Niederschlagsparametrisierung werden ferner numerische Simulationen mit einem hoeher aufloesdenden Atmosphaerenmodell (MC2, Maschenweite 2 km) behandelt. Anhand diagnostischer Untersuchungen der atmosphaerischen Wasserbilanz laesst sich ausserdem die

  17. Entwicklung eines Gasmoderators f\\"ur Positronen

    CERN Document Server

    Löwe, Benjamin

    2016-01-01

    (Translated Title: Development of a positron gas moderator) In this work a positron moderator that is based on inelastic positron scattering in nitrogen gas has been developed and set-up. A positron beam enters a gas cell through a small aperture. In the cell the positrons lose kinetic energy through collisions with the nitrogen molecules. By means of an electric field the positrons are then focused towards an exit where their kinetic energy is analysed. During measurements at the NEPOMUC beam moderated positrons could be observed. ----- Im Rahmen dieser Diplomarbeit wurde das Konzept eines Moderators f\\"ur Positronen untersucht, welches auf der Abbremsung und dem Drift von Positronen in gasf\\"ormigem Stickstoff beruht. Dazu wurde ein Versuchsaufbau konstruiert, aufgebaut und in Betrieb genommen. Ein Positronenstrahl wird durch eine kleine Blende in eine Gaszelle eingekoppelt, dort durch St\\"o{\\ss}e mit den Gasmolek\\"ulen abgebremst, durch ein elektrisches Feld auf den Ausgang fokussiert und dahinter analysie...

  18. Account-Bereitstellung per Selbstbedienung

    OpenAIRE

    Grunewald, Dietmar

    2002-01-01

    Gemeinsamer Workshop von Universitaetsrechenzentrum und Professur Rechnernetze und verteilte Systeme der Fakultaet fuer Informatik der TU Chemnitz. Es werden Varianten gezeigt, wie neue Studenten der TU-Chemnitz Ihr Benutzerkennzeichen für URZ-Dienste selbst anlegen können.

  19. Zivilreligion: eine, mehrere oder keine mehr?

    OpenAIRE

    Saurma, Adalbert

    1988-01-01

    Gefragt wird, was Zivilreligion ist und welche Funktion sie in der modernen Gesellschaft hat. Zwei Typen von Zivilreligion werden unterschieden: eine generelle, aber gleichwohl nicht alle Staatsbürger erfassende Form und eine spezielle, sozusagen von den besonders Motivierten geteilte Form. Die erste Form ist eine gelebte Religion der Mehrheit, die auch politische oder ökonomische Machtverhältnisse einbezieht. Die zweite, in der Diskussion im Vordergrund stehende Form, ist die eigentlich zivi...

  20. Ist die Bank der Zukunft eine Bank?

    OpenAIRE

    Spremann, Klaus

    1997-01-01

    Ist die Bank der Zukunft noch eine Bank? Ist sie noch eine Bank mit Menschen, oder wird die virtuelle Bank das Modell der Zukunft sein? Haben die Filialen noch eine Chance, oder werden künftig alle Bankgeschäfte über Computer abgewickelt? Umfragen unter Kreditinstituten bestätigen, dass die gegenwärtig drängendste Frage ist, auf welchem Weg die Bank und der Mensch zusammenkommen.

  1. Ueber eine Anomalie von Acromitus flagellatus (Stiasny)

    NARCIS (Netherlands)

    Stiasny, G.

    1934-01-01

    Bei erneuter Durchsicht des reichhaltigen Materiales von Acromitus flagellatus (Stiasny) in der Scyphomedusen-Sammlung des Rijksmuseum van Natuurlijke Historie in Leiden (vergl. meine Mitteilungen daruber, 1920, Uebersichtstabelle III und 1921, p. 131/136) fand ich ein Exemplar, das eine bemerkenswe

  2. Das Haarkleid eines Fetus von Schimpanse

    NARCIS (Netherlands)

    Bolk, L.

    1919-01-01

    In seiner ausführlichen Arbeit über die Richtung der Haare bei den Affenembryonen nebst allgemeinen Erörterungen über die Ursachen der Haarrichtungen, hat Schwalbe eine Fülle von Tatsachen und eine wertvolle kritische Betrachtung über das Problem der Haarrichtungen geliefert. Leider war der Autor ni

  3. Auch eine Theorie der Moderne

    Directory of Open Access Journals (Sweden)

    Sabine Rohlf

    2002-11-01

    Full Text Available Barbara Hahn zeichnet die Wege schreibender Frauen durch 200 Jahre deutsch-jüdische Kulturgeschichte nach. Ausgehend von Paul Celans vieldeutiger Jüdin Pallas Athene, werden dabei stereotype Bilder der „Jüdin“, der „Intellektuellen“ und die scharfe Trennlinie zwischen humanistisch christlicher und jüdischer Tradition zur Diskussion gestellt. Mit Celans Figur schreibt sich gleichzeitig die theoretische Herausforderung in diese Studie ein, nach Ambivalenzen und Dialogen zu fragen, deren Voraussetzungen mit beispielloser Gewalt zerstört wurden. Gestützt auf Archivmaterial und veröffentlichte Texte der von ihr vorgestellten Frauen, spannt Hahn den Bogen von frühen Strategien der Assimilierung bis in die Jahre nach 1945. Das Buch ist keine Überblicksdarstellung, sondern präsentiert einzelne, einander auch überschneidende Konstellationen – intellektuelle Netzwerke, Briefwechsel, intertextuellen Transfer.

  4. Online Marketing: Aufbau eines Virtual‐Campus

    OpenAIRE

    Cina, Christian; Blatter, Martin; Glenz‐Mounir, Chantal

    2008-01-01

    Das Internet bietet für viele Klein‐ und mittlere Unternehmen (KMU) eine Riesenchance im Marketing. Jedoch zeigt uns das Internet ein anderes Bild. KMU nutzen das Potenzial des Online Marketings zu wenig. Oft aus Zeitgründen, aber viel mehr aus Desinteresse und Geldmangel. Dabei muss Online Marketing nicht teuer sein. Aus diesem Grund wurde ein Kurs auf dem LHR‐ und GBBcampus8 eingerichtet, der kostenlos zur Verfügung steht. Im Selbststudium und mit dem dazugehörigen Buch Marketing – Erfolg i...

  5. Das Gamma Knife - eine Übersicht

    Directory of Open Access Journals (Sweden)

    Kitz K

    2002-01-01

    Full Text Available Die Radiochirurgie ist eine moderne Behandlungsform, bei der eine stereotaktisch-lokalisierte und scharf gebündelte Hochdosisbestrahlung eingesetzt wird, um kleine intrakranielle Prozesse schonend auszuschalten. Besonders in der Therapie benigner und maligner Hirntumoren hat sich die Radiochirurgie als wertvoll erwiesen und wird zunehmend als wirksame Alternative zur offenen Operation eingesetzt. Die Gamma Knife-Radiochirurgie ist eine sichere, effektive und kostensparende Alternative zur herkömmlichen Chirurgie und gilt weltweit als "goldener Standard" in der radiochirurgischen Behandlung von Hirntumoren, Gefäßmalformationen und funktionellen Erkrankungen.

  6. Ein modulares Navigationssystem für die dentale Implantologie

    OpenAIRE

    Krüger, Timo

    2006-01-01

    Die vorliegende Arbeit stellt ein modulares Navigationssystem für die dentale Implantologie vor. Dentale Implantate sind Verankerungen im Knochen eines Patienten für Zahnprothesen. Die wichtigsten Anforderungen beim Setzen von Implantaten sind ein möglichst fester Sitz der Implantate im Knochen, die Schonung sensibler Strukturen, z.B. Nerven und Kieferhöhle, eine möglichst ästhetische Prothetik, eine hohe Langzeithaltbarkeit der Implantate im Knochen, die Möglichkeit der Sofortversorgung, sch...

  7. Kriterien für eine Staatsinsolvenz

    OpenAIRE

    Martin Schütte

    2010-01-01

    Martin Schütte, Ludwig-Maximilians-Universität München, betont in seinem Kommentar die Unverzichtbarkeit eines Insolvenzverfahrens für EU-Mitgliedstaaten und entwickelt dafür einen Kriterienkatalog.

  8. Vorstellung eines Studienbesuchs in Nordrhein-Westfalen

    OpenAIRE

    Maden , Sevinç Sakarya

    2013-01-01

    Das CEDEFOP koordiniert ab dem 1. Januar 2008 bis 2013 im Auftrag der Kommission die Studienbesuche für Bildungs- und Berufsbildungsfachleute und Entscheidungsträger. Ein Studienbesuch verläuft folgendermaßen: eine kleine Gruppe von Experten und Entscheidungsträgern, die verschiedene Bildungs- und Berufsbildungsgruppen vertreten, besuchen drei bis fünf Tage einen Mitgliedstaat der EU, um dort einen bestimmten Aspekt des lebenslangen Lernens zu untersuchen.

  9. Entwurf und Implementierung eines psychoakustischen Testsystems

    OpenAIRE

    Beckmann, Thomas

    2008-01-01

    Inhalt dieser Arbeit sind Entwurf und Umsetzung eines Testsystems, das der Befragung menschlicher Probanden zu psychoakustischen Fragestellungen dienen soll. Zu diesem Zweck soll es sowohl das Erstellen und Verwalten von Testszenarien als auch die Befragung registrierter Probanden selbst realisieren. Einzelnen Testfragen können dabei variabel lange Sounddateien zugewiesen werden. Die Speicherung der Fragebögen sowie der erhobenen Daten erfolgt mit Hilfe eines Datenbanksystems. Dabei liegt das...

  10. Validierung eines hybriden Sensornetzwerks im Hubschrauberrotorblatt

    OpenAIRE

    Manner, Stephanie

    2016-01-01

    Systeme zur Zustandsüberwachung (Health and Usage Monitoring Systems, HUMS) sind von zunehmender Bedeutung für die Sicherheit von Luftfahrzeugen. Diese Arbeit untersucht die Eignung von FBG-Sensoren als redundante Datenquelle für HUMS-Systeme in Hubschraubern. Ein FBG-Sensornetzwerk wird dazu in den Faserverbund eines Hubschrauberrotorblatts integriert und experimentell untersucht. Insbesondere werden die Signaleigenschaften wie das Driftverhalten, der Temperatureinfluss und die Kalibrierbark...

  11. Das Christentum, eine Religion der Gewalt?

    OpenAIRE

    Vinnai, Gerhard

    2009-01-01

    "Das Christentum ist seinem Selbstverständnis nach eine Liebesreligion, aber seine Geschichte ist nicht zuletzt auch eine Geschichte der Gewalt. Der Text versucht diesen Widerspruch zu erklären. Er untersucht mit den Mitteln der Analytischen Sozialpsychologie, ausgehend vom Text der Bibel, was in dieser Religion der Ausübung von Gewalt entgegenkommen kann." (Autorenreferat) "in its self-image the Christianity is a religion of love, but its history itself is a history of violence too....

  12. Einfluss eines schweren Traumas auf die Frakturheilung

    OpenAIRE

    Recknagel, Stefan

    2012-01-01

    Es gibt klinische Hinweise, dass die Frakturheilung bei polytraumatisierten Patienten gestört ist. Eine der Ursachen könnte die posttraumatische systemische Inflammation darstellen. Das Thoraxtrauma ist eines der häufigsten und zugleich kritischsten Begleitverletzungen, da es verglichen mit anderen Verletzungen zu einer stärkeren systemischen Inflammation führt. Diese systemische Inflammation ist gekennzeichnet durch die Freisetzung von pro inflammatorischen Zytokinen, einer starken Aktivieru...

  13. Coal biotechnology. Pt. 1: Coordination, evaluation, providence of material, coal specific analysis. Final report; Kohleveredlung biotechnologisch. Teilvorhaben 1: Koordination, Bewertung, Recherchen, Bereitstellung von Untersuchungsmaterial, kohlespezifische chemische Analysen. Abschlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Schacht, S.

    1994-03-01

    The joint project was initiated to investigate if and to which degree native or chemical pretreated coal can be metabolized or degraded by microorganisms. The experimental results obtained by university partners of the project indicated that anaerobic reaction mechanisms are not suited to convert coal and its macromolecular derivatives. During aerobic attack chelators, alcaline substances and oxidative enzymes are involved. Aerobic degradation reaches from a softening of the material to complete solubilisation of coal particles. A chemical characterisation and technological evaluation of these products has to be done. The state of science on the field of microbial degradation of coal was presented during two international symposia held in 1991 and 1993. It can be summarized that there is a need of research concerning optimisation of metabolic activities and scaling up technologies. (orig.) [Deutsch] Im Rahmen des Verbundvorhabens wird die Fragestellung bearbeitet, ob und in welchem Ausmass native und chemisch vorbehandelte (oxidierte) Kohle einem mikrobiellen Abbau zugaenglich ist und welchen Wertstoffcharakter die produzierten Umsatzprodukte aufweisen. Die experimentellen Ergebnisse der an den Universitaeten durchgefuehrten Teilvorhaben zeigen, dass anaerobe Reaktionsmechanismen fuer den Umsatz von Kohle nicht geeignet sind. Bei aerobem Angriff auf Kohle sind Chelatoren, alkalische Substanzen sowie oxidierende Enzyme als verantwortliche Agenzien nachgewiesen worden. Durch enzymatische Umsetzung tritt eine Vermorschung bis hin zur Verfluessigung von Kohle auf. Die chemische Charakterisierung und technologische Bewertung der verfluessigten Produkte steht noch aus. Der Stand der internationalen Aktivitaeten auf dem Gebiet der mikrobiellen Kohleumwandlung und -aufbereitung wurde im Rahmen zweier internationaler Symposien 1991 und 1993 dargestellt und bewertet. Hierbei zeigte sich, dass hinsichtlich der Optimierung der Umsatzreaktionen sowie der Ueberfuehrung der

  14. Development of an axially staged annular combustor with low residence times in the main stage. Final report; Entwicklung eines gestuften Brenners in Ringanordnung mit kleiner Aufenthaltszeit in der Hauptzone. Abschlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, H.J. [BMW Rolls-Royce GmbH, Dahlewitz (Germany). Abt. Brennkammerentwicklung; Theisen, D. [Technische Univ. Muenchen (Germany). Lehrstuhl fuer Flugantriebe

    1998-05-28

    Hauptbrenner wurde in Niederdruckversuchen untersucht, waehrend sich Hochdruckversuche den Emissionen von NO{sub x} und Russ sowie nach dem Temperaturprofil am Brennkammeraustritt widmeten. Darauf aufbauend wurde eine zweite Konfiguration mit intensivierter Mischung entwickelt. Mit dieser Brennkammer konnte eine deutliche Absenkung der Stickoxidemissionen und eine Verbresserung des Temperaturprofiles am Turbineneintritt gegenueber der Ausgangsbasis erreicht werden. Die aerothermische Auslegung und Optimierung der Brennkammer sowie die Interpretation der Messergebnisse wurde durch begleitende CFD-Rechnungen unterstuetzt. Zur Verbesserung der Genauigkeit bei der Berechnung der Schadstoffkomponenten wurde das im vorliegenden CFD Verfahren implementierte Verbrennungsmodell um ein Laminar-Flamelet-Modell erweitert. In einem begleitenden Vorhaben wurden am LFA die Gemischbildung sowie die Verbrennung in einem ebenen Modell der gestuften Brennkammer mit laserspektroskopischen Verfahren untersucht. Unter atmosphaerischen Bedingungen wurden zweidimensionale Konzentrationsverteilungen von OH, O{sub 2} und NO ermittelt. Dabei konnten charakteristische Unterschiede der Verbrennung fuer den ungestuften und den gestuften Fall verdeutlicht werden. Darueber hinaus wurde die Anwendbarkeit der flaechigen Temperaturmessung nach der Zwei-Linien-Thermometrie nachgewiesen. (orig.)

  15. Kinderwunsch Online Coaching - ein webbasiertes Selbsthilfeprogramm

    Directory of Open Access Journals (Sweden)

    Hämmerli K

    2009-01-01

    Full Text Available Immer mehr Paare bleiben ungewollt kinderlos. Obschon sich infertile Patienten generell bezüglich psychopathologischer Auffälligkeiten nicht von der Allgemeinbevölkerung unterscheiden, stellt die Zeit des Bangens und Hoffens auf ein Kind, die Behandlung und die Verarbeitung der Kinderlosigkeit eines der stressreichsten Lebensereignisse dar. Insbesondere während der reproduktionsmedizinischen Behandlung wurden kurzfristig erhöhte Werte in Depressivität und Ängstlichkeit bei infertilen Frauen bestätigt. Da oftmals psychologische Unterstützung fehlt und ein offener Umgang mit Infertilität für die Paare häufig schwierig ist, sucht eine Vielzahl infertiler Patienten aus dem Internet Informationen und Austausch – heute existieren unzählige Informationsseiten und Selbsthilfeforen zu Infertilität. Gleichzeitig besteht ein Mangel an empirisch und theoretisch fundierten psychologischen Unterstützungsansätzen. In diesem Beitrag wird das erste deutschsprachige webbasierte Selbsthilfebehandlungsprogramm für infertile Patienten vorgestellt. Erfahrungen einer ersten Evaluation des Programms werden diskutiert.

  16. Rapid Manufacturing - eine interdisziplinäre Strategie

    OpenAIRE

    Gebhardt, Andreas

    2006-01-01

    Als um 1987 ein Verfahren namens Stereolithographie und ein Stereolithography Apparatus (SLA) vorgestellt wurden, war der Traum von der Herstellung beliebiger dreidimensionaler Bauteile direkt aus Computerdaten und ohne bauteilspezifische Werkzeuge Realität geworden.

  17. Was macht erfolgreiche Bibliothekspolitik aus? Ein Seminarbericht

    Directory of Open Access Journals (Sweden)

    Rudolf Mumenthaler

    2015-04-01

    Full Text Available Im Rahmen eines Seminars an der HTW Chur wurden Möglichkeiten und Grenzen von Bibliothekspolitik in der Schweiz erläutert. Ausgehend von wenigen Fällen, bei denen es zu Protesten oder anderen Aktivitäten gekommen ist, wurden Akteurinnen und Akteure und ihr Einfluss untersucht, mögliche politische Instrumente analysiert und diskutiert, wie sich Bibliotheken aktiv beteiligen können. Im Ergebnis stellte sich heraus, dass Netzwerke in die Gesellschaft und die Politik von grosser Bedeutung sind. Im Falle eines Konflikts (Budgetkürzung, geplante Schliessung etc. kann sich dieses Netzwerk mit Hilfe der geeigneten politischen Instrumente für die Bibliothek einsetzen. Die Mobilisierung der Bevölkerung, die in den untersuchten Fällen klar auf der Seite der Bibliotheksanliegen war, ist dabei ein entscheidender Erfolgsfaktor.

  18. Numerische Simulation eines berührungsfrei gelagerten Rotors für eine Blutpumpe

    OpenAIRE

    Steinbrecher, Christian

    2007-01-01

    Im Rahmen dieser Arbeit wird eine neuartige Blutpumpe für ein Herzunterstützungssystem entwickelt, die ohne Lager betrieben werden kann. Dabei schwebt der Rotor frei in einem Gehäuse und wird nur durch hydrodynamische und magnetische Kräfte stabilisiert. Mittels stationärer Strömungssimulationen wird ein erster Prototyp der Blutpumpe entworfen und im Hinblick auf hydraulische Effizienz und hohe hydrodynamische Kräfte zur Rotorstabilisierung optimiert. Außerdem werden die Fluid-Struktur Wechse...

  19. Ende eines Dornröschenschlafs

    Directory of Open Access Journals (Sweden)

    Beate Kennedy

    2005-11-01

    Full Text Available Der gut recherchierte, zum Teil mit Abbildungen versehene Jubiläums-Band Irmgard Keun 1905/2005 bietet u. a. mit den Dokumentationen der Erstrezeption der frühen Romane Gilgi, eine von uns und Das kunstseidene Mädchen in der Weimarer Republik und der Rezeption der Exilromane in den Zeitschriften Das Wort und Internationale Literatur reichlich bisher schwer zugängliches Material. Die neuen Deutungen weisen zudem bei aller Verschiedenheit auf eine Verschiebung der Parameter in der Keun-Forschung hin: weg vom biographischen Zugriff, hin zu einer stärker erzähltheoretischen Orientierung.

  20. Managing Diversity und Gender Mainstreaming: ein Konzeptvergleich

    OpenAIRE

    Krell, Gertraude

    2004-01-01

    Seit einiger Zeit wird - vor allem von engagierten Praktikerinnen - beim Thema Chancengleichheit die Frage aufgeworfen, ob ein Fokus auf 'Gender' überhaupt noch zeitgemäß ist, und es wird gefordert, 'Gender' durch 'Diversity' bzw. Gender Mainstreaming (GM) durch Managing Diversity (MD) zu ersetzen. Die Autorin stellt vor diesem Hintergrund beide Ansätze zunächst kurz vor, um anschließend einen Konzeptvergleich vorzunehmen. Ob in einer Organisation GM oder MD umgesetzt wird, ist nach ihrer Ein...

  1. Die Teilhabegesellschaft Modell eines neuen Wohlfahrtsstaates

    OpenAIRE

    Offe, Claus; Grözinger, Gerd; Maschke, Michael

    2006-01-01

    Dass der Sozialstaat in seiner gegenwärtigen Form ein Auslaufmodell ist, darüber besteht mittlerweile weitgehend Konsens. Über die Alternativen wird noch gestritten. Zu den wohl provokantesten Alternativen gehört das Modell der Teilhabegesellschaft: Jeder junge Bürger soll mit 18 Jahren als Startkapital eine steuerfinanzierte Sozialerbschaft von 60 000 Euro erhalten. So soll ihr oder ihm die Chance eröffnet werden, seines eigenen Glückes Schmied zu sein. Die Finanzierung erfolgt aus der Beste...

  2. Talcott Parsons - Zur Zukunft eines Theorieprogramms

    OpenAIRE

    Luhmann, Niklas

    1980-01-01

    Die Form, in der Talcott Parsons die Theorie des allgemeinen Handlungssystems hinterlassen hat, ist bestimmt durch die Geschichte ihrer eigenen Entwicklung. Dennoch lassen sich die Grundentscheidungen, an die die weitere Forschung anknüpfen könnte, deutlich erkennen: Die Anhaltspunkte für eine Theorie des Systems werden aus einer Analyse des Begriffs des Handelns gewonnen. Probleme für die Weiterführung der Theorie könnten sich vor allem in zwei Hinsichten ergeben. Der eine Punkt betri...

  3. Development and evaluation of a meteorological model system for assessing the effect of environmental measures on climate and air quality. Vol. 1: Main part and appendices 1 through 5. Final report; Entwicklung und Evaluierung eines meteorologischen Modellsystems zur Folgenabschaetzung von Umwelteingriffen auf Klima und Luftqualitaet. Bd. 1: Hauptteil und Anhaenge 1 bis 5. Abschlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Bigalke, K. [METCON Umweltmeteorologische Beratung, Pinneberg (Germany); Schluenzen, K.H. [Hamburg Univ. (Germany). Meteorologisches Inst.

    2001-09-01

    The project focused on the development of a low-cost planning tool for authorities and consulting engineers which meets the envisaged national quality standards (VDI standards). The program system METRAS{sup +} consists of four components for preparation, implementation and quality assurance of mesoscale model calculations, all under Windows. The program system will not be commercialized; instead, it will be made available to interested users at a small fee by the Meteorological Institute of Hamburg University. [German] Ziel war die Bereitstellung eines kostenguenstigen Planungsinstrumentes fuer Behoerden und Beratungsunternehmen, das geplante nationale Qualitaetsnormen (VDI-Richtlinie) erfuellt. Vergleichbare Modelle existieren bislang nur im wissenschaftlichen Bereich, sind kaum qualitaetsgesichert und werden u.a. aus wirtschaftlichen Erwaegungen nur in Ausnahmefaellen eingesetzt. Das Programmsystem METRAS{sup +} setzt sich aus vier Programmkomponenten zusammen, die der Vorbereitung, Durchfuehrung und Qualitaetssicherung mesoskaliger Modellrechnungen dienen. Alle Programmkomponenten laufen unter einer gemeinsamen, anwenderfreundlichen Windowsoberflaeche. Um die breite Anwendung qualifizierter Untersuchungsmethoden im Umweltconsulting zu foerdern, ist geplant, METRAS{sup +} nicht kommerziell zu vertreiben und das Programmsystem interessierten Anwendern gegen einen geringen Kostenbeitrag zur Verfuegung zu stellen. Vertrieb und Oeffentlichkeitsarbeit sollen vom Meteorologischen Institut der Universitaet Hamburg geleistet werden. (orig.)

  4. Development and evaluation of a meteorological model system for assessing the effect of environmental measures on climate and air quality. Vol. 2: Appendices 6 through 10; Entwicklung und Evaluierung eines meteorologischen Modellsystems zur Folgenabschaetzung von Umwelteingriffen auf Klima und Luftqualitaet. Bd. 2: Anhaenge 6-10

    Energy Technology Data Exchange (ETDEWEB)

    Bigalke, K. [Hamburg Univ. (Germany). Meteorologisches Inst.; Schluenzen, K.H. [METCON Umweltmeteorologische Beratung, Pinneberg (Germany)

    2001-09-01

    The project focused on the development of a low-cost planning tool for authorities and consulting engineers which meets the envisaged national quality standards (VDI standards). The program system METRAS{sup +} consists of four components for preparation, implementation and quality assurance of mesoscale model calculations, all under Windows. The program system will not be commercialized; instead, it will be made available to interested users at a small fee by the Meteorological Institute of Hamburg University. [German] Ziel war die Bereitstellung eines kostenguenstigen Planungsinstrumentes fuer Behoerden und Beratungsunternehmen, das geplante nationale Qualitaetsnormen (VDI-Richtlinie) erfuellt. Vergleichbare Modelle existieren bislang nur im wissenschaftlichen Bereich, sind kaum qualitaetsgesichert und werden u.a. aus wirtschaftlichen Erwaegungen nur in Ausnahmefaellen eingesetzt. Das Programmsystem METRAS{sup +} setzt sich aus vier Programmkomponenten zusammen, die der Vorbereitung, Durchfuehrung und Qualitaetssicherung mesoskaliger Modellrechnungen dienen. Alle Programmkomponenten laufen unter einer gemeinsamen, anwenderfreundlichen Windowsoberflaeche. Um die breite Anwendung qualifizierter Untersuchungsmethoden im Umweltconsulting zu foerdern, ist geplant, METRAS{sup +} nicht kommerziell zu vertreiben und das Programmsystem interessierten Anwendern gegen einen geringen Kostenbeitrag zur Verfuegung zu stellen. Vertrieb und Oeffentlichkeitsarbeit sollen vom Meteorologischen Institut der Universitaet Hamburg geleistet werden. (orig.)

  5. Beitrag zur Entwicklung eines Einspritzsystems für ein teilhomogenes Brennverfahren in Pkw-Dieselmotoren

    OpenAIRE

    Espig, Stefan

    2013-01-01

    Die Absenkung der Schadstoffemissionen bei der motorischen Verbrennung ist für Fahrzeughersteller und Umwelt von großer Bedeutung. Dieses Ziel kann erreicht werden, indem bei der Verbrennung weniger Schadstoffe entstehen oder indem eine verbesserte Abgasnachbehandlung die Schadstoffe umwandelt oder herausfiltert. Im Rahmen dieser Arbeit werden innermotorische Maßnahmen zur Senkung der Schadstoffemissionen beim Dieselmotor betrachtet. Im Fokus steht die Anpassung des Einspritzsystems an ein al...

  6. Kabelfernsehen : eine Einführung

    OpenAIRE

    Zimmermann, Harald H.

    1984-01-01

    Es werden die wesentlichen Komponenten des Kabelfernsehens erklärt, mit dem Ziel, dem Bürger eine Entscheidung dafür oder dagegen zu ermöglichen. Es wird eingegangen auf technische Fragen, Kosten, fremdsprachige Programme, soziale Fragen u.a.

  7. Heinrich Bebel (1472 - 1518) : wider ein barbarisches Latein

    OpenAIRE

    Graf, Klaus

    2009-01-01

    Kann gutes Latein in einem Bewerbungsgespräch von Vorteil sein? Folgt man der Argumentation eines im Herbst 1501 vor der Tübinger Universitätsöffentlichkeit aufgeführten Dialogs, so wird man diese Frage ohne weiteres bejahen müssen. Im vierten Akt tritt ein Hofbeamter des Königs - gemeint ist Maximilian I. - auf, der als Antwort eine kleine Geschichte erzählt. In Innsbruck wandte sich ein ansonsten durchaus gebildeter Mann an Kardinal Peraudi, Botschafter des Papstes im Reich, um sich um eine...

  8. Relevanz eines persistierenden Foramen ovale bei pulmonal arterieller Hypertonie

    OpenAIRE

    Mascher, Ingo Frederik

    2015-01-01

    Die pulmonal arterielle Hypertonie (PAH) ist eine chronische Erkrankung der Blutgefäße in den Lungen. Sie kann unbehandelt innerhalb weniger Jahre durch ein Cor pulmonale chronicum mit konsekutivem Rechtsherzversagen zum Tode führen. Ein persistierendes Foramen ovale cordis (PFO) ist ein in den meisten Fällen wenige Millimeter kleines funktionell verschlossenes Loch. Bestimmte Druckverhältnisse, z.B. eine PAH, können das Foramen ovale öffnen und somit einen kardialen Rechts-Links-Shunt in...

  9. Musik – eine internationale Kunst?

    Directory of Open Access Journals (Sweden)

    Anna Langenbruch

    2009-12-01

    Full Text Available La musique est-elle un art international ? Échappant aux limites linguistiques, la musique semble destinée à transgresser le rigide système des frontières nationales. Néanmoins, la vie musicale ne reste pas à l’écart des conflits internationaux dans lesquels la musique est un instrument privilégié de construction et de consolidation de l’identité nationale. C’est de ce paradoxe que traitera cet article en se penchant sur l’image des musiciens germanophones dans le discours musical de la presse française. Les relations musicales entre la France et l’Allemagne, interrompues par la Première Guerre mondiale, sont renouvelées après les accords locarniens de 1925. Dans ce contexte, il est très intéressant de voir comment les concerts de plus en plus fréquents de musiciens allemands ou autrichiens sont accueillis par les critiques musicaux français. Dans quels contextes la nationalité des musiciens ou l’internationalité de la musique sont-elles évoquées ? Par quels concepts ou stéréotypes ? Et quelle était la place de la musique sur le plan complexe des relations franco-allemandes ? Dans cette perspective, la musique s’avère un art non pas sans frontières, mais un prisme oscillant entre le national et l’international.Ist Musik eine internationale Kunst? Tatsächlich scheint sich die Musik als nicht oder nur gering sprachgebundene Kunst einem festgefügten nationalen Grenzraster zu entziehen. Dennoch bleibt das Musikleben von internationalen politischen Konflikten natürlich nicht unberührt, sondern dient in diesem Zusammenhang nur allzu oft der Konstruktion und Konsolidierung nationaler Identität. Dieses Paradox möchte dieser Artikel anhand des Bildes deutschsprachiger Musiker im französischen musikjournalistischen Diskurs untersuchen. Ab etwa 1925 beginnen sich im Zuge des Vertrags von Locarno auch die musikalischen Beziehungen Deutschlands und Frankreichs, die der erste Weltkrieg unterbrochen hatte

  10. Theoretische Psychologie – Eine Systematik der Kontroversen

    OpenAIRE

    Fahrenberg, Jochen

    2015-01-01

    Eine Theoretische Psychologie – nach dem Vorbild der Theoretischen Biologie oder Physik – existiert nicht. In der Psychologie ist die Vielfalt der Theorien, auch der Wissenschaftstheorien, unübersehbar. Die Recherchen zu den herausragenden Kontroversen erfolgen auf drei Ebenen: (1) Die hauptsächlichen Strömungen und Richtungen der Psychologie werden hinsichtlich ihrer Postulate und Prinzipien, d.h. den Positionen der Erkenntnis- und Wissenschaftstheorie, untersucht. Nach Kant, Herbart...

  11. Systematische Literatursuche ohne DIMDI. Ein Szenario

    OpenAIRE

    Knüttel, Helge

    2016-01-01

    Im Rahmen der sog. Evidenzbasierten Medizin (EBM) wird versucht, Empfehlungen für medizinisches Handeln zu erstellen. Basis dafür ist, alle Studien der medizinischen Forschung zu einem bestimmten Thema im Rahmen eines transparenten, reproduzierbaren Prozesses zu finden und zu bewerten. Hierfür wurden methodische Standards entwickelt, die sich auch auf die Literatursuche erstrecken und dabei die Einbindung von Informationsspezialisten vorsehen. In diesem Bereich findet die Rolle klassischer In...

  12. Antiinflammatorische Wirkungen und Pharmakokinetik eines standardisierten Kiefernrindenextraktes

    OpenAIRE

    Grimm, Tanja

    2005-01-01

    In der vorliegenden Arbeit wurde erstmalig die Hemmung des induzierten Abbaus von Matrixproteinen sowie von Gelatine durch Matrixmetalloproteinasen mithilfe des Kiefernrindenextraktes Pycnogenol, einer Auswahl seiner Inhaltsstoffe und seiner Metabolite d-(3,4-Dihydroxyphenyl)-g-valerolacton (M1) und d-(3-Methoxy-4-hydroxyphenyl)-g-valerolacton (M2) untersucht. Beide Metabolite zeigten eine signifikante Hemmwirkung und lagen in der Effektivität ihrer Hemmung auf einer µg/ml-Basis immer leicht ...

  13. Information als Gegenstand von Informationskompetenz. Eine Begriffsanalyse

    OpenAIRE

    Ingold, Marianne

    2011-01-01

    Der Informationsbegriff als zentraler Gegenstand von Informationskompetenz wird in der bibliothekarischen Diskussion in der Regel nicht explizit thematisiert, sondern lässt sich aus Fachliteratur und Bibliothekspraxis nur implizit erschließen. Eine theoretische Beschäftigung mit dem Informationsbegriff ist jedoch unabdingbar, soll das Konzept "Informationskompetenz" auch außerhalb des bibliothekarischen Kontextes verständlich und nutzbar gemacht werden. Im vorliegenden Text, der sich als B...

  14. Robustheit – eine Anforderung an intralogistische Systeme

    OpenAIRE

    Wildner, Christian

    2013-01-01

    Zuletzt häuften sich Erwähnungen des Begriffs 'Robustheit' in Veröffentlichungen, die die Intralogistik betreffen. Der vorliegende Beitrag bietet einen Überblick über einige dieser Sichtweisen, beleuchtet ergänzend eine Reihe relevanter Aspekte und begründet den Vorschlag einer Ausrichtung von 'Robustheit' in der Intralogistik auf die Verringerung unternehmerischer Risiken. The term 'robustness' is mentioned with an increasing frequency in the lattest papers referring to in-tralogistics. T...

  15. Accounting for a waste combustion plant; Stoffbuchhaltung fuer eine Muellverbrennungsanlage

    Energy Technology Data Exchange (ETDEWEB)

    Belevi, H.; Langmeier, M.; Moench, H.; Baccini, P. [EAWAG, Duebendorf (Switzerland); Turban, Y.; Mueller, T. [Kehrichtverbrennungsanlage Oftringen (Switzerland)

    1998-02-01

    This article describes in detail a method for goods- and materials flow in a waste combustion plant. Starting with the concept and the systems analysis, the authors are describing in detail the selection of the elements which are analysed as well as the materials which are controlled (for example sewage sludge, slags, waste water). The evaluation of the data is shown. (SR) [Deutsch] Eine Methode fuer die kontinuierliche Erfassung, Visualisierung und Interpretation der Guete- und Stofffluesse in einer Muellverbrennungsanlage wird vorgestellt. Sie dient als Grundlage sowohl fuer ein betriebliches Umweltmanagement als auch fuer ein marktorientiertes Ressourcenmanagement. Sie erlaubt zudem eine permanente Qualitaetskontrolle und Qualitaetssicherung. Die ersten Ergebnisse zeigen, dass die Methode eine Erfassung der Gueterfluesse mit einer zeitlichen Aufloesung von einigen Tagen ermoeglicht. Die Stofffluesse koennen fuer Zeitabschnitte von einigen Wochen bestimmt werden. Eine bessere Aufloesung ist grundsaetzlich moeglich, erfordert jedoch einen hoeheren finanziellen Aufwand. (orig.)

  16. Eine Enzyklopädie – aber was für eine ?

    Directory of Open Access Journals (Sweden)

    Michael Hascher

    2001-11-01

    Full Text Available Die „Enzyklopädie der DDR“ ist, anders als die „Enzyklopädie des Nationalsozialismus“, die 1999 als Band 20 der „Digitalen Bibliothek“ erschienen war, nicht die elektronische Version eines auch in einer Printausgabe erhältlichen Werkes. Vielmehr werden hier drei ältere, gedruckte Nachschlagewerke zu einer elektronischen Ausgabe zusammengeführt. In der folgende Besprechung verweist der Verfasser auf einige Mängel, die gegen diese Form eines Nachschlagewerks sprechen. Andererseits sieht das Urteil über die Brauchbarkeit der Enzyklopädie für Arbeiten in der Frauen- und Geschlechtergeschichte nicht so negativ aus, denn abgesehen von ihren Schwachstellen ist die CD durchaus eine gut zugängliche Datenkompilation.

  17. Entwicklung eines ökologischen Bewertungsmodells zur Beurteilung elektronischer Systeme

    OpenAIRE

    Nissen, Nils Frederik

    2001-01-01

    In dieser Arbeit wird eine Methode für die Umweltbewertung elektronischer Systeme vorgestellt. Dieses System soll bereits etablierte Bewertungssysteme, wie die mittlerweile in der Öffentlichkeit bekannte Ökobilanzierung, nicht ersetzen, sondern durch eine modulare Grundstruktur bisherige Ansätze geeignet ergänzen und die Anwendbarkeit in der Praxis erhöhen. Der Hauptschwachpunkt der Ökobilanz und verwandter Systeme ist der immense Aufwand zur Datenrecherche, um für ein komplexes Elektronikpro...

  18. Antwortverhalten des Luftrettungsdienstes bei zeitsensitiven Einsätzen

    OpenAIRE

    Grashey, Rupert

    2004-01-01

    Ziel der Arbeit war eine Erhebung des Status quo der Notarztversorgung in einer Region in Nordostbayern, wobei die Bedeutung der Luftrettung analysiert und der Bedarf für eine Ausweitung der Einsatzbereitschaft festgestellt wurde. Untersucht wurde eine Region von 257 Gemeinden im Einsatzgebiet des Rettungshubschraubers (RTH) Christoph 20 mit Standort in Bayreuth. Als Datengrundlage dienten die von den beteiligten Rettungsleitstellen erhobenen Einsatzdaten des Jahres 2000. Das Untersuchu...

  19. Eine Zugprüfvorrichtung zur Untersuchung mikrostrukturierter Proben

    OpenAIRE

    Ilzhöfer, A.

    1999-01-01

    Die vorliegende Arbeit befaßt sich mit der Entwicklung einer Prüfvorrichtung zur Untersuchung mikrostrukturierter Proben und Bauteile. In eine konventionelle Zugprüfmaschine wird ein neu entwickelter Lastrahmen eingebaut. In diesen Lastrahmen sind ein Kraft- und mehrere Wegmeßsysteme integriert. Mit diesen Komponenten können Festigkeitsuntersuchungen an mikrostrukturierten Proben durchgeführt werden. Zur Untersuchung des Spannungs-Dehnungs-Verhaltens von unterschiedlichen mikrostrukturierten ...

  20. Ein Beitrag zum Schrägschneiden von Leichtbauprofilen

    OpenAIRE

    Kötter, Hanno

    2010-01-01

    Gegenstand der Dissertationsschrift ist eine Darstellung des gegebenen Wissensstandes zum Scherschneiden anhand der Literatur, mit einer Einordnung des Schrägschneidens. Auf dieser Grundlage erfolgt eine Verfahrens- und Prozeßbeschreibung des Schrägschneidens, als Variante des Scherschneidens, insbesondere eine Untersuchung des auftretenden Verschleisses. Es wird die Anwendung des Laser-Pulver-Auftragschweißen an Schneidwerkzeugen zur Verschleißminimierung erprobt und bewertet.

  1. Silikose mit Autoimmunphänomen eines Achatschleifers

    OpenAIRE

    Karabin-Kehl, Bianca; Mittmann-Frank, Michaela; Wilkens, Heinrike; Wennemuth, Gunther; Buchter, Axel

    2011-01-01

    Die Silikose ist ein seit langem bekanntes Krankheitsbild, das vor allem im Bereich des Kohlebergbaus, in der Steinbruch-, Keramik-, Glas-, Stahl- und Eisenindustrie (Gießereien) sowie im Baugewerbe (Stollenarbeiter und Mineure) vorkommt. Ein mittlerweile selten gewordenes Berufsbild stellt das Edelstein- bzw. Achat-Schleifen dar. Achat gehört zu den kieselsäurehaltigen Gesteinen, durch deren Verarbeitung bei langjähriger inhalativer Exposition eine Silikose entstehen kann.

  2. Entwicklung eines Gumstix-Expansion-Boards für ein UAV-basiertes Rehkitzrettungssystem

    OpenAIRE

    Neugebauer, Philipp

    2011-01-01

    Während der Frühjahrsmahd werden alleine in Deutschland geschätzte 100 000 Rehkitze durch Landmaschinen getötet. Grund dafür ist der fehlende Fluchtinstinkt der im hohen Gras liegenden Tiere. Um diese vor der Mahd aufzufinden, wird ein Lösungsansatz, der auf einem UAV-System (engl. unmanned aerial vehicle - unbemanntes Luftfahrzeug) basiert, verfolgt, mit dem aus der Luft eine Detektion der Rehkitze stattfindet. Die Hauptsensorik, der an Bord mitfliegenden Messhardware, wird au...

  3. Ein Injektorkonzept zur Darstellung eines ottomotorischen Brennverfahrens mit Erdgas-Direkteinblasung

    OpenAIRE

    Bohatsch, Stefan

    2011-01-01

    Mitte der 70er Jahre wurde von Forschern eine steigende Erwärmung der Erdtemperatur seit Beginn des 19. Jahrhunderts festgestellt und die Suche nach den Ursachen begann. Dabei stellte sich heraus, dass im Vergleich zu früheren Wärmeperioden auf der Erde die Geschwindigkeit des aktuellen Temperaturanstiegs deutlich höher ist als in früheren Zeiten. Eine menschliche Einwirkung auf diesen Prozess ist durch den Umstand der zu diesem Zeitpunkt einsetzenden Industrialisierung sehr wahrscheinlich, d...

  4. Alles eine Frage der Zeit. Politische Bildung für eine nachhaltige Entwicklung

    OpenAIRE

    Reheis, Fritz

    2006-01-01

    In diesem Beitrag wird die Ökologie der Zeit als eine integrative Perspektive des Diskurses um Nachhaltige Entwicklung diskutiert. Ausgehend vom bisherigen Umgang mit dem Nachhaltigkeitsthema im Kontext von Bildung wird die Ökologie der Zeit sozial-/politökonomisch, allgemeinpädagogisch und politikdidaktisch fundiert und werden abschließend sieben Thesen präsentiert. Damit wird ein Angebot zur Fundierung der Bildung für Nachhaltige Entwicklung bzw. des Globalen Lernens erhofft. (DIPF/Orig.)...

  5. Chirurgische Behandlung von Melanomen in der Schwangerschaft: eine praktische Anleitung.

    Science.gov (United States)

    Crisan, Diana; Treiber, Nicolai; Kull, Thomas; Widschwendter, Peter; Adolph, Oliver; Schneider, Lars Alexander

    2016-06-01

    Als ein Tumor, der primär eine chirurgische Behandlung erfordert, ist ein neu diagnostiziertes oder vorbestehendes Melanom in der Schwangerschaft eine klinische Rarität. In solchen Fällen steht der Chirurg vor der Herausforderung, ein geeignetes therapeutisches Vorgehen festlegen zu müssen. Auf der Grundlage unserer klinischen Erfahrung und einer Übersicht über die Literatur geben wir in der vorliegenden Arbeit eine Anleitung für das praktische Vorgehen bei dieser seltenen klinischen Konstellation. Unserer Erfahrung nach müssen schwangere Melanom-Patientinnen im Hinblick auf ihre therapeutischen Optionen ausführlich beraten werden. Naturgemäß setzen sie ihr ungeborenes Kind an die erste Stelle und zögern, der erforderlichen Operation zuzustimmen, obwohl bei ihnen eine möglicherweise lebensbedrohliche Erkrankung diagnostiziert worden ist. Daher ist es entscheidend, diese Patientinnen klar darüber zu informieren, dass, wie die vorliegenden medizinischen Erfahrungen zeigen, eine Schwangerschaft per se kein Grund ist, eine notwendige Melanom-Operation aufzuschieben. Jedoch müssen bei einigen Parametern wie den präoperativen Bildgebungsverfahren, der Positionierung auf dem Operationstisch, der Überwachung, Anästhesie und der perioperativen Medikation bestimmte Anpassungen vorgenommen werden, um der speziellen Situation Rechnung zu tragen. PMID:27240063

  6. Hermeneutische Einzelfallrekonstruktion und funktionalanalytische Theoriebildung : ein Versuch ihrer Verknüpfung, dargestellt am Beispiel der Interpretation eines Interviewprotokolls

    OpenAIRE

    Schneider, Wolfgang Ludwig

    1992-01-01

    Der vorliegende Beitrag versucht nachzuweisen, daß Hermeneutik und funktionale Analyse auf eine gemeinsame Grundfigur zurückgeführt und ihre unterschiedlichen Leistungspotentiale deshalb zu einer übergreifenden Methode objektiven Verstehens verbunden werden können. Der gemeinsame Kern der Ansätze ist das Schema von Problem (Frage) und Problemlösung (Antwort). Anhand der Interpretation eines Interviewauszugs (Verhandlungen von Wissenschaftlern mit Ministerialbeamten über die Durchführung eines...

  7. Bau eines besseren Krankenhauses. Wertschöpfendes Management & Planung von Immobilien

    Directory of Open Access Journals (Sweden)

    Johan van der Zwart

    2015-06-01

    Verantwortlichkeiten impliziert, dass immobilienbezogene Risiken ebenfalls übertragen werden, was wiederum umgehend Auswirkungen für die Finanzposition der Organisation und den Zugang zu Darlehen und Risikokapital hat. Seit der Deregulierung von Investitionsentscheidungen und der Implementierung integrierter Sätze in der Gesundheitspflege wurden sich Krankenhäuser mehr über ihre konkurrenzfähige Position auf dem Gesundheitsmarkt und ihre Position in der Region bewusst. Zusätzlich änderte sich der Einfluss verschiedener externer Interessenvertreter. Die Minderung des direkten Einflusses der Regierung auf Investitionsentscheidungen und die zugehörige Kapazität von Institutionen der Gesundheitspflege bedeutete eine Steigerung des Einflusses der Krankenversicherungen bei der Bereitstellung von Gesundheitsversorgung (Kapazität und der Banken bei der Finanzierung der Einrichtungsinvestitionen. Die Folgen des sich ändernden Kontexts der Einrichtungsentscheidungen für Krankenhäusern sind: (1 eine neue Positionierung des Krankenhauses innerhalb der Gemeinschaft mit zugehöriger Standortwahl; (2 die Notwendigkeit von Einrichtungsentscheidungen, die zu arbeitssparenden Innovationen beitragen; (3 die Notwendigkeit der Wertschöpfung durch Immobilien für die Organisation und; (4 Möglichkeiten für die Vorhersage von Änderungen in der Organisation der Gesundheitsversorgung.Management der KrankenhausimmobilieWie eine Krankenhausimmobilie optimal auf die organisatorischen Zielsetzungen ausgerichtet werden kann, wird durch Anpassung bestehender konzeptioneller Modelle mit CREM-Modellen, welche die Qualität der organisatorischen Prozesse steuern, untersucht. Das grundlegende konzeptionelle Modell dafür ist eine Abstraktion des Modells der Europäischen Stiftung für Qualitätsmanagement (EFQM in vier Schritten: (1 Ziele der Interessenvertreter, (2 die Schlüsselthemen der Organisation für Erfolg, (3 Management der Struktur und Ressourcen der Organisation; (4 Verbesserung des

  8. Pancreatitis. An update; Pankreatitis. Ein Update

    Energy Technology Data Exchange (ETDEWEB)

    Schreyer, A.G. [Universitaetsklinikum Regensburg, Institut fuer Roentgendiagnostik, Regensburg (Germany); Grenacher, L. [Diagnostik Muenchen, MVZ Radiologie, Muenchen (Germany); Juchems, M. [Klinikum Konstanz, Diagnostische und Interventionelle Radiologie, Konstanz (Germany)

    2016-04-15

    Acute and chronic pancreatitis are becoming increasingly more severe diseases in the western world with far-reaching consequences for the individual patient as well as the socioeconomic situation. This article gives an overview of the contribution of radiological imaging to the diagnostics and therapy of both forms of the disease. Acute pancreatitis can be subdivided into severe (20 %) and mild manifestations. The diagnostics should be performed with computed tomography (CT) or magnetic resonance imaging (MRI) for assessing necrosis or potential infections only in severe forms of pancreatitis. In chronic pancreatitis transabdominal ultrasound should initially be adequate for assessment of the pancreas. For the differential diagnosis between pancreatic carcinoma and chronic pancreatitis, MRI with magnetic resonance cholangiopancreatography (MRCP) followed by an endoscopic ultrasound-guided fine needle aspiration is the method of choice. For the primary diagnosis for acute and chronic pancreatitis ultrasound examination is the modality of first choice followed by radiological CT and MRI with MRCP examinations. (orig.) [German] Akute und chronische Pankreatitis sind in der westlichen Welt zunehmende schwere Krankheitsbilder mit tiefgreifenden Konsequenzen fuer den einzelnen Patienten sowie soziooekonomisch. Der Beitrag radiologischer Bildgebung zur Diagnostik und Therapie beider Erkrankungsformen soll im vorliegenden Uebersichtsbeitrag diskutiert werden. Die akute Pankreatitis kann in eine schwere (20 %) und milde Verlaufsform unterteilt werden. Lediglich bei den schweren Formen sollte eine CT- oder MRT-Diagnostik bzgl. der Beurteilung von Nekrosen und moeglichen Infektionen erfolgen. Bei der chronischen Pankreatitis genuegt zunaechst eine Beurteilung des Pankreas durch transabdominellen Ultraschall. Hier sind die MRT mit der Magnetresonanzcholangiopankreatikographie (MRCP) sowie die endosonographisch gesteuerte Feinnadelpunktion die Methode, um

  9. Entwicklung eines Ultraschallkatheters mit integriertem Mikroantrieb

    OpenAIRE

    Ledworuski, Ralf

    2006-01-01

    In der medizinischen Diagnostik werden Ultraschallkatheter häufig eingesetzt, um Gefäße wie z. B. Arterien oder den Gallengang auf Ablagerungen und krankhafte Veränderungen zu untersuchen und diese in einem sehr frühen Stadium zu erkennen. Voraussetzung dafür ist eine kontrastreiche Gefäßdarstellung mit guter Auflösung. Kathetersysteme aus dem Bereich des intravaskulären Ultraschalls (IVUS) und Minisonden des endoskopischen Ultraschalls (EUS) erzeugen zirkuläre Ultraschallbilder mit dem Ultra...

  10. Eine Schulklasse – zwei Männlichkeitskulturen

    Directory of Open Access Journals (Sweden)

    Jürgen Budde

    2007-07-01

    Full Text Available Ruth Michalek untersucht anhand von Gruppendiskussionen die Männlichkeitsvorstellungen bei Drittklässlern. Mit Hilfe zahlreicher Zitate zeichnet sie ein differenziertes und empathisches Bild der diskutierenden Jungen. Sie weist detailliert nach, dass in einer Schulklasse zwei entgegengesetzte Männlichkeitskulturen nebeneinander existieren können: Während sich die Gruppe „Rock’n’Roll AG“ an tradierten Männlichkeitsbildern orientiert, kann die Gruppe „Tigerkralle“ mit diesen männlichen Orientierungsmustern wenig anfangen. Michaleks Arbeit stellt einen anschaulichen Beitrag zur Ausdifferenzierung von Männlichkeitsvorstellungen dar.

  11. Ein Modell der Open-Source-Entwicklung

    OpenAIRE

    Evers, Steffen

    2009-01-01

    In den letzten zwanzig Jahren hat sich in Bezug auf Software viel verändert: die abgedeckte Funktionalität, wie ihre Umgebung aussieht, wie sie wirtschaftlich verwertet wird und letztendlich auch wie sie entwickelt wird. In Bezug auf die Vorgehensweise stellt die Open-Source-Entwicklung wohl die größte Abweichung von den klassischen Methoden dar. Die altbewährten Modelle für eine deterministische Entwicklung von Softwareprodukten sind dafür unzureichend. Trotzdem haben beide Bereiche viele ge...

  12. Europawahl 2004 : eine Online-Umfrage

    OpenAIRE

    Kellermann, Charlotte; Juhász, Zoltán; Rattinger, Hans

    2004-01-01

    Aus Anlass der Wahlen zum Europäischen Parlament am 13. Juni 2004 führte das Bamberger Centrum für Europäische Studien (BACES) zusammen mit dem Lehrstuhl für Politikwissenschaft II vom 04. bis 13. Juni eine bundesweite Online-Umfrage durch. Die 2.936 Befragten sind im Mittel deutlich jünger, haben höhere Bildungsabschlüsse und sind auch politisch wesentlich stärker interessiert als der Durchschnittsbürger. Somit stellen die nachfolgenden Untersuchungsergebnisse, die sich in drei Themenbereich...

  13. Corporate Venture Capital im Bankensektor: Eine Fallstudie

    OpenAIRE

    Maxin, Hannes

    2015-01-01

    Die Digitalisierung der Gesellschaft beeinflusst zunehmend das klassische Bankgeschäft, was durch die Erfolge vieler junger FinTech-Unternehmen verdeutlicht wird. Der damit verbundene Innovationsdruck führte dazu, dass die Commerzbank AG im Oktober 2013 die Main Incubator GmbH gründete. Mithilfe dieser Corporate Venture Capital-Gesellschaft (CVC-Gesellschaft) versucht die Frankfurter Großbank, eine Kooperation mit den neuen Wettbewerbern einzugehen, um mögliche Synergiepotenziale für das eige...

  14. Kjenneteikn ved yoga som bevegelsessystem. Ein intervjustudie

    OpenAIRE

    2012-01-01

    Bakgrunn: Yoga er opprinneleg eit klassisk indisk filosofisk system med røter fleire tusen år tilbake i tid. I vesten har det ofte vore mest fokus på yoga som fysisk disiplin beståande av stillingar (asanas) og pust (pranayama), også kalla hatha yoga. I dei seinare år har yoga har har hatt ei jamn auke i popularitet, og er også gjenstand for mykje forsking innan medisin og helsefag. Det presenterast ofte som ein kontrast til anna trening. Føremål: Å få auka kunnskap om kjenn...

  15. Barrieren der Leitlinienumsetzung und Fortbildungsbedarf von Hausärzten zur Herzinsuffizienz: eine qualitative Studie [Barriers to guideline implementation and educational needs of general practitioners regarding heart failure: a qualitative study

    Directory of Open Access Journals (Sweden)

    Peters-Klimm, Frank

    2012-05-01

    enthalten systematisch entwickelte Empfehlungen, deren Umsetzung speziell in der hausärztlichen Praxis eine bekannte Herausforderung darstellt. Ziel der vorliegenden Studie war es, Barrieren bei der Umsetzung der Leitlinienempfehlungen zu identifizieren, Vorschläge zu Verbesserungsmaßnahmen der hausärztlichen Versorgung und für die Entwicklung einer bedarfsgerechten Fortbildung zu gewinnen.Methodik: Es wurde eine modifizierte Fokusgruppe mit Workshopcharakter durchgeführt. In drei parallelen Kleingruppen erarbeiteten 13 Hausärzte Barrieren bei der Leitlinienumsetzung zur HI. Darauf aufbauend wurde eine Bedarfsanalyse bzgl. der Lernziele und der spezifischen Verbesserungsmaßnahmen für eine hausärztliche Fortbildung zur HI durchgeführt. Die protokollierten Aussagen der Ärzte wurden mittels Inhaltsanalyse nach Mayring ausgewertet und anschließend thematisch kategorisiert.Ergebnisse: Als Barrieren der Umsetzung vorhandener Leitlinien nannten die teilnehmenden Ärzte arztseitige Defizite und Unterstützungsbedarf in den Dimensionen Wissen, kommunikativen und organisatorischen Fähigkeiten (z. B. Zeitmangel/-management und der Haltung gegenüber Leitlinien (z.B. Faulheit. Den Patienten wurden individuelle, patientenbezogene Probleme (z.B. Komplexität des Einzelfalles bei Multimorbidität, psychische Komorbidität sowie ablehnende Einstellungen (z.B. gegenüber „Schulmedizin“ zugeschrieben. Im Bereich der Arzt-Patient-Interaktion wurden u.a. mangelnde medikamentöse Adhärenz und Kommunikationsprobleme als Barrieren genannt. Vorschläge zu Verbesserungs- bzw. Schulungsmaßnahmen umfassten breit angelegte Schulungskonzepte (z.B. in interdisziplinären Qualitätszirkeln mit Fall-Audit, die neben der Vermittlung von Wissensaspekten aus einer (idealerweise einheitlichen Leitlinie auch praktische Fertigkeiten hinsichtlich Arzt-Patienten-Kommunikation und Praxis-Organisation einschlossen. Die Bereitstellung praktikabler Arbeitsmaterialien und Patientenschulungen

  16. Ein Web-basierter Computergraphik-Kurs im Baukastensystem

    OpenAIRE

    Hönisch, F.; Klein, R.; Straßer, W

    2016-01-01

    Aus der Zusammenfassung: "Dieses Beispiel eines interaktiven Online-Kurses zeigt, wie virtuelle Experimente die traditionellen Lehrmethoden im Bereich der Computergraphik sinnvoll ergänzen. Das Zusammenspiel von Java und dem World-Wide-Web erlaubt die einheitliche Integration von hypertextuellen Vorlesungstexten, interaktiven Visualisierungen, virtuellen Experimenten, Programmierübungen und Programmierschnittstellen in eine unbeschränkt nutzbare virtuelle Lernumgebung."

  17. Ein bunter Hund, die tool-box und lipstick lesbians

    OpenAIRE

    Ruben Marc Hackler

    2007-01-01

    Sara Mills legt eine Einführung in die Diskursanalyse vor, die durch ihre Ausrichtung am Forschungsprozess und ihr Interesse an der Vielzahl von Diskursen überzeugt. Aus dem Wald von Einführungen ragt sie heraus durch ihre Konzentration auf gesellschaftskritische Fragen, wie sie unter anderem vom Feminismus aufgeworfen wurden, und vertritt ein engagiertes Wissenschaftsverständnis.

  18. Effects of increased atmospheric CO{sub 2} concentrations on transpiration of a wheat field in consideration of water and nitrogen limitation; Die Wirkung von erhoehten atmosphaerischen CO{sub 2}-Konzentrationen auf die Transpiration eines Weizenbestandes unter Beruecksichtigung von Wasser- und Stickstofflimitierung

    Energy Technology Data Exchange (ETDEWEB)

    Grossman-Clarke, S.

    2000-09-01

    Primary responses of C{sub 3}-plants to elevated atmospheric CO{sub 2} concentrations are an increase in the net assimilation rate, leading to greater biomass, and an associated decrease in the transpiration rate per unit leaf area due to CO{sub 2}-induced stomatal closure. The question has therefore arisen: does canopy transpiration increase because of the greater biomass, or decrease because of the stomatal closure? The direct impact of an elevated atmospheric CO{sub 2} concentration of 550 {mu}mol mol{sup -1} on the seasonal course of canopy transpiration of a spring wheat crop was investigated by means of the simulation model DEMETER for production under unlimited water and nutrient supply, production under limited water but unlimited nutrient supply and the production under unlimited water but limited nitrogen supply. Independent data of the free-air carbon dioxide enrichment wheat experiments in Arizona, USA (1993-96) were used to test if the model is able to make reasonable predictions of water use and productivity of the spring wheat crop using only parameters derived from the literature. A model integrating leaf photosynthesis, stomatal conductance and energy fluxes between the plant and the atmosphere was scaled to a canopy level in order to be used in the wheat crop growth model. Temporal changes of the model parameters were considered by describing them as dependent on the changing leaf nitrogen content. Comparison of the simulation and experimental results showed that the applicability of the model approach was limited after anthesis by asynchronous changes in mesophyll and stomatal conductance. Therefore a new model approach was developed describing the interaction between assimilation rate and stomatal conductance during grain filling. The simulation results revealed only small differences in the cumulative sum of canopy transpiration and soil evaporation between elevated CO{sub 2} and control conditions. For potential growth conditions the model simulated a slightly lower water use under elevated CO{sub 2}, while water limitation lead to a slightly higher water use due to the relative increase in root biomass and hence water availability. Under nitrogen limitation elevated CO{sub 2} lead to a stronger decrease of water use than under adequate nitrogen supply. The simulation results confirm the experimental findings that water limitation increases and nitrogen limitation decreases the CO{sub 2}-effect. The qualitative as well as the quantitative behavior of the wheat crop under elevated CO{sub 2} was successfully described by the model for the three production conditions, which makes it possible to use the model with higher confidence for predictions about the future behavior of the crop. (orig.)

  19. Applications on Ground-based Tropospheric Measurements using Multi-Axis Differential Optical Absorption Spectrosopy

    OpenAIRE

    Ibrahim, Ossama

    2009-01-01

    In dieser Doktorarbeit werden die MAX-DOAS Meßergebnisse von zwei wichtigen atmosphaerischen Spurengasen, BrO und NO2, vorgestellt. Dabei wurden die MAX-DOAS Messungen von unterschiedlichen Plattformen (auf einem Schiff, auf dem Dach eines Autos oder an einem festen Ort installiert) und unter verschiedenen atmosphaerischen Bedingungen durchgefuehrt. Die Messung von BrO sind wichtig zur Untersuchung des Einflusses von Halogenverbindungen in der marinenGrenzschicht. Die NO2-Messungen dienen de...

  20. Feng Shui in cold water production. Energy-efficient cold water unit for domestic comfort, trade and industry; Feng Shui in der Bereitstellung von Kaltwasser. Energieeffizienter Kaltwassersatz fuer Komfort, Gewerbe und Indsutrie

    Energy Technology Data Exchange (ETDEWEB)

    Roeben, J. [Menerga Apparatebau GmbH, Muelheim (Germany)

    2003-10-01

    Feng Shui means 'wind and water'. According to Chinese philosophy, all processes in nature are influenced by five different elements. This principle has always been applied in air conditioning engineering, e.g. in the development of a novel, ecological cold water production process presented by Menerga. (orig.) [German] Feng steht fuer Wind, Shui fuer Wasser. Das Zusammenspiel aller Prozesse in der Natur wird nach der chinesischen Philosophie von weiteren Grundelementen beeinflusst. In der Klimatechnik hat man sich dieses Prinzip immer wieder zunutze gemacht. So auch bei der Entwicklung eines neuen oekologischen Verfahrens zur Kaltwasserbereitstellung der Firma Menerga. (orig.)

  1. Integration eines Anwendungssystems für die Tumordokumentation in ein klinisches Informationssystem

    OpenAIRE

    Stolte, Iris

    2001-01-01

    Die Tumordokumentation wurde bisher vor allem in Tumorzentren und klinischen Krebsregistern als retrospektive Erfassung der zu dokumentierenden Daten durchgeführt. Dieser Ansatz schränkt den Umfang der zu erhebenden Daten wegen des nicht unwesentlichen zusätzlichen Aufwands erheblich ein. Insbesondere für Aufgaben des Qualitätsmanagements, die in der Tumordokumentation immer stärker in den Vordergrund treten, ist es notwendig, umfangreiche, an Diagnose und Therapie der Patienten orie...

  2. Entwicklung des Kommunikationsteilsystems für ein objektorientiertes, verteiltes Betriebssystem

    OpenAIRE

    Becher, Mike

    1998-01-01

    Thema dieser Arbeit ist die Entwicklung eines Kommunikationsteilsystems fuer das Experimentiersystem CHEOPS zur Ermoeglichung einer Interobjektkommunika- tion zwischen Objekten auf dem gleichen bzw. verschiedenen Systemen. Ausgangspunkte stellen dabei eine verfuegbare Implementation eines Ethernet- Treibers der Kartenfamilie WD80x3 fuer MS-DOS, eine geforderte Kommunikations- moeglichkeit mit UNIX-Prozessen sowie die dort benutzbaren Protokoll-Familien dar. Die Arbe...

  3. Autoimmune pancreatitis. An update; Autoimmunpankreatitis. Ein Update

    Energy Technology Data Exchange (ETDEWEB)

    Helmberger, T. [Klinikum Bogenhausen, Staedt. Klinikum, Institut fuer Diagnostische und Interventionelle Radiologie, Neuroradiologie und Nuklearmedizin, Muenchen (Germany)

    2016-04-15

    have to be aware of the clinical, serological and histological parameters for AIP in order to guide clinicians towards the correct diagnosis. Only in this way can the highly efficient steroid therapy be initiated and otherwise possibly severe forms of therapy be avoided. (orig.) [German] Die Autoimmunpankreatitis (AIP) ist eine seltene Erkrankung, deren Verstaendnis sich in den letzten Jahren deutlich vertieft hat. Die haeufigste Form, die Typ-1-AIP, gehoert zu den IgG4-assoziierten Erkrankungen, die viel seltenere Typ-2-AIP ist hiervon zu differenzieren und steht mit chronisch entzuendlichen Darmerkrankungen in Verbindung. Bildgebend und klinisch besteht eine Ueberlappung zum Pankreaskarzinom. Aufgabe der Bildgebung und weiterer Parameter wie Serologie und Histologie ist es deshalb, eine Differenzierung zwischen den beiden Erkrankungsentitaeten zu schaffen, um sie jeweils der adaequaten Therapie zuzufuehren und die geringe, aber letztlich unnoetige Anzahl an Pankreatektomien wegen einer AIP zu verhindern. Die Diagnose der AIP ist komplex, wobei sich in den letzten Jahren die Konsensuskriterien der International Association of Pancreatology als Entscheidungsparameter vielfach durchgesetzt haben. Diese umfassen 5 Kardinalkriterien und ein therapeutisches Kriterium. Unter Verwendung dieser Parameter kann die AIP mit einer Sensitivitaet von 84,9 %, Spezifitaet von 100 % und Treffsicherheit von 93,8 % diagnostiziert werden. Die Diagnose einer AIP setzt sich aus verschiedenen Parametern zusammen, von denen 2 die Bildgebung betreffen. Wie bei der sonstigen Diagnostik des Pankreas sind dies Ultraschall, CT und MRT. Wesentlich fuer die Differenzialdiagnose ist der Ausschluss sekundaerer Malignitaetskriterien, wofuer CT und MRT etabliert sind. Das wesentliche diagnostische Kriterium der Histologie erfordert ausreichend Material, was in der Regel durch eine endoskopische Feinnadelpunktion (FNP) nicht gewonnen werden kann. Fuer die Identifikation des optimalen Punktionsorts und

  4. Fallbericht: Intrakranielle kontrastmittelaufnehmende Raumforderung 58 Jahre nach Resektion eines Vestibularisschwannoms: Entzündung oder Tumor?

    OpenAIRE

    Zeller, N.; Dalchow, C.; Knecht, R.

    2014-01-01

    Einleitung: Jahre nach Entfernung intracranieller Tumoren können raumfordernde Prozesse im Operationsgebiet vorkommen. Es kommen entzündliche oder neoplastische Ursachen in Betracht. In diesem Fall trat 58 Jahre nach Resektion eines Vestibularisschwannoms ein schnell progredienter Prozess auf.Fallbericht: Eine 76-jährige Patientin bei der 1955 die Resektion eines "Hühnerei-großen" Vestibularisschwannoms der mittleren Schädelgrube über eine temporale Kraniotomie und radikale Mastoidektomie r...

  5. Konfliktpotenziale zwischen Alt und Jung im deutschen Wohlfahrtsstaat: eine quantitative Analyse des European Social Survey (ESS)

    OpenAIRE

    Hollfelder, Thomas

    2012-01-01

    Bedingt durch eine niedrige Geburtenziffer und eine steigende Lebenserwartung, führt der demografische Wandel in Deutschland zu Finanzierungslücken in den sozialen Sicherungssystemen und zu einer politischen Machtverschiebung zu Gunsten der älteren Jahrgänge. Daraus wird oft vorschnell ein Konflikt der Generationen abgeleitet, ohne dass eine empirische Prüfung der dafür notwendigen sozialen Grundlagen stattgefunden hätte. In dieser Arbeit wird deshalb ein Modell entwickelt, das die Ents...

  6. Variant of a Klippel-Trenaunay syndrome - Case report; Variante eines Klippel-Trenaunay-Syndroms - ein Fallbericht

    Energy Technology Data Exchange (ETDEWEB)

    Irlbacher, K.; Behse, F.; Roericht, S.; Meyer, B.U. [Charite-Campus Virchow Klinikum, Humboldt-Univ. Berlin (Germany); Hoffmann, K.T. [Charite-Campus Virchow Klinikum, Humboldt-Univ. Berlin (Germany). Radiologische Klinik

    2000-07-01

    We report a patient with a variant of this syndrome presenting with extensive varicose veins and arteriovenous shunts within the left arm, bony hypotrophy of the left hand, mucocutaneous melanin spots in the face and thrombocytopenia. Imaging techniques play a major role in making a diagnosis in angiophakomatoses. (orig.) [German] Hier wird eine Patientin mit einer Variante eines KT vorgestellt, bei der klinisch und mit bildgebenden Verfahren folgende Befunde erhoben wurden: Segmentale varikoese Venektasien und arteriovenoese Kurzschluesse im linken Arm und Hypotrophie von Handknochen, Phlebolithen, Venenektasien in der linken Wangenschleimhaut, Pigmentnaevi in der Gesichts-, Lippen-, und Wangenschleimhaut und Thrombozytopenie. Bildgebende Verfahren helfen hier eine diagnostische Einstufung vorzunehmen. (orig.)

  7. Ein Nelson-Winter-Modell der deutschen Volkswirtschaft

    OpenAIRE

    Quaas, Georg

    2012-01-01

    Die von Nelson und Winter (1982) vorgeschlagene evolutorische Theorie hat hunderte Studien angeregt, die sich auf das Modell beziehen, das in ihrem Buch vorgestellt wird. Dieses Modell demonstrierte die empirische Gültigkeit eines neuen theoretischen und methodologischen Ansatzes auf dem Hintergrund der U.S.-amerikanischen Ökonomie und entsprechender Daten. Allerdings wurde nur in wenigen Studien versucht, das Modell durch Anwendung auf eine andere Volkswirtschaft zu replizieren. Das vorliege...

  8. Entwicklung, Aufbau und Messungen eines schnellen Eiskeimzählers

    OpenAIRE

    Nillius, Björn

    2008-01-01

    Im Rahmen dieser Arbeit wurde ein neuer Eiskeimzähler FINCH (Fast Ice Nucleus CHamber) entwickelt und erste Messungen von verschiedenen Testaerosolen im Labor und atmosphärischem Aerosol durchgeführt. Die Aerosolpartikel bzw. Ice Nuclei IN werden bei Temperaturen unter dem Gefrierpunkt und Übersättigungen in Bezug auf Eis zum Anwachsen zu Eiskristallen gebracht, um sie mittels optischer Detektion zu erfassen. In FINCH ist dies durch das Prinzip der Mischung realisiert, wodurch eine kontin...

  9. Ein Produktmodell für die Entwicklung verteilter Informationssysteme

    OpenAIRE

    Schwerin, Wolfgang

    2007-01-01

    Vorgehensmodelle unterstützen eine systematische Entwicklung, indem sie zu erbringende Entwicklungsergebnisse, synonym -produkte, und auszuführende Aktivitäten angeben. In dieser Arbeit wird eine mathematisch fundierte Grundlage für durchgängige Vorgehensmodelle zur Entwicklung verteilter Informationssysteme geschaffen. In einem Produktmodell werden die verschiedenen Arten von Entwicklungsprodukten integriert, die im Rahmen der Unternehmens- und der Anforderungsspezifikation sowie des Softwar...

  10. Entwicklung eines Zeitmodells für einen symbolischen Simulator

    OpenAIRE

    Kapp, Kai

    1998-01-01

    Lange Zeit beschränkten sich die Optimierungsverfahren beim Entwurf höchstintegrierter Schaltungen auf Schnelligkeit, geringen Flächenbedarf und minimale Kosten von Schaltkreisen. Infolgedessen wurden immer schnellere und kleinere Schaltungen mit entsprechend wachsender Integrationsdichte entwickelt, die allerdings eine erhöhte Wärmeentwicklung aufwiesen. Hohe Temperaturen beeinträchtigen jedoch die Zuverlässigkeit von Schaltkreisen. Ein Weg, die hohe Wärmeentwicklung zu minimieren, besteht i...

  11. Beziehungen: ein Educast-Projekt und sein interkulturelles Lernangebot

    OpenAIRE

    Timmermann, Waltraud

    2012-01-01

    Interculture TV ist ein didaktisches Videoprojekt des Fachgebiets Interkulturelle Wirtschaftskommunikation der Friedrich Schiller-Universität, Jena. Das Projekt stellt audiovisuelles Lehr- und Lernmaterial, das von Studierendengruppen produziert worden ist, zur freien Verfügung. Dieser Artikel konzentriert sich auf ein deutsch-chinesisches Teilprojekt von dieser Plattform: Drei Videos zum Thema Beziehungen (zwischen Chef und Angestelltem, Kind und Eltern und zwischen Freunden) zeigen fiktiona...

  12. Mikroskopische Modellierung des Außenverkehrs eines Planungsraums

    OpenAIRE

    KAGERBAUER, Martin

    2010-01-01

    Im Rahmen der mikroskopischen Verkehrsnachfragemodellierung wird ein Modell vorgestellt, das den für den Planungsraum relevanten Verkehr der in den Außenzellen wohnenden Personen abbildet. Voraussetzung dafür ist die Übertragbarkeit von individuellen Mobilitätsdaten, die auf Basis der Daten des Deutschen Mobilitätspanels (MOP) analysiert wird. Darüber hinaus wird eine Methode zur Abgrenzung von Untersuchungsgebieten für beliebige Planungsräume in Deutschland dargelegt.

  13. Ein bunter Hund, die tool-box und lipstick lesbians

    Directory of Open Access Journals (Sweden)

    Ruben Marc Hackler

    2007-11-01

    Full Text Available Sara Mills legt eine Einführung in die Diskursanalyse vor, die durch ihre Ausrichtung am Forschungsprozess und ihr Interesse an der Vielzahl von Diskursen überzeugt. Aus dem Wald von Einführungen ragt sie heraus durch ihre Konzentration auf gesellschaftskritische Fragen, wie sie unter anderem vom Feminismus aufgeworfen wurden, und vertritt ein engagiertes Wissenschaftsverständnis.

  14. Ein Referenzmodell für die Herstellung von Fachmedienprodukten

    OpenAIRE

    Delp, Martin

    2006-01-01

    Referenz-Prozessmodelle haben aufgrund ihrer breiten Anwendbarkeit an Bedeutung gewonnen, beispielsweise bei der Organisationsgestaltung, bei der Prozessverbesserung, bei der Softwareentwicklung und in anderen Bereichen. Ziel des Werkes ist die Beschreibung eines Referenzmodells der Medienherstellung. Es zeichnet sich besonders aus durch die eine umfassende Unterstützung der Herstellung, durch einen modularen Aufbau, durch die Wiederverwendbarkeit der Modellelemente sowie durch die Unterstütz...

  15. Entwicklung eines Versuchsstandes zur zweiaxialen Beanspruchung von textilbewehrtem Beton

    OpenAIRE

    Michler, Le

    2009-01-01

    Im Rahmen der vorliegenden Arbeit wird das Versuchskonzept für zweiaxiale Zug-Zug-Versuche an textilbewehrten Betonscheiben behandelt. Diese Arbeit soll einen Beitrag leisten, die Kenntnisse aus dem Maschinenbau, der Mechanik in den Bereich der Bauingenieure und Baustoffe umzusetzen, um alle Effekte, die vom Versuchstand verursacht werden, öffentlich zu machen. Es ist ein Versuchskonzept zu erarbeiten, wie ein experimenteller Zug-Zug-Versuch optimal zu gestalten ist, um das Tragverhalten d...

  16. Fallstudie J. v. T. : Ein Patient Sigmund Freuds

    OpenAIRE

    M. Neumann

    2002-01-01

    J.v.T. war ein 23-jähriger Homosexueller, der von 1907 bis 1911 bei Freud in Behandlung war. Freud überwies diesen Kranken wegen einer Depression zur stationären Behandlung an Ludwig Binswanger jun. in die Anstalt Bellevue. Dort wurde eine Dementia praecox hebephrenica diagnostiziert. Die Therapie wurde in regem Briefwechsel zwischen Freud und Binswanger diskutiert. Während des zweiten Aufenthaltes wurde der Patient von Alphonse Maeder behandelt.

  17. Claudio Magris' Danubio: ein Übersetzungskritischer Textvergleich

    Directory of Open Access Journals (Sweden)

    Dieter Kattenbusch

    1991-12-01

    Full Text Available Ober den Fluß, an dessen Ufern man lebt, spricht man nicht. Wenn ein Regensburger über die Donau redet, dann muß das einen besonderen Grund haben, wie etwa ein Jahrhunderthochwasser oder das Buch von Claudio Magris Danubio, das, wenn man dem Bayerischen Rundfunk glauben kann, zu einem deutlichen Ansteigen der Zahl italienischer Besucher in der alten Reichsstadt Regensburg geführt hat.

  18. Montagegerechte Gestaltung eines Befestigungssystems für Photovoltaikgeneratoren

    OpenAIRE

    Schumann, Sven

    2004-01-01

    Der Bedarf an elektrischer Energie ist durch die stetig wachsende Weltbevölkerung, die erhöhte Mobilität sowie das gestiegene Komfortbedürfnis innerhalb der letzten Jahrzehnte stark angestiegen. Eine Fortsetzung dieses Trends ist sehr wahrscheinlich. Bei der erforderlichen nachhaltigen Umstrukturierung der Energieversorgungssysteme kommt der Photovoltaik eine wesentliche Rolle zu. Zur Reduzierung der Kosten der Photovoltaik müssen alle kostenverursachenden Faktoren im Hinblick auf ihr Kostens...

  19. Identifizierung und Charakterisierung eines Sdr-Proteins von Staphylococcus saprophyticus

    OpenAIRE

    Sakinç, Türkân

    2001-01-01

    Gegenstand der vorliegenden Arbeit war es, das Oberflächenprotein Ssp zu klonieren und zu charakterisieren. Stattdessen wurde ein neues Zellwand-assoziertes Protein, das SdrI, ein MSCRAMM, kloniert. Dies sollte zur Klärung der Uropathogenität von Staphylococcus saprophyticus weiterhelfen. Die Voraussetzungen zur Untersuchung der Funktion des SdrI Protein von Staphylococcus saprophyticus wurde durch die Konstruktion einer isogenen Mutante geschaffen. Die Bedeutung der SdrI-Protein ...

  20. Zwischen Boykott und CSR : eine Beziehungsanalyse zu Unternehmen und NGOs

    OpenAIRE

    Curbach, Janina

    2008-01-01

    "Um zur verstehenden Analyse der vielfältigen Beziehungen zwischen dem Unternehmenssektor und Nichtregierungs-Organisationen (NGOs) beizutragen, wird im vorliegenden Artikel die Idee eines hohen gesellschaftlichen Legitimationskapitals von NGOs aufgegriffen. Darauf aufbauend werden die Strategien der Einflussnahme von NGOs und ihre Einflusschancen auf Unternehmen vorgestellt und in Beziehung zu den strategischen Reaktionsmöglichkeiten von Unternehmen gesetzt. Daraus ergibt sich eine Topograph...

  1. Evaluation eines psychosomatischen Behandlungskonzepts bei opiatabhängigen Schwangeren

    OpenAIRE

    Härtl K; Kästner R; Stauber M

    2001-01-01

    Heroinkonsum während der Schwangerschaft erhöht die Wahrscheinlichkeit spontaner Aborte, vorzeitiger Wehen, intrauteriner Asphyxie, niedrigen Geburtsgewichts und neonataler Entzugssymptome. Abrupte Entzüge von Heroin gehen mit einer erhöhten kindlichen Mortalitätsrate einher. Substitution mit Levomethadon gilt als eine sinnvolle Behandlungsmöglichkeit bei opiatabhängigen Schwangeren. Untersucht wird die Effizienz eines psychosomatischen Behandlungskonzepts bei opiatabhängigen Schwangeren hins...

  2. Ein Jahr nach stationärer Rehabilitation - was blieb?

    Directory of Open Access Journals (Sweden)

    Laimer H

    2004-01-01

    Full Text Available Im Anschluß an die Erstmanifestation einer koronaren Herzkrankheit sind umfassende sekundärpräventive und rehabilitative Maßnahmen erforderlich, um den weiteren Verlauf der Krankheit zu optimieren. Ein intensiver erster Einsatz der Rehabilitation erfolgt unmittelbar nach dem Krankenhausaufenthalt in der Phase 2, die in Österreich überwiegend stationär in einem Rehabilitationszentrum durchgeführt wird. Im Rahmen eines Anschlußheilverfahrens werden die Risikofaktoren Lipide, Gewicht und Rauchverhalten sowie die medikamentöse Einstellung erfolgreich beeinflußt. Diese günstigen Effekte zeigen sich jedoch nach einem Jahr teilweise wieder abgeschwächt, wobei vor allem die neuerliche Gewichtszunahme der Patienten imponiert. Das Ausmaß der Verschlechterung nach einem Jahr ist jedoch bei weitem nicht so ausgeprägt wie bei den Daten von 5.556 Patienten aus 15 europäischen Ländern in der EUROASPIRE-II-Studie. Zur Optimierung des Langzeiterfolges ist eine Fortführung rehabilitativer Maßnahmen auch nach der Anschlußheilbehandlung erforderlich. Ein stationäres Wiederholungsheilverfahren ein Jahr nach dem Akutereignis führt zu einer weiteren Verbesserung des Risikoprofils, kann jedoch aus Kostengründen nicht generell empfohlen werden. Als Alternative bietet sich eine der stationären Phase-2-Rehabilitation angeschlossene ambulante Phase-3-Rehabilitation an.

  3. Arbeitspensum eines Achtundsiebzigjährigen : eine unbekannte Agenda Goethes vom November und Dezember 1827

    OpenAIRE

    Donat, Sebastian

    2008-01-01

    Das Anlegen von Agenden gehört zu den grundlegenden Elementen der Arbeits- und Lebensorganisation Goethes. [...] Zwar wird diesen Arbeitslisten dort erst ab dem Jahr 1802 eine eigene (Teil)Rubrik zugestanden, doch findet sich bereits unter dem 1. Januar 1782 der Tagebucheintrag: "Früh verschiednes in Ordnung. Agenda durchgesehn und überlegt." [...] Im Januar 1790 nahm sich Goethe unter anderem die Fertigstellung der Bearbeitungen von Torquato Tasso, Lila, Jery und Bätely sowie Faust für die S...

  4. Aufbau und Inbetriebnahme eines hochsensitiven 3-He-Magnetometers für ein zukünftiges Experiment zur Bestimmung eines elektrischen Dipolmoments des freien Neutrons

    OpenAIRE

    Kraft, Andreas

    2012-01-01

    Die Messung eines möglichen elektrischen Dipolmoments des freien Neutrons erfordert genaustmögliche Kenntnis und Überwachung des magnetischen Feldes im Inneren der n2EDM-Spektrometerkammer. Die freie Spinpräzession von hyperpolarisiertem ³He kann verbunden mit einer Signalauslese mittels optisch gepumpter Cs-Magnetometer dazu genutzt werden, Messempfindlichkeit auf Magnetfeldschwankungen im Bereich weniger Femto-Tesla zu erhalten. Am Institut für Physik der Universität Mainz wurde eine ³He/Cs...

  5. Competition around biomass. Development of a land use model for the derivative of possible future developments of the agriculture regarding the supply of food and energy biomass; Konkurrenz um Biomasse. Entwicklung eines Landnutzungsmodells zur Ableitung moeglicher zukuenftiger Entwicklungen in der Landwirtschaft hinsichtlich der Bereitstellung von Nahrungsmitteln und Energiebiomasse

    Energy Technology Data Exchange (ETDEWEB)

    Rauh, Stefan Markus

    2010-08-23

    In this work a land use model is developed, which derives possible developments of the agriculture regarding the supply from food and energy biomass. The comparative static model LaNuOpt is based on an optimization of the total land rent using linear optimization. The results are determined in scenarios with different market situations and political basic conditions. With a continuance of the current basic conditions the model computes a doubling of the biogas capacities. Classic procedures of the food production are displaced, depending upon accepted market price.As side effect greenhouse gas emissions are saved. With the help of the model further questions can be examined. (orig.)

  6. Wo sind sie geblieben? – Eine Diskussion über die Positionierung von Medizinerinnen zwischen Karriere, Beruf und Familie [Where have they gone? – A discussion on the balancing act of female doctors between work and family

    Directory of Open Access Journals (Sweden)

    Jerg-Bretzke, Lucia

    2012-04-01

    Diskussion zu verstehen und soll auf Basis des aktuellen Stands der Forschung potentielle Ansatzpunkte für eine Optimierung des Arztberufes aus familienfreundlicher Perspektive darstellen und insbesondere zur weiteren Diskussion anregen.Ergebnisse: Einige grundlegende Schritte zur Vereinbarkeit von Beruf und Familie wurden bereits getan, beispielsweise die Bereitstellung von Betreuungsplätzen oder das zunehmende Angebot einer flexibleren Arbeitszeitgestaltung. Dennoch scheinen diese Maßnahmen, da weder flächendeckend umgesetzt noch ausreichend, nicht zu genügen, um eine Bindung von Nachwuchskräften zu sichern. Gerade Frauen in Führungspositionen sind weiterhin selten zu finden.Schlussfolgerung: Ärztinnen und Ärzte wünschen sich mehr Lebensqualität durch die Vereinbarkeit von Beruf und Familie. Der Ausbau familienfreundlicher Angebote ist als notwendiger Schritt zu sehen, um eine zufriedenstellende Positionierung von Medizinerinnen in den Bereichen Beruf und Familie zu ermöglichen .Um jedoch präzise sagen zu können, welche Maßnahmen ergriffen werden müssen, bedarf es einer genauen Datenbasis bspw. in Form von detaillierten Mitarbeiterbefragungen.

  7. Up-to-date der Betreuung von Chorionkarzinompatientinnen - ein Fallbeispiel

    Directory of Open Access Journals (Sweden)

    Söhnchen N

    2010-01-01

    Full Text Available Das Chorionkarzinom tritt in Europa bei einer von 30.000 Schwangerschaften auf. Betroffen sind vor allem junge und ältere Mütter sowie Patientinnen mit einer positiven Anamnese für Trophoblasterkrankungen. Kardinalsymptome sind persistierende vaginale Blutungen nach der Geburt. Bei Diagnosestellung liegen häufig bereits pulmonale Metastasen vor. In der Behandlung spielt die Chirurgie nur eine untergeordnete Rolle. Der rasche und ununterbrochene Beginn einer Chemotherapie ist hingegen entscheidend. Oft reicht eine Monochemotherapie aus. Hochrisikopatienten werden hingegen mit einer Kombinationschemotherapie (EMA/CO behandelt. Das Ansprechen auf diese Therapie ist ausgesprochen gut. Wichtig sind die weiteren Kontrollen der Patientinnen mithilfe von biochemischen Markern und radiologischer Diagnostik. Kinder betroffener Frauen sollten ebenfalls kontrolliert werden, da es auch bei ihnen zu einer intrauterinen Metastasierung gekommen sein kann. Wir stellen das diagnostische und therapeutische Vorgehen anhand eines aktuellen Fallbeispiels aus unserer Klinik dar.

  8. Ein Kanon ganz für uns allein?

    Directory of Open Access Journals (Sweden)

    Annette Kliewer

    2007-11-01

    Full Text Available Die Gender-Studies haben sich immer wieder damit hervorgetan, dass sie den traditionellen Kanon im Wissenschaftsbetrieb kritisierten. Nun veranstaltete das Referat Genderforschung der Universität Wien vom 28. bis 29. 11. 2005 eine internationale Tagung, bei der nach Existenz, Entwicklung und Sinn eines Kanons für die Frauen- und Geschlechterforschung selbst gefragt wurde. Mit dieser wissenschaftspolitischen Tagung wurde das Thema einer Ringvorlesung „Ein Kanon ganz für uns allein?“ (Sommersemester 2005 auf Fragen des internationalen Wissenschaftstransfers ausgedehnt. Auch in den Gender Studies gibt es Kanonisierungen, die Wissenschaftlerinnen ausschließen, vor allem aus nichtwestlichen Zusammenhängen, seien es postkoloniale oder postsozialistische Staaten. Eingeladen waren deshalb Referentinnen aus 15 verschiedenen Ländern.

  9. Private air conditioning systems - just a matter of conscience?; Ist eine private Klimaanlage nur eine Gewissensfrage?

    Energy Technology Data Exchange (ETDEWEB)

    Rogg, W. [NOK-Energieanwendung, Baden (Switzerland)

    1996-08-01

    Until recently, air conditioning systems in private buildings and single office rooms were an exception in this country rather than the rule, but it seems that the hot summer of 1995 brought about a change in this field. Confronted with the choice of raising their energy consumption and having to face the extreme heat, many house owners decided to install an air conditioning system. (orig.) [Deutsch] Bis vor kurzem bildeten Raumkuehlgeraete in Privathaushalten und Einzelbueros hierzulande eher die Ausnahme. Dies scheint seit dem letzten Sommer der Vergangenheit anzugehoeren, will man den Verkaufszahlen des Handels Glauben schenken. Im Gewissenskonflikt zwischen Energiesparen und Hitzekollaps moegen sich so manche schweissgeplagten Mitbuerger beim Kauf eines solchen Geraets in thermischer Notwehr befunden haben. (orig.)

  10. Entwicklung und Evaluation eines psychoedukativen Elterngruppen-Trainingsprogramms für Familien mit autistischen Kindern

    OpenAIRE

    Probst, Paul

    2003-01-01

    In der Einleitung wird das Konzept des "Psychoedukativen Elterntrainings" erläutert und ein Überblick über den Forschungsstand zum Thema "Elterntraining in Familien mit autistischen Kindern" gegeben. Ausgehend von dieser Analyse wurde ein psychoedukatives Eltern-Gruppentraining für Familien mit autistischen Kindern entwickelt und im Rahmen eines 3-Monate-Follow-up-Versuchsplans evaluiert. Die beiden Hauptziele des Trainingcurriculums waren "Vermittlung eines Konzepts über Wesen, Ursach...

  11. Entwicklung und Evaluation eines psychoedukativen Elterngruppen-Trainingsprogramms für Familien mit autistischen Kindern

    OpenAIRE

    Probst, Paul

    2003-01-01

    In der Einleitung wird das Konzept des „Psychoedukativen Elterntrainings“ erläutert und ein Überblick über den Forschungsstand zum Thema „Elterntraining in Familien mit autistischen Kindern“ gegeben. Ausgehend von dieser Analyse wurde ein psychoedukatives Eltern-Gruppentraining für Familien mit autistischen Kindern entwickelt und im Rahmen eines 3-Monate-Follow-up-Versuchsplans evaluiert. Die beiden Hauptziele des Trainingcurriculums waren „Vermittlung eines Konzepts über Wesen, Ursachen, Beh...

  12. MOOCs – ein Schritt zurück, ein Schritt nach vor?

    Directory of Open Access Journals (Sweden)

    Angelika Güttl-Strahlhofer

    2015-06-01

    Full Text Available MOOCs boomen. Aber sind sie nicht ein Rückschritt beim Lernen mit digitalen Medien, diese Massenkurse mit überschaubarer Didaktik? Angelika Güttl-Strahlhofer hat sich für uns die Frage gestellt, ob bzw. inwieweit MOOCs das Lernen mit digitalen Medien voran treiben. Aktuell nehme ich an dem MOOC von Futurelearn (www.futurelearn.com der Open University, UK teil, zum Thema "Propaganda and Ideology in Everyday Life". Die Teilnahme ist kostenlos, nur für das Teilnahmezertifikat wird etwas verlangt. Angemeldet ist man in wenigen Minuten und nachdem das erledigt ist, wird man in einem hochklassigen Video von einer Universitätsprofessorin in das Thema eingeführt, nicht ganz 10 Minuten lang. Ich werde aufgefordert, meine Meinung im bereit gestellten Forum , wie das bereits etwa 1000 Personen vor mir gemacht haben, darzulegen, oder das unter dem angegebenen Twitter-Hashtag zu tun. So oder so ähnlich laufen MOOCs ab. Unter einem MOOC, im Langtext: Massive Open Online Course, versteht man einen großteils kostenfreien Kurs, der für große Personengruppen entwickelt wurde und via Internet stattfindet. Landläufig sagt man, die MOOCs kommen aus Amerika. Spricht man mit europäischen, deutschsprachigen, Weiterbildnern wird klar: ähnliche Kurse gab es auch schon in den 2000er Jahren in Europa, nur der Terminus MOOC wurde in Übersee erfunden. War zu Beginn der "MOOC-Ära" insbesondere die Vernetzung der Teilnehmenden ein Ziel, hat dies im Laufe der Zeit verglichen mit der individuellen Wissensvermittlung an Bedeutung abgenommen. Die Qualität der MOOCs variiert, genauso wie eben die Bedeutung der Vernetzung im Kurs.

  13. Fallbericht: Seltene Raumforderungen der Leiste in der klinischen Erscheinung inguinaler Hernien: eine seminomatöse Lymphknotenmetastase und ein Liposarkom des Samenstranges

    Directory of Open Access Journals (Sweden)

    Burger M

    2005-01-01

    Full Text Available Einleitung: Wir berichten über eine seminomatöse inguinale Lymphknotenmetastase und ein Liposarkom des Samenstranges, die sich klinisch als eine inguinale Hernie präsentierten. Kasuistik: Fall 1: Ein 53jähriger Patient wurde unter der Annahme einer inguinalen Hernie links in einer chirurgischen Abteilung operiert. Es fand sich eine Raumforderung, welche in der Schnellschnittuntersuchung den Befund einer seminomatösen Lymphknotenmetastase ergab. In der folgenden Abklärung ergab sich ein linksseitiges pT2-Seminom. Anamnestisch wurde vor 26 Jahren eine inguinale Varikozelektomie links vorgenommen. Fall 2: Ein 61jähriger Patient stellte sich mit einer schmerzlosen Raumforderung der rechten Leiste vor, die klinisch als inguinale Hernie imponierte und seit drei Jahren größenprogredient war. Die Ultraschall- und MRT-Befunde wurden als eine inguinale Hernie mit einem Peritonealfett enthaltenden Bruchsack gedeutet. Intraoperativ fand sich ein Liposarkom des Samenstranges. Schlußfolgerung: Trotz der Häufigkeit inguinaler Herniotomien sind überraschende maligne Raumforderungen selten. Man sollte diese Möglichkeit aber bei transskrotalen Eingriffen in der Anamnese und bei nicht eindeutig einzuordnenden Befunden differentialdiagnostisch bedenken. Inguinale Lymphknotenmetastasen testikulärer Neoplasien sind selten, in der Literatur ist ein eindeutiger Zusammenhang mit Eingriffen im Skrotal- und Leistenbereich beschrieben. Die klinische Erscheinung einer solchen als Leistenhernie ist bisher noch nicht beschrieben worden. Liposarkome des Samenstranges sind ebenfalls selten. Therapeutisch sollte eine radikale chirurgische Exzision und in Fällen unklarer Absetzungsränder eine Radiatio erfolgen. Lokalrezidive treten häufig und eventuell auch spät auf.

  14. Spannungsfeld Hochwasserrückhaltung und Trinkwassergewinnung : ein Leitfaden

    OpenAIRE

    Kühlers, Dirk; Bethge, Ekkehart; Fleig, Michael; Hillebrand, Gudrun; Hollert, Henner; Lehmann, Boris; Maier, Dietrich; Maier, Matthias; Mohrlok Ulf; Wölz, Jan

    2011-01-01

    Viele Talauen sind sowohl für die Gewinnung von Trinkwasser aus Grundwasser, als auch für die Schaffung von Hochwasserrückhalteräumen geeignet. Im vorliegenden Leitfaden werden die Prozesse des Stofftransports von der fließenden Welle über den Retentionsraum bis zu den Entnahmebrunnen eines Wasserwerks vorgestellt. Es wird deren Einfluss auf ein höheres Risiko der Verunreinigung der Grundwasserressource durch den Eintrag von Schadstoffen aus den Retentionsräumen diskutiert.

  15. Fehlprogrammierung der frequenzadaptiven Parameter eines DDD-R-Schrittmachers

    Directory of Open Access Journals (Sweden)

    Wimmer L

    2000-01-01

    Full Text Available Aufgrund einer chronotropen Inkompetenz wurde bei einem 58jährigen Patienten ein frequenzadaptiver Schrittmacher implantiert. Nach Implantation kam es unerwarteterweise zu keiner Verbesserung der klinischen Beschwerdesymptomatik. In den verschiedensten kardiologischen Spezialabteilungen wurden mehrere erfolglose Neuprogrammierungen vorgenommen. Schlußendlich konnte durch Erhöhung des Anstiegsfaktors des Akzelerometers eine prompte Beschwerdefreiheit erzielt werden. Die meisten Sensoren stellen mit der Aktivität die Akzelerometer dar. Es handelt sich dabei um einen piezoelektrischen Kristall, der auf Beschleunigungsänderungen reagiert. Sehr oft kann durch einfache Änderungen der Programmierung entscheidend die Lebensqualität für den Patienten verbessert werden.

  16. Einbrennsilikonisierung bei pharmazeutischen Glaspackmitteln - Analytische Studien eines Produktionsprozesses

    OpenAIRE

    Mundry, Tobias

    1999-01-01

    Die Einbrennsilikonisierung wird schon lange verwendet, um spezielle Eigenschaften bei pharmazeutischen Glasbehältnissen zu erzielen. Üblicherweise werden Silikonöle verwendet um Gleitfilme auf den Oberflächen vorgefüllter Glasspritzen zu erzeugen oder die Glaswand zu hydrophobieren damit wäßrige Inhalte sauber ablaufen können. Weiterhin kann durch die hydrophobe Deaktivierung der Glaswände eine Reduktion der Adsorption von Wirk- und Hilfsstoffen sowie eine Erhöhung der hydrolytischen Resiste...

  17. Odyssee im Zeptoraum eine Reise in die Physik des LHC

    CERN Document Server

    Giudice, Gian Francesco

    2010-01-01

    Der Band lädt Leser ein, die Teilchenphysik mit den Augen eines Insiders zu betrachten, dadurch bieten sich neue Einblicke in die Welt der Teilchen und ihrer Wechselwirkungen. Aufschlussreich und unterhaltsam thematisieren die Autoren die Geschichte des Large Hadron Collider (LHC) und erläutern die mit dem LHC verknüpften wissenschaftlichen Fragen: Existiert das mysteriöse Higgs-Teilchen wirklich? Erstreckt sich der Raum in zusätzliche Dimensionen? Das Buch verhilft dazu, die Entdeckungen der kommenden Jahre mitzuverfolgen und nachzuvollziehen.

  18. Eine funktionsbasierte Analyse der Technologierelevanz von Nanotechnologie in der Produktplanung

    OpenAIRE

    Heubach, Daniel

    2009-01-01

    Die Nanotechnologie bietet ein großes Innovationspotenzial durch die Schaffung neuer Funktionalitäten von Materialien und Strukturen durch deren gezielte und spezifische Gestaltung im nm-Bereich. Aufgrund der Universalität und Kombinationsmöglichkeit der funktionalen Nanomaterialien eröffnen sich vielfältige Anwendungsmöglichkeiten. In der Praxis kann jedoch eine Lücke zwischen Nanotechnologie und den möglichen Anwendung identifiziert werden. Nanotechnologische Lösungsansätze sind auf Anwendu...

  19. Game-based Learning im Bildungskontext einer Hochschule. Ein Praxisbericht

    Directory of Open Access Journals (Sweden)

    Jochen Pfannstiel

    2009-04-01

    Full Text Available Das Fach Software-Engineering stellt Lernende und Lehrende gleichermassen vor eine grosse Herausforderung, da eine Vielzahl von abstrakten Methoden und Modellen zu erlernen sind. An der Hochschule Offenburg wurde das Lernspiel «Software Engineering in the Future» als Ergänzung zur Präsenzveranstaltung entwickelt. Die Studierenden sollen über das Lernspiel motiviert werden, sich mit der Thematik zu befassen, um dann in ansprechend gestalteten authentischen Szenarien einzelne Methoden zu erlernen und zu vertiefen. Der Artikel stellt die zentralen Aspekte der Spielentwicklung und Ergebnisse einer ersten Befragung der Studierenden vor.

  20. Untersuchung spinninduzierter Streifigkeit durch Online Messungen eines Spinnprozesses

    OpenAIRE

    Moritz, Christoph

    2009-01-01

    In der Verarbeitung von Polyamid zu synthetischen Garnen gibt es oft Probleme mit der Anfärbung, speziell bei Verwendung von Säure- bzw. Metallkomplexfarbstoffen. Häufig tritt eine unregelmäßige Anfärbung in Form von Streifigkeit des Gewebes auf. In der vorliegenden Arbeit werden die Einflüsse der Spinnbedingungen auf das Problem der Streifigkeit untersucht. Eine textile Hochgeschwindigkeitsspinnanlage wird mit Hilfe von Sensoren und einer Auswertesoftware in verschiedenen Betriebszuständen u...

  1. In Lernprozessen Sinn erfahren. Eine fachdidaktische Studie zur Humanistischen Lebenskunde

    OpenAIRE

    Adloff, Peter

    2010-01-01

    Zum Selbstverständnis der Humanistischen Lebenskunde, die im ausgehenden 19. Jahrhundert begründet wurde und als Schulfach derzeit in Berlin und Brandenburg angeboten wird, und des staatlichen Ethikunterrichts, der sich als Antwort auf Säkularisierung, Individualisierung und Pluralisierung von Kulturen versteht, gehört u.a., Sinnfragen von Kindern und Jugendlichen im Rahmen eines Schulfachs aufgreifen zu können. Eine Analyse diverser Rahmenlehrpläne zeigt allerdings einen ungeklärten bzw. une...

  2. Postpartale Depression: Ein interdisziplinärer Therapie- und Forschungsansatz

    Directory of Open Access Journals (Sweden)

    Oddo S

    2008-01-01

    Full Text Available Kurzfassung: Die postpartale Depression (PPD tritt mit einer Prävalenz von 5–20 % aller Entbindenden auf und hat ihren Häufigkeitsgipfel in der 2.–6. postpartalen Woche. Zusätzlich zu den für eine Depression klassifizierten Symptomen wie Interessenverlust, Antriebslosigkeit und erhöhte Ermüdbarkeit treten im Rahmen der PPD kindbezogene Symptome wie Ambivalenz, Schuldgefühle gegenüber dem Kind, zwanghafte Impulse und Infantizidabsichten auf. Bisher existieren wenig umfassende Befunde zur Ätiologie und Pathogenese. Psychische Vorerkrankungen, verminderte soziale Unterstützung sowie Geburtskomplikationen und endokrinologische Faktoren werden mit der Entstehung einer PPD diskutiert. Inwiefern diese Faktoren zusammenhängen und sich gegenseitig beeinflussen, ist derzeit noch unklar. Auch die neuroanatomischen Grundlagen der postpartalen Depression sind bislang kaum erforscht. Aufgrund der möglichen verheerenden Auswirkungen der PPD ist eine frühzeitige Intervention notwendig. Zu diesem Zweck haben wir eine multimodale und interdisziplinäre Langzeitstudie entwickelt, um Frauen nach der Entbindung sowie Hebammen und Angehörige zu unterstützen und aufzuklären. Epidemiologische Daten und psychosoziale Faktoren werden neben Persönlichkeits- und Bindungsfaktoren sowie neuroanatomischen Aspekten untersucht. Ein umfassendes Beratungsangebot mittels Telefonhotline und therapeutischer Unterstützung wurde eingerichtet. Die ersten vorläufigen Ergebnisse unserer Studie zeigen, dass ein hoher Bedarf an Beratungsangeboten erforderlich ist, da ca. 50 Hotline-Anrufe in nur wenigen Monaten erfolgten. Die PPD-Prävalenz lag bei 8 % von 185 Frauen in einem Zeitraum von sechs Wochen nach der Entbindung. Bei 5 der 14 PPD-Patientinnen lag gleichzeitig eine verzögerte Bindung zum Kind vor. Mangelnde soziale Unterstützung sowie das Stillverhalten hingen nicht mit der PPD zusammen, vielmehr spielten psychische Vorerkrankungen in der Eigen- und

  3. Fallbericht: Japanische Aspekte eines „Floridsdorfer Frauenherzens“

    Directory of Open Access Journals (Sweden)

    Veegh W

    2006-01-01

    Full Text Available bFallbericht/bbr Das „Floridsdorfer Frauenherz“ schlägt in einer 73jährigen Patientin, die sich bei Spitalsaufnahme mit den Zeichen eines akuten Vorderwandinfarktes im EKG (Abb. 1 und typischen Angina-pectoris-Beschwerden präsentierte. Anamnestisch gab die Patientin eine Hypertonie, einen Typ-II-Diabetes und Angina pectoris seit 1991 an. Es bestand allerdings keine Infarktanamnese, seit 2001 war die Patientin wegen paroxysmalem Vorhofflimmern marcoumarisiert. Am Aufnahmetag verspürte die Patientin eine schmerzhafte Schwellung im rechten Kniegelenk ohne Trauma, sie suchte eine orthopädische Ambulanz auf, wo ein Hämarthros unter Marcoumartherapie diagnostiziert wurde. Die Patientin wurde punktiert und mit einem Verband nach Hause entlassen. Nach den Anstrengungen und Aufregungen dieses Tages setzten bei der Patientin abends typische Angina-pectoris-Schmerzen ein, die an Intensität zunahmen und sie schließlich veranlaßten, die Rettung zu verständigen. Die Spitalsaufnahme erfolgte etwa 3 Stunden nach Schmerzbeginn, CK und Troponin T waren zu diesem Zeitpunkt negativ. Der Blutdruck betrug 130/70, der Puls 100 rhythmisch, der Blutzucker 209 mg/dl. Darüber hinaus bestand zu diesem Zeitpunkt eine mäßige Sprechdyspnoe. In der kurz nach der Spitalsaufnahme durchgeführten Echokardiographie zeigte sich eine ausgedehnte apikale Wandbewegungsstörung des linken Ventrikels mit hyperdynamer Kontraktilität der basalen klappennahen Myokardabschnitte. Auffallend dabei war, daß die Wandbewegungsstörung das typische Versorgungsgebiet der LAD überschritten und quasi symmetrisch die gesamten apikalen 2/3 des linken Ventrikels umfaßt hat. Der ballonartig dilatierte Apex erinnerte dabei an ein Apexaneurysma. Weiters fanden sich bei der Patientin eine septal betonte linksventrikuläre Myokardhypertrophie, ein mäßig vergrößerter linker Vorhof und eine geringgradige Mitralinsuffizienz (Abb. 2. Neben den klinischen Symptomen der

  4. Geschlecht und Technik: eine gesellschaftliche Praxis im Blick feministischer Erkenntnistheorie

    Directory of Open Access Journals (Sweden)

    Carola Schirmer

    2001-07-01

    Full Text Available Die Rezension stellt ein vielschichtiges Buch mit sehr unterschiedlichen Beiträgen zum Thema Geschlecht und Technik vor. Das breitgefächerte Spektrum der Aufsätze bietet einen guten Überblick über sehr verschiedene Forschungsansätze. Mehrere Autorinnen analysieren Geschlecht und Technik erkenntnistheoretisch-historisch, z.B. anhand der Begriffsentwicklung in verschiedenen naturwissenschaftlichen Disziplinen wie der Mathematik, Physik, Genetik und der Künstlichen Intelligenz. Eine Reihe andere Beiträge erforscht die Seite subjektiver Erfahrungen von Frauen in technisch geprägten Arbeitsfeldern mittels empirischer Studien.

  5. Wirtschaftswachstum in den Volkswirtschaftlichen Gesamtrechnungen: Ein Vergleich Deutschland - USA

    OpenAIRE

    Wolfgang Nierhaus

    2001-01-01

    In den USA wird seit 1996 die Wachstumsrate des realen BIP auf der Basis eines "chain-type annual-weighted" Fisher-Index ermittelt, d.h. die Wachstumsrate des realen BIP ist zwar unabhängig vom Basisjahr, andererseits ist aber nicht mehr gewährleistet, dass das BIP gleich der Summe seiner Komponenten ist. Trotz dieses Nachteils könnte ein Systemwechsel in den deutschen Volkswirtschaftlichen Gesamtrechnungen dann angezeigt sein, wenn auch in Deutschland bei der Messung der Preisentwicklung im ...

  6. Coxarthrosis - an update; Koxarthrose - ein Update

    Energy Technology Data Exchange (ETDEWEB)

    Imhof, H.; Noebauer-Huhmann, I.; Trattnig, S. [Medizinische Universitaet Wien, Klinik fuer Radiodiagnostik, Wien (Austria)

    2009-05-15

    klinischen Symptomatik gestellt. Die typischen konventionell-radiologischen sowie CT-Befunde sind: Gelenkspaltverschmaelerung, Osteophytenformation, subchondrale Demineralisation/Sklerose, subchondrale Zystenbildung, freie Gelenkkoerper, Gelenkfehlstellung, Gelenkdeformitaet. Durch die MR-Diagnostik lassen sich weitere Fruehsymptome bzw. Aktivitaetszeichen festhalten: Knorpeloedem, -riss, -defekt, subchondrales Knochenmarkoedem, synoviales Oedem und Gelenkerguss sowie Muskelatrophie. Derzeit wird die Bedeutung oft nur geringfuegiger Fehlformen (z. B. Impingement, Dysplasie), Fehlstellungen, Ligamentlockerungen etc. sowie Stoerungen in der Gefaessversorgung (z. B. Osteonekrose etc.) heftig diskutiert, die alle als moegliche Praearthrose eine hohe Wahrscheinlichkeit zur Arthroseentwicklung aufweisen. Dem gesamthaften Gelenkcontainment sowie der Genderproblematik wird heute ebenfalls richtigerweise hoehere Aufmerksamkeit gewidmet. In der Forschung wird mittels verschiedener MR-Verfahren (z. B. Hoechstfeld-MR mit H- und Na- Spektroskopie, T2*-Mapping etc.) der Knorpelstoffwechsel und seine Aenderungen bei Praearthrose untersucht (biochemisches Imaging). Zweifellos sind auf diesem Gebiet bereits in wenigen Jahren neue tief greifende Erkenntnisse zu erwarten. (orig.)

  7. Eine neue Art der Gattung Fieberiella Signoret, 1880 (Insecta, Homoptera) aus Griechenland

    NARCIS (Netherlands)

    Wagner, Wilhelm

    1963-01-01

    Vom Herrn W. H. Gravestein, Amsterdam, erhielt ich eine Anzahl Zikaden zur Bestimmung, die während einer Entomologischen Exkursion des Zoologischen Museums Amsterdam in Griechenland gesammelt worden sind. Darunter befand sich auch eine neue Fieberiella-Art. Eine taxionomische Bearbeitung der drei bi

  8. Die Leiden und Freuden eines Sprachlehrers : der Pädagoge Eduard Vencl

    OpenAIRE

    Němec, Mirek

    2007-01-01

    Am Beispiel der Biographie eines aus Wien stammenden Pädagogen tschechischer Herkunft werden die politischen und nationalen Konflikte des ausgehenden 19. und der ersten Hälfte des 20. Jahrhunderts in Mitteleuropa dargestellt. Dabei wird die Rolle eines Sprachlehrers als eines Mittlers zwischen zwei Kulturen sichtbar, die allerdings in totalitären Regimen nur mit großen Schwierigkeiten wahrzunehmen ist.

  9. Internetrecherche im Biologieunterricht:Eine grundlegende Studie am Beispiel der Gentechnik

    OpenAIRE

    Wedershoven, B. (Britta); Bickel, H

    2003-01-01

    In der dargestellten Unterrichtsreihe wurde das Internet zur Erarbeitung vier verschiedener Anwendungsbereiche der Gentechnik genutzt. Die Benutzung des Internets war somit in die Erarbeitungsphase der fachspezifischen Inhalte als ein Medium in didaktischem Sinne integriert, also ein Inhalte vermittelnder Gegenstand. Die Vermittlung von internetspezifischer Medienkompetenz erfolgte dabei über die konkrete Erarbeitung der fachlichen Themen („Huckepackverfahren“). Durch eine besondere Form der ...

  10. Dezentrale selbstorganisierte Grobplanung von Intralogistiksystemen mit Hilfe eines Software-Agentensystems

    OpenAIRE

    Yousefifar, Ramin; Wehking, Karl-Heinz; Beyer, Theresa; Jazdi, Nasser; Göhner, Peter

    2014-01-01

    In diesem Beitrag wird eine dezentral aufgebaute und auf Selbstorganisation basierende Methodik zur Grobplanung von Intralogistiksystemen thematisiert. Diese Methodik sieht eine Kombination des Wissenschaftsgebiets der Agentensysteme aus der Informatik mit der Materialflussplanung vor. Dieser Artikel leistet somit einen Beitrag für die Entwicklung eines intelligenten, rechnergestützten Assistenzsystems zur Planung intralogistischer Systeme. This article introduces a decentralized and self-...

  11. Interspinöse Implantate in der Wirbelsäulenchirurgie - eine Frage der Indikation: Ein Fallbericht

    Directory of Open Access Journals (Sweden)

    Decristoforo I

    2009-01-01

    Full Text Available Ein 77-jähriger Patient war wegen manifester neurogener Claudicatio spinalis bei bekannter lumbaler Spinalkanalstenose in 3 Segmenten an einer auswärtigen Institution mit perkutanen interspinösen Implantaten versorgt worden, wonach sich die klinische Symptomatik nicht änderte. Erst die mikrochirurgische Dekompression und die Entfernung der Platzhalter führten zu einer deutlichen Besserung der Beschwerden und Verlängerung der schmerzfreien Gehstrecke. Anhand dieses Falles wird die Verwendung von interspinösen Platzhaltern beleuchtet. In der bisherigen klinischen Anwendung fehlen noch die Langzeitergebnisse. Eine korrekte Indikationsstellung zur Intervention bei Spinalkanalstenose ist Voraussetzung für ein zufriedenstellendes postoperatives Ergebnis.

  12. Leitung und Kooperation in wissenschaftlichen Bibliotheken Berlins - eine empirische Untersuchung

    OpenAIRE

    Paul, Gerhard

    1998-01-01

    Die vorliegende Arbeit greift ein im bibliotheks- und IuK-wissenschaftlichen sowie im fachprofessionellen Diskurs bisher weitgehend vernachlässigtes, aber immer bedeutsameres Thema auf: das vertikale soziale Geschehen in der Arbeitsorganisation ?wissenschaftliche Bibliothek". Die Absicht der Untersuchung lag darin, einen Zusammenhang zwischen dem Interaktionsverhalten der Leitungspersonen einerseits und der Mobilisierung von Leistungs- und Innovationspotentialen bei den Mitarbeiterinnen und M...

  13. Fehlverhalten am Arbeitsplatz – ein kostspieliges Phänomen

    OpenAIRE

    Schmid, Andreas,

    2014-01-01

    Zur Bekämpfung von Fehlverhalten am Arbeitsplatz bedarf es nicht der Repression, sondern der Stärkung der emotionalen Verbundenheit der Beschäftigten mit dem Unternehmen. Doch dafür braucht es gemeinsame Werte und eine entsprechende Ausgestaltung der relevanten HR-Praktiken.

  14. Die Wissensgesellschaft und die Bildung des Subjekts - ein Widerspruch?

    Directory of Open Access Journals (Sweden)

    Sebastian Hacke

    2009-05-01

    Full Text Available Der Beitrag untersucht, inwiefern sich medienpädagogisch relevante Diskrepanzen zwischen dem Diskurs der Wissensgesellschaft und jugendlichem Medienhandeln nachzeichnen lassen. Dazu werden zunächst einige Aspekte des Konstrukts Wissensgesellschaft skizziert, das in seiner gegenwärtig populären Form ins Fahrwasser an volkswirtschaftlichen Verwertungskalkülen orientierter Denkformen geraten ist. Dies wird in Bezug auf die sich daran gekoppelte Programmatik von Kompetenz diskutiert, welche den «homo oeconomicus» beschwört und sich darin konträr zu klassisch bildungstheoretischen Kategorien verhält. Weitergeführt werden diese Überlegungen anhand der Problematisierung des Medienkompetenztheorems, das sich bis heute damit schwer tut, sich von der Vereinnahmung durch zweckrationale und restringierende Tendenzen zu befreien. Argumentiert wird, dass mit Medienkompetenz zu wenig einer milieuspezifischen Differenzierung Rechnung getragen werden kann, die eine wichtige Prämisse für eine soziale Ungleichheiten ernst nehmende Medienpädagogik ist. Als eine Alternative diskutieren wir, inwieweit sich hier praxeologische Perspektiven zum Verständnis jugendlichen Handelns anbieten. Der Beitrag mündet in einige medienpädagogisch fruchtbare Ideen, in deren Zentrum eine reflexivere, stärker am Habitus von Jugendlichen orientierte Praxis steht.

  15. Klimaschutz und Ernährungssicherheit : ein ordnungspolitischer Ansatz

    OpenAIRE

    Presse, André; Häußner, Ludwig Paul; Köke, Sonja

    2009-01-01

    Die vorliegende Arbeit untersucht und entwickelt Maßnahmen für den Klimaschutz und bezieht hierbei finanzielle Anreize unternehmerischen Handelns ein. Das vorgestellte Drei-Ebenen-Modell führt unter Verknüpfung beider Aspekte dazu, dass hierbei zugleich Ernährungssicherheit für alle Menschen realisiert werden kann.

  16. Der Einfluss von Rekrutiererverhaltensweisen auf den Bewerber: Ein mediierter Prozess

    OpenAIRE

    Eberz, Lisa-Marie; Baum, Matthias; Kabst, Rüdiger

    2012-01-01

    In dieser Studie wird die Wirkung der Rekrutiererfreundlichkeit und -kompetenz auf den Bewerber und dessen Absicht, den Bewerbungsprozess weiter zu verfolgen, empirisch analysiert. Als theoretisches Fundament dienen das Signaling und die Theory of Reasoned Action. Unter Zuhilfenahme eines Strukturgleichungsmodells kann gezeigt werden, dass die wahrgenommene Freundlichkeit und Kompetenz des Rekrutierers entgegen bisheriger Annahmen keine direkten Auswirkungen auf den Bewerbungsprozess haben, s...

  17. Auswege aus dem Natur-Technik-Dualismus: Eine konstitutionslogische Perspektive

    Directory of Open Access Journals (Sweden)

    Bettina Bock von Wülfingen

    2003-03-01

    Full Text Available Angelika Saupe ist eine ebenso aktive feministische Naturwissenschaftskritikerin wie profunde Kennerin der metatheoretischen Materie. Ihre Arbeit zeigt: Feministische Technikforschung übersieht die „Produktion von Natur“. Diese jedoch zu erkennen, decke weitreichende feministische Gestaltungsmöglichkeiten auf.

  18. Obamacare – Hoffnung auf eine Reform des amerikanischen Gesundheitssystems?

    OpenAIRE

    Sven Neelsen; Michael Metzger

    2009-01-01

    Der Umbau des US-amerikanischen Gesundheitssystems ist eines der Vorhaben der gegenwärtigen US-Regierung. Der folgende Beitrag stellt die Organisation und die Leistungsfähigkeit des derzeitigen Gesundheitswesens vor und diskutiert die aktuellen Reformvorschläge.

  19. Ist der deutsche Mittelstand tatsächlich ein Innovationsmotor?

    OpenAIRE

    Michael Berlemann; Vera Jahn

    2014-01-01

    Michael Berlemann und Vera Jahn, Helmut-Schmidt-Universität Hamburg, liefern in diesem Beitrag eine qualitative und quantitative Abgrenzung des Mittelstands und zeigen auf, dass sich mit Hilfe dieser Abgrenzung die Hypothese stützen lässt, dass mittelständische Unternehmen überdurchschnittlich innovativ sind.

  20. Katheterablation von Vorhofflimmern: Eine Standortbestimmung im Jahr 2006

    Directory of Open Access Journals (Sweden)

    Piorkowski C

    2006-01-01

    Full Text Available Vor dem Hintergrund der großen Patientenzahl, der häufig bedeutenden Symptomatik, der negativen hämodynamischen Auswirkungen, der thromboembolischen Komplikationen sowie der Einflüsse des Vorhofflimmerns auf die Mortalität kommt der Weiterentwicklung der direkten Katheterablation von Vorhofflimmern eine bedeutende klinische und auch sozioökonomische Bedeutung zu. Bei den Strategien zur Katheterablation werden die Pulmonalvenendiskonnektion, die zirkumferentielle Pulmonalvenenisolation, die Substratmodifikation mit linearen Ablationslinien und die kombinierte Strategie aus Pulmonalvenenisolation und linearen Ablationslinien unterschieden. Kürzlich sind diese Konzepte noch um die Strategie der Ablation fragmentierter Potentiale und der Ablation an Stellen vagaler Reizantwort ergänzt worden. Die Ergebnisse der publizierten Studien variieren stark in Abhängigkeit der Selektion der Patienten sowie der Methodik der Nachbeobachtung. Prinzipiell sind die Ergebnisse besser bei paroxysmalem als bei persistierendem Vorhofflimmern, und besser bei Patienten mit leichter kardiovaskulärer Grunderkrankung als mit schwerer. Bedeutende Komplikationen treten in den publizierten Studien in etwa 1–5 % auf. Hierbei sind insbesondere die Tamponade, thromboembolische Komplikationen, die Pulmonalvenenstenose, die Ösophagusperforation und die Phrenikusparese zu nennen. Die Katheterablation von Vorhofflimmern ist heute an der Schwelle zu einem Routineverfahren. Insbesondere bei hochsymptomatischen Patienten mit paroxysmalem Vorhofflimmern, die trotz eines oder mehrerer Versuche einer medikamentösen Einstellung nicht ausreichend gut behandelt sind, ist die Katheterablation schon heute eine gute Chance auf eine dauerhafte Stabilisierung des Sinusrhythmus.

  1. Die Wirkung staatlicher Fördermaßnahmen auf die Innovationsdynamik im Bereich der erneuerbaren Energien : eine Analyse der deutschen PV-Branche auf Basis eines agentenbasierten Simulationsmodells

    OpenAIRE

    Roloff, Nils

    2012-01-01

    Der zu erwartende Anstieg des Weltenergiebedarfs macht angesichts der Klimaproblematik und der begrenzten fossilen Ressourcen eine Umgestaltung der Energiesysteme dringend notwendig. Die erneuerbaren Energien sind jedoch noch nicht in der Lage, eine zuverlässige und kostengünstige Energieversorgung zu gewährleisten. Die technologische Weiterentwicklung der regenerativen Energien sowie eine effektive Gestaltung geeigneter Förderstrategien sind daher zentrale Herausforderungen, denen Industrie ...

  2. Automatische Segmentierung der Gewebegrenzen eines schlagenden embryonalen Hühnerherzens im 2D-Videobild

    Science.gov (United States)

    Thommes, Jan; Yelbuz, Talât Mesud

    Eine Klimakammer ermöglicht es, die Herzentwicklung bei Hühnerembryonen in einer schalenlosen Kultur über einen Zeitraum von etwa 50 Stunden visuell zu beobachten. Eine Hochgeschwindigkeits-Mikroskopkamera liefert eine Aufsicht auf das schlagende embryonale Herz. Da die für eine Analyse der Herzfunktion notwendige Segmentierung der Myokardgrenzen und des blutgefüllte Cavums manuell sehr zeitaufwändig ist, wird ein Ansatz zur kontinuierlichen, automatischen Segmentierung des schlagenden embryonalen Herzens mit Active Appearance Modellen präsentiert.

  3. Prolongierte iktale Hemiparese und Aphasie in Kombination mit PLEDs im EEG: ein Fallbericht

    Directory of Open Access Journals (Sweden)

    Leutmezer F

    2002-01-01

    Full Text Available Eine 89jährige Patientin wurde wegen eines konvulsiven Status epilepticus an einer internen Abteilung aufgenommen. In der Anamnese finden sich ein Zustand nach ischämischem Insult links hoch-parietal (2 Jahre vor Aufnahme, ein Zustand nach intrazerebraler Blutung in das Infarktareal (1 Jahr vor Aufnahme mit konsekutiver symptomatischer Epilepsie, die mit Lamotrigin gut eingestellt war, sowie ein chronisches, normofrequentes Vorhofflimmern. Anhand unseres Fallberichtes möchten wir mehrere Aspekte, die unserer Ansicht nach zum Teil von klinischer, zum Teil von theoretischer Bedeutung sind, herausstreichen.

  4. Merkmals- und Prototypensemantik: Eine Einführung

    Directory of Open Access Journals (Sweden)

    Bärenfänger, Olaf

    2002-01-01

    Full Text Available Traditional componential semantics are faced with various problems in adequately describing the meaning of a word. Therefore, this contribution presents the prototype theory as a fruitful approach for the description and explanation of many phenomena in the field of lexical semantics. Starting out from a large body of empirical results, it is discussed how prototype theory conceives lexical categories and meaning or concepts respectively. Important properties of a category are fuzzy boundaries as well as that particular elements can be viewed as differently typical for a category. The degree to which an element belongs to a category is defined in terms of typical features, whereby the most central element is called "prototype" and possesses the greatest possible number of typical features. Unlike traditional componential semantics, family resemblance relations determine which elements belong to a particular category, i.e. not all elements have to share the same necessary features, but at least one typical one. Subsequent to the description of these theorems consequences for argumentation theory, lexicography and the formation of linguistic theories are discussed as well as critical aspects of the prototype theory. After an enumeration of some research desiderata a concluding chapter gives a short summary and names the most impressive achievements of this increasingly influential research paradigm. Angesichts der verschiedenen Schwierigkeiten traditioneller Merkmalssemantiken, die Bedeutung eines Wortes angemessen zu beschreiben, wird mit der Prototypentheorie im vorliegenden Beitrag eine Konzeption vorgestellt, die möglicherweise vielversprechende Lösungsansätze bereithält. Ausgehend von empirischen Befunden wird diskutiert, wie lexikalische Kategorien resp. Bedeutungen oder Begriffe von der Prototypentheorie konzipiert worden sind. Als wesentliche Kategorieneigenschaften spielen hierbei insbesondere unscharfe Kategoriengrenzen eine Rolle

  5. Kyphoplasty - Vertebroplasty. A critical assessment; Kyphoplastie - Vertebroplastie. Eine kritische Standortbestimmung

    Energy Technology Data Exchange (ETDEWEB)

    Kasperk, C. [Medizinische Universitaetsklinik Heidelberg, Sektion Osteologie, Heidelberg (Germany)

    2015-10-15

    Painful vertebral compression fractures. Analgesia. Osteoplastic procedures, such as kyphoplasty and vertebroplasty. Anamnestic and radiological associations of clinical complaints with the radiomorphological findings of vertebral compression fractures are required for an adequate consideration to assess whether an osteoplastic procedure should be carried out. A computed tomography (CT) scan allows a reliable judgement whether an osteoplastic procedure is technically feasible and promising to improve the local vertebral fracture-associated pain. Prospective controlled trials have demonstrated a satisfactory improvement of back pain associated with vertebral fractures and parameters of quality of life by osteoplastic interventions. No prospective, truly sham-controlled blind trials are currently available which demonstrate an advantage of osteoplastic interventions compared to standard pain treatment; however, the currently published prospective controlled trials show a satisfactory pain reduction by osteoplastic interventions, such as kyphoplasty and vertebroplasty. Painful vertebral fractures and progressive loss of vertebral height of compression fractures should be evaluated in an interdisciplinary team consisting of radiologists, spinal surgeons and internists to assess whether an osteoplastic procedure is technically feasible and promising to improve local pain and immobility associated with vertebral fractures. (orig.) [German] Schmerzhafte Wirbelkoerpersinterungsfraktur. Schmerztherapie. Osteoplastische Verfahren wie die Kyphoplastie und die Vertebroplastie. Anamnestische und bildgebende (moeglichst CT) Assoziation der klinischen Beschwerden (Hauptschmerzbereich) mit dem radiologischen Befund eines eingebrochenen Wirbelkoerpers. Das CT gestattet am zuverlaessigsten eine Beurteilung der technischen Durchfuehrbarkeit eines osteoplastischen Verfahrens bei einer Wirbelkoerpersinterungsfraktur. Kontrollierte prospektive Studien belegen die schmerzreduzierende

  6. ETVS - a process for decentral processing of liquid, pasty and solid organic residues into electrical energy and ash, optionally with hydrosoft high-pressure dewatering, fluidized-bed drying, fluidized-bed gasification and heat-and-power cogeneration using product gas; ETVS - Ein Verfahren zur dezentralen Verwertung von fluessigen, pastoesen und festen biologischen Reststoffen in elektrische Energie und Asche, bedarfsweise mit Hydrosoft-Hochdruckentwaesserung, Wirbelschicht-Trockner, Wirbelschicht-Vergaser und Produktgas-Kraft-Waerme-Kopplung

    Energy Technology Data Exchange (ETDEWEB)

    Eder, C.; Eder, G. [Christian Eder Technology, Neunkirchen (Germany); Wied, E. [Bisanz GmbH, Saarbruecken (Germany)

    1999-07-01

    By means of the ETVS process, predominantly liquid organic residues can be converted into electrical energy and mineral ash decentrally, i.e. where they accrue. The process is exemplified with reference to sewage sludge. Sludge containing at least about 4 % dry residue is dewatered to the highest dry substance content possible. The obtained filter cakes are indirectly dried in a fluidized-bed drier using internal process waste heat. Then the organic sewage sludge constituents are gasified in an atmospheric fluidized bed system. The cleaned product gas is used to generate power in a cogeneration power plant, meeting the sewage treatment plant's in-house power demand. The ETVS process is self-sufficient in terms of thermal energy requirement from an initial dry substance content of the filter cake > 40 %. Incineration is a means of disposing of sewage sludge in accordance with the boundary conditions for sewage sludge disposal from 2005, laid down in the technical code on municipal waste. Combining the ETVS process with modern biological treatment stages makes for a substantial cut in the construction and operating cost of sewage treatment plants. (orig.) [German] Mit dem ETVS-Verfahren koennen ueberwiegend fluessige biologische Reststoffe dezentral, d.h. an der Anfallstelle in eigennutzbare elektrische Energie und mineralische Asche umgewandelt werden. Das Verfahren wird am Klaerschlamm beispielhaft dargestellt. Der Klaerschlamm wird ab einem Trockensubstanzgehalt von ca. 4%TR auf moeglichst hohe Trockensubstanzgehalte entwaessert und die dabei erzeugten Filterkuchen mit internen Prozessabwaermen in einem Wirbelschichttrockner indirekt getrocknet. Die organischen Bestandteile des Klaerschlammes werden anschliessend in einer ebenfalls atmosphaerischen Wirbelschichtanlage vergast. Der mit dem gereinigten Produktgas in einer KWK-Anlage erzeugte Strom wird zur Deckung des Eigenbedarfs der Klaeranlage verwandt. Durch die Veraschung liefert das ab einem

  7. Tomato Fruit Development and Ripening Are Altered by the Silencing of LeEIN2 Gene

    Institute of Scientific and Technical Information of China (English)

    Hong-Liang Zhu; Ben-Zhong Zhu; Yi Shao; Xiao-Guang Wang; Xi-Jin Lin; Yuan-Hong Xie; Ying-Cong Li; Hong-Yan Gao; Yun-Bo Luo

    2006-01-01

    Loss-of-function ethylene insensitive 2 (EIN2) mutations showed ethylene insensitivity in Arabidopsis,which indicated an essential role of EIN2 in ethylene signaling. However, the function of EIN2 in fruit ripening has not been investigated. To gain a better understanding of EIN2, the temporal regulation of LeEIN2 expression during tomato fruit development was analyzed. The expression of LeEIN2 was constant at different stages of fruit development, and was not regulated by ethylene. Moreover, LeEIN2-silenced tomato fruits were developed using a virus-induced gene silencing fruit system to study the role of LeEIN2 in tomato fruit ripening. Silenced fruits had a delay in fruit development and ripening, related to greatly descended expression of ethylene-related and ripening-related genes in comparison with those of control fruits. These results suggested LeEIN2 positively mediated ethylene signals during tomato development. In addition,there were fewer seeds and Iocules in the silenced fruit than those in the control fruit, like the phenotype of parthenocarpic tomato fruit. The content of auxin and the expression of auxin-regulated gene were declined in silenced fruit, which indicated that EIN2 might be important for crosstalk between ethylene and auxin hormones.

  8. Chirurgische Therapie der Stressharninkontinenz (SUI - Ein Überblick

    Directory of Open Access Journals (Sweden)

    Riss P

    2009-01-01

    Full Text Available Die Stressharninkontinenz der Frau hat ihre höchste Prävalenz um die Zeit der Menopause. Es gibt verschiedene Erklärungsmöglichkeiten für die Kontinenz bei der Frau: die anatomische Lage des Blasenhalses, die Druckübertragung auf die proximale Urethra, eine Degeneration des M. sphincter urethrae, die sogenannte Hängemattentheorie der Unterstützung des Blasenhalses, das Trampolinmodell von P. Petros und schließlich das Konzept der mittleren Urethra. Auf letzterem beruhen die Operationen, bei denen ein Prolene-Band spannungsfrei unter die mittlere Urethra gelegt wird (TVT und Modifikationen. Wegen der Einfachheit der Durchführung und der exzellenten Erfolgsraten haben diese Operationen die bewährte Kolposuspension nach Burch weitgehend verdrängt. Faszienschlingenoperationen sind speziellen Rezidivsituationen vorbehalten.

  9. Ein Universum nach Maß. Bedingungen unserer Existenz.

    Science.gov (United States)

    Gribbin, J.; Rees, M.

    This book is a German translation, by A. Ehlers, of the English original "Cosmic coincidences. Dark matter, mankind, and anthropic cosmology", published in 1989 (see 52.003.043). Contents: I. Zufälle im Weltall. 1. Wie außergewöhnlich ist unsere Welt? 2. Himmelskunde. 3. Zwei Arten dunkler Materie. II. Der Stoff aus dem die Welt besteht. 4. Der Teilchenzoo. 5. Halomaterie. 6. Der Stoff, aus dem die Kerne sind. 7. Kosmische Strings. 8. Die Schwerkraft als Fernrohr. 9. Der Lyman-Wald: Entstehung und Entwickluing von Galaxien. III. Ein Universum nach Maß? 10. Dem Menschen auf den Leib geschneidert? 11. Ein Weltall von der Stange?

  10. Beurteilung eines Übungsphantoms zur transurethralen Resektion der Prostata

    Directory of Open Access Journals (Sweden)

    Reichelt O

    2002-01-01

    Full Text Available Wir beurteilten die Eignung eines Übungsphantoms zur Simulation transurethraler Resektionen der Vorsteherdrüse (TUR-P. Es wurde in natürlicher Größe konzipiert und besteht weitgehend aus Silikonkautschuk. Ein leitender Oberarzt und zwei Assistenzärzte beurteilten unabhängig voneinander die Vergleichbarkeit des Modells mit der TUR-P hinsichtlich anatomischer Ähnlichkeit, Handling, Resektionsablauf und Resektionswiderstand. Insbesondere hinsichtlich des Erlernens des Resektionsablaufes und des Handlings einschließlich der Beurteilung des Resektionswiderstandes und -ergebnisses wurden gute Simulationsergebnisse attestiert, so daß das Modell für die Ausbildung von Assistenzärzten empfohlen werden kann.

  11. Elektromobilität - Baustein eines integrierten, klimagerechten Verkehrssystems

    OpenAIRE

    Klein, Ralf

    2013-01-01

    "Das WBGU-Gutachten 'Welt im Wandel. Gesellschaftsvertrag für eine Große Transformation' (2011) sieht Elektromobilität im Zusammenhang mit der Nutzung erneuerbarer Energien als Zukunftsmodell für den Verkehr, in dem die mit endlichen fossilen Ressourcen betriebenen Fahrzeuge sukzessive ersetzt werden. Die Elektrofahrzeuge und Ladeinfrastruktur produzierenden Unternehmen befinden sich in einem zunehmenden marktwirtschaftlichen Wettbewerb. Mit politisch gesetzten Rahmenbedingungen und Strategie...

  12. Jugendmusikbewegung? Erwachsenenmusikbewegung? Zur empirischen Gründung eines Begriffs

    OpenAIRE

    Lehmann-Wermser, Andreas

    2004-01-01

    Mit „Jugend“ und „Jugendlichkeit“ werden insbesondere die Krisenphänomene und Reformansätze in den Jahren unmittelbar vor und nach der Wende zum 20. Jahrhundert verbunden, weil hier erstmals Jugendliche selbstsozialisierend aufzutreten scheinen. Auch in der musikpädagogischen Historiografie sind die Begriffe präsent. [...] Es scheint gelegentlich, dass eher unkritisch über die Begriffe eine nahtlose und umfassende Gleichsetzung der musikalischen und musikpädagogischen Reformbestrebungen der Z...

  13. Grätzeleltern. Herausforderungen und Potenziale eines Wiener Nachbarschaftsprojekts

    OpenAIRE

    Kirsch-Soriano da Silva, Katharina

    2013-01-01

    „Grätzeleltern“ ist ein 2012 gestartetes Pilotprojekt der Caritas Wien und der Gebietsbetreuung Stadterneuerung, das sich mit strukturschwachen Wohngebieten im 6. und 15. Wiener Gemeindebezirk auseinandersetzt. Unter dem Motto „Hilfe zur Selbsthilfe“ werden BewohnerInnen rund um Themen des Wohnens und Zusammenlebens geschult und geben das erworbene Wissen als MultiplikatorInnen, als sogenannte „Grätzeleltern“, im Rahmen von Hausbesuchen an weitere BewohnerInnen in ihren Communities und Bekann...

  14. Mehrwertsteuererhöhung: Eine wirtschaftspsychologische Analyse ihrer Wirkung

    OpenAIRE

    Witte, Erich H.; Van Quaquebeke, Niels; Mölders, Christina

    2005-01-01

    Mehrwertsteuererhöhungen werden in wirtschaftlichen Kreisen normalerweise als Konsumhemmer und damit als schädlich für die Binnenkonjunktur angesehen. Um diesen Sachverhalt wirtschaftspsychologisch zu betrachten, wurden zwei Studien (online, n = 929, und offline, n = 405) durchgeführt. Es konnte nachgewiesen werden, dass eine Mehrwertsteueranhebung durch die Befragten in der Tat erst einmal als konsumeinschränkend eingeschätzt wird. Bei der nachfolgend eingesetzten experimentellen Szenari...

  15. Netzwerk- und IT-Sicherheitsmanagement : eine Einführung

    OpenAIRE

    Dinger, Jochen; Hartenstein, Hannes

    2008-01-01

    Dieses Buch führt den Leser in die beiden Themengebiete Netzwerk- und IT-Sicherheitsmanagement ein. Neben den technischen Aspekten sind dabei die strategischen, planerischen, organisatorischen und steuernden Maßnahmen des Managements von besonderer Bedeutung. Zur Verdeutlichung der Inhalte werden Fallbeispiele angeführt, bei denen insbesondere auf Erfahrungen und Maßnahmen des Rechenzentrums der Universität Karlsruhe (TH) Bezug genommen wird.

  16. Zur Effizienz des Grundwasserschutzes - eine ökonomische Analyse

    OpenAIRE

    Pfister, Gerhard

    2002-01-01

    Die erneuerbare Ressource Grundwasser steht in einem Nutzungskonflikt: Einerseits wollen Trinkwasserkonsumenten durch qualitativ hochwertiges Grundwasser ein kostengünstiges Angebot an Trinkwasser erhalten. Andererseits möchten Landwirte und Gartenbauer im Rahmen ihrer betrieblichen Zielsetzung die Möglichkeit aufrecht erhalten, Grundwasser als Senke für überschüssiges Nitrat zu nutzen. Aufgrund dieser konkurrierenden Ansprüche kann das Thema "Grundwasserschutz" auch aus ökonomischer Sicht be...

  17. Sechs-Eins-Zwo - D-P-O

    OpenAIRE

    Tietel, Erhard

    1984-01-01

    Der Autor beschreibt unter dem Eindruck einer nach dem Praktikum erlittenen schweren Krankheit seine Eindrücke und Wahrnehmungen während des Praktikums in einer Beratungsstelle des Sozialpsychiatrischen Dienstes in Bremen. Er thematisiert seine Rolle innerhalb der Beratungsinstitution und geht auf seine Erfahrungen hinsichtlich der Zusammenarbeit des Sozialpsychiatrischen Dienstes mit anderen Institutionen und hinsichtlich seiner therapeutischen Bemühungen in einem Arbeitslosenzentrum ein. Ab...

  18. Evaluation eines humanisierten Mausmodells der allergischen Atemwegsentzündung

    OpenAIRE

    Martin, Helen

    2012-01-01

    Aus der zunehmenden Prävalenz allergischer Erkrankungen vor allem in den Industrienationen ergibt sich ein erhöhter Bedarf an Grundlagenforschung im Bereich von Allergie und Asthma sowie der Entwicklung innovativer Therapiestrategien. In der vorliegenden Dissertation wurden die immundefizienten Mausstämme NOD-Scid und NOD-Scid gc als vielversprechender translationaler Schritt zwischen dem reinen Tiermodell und der Erprobung neuer Therapieansätze an Probanden in klinischen Studien beleuchtet. ...

  19. Die Vorhersage von Fragenreihenfolgeeffekten durch Antwortlatenzen : eine Validierungsstudie

    OpenAIRE

    Stocké, Volker

    2002-01-01

    'Der vorliegende Beitrag untersucht, inwieweit die Geschwindigkeit bei der Beantwortung von Einstellungsfragen als valider Indikator für die Einstellungsstärke der Befragten und als zuverlässiger Prädiktor für deren Beeinflussbarkeit durch Fragenreihefolgeeffekte angesehen werden kann. Dabei werden die Abweichungen der Antwortlatenzen bei den Zielitems von der 'normalen' Antwortgeschwindigkeit der jeweiligen Befragten und damit eine standardisierte Version dieses Indikators herangezogen. Die ...

  20. Information Lifecycle Management - Eine Methode zur Wertzuweisung von Dateien

    OpenAIRE

    Turczyk, Lars Arne

    2009-01-01

    Konventionelle IT-Architekturen betrieblicher Informationssysteme stoßen im Falle von organisatorischem Wandel in der Regel schnell an ihre Grenzen. Um strukturelle Analogien zwischen Unternehmensorganisationen und Informationssystemen zu entwickeln, wurden in den letzten Jahren unterschiedliche Ansätze verfolgt. Eine ganzheitliche Problemsicht ist jedoch erst dann gegeben, wenn auch die Speicherung gemäß den Anforderungen des Ge-schäftsprozesses Berücksichtigung in einer IT-Architektur finde...

  1. Unterrichtsentwurf: „Paneuropa“ – eine utopische Europaidee?

    OpenAIRE

    Annika Jücker

    2014-01-01

    Within the context of the internal series Europaideen im 20. Jahrhundert, Annika Jücker thematised Richard N. Coudenhove-Kalergi’s pan-European concept for her lesson plan “Paneuropa“ – eine utopische Europaidee? The plan provides insight into an early 20th century European idea, as well as an interesting lesson approach to the historical development of Europe. Utilising diverse types of sources (caricature, speech, quote), the students of an advanced level course will be familiarised with th...

  2. Solar heating for a village; Ein Dorf heizt solar

    Energy Technology Data Exchange (ETDEWEB)

    Roepcke, Ina

    2013-07-05

    In Buesingen (administrative district of Konstanz) a solar thermal system with 1091 sqm collector area is put into operation. Together with two wood chip boilers they supply more than 100 private and municipal buildings with regenerative heat. [German] In Buesingen im Landkreis Konstanz ist eine solarthermische Anlage mit 1091 qm Kollektorflaeche in Betrieb gegangen. Zusammen mit zwei Hackschnitzelkesseln versorgt sie ueber 100 private und kommunale Gebaeude mit regenerativer Waerme.

  3. Beiträge zur Instrumentierung und Identifikation eines Kleinluftschiffes

    OpenAIRE

    Wimmer, Dirk-Alexander

    2008-01-01

    Die Entwicklung moderner Luftschiffe und ihrer Steuerungs- und Regelungskonzepte erfordert exakte Modelle ihres dynamischen Verhaltens. Aus diesem Grund beschäftigt sich die vorliegende Arbeit mit der Identifikation der Luftschiffdynamik. Die Basis bildet ein Modell der Flugdynamik, das am Institut für Flugmechanik und Flugregelung mit theoretischen Grundlagen und Windkanaldaten aufgebaut wurde. Das Ziel der Untersuchung ist die Überprüfung dieses Modells an Hand von Messdaten, die mit dem Fo...

  4. Konzeption und Erprobung eines biohybriden nanoanalytischen Handheld Systems

    OpenAIRE

    Schmidhuber, Michael

    2011-01-01

    Die Arbeit befasst sich mit der Konzeption und Erprobung eines mobilen Bioanalysetools. Durch einen bioelektronischen Mikrosensorchip ist es möglich, Analysen im Bereich Lebensmitteltest und Pestiziddetektion durchzuführen. Neuartig ist hierbei die Verwendung lebender biologischer Zellen als Wandler zur Signaldetektion (cellristor). Dieser Biosensor ermöglicht die Messung von zellphysiologischen Parametern im extrazellulären Umfeld der Zelle. Sensoren für pH, Sauerstoffpartialdruck, Impedanz ...

  5. Ein Beitrag zur Blutzellmorphologie ausgewählter karnivorer Zootierarten

    OpenAIRE

    Güth, Henrike

    2004-01-01

    Henrike Güth Ein Beitrag zur Blutzellmorphologie ausgewählter karnivorer Zootierarten Zoo Leipzig Januar 2003 156 Seiten, 222 Abbildungen, 67 Tabellen, 1 Graphik, 151 Literaturangaben, Anhang mit 25 Abbildungen und 6 Tabellen Zur Beurteilung des Blutbildes ist es nötig, neben der quantitativen Betrachtung der Blutzellen auch ihre Morphologie in die Untersuchungen einzubeziehen. In der Praxis werden dazu häufig nach May-Grünwald-Giemsa-gefärbte Ausstriche verwendet. Referenzwerte zur physiolog...

  6. Das bibliothekarische Konzept der Informationskompetenz - ein Überblick

    OpenAIRE

    Ingold, Marianne

    2005-01-01

    Informationskompetenz hat sich in den letzten Jahren als wichtiges Teilgebiet des Bibliothekswesens etabliert. Der vorliegende Text gibt einen einführenden Überblick über Hintergrund und Entwicklung, Terminologie, Definitionen und Inhalte, Modelle und Standards sowie Vermittlungs- und Evaluationspraxis von Informationskompetenz im bibliothekarischen Kontext. Ein Blick auf Debatten und Kritik zeigt aber auch, dass sowohl Begriff wie Konzept in bibliothekarischen Fachkreisen keineswegs unumstri...

  7. LaMedica - Eine multimediale online Lehr- und Lernplattform [

    Directory of Open Access Journals (Sweden)

    Stracke, Sylvia

    2006-02-01

    Full Text Available [english] The project LaMedica ( has as its aim the development of a multimedia teaching and learning platform, the compilation of contents for medicine and the implementation of these in the teaching process. An on-line author environment was created which supports a variety of didactic approaches: systematic and networked communication of knowledge, case-based learning, the creation of lectures and learning sequence checks. The teaching contents can be edited and illustrated, and are aimed in particular at students, doctors in continuing education and specialists. An on-line media databank supports the re-use and the exchange of contents on the basis of a content management system through the use of the Learning Objects Metadata standards (LOM. Funding is provided by the Federal Ministry for Education and Research (FKZ NM054A. [german] Das Projekt LaMedica ( hat zum Ziel, eine multimediale Lehr- und Lernplattform zu entwickeln, Inhalte für die Medizin zu erstellen und diese in die Lehre zu implementieren. Es wurde eine on-line Autorenumgebung geschaffen, die sehr unterschiedliche didaktische Ansätze unterstützt: systematische und vernetzte Wissensvermittlung, fallbasiertes Lernen, Erstellung von Vorlesungen und Lernerfolgskontrolle. Die Lehrinhalte können zielgruppenspezifisch aufbereitet und dargestellt werden und richten sich insbesondere an Studenten, Ärzte in der Weiterbildung und Fachärzte. Eine on-line Medien-Datenbank unterstützt die Wiederverwendung und den Austausch von Inhalten auf der Basis eines Content-Management-Systems durch Verwendung des Learning Objects Metadata Standards (LOM. Die Förderung erfolgt durch das BMBF (FKZ NM054A.

  8. Systems for uninterrupted power supply; USV - ein starkes Stueck Sicherheit

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, D.; Soelter, W. [AEG SVS GmbH, Warstein-Belecke (Germany)

    1999-09-01

    The millennium bug is only one of the many potential hazards in information technology. Systems for uninterrupted power supply offer a solution. [German] Alle Welt spricht vom Jahr-2000-Problem (Y2K). Die Meinungen dazu reichen von Horror-Szenarien bis hin zum Ignorieren dieses Problems. Dabei steht fest: Das Jahr-2000-Problem ist nur eines unter vielen Gefahrenpotentialen fuer die Informationstechnik. Dabei lassen sich alle Stoerfaktoren, die aus der Energieversorgung resultieren mit einer USV beseitigen. USV sichern Geschaeftsablaeufe und Fertigungsprozesse. (orig.)

  9. A distance-corrected microwave sensor; Ein abstandskorrigierter Mikrowellensensor

    Energy Technology Data Exchange (ETDEWEB)

    Sklarczyk, C.; Kuehn, M. [Fraunhofer-Inst. fuer Zerstoerungsfreie Pruefverfahren (IZFP), Saarbruecken (Germany)

    2002-07-01

    The contribution presents experimental experience with a distance-corrected, contactless frequency-modulated continuous radar sensor (FMCW radar) in the frequency range between 75 and 100 GHz, in which the phase of the interfrequency signal is evaluate. The important point is to eliminate the nonlinearity of the frequency-voltage characteristic of the radar sensor. [German] Elektrisch nichtleitende und schwach leitende Pruefobjekte lassen sich beruehrungslos und zerstoerungsfrei mittels Mikrowellensensoren bezueglich ihrer Materialeigenschaften und ihrer Geometrie (Schichtdicke, Hohlraeume, Lunker, usw.) charakterisieren. Die Messsignale der fuer den Industrieeinsatz in Frage kommenden Sensoren sind ausser von den Objekteigenschaften auch vom Abstand zwischen dem Sensor und dem Pruefobjekt abhaengig. Zur Eliminierung der Abstandsabhaengigkeit ist der Einsatz eines zusaetzlichen, unabhaengigen Abstandsmessgeraets, z.B. eines Lasertriangulationssensors oder eines luftgekoppelten Ultraschallwandlers, noetig. Im folgenden werden experimentelle Erfahrungen mit einem abstandskorrigierten, beruehrungslos arbeitenden frequenzmodulierten Dauerstrich-Radarsensor (FMCW-Radar) im Frequenzbereich zwischen 75 und 100 GHz beschrieben. Dabei wird die Phase des Zwischenfrequenzsignals ausgewertet. Wichtig ist, dass die Nichtlinearitaet der Frequenz-Spannungs-Kennlinie des Radarsensors eliminiert wird.

  10. Rekonstruktive Urologie des oberen und unteren Harntraktes - ein Therapieupdate

    Directory of Open Access Journals (Sweden)

    John H

    2009-01-01

    Full Text Available Trotz des Fortschritts konservativer Therapiemöglichkeiten ist für viele urologische Erkrankungen ein chirurgisches Vorgehen unabdingbar. Hieraus resultiert die Notwendigkeit einer ausgefeilten rekonstruktiven Chirurgie, um verloren gegangene Funktionen der einzelnen Urogenitalorgane zu ersetzen bzw. wiederherzustellen. In erster Linie bedingen ausgedehnte radikalchirurgische Eingriffe der Onkologischen Urologie einen rekonstruktiven Ersatz im Bereich des oberen und unteren Harntraktes. Neben der Rekonstruktiven Urologie als Teil der Onkologie werden diese Techniken auch für Krankheitsbilder außerhalb des onkologischen Krankheitskreises benötigt. Der vorliegende Artikel gibt anhand Peer-reviewter Literatur einen Überblick der therapeutischen Möglichkeiten des Harnblasen- und Harnleiterersatzes, der rekonstruktiven Harnröhrenchirurgie und der Möglichkeiten der operativen Korrektur der Nierenbeckenabgangsstenose. Ähnlich wie in anderen Fachrichtungen wird auch in der Urologie der Gewebeersatz durch Tissue Engineering im Labor und Tiermodell vorangetrieben. Es ist davon auszugehen, dass eine optimalere und damit funktionellere Rekonstruktion möglich und dadurch die Lebensqualität der Patienten weitreichend verbessert wird. Durch Tissue Engineering wird ein Organ- und Gewebeersatz unter möglichst äquivalenten anatomischen und funktionellen Gesichtspunkten möglich. Die Kombination altbewährter Techniken mit innovativen Neuerungen wird sich vor allem in der nahen Zukunft an Therapieerfolg, Lebensqualität und Patientenzufriedenheit messen müssen.

  11. Doppler-Ultraschall in der Schilddrüsenabklärung: Eine Übersicht

    Directory of Open Access Journals (Sweden)

    Radl I

    2012-01-01

    Full Text Available Die farbkodierte Dopplersonographie ermöglicht in der Schilddrüsendiagnostik die Quantifizierung der Gewebevaskularisation. Die Diagnose eines Morbus Basedow kann mithilfe der Dopplersonographie aufgrund der eindeutigen Gewebehypervaskularisation praktisch allein getroffen werden und gibt Auskunft über den Therapieerfolg. Entzündliche Veränderungen der Schilddrüse zeigen im Vergleich zum M. Basedow praktisch immer einen geringeren Vaskularisationsgrad. Auch Schilddrüsentumoren zeigen eine vermehrte Vaskularisation. Während Adenome eine perinodale Durchblutung aufweisen, zeigen Karzinome eine Zunahme der zentralen Vaskularisation. Die Dopplersonographie kann zwar eine große Hilfestellung in der Abklärung von Schilddrüsenknoten bieten, eine Differenzierung zwischen benignen und malignen Gewebeveränderungen ist jedoch nicht möglich. Daher ist die ultraschallgezielte Feinnadelpunktion unerlässlich in der präoperativen Abklärung von Schilddrüsenknoten.

  12. Die Siemens AG: Inkrementale Anpassung oder Unternehmenstransformation? Eine Fallstudie über Kontinuität und Wandel eines Konzerns

    OpenAIRE

    Naschold, Frieder

    1997-01-01

    In dieser Fallstudie analysiert der Autor die Anpassungsreaktionen des Unternehmens auf strategischer wie operativer Ebene. Untersucht wurde ein prominentes, derzeit noch andauerndes Restrukturierungsprogramm des größten deutschen Elektrokonzerns Siemens. Der Autor hat drei exemplarische Unternehmensbereiche - private und öffentliche Netze sowie PCs zwischen 1992/93 und 1995 untersucht und so Einblicke in die Umstrukturierungsmaßnahmen, die durch das sogenannte TOP (Time Optimized Process)-Pr...

  13. Eine Re-Analyse der Blue Mountains Eye Study zum Kataraktrisiko durch inhalative Kortikoide: Ein Beitrag zur Objektivierung der Diskussion

    OpenAIRE

    Hartung, Joachim; Knapp, Guido

    1999-01-01

    In einer Re-Analyse der Blue Mountains Eye Study von Cumming, Mitchell und Leeder (1997) wird gezeigt, daß diese Studie keinen Beitrag zur Klärung des Kataraktrisikos von inhalativen Kortikoiden leistet. Akzeptiert man die Schlußweisen der Studie, so ergibt sich ein diffuses und zugleich aber auch interessantes Bild von diversen Aussagen zu Kataraktrisiken bei inhalativen Kortikoiden, systemisch verabreichten Kortikoiden bzw. einer Kombination von inhalativen und systemisch verabreichten Kort...

  14. Höhepunkte der Thyreologie: Eine historische Vignette

    Directory of Open Access Journals (Sweden)

    Weissel M

    2014-01-01

    Full Text Available Die vorliegende Übersicht gibt einen historischen Überblick über die Entwicklung des Verständnisses für Erkrankungen der Schilddrüse und die Möglichkeiten, diese zu behandeln. Erkenntnisse vom 3. Jahrtausend vor Christus bis ins 19. Jahrhundert ergeben, dass ein mit der Nahrung aufgenommener Stoff zur Vermeidung eines Kropfes notwendig ist, dass Kröpfe (die in gebirgigen Gegenden gehäuft vorkommen oft mit Kretinismus einhergehen und dass die Schilddrüse ein Organ ist, dessen 2 Lappen durch einen Isthmus verbunden sind. Kurz nach der Entdeckung des Halogens Jod (1811 erkennt man schon seine Bedeutung für die Behandlung und Vermeidung vom Strumawachstum. Sein Vorkommen in der Schilddrüse und im menschlichen Plasma wird eine Dekade später entdeckt. Die Klinik der Hyperthyreose wird bereits genau beschrieben, nur dauert es eine gewisse Zeit, bis man sie einer Überfunktion der Schilddrüse zuordnet. Die Klärung der Ätiologie der autoimmun bedingten Hyperthyreose erfolgte erst ab der Mitte des 20. Jahrhunderts. Therapeutisch war anfangs die Kropfexstirpation die einzige Möglichkeit. Wien und Bern waren die Zentren mit der weltweit besten Expertise. Zur Behandlung des nachfolgenden Myxödems wurden Extrakte von Schaf-Schilddrüsen verwendet. Radiojod wird seit 1946 routinemäßig zur Behandlung der Hyperthyreose und auch des Schilddrüsenkarzinoms eingesetzt. Seit 1948 stehen die Thyreostatika unverändert zur Therapie der Hyperthyreose zur Verfügung. Die verschiedenen Arten der Entzündung der Schilddrüse werden ab Ende des 19. und Beginn des 20. Jahrhunderts beschrieben. Die Pathogenese der chronischen Autoimmunthyroiditis wurde 1956 geklärt, wobei unter anderem auf das außergewöhnliche Schicksal des Erstbeschreibers H. Hashimoto eingegangen wird. Das Schilddrüsenhormon Thyroxin wurde zu Beginn des 20. Jahrhunderts entdeckt. Die Synthese gelang etwa 10 Jahre danach. Die Existenz von 3,5,3’-Triojodthyronin (T3 wurde Mitte der

  15. Determinanten der Firmen- und Branchenentwicklung in evolutorischen Modellen, Analyse eines Simulationsmodells (GERMAN)

    OpenAIRE

    Martin Bemmann

    2005-01-01

    Eine formale Analyse der Firmen- und Branchenentwicklung muß nicht auf so stark vereinfachenden und damit unrealistischen Annahmen zurückgreifen, wie dies in neoklassischen Modellen geschieht. Evolutorische Simulationsmodelle bieten sich hier als eine Alternative an. Sie gestatten eine realistischere Abbildung individueller Entscheidungsprozesse, Handlungsmöglichkeiten und -weisen und ermöglichen die Analyse der sich hieraus ergebenden Interaktionen heterogener Individuen auch über lange Zeit...

  16. Das Kindersprachscreening (KiSS) - ein Verfahren zur Sprachstandserfassung vierjähriger Kinder

    OpenAIRE

    NEUMANN, K; Holler-Zittlau, I; Sick, U; Zaretsky, Y; Euler, HA

    2009-01-01

    Einleitung: Zur Feststellung von Sprachförder- oder -therapiebedarf eignet sich ein Sprachscreening, sofern es eine ausreichende Validität aufweist und über streng algorithmische Kriterien zur Auffälligkeitsklassifizierung verfügt. Material und Methode: Für eine hessenweite Erfassung der vorschulischen Sprachkompetenz wurde das psychometrisch geprüfte Kindersprachscreening (KiSS) entwickelt. 257 Kinder im Alter von 4;0 bis 4;5 Jahren wurden mit einer Testbatterie auf ihren Sprachstand ...

  17. Formale Mengenlehre und Topologie:Ein Beitrag zur Degradierung des Mengenbegriffs

    OpenAIRE

    Hohelüchter, M. (Martin)

    2007-01-01

    Die Mengenlehre hat heute eine Zwitterstellung: Einerseits beherrscht ihre Terminologie einen Großteil der Mathematik, andrerseits soll sie als eine spezielle formale axiomatische Theorie aufgebaut werden. Die Hilbertsche Auffassung der Formalität als syntaktische und somit sprachgebundene Struktur scheint diese beiden Aufgaben vereinbar zu machen. Diese Auffassung wird hier in Frage gestellt und durch eine andere rein strukturelle ersetzt, der auch die Sprache unterworfen ist. Danach sind ni...

  18. Determinanten des Verhaltens : Verhaltensprädiktion durch eine Weiterentwicklung der Theory of Planned Behavior

    OpenAIRE

    Hilkenmeier, Frederic; Treeck, Joost van

    2007-01-01

    "Obwohl die Theory of Planned Behavior eines der einflussreichsten Modelle der Sozialpsychologie ist, konnte die Wirkweise ihrer Komponenten bis heute nicht eindeutig geklärt werden. Die theoretisch naheliegende und oft publizierte Vermutung, zwischen Verhaltensabsicht und Kontrollmöglichkeit bestehe eine Interaktion, ist bisher nie eindeutig nachgewiesen worden. Diese Studie entwickelt ein Modell, das den Gedanken der Interaktivität gezielt in die Theorie integriert. Die Bestimmung von Kennw...

  19. Aufbau eines Photolumineszenz-Messplatzes zur Charakterisierung von Wafern und Solarzellen aus kristallinem Silizium

    OpenAIRE

    Steuer, Benjamin

    2011-01-01

    Die Arbeit behandelt neben den Grundlagen der Lumineszenz in Silizium den Aufbau und die Entwicklung eines Photolumineszenz-Messplatzes. Bei der Photolumineszenz-Methode kommt die optische Anregung von Ladungsträgern mittels eines Infrarotlasers bzw. mittels eines LED-Arrays zum Einsatz. Die im Silizium auftretende Rekombinationsstrahlung (Lumineszenz) wird mittels einer sensitiven Infrarotkamera detektiert, wodurch sich unter anderem Informationen über Ladungsträger-Lebensdauern in Siliziumw...

  20. Etablierung eines spezies-spezifischen in vitro-Instrumentariums zur Erfassung der Induktion des Fremdstoffmetabolismus

    OpenAIRE

    Fery, Yvonne

    2009-01-01

    Der Kernrezeptor PXR spielt eine bedeutende Rolle im Fremdstoffmetabolismus als auch im Stoffwechsel endogener Substrate. Er reguliert die Expression zahlreicher Proteine des Fremdstoffwechsels. Deshalb hat die Aktivierung oder Hemmung des PXR einen großen Einfluss auf den Stoffwechselstatus dieser Proteine. Zum derzeitigen Stand der Forschung nimmt der PXR eine Schlüsselfunktion bei der Regulation der CYP3A-Enzyme ein. Es besteht deshalb Interesse Substanzen, die in Verdacht stehen PXR abhän...

  1. Vermittlung von Informationskompetenz an der Grundschule : Erarbeitung eines integrativen Praxiskonzepts für den Deutschunterricht

    OpenAIRE

    Schulz, Lena

    2011-01-01

    Diese Arbeit stützt sich auf die These, dass die Vermittlung von Informationskompetenz bereits in der Grundschule notwendig ist, da der Computer und das Internet mittlerweile fester Bestandteil des Alltags von Grundschülern geworden sind. Deshalb sollte man ihnen Wissen, das eine kompetente Nutzung dieser Medien ermöglicht, an die Hand geben. Die Basis der Arbeit bildet eine auf einem Quellenstudium basierende Definition von Informationskompetenz inklusive eines Überblicks über verschiedene T...

  2. Ausländer in Deutschland: ein langwieriger Integrationsprozeß : demographische und sozialstrukturelle Aspekte

    OpenAIRE

    Wiegand, Erich

    1990-01-01

    Auf der empirischen Grundlage verschiedener Befragungen und statistischer Datenquellen behandelt der Beitrag demographische und sozialstrukturelle Aspekte der Integration von Ausländern in der Bundesrepublik Deutschland. Hervorgehoben wird dabei ein geringes Interesse der Ausländer an einer Einbürgerung und eine langsame Entwicklung bei der schulischen Integration. Bei der beruflichen Integration wird eine uneinheitliche Entwicklung vermerkt, die sich u.a. in einer abnehmenden Konzentration d...

  3. Design und Modellierung eines integrierten Bioprozesses zur Produktion natürlicher Aromastoffe

    OpenAIRE

    Maltzahn, Bianca

    2005-01-01

    Im Rahmen der vorliegenden Arbeit wurde ein integrierter Bioprozess zur mikrobiellen Biokonversion von L-Phenylalanin zu den natürlichen Aromastoffen 2-Phenylethanol (2-PE) und 2-Phenylethylacetat (2-PEA) entwickelt und optimiert. Zur in situ Entfernung der inhibierenden Produkte (2-PE, 2-PEA) wurde das Verfahren der organophilen Pervaporation gewählt. Nach Charakterisierung und Optimierung des Prozesses erfolgten eine Maßstabsvergrößerung sowie die Erstellung eines Modells zur Beschreibung d...

  4. Ein Risikoausgleichsmodell für den Wettbewerb um Bestandskunden in der PKV

    OpenAIRE

    Nell, Martin; Rosenbrock, Stephan

    2008-01-01

    Die Diskussion über die Portabilität der Alterungsrückstellung in der deutschen Privaten Krankenversicherung (PKV) leidet unter dem Fehlen eines konkreten Modellrahmens. Hier setzt die vorliegende Arbeit an, indem erstmals ein Risikoausgleichsmodell zur Übertragung der Alterungsrückstellung formuliert wird. Das Modell ist kompatibel mit den bestehenden Methoden der PKV-Tarifkalkulation. Zentral ist dabei ein kollektiver Risikoausgleichsbetrag, der mit der Rechnungsgrundlage Grundkopfschaden i...

  5. Eine Enzyklopädie – aber was für eine ? What kind of encyclopedia is this?

    Directory of Open Access Journals (Sweden)

    Michael Hascher

    2001-11-01

    Full Text Available Die „Enzyklopädie der DDR“ ist, anders als die „Enzyklopädie des Nationalsozialismus“, die 1999 als Band 20 der „Digitalen Bibliothek“ erschienen war, nicht die elektronische Version eines auch in einer Printausgabe erhältlichen Werkes. Vielmehr werden hier drei ältere, gedruckte Nachschlagewerke zu einer elektronischen Ausgabe zusammengeführt. In der folgende Besprechung verweist der Verfasser auf einige Mängel, die gegen diese Form eines Nachschlagewerks sprechen. Andererseits sieht das Urteil über die Brauchbarkeit der Enzyklopädie für Arbeiten in der Frauen- und Geschlechtergeschichte nicht so negativ aus, denn abgesehen von ihren Schwachstellen ist die CD durchaus eine gut zugängliche Datenkompilation.Unlike the “Encyclopedia of National Socialism,” which was published in 1999 as volume 20 of the “Digital Encyclopedia,” the Encyclopedia of the GDR is not merely a digitalized book. Rather, it combines the contents of three older print encyclopedias. The reviewer points to a few flaws which he argues arise from the digital nature of this encyclopedia. Aside from this criticism, this encyclopedia does have to offer a fair bit of useful and accessible information for anyone working in women’s studies and gender studies.

  6. Ein Speichermagazin für die Staatsbibliothek zu Berlin – Preussischer Kulturbesitz. Eine betriebliche Perspektive

    Directory of Open Access Journals (Sweden)

    Daniela Lülfing

    2015-01-01

    Full Text Available Da die Magazinkapazitäten der beiden Häuser der Staatsbibliothek zu Berlin Unter den Linden und Potsdamer Strasse erschöpft sind, wurde im Berliner Ortsteil Friedrichshagen ein Speichermagazin nach dem Entwurf des Münchner Architekten Eberhard Wimmer errichtet. In einem ersten Bauabschnitt ist Magazinkapazität für 6 Millionen Bände entstanden, die von der Staatsbibliothek gemeinsam mit dem Ibero-Amerikanischen Institut und der Bildagentur für Kunst, Kultur und Geschichte der SPK genutzt wird. Die Bände stehen weiterhin zur Benutzung zur Verfügung. Der Betrieb des Speichermagazins erfolgt erstmals komplett durch Dienstleister. Since the storage capacities in both buildings of the State Library of Berlin have been exhausted, a new storage library has been built in Berlin-Friedrichshagen. The architect for this building was Eberhard Wimmer from Munich. In phase one of the building work, space has been created for about 6 Million volumes. This space is going to be used by the State Library, the Ibero-American Institute, and the Bildagentur für Kunst, Kultur und Geschichte of the Stiftung Preussischer Kulturbesitz. All volumes will be equally available to all users. Also, for the first time, the storage library will be operated by an external service company. L’espace de stockage de ses bâtiments à Unter den Linden et Potsdamer Strasse étant épuisée, la Staatsbibliothek zu Berlin a construit un nouveau dépôt situé dans le quartier de Friedrichshagen à l’est de Berlin et dessiné par l’architecte munichois Eberhard Wimmer. Le premier module achevé est utilisé tant par la Staatsbibliothek que par l’Institut ibéro-américain et la Bildagentur für Kunst, Kultur und Geschichte (Agence graphique pour l’art, la culture et l’histoire de la Fondation pour le patrimoine culturel prussien SPK. Les ouvrages restent à la disposition du public. Ce dépôt est le premier de son genre entièrement géré par des prestataires de

  7. Lernen als Entwicklung der mathematischen Sinne: Ein Beispiel aus der Algebra

    OpenAIRE

    Janssen, Thomas

    2014-01-01

    Wer die Algebra beherrscht, hat ein Gespür dafür, wie mit ihren Strukturen umzugehen ist. Er oder sie weiß, wie man eine Gleichung löst, was ein Funktionsterm aussagt oder wie sich ein quadratischer Ausdruck umformen lässt. Gerade wenn die Algebra für Probleme sorgt, hört man naturalisierende Äußerungen wie: „Dafür fehlt mir der Sinn“. Dass dieser Sinn sich (weiter-)entwickeln kann, wird damit implizit verneint.

  8. Entscheidung als notwendige Fiktion: Über eine fundamentale ökonomische Narration

    OpenAIRE

    Priddat, Birger P.

    2015-01-01

    Elena Esposito analysiert das ökonomische Entscheiden in Zukunftsmärkten (finance) als „Fiktion der wahrscheinlichen Realität“ (Esposito 2007). Eine ‚wahrscheinliche Realität’ ist eine Realitätsvermutung. In der Vermutung steckt eine Vorauswahl dessen, was wahrscheinlicher ist als anderes. Damit ist angedeutet, daß weiterhin anderes, andere Realitäten im Spiel sind, aber nicht mitspielen. Wenn aber mehre Realitäten möglich sind, ist die Behauptung, eine davon wäre wahrscheinlich (eigentlich g...

  9. Public-Health-Apekte der Hypertonie: ein Update

    Directory of Open Access Journals (Sweden)

    Dorner T

    2009-01-01

    Full Text Available Die Darstellung des Public-Health-Problems aufgrund von Hypertonie ist stark verbunden mit den Auswirkungen auf das kardiovaskuläre Risiko, die kardiovaskuläre Mortalität und mit dem Einfluss auf die Lebensqualität. In Österreich ist Hypertonie für 22,8 % aller Todesfälle und 8,9 % der DALYs (Disability adjusted life years verantwortlich. Hypertonie ist ein modifizier- bis eliminierbarer Risikofaktor, dem durch die Implementierung einer medikamentösen Therapie, die Etablierung von Lebensstiltherapie oder die Kombination von beiden entgegengewirkt werden kann. Dennoch ist das Blutdruckbewusstsein ("Awareness" in der Bevölkerung geringer ausgeprägt als die Awareness bezüglich anderer kardiovaskulärer Risikofaktoren wie Rauchen oder Übergewicht. Es gibt große Mängel in der Blutdruckkontrolle, im Sinne des Erreichens und Aufrechterhaltens von Normalwerten. Die Kosten, die aufgrund von nicht oder schlecht behandelter Hypertonie entstehen, sind enorm. Das präventive Potenzial durch Blutdruckbehandlung, bei der Lebensstilmaßnahmen durch medikamentöse Maßnahmen eher unterstützt statt ersetzt werden sollen, ist sehr hoch. Ziel der Prävention ist eine Verhinderung der hypertoniebedingten Folgeerkrankungen. Dies bedingt einen interdisziplinären Zugang und integrierte Versorgungsmodelle, wobei die verschiedenen "Stakeholder" wie Ärzte und alle Health Professionals, Patienten, aber auch die Gesundheitspolitik miteinbezogen werden. „Empowerment“ der Patienten soll durch öffentliche Bewusstseinsbildung und Information gewährleistet werden. Durch Public-Health-Programme und eine umfassende Public-Health-Policy kann die Lebensqualität erhöht und die Lebenserwartung in Gesundheit gesteigert werden.

  10. Eine vergleichende Studie zweier Sextantenbiopsietechniken in derselben Prostata

    Directory of Open Access Journals (Sweden)

    Brössner C

    1999-01-01

    Full Text Available Einleitung: Ziel dieser Studie ist ein Vergleich der "Standard"-Sextantenbiopsietechnik mit der Fächerbiopsietechnik. Letztere hat ihren Schwerpunkt im Apikalbereich der Prostata, in dem die meisten Karzinome entstehen. Methoden: Insgesamt wurden 280 Patienten in diese Studie inkludiert. Von jedem Patienten wurden 12 Stanzen gewonnen. Sechs Stanzen wurden mit der "Standard"-Biopsietechnik (Technik A gewonnen: In beiden Lappen der Prostata wurden je 3 Stanzen hintereinander (Apex-Mitte-Basis in einem Winkel von ca. 45° gewonnen (Abb. 1. Sechs weitere Stanzen vom linken zum rechten Rand der Prostata, in einer Ebene immer apikal eingehend wurden mit der Fächertechnik (Technik B gewonnen (Abb. 2. Ergebnisse: Insgesamt wurden 72 Prostatakarzinome (PC entdeckt (= 25,7 %. In der PC Untergruppe mit PSA 10 hat Technik A eine Sensitivität von 88,8 % (p = 0,037, Technik B 96,2 % (p = 0,326 verglichen mit dem Referenzstandard von 100 % erzielt mit allen 12 Stanzen. In bezug auf die Anzahl der Karzinom-positiven Stanzen ist in dieser Untergruppe Technik B in 12 Fällen überlegen, Technik A in 3, ausgeglichen sind beide Techniken in 12 Fällen. In der PC Untergruppe PSA 10 hat Technik A eine Sensitivität von 93,3 % (p = 0,083, Technik B 88,8 % (p = 0,023. In bezug auf die Karzinom-positiven Stanzen ist in dieser Untergruppe Technik B in 12 Fällen überlegen, Technik A in 14, ausgeglichen sind beide Techniken in 19 Fällen. Konklusion: Die Fächerbiopsietechnik bringt Vorteile bei Patienten mit PSA 10 sowohl in Hinblick auf die Karzinomentdeckungsrate, als auch bezüglich der Anzahl der positiven Stanzen. Da die Fächerbiopsie mehr den Apikalbereich der Prostata bevorzugt, sollte sie bei frühen Karzinomen (PSA 10 Anwendung finden.

  11. Okto - Ein zukunftsträchtiges Modell medialer Partizipation

    Directory of Open Access Journals (Sweden)

    Georg Lindner

    2014-03-01

    Full Text Available Als kleiner Sender mit großen Ideen ging Okto am 28. November 2005 um 20 Uhr on air. Seither haben an die 350 verschiedene Gruppierungen unterschiedlichster Zusammensetzung, was Alter, Herkunft, Interessen und Vorstellungen betrifft, mit der Produktion eigener Sendereihen am Zustandekommen des vielfältigen, spannenden und immer professioneller hergestellten Programm des Sender mitgewirkt. Diese Erfolgsgeschichte macht es deutlich: Partizipation ist aus der medialen Gegenwart nicht mehr wegzudenken und stellt, das zeigen die Bemühungen vieler – auch kommerziell orientierter Anbieter – eine der größten und spannendsten Herausforderungen für die Medienproduktion der Zukunft dar.

  12. IB Online (3/11): eine kleine Netzschau

    OpenAIRE

    Wender, Stefan

    2014-01-01

    In der Netzschau diese Woche haben wir versucht, mal “neue” Themen für Euch rauszusuchen: so findet sich hier Links zu einer Diskussion der neuen, nicht-westlichen Weltordnung, der Bekämpfung von Ebola mittels des Militärs, einer grundsätzlichen Diskussion der Ursachen von Armut sowie – nun gut, so neu ist das nicht – der Lage in der Ost-Ukraine. Dazu gibt es ein paar unkommentierte, aber dennoch lesenswerte Links. Viel Spaß!

  13. Singen im Alterungsprozess - eine explorative Studie in der Altersgruppe 50+

    OpenAIRE

    Von Rotenhan, Monika

    2011-01-01

    Der demographische Wandel Deutschlands, der in zunehmender Lebenserwartung und zurückgehender Geburtenrate begründet ist, erfordert ein Umdenken bezüglich vorhandener Strukturen im Gesellschaftssystem, damit den Herausforderungen einer überalterten Bevölkerung begegnet werden kann. Die späte Lebensphase ist häufig durch Multimorbidität gekennzeichnet und stellt damit enorme Belastungen für das Gesundheitssystem dar; Prävention und Gesundheitsförderung rücken dadurch mehr in den Mittelpunkt. N...

  14. Propädeutikum Java : ein Buch zum Selbststudium

    OpenAIRE

    Buchwald, Hagen; Elstermann, Matthes

    2011-01-01

    Propädeutikum Java ist ein Einführungskurs in die Programmiersprache Java für Schüler und Abiturienten, die sich auf das Studium vorbereiten möchten. Die Autoren - erfahrene Dozenten, Übungsleiter und Tutoren am Karlsruher Institut für Technologie (KIT) - ermöglichen Anfängern den Einstieg in die faszinierende Welt der Programmierung anhand einer Vielzahl einfacher und einprägsamer Beispiele, die den Einstieg in die Programmierung mit Java im Selbststudium ermöglichen.

  15. Eine über 300-jährige Geschichte

    OpenAIRE

    Lerch, Gisela; Schaefgen, Annette; Aue, Stefan

    2012-01-01

    Die Berlin-Brandenburgische Akademie der Wissenschaften (vormals Preußische Akademie der Wissenschaften) ist eine moderne, zukunftsorientierte Wissenschaftseinrichtung, die in einer großen, mehr als 300-jährigen Tradition steht und auf eindrucksvolle Leistungen verweisen kann. Bis heute prägen 78 Nobelpreisträger ihre bewegte Geschichte, die - unter wechselnden Namen - bis zur Kurfürstlich Brandenburgischen Sozietät der Wissenschaften zurückreicht, welche im Jahre 1700 von Gottfried Wilhelm L...

  16. Zum Unternehmerhabitus. Eine kultursoziologische Bestimmung im Hinblick auf Schumpeter

    OpenAIRE

    Loer, Thomas

    2006-01-01

    Unternehmerisches Handeln ist soziologisch gesehen ein Typus des Handelns, der unter den Bedingungen der Moderne exemplarisch für Handeln überhaupt stehen kann, verbindet es doch Freimut zu riskanter Entscheidung mit dem Anspruch auf rationale Verlässlichkeit: Der Unternehmer kann ebenso wenig umhin, Neuerungen zu suchen und zu fördern wie er dabei auf berechnende Berücksichtigung und materiale Würdigung seiner Möglichkeiten und der Erfolgschancen seines Handelns verzichten kann. Um so handel...

  17. Odontologie im numismatischen Spiegel : Ein Beitrag zur Geschichte der Zahnheilkunde

    OpenAIRE

    Heckert, Gerold Rüdiger

    2006-01-01

    Obgleich Medaillen mit zahnheilkundlichen Motiven schon sehr lange vertreten sind, hat dies in der Literatur bisher wenig Beachtung gefunden. Eine eigenständige Veröffentlichung erschien 1988 herausgegeben von Ladendorf und Salaschek (Proskauer 1940), die sich aber nur mit der Reklame von Zahnärzten und für Zahnärzte auf Medaillen befasst. Dieser Publikation liegt die Zusammenstellung von Storer und der Katalog zur Sammlung Brettauer zu Grunde. In den USA führte der Gynäkologe Horatio...

  18. Seelsorgliche Gesprächsführung : ein Lernprogramm

    OpenAIRE

    Baumann, Urs; Reuter, Mark; Teuber, Stephan

    2002-01-01

    Wir leben in einer Zeit der Mißverständnisse, in einer Welt, in der die Menschen trotz immer besserer Kommunikationsmittel zunehmend Probleme haben, sich über das Lebensnotwendige zu verständigen. Apathie und Gleichgültigkeit, Ungeduld und Rechthaberei, Intoleranz gegenüber Ausländern bis hin zum blanken Fremdenhaß, das massenhafte Scheitern von Partnerschaften, das alles sind Anzeichen für eine Gesellschaft, in der es Menschen offenkundig schwerfällt, andere Sprachen, Kulturen und Gedankenwe...

  19. Das Verschwinden des Patriarchats : modernisierungstheoretische Ansichten eines umstrittenen Theorems

    OpenAIRE

    Kahlert, Heike

    2000-01-01

    'Die Frage von Macht und Herrschaft in den Geschlechterverhältnissen gehört auch an der Schwelle zum 3. Jahrtausend zu den nach wie vor ungelösten Kernthemen von politischer Theorie und Praxis. Folglich erweist sich das Ende des Patriarchats als eine mächtige emanzipatorische Utopie. In diesem Beitrag wird dieses utopische Moment feministischer Denk- und Politikbewegungen am Beispiel des Ansatzes der italienischen Frauen aus der Libreria delle donne di Milano diskutiert. Die Vision 'der Mailä...

  20. Ein Maulwurf für den Mars

    OpenAIRE

    Köhler, Ulrich

    2012-01-01

    Kein Planet wird gegenwärtig so intensiv erforscht wie der Mars. Nicht nur die vielfältigen Spuren, die Wasser in der Frühzeit auf dem Planeten hinterlassen hat, begründen die aufwändige Suche nach kleinen, ökologischen Nischen auf dem Mars und nach organischen Molekülen. Eine ganz andere Frage ist, wie sich der Mars zu dem Himmelskörper entwickelt hat, der er heute ist: Hier tappt die Wissenschaft noch ziemlich im Dunkeln. Das soll sich aber 2016 ändern, wenn die Forschungsstation I...

  1. Fiskalische Effekte der Zuwanderung nach Deutschland: Eine Generationenbilanz

    OpenAIRE

    Bonin, Holger

    2001-01-01

    Der Beitrag untersucht die Bedeutung von Zuwanderung für die langfristige Entwicklung öffentlicher Haushalte in Deutschland. Mit Hilfe der Generationenbilanzierung werden die Nettosteuerzahlungen von Zuwanderern von ihrer Ankunft im Aufnahmeland bis an ihr Lebensende geschätzt. Wenn künftige Einwanderer der heute in Deutschland lebenden Ausländerbevölkerung ähneln, ist der Gesamtbeitrag der Zuwanderung zu den öffentlichen Haushalten eindeutig positiv. Immigration wäre daher ein geeignetes Ins...

  2. Cloning of Brassica napus EIN3 Gene and Its Expression Induced by Sclerotinia sclerotiorum%甘蓝型油菜BnEIN3基因的克隆及菌核病诱导表达研究

    Institute of Scientific and Technical Information of China (English)

    许李明; 黄军艳; 刘学群; 覃瑞; 刘胜毅

    2009-01-01

    [Objective] The study was to investigate roles of Brassica napus EIN3 in (BnEIN3) resistance to Sclerotinia sclerotiorum. [Methods] Genomic PCR and RT-PCR were carried out to isolate genomic DNA and cDNA sequences of BnEIN3 from oilseed rape, based on the highly conserved region of EIN3 gene from Arabidopsis thaliana and the homologous sequences of oilseed rape ESTs. Expression levels of BnEIN3 were detected in three varieties of oilseed rape inoculated with S.sclerotiorum by real-time quantitative PCR. [Results]A 1 947 bp DNA fragment was obtained from oilseed rape. The fragment shared 82% identity to A. thaliana EIN3, encoded 614 amino acids containing an EIN3 domain, and was named as BnEIN3. Real-time PCR results showed that expression patterns of BnEIN3 were drastically different in different varieties. In highly resistant oilseed rape variety D083, BnEIN3 expression level was significantly increased 72 h after S.sclerotiorum inoculation whereas in middle resistant and susceptible varieties Zhongshuang 9 and 84039, BnEIN3 expression was suppressed. [Conclusion] BnEIN3 may play an important role in oilseed rape resistance to S.sclerotiorum.

  3. IFRS 8 OPERATING SEGMENTS: Eine Untersuchung der erstmaligen Anwendung in der Schweiz

    OpenAIRE

    Meyer, C.; Weiss, S.

    2010-01-01

    Seit dem 1. Januar 2009 sind kotierte IFRS-Anwender verpflichtet, eine Segmentberichterstattung nach IFRS 8 zu erstellen. Anhand einer Analyse der Geschäftsberichte 2009 der an der SIX Swiss Exchange kotierten Unternehmen soll ein Überblick über die erstmalige Anwendung von IFRS 8 "Operating Segments" in der Schweiz gewonnen werden.

  4. Review Essay: Dialogische Introspektion : eine Erweiterung des empirischen Methodenspektrums durch die Wiederentdeckung von Introspektionsverfahren

    OpenAIRE

    Weggen, Jenny

    2012-01-01

    Das Buch "Dialogische Introspektion. Ein gruppengestütztes Verfahren zur Erforschung des Erlebens" beschreibt die Wiederentdeckung und Weiterentwicklung eines weitgehend in Vergessenheit geratenen qualitativen Verfahrens im Methodenspektrum von Psychologie und Sozialwissenschaften. Die Hamburger Forschungswerkstatt um Thomas BURKART, Gerhard KLEINING und Harald WITT greift das Verfahren der Introspektion auf, systematisiert es und entwickelt es unter Bezugnahme auf neue Erkenntnisse der empir...

  5. Eine bisher unbekannte Doline im Bereich des Sattels von Holte bei Osnabrück

    OpenAIRE

    Kieser, Helmuth

    2012-01-01

    Ein bisher nicht bekannt gewordener Erdfall im Gebiet östlich Holte ist auf unterirdische Ablaugung von Gips im Mittleren Muschelkalk zurückzuführen. Er befindet sich da. wo ein stärkeres Abtauchen der Schichten festzustellen ist. was seine Entstehung an dieser Stelle begünstigt haben dürfte.

  6. Der Beginn der Philosophie in Indien: Die Upanischaden, ein Überblick

    OpenAIRE

    Hausknotz, Florentina

    2002-01-01

    Vor welchem Hintergrund entstanden die Upanischaden? · gesellschaftliche, politische Situation Vedische Literatur, ein Überblick. Die Upanischaden; Themen, Hintergründe. · wichtige Denker Wie werden die Upanischaden eingeteilt? Der Hinduismus. · Hinduismus, eine Religion? · Der upanischadische Hinduismus

  7. Untersuchungen zur klinischen Anwendung von niederenergetischem, gepulstem Ultraschall bei der Distraktionsosteogenese : eine prospektiv randomisierte Studie

    OpenAIRE

    Dudda, Marcel

    2008-01-01

    Einleitung: Im Rahmen der vorliegenden Untersuchung zur Wirksamkeit von niederenergetischem, gepulstem Ultraschall bei Distraktionsosteogenesen sollte gezeigt werden, ob sich eine Beschleunigung der Regeneratreifung durch die Behandlung mit Ultraschall erzielen lässt. Methode: Hierzu wurden 40 Patienten in einer prospektiven, randomisierten Studie mit Distraktionskortikotomien >2cm eingeschlossen. Ergebnis: Es konnte eine deutliche Verkürzung der Behandlungszeit in der Untersuc...

  8. Digital Literacy – ein Garant für gesellschaftliche Partizipation?

    Directory of Open Access Journals (Sweden)

    Susanne Krucsay

    2009-09-01

    Full Text Available E-Inclusion ist ein politisches Programm der EU-Kommission – schlag nach bei Lissabon. Digital literacy wiederum wird als ein Teilbereich eben dieses Einschlusses geführt. Zu Recht? Zunächst eine Erklärung der Titelfrage: E-Inclusion ist ein politisches Programm der EU-Kommission – schlag nach bei Lissabon. Digital literacy wiederum wird als ein Teilbereich eben dieses Einschlusses geführt. Zu Recht? Mit dem Zauberwort Literacy werden wir uns in einer der nächsten Ausgaben der MEDIENIMPULSE eingehend beschäftigen, für diesen Beitrag, der im Ressort Medien/Bildung/Politik angesiedelt ist, wollen wir uns ein bisschen umsehen, was sich bildungspolitisch im Bereich Digitale Kompetenz ( nicht ganz deckungsgleiche Wiedergabe, aber dazu siehe oben tut. Die EU-Kommission, die vor einem guten Jahr eine Kommunikation, d.h. offizielle Stellungnahme zur Medienkompetenz (Media Literacy erstellt hat (http://www2.mediamanual.at/themen/kompetenz/61Zacchetti-Media-Literacy-European-approach.pdf ist bei den Kompetenzen mehrfach aktiv. Parallel zum Beratungsgremium (Expert Group für Medienkompetenz gibt es nämlich eine High-Level-Expert Group, die die Kommission in der Frage der Digitalen Kompetenz berät.

  9. Nur noch ein Mausklick trennt die da unten von denen da oben

    OpenAIRE

    Schedler, Kuno; Scharf, Maria Christina

    2000-01-01

    Das Electronic Government ist eine Chance für die Demokratie. Wenn sie erkannt und richtig umgesetzt wird. Der Artikel führt in drei verschiedene Generationen von Homepages ein, definiert drei Elemente des E-Government und zeigt den aktuellen Stand der Diskussion.

  10. Bifurkationsanalyse eines LC Tank VCOs unter Berücksichtigung der variablen Kapazität

    Directory of Open Access Journals (Sweden)

    J.-K. Bremer

    2009-05-01

    Full Text Available In dieser Arbeit präsentieren wir einen neuartigen Ansatz für den systematischen Entwurf von integrierten LC Tank VCO-Schaltungen basierend auf dem Andronov Hopf Theorem und der Störungstheorie. Der Ansatz ermöglicht es, eine Abschätzung des resultierenden Abstimmbereichs, eine Stabilitätsanalyse und eine Berechnung der Amplitude des VCOs im Vorfeld des eigentlichen Entwurfs durchzuführen. Des Weiteren erlaubt die vorgestellte Methode eine Optimierung des VCOs hinsichtlich der in den Spezifikationen geforderte Amplitude und eine Minimierung der höheren Harmonischen. Mit Hilfe eines ladungsbasierten MOS-Modells ist es möglich die spannungsabhängige Kapazität der Varaktortransistoren durch einen analytischen Ausdruck zu beschreiben. Auf Basis dieses analytischen Ausdrucks wird die amplitudenabhängige Großsignalkapazität des VCOs in Abhängigkeit von Designparametern und der Tuningspannung modelliert. Die Gültigkeit der vorgestellte Entwurfsmethode wird anhand eines Beispielentwurfes eines 2.4 GHz VCO unter Verwendung einer 0.25 μm HF-CMOS Technologie verifiziert.

  11. Koidula piiri- ja tollipunkt / Mai Šein, Aulo Padar, Juta Lember...[jt.

    Index Scriptorium Estoniae

    1999-01-01

    asendiplaan, 4 fotot, värv.: välisvaated; peaprojekteerija Eesti Projekt, peahoone: arhitekt M. Šein, sisekujundajad A. Padar, J. L:ember, veoautode tollikontrolli hall, asendiplaan: arhitekt H.-R. Aurik, trafalgoalajaama ja reservjõujaama projekteerisid E. Hirvesoo, M. Järvela, kontrollpaviljonid M. Järvela, vahimaja M. Šein, M. Järvela

  12. Persönliche Publikationslisten als hochschulweiter Dienst – Eine Bestandsaufnahme

    OpenAIRE

    Horstmann, Wolfram; Jahn, Najko

    2010-01-01

    Die persönliche Publikationsliste im Internet ist eine wichtige wissenschaftliche Informationsquelle. Anhand einer Bestandsaufnahme wird der Frage nachgegangen, welche Unterstützungsleistungen Hochschulen und Bibliotheken ihren Forschenden anbieten können. Daraufhin werden strukturelle und funktionale Anforderungen entwickelt. Abschließend wird auf Instrumente für die Erreichung eines hochschulweiten Dienstes hingewiesen.

  13. Krebstiere (Crustacea) – Biologie, Vorkommen, Haltung und Erkrankungen, sowie ihre Bedeutung als Zootierobjekte und Lebensmittelressourcen : eine Literaturstudie

    OpenAIRE

    Walther, Marc

    2008-01-01

    Crustaceen stellen nicht nur eine biologisch interessante Tiergruppe dar, sondern erlangen aufgrund ihrer Haltung in Zoos und durch ihre Nutzung als wichtige Lebensmittelquelle ein immer größer werdendes Interesse. Gerade in den letzen Jahren gab es eine enorme Informationsflut über Erkrankungen bei Crustaceen. Dies wurde als Anlass genommen, das heutige Wissen in einer Abhandlung zusammenzufassen. Die Literaturstudie wird durch eine systematische zoologische und lebensmitterel...

  14. Die südafrikanische Wahrheits- und Versöhnungskommission : eine exemplarische Studie zum Umgang mit Unrechtssystemen

    OpenAIRE

    Audretsch, Andreas

    2008-01-01

    Die Apartheid in Südafrika war ein Unrechtssystem. Zu den Grausamkeiten des Regimes zählten Massaker, Folter, Mord, Freiheitsberaubung, Zwangsumsiedlung, ökonomische Benachteiligung und alltägliche Diskriminierung. Was nach dem Ende eines solchen Unrechtssystems bleibt, ist die Frage nach dem Umgang mit der Vergangenheit. Die drei grundlegenden Möglichkeiten der Vergangenheitsbewältigung sind die rein justiziare Aufarbeitung, eine Generalamnestie oder ein drittes Modell, das zum Ziel hat, die...

  15. Wie professionell sind Schweizer Audit Committees? Eine Studie zeigt, dass nur in jedem zweiten Audit Committee von Verwaltungsräten ein Finanzexperte sitzt

    OpenAIRE

    Leibfried, Peter; Roffler, Mario

    2008-01-01

    Die Mitglieder des Audit Committee eines Verwaltungsrats (VR) müssen Jahresrechnungen lesen und verstehen und mit dem Chief Financial Officer auf gleicher Augenhöhe diskutieren können. Eine Untersuchung der Universität St. Gallen unter kotierten Unternehmen hat indes gezeigt, dass diese Voraussetzung bei weitem nicht in allen Schweizer Gesellschaften erfüllt ist. Die Autoren werfen die Frage auf, ob der VR seine Kontrollfunktion so überhaupt angemessen wahrnehmen kann.

  16. Ist der Ablauf der Lock-up-Frist bei Neuemissionen ein kursrelevantes Ereignis? : Eine empirische Analyse von Unternehmen des Neuen Marktes

    OpenAIRE

    Nowak, Eric; Gropp, Alexandra

    2000-01-01

    Ja, der Ablauf der Lock-up-Frist ist ein kursrelevantes Ereignis. Wir untersuchen Kursreaktionen auf das Ende der Lock-up-Frist bei 142 Unternehmen des Neuen Marktes. Da der Ablauf der Sperrfrist bereits zum Zeitpunkt des Börsengangs bekannt ist, erwarten wir bei einem (semi-)informationseffizienten Kapitalmarkt durchschnittlich keine Kursreaktion. Im Rahmen einer Ereignisstudie zeigen wir aber, dass sich am Ende der Sperrfrist signifikant negative Überrenditen ergeben. Durch eine differenzie...

  17. Design und Implementierung von Formfokussierungsaufgaben im interaktiven inhalts- und bedeutungsorientierten DaFT1 - Unterricht. Eine Fallstudie im Rahmen eines Aktionsforschungsprojekts

    Directory of Open Access Journals (Sweden)

    Gloria Bosch-Roig

    2015-11-01

    Full Text Available Die folgende Fallstudie ist das Resultat eines Aktionsforschungsprojekts, das mit Deutschstudenten im letzten Jahr des Tourismusstudiums an der Universität der Balearen durchgeführt wurde. Die Studie geht der Frage nach, wie Formfokussierungsaufgaben im interaktiven inhalts- und bedeutungsorientierten Deutschunterricht eingesetzt und implementiert werden können, damit eine qualitativ bessere bzw. sprachlich korrektere und komplexere Lernerproduktion erreicht werden kann.

  18. Auswirkungen eines verringerten Haushaltsbudgets auf den Lebensmittelkonsum : eine empirische Untersuchung zu den finanziell bedingten Veränderungen am Lebensmitteleinkauf und beim Ernährungsverhalten

    OpenAIRE

    Yildiz, Juliane

    2014-01-01

    Problemstellung und Zielsetzung In Deutschland lässt sich beim Ernährungs- und Gesundheitsverhalten ein sozialer Gradient feststellen. Personen mit niedrigem Einkommen weisen dabei durchschnittlich ein unausgewogeneres Essverhalten auf als Personen mit höherem Einkommen. Ziel der Arbeit ist es, die Auswirkungen einer Budgetverringerung auf den Lebensmittelkonsum und das Essverhalten dynamisch zu betrachten und daraus handhabbare Interventionsstrategien abzuleiten. Methodische Vorge...

  19. Integration eines durchstimmbaren Femtosekundenlasersystems in eine Laser-Sekundärneutralteilchen-Massenspektrometrie-Apparatur zur Nachionisierung von zerstäubten Atomen und Molekülen

    OpenAIRE

    Sohn, S. (Sascha)

    2012-01-01

    Im Rahmen dieser Arbeit wurde ein bis in den UV-Bereich durchstimmbares Hochleistungsfemtosekundenlasersystem in eine Laser-Sekundärneutralteilchen-Massenspektrometrie-Apparatur (Laser-SNMS) integriert. Die sich dadurch ergebenden Möglichkeiten der Nachionisierung der durch Ionenbeschuss von der Probenoberfläche zerstäubten Teilchen wurden durch Anpassung von Wellenlänge, Leistungsdichte und zeitlichem Abstand von Ionen- und Laserpuls optimiert, so dass sowohl atomare als auch molekulare Prob...

  20. Lightweight construction, a historical challenge; Leichtbau - eine historische Herausforderung

    Energy Technology Data Exchange (ETDEWEB)

    Eigenfeld, K. [Technische Univ. Bergakademie Freiberg (Germany). Giesserei-Inst.

    2000-07-01

    The paper presents a historical outline of the development of mobility, motor cars, and lightweight construction in an integrated approach. [German] Die Entwicklung technischer Prozesse und Produkte nahm mit Beginn der industriellen Revolution einen vorher nicht gekannten Aufschwung. Mit den daraus resultierenden Veraenderungen in den Lebensgewohnheiten der Menschen hat sich, abgesehen von den elementaren Grundbeduerfnissen, die Notwendigkeit und das Beduerfnis nach Mobilitaet sukzessive herangebildet. Mobilitaet heisst nach der Definition in der damaligen Technik Bewegung durch Maschinen, und Maschinen bestehen aus Werkstoffen. Schon fruehzeitig war bekannt, dass bewegte Werkstoffe wenig Masse besitzen sollen. Die Entwicklung des Leichtbaues laesst sich demzufolge am Fortschritt des Verkehrswesens ablesen und dokumentieren. Dabei spielte, wenn auch nicht aus den gleichen Gruenden wie heute, die Verfuegbarkeit, der Energieeinsatz und die Wiederverwendbarkeit, das 'Recycling', eine wichtige Rolle. Der konstruktive und werkstoffbestimmte Leichtbau laesst sich danach in seiner Entstehung auch als Leitfaden fuer heutige Tendenzen betrachten und vieles, was wir derzeit an Entwicklungsrichtungen diskutieren, hat seine Urspruenge im Beginn des motorisierten Verkehrswesens. Ein Blick in die Historie kann jedoch nie schaden, wenn es darum geht, zukuenftige Aufgaben zu bewaeltigen. (orig.)

  1. Fotografiegeschichte greifbar machen – Ein Modell transmedialer Vermittlung

    Directory of Open Access Journals (Sweden)

    Mandy Gnägi

    2013-05-01

    Full Text Available Mit dem Modell transmedialer Vermittlung wird ein Unterrichtskonzept vorgestellt, das auf mehrsemestrigen Erfahrungen an verschiedenen Fachhochschulen der Schweiz beruht. Die methodische und pädagogische Versiertheit der Dozierenden einerseits und die unterschiedlichen Kompetenzen der Studierenden andererseits nutzend, führt das Modell aus einem vermeintlichen Chaos der heutigen Bilderflut heraus und schafft gemeinsam mit den Studierenden eine geordnete Übersicht für die Vermittlung von Fotografiegeschichte. In dem Modell kommen sowohl neue Medien zum Tragen, mit denen die Studierenden als mehrheitlich «digital natives» unterrichtsspezifische Inhalte in interne und externe Blogs, Bild- und Filmdatenbanken, Diskussionsforen, u. a. m., übertragen, als dass dies auch explizit mit der Arbeit an einer Zeitleiste verknüpft wird. Die Studierenden bringen darauf in regelmässigen, diskursiv und reflexiv aufgebauten Unterrichtseinheiten gedruckte Bilder und auf Notizzettel notierte Schlagworte zur Geschichte und Theorie der Fotografie sowie der allgemeinen Kulturgeschichte an. Durch diese transmedial angelegte Vermittlung sind Studierende Lehrende und Lernende gleichermassen und bilden auf dieser Grundlage ihre visuelle Kompetenz aus, machen Zusammenhänge sowie Beziehungen sichtbar und Fotografiegeschichte greifbar.

  2. Bildungstheoretische Kriterien der Lehrplananalyse - Ein Diskussionsangebot an die Politikdidaktik

    Directory of Open Access Journals (Sweden)

    Hennig J. Schluss

    2002-07-01

    Full Text Available Das Verhältnis von Didaktik der Politischen Bildung und Allgemeiner Pädagogik ist immer stärker von der weitergehenden Ausdifferenzierung der pädagogischen Disziplinen gezeichnet. Dies führte zu einer Entfernung der Disziplinen, die bis hin zur Kommunikationslosigkeit reicht. Anliegen dieses Beitrages ist es, anhand eines bestimmten Themas, der Lehrplananalyse, dieser Sprachlosigkeit ein Gesprächsangebot entgegenzusetzen. In einer von der DFG geförderten Forschergruppe zur Untersuchung der Übergangsphasen zu Beginn der SBZ/DDR und nach der Gründung der neuen Länder entwickelte das Projekt "Bildungstheorie und Unterricht" neun Kriterien zur Unterscheidung von affirmativen und reflektierenden Lernzielnormierungen. Diese Kriterien werden vorgestellt und auf ihre mögliche Bedeutung für die Politische Bildung hin ausgelegt und erläutert. Dabei greift der Autor u.a. auf Erfahrungen zurück, die er mit der Analyse der thüringischen Lehrplanentwicklung im Fach "Sozialkunde" gemacht hat. Zugleich sollen Anschlussmöglichkeiten an Überlegungen der Politikdidaktik zumindest kursorisch aufgezeigt werden. Als Voraussetzung dafür wird der verwendete Transformationsbegriff vorgestellt. Über das Aufzeigen von Relevanzbildungskriterien und erziehungstheoretischen Kriterien für die Lehrplananalyse soll das Gespräch zwischen den Disziplinen neu belebt werden.

  3. Energy from biomass. Teaching material; Energie aus Biomasse. Ein Lehrmaterial

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-04-01

    The textbook discusses the available options for power and heat generation from biomass as well as the limits of biomass-based power supply. The main obstacle apart from the high cost is a lack of knowledge, which the book intends to remedy. It addresses students of agriculture, forestry, environmental engineering, heating systems engineering and apprentice chimney sweepers, but it will also be useful to all other interested readers. [German] Biomasse kann aufgrund seiner vielfaeltigen Erscheinungs- und Umwandlungsformen sowohl als Brennstoff zur Waerme- und Stromgewinnung oder als Treibstoff eingesetzt werden. Die energetische Nutzung von Biomasse birgt zudem nicht zu verachtende Vorteile. Zum einen wegen des Beitrags zum Klimaschutz aufgrund der CO{sub 2}-Neutralitaet oder einfach, weil Biomasse immer wieder nachwaechst und von fossilen Ressourcen unabhaengig macht. All den bisher erschlossenen Moeglichkeiten der energetischen Nutzung von Biomasse moechte dieses Lehrbuch Rechnung tragen. Es zeigt aber auch die Grenzen auf, die mit der Energieversorgung durch Bioenergie einhergehen. Hohe Kosten und ein erhebliches Informationsdefizit behinderten bisher eine verstaerkte Nutzung dieses Energietraeges. Letzterem soll dieses Lehrbuch entgegenwirken. Das vorliegende Lehrbuch wurde fuer die Aus- und Weiterbildung erstellt. Es richtet sich vor allem an angehende Land- und Forstwirte, Umwelttechniker, Heizungsbauer und Schornsteinfeger, ist aber auch fuer all diejenigen interessant, die das Thema ''Energie aus Biomasse'' verstehen und ueberblicken moechten. (orig.)

  4. Ist der chronische nicht malignombedingte Beckenschmerz beim Mann eine neuro-urologische Erkrankung?

    Directory of Open Access Journals (Sweden)

    Zermann D-H

    1999-01-01

    Full Text Available Zielsetzung: Der im Genitalbereich und unteren Harntrakt lokalisierte Schmerz ist ein häufiges Symptom in der urologischen Praxis. Unbefriedigende Therapieansätze und langjährige ungenügende Behandlungserfolge für den Patienten charakterisieren diese Problematik. Die folgende Arbeit umfaßt eine Analyse klinischer und urodynamischer Befunde bei Patienten mit chronischen Beckenschmerzen, um die Arbeitshypothese eines Zusammenhanges zwischen Beckenschmerzen und funktionellen Störungen des unteren Harntraktes zu belegen oder auszuschließen. Material und Methode: Eine retrospektive Auswertung von Anamnese, klinischer und urodynamischer Untersuchung wurde bei 103 Männern (durchschnittliches Alter 47, von 23 bis 89 Jahren mit Beckenbeschwerden von 8/1994 bis 8/1997 durchgeführt. Alle in die Untersuchung eingeschlossenen Patienten hatten mehrere verschiedene konservative Therapieansätze ohne Erfolg hinter sich. Ergebnisse: Die Hauptlokalisationen des Schmerzes waren: Prostata/Perineum 45,6 %, Scrotum/Hoden 38,8 %, Penis 5,8 %, Harnblase 5,8 %, Unterbauch 1,9 %, Rücken 1,9 %. Eine deutliche Beckenbodendysfunktion war bei 88,3 % der Patienten reproduzierbar nachweisbar. Bei 84 Patienten wurde eine urodynamische Untersuchung durchgeführt. Hauptbefunde waren: 1 eine Zunahme des Sphinktertonus, 2 eine Reduktion des maximalen Harnflusses, 3 eine Verlängerung der funktionellen Urethralänge. Diskussion: Der Zusammenhang zwischen Beckenbodendysfunktion und Beckenschmerz ist offensichtlich. Was hierbei Ursache oder Folge ist und inwieweit diese Störungen auf einer primären oder sekundären Funktionsstörung des ZNS beruhen, kann derzeit nicht abschließend bewertet werden. Allerdings belegen Erfolge therapeutischer Maßnahmen, die am Beckenboden angreifen (Biofeedback, Alpha-Blockade, sakrale Neuromodulation die Hypothese eines Zusammenhanges zwischen Funktionsstörung und Beckenschmerzen.

  5. Fingerübungen in Digitalien: Erfahrungsbericht eines teilnehmenden Beobachters der Digital Humanities aus Anlass eines Lehrexperiments

    Directory of Open Access Journals (Sweden)

    Hanno Ehrlicher

    2016-06-01

    Full Text Available Das neue interdisziplinäre Methodenfeld der Digital Humanities (DH hat bisher jenseits spezifischer DH-Studiengänge noch kaum Eingang in die Lehre gefunden. Der Essay beschreibt den Versuch, innerhalb der Romanistik im Rahmen einer curricularen Vorlesung eine praxis- und anwendungsnahe Einführung in die Digital Humanities zu vermitteln und will die dabei gewonnenen Erfahrungen mit allgemeineren Reflexionen über den Stand der DH zu verknüpfen. Den Verächtern der DH wird die These entgegengesetzt, dass dieser Bereich die Chance zu fruchtbaren neuen methodologischen Debatten und entsprechenden Innovationen bietet, den Anhängern, dass man zur erfolgreichen Verankerung der DH in der universitären Lehre es mit dem Bemühen um ‚harte‘ normierte Standards im Umgang mit den Daten auch nicht übertreiben sollte und Querköpfe wie Franco Moretti für eine breite interdisziplinäre Akzeptanz der Methoden unverzichtbar sind.

  6. Development of a procedure for qualitative and quantitative evaluation of human factors as a part of probabilistic safety assessments of nuclear power plants. Part B. Technical documentation; Entwicklung eines Verfahrens zur qualitativen und quantitativen Bewertung von Personalhandlungen in der probabilistischen Sicherheitsanalyse fuer Kernkraftwerke. Teil B. Technische Dokumentation

    Energy Technology Data Exchange (ETDEWEB)

    Richei, A.

    1998-06-01

    -Maschine-Systems im Hinblick auf eine Minimierung der Fehlerwahrscheinlichkeit moeglich sind. Hierzu werden aus dem Modell eines Mensch-Maschine-Systems zunaechst die drei Bewertungsbereiche Organisationsstruktur, Arbeitsumgebung und Mensch-Maschine-Schnittstelle abgeleitet. Innerhalb dieser Bewertungsbereiche werden fuer alle leistungsbeeinflussenden Faktoren linguistische Variable aufgestellt, welche der Erstellung eines unscharfen regelbasierten Expertensystems dienen. Die Wissensbasis des Expertensystems wird dabei durch Regeln repraesentiert. Ihre Verarbeitung erfolgt nach der Bereitstellung von Daten fuer die zu bewertende Personalhandlung unter Nutzung der Fuzzy Set Theorie. Diese ermoeglicht die einfache und effektive Nutzung allgemeingueltiger arbeitswissenschaftlicher und ergonomischer Studien als Datenbasis, die auf Anlagen beliebigen Designs uebertragbar ist. Das Expertensystem besteht aus insgesamt 16 einzelnen Regelbasen, mit denen alle ermittel- und bestimmbaren Einflussfaktoren erfasst sind. Auch fuer kognitive Handlungen werden aus einem psychologischem Modell Bewertungskriterien abgeleitet, die deren Analyse mit einer entsprechenden Regelbasis ermoeglichen. Erste Rechnungen zur Validierung des Verfahrens erfolgen anhand von drei Beispielen, die einerseits die haeufige Praxis probabilistischer Sicherheitsanalysen widerspiegeln und andererseits auch Probleme beinhalten, die mit etablierten Verfahren nicht oder nur sehr schlecht erfassbar sind. Diese Anwendungen von HEROS zeigen plausible und nachvollziehbare Ergebnisse, die auch mit etablierten Verfahren vergleichbar sind und die Moeglichkeit der direkten Ableitung von Optimierungsansaetze fuer das Mensch-Maschine-System durch eine Sensitivitaetsanlyse bieten. Das Verfahren ist auf andere Einsatzgebiete erweiterbar und bietet Entwicklungsmoeglichkeiten bis hin zum `Erlernen` von Daten mittels der NeuroFuzzy-Technologie. (orig.)

  7. Evaluation eines psychosomatischen Behandlungskonzepts bei opiatabhängigen Schwangeren

    Directory of Open Access Journals (Sweden)

    Härtl K

    2001-01-01

    Full Text Available Heroinkonsum während der Schwangerschaft erhöht die Wahrscheinlichkeit spontaner Aborte, vorzeitiger Wehen, intrauteriner Asphyxie, niedrigen Geburtsgewichts und neonataler Entzugssymptome. Abrupte Entzüge von Heroin gehen mit einer erhöhten kindlichen Mortalitätsrate einher. Substitution mit Levomethadon gilt als eine sinnvolle Behandlungsmöglichkeit bei opiatabhängigen Schwangeren. Untersucht wird die Effizienz eines psychosomatischen Behandlungskonzepts bei opiatabhängigen Schwangeren hinsichtlich medizinischer und psychosozialer Parameter der substituierten Frauen und deren Neugeborenen. Die Stichprobe besteht aus 100 opiatabhängigen Schwangeren, die zwischen 1990 und 2000 an der I. Universitätsfrauenklinik in München am psychosomatischen Behandlungskonzept, das aus Substitutionstherapie und psychotherapeutischer Begleitung besteht, teilnahmen. Dargestellt werden demographische und psychosoziale Parameter der substituierten Frauen, Schwangerschaftskomplikationen, Geburtsparameter und kindliche Daten. Die Daten zeigen eine psychosozial belastete Stichprobe mit einer seit durchschnittlich acht Jahren bestehenden Opiatabhängigkeit, häufiger Polytoxikomanie und mit einer späten Realisierung der Schwangerschaft nach durchschnittlich 16 Schwangerschaftswochen. Dennoch war in unserem Kollektiv die Häufigkeit von Schwangerschaftskomplikationen relativ gering, mit Ausnahme des erhöhten Risikos für vorzeitige Wehen (19 %. Das Gestationsalter lag mit durchschnittlich 38,8 Schwangerschaftswochen im Normbereich. Das Frühgeburtsrisiko war mit 14 % leicht erhöht, es kam jedoch zu keiner Totgeburt. Die Sectiorate und Rate an vaginal-operativen Entbindungen waren nicht erhöht. Die kindlichen Werte unserer Stichprobe zeigen bzgl. Kopfumfang, Apgar-Scores und pH-Werte normale Werte. Die Kinder wurden mit einem durchschnittlichen Geburtsgewicht von 2863 g geboren. 74% der Neugeborenen hatten Entzugserscheinungen, die durchschnittlich nach 39

  8. Aktuelles in der Reproduktionsmedizin. Eine gemeinsame Publikation der Deutschen Gesellschaft für Gynäkologische Endokrinologie und Fortpflanzungsmedizin (DGGEF e.V.

    Directory of Open Access Journals (Sweden)

    Ludwig M

    2008-01-01

    Full Text Available Die Idee dieses Manuskriptes war eine kurze, knappe, übersichtliche Darstellung einer Reihe relevanter Punkte, die aktuell gefragt sind. Für jeden, der sich interessiert, sei es ein Laie, ein ärztlicher Kollege oder ein Journalist. Insofern erhebt das Manuskript nicht den Anspruch auf einen aktuellen Review der gesamten Reproduktionsmedizin.

  9. Unterrichtsentwurf: „Paneuropa“ – eine utopische Europaidee?

    Directory of Open Access Journals (Sweden)

    Annika Jücker

    2014-12-01

    Full Text Available Within the context of the internal series Europaideen im 20. Jahrhundert, Annika Jücker thematised Richard N. Coudenhove-Kalergi’s pan-European concept for her lesson plan “Paneuropa“ – eine utopische Europaidee? The plan provides insight into an early 20th century European idea, as well as an interesting lesson approach to the historical development of Europe. Utilising diverse types of sources (caricature, speech, quote, the students of an advanced level course will be familiarised with the beginnings and problems of European unification. The plan is set out to develop a critical understanding of the nowadays taken-for-granted EU and to raise awareness of a possible European cultural consciousness.

  10. Gewalt und Geschlecht – neue Einsichten in ein altes Thema

    Directory of Open Access Journals (Sweden)

    Heike Raab

    2008-11-01

    Full Text Available Ausgehend von der Multidimensionalität von gewalttätigen Beziehungsdynamiken untersucht Constance Ohms in ihrer Monographie häusliche Gewalt in Intimbeziehungen zwischen Frauen. Hierbei wird Gewalt nicht nur als unmittelbarer Ausdruck körperlicher An- und Übergriffe begriffen. Mit Hilfe qualitativer Interviews erstellt die Autorin eine Klassifikation von gewalttätigen Beziehungsdynamiken. Im Mittelpunkt der Analyse steht die weibliche Gewalttäterin. Die Ergebnisse verdeutlichen, dass gesellschaftliche, subkulturelle und individuelle Einflussfaktoren und deren Wechselwirkung in Gewaltverhalten einfließen. Provokative Einsichten liefert Ohms Studie in zweierlei Hinsicht: zum einen wird die feministische Debatte um häusliche Gewalt, die Gewalttätigkeit mit Männlichkeit gleichsetzt, kritisiert, zum anderen wird gezeigt, dass das gängige Liebes-Ideal lesbischer Beziehungen in der Lesbenbewegung, das Thema Gewalt tabuisiert.

  11. Bibliothekarische Berufsethik in der Praxis – Ergebnisse eines Studienprojekts aus Deutschland und Großbritannien

    Directory of Open Access Journals (Sweden)

    Jens Boye

    2011-10-01

    Full Text Available Sowohl in Deutschland als auch in Großbritannien existieren seit einigen Jahren Grundsatzpapiere zur Berufsethik im Informations- und Bibliotheksbereich. Neben der bloßen Existenz derartiger Kodizes stellt sich die Frage, welche Relevanz diese Dokumente in der beruflichen Praxis haben. Dieser Frage wurde im Rahmen einer Team-Projektarbeit an der FH Köln nachgegangen. Mithilfe eines standardisierten Fragebogens wurden deutsche Bibliotheksleitungen zu der Thematik befragt. In Großbritannien wurde ein Interview mit Paul Sturges geführt, darüber hinaus erfolgte eine Analyse der Online-Angebote von CILIP, insbesondere des Information Ethics Blog.

  12. Werkzeuge zur automatischen Optimierung erweiterter Entity-Relationship Modelle und deren Abbildung in ein relationales Datenbankschema

    OpenAIRE

    Schneider, Monika

    2003-01-01

    Das Entity-Relationship Modell (kurz ER-Modell) ist eine weit verbreitete Methode zur graphischen Beschreibung von Datenbankschemata. Seine Anwendung ist auch für Laien auf dem Gebiet der Datenmodellierung leicht zu verstehen. Deshalb werden graphische Editoren entwickelt, die dem Benutzer die Erstellung von Datenbankschemata in Form von ER-Modellen ermöglichen. In der Regel ist so eine Modellierung natürlich kein Selbstzweck. Das Schema soll in eine Datenbank übertragen und benutzt werden. I...

  13. Über ein modifiziertes Verfahren zur Trennung von Sehfarbstoffisomeren durch HPLC

    OpenAIRE

    Becker, Christian Theodor

    2006-01-01

    Die enzymatische Umwandlung von all-trans in 11-cis Retinol im Rahmen des Sehzyklus ist Gegenstand intensiver Forschungsarbeit. Um ein modifiziertes Nachweisverfahren der Sehfarbstoffe mittels HPLC zu etablieren, ersetzten wir das als HPLC-Lösungsmittel gängige n-Hexan durch n-Heptan aufgrund der Tatsache, das eine frühere Arbeit der Forschungsgruppe Hinweise auf eine deutlich bessere Trennqualität erbrachte und führten hierzu Untersuchungen an den in-vitro entstehenden Isomeren des Retinals,...

  14. Die psychosoziale Anpassung an Querschnittslähmung: Eine empirische Untersuchung

    OpenAIRE

    Brodbeck, Daniela

    2010-01-01

    Untersuchung der psychosozialen Anpassung bei hoher Querschnittslähmung: Soziale Unterstzützung und Unabhängigkeit spielen als Bewältigungsstrategie eine wichtige Rolle. Weniger Suche nach Information sowie eine häufige Anwendung der Strategie Unabhängigkeit sagen am besten eine niedrige Depressivität der Patienten voraus. Der Grad der körperlichen Beeinträchtigung ist nicht prädiktiv und zur Varianzaaufklärung nicht beitragend. Bei der Vorhersage individueller Lebensqualität zeigte sich d...

  15. Der "FACES-Index" - Ein computergesteuertes Messverfahren zur Erfassung der emotionalen Sensitivität.

    OpenAIRE

    Zumkley-Münkel, Cordula; Grässer, Uwe; Maxeiner, Jürgen; Zumkley, Horst; Dreher, Eva

    2003-01-01

    HINWEIS: Zur Printversion dieses Dokumentes existiert eine CD-Rom Beilage. Diese ist über den OPAC der Saarländischen Universitäts- und Landesbibliothek (http://opac.sulb.uni-saarland.de) mit der Signatur MV 1128 erhältlich. Kurzfassung: Nachfolgend wird über die Entwicklung und Erprobung eines computergesteuerten Messverfahrens zur Bestimmung der "emotionalen Sensitivität" berichtet. Ausgangspunkt für die Verfahrensentwicklung war eine Studie von Martin et al. (1996) zum Thema individ...

  16. Der menschliche Alltag - ein unverzichtbarer Bestandteil eines wissenschaftlichen Menschenbildes [Everyday life - a vital component of every scientific model of man

    Directory of Open Access Journals (Sweden)

    Schmid-Tannwald, Ingolf

    2008-02-01

    Full Text Available [english] The inadequacy of the current model of reproduction in mammals and vertebrates and the "need for a new model of man" becomes evident as soon as the relations and interactions of heterosexual partners within their living conditions are concerned. In contrast to animals hu-mans constitute an everyday life by interpersonal (social actions. Here at first the biological processes are triggered bringing humans as unique interpersonal and biological realites into existence at the moment of fertilisation. This twofold reality may be integrated into a more comprehensive scientific model of man by means of general system theory and semiotics rep-resenting human life as a flow of signs through various sign systems.[german] Jeder Mensch ist das Ergebnis eines zwischenmenschlichen Handelns in der menschlichen Sozialwelt der dort in Gang gesetzten biologischen Prozesse. Letztere sind für den Menschen und andere Säuge- und Wirbeltieren prinzipiell gleicher maßen gültig und im gängigen naturwissenschaftlichen Fortpflanzungsmodell beschrieben. Aber das naturwissenschaftliche Modell kann dieses gewissermaßen zweifache Werden des Menschen nicht angemessen repräsentieren. Dies wäre nur dann der Fall, wenn die menschlichen Beziehungen in der Sozialwelt identisch oder zumindest sehr ähnlich wären, wie die Lebensumstände der nichtmenschlichen Säuge- und Wirbeltiere, in denen sie ihre Nachkommen hervorbringen. Dann würde sich der Unterschied zwischen dem Werden des Menschen und jenem der anderen Säuge- und Wirbeltiere auf die biologischen Fakten beschränken und diese wären mit dem Fortpflanzungsmodell hinreichend beschrieben. Die Voraussetzung gleicher Lebenswelten bei Mensch und Tier trifft aber nicht zu. Deshalb stellt das Fortpflanzungsmodell eine Verfremdung des Phänomens „Mensch“ dar, noch dazu eine folgenschwere, vor allem am Lebensanfang, da Modelle als Bilder unser Handeln im Alltag leiten, vor allem, wenn sie

  17. Entwicklung einer Methodik zur monetären Bewertung von Schadensereignissen - Vorstellung einer Methodik zur Bewertung der finanziellen Auswirkungen verursacht durch eine Explosion.

    OpenAIRE

    Kustosz, Anja

    2014-01-01

    Eine Explosion ist ein seltenes Ereignis, welches sich im Lebenszyklus eines Unternehmens im besten Fall niemals oder im schlechtesten Fall nur einmal ereignet. Die Auswirkung dieses Ereignisses hat - in Abhängigkeit von der Schwere der Explosion - erhebliche finanzielle Auswirkungen auf das betroffene Unternehmen. Die Explosion kann daher zu den strategischen Risiken eines Unternehmens gezählt werden, da in den meisten Fällen nicht nur ein Unternehmensbereich betroffen ist, sonde...

  18. Short-rotation coppices. State of the realizability, organisation and a model for the evaluation of the production and supply of rapidly growing wood from short-rotation coppices als a biofuel for biomass-fuelled heating power stations in Bavaria; Kurzumtriebsplantagen. Stand der Umsetzbarkeit, Organisation und ein Modell zur oekonomischen Bewertung von Produktion und Bereitstellung schnell wachsenden Holzes aus Kurzumtriebsplantagen als biogener Festbrennstoff fuer Biomasse(heiz)kraftwerke in Bayern

    Energy Technology Data Exchange (ETDEWEB)

    Paschlau, Helmut F.

    2011-04-07

    The study examines most aspects of Short-rotation Coppice Crops (SRC), mainly from willows (Salix sp.) and poplars (Populus sp.), for energetic use in big biomass powerstations in Bavaria (southern Germany). In addition to the compilation of framework conditions concerning environmental and agrarian politics as well as legal issues, every link in the process chain of SRC will be considered - from planting to harvesting, treatment of the wood chips and Just-in-time delivery to the powerplant - followed by an evaluation of SRC in ecological terms. The basic aim of this study is to evaluate every single link with regard to organisational und economic issues, analysis of relevant markets and to develop a comprehensive calculation model for the amount of annuities of the whole process chain.

  19. Ein effizientes Message-Passing-Interface (MPI) für HiPPI

    OpenAIRE

    Beisel, Thomas

    1996-01-01

    In dieser Programmbeschreibung wird auf den internen Aufbau von MPI eingegangen und begründet, warum eine Erweiterung der Funktionalitäten erforderlich ist. Der Lösungsansatzes zur Erweiterung von MPI wird vorgestellt.

  20. Imaging and therapy of a chondroblastoma; Bildgebung und Therapie eines Chondroblastoms

    Energy Technology Data Exchange (ETDEWEB)

    Nickel, J.; Meyer, D.R.; Geufke, P.; Andresen, R. [Krankenhaus Guestrow, Akademisches Lehrkrankenhaus der Universitaet Rostock (Germany)

    2002-07-01

    ] Das Chondroblastom ist eine seltene lytische ossaere Laesion, welche typischerweise in den Epiphysen der langen Roehrenknochen zu finden ist. Wir praesentieren die differentialdiagnostische Bildgebung und die opterative Therapie kasuistisch an einem Chondroblastom der proximalen Tibiaepiphyse. In der traumatologischen Ambulanz stellte sich ein 16 jaehriger Patient mit unklarem, seit Monaten zunehmenden Kniegelenksschmerz vor. Ein akutes Trauma war nicht erinnerlich. Zur weiteren Abklaerung erfolgte eine konventionelle Roentgenaufnahme in zwei Ebenen, ein Duennschicht CT, ein multiplanares MRT vor und nach Gd-DTPA und eine 3-Phasen-Skelettszintigrafie. Die konventionelle Roentgendiagnostik zeigt eine glattbegrenzte, osteolytische, exzentrische Laesion mit Randsklerosierung, welche die Epiphysenfuge der proximalen Tibia nicht ueberschreitet. In der Duennschicht-CT findet sich eine exzentrische Osteolyse mit typischen, schmalen Sklerosierungssaum und zentralen Verkalkungen. In der hochaufloesenden MRT zeigen die T2 gewichteten Sequenzen eine lokal begrenzte, epiphysaere, lobulierte Laesion mit einem heterogenen z.T. angehobenen Signal, eine weitere Signalanhebung zeigt sich in den T1 gewichteten Sequenzen nach Gabe von Gd-DTPA. Perifokal findet sich ein epiphysaeres Oedem und diskrete Fluessigkeit im Kniebinnenraum. In der Skelettszintigrafie kommt es zu einer starken fokalen und diffusen Mehrbelegung der proximalen, lateralen Tibiaepiphyse. Nach Diagnosestellung wurde eine Kuerettage des Defektes durchgefuehrt und anschliessend nach histologischer Bestaetigung der Diagnose die komplettierende Kuerettage und Spongiosaplastik vorgenommen. Unter Beruecksichtigung der Tumorlokalisation und des Alters des Patienten laesst sich bereits mit der konventionellen Bildgebung eine praktisch sichere Diagnose stellen. Eine ergaenzende MRT oder CT kann zur endgueltigen Abklaerung hilfreich sein, eine 3-Phasen-Skelettszintigrafie ist ueberfluessig. Die Therapie der Wahl ist die

  1. Die App „Weltbrand 1914“ der SUB Hamburg – Ein Werkstattbericht

    Directory of Open Access Journals (Sweden)

    Markus Trapp

    2015-01-01

    Full Text Available Wie kommt eine wissenschaftliche Bibliothek  dazu, eine App entwickeln zu lassen, auf der 100 Jahre alte Zeitungsseiten der Hamburger Nachrichten gelesen werden können, in denen auf Volltextebene recherchiert werden kann und die einen Einblick in Fotos gibt, die zu Beginn des Ersten Weltkrieges veröffentlicht wurden? Wie ist die Vorgeschichte der Tablet-App für iOS und Android, wie ist die SUB Hamburg an diese Aufgabe herangegangen und wie hat sie das Projekt zusammen mit dem Hamburger Softwareunternehmen CCS realisiert? Auf diese Fragen gibt der folgende Werkstattbericht eine Antwort und liefert auch ein erstes persönliches Zwischenfazit von einem der Projektbeteiligten.

  2. Das mehrsprachige Europa: eine Herausforderung für die Sprachtechnologie

    Directory of Open Access Journals (Sweden)

    Georg Rehm

    2011-03-01

    Full Text Available In der europäischen Informationsgesellschaft des 21. Jahrhunderts sollte niemand einen sozialen oder wirtschaftlichen Nachteil dadurch erleiden, lediglich seine Muttersprache zu sprechen – sei es Lettisch, Ungarisch oder Portugiesisch. Sprachtechnologie hat das Potential dieser Herausforderung entgegen zu treten, sofern sie robust und kosteneffektiv sowie für alle europäischen Sprachen und alle Bürger Europas verfügbar ist. Um diese Ziele zu erreichen muss das Tempo von Forschung und Entwicklung durch eine gezielte und gemeinsame Anstrengung erhöht werden. Eine derartige umfangreiche Anstrengung kann nur mit Hilfe von Vertretern aller beteiligten Interessensgruppen erfolgen, vor allem Forscher, Nutzer, Anbieter und Integratoren von Technologien, den Sprachgemeinschaften, Politiker, und der gesamten Gesellschaft. META-NET, ein europäisches Kompetenznetzwerk, das aus 44 Forschungszentren aus dem Bereich Sprachtechnologie besteht und 31 Länder abdeckt, schmiedet zu diesem Zweck eine strategische Allianz: META, die Multilingual Europe Technology Alliance.

  3. Osteologische Konsiliarbetreuung im Klinikum Klagenfurt am Wörthersee: Initiale Ergebnisse eines Pilotprojekts

    Directory of Open Access Journals (Sweden)

    Mikosch P

    2011-01-01

    Full Text Available Einleitung: Patienten mit „Lowenergy“- Frakturen erhalten laut Literatur nach der chirurgischen Frakturversorgung oftmals keine Therapieempfehlungen betreffend einer medikamentös osteologischen Therapie zwecks Sekundärprophylaxe weiterer Frakturen. Ziel: Dieses bekannte Problem sollte durch ein Pilotprojekt, das interdisziplinäre Zusammenarbeit in den Vordergrund stellt, vermindert werden. Patienten, die eine „Low-energy“-Fraktur erlitten hatten, sollten durch ein osteologisch-internistisches Konsilium direkt an den chirurgischen Abteilungen betreut werden, wodurch die chirurgische Versorgung mit weiteren medikamentösen konservativen Therapieempfehlungen und eventuell in Einzelfällen auch durch zusätzliche diagnostische Maßnahmen ergänzt werden sollte. Ergebnisse: Im Rahmen des 3 Monate dauernden Pilotprojekts wurden insgesamt 77 Patienten (63 Frauen, 14 Männer vorgestellt, davon lehnten 5 Patienten ein osteologisch-internistisches Konsil ab. Obwohl die Mehrzahl der 72 betreuten Patienten ein deutlich erhöhtes Frakturrisiko basierend auf der FRAX-Analyse aufwies, hatten nur einige bereits eine vorangehende Osteoporosetherapie (Vitamin D 29,2 %, Kalzium 26,4 %, spezifische Osteoporosemedikation 19,4 % erhalten. Durch die Konsiliarbetreuungen konnte bei 66/72 Patienten eine osteologische Therapieempfehlung abgegeben werden, in 7 Fällen davon unter der Bedingung einer noch durchzuführenden Osteodensitometrie. Die Therapieempfehlungen versuchten differenziert auf die individuellen Bedürfnisse der Patienten einzugehen, wodurch die gesamte Palette aktuell verfügbarer osteologischer Therapien empfohlen wurde. Bei 5 Patienten ergaben sich keine Hinweise auf eine Osteoporose, womit eine Therapieempfehlung nicht erforderlich war. Lediglich bei einem Patienten war eine osteologische Therapieempfehlung wegen unzureichender Vordaten nicht möglich. Schlussfolgerung: Die Durchführung eines osteologisch-internistischen Konsiliums direkt am

  4. Meta-Analyse und "publication bias" : eine empirisch-statistische Fallstudie

    OpenAIRE

    Fiebig, Joachim; Rüdebusch, Gerrit; Urban, Dieter

    2012-01-01

    Die Schrift berichtet über empirische Analysen zur Identifikation eines "publication bias"” in einer Meta-Analyse von 30 Studien zu den Effekten von pädosexueller Viktimisierung auf die Entstehung von pädosexueller Delinquenz. Zur Identifikation eines möglichen "publication bias" werden verschiedene statistische Verfahren vorgestellt und erläutert (graphische und regressionsanalytische "funnel-plot"-Methodik sowie die "rank-correlation"-, "fail-safe numbers"- und "trim and fill"-Methodik). In...

  5. Friedrich Wilhelm Carové (1789 - 1952) : ein Tag auf dem Stadtturm zu Andernach

    OpenAIRE

    Graf, Klaus

    2009-01-01

    Friedrich Wilhelm Carové wurde am 20. Juni 1789 als Sohn eines kurtrierischen Hofrates in Koblenz geboren. Er besuchte das Koblenzer Gymnasium, an dem damals Joseph Görres lehrte, und absolvierte in Koblenz ein Studium an der von den Franzosen eingerichteten Rechtsfakultät. 1809 wurde er zum Lizentiaten des Rechts promoviert und als Advokat am Trierer Appellationsgerichtshof zugelassen. Um privaten Studien nachgehen zu können, nahm er 1811-1816 verschiedene Verwaltungstellen in Zütphen, Leer,...

  6. Sozialer Wandel des Risikomanagements bei Kindern und Jugendlichen. Eine Replikationsstudie zur langfristigen Zunahme des Anzeigeverhaltens

    OpenAIRE

    Köllisch, Tilman; Oberwittler, Dietrich

    2004-01-01

    In der Polizeilichen Kriminalstatistik steigen die Belastungsziffern von Kindern und Jugendlichen, insbesondere bei Gewaltdelikten, seit vielen Jahren an. Es ist jedoch umstritten und mangels regelmäßiger Täter- und Opferbefragungen schwer zu entscheiden, ob dies eher auf ein verändertes Gewaltverhalten oder eher auf ein verändertes Anzeige- und Registrierungsverhalten zurückzuführen ist. Anhand einer lokalen Vergleichsstudie im Abstand von 25 Jahren präsentieren wir erstmals einen direkten B...

  7. Kontrazeption und Schwangerschaft bei Frauen mit Epilepsie - Eine Stellungnahme der DGGEF

    Directory of Open Access Journals (Sweden)

    Rabe T

    2010-01-01

    Full Text Available Epilepsien gehören zu den häufigsten neurologischen Erkrankungen. Für Frauen, die unter einer Epilepsie leiden, ist eine enge Zusammenarbeit zwischen dem betreuenden Neurologen und Gynäkologen unerlässlich, da sowohl die Epilepsie an sich aber auch die antiepileptische Medikation viele Bereiche des Lebens der betroffenen Frauen negativ beeinflussen kann: so können Fertilität und reproduktive Funktionen eingeschränkt sein, aber auch die bidirektionalen Interaktionen zwischen der antiepileptischen Therapie und hormonalen Kontrazeptiva müssen berücksichtigt werden, um ungeplante Schwangerschaften und eine Verschlechterung der Anfallskontrolle zu verhindern. Das mit einer antiepileptischen Therapie assoziierte teratogene Risiko muss, ebenso wie das mit der Behandlung möglicherweise verbundene Risiko einer ungünstigen Beeinflussung der kognitiven Entwicklung beim Kind, gegenüber dem Nutzen einer optimalen Anfallskontrolle abgewogen werden. Wenn möglich, sollten Frauen im reproduktionsfähigen Alter auf ein wenig teratogenes Therapieregime eingestellt werden. Eine umfassende proaktive präkonzeptionelle Beratung ist bei Frauen mit Epilepsie obligat, um bei Mutter und Kind einen möglichst unproblematischen Verlauf von Schwangerschaft, Geburt und Postpartalzeit zu ermöglichen. Im Allgemeinen wird bei Frauen mit Epilepsie eine hochdosierte, bereits präkonzeptionell zu beginnende Folsäureprophylaxe angeraten, um das Risiko für das Auftreten großer Fehlbildungen zu reduzieren. Im Verlauf der Schwangerschaft können je nach antiepileptischer Therapie eine regelmäßige Überprüfung der Antieepileptikaspiegel und ggf. auch eine Anpassung der Dosierung notwendig werden. Eine differenzierte Fehlbildungsdiagnostik sollte genauso wie die regelmäßige Überwachung der Schwangerschaft auf geburtshilfliche Komplikationen Teil der Routineversorgung von Frauen mit Epilepsie sein.

  8. Untersuchungen zur deutschen Schreibsprache eines spätmittelalterlichen Gebetbuches von Ljubljana

    OpenAIRE

    Marija Javor Briški

    2015-01-01

    Der vorliegende Aufsatz  bietet eine ausführliche systematische Darstellung der deutschen Schreibsprache des Manuskriptes NUKLj Ms 224, eines spätmittelalterlichen Gebetbuches der National- und Universitätsbibliothek in Ljubljana, welches drei verschiedene Hände aufweist. Die Schreibsprache wird nach den für räumliche und zeitliche Einordnung relevanten Kriterien in drei Bereichen untersucht: im phonetisch-orthographischen, im morphologischen und im lexikalischen. Den methodologischen Untersu...

  9. Ein modulares System zur Nachrechnung und Optimierung hydraulischer Turbomaschinen radialer Bauweise

    OpenAIRE

    Schmalhorst, Carsten W.

    2014-01-01

    In dieser Arbeit wird ein Programmsystem zur Nachrechnung und Optimierung von radialen Turbomaschinen vorgestellt und seine Leistungsfähigkeit anhand von praxisbezogenen Beispielen aufgezeigt. Es wird ein Verfahren für die schnelle Voroptimierung von Turbomaschinen entwickelt und die Durchführung von CFD-Simulationen von hydraulischen Turbomaschinen weitestgehend automatisiert. Das Programmsystem wird angewendet, um Kennlinien von radialen Kreiselpumpen verschiedener Schnelläufigkeit zu erzeu...

  10. Prostitution - ein Beruf wie andere auch? : zur Kritik einer aktuellen Perspektive

    OpenAIRE

    Stallberg, Friedrich W.

    1991-01-01

    Der Beitrag wendet sich gegen die Auffassung, Prostitution sei ein Beruf wie jeder andere auch. Mit dieser Position, die aus dem Umkreis der Prostituiertenbewegung stammt, wird für eine Entdiskriminierung der Prostituierten gestritten und deren Selbstorganisation gefordert. In dem Beitrag wird darauf hingewiesen, daß Prostitution von den Sozialwissenschaften keineswegs als 'normaler Beruf' angesehen wird. Die Forschung orientiert sich eher an den Kategorien der Abweichung, der Randständigkeit...

  11. Verletzungsmanagement im Spitzensport. Eine systemtheoretisch-konstruktivistische Analyse mit Fallstudien aus den Sportarten Leichtathletik und Handball.

    OpenAIRE

    Mayer, Jochen

    2009-01-01

    Problemstellung Schmerzen, Beschwerden und Verletzungen sind ein alltägliches Phänomen im Spitzensport. Ausgehend von Hinweisen auf einen aus medizinischer Sicht höchst problematischen Umgang mit Schmerzen und Verletzungen durch Athleten und ihr Umfeld werden in der vorliegenden Arbeit Möglichkeiten und Grenzen eines ganzheitlichen Verletzungsmanagements im Spitzensport beleuchtet. Dabei stehen Fragen der verletzungsbezogenen Entscheidungspraxis und ihrer psychosozialen Entscheidungsbeding...

  12. Periimplantäre Knochenveränderungen am Frialit-2 Implantat - Eine 10-Jahresuntersuchung

    OpenAIRE

    Rombach, Stefan Joachim

    2016-01-01

    Zahnimplantate werden vermehrt zur prothetischen Rehabilitation eingesetzt. Eine wichtige Voraussetzung für den Langzeiterfolg der Implantate und damit auch des darauf verankerten Zahnersatzes ist ein niveaustabiler periimplantärer Knochen. Veränderungen in seinen Ausmaßen können radiographisch sichtbar gemacht und quantifiziert werden. Ziel dieser Studie war es, Frialit-2 Implantate mit unterschiedlicher prothetischer Versorgung in Ober- und Unterkiefer in einem Untersuchungszeitraum v...

  13. Review Essay: (Auto-) Biografie als Methode: Eine dialektische Soziologie des Alltagslebens

    OpenAIRE

    Roth, Wolff-Michael

    2002-01-01

    Our Lives as Databases ist das Produkt eines Forschungsprojekts, in dem die teilnehmenden Autoren das kollektive Schreiben und Analysieren ihrer Autobiographien als Medium zum Praktizieren akademischer Soziologie benutzen. In diesem Beitrag beschreibe ich die Struktur und den Inhalt dieses ungewöhnlichen und sehr interessanten Buches und stelle meine Lesart anhand der exemplarischen Analyse eines der Kapitel dar. Obwohl der Herausgeber des Sammelbandes überzeugend für das kollektive Schreiben...

  14. Vermittlungs- und Integrationsprozesse in transdisziplinären Projekten: eine empirische Untersuchung

    OpenAIRE

    Nell, Pina

    2012-01-01

    "Inter- und transdisziplinäre Forschungsverbünde werden in der Wissenschaft immer wichtiger. Hiermit ist die Hoffnung verbunden, dass durch die Zusammenführung unterschiedlicher Sichtweisen und Fachdisziplinen neues Wissen generiert werden kann, das über disziplinär erzeugtes Wissen hinausgeht. Heterogene Forschungsverbünde bergen jedoch auch Risiken, die häufig nicht explizit thematisiert werden. Eine These der vorliegenden Arbeit ist es, dass eine vermittelnde Instanz in Forschungsverbünden...

  15. Fortschritt und Arbeitszeit: Ein Vergleich der Ansichten von Marx, Keynes und der Sozialdemokratie

    OpenAIRE

    Bernhard Schütz

    2014-01-01

    Die Ideen von Karl Marx und John Maynard Keynes übten im Laufe der Zeit großen Einfluss auf die Ansichten der österreichischen Sozialdemokratie aus. Beide Autoren sahen das Ziel der Geschichte in der Selbstverwirklichung des Menschen. Sie gingen davon aus, dass eine weitestgehende Befreiung des Menschen von der Notwendigkeit der Arbeit eine unbedingte Voraussetzung für diese Selbstverwirklichung ist. Der vorliegende Beitrag analysiert, ob sich diese spezifische Vorstellung von Fortschritt ...

  16. Entwicklung und Überprüfung eines Strukturmodells der fachlichen Kommunikationskompetenz im Biologieunterricht

    OpenAIRE

    Kramer, Gesa

    2009-01-01

    Schüler zeigen Defizite in der sach- und fachgerechten Benutzung von Sprache im Biologieunterricht. Mit Hilfe eines Kompetenzstrukturmodells können relevante Strukturen und Zusammenhänge der fachl. Kommunikationskompetenz identifiziert werden. Entsprechend theor. Vorgaben (KMK-Bildungsstandards, Expertiseforschung u. a.) wird ein Kompetenzstrukturmodell postuliert, das die beiden Dimensionen Individuelle Wissensrepräsentation und Wissenskommunikation mit den Komponenten Wissen, Wortschatz, Ar...

  17. Der Bystander-Effekt in alltäglichen Hilfesituationen : ein nicht-reaktives Feldexperiment

    OpenAIRE

    Alle, Katrin; Mayerl, Jochen

    2010-01-01

    "Der These der Verantwortungsdiffusion zufolge sinkt die Wahrscheinlichkeit einer Hilfeleistung, wenn mehrere Zeugen eine Hilfesituation beobachten, da sich aufgrund der Anwesenheit mehrerer potentieller Helfer die individuell wahrgenommene Verantwortung reduziert (sog. Bystander-Effekt). Die vorliegende Arbeit stellt Ergebnisse eines nicht-reaktiven Feldexperiments mit verdeckter Beobachtung zur Untersuchung des Bystander-Effekts in einer ungefährlichen alltäglichen Hilfesituation mit 80 Ver...

  18. Der Bystander-Effekt in alltäglichen Hilfesituationen : ein nicht-reaktives Feldexperiment

    OpenAIRE

    Alle, Katrin; Mayerl, Jochen

    2010-01-01

    Der These der Verantwortungsdiffusion zufolge sinkt die Wahrscheinlichkeit einer Hilfeleistung, wenn mehrere Zeugen eine Hilfesituation beobachten, da sich aufgrund der Anwesenheit mehrerer potentieller Helfer die individuell wahrgenommene Verantwortung reduziert (sog. Bystander-Effekt). Die vorliegende Arbeit stellt Ergebnisse eines nicht-reaktiven Feldexperiments mit verdeckter Beobachtung zur Untersuchung des Bystander-Effekts in einer ungefährlichen alltäglichen Hilfesituation mit 80 Vers...

  19. Farbkonstanz und Farbkontrast – eine Untersuchung mit Hilfe der farbigen Schatten

    OpenAIRE

    Kallmann, Anatol Julian

    2003-01-01

    Zusammenfassung der Dissertation von Anatol Julian Kallmann Farbkonstanz und Farbkontrast – eine Untersuchung mit Hilfeder farbigen Schatten Die farbigen Schatten werden als ein Spezialfall dessimultanen Farbkontrastes angesehen. Um herauszufinden,warum die farbigen Schatten im Vergleich zur gewöhnlichenDarstellung des simultanen Farbkontrastes so intensiv farbigerscheinen, wurde das Phänomen hinsichtlich derFarbparameter Helligkeit, Sättigung und Farbton analysiert. Der Induktionsef...

  20. Ist der Ablauf der Lock-up-Frist bei Neuemissionen ein kursrelevantes Ereignis

    OpenAIRE

    Nowak, Eric; Gropp, Alexandra

    2000-01-01

    Ja, der Ablauf der Lock-up-Frist ist ein kursrelevantes Ereignis. Wir untersuchen Kursreaktionen auf das Ende der Lock-up-Frist bei 142 Unternehmen des Neuen Marktes. Da der Ablauf der Sperrfrist bereits zum Zeitpunkt des Börsengangs bekannt ist, erwarten wir bei einem (semi-)informationseffizienten Kapitalmarkt durchschnittlich keine Kursreaktion. Im Rahmen einer Ereignisstudie zeigen wir aber, dass sich am Ende der Sperrfrist signifikant negative Überrenditen ergeben. Durch eine differenzie...

  1. Untersuchung eines thermischen Lichtbogentriebwerksystems für die Lunar Mission BW1

    OpenAIRE

    Bock, Dagmar

    2009-01-01

    Die Verwendung von thermischen Lichtbogentriebwerksystemen in der 1 bis 2 kW-Klasse mit Hydrazin als Treibstoff zur Lageregelung auf geostationären Satelliten ist heutzutage Stand der Technik. In der vorliegenden Dissertation wird ein thermisches Lichtbogentriebwerksystem mit Ammoniak als Treibstoff für die Anwendung als eines der Haupttriebwerke der universitären Kleinsatellitenmission Lunar Mission BW1 des Instituts für Raumfahrtsysteme der Universität Stuttgart untersucht und charakteri...

  2. Traktionsantrieb mit linearem geschalteten Reluktanzmotor für ein autonomes Bahnfahrzeug

    OpenAIRE

    Schneider, Tobias

    2014-01-01

    Im Rahmen des NBP-Projekts wird ein Bahnsystem entwickelt, welches auf kleinen, autonom verkehrenden Fahrzeugen beruht. Diese so genannten RailCabs werden fahrerlos betrieben und können sich selbstständig zu Konvois zusammenschließen. Die Traktionskraft und damit die Beschleunigung der Fahrzeuge wird über das magnetische Luftspaltfeld eines Linearmotors erzeugt. Die Luftspaltbreite zwischen den strecken- und fahrzeugseitigen Motorteilen ist sowohl durch Witterungsbedingungen als auch durch Al...

  3. Konzeption und Implementierung eines GIS-basierten Kartierungssystems für die geowissenschaftliche Planetenforschung

    OpenAIRE

    Naß, Andrea

    2013-01-01

    Die Kartierung planetarer Körper stellt ein wesentliches Mittel der raumfahrtgestützten Exploration der Himmelskörper dar. Aktuell kommen zur Erstellung der planetaren Karten Geo-Informationssysteme (GIS) zum Einsatz. Ziel dieser Arbeit ist es, eine GIS-orientierte Prozesskette (Planetary Mapping System (PMS)) zu konzipieren, mit dem Schwerpunkt geologische und geomorphologische Karten planetarer Oberflächen einheitlich durchführen zu können und nachhaltig zugänglich zu machen.

  4. Schulbibliotheken in Schweden: Strukturen, Aufgaben und Konzepte : Eine Analyse anhand ausgewählter Beispiele

    OpenAIRE

    Reuter, Stefan

    2008-01-01

    Die Arbeit thematisiert schwedische Schulbibliotheken, ihre Strukturen, Aufgaben und an sie gestellte pädagogische Anforderungen auch im Zusammenhang mit der Vermittlung von Informationskompetenz, als eine der Kernkompetenzen von Schulbibliotheken. Die Rolle von Schulbibliotheken auf internationaler Ebene wird behandelt. Hierbei wird auf einen möglichen Zusammenhang mit den Ergebnissen der PISA-Studie eingegangen. Mit dem Schulbibliotheksmanifest der UNESCO wird ein international gültiges Gru...

  5. Informationskompetenz als Studienfach?! Eine curriculare Zusammenarbeit von Universitätsbibliothek und Fachdisziplinen

    OpenAIRE

    Wolff, Christian

    2007-01-01

    In diesem Beitrag wird ein seit 2006 an der Universität Regensburg eingeführtes Lehrprogramm für die Schlüsselqualifikation Informationskompetenz vorgestellt. Es zeichnet sich durch die Kooperation von Universitätsbibliothek, Informationswissenschaft und Medieninformatik sowie weiterer Disziplinen aus. Eine weitere Besonderheit ist die Verankerung als Nebenfach im Rahmen der Studiengänge der philosophischen Fakultäten der Universität Regensburg. We discuss a program in information literac...

  6. DISCUS – Online-Tutorial zur Förderung von Informationskompetenz - Ein Blick in die Werkstatt

    OpenAIRE

    Bieler, Detlev

    2004-01-01

    DISCUS – Online-Tutorial zur Förderung von Informationskompetenz (Developing Information Skills & Competence for University Students) ist ein E-Learning-Projekt der Universitätsbibliothek der TU Hamburg-Harburg. Der Blick in die Werkstatt beleuchtet folgende Themen: Motivation, Visualisierung, inhaltliche Strukturierung, Interaktivität und Personalisierung. Die Datei ist die Powerpoint-Präsentation (im PDF-Format) eines Vortrages auf der Campus Innovation Hamburg 2004 am 1. Oktober 2004, s...

  7. Wirksamkeitsnachweis und Indikationen des Autogenen Trainings - eine Metaanalyse nach den Cochrane Kriterien

    OpenAIRE

    Bregenzer, Maximilian

    2015-01-01

    Die Therapieoption „Autogenes Training“ wird heutzutage immer häufiger bei psychosomatischen und auch somatischen Erkrankungen diskutiert und bereits angewendet. Professor Stetter veröffentlichte im Jahr 2002 eine Metaanalyse, in der er 64 kontrollierte randomisierte klinische Studien zur Anwendung des Autogenen Trainings untersuchte. Hiermit wurde ein erster großer Schritt zur Etablierung dieser Therapieform getan. Aufgrund der noch unzureichenden Datenlage, machte es sich die vorliegende A...

  8. Der Einsatz des International Caries Detection and Assessment System (ICDAS-II) - Eine Pilotstudie

    OpenAIRE

    Busche, Jan Friedrich

    2012-01-01

    Problemstellung: In Zeiten der modernen Zahnmedizin ist ein Rückgang der Kariesprävalenz und vor allem der großflächigen kariösen Läsionen zu beobachten. Kariös veränderte Zahnhartsubstanz erscheint vermehrt als initiale Läsion. Dieser Umstand macht ein Kariesdiagnoseverfahren notwendig, welches die Zahnkaries nicht nur auf Kavitationsniveau, sondern bereits im Initialstadium erfasst und differenziert. Dieses gelingt mit ...

  9. Transaktionen anstelle von Tauschakten: Einleitung in eine Revision ökonomischer Theorie

    OpenAIRE

    Kabalak, Alihan; Priddat, Birger P.

    2011-01-01

    Die moderne Ökonomik ist in ihrem Kern immer noch tauschtheoretisch begründet. Die Bemühungen der Neuen Institutionenökonomik für eine transaktionstheoretische Fundierung sind auf halbem Wege stehengeblieben (Fokussierung von Kosten bei gegebenen Nutzen; keine spezifisch transaktionsbasierte Markttheorie, nur eine theory of the firm und institutional change aus wirtschaftshistorischer Perspektive). Wir werden die Konzepte 'Tausch' und 'Transaktion' voneinander abgrenzen und daraufhin die ökon...

  10. Ein Konzept für die merkmalsbasierte Tumor-Klassifikation mit diagnostischem Ultraschall

    OpenAIRE

    Siebers, Stefan

    2008-01-01

    Die Bildgebung mit Ultraschall (Sonographie) hat sich zu der am häufigsten verwendeten medizinischen Bildgebungsmodalität entwickelt. Eine Unterscheidung gut- und bösartiger Tumoren mit Hilfe der Sonographie setzt allerdings große Erfahrung beim Untersucher voraus und gilt als außerordentlich schwierig. In dieser Arbeit wurde daher ein Konzept zur automatisierten Klassifikation mit diagnostischem Ultraschall entwickelt und im Rahmen einer klinischen Studie mit 138 Fällen zur Digni...

  11. Auswirkungen eines präventiven Dienstsportprogramms bei der Polizei auf Gesundheitsindikatoren und Krankenstand

    OpenAIRE

    Weiler, Thorsten

    2011-01-01

    Einleitung: Die demografisch bedingte Überalterung der Mitarbeiter und hohe Krankenstände haben nicht nur in der freien Wirtschaft, sondern vor allem auch im Bereich der öffentlichen Verwaltung ein besorgniserregendes Ausmaß angenommen. Vor diesem Hintergrund gerät die Notwendigkeit betrieblicher Gesundheitsförderung (BGF) auch in der Vollzugspolizei zunehmend in die Diskussion. Ein wesentlicher Bestandteil der BGF ist der gesundheitsorientierte Dienstsport, der bislang jedoch kaum adäquat ev...

  12. Ein Interview zur Erfassung sozialer Ängste unter Einbeziehung von Körpersymptomen

    OpenAIRE

    Chaker, Samia; Haustein, Elisa; Hoyer, Jürgen; Davidson, Jonathan R.T.

    2014-01-01

    Die Brief Social Phobia Scale – German version (BSPS-G) ist ein Kurzinterview zum Screening sozialer Ängste. Dabei werden Schwere oder Verlauf einer bereits diagnostizierten sozialen Angststörung erfasst. Im Folgenden wird der Hintergrund dargelegt und eine Kurzbeschreibung des englischsprachigen Originals (BSPS) gegeben: Die soziale Phobie ist gekennzeichnet durch ausgeprägte und anhaltende Angst, sich in sozialen oder Leistungssituationen peinlich zu verhalten, gedemütigt zu werden oder...

  13. Event als Interaktion und Inszenierung. Ein Beitrag zu Theorie und Praxis der Medienästhetik

    OpenAIRE

    Wünsch, Ulrich

    2010-01-01

    Die Dissertation untersucht die ästhetische Bedingtheit und Verfasstheit eines bestimmten Mediums: des Event. Ästhetik wird als Prozess der sinnlichen Wahrnehmung und Aufmerksamkeitslenkung des psychophysischen Systems Mensch (Leib) verstanden, der symbolvermittelt auch (und gerade bei Events) außersprachlich vor sich geht. Event wird eine Veranstaltung genannt, die, vornehmlich in der Unternehmenskommunikation eingesetzt, den Nimbus des Außergewöhnlichen und Einzigartigen im Kontext der so g...

  14. In vitro Herstellung eines vorderen Kreuzbandkonstruktes aus mesenchymalen Stammzellen und einem Kollagen Typ I-Hydrogel

    OpenAIRE

    Schupp, Kathrin

    2007-01-01

    Verletzungen des vorderen Kreuzbandes gehören zu häufigsten Verletzungen des menschlichen Bandapparates. Da das vordere Kreuzband über ein schlechtes intrinsisches Heilungspotenzial verfügt, ist heutzutage die chirurgische Rekonstruktion mittels Sehnentransplantaten die Therapie der Wahl. Die vorliegende Arbeit beschäftigte sich mit der Fragestellung, ob es möglich ist, ein Kreuzband-Konstrukt aus mesenchymalen Stammzellen (MSCs) und einem Kollagen Typ I-Hydrogel herzustellen und wie die Einw...

  15. Bildung in Medienwelten?: Eine biografieanalytische Studie zu Lern- und Bildungsprozessen bei Homosexuellen im Internet

    OpenAIRE

    Bender, Claus

    2010-01-01

    Innerhalb der vorliegenden Untersuchung geht es um die Verknüpfung von Medienbildung, homosexueller Sozialität und der Methodik der Biografieanalyse. Ausgangsbasis ist eine sozialkonstruktivistische Sichtweise auf Geschlecht und (Homo-) Sexualität, wobei eine sozio-historische Kontextualisierung von Homosexualität unter Berücksichtigung von Diskriminierung erfolgt. Im Fokus steht der Coming-out-Prozess, der zwischen Zeigen und Verstecken changiert und mittels des Mediums Internet einen Raum f...

  16. Chromosomale Veränderungen bei der monoklonalen Gammopathie unbestimmter Signifikanz (MGUS) - Eine molekularzytogenetische Analyse

    OpenAIRE

    Kurb, Nadine

    2013-01-01

    Die Monoklonale Gammopathie unbestimmter Signifikanz (MGUS) resultiert aus einem klonalen Prozess, der zur monoklonalen Proliferation von Immunglobulinen führt. Das Risiko ein Multiples Myelom (MM) zu entwickeln, beträgt bei der MGUS ungefähr 1 % pro Jahr. Chromosomale Aberrationen scheinen hierbei eine entscheidende Rolle zu spielen. Beim MM wurde die Inzidenz, die pathogenetische Relevanz und die prognostische Bedeutung genetischer Veränderungen umfangreich untersucht. Die Datenlage bei der...

  17. Oplysningstidens danske oversættelser af Martin Luthers salme "Ein feste Burg ist unser Gott"

    DEFF Research Database (Denmark)

    Balslev-Clausen, Peter

    2006-01-01

    En litterær og teologisk analyse af de danske oversættelser af Martin Luthers salme "Ein feste Bug ist unser Gott" fra perioden 1775 - 1800 viser, at disse oversættelser afspejler tidens oplysningsteologi......En litterær og teologisk analyse af de danske oversættelser af Martin Luthers salme "Ein feste Bug ist unser Gott" fra perioden 1775 - 1800 viser, at disse oversættelser afspejler tidens oplysningsteologi...

  18. Ein Framework für echtzeitfähige Ethernet-Netzwerke

    Science.gov (United States)

    Dopatka, Frank

    Im Rahmen dieser Arbeit wird die Entwicklung eines formalen Framewoks vorgestellt, mit dessen Hilfe zwischen der Kompatibilität zum verbreiteten baumförmigen Standard-Ethernet und der Einhaltung von Echtzeitanforderungen einer automatisierten Anlage variiert werden kann. Damit kann bereits vor der Auswahl einer bestimmten Technologie eine Schedule der Echtzeit-Übertragungen offline kalkuliert und simuliert werden, sobald die Anforderungen der Geräte im industriellen Echtzeit-Netzwerk bekannt sind.

  19. Ein, zwei Punkte zu Nichtkommutativer Geometrie und Quantenfeldtheorie auf diskreten Räumen

    OpenAIRE

    Pöselt, Christian

    2002-01-01

    Über viele Jahre hinweg wurden wieder und wieder Argumente angeführt, die diskreten Räumen gegenüber kontinuierlichen Räumen eine fundamentalere Rolle zusprechen. Unser Zugangzur diskreten Welt wird durch neuere Überlegungen der Nichtkommutativen Geometrie (NKG) bestimmt. Seit ca. 15Jahren gibt es Anstrengungen und auch Fortschritte, Physikmit Hilfe von Nichtkommutativer Geometrie besser zuverstehen. Nur eine von vielen Möglichkeiten ist dieReformulierung des Standardmodells derElementarteil...

  20. Review: Rainer Diaz-Bone (2002). Kulturwelt, Diskurs und Lebensstil. Eine diskurstheoretische Erweiterung der bourdieuschen Distinktionstheorie

    OpenAIRE

    Angermüller, Johannes

    2004-01-01

    DIAZ-BONE legt eine Studie über den Diskurs der Populärmusik vor, in der die BOURDIEUsche Distinktionstheorie um eine diskurstheoretische Komponente erweitert wird. Anhand einer beispielhaften Diskursanalyse von Heavy Metal- und Techno-Zeitschriften wird die Bedeutung einer differenztheoretisch fundierten Diskurstheorie für die kultursoziologische Forschung demonstriert. Wegen seiner reduktionistischen Tendenz wird der BOURDIEUsche Ansatz kritisiert und die relative Autonomie diskursiver Must...

  1. Vernetztes Lernen an der Hochschule? Ergebnisse und Erfahrungen eines cMOOS

    OpenAIRE

    Kahnwald, Nina; Pscheida, Daniela

    2015-01-01

    Der Ansatz des Konnektivismus und die rasante Verbreitung von Massive Open Online Courses (MOOCs) haben eine anhaltende Debatte um die Chancen, Schwierigkeiten und Perspektiven offener Lernnetzwerke in der Hochschulbildung ausgelöst. Die Diskussion reicht dabei vom befürchteten Verlust des Einflusses der Dozierenden als Gewährleister einer kritischen und vielseitigen Auseinandersetzung mit Themen und Lerninhalten, über die lernerseitigen Voraussetzungen für eine erfolgreiche und gewinnbringen...

  2. Quantitative Datenanalyse: Arbeiten mit SPSS Statistics : Eine Einführung

    OpenAIRE

    Hoidn, Sabine

    2012-01-01

    Bei diesem Buch handelt es sich um eine verständliche Einführung in das Arbeiten mit dem quantitativen Datenanalyseprogramm SPSS Statistics. Die Studierenden setzen sich mit den Grundlagen zum Arbeiten mit SPSS Statistics auseinander, können selbständig eine SPSS Statistics-Datei erstellen, Daten einlesen, zusammenfügen und modifizieren, erfasste Daten managen und die gebräuchlichsten tabellarischen und grafischen Grundauswertungen sowie Analyseverfahren durchführen und interpretieren. Au...

  3. Therapeutische Blutdrucksenkung durch ein aktives Implantat: Ein neues Verfahren zur Behandlung der medikamentös therapierefraktären Hypertonie

    Directory of Open Access Journals (Sweden)

    Peters TK

    2008-01-01

    Full Text Available Wenn Hochdruckpatienten trotz medikamentöser Compliance unter einer Kombination aus mindestens 3 Antihypertensiva und ohne behandelbare sekundäre Ursache einen unkontrollierten Blutdruck aufweisen, kann eventuell ein neues, in der Entwicklung befindliches aktives Implantat angewandt werden. Diese Übersicht beschäftigt sich mit der Entwicklung und den frühen Daten zur Sicherheit und Wirksamkeit eines aktiven implantierbaren Gerätes zur chronischen elektrischen Stimulation der Gefäßwand der Karotisbifurkation. Das neue Gerät ist ähnlich wie ein Defibrillator vollständig implantierbar. Das seit langem bekannte und auch klinisch untersuchte Wirkprinzip basiert darauf, dass den in der Blutdruckregulation beteiligten zentralnervösen Strukturen durch elektrische Aktivierung von barorezeptorischen Afferenzen ein "erhöhter Blutdruck vorgetäuscht" wird. Das zentrale Nervensystem "antwortet" darauf mit Anpassungen der neurohumoralen Regulation, deren Ergebnis eine "reflektorische" Blutdrucksenkung ist. Eine positive Nutzen-Risiko- Bewertung von Daten aus 2 klinischen Studien (in Europa und den USA führte 2007 zur Marktzulassung in Europa (CE-Kennzeichnung. Gegen Ende 2007 waren mehr als 60 Patienten im Rahmen klinischer Studien behandelt worden. Langzeitdaten einer begrenzten Anzahl von Patienten haben gezeigt, dass auch nach 12 Monaten der systolische Blutdruck im Mittel um mehr als 25 mmHg nachhaltig reduziert war, wobei die medikamentöse Begleittherapie unverändert war. Es wurden keine unerwarteten schwerwiegenden unerwünschten Ereignisse berichtet, so dass sich diese neue Methode als Alternative bei Patienten mit schlechter Prognose unter stark hypertensiven Blutdruckwerten eignet. Die Risikobewertung hat insbesondere perioperative Risiken wie Infektionen und Verletzungen zu berücksichtigen. Allerdings könnte diese neue Therapie trotz einer notwendigerweise konservativen Risikobewertung einen Beitrag zur künftigen Behandlung von

  4. Metastase eines papillären Schilddrüsenkarzinoms in den Nasennebenhöhlen - eine seltene Entität

    OpenAIRE

    Graß, I; Alduwillah, R; Bergler, W

    2014-01-01

    Einleitung: Schilddrüsenkarzinome gehören zu den häufigsten malignen endokrinen Tumoren, machen jedoch in der Gesamtheit der bösartigen Tumore nur 0,15-1% aus und sind damit eher selten. In absteigender Häufigkeit überwiegen die papillären Karzinome, gefolgt von den follikulären, den medullären und den undifferenzierten Karzinomen. Ein seltenes Erstsymptom einer Metastasierung in die Keilbeinhöhle kann eine behinderte Nasenluftpassage sein. Die häufigsten Metastasierungswege sind je nach His...

  5. Schwerpunkt: Georg Büchner und seine Zeit - Georg Büchner und seine Zeit : Ein privilegierter Schriftsteller und ein solitäres Werk

    OpenAIRE

    Oesterle, Günter

    2012-01-01

    Wenn man an die Stelle des Titels „Georg Büchner und seine Zeit“ „Georg Büchner in seiner Zeit“ setzt, hat man den Unterschied der Lebenszeit Büchners (1813-1837) und seiner Wirkung über einen umfassenderen Zeitraum im Blick. Diese doppelte Perspektive versucht der Essay durchzuhalten: Er fragt zunächst, wie es möglich wurde, dass ein jungerMann, der mit 24 Jahren starb, nicht nur als Schriftsteller, sondern auch als Wissenschaftler und Revolutionär eine herausragende Rolle spielen konnte. An...

  6. Ein Lehrbuch über Psychiatrie und Psychotherapie – Geschlechtsunterschiede unter der Lupe?

    Directory of Open Access Journals (Sweden)

    Isabella Heuser

    2007-07-01

    Full Text Available Anke Rohde und Andreas Marneros haben sich ein hohes Ziel gesetzt: ein übersichtliches Lehrbuch für Psychiatrie und Psychotherapie, das erstmals eine systematische Zusammenstellung des Wissens über geschlechtsspezifische Aspekte von Symptomatologie, Epidemiologie, Diagnostik, Pharmakotherapie und Psychotherapie psychischer Störungen enthält. Bemerkenswert ist dabei zweierlei: Erstens werden bei der Betrachtung geschlechtsspezifischer Unterschiede im Sinne der Genderforschung Frauen und Männer berücksichtigt, zweitens wird ein vollständiger Überblick sowohl über die häufigen und bekannten psychischen Störungen als auch die äußerst seltenen psychiatrischen Erkrankungen der gesamten Altersspanne gegeben. Wenngleich die Qualität der einzelnen Beiträge deutlich zwischen sehr differenzierter und leider auch für ein Handbuch eindeutig zu oberflächlicher Betrachtung variiert, liegt in dem Band ein weitgehend informatives Nachschlagewerk vor, das einen ersten Überblick über die geschlechtsspezifische Psychiatrie gibt.

  7. Medikamentös explusive Therapie von Uretersteinen - Ein systematischer Review

    Directory of Open Access Journals (Sweden)

    Seitz C

    2012-01-01

    Full Text Available Einleitung: Eine medikamentös expulsive Therapie (MET steigert Steinausscheidungsraten und reduziert Kolikepisoden. MET ist eine angemessene Therapie zur erleichterten Steinpassage bei Patienten mit einem neu diagnostizierten Ureterstein, deren Symptome kontrolliert sind. Eine adjuvante Therapie nach SWL zeigt ebenfalls höhere Steinpassageraten. Ziel: Durchführung eines systematischen Reviews der medikamentös expulsiven Therapie von Uretersteinen. Ergebnisse: MET mittels Alpha-Blocker oder Kalzium-Kanal-Blocker resultiert in einer höheren und beschleunigten Steinfreiheitsrate im Vergleich zu einer Kontrollgruppe. Höhere Steinfreiheitsraten werden für den gesamten Ureter beschrieben, obwohl die meisten Studien distale Uretersteine untersuchten. MET war effektiv nach SWL und URS. Die Kombination von MET mit Kortikosteroiden zeigt zwar vielversprechende Ergebnisse, jedoch ist die Datenlage unzureichend. Der Schmerzmittelverbrauch sowie die Anzahl an Kolikepisoden und stationären Aufnahmen wurden unter MET reduziert. Schlussfolgerung: MET erleichtert die Steinausscheidung bei Patienten mit Uretersteinen 10 mm. Bei Alpha-Blockern besteht ein Klasseneffekt in Bezug auf eine erleichterte Steinausscheidung. MET ist ebenfalls nach SWL und URS wirksam. Die Kombination mit Kortikosteroiden kann außerhalb klinischer Studien nicht empfohlen werden. Große placebokontrollierte, randomisierte Studien und die Erforschung neuer, vielversprechender Substanzen sind nötig, um die zukünftige Rolle der MET zu definieren.

  8. Bluthochdruck und Herzrhythmusstörungen - eine gefährliche Kombination

    Directory of Open Access Journals (Sweden)

    Strohmer B

    2009-01-01

    Full Text Available Herzrhythmusstörungen sind ein häufiges Problem bei Patienten mit arterieller Hypertonie. Das Auftreten von Vorhofflimmern beeinträchtigt nicht nur die Lebensqualität der oft asymptomatischen Hypertoniepatienten, sondern ist auch mit erhöhter Morbidität und Mortalität assoziiert, sofern keine entsprechenden therapeutischen Maßnahmen getroffen werden. Die Bandbreite der ventrikulären Arrhythmien reicht von der isolierten Extrasystolie bis hin zu anhaltenden Tachyarrhythmien mit erhöhtem Risiko für den plötzlichen Herztod. Die linksventrikuläre Hypertrophie, eine diastolische Dysfunktion sowie eine abnorme Vorhofdilatation bzw. -funktion sind die zugrundeliegenden Faktoren für die Entwicklung der elektrischen Instabilität bei Hypertonikern. Eine moderne antihypertensive Therapie normalisiert nicht nur den Blutdruck, sondern reduziert durch Rückbildung der linksventrikulären Hypertrophie auch das Risiko für Vorhofflimmern und den plötzlichen Herztod. Aktuelle Studien belegen insbesondere für die medikamentöse Blockade des Renin-Angiotensin- Aldosteron-Systems eine besondere Effektivität. Eine antiarrhythmische Therapie ist aufgrund ihrer potenziellen Proarrhythmie nur bei entsprechender Indikation mit Vorsicht einzusetzen.

  9. Die Amerikanischen Reisetagebücher: ein erster Zugang

    Directory of Open Access Journals (Sweden)

    Horst Bredekamp

    2015-12-01

    Full Text Available Zusammenfassung Die Reisetagebücher der Amerika-Reise (1799-1804 stellen ein Kompendium an schriftlichen Einträgen, Tabellen, Diagrammen und Zeichnungen dar, das in der Tradition römischer Papiermuseen des 17. Jhs. steht. Sie können als Mikrokosmen kleiner Kunstkammern aufgefasst werden, in denen Naturobjekte, Kunstwerke und Arbeitsmittel einen gemeinsamen Reflexionsraum bilden. Im Zentrum des vorliegenden Beitrags steht Humboldts Auffassung einer gestalteten Bestimmung von Landschaft vermittels besonders einprägsamer Bildformen. Auf erstaunliche Weise nähert sich Humboldts Ästhetik der Gesamtsicht von Natur Charles Darwins Begriff der natürlichen Schönheit an. In den Reisetagebüchern zeigt sich ein heterogener, von Lebendigkeit zeugender Charakter, der sowohl durch das unterschiedliche Format der einzelnen Hefte, als auch durch die inkonsistente Behandlung des Papiers erreicht wird. Dieser bewegliche Zug setzt sich in zahlreichen Zetteln, Briefen und weiteren Texten fort als ein eigenes Prinzip von Evolution. Abstract The travel diaries of Humboldt’s journey to the Americas (1799-1804 form a corpus of research in the form of written entries, tables, diagrams and sketches and serve as a continuation of the Roman “paper museums” of the 17th century. They can be seen as microcosms of small Kunstkammern (cabinets of curiosity in which specimens from nature, artworks and working materials are documented and presented together in a common space for reflection and contemplation. The focus of this paper is Humboldt’s conception of a “designed determination” through particularly memorable images and forms. His aesthetic of an overall vision of nature bears a striking similarity to Charles Darwin’s theory of natural beauty. His travel diaries reveal a heterogeneous character, imbued with a vibrancy that is attained through both the various formats of different notebooks, as well as by the inconsistent treatment of the of the

  10. Blutdruck-SMS: Eine Methode zur besseren Therapiesteuerung

    Directory of Open Access Journals (Sweden)

    Magometschnigg D

    2015-01-01

    Full Text Available Durch verschiedene endogene blutdruckregulierende Systeme werden die Blutdrücke während 24 Stunden in einem Bereich von ca. 50 mmHg systolisch und 35 mmHg diastolisch gehalten. Wegen dieser Blutdruckvariabilität sind Einzelmessungen mehrdeutig und sagen nichts über den Blutdruckmittelwert aus, der aus einer Vielzahl von abweichenden Einzelmessungen errechnet wird. Die Hochdruck-Guidelines empfehlen, dass die „Blutdruckhöhe“ einzelner Patienten anhand von zumindest 3 Messwerten eingeschätzt werden sollen. Wenn man der Blutdruckvariabilität einzelner Patienten eine Standardabweichung von 12 mmHg zugrunde legt, bessert sich die Reproduzierbarkeit des Befundes unwesentlich. Daher sind Einzelmessungen prinzipiell ungeeignet, um Hypertoniker zuverlässig einer Hypertonieklasse zuzuordnen. Die Zuordnung zur Klasse der therapieresistenten Hypertoniker über Einzelmessungen hat bei den Symplicity-Studien 1 und 2 zu irreführend positiven Ergebnissen und vielen nicht gerechtfertigten Behandlungen geführt. Der Missbrauch von Einzelmessungen ist bei klinischen Hypertoniestudien gang und gäbe und führt dazu, dass die Ergebnisse von Studien mit Arztmessungen ganz anders ausfallen als von Studien, die statt den „casual readings“ Mittelwerte von 24-h-Blutdruckmonitorings verwenden. Dass Schlussfolgerungen auf der Grundlage von Einzelmessungen nicht zielführend sind, hat Symplicity-HTN-3 eindrucksvoll aufgezeigt. Das Blutdruck-SMS ist ein einfaches, automatisiertes Verfahren, mit dem der Arzt die Hypertonie – ohne Mehraufwand – anstatt mit Einzelwerten über Mittelwerte und Langzeitblutdruckverläufe beurteilt. Diese zutreffendere Art der Hypertoniebeurteilung führt dazu, dass die Therapieerfolge im Routinebetrieb ähnlich hoch sind wie in klinischen Studien; über 80 % erreichen die Zielwerte [1]. Das Blutdruck-SMS vermeidet Fehldiagnosen wie Ordinationshochdruck und maskierte Hypertonie und erhöht die Medikamenten-„ Adherence“ [2]. Das

  11. Der Krieg als eine besondere Form des Konflikts

    Directory of Open Access Journals (Sweden)

    Sebastian Schneider

    2011-12-01

    Full Text Available Comme le montrent les débats politiques et scientifiques actuels, la notion de guerre ne décrit pas uniquement une condition, mais a des implications normatives larges. Dans les situations de guerre, l’interdiction générale de tuer est en partie levée ou limitée. Afin d’éviter toute instrumentalisation politique et arbitraire de la notion de guerre, il faut repenser les critères de distinction entre la notion de guerre et les autres formes de conflit. Cet article se propose d’évoquer les réflexions philosophiques ainsi que politiques sur le thème de la guerre et critique le manque de réflexion sur la distinction entre la notion de guerre et les autres formes de conflits.Wie sich an aktuellen politischen und wissenschaftlichen Debatten zeigen lässt, ist der Begriff des Krieges nicht nur eine reine Zustandsbeschreibung, sondern hat auch weitreichende normative Implikationen. Im Krieg ist das ansonsten generelle Tötungsverbot partiell aufgehoben oder eingeschränkt. Um den Begriff nicht einer willkürlichen politischen Instrumentalisierung zu übergeben, muss über Kriterien zur Abgrenzung von Krieg und anderen Formen des Konflikts nachgedacht werden. Der Artikel wirft einen Blick auf die Beschäftigung der Philosophie und Politikwissenschaft mit dem Thema Krieg und kritisiert die mangelnde Abgrenzung des Krieges zu anderen Konfliktformen.

  12. Radiotherapy: an interactive learning tool; Strahlentherapie: Ein interaktives Lernprogramm

    Energy Technology Data Exchange (ETDEWEB)

    Frenzel, T.; Kruell, A.; Schmidt, R.; Dobrucki, W.; Malys, B.

    1998-11-01

    The program is primarily intended for radiological medical technicians, student nurses, students of medicine and physics, and doctors. It is designed as a tool for vocational training and further training and gives comprehensive insight into the daily routines of a radiotherapy unit. The chapters deal with: fundamental biological aspects - fundamental physical aspects - radiation sources and irradiation systems - preparatory examinations - therapies and concepts - irradiation planning - irradiation performance - termination of irradiation treatment. For every page displayed, spoken texts and written, on-screen keywords, illustrations, animated sequences and a large number of videos have been combined in a way easy to digest. The software of the program permits handling also by learners less familiar with computer-based learning. (orig./) [Deutsch] Das Programm richtet sich in erster Linie an MTRAs, Schwesternschuelerinnen, Medizin- und Physikstudenten sowie Aerzte. Es wurde zur Aus- und Weiterbildung konzipiert und soll helfen, die Arbeitsablaeufe einer Strahlentherapieabteilung transparent zu machen. Die Kapitel lauten - biologische Grundlagen - physikalische Grundlagen - Bestrahlungsgeraete - vorbereitende Untersuchungen - Behandlungskonzept - Bestrahlungsplanung - Ausfuehrung der Bestrahlung sowie Ende der Strahlenbehandlung. Fuer jede Bildschirmseite sind gesprochener Text und auf dem Bildschirm ausgegebene Stichworte, Abbildungen, Animationen und eine Vielzahl von Videos in einpraegsamer Weise kombiniert worden. Das Programm wurde so konzipiert, dass es sich auch von Personen ohne grosse Computerkenntnisse bedienen laesst. (orig.)

  13. Evaluierung eines Qualitäts- und Herkunftszeichens: Das Beispiel "Geprüfte Qualität - HESSEN"

    OpenAIRE

    Will, Sabine

    2013-01-01

    Die Dissertation führt eine umfassende Erfolgskontrolle des Qualitäts- und Herkunftszeichens „Geprüfte Qualität – HESSEN“ (GQH) aus Sicht der verschiedenen Akteure durch. Die GQH ist ein regionales Qualitätssicherungssystem des hessischen Agrarmarketings. Da die Wirtschaftspartner zunehmend finanziell beteiligt sind, steigt die Erfolgsabhängigkeit des Marketings und Erfolgsanalysen sind von zunehmender Bedeutung. Auf Verbraucherebene erfolgt daher eine produktübergreifende Bewertung der Marke...

  14. Untersuchungen zum Einsatz von Antiseptika in der Behandlung akuter Wunden anhand einer evidenzbasierten Literaturanalyse, Auswertung eines Fragebogens und internationaler Symposiumdiskussion

    OpenAIRE

    Steller, Daniel

    2015-01-01

    Ziel dieser Arbeit war es anhand einer evidenzbasierten Literaturanalyse, einer Umfrage sowie eines Expertentreffens herauszufinden, welche Wundspüllösung für die Behandlung von akuten Weichgewebewunden mit/ ohne Knochenbeteiligung am geeignetsten ist und ob eine starke Evidenz für Handlungsempfehlungen besteht. Des Weiteren sollte anhand der vorliegenden Arbeit untersucht werden, inwieweit ein Konsens bezüglich der Therapie akuter Wunden besteht. Die Umfrageergebnisse als auch die Expert...

  15. Die Ordnung des Diskurses in der Flüchtlingskonstruktion : eine postkoloniale Re-Lektüre

    OpenAIRE

    Niedrig, Heike; Seukwa, Henri

    2010-01-01

    "Ziel dieses Beitrages ist eine postkoloniale Dekonstruktion der essentialisierenden Kategorie 'Flüchtling'. Die Analyse geht davon aus, dass der 'Flüchtling' ein politisch-rechtliches und soziales Konstrukt ist, das bestimmte Funktionen für die national kodierte Selbstdeutung der Mehrheitsgesellschaft hat. Die Positionen in der Dreiecksstruktur Täter-Opfer-Retter werden in den dominanten diskursiven Formationen in einer Weise zugeordnet, die eine kollektive weiße europäische Identität konstr...

  16. Konzeption eines Umweltkennzahlensystems zur Umweltleistungsmessung für Prozesse unter Beachtung der in Unternehmen vorliegenden Rahmenbedingungen

    OpenAIRE

    Scheibe, Lilly

    2004-01-01

    Die vorliegende Ausgabe beschäftigt sich mit dem Thema Umweltkennzahlensysteme für die Umweltleistungsmessung. Ziel der Arbeit ist es, Unternehmen ein Hilfsmittel zur Integration von Umweltaspekten ins allgemeine Unternehmensgeschehen an die Hand zu geben. Angestrebt ist die Konzeption eines Umweltkennzahlensystems zur Umweltleistungsmessung für Prozesse. Im ersten Schritt wird ein Öko-Controlling-Modell vorgestellt und Umweltkennzahlensysteme in dieses eingeordnet. Umweltkennzahlensysteme si...

  17. Verbraucherpräferenzen für regionale Lebensmittel : Eine repräsentative Untersuchung der Einflussfaktoren

    OpenAIRE

    Henseleit, Meike; Kubitzki, Sabine; Schütz, Daniel; Teuber, Ramona

    2007-01-01

    Während einerseits die Agrar- und Ernährungswirtschaft durch eine zunehmende Internationalisierung gekennzeichnet ist, kann gleichzeitig in vielen Ländern ein wachsendes Interesse der Verbraucher an der regionalen Herkunft von Lebensmitteln beobachtet werden (7; 3). Insbesondere bei bezüglich der Lebensmittelsicherheit sensiblen Produkten, wie beispielsweise Rindfleisch, stellt die Herkunft eines der wichtigsten, wenn nicht sogar das wichtigste Produktattribut dar (24). Der Begriff „Region...

  18. Adressierung in der ein- und zweisprachigen Lexikographie. Eine einführende Übersicht über die Forschungs- und Problemlage

    OpenAIRE

    Herbert Ernst Wiegand

    2011-01-01

    Zusammenfassung: Obwohl die Adressierungsbeziehung eine wichtige textuelle Beziehunginsbesondere in Wörterbuchartikeln ist, ohne deren theoretisches Verstandnis die Gewinnungvon lexikographischen Informationen anhand von hochverdichteten und stark standardisiertenWorterbuchartikeln nicht erklart werden kann, gibt es bisher nur wenige Beitrage, in denendie Adressierung theoriebezogen behandelt wurde.Zunachst werden einige theoretische Voraussetzungen aus einer Theorie der Worterbuchfo...

  19. Applikation von fermentierter Soja bei Krebspatienten zur Verminderung von Kachexie und Erhöhung der Apoptose - eine prospektive Pilotstudie

    Directory of Open Access Journals (Sweden)

    Jacob U

    2009-01-01

    Full Text Available Kachexie ist eine Begleiterkrankung von Krebs, Aids oder rheumatoider Arthritis. Andere Symptome dieser Erkrankungen sind Depression sowie chronische Erschöpfung. Für alle diese Begleiterkrankungen, die die Lebensqualität der schwererkrankten Patienten negativ beeinflussen, wird eine Erhöhung von Entzündungsmediatoren (z.B. IL-6 und TNF-α verantwortlich gemacht. Für Krebs wird eine Erniedrigung der Apoptose, ausgelöst durch eine Erhöhung von NFκB verantwortlich gemacht. Eine Gabe eines fermentierten Soja-Produktes, das in den USA seit 10 Jahren zur Verbesserung der Lebensqualität von Krebspatienten eingesetzt wird, wurde in einer prospektiven Studie untersucht: Für je 5 Patienten, die unter Prostata-, Ovar- oder Brustkrebs litten, konnte eine signifikante Verminderung von Kachexie, Stress und Depression festgestellt werden. Gleichzeitig konnte man für Prostata- und Ovarkrebs-Patienten eine Erhöhung der Genexpression apoptotischer Marker disseminierter Tumorzellen feststellen. Zusätzlich wurde eine starke Erhöhung der Genexpression des Tumorsuppressorgens p21 festgestellt. Auch wenn die prospektive Studie präliminär ist und die Anzahl der untersuchten Patienten zu klein, so widerspricht sie nicht unserer Annahme, dass es einen direkten Zusammenhang zwischen Krebs und Begleiterkrankungen, besonders der Kachexie, gibt.

  20. Angeleitete internetbasierte Patienteninformation - Studie zur Effektivität eines Informationssystems für Kopfschmerzpatienten

    Directory of Open Access Journals (Sweden)

    Wilfried Honekamp

    2009-11-01

    Full Text Available Eine stetig wachsende Zahl von Nutzern sucht im Internet nach Gesundheitsinformationen. Hierzu steht ihnen eine Vielzahl ganz unterschiedlicher Anbieter zur Verfügung, die bei divergierenden Interessen gesundheitsrelevante Angebote im Internet vorhalten. Abgesehen von der Informationsflut, mit der die Nutzer bei der Suche überhäuft werden, erhalten sie auch falsche, irreführende, veraltete und sogar gesundheitsgefährdende Informationen. In den letzten zehn Jahren haben verschiedene Wissenschaftler die Anforderungen an ein ideales Gesundheitsinformationssystem ermittelt.Im Rahmen des in diesem Beitrag beschriebenen Projekts wurde ein Gesundheitsinformationssystem als Prototyp zur anamnesebezogenen, internetbasierten Patienteninformation entwickelt und anhand einer Studie evaluiert. Dabei wird die Untersuchung auf deutschsprachige Erwachsene mit Kopfschmerzen eingegrenzt. Insgesamt wird die Hypothese überprüft, dass eine computerunterstützte, anamnesebezogene Internetsuche für den Patienten bessere Ergebnisse liefert, als diese durch die herkömmliche Nutzung von Gesundheitsportalen oder Suchmaschinen erreicht werden kann.Zur Evaluation wurde eine kontrollierte Zweigruppenstudie mit insgesamt 140 Teilnehmern in zwei Studienabschnitten durchgeführt. Dabei wurde im ersten Abschnitt festgestellt, dass bei einfach strukturierten Krankheitsfällen das Informationssystem gleichgute Ergebnisse liefert, wie die herkömmliche Suche. Im zweiten Abschnitt konnte allerdings festgestellt werden, dass bei komplexen Kopfschmerzfällen mit Hilfe des Prototyps signifikant (P=0,031 bessere Diagnosen gestellt werden konnten als ohne. Medizinische Expertensysteme in Kombination mit einer Meta-Suche nach maßgeschneiderten qualitätsgesicherten Informationen erweisen sich als probate Möglichkeit, den Ansprüchen an eine geeignete Versorgung mit Gesundheitsinformationen gerecht zu werden.

  1. Die abbildung eines schreibers auf dem relief aus Ajdovski gradec über Vranje bei Sevnica

    Directory of Open Access Journals (Sweden)

    Peter Petru

    2015-10-01

    Full Text Available Die Redaction des Sammelbandes, der 1mserem angesehenen klassischen Philologen Prof. Dr. M. Grošelj gewidmet ist, hat mir durch ihre Einladung die Möglichkeit gegeben, entsprechend der fachlichen Liebe des Professors das bisher in Slowenien  älteste direkte Zeusnis des Schifttums vorzustellen, die auf Ajdovski gradec ëntdeckte Darstellung eines Schreibers (Abb. l. Im J. 1978 wurde in diesem Fundort in der Zisterne (castellum aquae tmter anderen auch ein Steinblock mit den Darstellungen eines Schreibers, der Medusa, der Szene eines von einem Löwen verfolgten Pferdes und der Abbildung einer Weinrebe auf der Seiten­fläche (Abb. 2 ausgegraben. Die orphisch-pythagoreischen Vorstellungen von der Flucht vor dem Tode, abgeschtlossen mit der Gestalt der Medusa, deuten den Glauben an die resurrectio an und bestätigen auf unmittelbare Weise, dass das Denkmal Teil einer grösseren Grabkammer ist. Leider fehlt unmittelbar neben dem Schreiber das durch eine norisch-pannonische Volute begrenzte Feld mit Inschrift, das bestimmter angeben würde, wem das honument gesetzt worden war, und dadurch eine genauere zeitliche Einordnung ermöglichen würde. So ist jedoch die Datierung nur mittelbar, gestützt auf bildliche Elemente, die darauf hinweisen, dass das Denkmal in die erste Hälfte des 3. Jahrhundorts zu setzen ist. Bildnerisch äussern sich nämlich auf dem Bonkmal mit der Darstellung des Schreiber Stilelemente, ausgedrückt in zeichnerischen Konzept, und eine in den Umrissen erfolgreich eingefangen örpermasse, die indes in den entscheidenden Details oberglächlich ausgestaltet und grösstenteils unsymmetrisch sind, wobei die ornamentalen Huster verkümmert worden sind, während der pflanzliche Rebenschmuck zu einem zweidimensionalen Schema oder Symbol zusammengeschrumpft ist. Infolgedessen steht diese flächige Kunst der zeicherisch konzipierten narrative. Darbietungsweise der ursprünglichen illyrischkeltischen Altangesessenen näher. Ausserdem

  2. Auch eine Theorie der Moderne Another Theory of Modernity

    Directory of Open Access Journals (Sweden)

    Sabine Rohlf

    2002-11-01

    Full Text Available Barbara Hahn zeichnet die Wege schreibender Frauen durch 200 Jahre deutsch-jüdische Kulturgeschichte nach. Ausgehend von Paul Celans vieldeutiger Jüdin Pallas Athene, werden dabei stereotype Bilder der „Jüdin“, der „Intellektuellen“ und die scharfe Trennlinie zwischen humanistisch christlicher und jüdischer Tradition zur Diskussion gestellt. Mit Celans Figur schreibt sich gleichzeitig die theoretische Herausforderung in diese Studie ein, nach Ambivalenzen und Dialogen zu fragen, deren Voraussetzungen mit beispielloser Gewalt zerstört wurden. Gestützt auf Archivmaterial und veröffentlichte Texte der von ihr vorgestellten Frauen, spannt Hahn den Bogen von frühen Strategien der Assimilierung bis in die Jahre nach 1945. Das Buch ist keine Überblicksdarstellung, sondern präsentiert einzelne, einander auch überschneidende Konstellationen – intellektuelle Netzwerke, Briefwechsel, intertextuellen Transfer.Hahn traces the paths of women writers through two hundred years of German-Jewish cultural history. Using Celan’s plurivalent “Pallas Athene” as a starting point, Hahn discusses stereotypical images of “the Jew,” “the Intellectual,” and the sharp division between the humanistic Christian and the Jewish tradition. The character created by Celan functions as a theoretical challenge in this text, asking about feelings of ambivalence and dialogues which could not take place as their premises were destroyed with an unprecedented violence. Based on archival material and biographical texts about the women she uses, Hahn completes the circle between early strategies and assimilation until the post-WWII years. This book does not offer a general overview, but offers individual, overlapping constellations-intellectual networks, letters, and intertextual transfers.

  3. Die Wende der ägyptischen Germanistik von der Kontrastiven zur Interkulturellen Linguistik. Eine herausfordernde Chance?

    Directory of Open Access Journals (Sweden)

    Hoda Lotfy

    2012-06-01

    Full Text Available Im Zeitalter der Globalisierung ist der Begriff der Interkulturalität in  den Vordergrund bzw. ins Zentrum verschiedener Disziplinen gerückt. Von einer interkulturellen Wende, die die Sprachwissenschaft auch nicht unangetastet ließ, ist die Rede. Zeittypische Impulse auf internationaler Ebene haben die In- und Auslandsgermanistik gleichermaßen erfasst. Hierbei deutet der Forschungsstand auf eine noch weitgehend undefinierte bzw. unstrukturierte (Teil-Disziplin hin.In ihrer allgemeinen Ausrichtung kann die Germanistische Linguistik in Ägypten (GLÄ seit ihren Anfängen in den siebziger Jahren auf         eine lange Forschungstradition im Bereich der Kontrastiven Linguistik (KL zurückblicken.  Der vorliegende Beitrag versucht chronologisch den Spuren nachzugehen, die hinter einer möglichen Hinwendung      der GLÄ von der kontrastiven zur interkulturellen Linguistik (IL stecken. Das zentrale Anliegen des Aufsatzes ist es die Frage zu beantworten, ob es sich hierbei in Bezug auf außersprachlichen Bedingungen um eine Chance, eine Herausforderung oder etwa         eine herausfordernde Chance für die GLÄ - als Linguistikvariante       der Auslandsgermanistik -  handelt, um  im weiteren Verlauf zur Ausformulierung bzw. Etablierung einer zeittypischen wissenschaftlich fundierten interkulturellen (Teil- Disziplin mit exakt definierten Forschungsgegenständen, Zielen und Methoden einen Beitrag zu leisten.

  4. Von den SSG zu den FID – eine kritische Reflexion von Anspruch und Wirklichkeit

    Directory of Open Access Journals (Sweden)

    Steffen Illig

    2015-07-01

    Full Text Available In der überregionalen Literaturversorgung vollzieht sich durch die Transformation der Sondersammelgebiete (SSG in Fachinformationsdienste für die Wissenschaft (FID ein vielschichtiger Wandel. So fordert die DFG in ihren Förderrichtlinien, dass sich die FID nicht nur konsequent an den Bedürfnissen der Wissenschaftler orientieren, sondern sich auch von den Grundaufgaben wissenschaftlicher Bibliotheken abgrenzen und einen Mehrwert gegenüber bestehenden Services anbieten. Dies bedeutet in letzter Konsequenz auch die Abwendung vom Ideal einer größtmöglichen Vollständigkeit der Bestände hin zu einem selektiven Bestandaufbau entlang der e-only-policy der DFG, nach der die elektronische Version eines Werkes gegenüber der gedruckten Form bevorzugt werden soll. Die durch diese Paradigmenwechsel notwendig gewordene Neuorientierung stellt die antragstellenden Bibliotheken jedoch vor große Herausforderungen. Daher soll der vorliegende Beitrag die bisherigen Entwicklungen und Zielsetzungen in der Förderpolitik der DFG analysieren und helfen, die aktuellen Geschehnisse einzuordnen. Darauf aufbauend werden die wesentlichen FID-Richtlinien anhand eines Modells dargestellt und kritisch reflektiert. Abschließend wird eine Maßnahme aufgezeigt, die im Sinne einer Profilierung insbesondere die Vermittlung von Informationskompetenz adressiert und eine Einbindung von Fachreferenten und Fachreferentinnen in die FID-Förderung skizziert.

  5. Metastasiertes Mammakarzinom in der Schwangerschaft mit fulminantem Verlauf – Ein Fallbericht

    Directory of Open Access Journals (Sweden)

    Mayer-Pickel K

    2014-01-01

    Full Text Available Wir behandelten eine 35-jährige Patientin mit bilateralem muzinösem, multizentrischem, primär metastasiertem Mammakarzinom, welches erstmals in der Schwangerschaft diagnostiziert wurde. Eine durchgeführte Stanzbiopsie ergab ein niedrig differenziertes Triple-negatives Mammakarzinom. Die Staging-Untersuchungen zeigten Lungen- und Wirbelkörpermetastasen. Eine anthrazyklinhaltige Chemotherapie wurde begonnen und aufgrund einer lokalen Progression auf Docetaxel umgestellt. Aufgrund weiterer Progression und dem Verdacht auf Wirbelkörperfraktur wurde nach abgeschlossener Lungenreife die Schwangerschaft in der 28. Schwangerschaftswoche vorzeitig beendet und die Patientin von einem gesunden Mädchen entbunden. Postpartal wurde eine Radiatio der Wirbelsäule durchgeführt. Chemotherapieversuche mit Capecitabin und Paclitaxel mussten aufgrund Unverträglichkeit bzw. allergischer Reaktion wieder abgesetzt werden. Unter Vinorelbin, Bevacizumab und schließlich PEG-liposomalem Doxorubicin kam es zu einer weiteren Tumorprogression. Die Patientin verstarb schließlich 88 Tage post partum bzw. 5 Monate nach Diagnosestellung.

  6. Etablierung eines Tiermodells des hepatozellul(a)ren Karzinoms durch den Einsatz von allogenischer Implantationstechnik

    Institute of Scientific and Technical Information of China (English)

    QIAN; Jun; FENG; Gansheng; Trübenbach; J; Huppert; P; E; Pereira; P; L; Claussen; C; D

    2001-01-01

    Etablierung eines tierexperimentellen Modells des hepatozellularen Karzinoms(HCC) bei ACI-Ratten durch den Einsatz von allogenischer Implantationstechnik und Beobachtung durch die MR-Untersuchung. Bei einer mannlichen ACI-Ratte wurde die Tumorzellen yon Morris Hepatoma 3924A in die Flanke subkutan injiziert. 13 Tage danach erfolgte die Implantation eines soliden Tumorfragments (1 mm3) aus dem gewachsenen Tumor subkapsular in den linkem Leberlappen bei anderen mannlichen ACI-Ratten (n= 12). 14 Tage nach Implantation wurden die Tumorvolumina kernspintomographisch bestimmt. 14 Tage nach Implantation wurde der isolierte und solide Lebertumor bei allen ACI-Ratten kernspintomographisch beobachtet. Das durchschnittliche Tumorvolumen betrug hierbei 0,090± 0,008 cm3. Die Angehrate der Tumorimplantation war 100 %. Eine auffallende Hypointensitat der Lasion im Vergleich zum umgebenden Lebergewebe im Tlw-Bild und eine massig vermehrte Signalintensitat im T2w-Bild mit inhomogener Struktur waren bei allen implantierten Ratten erkennbar. Mit einer guten Angehrate des Implantations und geeignetem Tumorwachstumsverhalten steht dieses Verfahren zur Etablierung eines Tiermodells des HCCs zur Verfugung. Es ist einfach zu kontrollieren und leicht reproduzierbar.

  7. Radiofrequency ablation - is a technique finished?; Radiofrequenzablation - ist eine Technik am Ende

    Energy Technology Data Exchange (ETDEWEB)

    Wiggermann, P.; Jung, E.M.; Stroszczynski, C. [Klinikum der Universitaet Regensburg (Germany). Institut fuer Roentgendiagnostik

    2012-01-15

    According to current scientific investigations radiofrequency ablation (RFA) as a local ablative tumor therapy for unresectable liver malignancies is currently accepted as the best therapeutic choice. The results of randomized trials justify RFA for small hepatocellular carcinomas (HCC) and RFA is considered to be a viable alternative to resection for inoperable patients with limited hepatic metastatic disease, especially from colorectal cancer (CRC LM). However, surgical resection still remains the gold standard for resectable CRC LM. The intraprocedural image guidance modality of choice is computed tomography (CT) alongside CT fluoroscopy. Contrast-enhanced ultrasound (CEUS) and magnetic resonance imaging (MRI) are used for preprocedural lesion detection and differentiation as well as for follow-up and can be used to perform RFA procedures as well. This article highlights new developments in RFA. (orig.) [German] Aktuellen wissenschaftlichen Untersuchungen entsprechend stellt die Radiofrequenzablation (RFA) das derzeit kurativste Verfahren zur Behandlung maligner Leberlaesionen dar, wenn eine chirurgische Resektion bzw. Transplantation nicht moeglich ist. Voraussetzung fuer eine erfolgreiche Radiofrequenzablation sind maximal 6 Tumorlaesionen bis zu einer Groesse von maximal 3 cm. Die haeufigsten Indikationen zur RFA-Behandlung sind das hepatozellulaere Karzinom bzw. Lebermetastasen des kolorektalen Karzinoms. Bildgebendes Verfahren der Wahl ist eine kontrastmittelverstaerkte dynamische Spiral-CT, zur Interventionsdurchfuehrung eine CT-Fluoroskopie; alternativ zu letzterer kann eine Ultraschalluntersuchung eingesetzt werden. Die kontrastmittelverstaerkte MRT dient vorwiegend der Tumordetektion und Charakterisierung sowie der postinterventionellen Kontrolle, selten zur Durchfuehrung der RFA. Die aktuelle Arbeit stellt die neuesten Entwicklungen bzgl. der RFA dar. (orig.)

  8. Salt-induced stabilization of EIN3/EIL1 confers salinity tolerance by deterring ROS accumulation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jinying Peng

    2014-10-01

    Full Text Available Ethylene has been regarded as a stress hormone to regulate myriad stress responses. Salinity stress is one of the most serious abiotic stresses limiting plant growth and development. But how ethylene signaling is involved in plant response to salt stress is poorly understood. Here we showed that Arabidopsis plants pretreated with ethylene exhibited enhanced tolerance to salt stress. Gain- and loss-of-function studies demonstrated that EIN3 (ETHYLENE INSENSITIVE 3 and EIL1 (EIN3-LIKE 1, two ethylene-activated transcription factors, are necessary and sufficient for the enhanced salt tolerance. High salinity induced the accumulation of EIN3/EIL1 proteins by promoting the proteasomal degradation of two EIN3/EIL1-targeting F-box proteins, EBF1 and EBF2, in an EIN2-independent manner. Whole-genome transcriptome analysis identified a list of SIED (Salt-Induced and EIN3/EIL1-Dependent genes that participate in salt stress responses, including several genes encoding reactive oxygen species (ROS scavengers. We performed a genetic screen for ein3 eil1-like salt-hypersensitive mutants and identified 5 EIN3 direct target genes including a previously unknown gene, SIED1 (At5g22270, which encodes a 93-amino acid polypeptide involved in ROS dismissal. We also found that activation of EIN3 increased peroxidase (POD activity through the direct transcriptional regulation of PODs expression. Accordingly, ethylene pretreatment or EIN3 activation was able to preclude excess ROS accumulation and increased tolerance to salt stress. Taken together, our study provides new insights into the molecular action of ethylene signaling to enhance plant salt tolerance, and elucidates the transcriptional network of EIN3 in salt stress response.

  9. Indirect determination of single scattering albedo and complex refractive index of atmospheric aerosol from combined spectral sun- and sky-radiance- as well spectral radiation flux-measurements and determination of radiative forcing. Final report; Indirekte Bestimmung der Single Scattering Albedo und des komplexen Brechungsindex des atmosphaerischen Aerosols aus kombinierten spektralen Sonnen- und Himmelsstrahlungs- sowie spektralen Strahlungsflussmessungen und Ermittlung des Strahlungsantriebs. Abschlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Hoyningen-Huene, W. von; Burrows, J.P.; Schmidt, T.; Freitag, M.; Waltersdorf, M.; Roth, S.

    2001-07-01

    atmosphaerischer Strahlungsmessungen waehrend des Schliessungsexperiments LACE-98 wurden die wesentlichen strahlungsrelevanten Aerosolparameter experimentell abgeleitet: spektrale optische Dicke, Phasenfunktion und Single Scattering Albedo. Durch Verwendung spektraler Strahlungsflussmessungen konnte auch die spektrale Single Scattering Albedo erhalten werden. Die erhaltenen Aerosolparameter dienten Strahlungstransferrechnungen zur Bestimmung der Strahldichte am Oberrand der Atmosphaere und zum Vergleich mit Satellitendaten (SeaWiFS). Aus dem Vergleich wurde ein dynamisches Reflektanzmodell fuer Landoberflaechen abgeleitet, das in einem aus den Schliessungen abgeleiteten Retrievalverfahren fuer die Bestimmung der optischen Dicke aus multispektralen Satellitenmessungen resultiert. Die optischen Aerosolparameter, das entwickelte Retrievalverfahren und die damit erhaltene regionale Verteilung der optischen Dicke ueber Deutschland werden dargestellt. (orig.)

  10. Experimental investigations for provision of a data basis for optimization of active surge control. Final report; Experimentelle Untersuchungen zur Bereitstellung einer Datenbasis fuer die Optimierung der aktiven Stabilitaetsverbesserung. Teilverbund-Projekt: Aktive Stabilitaetsverbesserung - Analyseverfahren der Arbeitsgemeinschaft AG Turbo II. Abschlussbericht zum Vorhaben 1.1.4

    Energy Technology Data Exchange (ETDEWEB)

    Seume, J.; Reissner, A.

    2001-07-01

    Presently axial compressors have to run with considerable distance to operation points of high load although usually the best efficiencies can be obtained there. In those areas there is high danger of surge which brings high damaging potential to the compressor. The prediction time to surge presently is very short (<<1s) and depends on the load and rotor rotation of the compressor. The goal of this project is the production of a data basis to investigate stall inception (which is the precursor of surge) and to develop and test better precursory warning algorithms. An extensive set of data as well in stable as in unstable operating points in different load areas was developed which now is ready for use in research, verification and for comparison of forewarning systems. (orig.) [German] Zur Zeit ist es notwendig, Axialverdichter mit deutlichem Abstand von den hoch belasteten Betriebspunkten zu betreiben, obwohl haeufig dort die besten Wirkungsgrade zu erzielen waeren. In diesen Bereichen kann es leicht zu sog. Pumpen kommen, wodurch der Verdichter einem extremen Schaedigungspotential ausgesetzt ist. Die Vorwarnzeiten fuer das Pumpen sind bisher noch sehr kurz. Sie liegen in einem Bereich von deutlich weniger als einer Sekunde (abhaengig von der Belastung und der Drehzahl des Verdichters). Ziel dieser Untersuchungen ist es, eine Datenbasis zu liefern, anhand derer die Entstehungsmechanismen untersucht und moeglichst fruehzeitige Vorwarnalgorithmen entwickelt bzw. erprobt werden koennen. Es wurde eine umfangreiche Datenbasis sowohl an verschiedenen stabilen als auch instabilen Betriebspunkten in unterschiedlichen Lastbereichen erstellt, die nun zur Entwicklung, zur Verifizierung und zum Vergleich von Fruehwarnsystemen zur Verfuegung steht. (orig.)

  11. Politik von heute für die Welt von morgen : wie ein Bewusstsein von Nachhaltigkeit auf der Ebene der Weltpolitik den Krieg vermeiden könnte

    OpenAIRE

    Eisbrenner, Kerstin

    2009-01-01

    Rezension zu: Harald Müller : Wie kann eine neue Weltordnung aussehen? Wege in eine nachhaltige Politik ; Fischer Taschenbuch Verlag, Frankfurt am Main 2008 ; ISBN 978-3596176663, 320 Seiten, 9,95 Euro.

  12. Rekonfigurationstechniken und Anwendungsgebiete für ein programmierbares Gm-C Analog-Filter

    Directory of Open Access Journals (Sweden)

    J. Becker

    2006-01-01

    Full Text Available FPAAs (Field Programmable Analog Arrays erlauben es, analoge Signalübertragungsfunktionen auf Hardware abzubilden, die von veränderbaren digitalen Konfigurationsdaten abhängen. Sowohl für das Design von Filterstrukturen auf Systemebene als auch für die genaue Simulation ihrer analogen Übertragungsfunktion auf Transistorebene ist es dabei notwendig, die entsprechenden Konfigurationsdaten einzugeben bevor die Phasen/Betragsanalyse durchgeführt werden kann. Die vorliegende Arbeit stellt ein graphisches Entwurfsprogramm zur Instantiierung von analogen Filtern für ein FPAA mit 17 gm-C Blöcken vor. Es wird über erste Simulationsergebnisse berichtet, die die Machbarkeit mit Eckfrequenzen bis zu hundert Mhz bestätigen. Simulierte Übertragungsfunktionen von grundlegenden Bausteinen werden mit der Theorie verglichen und zu einer exemplarischen Instantiierung eines Butterworth-Filters der vierten Ordnung weitergeführt.

  13. Schöneweide - neu kollagiert. Ein künstlerisches Forschungsprojekt

    Directory of Open Access Journals (Sweden)

    Albert Markert

    2015-04-01

    Full Text Available Der Berliner Stadtteil Schöneweide – einst AEG-Areal und Wiege der Elektrifizierung Berlins - war bis zur Wende einer der größten Industriestandorte Europas. Nach der Wende schlossen nahezu alle Industriebetriebe. Seitdem stehen die meisten Fabrikhallen leer. Seit einiger Zeit wandelt sich Oberschöneweide: Die Hochschule für Technik und Wirtschaft hat seit einigen Jahren hier ihren Hauptstandort; eine international expandierende Kunstgießerei hat eine neue Produktionsstätte eröffnet; der kanadische Rocksänger und Fotograf Bryan Adams plant, ein Kulturzentrum zum internationalen Austausch in einer der ehemaligen Produktionshallen zu etablieren. Seit einigen Jahren ziehen zahlreiche Designer_innen, Künstler_innen und Student_innen nach Schöneweide und prägen zunehmend das Erscheinungsbild des Stadtteils (...

  14. Ein Qedem 2: a Kebaran site in Nahal Galim, Mount Carmel, Israel:

    OpenAIRE

    Danny Rosenberg; Dani Nadel; Avraham Ronen

    2011-01-01

    Ein Qedem 2 (EQ2) is an open-air Kebaran site (Early Epipalaeolithic period, ca. 22 000 –17 500 calBP) located on the slope of Mount Carmel, Israel. The site is a part of a complex of prehistoric sites situated around the perennial spring of Ein Qedem and near the outskirts of the city of Haifa. EQ2, located near affluent sources of flint, presents ample evidence for Kebaran flint knapping. The rich flint assemblage provides valuable information concerning the microlithic industry, one of the...

  15. Meta-Analyse und "publication bias": eine empirisch-statistische Fallstudie

    OpenAIRE

    Fiebig, Joachim; Rüdebusch, Gerrit; Urban, Dieter

    2012-01-01

    "Die Schrift berichtet über empirische Analysen zur Identifikation eines “publication bias” in einer Meta-Analyse von 30 Studien zu den Effekten von pädosexueller Viktimisierung auf die Entstehung von pädosexueller Delinquenz. Zur Identifikation eines möglichen „publication bias“ werden verschiedene statistische Verfahren vorgestellt und erläutert (graphische und regressionsanalytische „funnel-plot“-Methodik sowie die „rank-correlation“-, „fail-safe numbers“- und „trim and fill“-Methodik). In...

  16. Fortschritt und Arbeitszeit: Ein Vergleich der Ansichten von Marx, Keynes und der Sozialdemokratie

    Directory of Open Access Journals (Sweden)

    Bernhard Schütz

    2014-12-01

    Full Text Available Die Ideen von Karl Marx und John Maynard Keynes übten im Laufe der Zeit großen Einfluss auf die Ansichten der österreichischen Sozialdemokratie aus. Beide Autoren sahen das Ziel der Geschichte in der Selbstverwirklichung des Menschen. Sie gingen davon aus, dass eine weitestgehende Befreiung des Menschen von der Notwendigkeit der Arbeit eine unbedingte Voraussetzung für diese Selbstverwirklichung ist. Der vorliegende Beitrag analysiert, ob sich diese spezifische Vorstellung von Fortschritt in den Programmen der österreichischen Sozialdemokratie wiederfindet.

  17. Implementation und Evaluation eines sozial-kognitiven Kompetenztrainings für Kinder im Grundschulalter

    OpenAIRE

    Hacker, Stefanie

    2008-01-01

    Mit dem „Training im Problemlösen (TIP)“ wird ein sozial-kognitives Kompetenztraining für das Grundschulalter vorgestellt, welches als eine Adaptation an das amerikanische PATHS Curriculum (Kusché & Greenberg, 1992, 1994, 1996) entwickelt wurde. Ziele dieser univer-sellen Maßnahme zur Prävention sozialer Verhaltensprobleme sind die Förderung von Selbst-kontrolle, sozialer Problemlösefertigkeiten und emotionaler Aufmerksamkeit. Das Programm ist als Kurzzeittraining angelegt und umfasst 16 Lekt...

  18. Harnableitung bei Kindern und Jugendlichen mit neurogener Blasenfunktionsstörung: auch langfristig eine sichere Therapieoption?

    Directory of Open Access Journals (Sweden)

    Stein R

    2002-01-01

    Full Text Available Einleitung: Pharmakotherapie, der saubere Einmalkatheterismus (clean intermittent catheterization = CIC und die Infektionsprophylaxe sind die drei Säulen der konservativen Therapie bei Patienten mit neurogener Blasenfunktionsstörung. Während der Pubertät werden die Patienten zunehmend unabhängiger vom Elternhaus. Gleichzeitig nimmt jedoch die Compliance der Medikamenteneinnahme und der Durchführung des regelmäßigen CIC ab. Der orthopädische und/oder neurologische Status kann sich ebenfalls verändern. Dies kann letztlich zum Fehlschlagen der konservativen Therapie (Inkontinenz, Restharn, Verschlechterung der Funktion des oberen Harntraktes führen. In einem multidisziplinären Team wird diese Problematik der Kinder und Jugendlichen unter Berücksichtigung der Wünsche des Patienten als auch der medizinischen Ziele (z. B. Schutz der Nierenfunktion in unserer Klinik diskutiert. Die Harnableitung wurde hierbei in einigen Fällen als notwendige Kompromißlösung angesehen. In der vorliegenden retrospektiven Studie untersuchten wir, ob die Harnableitung auch langfristig ein sicheres Verfahren darstellt. Material und Methode: Zwischen 1967 und 1997 erfolgte bei 149 Kindern und Heranwachsenden die Anlage einer Harnableitung. 129 Patienten konnten durchschnittlich 11,8 Jahre (0,8-28,5 nachbeobachtet werden. Das durchschnittliche Alter bei der Operation betrug 12,1 Jahre (0,8-20. Ein Colon-Conduit wurde bei 59 Patienten (in der Mehrzahl der Fälle vor der Ära des CIC und der kontinenten Harnableitung angelegt, eine orthotope Blasensubstitution erfolgte bei 12, eine kontinente kutane Harnableitung bei 58 Patienten (50 % Rollstuhlfahrer. Ergebnisse: Der obere Harntrakt blieb bei 95-97 % der renoureteralen Einheiten (RUE stabil, bzw. verbesserte sich. Alle Patienten mit einer orthotopen Blasensubstitution sind tagsüber kontinent; eine Patientin benötigt zur Sicherheit zeitweise eine Vorlage während der Nacht. 7 der 12 Patienten führen einen

  19. Haftung und Compliance: Wie beeinflusst eine CMS-Zertifizierung den Sorgfaltsmaßstab?

    Directory of Open Access Journals (Sweden)

    Mona Philomena Ladler

    2016-05-01

    Full Text Available Eine ungenügende Compliance-Organisation stellt eine Sorgfaltspflichtverletzung der Geschäftsleiter dar. CMS-Standards, wie die Norm ISO 19600, bieten Hilfestellungen zur Ausgestaltung einer Compliance-Organisation und können daher das Haftungsrisiko der Geschäftsleitung reduzieren. In diesem Beitrag wird der Frage nach der Rechtsqualität von CMS-Standards nachgegangen. Es werden die Haftungsfolgen einer Zertifizierung einer Compliance-Organisation auf Basis von CMS-Standards untersucht und analysiert, ob die ordentliche Sorgfalt die Errichtung einer den CMS-Standards entsprechenden Compliance-Organisation gebieten kann.

  20. Wirkungsmessung pädagogischer Interventionen: Anpassung eines Zielerreichungsinstruments an jugendforensische Anforderungen

    OpenAIRE

    Singer, Hanneke; Prestel, Anja; Schmid, Marc; Keller, Ferdinand; Fegert, Jörg M; Kölch, Michael

    2009-01-01

    Fragen der Qualitätssicherung gewinnen in der stationären Jugendhilfe zunehmend an Bedeutung, sicherlich auch, um die erheblichen gesellschaftlichen Kosten rechtfertigen zu können. Für eine breite Akzeptanz in der pädagogischen Praxis müssen Instrumente der Qualitätssicherung einerseits die Praxis und die unterschiedlichen Problemlagen der Kinder und Jugendlichen abbilden können, andererseits aber über eine so gute methodische Qualität und Generalisierbarkeit verfügen, dass Aussagen...

  1. Ein konservatives MPV-Verfahren zur Simulation der Strömungen in allen Machzahlbereichen

    OpenAIRE

    Park, Jea-Ho

    2003-01-01

    Zur Simulation sowohl inkompressibler als auch kompressibler Strömungen wird ein neues numerisches Verfahren eingeführt. Dabei wird zunächst die konservative Form der Navier-Stokes-Gleichungen aufgestellt, da sie das numerische Erhaltungsprinzip für Strömungen höherer Machzahl gewährleistet. Auf den Druck wird noch der sogenannte MPV-Ansatz angewandt. Dies ist eine Art Druckzerlegungsmethode. Damit kann die beim inkompressiblen Grenzfall auftretende Singularität beseitigt werden. Eigentlich b...

  2. Ein Fremdling erobert das Weserbergland - Das Indische oder Drüsige Springkraut (Impatiens glandulifera)

    OpenAIRE

    Happe, Horst

    2013-01-01

    Dem aufmerksamen Naturbeobachter wird es kaum entgangen sein, dass eine im Kreis Höxter neue Pflanze, ein sogenannter Neubürger oder Neophyt, schon seit geraumer Zeit die Weser und ihre Nebenflüsse, ja auch die Muschelkalkhänge und den Solling, erobert hat und teilweise einige Arten der ehemaligen Hochstaudenflur verdrängt. Wie HÄCKER (1988) nachweisen konnte, verschwinden z. B. an der Weser mannshohe einheimische Pflanzen wie der Knollige Kälberkropf (Chaerophyllum bulbosum), die Krause Dist...

  3. Beacon Hill Village in Boston: Ein erfolgreiches Beispiel einer Mitgliederorganisation auf Quartiersebene

    OpenAIRE

    Osl, Philipp; Benz, Alain; Österle, Hubert

    2011-01-01

    Beacon Hill Village erbringt und koordiniert als Intermediär ein breites Spektrum von Dienstleistungen für ältere Menschen in Boston. Durch Kombination professioneller Dienstleister und Freiwilligenarbeit sowie alternative Preismodelle für finanzschwache Mitglieder ist es der Organisation gelungen, ein an den Kundenbedürfnissen orientiertes Angebot für (fast) alle Menschen zugänglich zu machen. Der Beitrag stellt das Geschäftsmodell von Beacon Hill Village vor und diskutiert die Umsetzbarkeit...

  4. Entwicklung eines Modells des Paracetamol-induzierten akuten Leberversagens und Vergleich von Leberersatzverfahren am Schwein

    OpenAIRE

    Rubitschek, Sofia

    2011-01-01

    Paracetamol (PCM) ist ein weit verbreitetes Antipyretikum und Analgetikum, von dem seit Jahren bekannt ist, dass es bei Überdosierung lebertoxisch wirkt und zu einem ALV, schlimmstenfalls bis zum Tode führen kann. Trotz großer Bemühungen war es bislang nicht möglich, die genauen Zusammenhänge der Toxizität zu klären, was eine zuverlässige Prognose des Krankheitsverlaufs bei einer Überdosierung erschwert. Nicht unbeteiligt hieran ist der Mangel an suffizienten Großtiermodellen, die es sowohl e...

  5. Convention on Cybercrime (ETS 185) - Ein Vergleich mit dem deutschen Computerstrafrecht in materiell- und verfahrensrechtlicher Hinsicht

    OpenAIRE

    Spannbrucker, Christian

    2005-01-01

    Die �Convention on Cybercrime� ist das 185. völkerrechtliche Abkommen aus der Feder des Europarats. Sie ist ein Resultat jahrelanger, internationaler Bemühungen zur Verbesserung der Bekämpfung der Computerkriminalität. Neben dem Europarat findet eine länderübergreifende Zusammenarbeit auch auf der Ebene der Vereinten Nationen, der OECD, der G8 und der Europäischen Union statt. Bislang stellt die Konvention das weitest reichende und konkreteste Ergebnis dieser Bemühungen dar. Sie wurde im ...

  6. "Shadow Education" in Deutschland und Japan : eine Einführung in das Forschungsfeld

    OpenAIRE

    Steve R. Entrich

    2012-01-01

    Der Autor versucht mit dieser kurzen Einführung eine Übersicht über den Stand der Forschung zu einem Thema zu geben, das in der Forschung bisher noch nicht ausreichend berücksichtigt wurde: der außerschulischen, privatwirtschaftlich organisierten Zusatzbildung, der sogenannten Shadow Education. Der Fokus der Arbeit richtet sich dabei auf die Länder Japan, welches bereits seit den 1970er Jahren ein System außerschulischer Bildungsinstitutionen besitzt, dessen Einfluss auf den Bildungserwerb ju...

  7. Entwicklung von Manövrier- und Steuereinrichtungen für ein druckneutrales Unterwasserfahrzeug

    OpenAIRE

    Olenew, Eugen

    2013-01-01

    Unbemannte autonome Unterwasserfahrzeuge (AUV) dringen in Gebiete vor, die für Taucher unerreichbar sind, um dort Inspektions- und Überwachungsaufgaben zu übernehmen. Eine Besonderheit ist die kabelunabhängige und autonome Navigations- und Manövrierweise, die es erlaubt, große Areale während einer Tauchmission zu untersuchen. Um die zurückzulegenden Strecken bei begrenzter Energieversorgung bewältigen zu können, weisen autonome Unterwasserfahrzeuge meist eine strömungsgünstige Form auf. Für d...

  8. Die Europäische Zentralbank. Ein Vergleich mit der Deutschen Bundesbank

    OpenAIRE

    Kiencke, Norbert

    1996-01-01

    Seit Gründung der Europäischen Gemeinschaft existieren der politische Wille und die Bemühungen auf politischer Ebene eineWirtschafts- und Währungsunion in Europa zu errichten. Die Europäische Wirtschafts- und Währungsunion ist ein weitererSchritt zur 'wirtschaftlichen und politischen Integration Europas'[1] . Der Vertrag von Maastricht schreibt den Zeitpunkt derVollendung für das Jahr 1997, spätestens jedoch 1999 vor[2]. Zu diesem Zweck wurden die wirtschaftspolitischen Ziele derGemeinschaft ...

  9. Trauma der Otobasis und des angrenzenden Kiefergelenkes links nach Fischbiss eines Tylosurus crocodilus (Krokodil-Hornhecht)

    OpenAIRE

    Semmler, S; Dommerich, S; Stölzel, K; Olze, H; Jöhrens, K

    2016-01-01

    Einleitung: In unserer Fallvorstellung handelt es sich um einen Biss eines Tylosurus crocodilus, der in den Tropen und Subtropen beheimatet ist. Unfälle durch diese Fischart beim Menschen sind in der Literatur beschrieben und werden meist durch die scharfen Zähne beim plötzlichen Herausspringen des Fisches aus dem Wasser verursacht.Fallvorstellung: In unserer Klinik sahen wir im März 2015 einen 36-jährigen Patienten, der drei Wochen zuvor beim Baden in Thailand, einen Fischbiss eines Tylosu...

  10. Touristification in Berlin. Ein Bericht zur Workshop-Reihe des Vereins Kritische Geographie Berlin

    OpenAIRE

    Kritische Geographie Berlin

    2014-01-01

    Die Gruppe Kritische Geographie Berlin beschäftigt sich seit Längerem mit Phänomenen, Ursachen, Akteuren und Wirkungsweisen des neuen touristischen Interesses an Berliner ‚Trend-Bezirken’ wie etwa Mitte, Friedrichshain-Kreuzberg und den nördlichen Teilen Neuköllns. Nachdem zunächst in mehreren Diskussionen und internen Workshops ein Überblick über das Thema und einzelne Facetten jener ‚Touristifizierung der Stadt’ erarbeitet wurde, folgte in den Jahren 2012/13 eine öffentliche Workshop-Reihe....

  11. Ein Mathematiker mit universalem Anspruch : über Max Dehn und sein Wirken am Mathematischen Seminar

    OpenAIRE

    Burde, Gerhard; Schwarz, Wolfgang; Wolfart, Jürgen

    2007-01-01

    Für eine erste Blüte der Mathematik in Frankfurt gab Max Dehn (1878 –1952) in den Jahren ab 1921 bis 1935 entscheidende Impulse. Seine völlig neuen Ideen zur Knotentheorie und zur Topologie beeinflussten die Entwicklung der Mathematik weit über Deutschland hinaus. 1935 fand sein Wirken in Frankfurt durch den Terror der Nationalsozialisten ein jähes Ende. Nach einer gefahrvollen Flucht über Norwegen, Finnland, die Sowjetunion und Japan erreichte Dehn schließlich, 62-jährig, die Vereinigten Sta...

  12. Effekte der Frauenquote in Aufsichtsräten: Ein Ausblick für Deutschland

    OpenAIRE

    Pipke, David; Pönitzsch, Gert

    2015-01-01

    [Einleitung] Einige Industrieländer der Europäischen Union haben seit 2001 entweder Frauenquoten in Aufsichtsräten (bzw. in äquivalenten Organen) eingeführt oder diskutieren über gesetzliche Regelungen (Storvik & Teigen, 2010). Auch in Deutschland wird es ab dem 1. Januar 2016 eine gesetzliche Frauenquote für Aufsichtsräte geben. Die Folgen der Quote für Unternehmen und Belegschaft lassen sich nur schwer abschätzen, jedoch hat Norwegen bereits seit 2006 eine gesetzliche Quote eingeführt und e...

  13. EINE UNTERSUCHUNG UBER DIE NUTZUNG DER WINDENERGIE IN DER WELT UND IN DER TURKEI

    Directory of Open Access Journals (Sweden)

    Aydoğan ÖZDAMAR

    2000-02-01

    Full Text Available In dieser Arbeit wurde die Nutzung der in Zukunft bei der Energieversorgung eine wichtige Rolle zuspielende Windenergie allgemein bewertet. Zu dem Zweck wurde zuerst Potential und geschichtliche Entwicklung der Windenergienutzung in der Welt und in der Türkei, Entstehung des Windes und Windmessungen betrachtet. Anschließend wurden Kritiken über die Unstetigkeit der Windenergie, der Deckung des Energiebedarfs eines Hauses vollständig von Windenergie und der Wirtschaftlichkeit des Windstroms behandelt und Antworten mit konkreten Beispielen auf diese Kritiken gegeben.

  14. Die Kosten der Flüchtlingskrise in Deutschland - eine Investition in die Zukunft? Ein 5-Punkte-Programm könnte dazu beitragen

    OpenAIRE

    Brühl, Volker

    2016-01-01

    [Ausgangssituation ...] Das hier vorgestellte finanzökonomische Simulationsmodell soll die bestehenden Untersuchungen ergänzen, indem zum einen eine differenziertere Betrachtung der Kosten erfolgt und zum anderen die mittel- bis langfristig zu erwartenden Wertschöpfungsbeiträge der Schutzsuchenden berücksichtigt werden. Die nachfolgenden Berechnungen unterscheiden bewusst zwischen fiskalischen und gesamtwirtschaftlichen Effekten der Zuwanderung, da diese weit auseinanderfallen können. Dadurch...

  15. MaxControl : ein objektorientiertes Werkzeug zur automatischen Erstellung von 3D-Computeranimationsfilmen und dessen Integration in eine professionelle 3D-Animationssoftware

    OpenAIRE

    Paul, Jan

    2008-01-01

    Durch die wachsende Computerleistung können 3D-Computeranimationen sehr komplexe Szenen mit ebenso komplexen zeitlichen Abläufen animiert darstellen. Jedoch ist neben der Erstellung einer komplexen Szene auch deren Animation entsprechend aufwendig, wenn keine Automatisierungen genutzt werden können. Das in dieser Arbeit entwickelte Werkzeug MaxControl ist ein System zur automatischen Animation von nicht-interaktiven 3D-Animationsfilmen. Dies wird durch die Simulation von Verhaltensweisen erre...

  16. Environmental pollution: Measurable quantity or a problem of general risk acceptance?; Die stoffliche Belastung der Umwelt. Eine Systemgroesse oder eine Frage der allgemeinen Risikoakzeptanz?

    Energy Technology Data Exchange (ETDEWEB)

    Ballschmiter, K.

    2001-08-01

    Having different disciplines give different meanings to one same word is not unusual; using the word 'risk' in an environmental context has its specific importance. The classical definitions of 'risk' as the possibility of an adverse incident have been projected in the environmental and human health study areas. Risk-acceptance and risk-preference are general factors of the everyday life and even find a role in economics. However, their use as parameters in the field of environmental hazards should be avoided, or at least be defined as to their meaning. The environment is a complex system of mass fluxes and interdependencies that can be observed and described but not regulated in its global dimension. Technology assessment has here a specific task in defining precaution as the prevention of hazards as well as the 'repair in advance' of potential environmental risks of global dimensions. The globe as a whole and many of its parts cannot be subjected to 'end of the pipe' repair strategies. (orig.) [German] Das Phaenomen der unterschiedlichen Fuellung eines Begriffs in unterschiedlichen Disziplinen ist nicht neu; es wird aber besonders deutlich bei der Verwendung des Begriffes Risiko, wenn es um reale oder nur als moeglich angesehene Gefaehrdungen im Umweltbereich geht. Es werden die klassischen Definitionen eines Risikos, d.h. des moeglichen Eintritts eines Schadensereignisses, in ihrer Anwendung auf moegliche Schadensereignisse fuer Umwelt und Gesundheit gegenueber gestellt. Es wird die These vertreten, dass spezifische Formen der Risikoakzeptanz und Risikopraeferenz sehr wohl Faktoren der persoenlichen Lebensgestaltung sein koennen und auch in wirtschaftlichen Unternehmungen definierbare Groessen sind, dass sie aber fuer vom Menschen angestossene Veraenderungen in der Umwelt und hier insbesondere im Bereich der stofflichen Vorgaenge in den globalen Dimensionen nicht eingebracht werden koennen oder wenigstens eine sehr eigene

  17. Plain film emergency radiology of child abuse: a strategy; Die akute Roentgendiagnostik der Kindesmisshandlung: Eine Strategie

    Energy Technology Data Exchange (ETDEWEB)

    Oestreich, A.E. [Children`s Hospital Medical Center, Cincinnati OH (United States). Dept. of Radiology

    1998-04-01

    A strategy is proposed for the dedicated interpretation of possible radiographic plain film signs that are suspicious for indicating child abuse. For each sign, the features `PRO` raise the question of abuse, while radiographic or clinical findings `CON` suggest an alternate explanation. Birth trauma, oesteogenesis imperfecta, rescue trauma, and metastatic neuroblastoma are among the many entities cited. A triad of situations may lead a radiologist to look systematically for changes from abuse; a triad of resolutions may result from the search. Periosteal reaction is the major factor in dating of fractures; physiologic periosteal reaction of infancy and periosteal reaction from previous fracture must be considered when so dating fractures. (orig.) [Deutsch] Es wird eine Strategie fuer die genaue Interpretation roentgenologischer Befunde, die auf eine Kindesmisshandlung hindeuten koennen, vorgeschlagen. Fuer jeden Befund werfen die unter `PRO` aufgefuehrten Merkmale die Frage nach einer Kindesmisshandlung auf, waehrend radiologische und klinische Befunde unter `CON` andere Erklaerungen nahelegen. Geburtstrauma, Osteogenesis imperfecta, Rettungstrauma und metastasierendes Neuroblastom sind unter den vielen zitierten Differentialdiagnosen. Drei moegliche Situationen koennen den Radiologen dazu veranlassen, systematisch nach Zeichen einer Kindesmisshandlung zu suchen, 3 moegliche Loesungen koennen aus dieser Suche hervorgehen. Eine Periostreaktion ist ein Kardinalbefund zur Datierung von Frakturen. Physiologische Periostreaktionen im fruehen Kindesalter und Periostreaktionen durch fruehere Frakturen muessen bei einer solchen Datierung von Frakturen mitbedacht werden. (orig.)

  18. Against the rust. A practice report; Gegen den Rost. Ein Praxisreport

    Energy Technology Data Exchange (ETDEWEB)

    Pinger, Thomas [Voigt und Schweitzer, Wolfsburg (Germany). Bereich Nachhaltigkeit und Innovationsmanagement

    2013-11-01

    For outdoor installations, the costs play a major role. With underframes made of piece by piece galvanized steels the costs can be reduced. [German] Bei Freilandanlagen spielen die Kosten eine grosse Rolle. Mit Untergestellen aus stueckverzinktem Stahl lassen sie sich senken.

  19. [Jean-Daniel Strub. Der gerechte Friede. Spannungsfelder eines friedensethnischen Leibegriffs.] / Andreas Pawlas

    Index Scriptorium Estoniae

    Pawlas, Andreas

    2012-01-01

    Arvustus: Strub, Jean-Daniel. Der gerechte Friede. Spannungsfelder eines friedensethnischen Leibegriffs. (Forum Systematik. beiträge zur Dogmatik, Ethik und ökumenischen Theologie, hg von Johannes Brosseder, Johannes Fischer und Joachim Track, Band 36), Verlag W. Kohlhammer, Stuttgart 2010

  20. Separation anxiety: An analysis of ethylene-induced cleavage of EIN2

    Science.gov (United States)

    Since the discovery of the CTR1 protein kinase and the endoplasmic reticulum (ER)-localized EIN2 protein nearly 20 y ago, plant biologists have wondered how these proteins respectively serve as negative and positive regulators of ethylene-mediated signal transduction in plants. Now with the publicat...

  1. Milax Clerxi nov. spec., eine neue Nacktschnecke aus Südjugoslawien (Gastropoda, Pulmonata, Milacidae)

    NARCIS (Netherlands)

    Rähle, W.

    1977-01-01

    Durch das Entgegenkommen von Herrn Dr. C. O. van Regteren Altena, Leiden, erhielt der Verfasser eine Serie juveniler, fast erwachsener und erwachsener Nacktschnecken aus der Gattung Milax zur Bearbeitung, welche aus der Umgebung der Stadt Ohrid in Mazedonien stammen und dort im Sommer 1974 von Drs.

  2. Das „Permafrost Young Researchers Network“ (PYRN) - Eine deutsche Perspektive -

    OpenAIRE

    Fritz, Michael; Krautblatter, Michael; Sanders, Tina; Lantuit, Hugues

    2011-01-01

    Das „Permafrost Young Researchers Network“ (PYRN, http://pyrn.ways.org) ist ein Netzwerk von und für junge Wissenschaftler, die sich sowohl durch ihren beruflichen Werdegang als auch aus privatem Interesse mit dem Thema Permafrost beschäftigen und mit dieser Motivation, lokale bis internationale bzw. individuelle bis organisierte Kooperation betreiben.

  3. Ethnisches Unternehmertum als Chance sozio-kultureller Integration? Entwicklung eines system- und integrationstheoretischen Modells

    OpenAIRE

    Aigner, Petra

    2012-01-01

    "Anhand einer kurzen Diskussion zum bisherigen theoretischen und empirischen nationalen, aber auch internationalen Forschungsstand zu 'Ethnischem Unternehmertum' wird dieser Artikel Modelle zu Entstehung, Etablierung und Struktur sowie zu derzeit sichtbaren sozio-ökonomischen und sozio-kulturellen Wirkungsweisen, insbesondere zu Integrations- und Segregationsaspekten, diskutieren und weiterentwickeln. Anhand eines eigenen Modells, unter Einbeziehung und theoretischer Weiterentwicklung von Ans...

  4. Kooperatives Lernen in multimedialer Lernumgebung. Eine Pilotstudie im Feld der beruflichen Weiterbildung

    OpenAIRE

    Strittmatter, Peter; Hochscheid, Ulrike; Jüngst, Karl Ludwig; Mauel, Dirk

    1994-01-01

    Ausgehend von verschiedenen kooperativen Lernmodellen wurden Annahmen im Leistungs-, interpersonalen und affektiven Bereich bezüglich kooperativen Lernens am Computer untersucht. Versuchspersonen waren erwachsene Lerner beiderlei Geschlechts, die ein multimediales Lernprogramm als berufliche Weiterbildungsmaßnahme bearbeiteten. 50 Vpn nahmen an der Kooperationsbedingung teil, während 25 Vpn in der gewohnten Individualbedingung als Kontrollgruppe dienten. Entsprechend unserer Annahmen zeigte s...

  5. Notfallmedizinische Ausbildungskonzepte von Studenten der Zahnmedizin - eine Umfrage an den zahnmedizinischen Fakultäten Deutschlands

    OpenAIRE

    Buhr, Katharina de

    2010-01-01

    Es wurde im Rahmen einer Umfrage mittels Versendung eines Fragebogens der Versuch unternommen, den derzeitigen Stand der Ausbildung von Zahnmedizinstudenten im Bereich Notfallmedizin an den verschiedenen Universitäten Deutschlands zu ermitteln. Immerhin veranstaltet inzwischen jede Universität, die den Fragebogen beantwortet hat, spezielle Unterrichtsveranstaltungen zum Thema. Dennoch variieren Umfang und Qualität der Ausbildung erheblich.

  6. [Reinhold Reith. Torsten Meyer (Hrsg.) Luxus und Konsum : eine historische Annäherung] / Raimo Pullat

    Index Scriptorium Estoniae

    Pullat, Raimo, 1935-

    2009-01-01

    Arvustus: Reith, Reinhold. Torsten Meyer (Hrsg.) Luxus und Konsum : eine historische Annäherung. Cottbuser Studien zur Geschichte von Technik, Arbeit und Umwelt. hrsg. von Günter Bayerl. Bd. 21. 2003. Collegium Johann Beckmann'i kolmanda teaduskonverentsi ettekannete kogumikust

  7. Potenziale eines ‚Dispositive Turn‘ in der Medienpädagogik

    Directory of Open Access Journals (Sweden)

    Patrick Bettinger

    2016-09-01

    Full Text Available Rezension zu: Caborn Wengler, Joannah, Britta Hoffarth, und Łukasz Kumięga, Hrsg. 2013. Verortungen des Dispositiv-Begriffs. Analytische Einsätze zu Raum, Bildung, Politik. Wiesbaden: Springer Fachmedien Wiesbaden. doi:10.1007/978-3-531-94260-5.

  8. Safety audits/Verkehrssicherheitsaudits : ein vielsprechendes Instrument zur Förderung der Verkehrssicherheit ?

    NARCIS (Netherlands)

    Wegman, F.C.M. & Schagen, I.N.L.G. van

    1998-01-01

    Das Instrument `Verkehrssicherheitsaudit' (`Audits') hat zum Zweck die infrastrukturellen Bedingungen für Verkehrssicherheit bereits während der Entwurf- und Realisierungsphase der Verkehrsinfrastruktur einzubauen. Dieser Bericht gibt ein Übersicht der Tragweite des Audits. Ausserdem werden verschie

  9. Establishment and management of a Call Center; Aufbau und Management eines Call Centers

    Energy Technology Data Exchange (ETDEWEB)

    Heckelsmueller, U.; Fehn, M. [Isar-Amperwerke AG, Muenchen (Germany)

    1998-05-01

    The article describes the activities for establishment of a Call Center as well as the objectives pursued which, in a competitive energy market, focus on establishing a comprehensive and efficient service for the customers of a utility, as satisfying customers is a major factor of success. The telephone service for direct and prompt handling of customer requests is the key service. For this service, the telecommunications spectrum of the company had to be optimised in terms of information technology and developed into a Call Center equipped with state-of-the art technology as well as trained personnel, so as to be able to implement the customer-oriented management strategy and win long-lasting consumer loyalty. (orig./CB) [Deutsch] Wie dargestellt wird ist im Wettbewerb in der Stromversorgung die effiziente Zufriedenstellung der Kundenwuensche ein wichtiger Erfolgsfaktor. Wesentlich dabei ist eine direkte und rasche Bearbeitung der telefonischen Kundenanfragen. Dazu ist eine Buendelung und informationstechnische Optimierung dieses Telekommunikationsspektrums erforderlich. Mit dem Aufbau eines Call Centers wird diesen Anforderungen Genuege getan. Das Call Center soll die Kundenzufriedenheit verbessern und zu einer nachhaltigen Kundenbindung fuehren. Daran werden Qualitaet und Erfolg gemessen. (orig./RHM)

  10. Thomas Hacker: Portfolio: Ein Entwicklungsinstrument für selbstbestimmtes Lernen. Schneider Verlag Hohengehren, 2006. [...] [Sammelrezension

    OpenAIRE

    Sacher, Werner

    2007-01-01

    Sammelrezension von: 1. Thomas Hacker: Portfolio: Ein Entwicklungsinstrument für selbstbestimmtes Lernen. Schneider Verlag Hohengehren, 2006 (333 Seiten). 2. Ilse Brunner, Thomas Hacker & Thomas Winter (Hrsg.): Das Handbuch Portfolioarbeit. Schneider Verlag Hohengehren, Baldmannsweiler. Kallmeyer Verlag, Seelze-Velber (272 Seiten)

  11. Philosophische Anthropologie - Ein wirkungsvoller Denkansatz in der deutschen Soziologie nach 1945

    OpenAIRE

    Fischer, Joachim

    2006-01-01

    Vorgeschlagen wird, die 'Philosophische Anthropologie' als eine dritte Position in der sich neu formierenden deutschen Nachkriegssoziologie zu beobachten. Inspiriert durch die im Schelerschen Theorieprogramm einer 'Philosophischen Anthropologie' miteinander verbundenen Denker Helmuth Plessner und Arnold Gehlen, die beide von der Philosophie zu soziologischen Lehrstühlen wechselten, entwickelte sich (trotz der persönlich-akademischen und politisch-biografischen Divergenzen zwischen den Hauptpr...

  12. Ein Überblick über die Sprechakttheorie von Austin und Searle

    Institute of Scientific and Technical Information of China (English)

    周婧

    2016-01-01

    Die Sprechakttheorie ist ein bedeutender Teilbereich von der linguistischen Pragmatik, die sich seit den 50er und 60er Jahren des letzten Jahrhunderts entwickelte. Die berühmten Sprachwissenschaftler Austin und Searle legten den Grundstein zu Sprechakttheorie. Dieser Text liefert einen Überblick ü ber die Forschungsergebnisse von den beiden Forschern. Dadurch kann man die Entwicklung der Sprechakttheorie gut erkennen.

  13. Das Lokalrezidiv in der orthotopen Neoblase – 2 Kasuistiken und eine Literaturübersicht

    Directory of Open Access Journals (Sweden)

    Hamidov Z

    2012-01-01

    Full Text Available Hintergrund: Die orthotope Neoblase hat sich in den vergangenen Jahren zur häufigsten Form der Harnableitung nach radikaler Zystektomie entwickelt. Sie offeriert dem Patienten einen weitestgehend normalen Alltag. Ein Rezidiv in der Neoblase kann aber nicht nur zu einem tumorspezifischen, sondern auch funktionellen Problem führen. Kasuistiken: Seit 2000 führten wir in unserer Klinik 122 Zystektomien durch, bei 67 Patienten erfolgte dabei die Anlage einer orthotopen Ileumneoblase. In 2 Fällen kam es nach 5 bzw. 6 Monaten zu einem Rezidiv in der Ileumneoblase (1,3 %. Beim ersten Patienten handelte es sich um einen 71-jährigen Mann mit einem pT4 G4 N2 V1 R1 Urothelkarzinom der Harnblase und einem simultanen Gleason- 9-Prostatakarzinom. Nach primär unkompliziertem Verlauf nach Zystektomie und simultaner Rektosigmoidresektion stellte er sich 6 Monate später unter dem Bild einer Neoblasentamponade notfallmäßig vor. Intraoperativ zeigte sich eine große Raumforderung, die transurethral nicht komplett reseziert werden konnte. Noch vor Induktion einer palliativen Chemotherapie verstarb er innerhalb von 2 Wochen an seinem Tumorleiden. Der zweite Patient (71 Jahre wurde ebenfalls wegen eines pT3 G3 N0 V0 R0 Urothelkarzinoms der Harnblase zystektomiert. Nach protrahiertem Verlauf und mehreren stationären Aufenthalten wegen eines entgleisten Säure-Basenhaushaltes stellte er sich wegen eines Harnverhalts erneut vor. Nach erschwerter Kathetereinlage wurde auch in diesem Fall zystoskopisch ein intraneovesikales Rezidiv diagnostiziert. Bei beiden Patienten wurden computertomographisch Lymphknoten- bzw. Organmetastasen ausgeschlossen. Conclusio: In der Literatur wird die Häufigkeit des Lokalrezidivs mit 1,7–7 % angegeben. In einem großen Teil der Fälle wird die Neoblasenfunktion nicht beeinträchtigt. Als Therapie werden palliative Chemotherapieansätze, transurethrale Resektionen bis hin zu Komplettresektionen beschrieben. Das lokale Rezidiv in der

  14. Die Rekonstruktion der digitalen Handlungspraxis Jugendlicher als Theoriegrundlage für eine geschlechterreflexive schulische Medienbildung

    Directory of Open Access Journals (Sweden)

    Sylvia Buchen

    2006-04-01

    Full Text Available Ausgangspunkt unserer bildungstheoretischen Überlegungen zum Thema «Informationstechnologie und Medienbildung» sind Ergebnisse unseres Forschungsprojekts «Interneterfahrungen und Habitusformen Jugendlicher unterschiedlicher Schulformen». Die rekonstruktive Jugendstudie auf der Grundlage der «dokumentarischen Methode» zielt darauf, die digitale Handlungspraxis Jugendlicher, insbes. aus Haupt- und Realschulmilieus, schulform- und geschlechtspezifisch zu generieren; d. h. die Untersuchung ist an der Schnittstelle von Jugend- und Schulforschung zu verorten. Ein zentrales Ziel des Forschungsprojekts besteht darin, Erkenntnisse, die über die medialen Orientierungen der Jugendlichen gewonnen werden, in allgemeindidaktische Bildungskonzepte für die Lehreraus- und -fortbildung überzuführen. Im Zentrum des Projekts steht also die bildungs- bzw. professionstheoretische Frage, der auch in unserem Beitrag nachgegangen werden soll, wie eine theoriegestützte schulformbezogene Lehrerbildung aussehen könnte, um Unterricht so zu gestalten, dass Schüler/innen ein (selbst-reflexives Verhältnis zu den neuen Medien aufbauen können. Hierbei sollen erstens Ergebnisse unseres Projekts kurz dargestellt und auf einen Befund fokussiert werden: die zentrale Bedeutung der digitalen Medien im Leben von Haupt- und Realschüler/innen ausserhalb der Schule und ein daran geknüpfter «digitaler Pseudo-Spezialistenhabitus» von Jungen, insbesondere im Hauptschulbereich. Vor diesem Hintergrund soll zweitens der Kern pädagogischen Handelns genauer beleuchtet und Ansätze eines heuristischen Modells für die Lehreraus- und -fortbildung diskutiert werden, das beansprucht, zu einer geschlechterreflexiven Medienbildung beizutragen.

  15. Die elektronische Gesundheitsakte (ELGA in Österreich Eine Evaluierung in Bezug auf funktionale Benutzeranforderungen

    Directory of Open Access Journals (Sweden)

    Alexander Ströher

    2010-02-01

    Full Text Available Die Einführung der elektronischen Gesundheitsakte, kurz ELGA, in Österreich ist ein seit längerer Zeit kontrovers diskutiertes Thema. Gerade in den letzten Monaten waren vermehrt Lebenszeichen der ELGA in der Presse zu finden, deren Umsetzung Teil der aktuellen Regierungsvereinbarung ist. Zudem wurden in vielen Gesprächen im Rahmen des Studiums immer wieder Vorwürfe geäußert, dass die Vorgaben seitens der Arbeitsgemeinschaft ELGA (ARGE ELGA zu sehr techniklastig seien, während die Forderungen der einzelnen zukünftigen Benutzer nicht oder zu wenig Beachtung finden. Im Rahmen der vorliegenden Arbeit wurde erarbeitet, wie sehr sich wirklich die Vorgaben seitens der ARGE ELGA auf den Bereich Technik konzentrieren bzw. welche Benutzeranforderungen bereits definiert wurden. Im nächsten Schritt wurden mittels eines problemzentrierten Interviews verschiedene Benutzergruppen der geplanten ELGA zu deren funktionalen Benutzeranforderungen befragt. Die ausgewählten Stakeholder waren: Ärzte, Apotheker, Soziale Dienste und Vertreter von Selbsthilfeorganisationen.Aus den durchgeführten 29 Interviews wurde im Anschluss eine Auswertung von funktionalen Benutzeranforderungen für die bislang beschriebenen Kernanwendungen der ELGA (Portal, e-Arztbrief, e-Befund Labor/Radiologie und e-Medikation erstellt. So wurde am Vordringlichsten die Einführung einer elektronischen Medikamentenübersicht bzw. der e-Impfpass gewünscht. Aber auch die Möglichkeit zur Präsentation der Selbsthilfe im Rahmen des ELGA-Portals war ein Punkt mit hoher Zustimmung. Demgegenüber wurde der Vorschlag des Versteckens von Dokumenten bzw. der Online-Kontakt mit dem behandelnden Arzt deutlich abgelehnt. Als Ergebnis wird zusammengefasst, dass derzeit keine ausreichende Definition von funktionalen Benutzeranforderungen für die elektronische Gesundheitsakte verfügbar ist. Die aus den Interviews erarbeiteten Anforderungen stellen aufgrund des geringen Stichprobenumfangs aller

  16. Die Xenobiotika-Exposition stellt ein zu wenig beachtetes Risiko der Embryonalentwicklung vor der Implantation dar

    Directory of Open Access Journals (Sweden)

    Fischer B

    2008-01-01

    Full Text Available Xenobiotika sind Umweltkontaminanten mit toxischen und/oder endokrinen Wirkungen. Sie umfassen eine große Gruppe von Stoffen, die sich in ihrer chemischen Natur, toxikologischen Wirkung und effektiven Dosis unterscheiden. Sie können die Gesundheit schädigen, also auch die Fortpflanzung (Reproduktionstoxizität und die Entwicklung von Embryonen (Embryotoxizität. Gesicherte Aussagen zur Schädigung von Präimplantationsembryonen durch Xenobiotika in umweltrelevanten Konzentrationen liegen nicht vor. Dies ist mehreren Faktoren geschuldet: Art und Ausmaß der induzierten toxischen oder entwicklungsverändernden Wirkungen, das kritische Zeitfenster für die Exposition und Zielgewebskonzentrationen sind für fast alle der (vielen in Frage kommenden Xenobiotika nicht bekannt. Gerade die beiden letzten Punkte, Expositionszeit und Konzentration, erfordern dringlich eine Abklärung. Dabei kommt erschwerend hinzu, dass die Xenobiotikakonzentrationen in einfach zu gewinnenden Körperflüssigkeiten, wie Blut oder Urin, häufig nicht die Zielgewebskonzentrationen in Eileiter und Uterus repräsentieren. Ein zunehmend in den Mittelpunkt wissenschaftlicher Untersuchungen tretender Angriffspunkt für Xenobiotika ist der Stoffwechsel von Präimplantationsembryonen. Viele von adulten Zellen bekannte Stoffwechselwege sind bereits in dieser frühen Entwicklungsphase im Embryo aktiv. Dies betrifft alle elementaren Stoffwechselprozesse, so auch den Energie- und Fettsäurestoffwechsel. Eine Störung hat z. T. deletäre Folgen für die weitere Embryonal- und Fötalentwicklung. Mittlerweile liegen experimentell gesicherte Belege dafür vor, dass pränatal erfolgte Fehlsteuerungen von Stoffwechselwegen langfristige Gesundheitsschäden verursachen können ("metabolic programming/imprinting". Daraus ergibt sich zwingend, dass ein besonderes Augenmerk der Embryotoxikologie auf Präimplantationsembryonen zu richten ist, auch deshalb, weil während und nach der

  17. Epiploic appendagitis of caecum: a diagnostic dilemma [Appendicitis epiploica des Blinddarms: ein diagnostisches Dilemma

    Directory of Open Access Journals (Sweden)

    Rashid, Arshad

    2012-10-01

    Full Text Available [english] Epiploic appendagitis is a rare cause of acute abdomen. Depending on the site of occurrence, it can mimic any cause of acute abdomen or disease of the colon and caecal appendix; making its preoperative diagnosis very difficult. We present here a case of a 7-year-old boy misdiagnosed preoperatively as acute appendicitis and later on, upon surgical exploration, found to have caecal appendagitis. The affected epiploic appendage was removed and the patient had an uneventful recovery. We also review the relevant literature and discuss the measures to overcome this diagnostic dilemma. General surgeons should be aware of this self-limiting disease and consider it as a differential diagnosis of acute abdomen.[german] Appendicitis epiploica oder epiploische Appendagitis ist eine seltene Ursache des akuten Abdomens. Je nach Ort des Auftretens kann sie jede Ursache für akuten Unterleibsschmerz oder Erkrankungen des Dickdarms und Appendix vermiformis imitieren, was ihre präoperative Diagnose sehr schwierig macht. Wir präsentieren hier den Fall eines alten Jungen, bei dem präoperativ akute Blinddarmentzündung diagnostiziert wurde. Beim chirurgischen Eingriff stellte sich dann eine Appendicitis epiploica des Blinddarms als Befund heraus. Der betroffene Appendix epiploica wurde entfernt und der Patient erholte sich ohne besondere Vorkommnisse. Wir geben auch eine Übersicht über die relevante Literatur und diskutieren die Maßnahmen, um dieses diagnostische Dilemma zu überwinden. Allgemeine Chirurgen sollten sich dieser selbstlimitierenden Krankheit bewusst sein und sie als eine Differentialdiagnose bei akutem Abdomen in Betracht ziehen.

  18. Abkommen mit Nebenwirkungen? : Die EU und die USA stehen vor Verhandlungen über eine Transatlantische Handels- und Investitionspartnerschaft

    OpenAIRE

    Mildner, Stormy-Annika; Schmucker, Claudia

    2013-01-01

    "Die EU und die USA wollen über eine umfassende Handels- und Investitionspartnerschaft verhandeln. Ziel der 'Transatlantic Trade and Investment Partnership' (TTIP) ist der Abbau von Zöllen und nichttarifären Handelshemmnissen; dies verspricht deutliche Wohlfahrtsgewinne für beide Seiten. Angesichts düsterer Wachstumsprognosen wäre ein solcher Impuls mehr als willkommen. Doch eine TTIP ist nicht ganz ohne Risiken für den globalen Handel und das multilaterale Handelssystem. Die Gespräche über e...

  19. Impfungen von Kindern und Jugendlichen auch gegen den Elternwillen? - Ein Diskussionsbeitrag zu ärztlichen Aufgaben und rechtlichen Rahmenbedingungen

    OpenAIRE

    Nassauer, Alfred; Meyer, Christiane

    2004-01-01

    Berichte über Todesfälle oder bleibende Gesundheitsschäden nach impfpräventablen Erkrankungen sind in Deutschland ob der in Teilen doch zufrieden stellenden Durchimpfungsraten eine Seltenheit. Das Grundgesetz garantiert den Eltern das weitgehende, von staatlichen Einflüssen ausgenommene Recht, für das Wohl der Kinder zu sorgen. Der Staat hat im Rahmen seines Wächteramtes bei der Ausgestaltung dieses Rechtes lediglich eine koordinierende Funktion. Dies führt zur Frage, ob Kinder ein eigenes, e...

  20. The Dutch Disease: Erscheinungsbilder und Therapievorschläge für eine verbreitete ökonomische Krankheit

    OpenAIRE

    Sell, Friedrich L.

    1988-01-01

    Im Zusammenhang mit den Erdgasfunden in den Niederlanden und dem im Anschluß daran beobachteten Entindustrialisierungstrend wurde der Begriff der holländischen Krankheit geprägt. Auch die die Kontraktion des Fertigwarensektors begleitende reale Aufwertung, die tendenziell Exportgüter und Importsubstitute benachteiligt, wird zum Krankheitsbild gerechnet. Wenn ein Land per Rohstoffboom eine Rente in Form eines Transfers aus dem Ausland erhält - wäre da nicht der Begriff von den economics of a l...

  1. Alleinerziehende Mütter im Bereich des SGB II: eine Synopse empirischer Befunde aus der IAB-Forschung

    OpenAIRE

    Achatz, Juliane; Hirseland, Andreas; Lietzmann, Torsten; Zabel, Cordula

    2013-01-01

    Alleinerziehende - mehrheitlich handelt es sich um Mütter - sind eine wichtige Zielgruppe in der Arbeitsmarkt- und Sozialpolitik. Eltern, die den Lebensunterhalt der Familie und die Versorgung der Kinder allein schultern müssen, können oft nur in begrenztem Umfang erwerbstätig sein und geraten oftmals in eine prekäre materielle Lage. Dies kommt in einer hohen SGB-II-Hilfequote von Ein-Eltern-Familien zum Ausdruck, die knapp das Vierfache des Durchschnitts aller Haushalte beträgt. Auf der Grun...

  2. Der Verschluss nach alloplastischer infragenualer Gefäßrekonstruktion - Ursachen und Konsequenzen - Eine retrospektive Analyse 1993 - 2001

    OpenAIRE

    Kegel, Christian

    2007-01-01

    Einleitung: In der Behandlung der peripheren arteriellen Verschlusskrankheit (pAVK) hat die Implantation von Kunststoffprothesen einen festen Stellenwert. Allerdings weisen diese, eine höhere Thrombogenität, Infekt- und damit auch Verschlussrate als die Eigenvene auf. Im Falle eines Bypassverschlusses ist die Extremität häufig gefährdet und es ergibt sich ein unmittelbarer Handlungsbedarf. Ziel der hier dargestellten Untersuchung war es, über einen bestimmten Zeitraum alle Fälle mit Bypassver...

  3. Der Einfluss der Persönlichkeit auf das Informationsverhalten: Eine empirische Studie zur Suche im Web

    OpenAIRE

    Schmidt, Thomas

    2016-01-01

    In dieser Arbeit wird eine quantitative Studie mit 30 Teilnehmern präsentiert, die den Zusammenhang zwischen Persönlichkeit und dem Informationsverhalten im Kontext der Web-Suche untersucht. Die Arbeit führt zunächst in das psychologische Konzept der Persönlichkeit und die dazugehörige Forschung im IR ein. Die Persönlichkeit der Teilnehmer wird mit Hilfe eines psychometrischen Tests operationalisiert, der Persönlichkeit auf verschiedene Dimensionen abbildet. Die Teilnehmer müssen Such-Tasks i...

  4. Laserunterstützte Synthese von einwandigen Kohlenstoffnanoröhren (SWCNTs) und Applikationen in Polycarbonaten

    OpenAIRE

    Hornbostel, Björn

    2008-01-01

    In der vorliegenden Arbeit wurde die Realisierung eines Funktions- bzw. Strukturwerkstoffs aus einwandigen Kohlenstoffnanoröhren (SWCNTs) plus Polycarbonat vorangetrieben, und die sich einstellenden Eigenschaftsänderungen des Werkstoffsystems für makroskopischen Applikationen evaluiert. Zur Bereitstellung des Röhrenmaterials wurde eine Apparatur zur lasergestützten Synthese von hochqualitativen SWCNTs konzipiert, die zwei Lasersysteme von extrem unterschiedlichen Wellenlängen (Nd:YAG, CO2) im...

  5. Fallbericht: Intervention an der distalen Anastomose eines 20 Jahre alten Venenbypasses zum R. interventricularis anterior

    Directory of Open Access Journals (Sweden)

    Kerschner K

    2006-01-01

    Full Text Available Interventionen an alten degenerierten Venenbypässen sind ein spezielles Problem der interventionellen Kardiologie. Die Komplikationsrate bei Interventionen im Schaftbereich kann durch den Einsatz einer distalen Protektion reduziert werden. Die Restenoserate wird durch Verwendung von Drug-eluting-Stents (DES gesenkt. Bei Intervention von Stenosen an der distalen Anastomose besteht das Problem der Erhaltung des Flusses sowohl nach proximal als auch in das distale Stromgebiet. Es wird die Intervention an der distalen Anastomose eines 20 Jahre alten Venenbypasses zum Ramus interventricularis anterior (RIVA mit DES und Kissing-Ballontechnik demonstriert.br Anamnese br 64jährige Patientin mit PTCA RIVA 1984, aortokoronarer Single-Venenbypass-LAD 1985 wegen Restenose. Februar 2001: Bare-Stent A. circumflexa (RCX, März 2001: Bare-Stent rechte Koronararterie, Oktober 2002: PTCA mit Cutting-Ballon-Restenose RKA, November 2002: Cypher®-Stent, proximaler Abschnitt Venenbypass LAD, Juli 2004: fokale Bypass-In-Stent-Restenose, Taxus-Stentimplantation. Risikofaktoren: ehemals Raucherin, arterielle Hypertonie, Hypercholesterinämie. Als Begleiterkrankung besteht eine COPD. Neuerliche Aufnahme im September 2005 wegen seit einigen Wochen bestehender Crescendo-Angina. Im EKG geringe linksventrikuläre Erregungsrückbildungsstörung, die Herzenzyme waren negativ.br Angiographiebr Normale Linksventrikelfunktion (EF 70 % ohne regionale Kontraktionsstörung. Proximaler Verschluß der LAD, keine Restenosen der RCA und RCX sowie im proximalen Bypass-LAD, neu aufgetretene 90%ige Stenose an der distalen Anastomose des Bypasses (Abb. 1 und 2.br Interventionbr Sondierung des Bypasses mit einem 6F-Judkins re Zuma-Katheter (Medtronic, BMW-Guide Wire (Guidant in das distale Nativgefäß und Vordilatation der Stenose mit einem 2,5/15-mm-Voyager-Ballon (Guidant und Implantation eines 18 mm langen Cypher®-Stents (Cordis auf einem 2,75-mm-Ballon mit 16 bar (Abb. 3. Bei

  6. Review: Holger Stoecker: Afrikawissenschaften in Berlin von 1919 bis 1945. Zur Geschichte und Topographie eines wissenschaftlichen Netzwerkes (2008 Buchbesprechung: Holger Stoecker: Afrikawissenschaften in Berlin von 1919 bis 1945. Zur Geschichte und Topographie eines wissenschaftlichen Netzwerkes

    Directory of Open Access Journals (Sweden)

    Katrin Bromber

    2009-05-01

    Full Text Available Review of the monograph: Holger Stoecker: Afrikawissenschaften in Berlin von 1919 bis 1945. Zur Geschichte und Topographie eines wissenschaftlichen Netzwerkes, Stuttgart: Franz Steiner Verlag 2008, ISBN 978-3-515-09161-9, 359 pages. Besprechung der Monographie: Holger Stoecker: Afrikawissenschaften in Berlin von 1919 bis 1945. Zur Geschichte und Topographie eines wissenschaftlichen Netzwerkes, Stuttgart: Franz Steiner Verlag 2008, ISBN 978-3-515-09161-9, 359 Seiten.

  7. Ossäre Regeneration eines experimentellen critical-size Defektes der Schweinekalotte durch ein biphasisches Knochenersatzmaterial mit lokalem Gentransfer - Einfluss einer biodegradierbaren PEG-Membran auf Ossifikation und Mineralisation

    OpenAIRE

    Kölpin, Felix

    2010-01-01

    Die eingeschränkte Regenerationsfähigkeit von critical size Defekten stellt besondere Anforderungen an alloplastische Knochenersatzmaterialien. Aus diesem Grund wurde in der vorliegenden Tierversuchsstudie ein biphasischer Knochenersatz aus Trikalziumphosphat, Hydroxylapatit und Polyethylenglycol(PEG) verwendet, um in Verbindung mit osteoinduktiven Substanzen eine zeitnahe knöcherne Defektregeneration zu vermitteln. Untersucht wurde am Schweineschädel der Einfluss der PEG Hydrogelmembran auf ...

  8. indICT - Ein neues Geschäftssystem für ICT-Dienstleister : Möglichkeiten und Potentiale eines ICT-Managements nach industriellen Massstäben

    OpenAIRE

    Pilgram, Uwe; Vogedes, Alexander

    2012-01-01

    ICT-Dienstleistungen sind ein zentraler Bestandteil der Unterstützung von Geschäftsprozessen bis hin zu deren kompletter Abwicklung. Selbst bei einem geringen Anteil an den Gesamtkosten, haben ICT-Dienstleistungen eine unternehmenskritische Bedeutung. Die Akzeptanz der ICT-Organisationen entspricht allerdings häufig nicht der Bedeutung ihrer Dienstleistungen. Analysen der Akzeptanz von ICT-Organisationen zeigt, dass im Management der Leistungsbeziehung zwischen ihnen und ihren Kunden erheb...

  9. Die Wirkung eines Lipidsenkers bzw. eines Lipidsenkers in Kombination mit einem Hormonpräparat auf den Fettstoffwechsel und auf die Gefäße bei Behandlungen von Frauen in der Postmenopause

    OpenAIRE

    Müller, Susanne Elisabeth

    2008-01-01

    Einleitung: Prämenopausale Frauen erfahren eine östrogeninduzierte Kardioprotektion. Nach der Menopause ist ein Anstieg der Inzidenz kardiovaskulärer Erkrankungen auffällig. Die Hormonersatztherapie (HET) mit konjugierten equinen Östrogenen + Medroxyprogesteronacetat (MPA) zeigte in großen Anwendungsstudien keinen sekundärprophylaktischen Effekt. Für Statine ist die Wirksamkeit in der Primär- als auch Sekundärprophylaxe der koronaren Herzerkrankung (KHK) bekannt. In dieser Studie wurde ei...

  10. PORPUS: Ein kurzer, alltagstauglicher und valider Lebensqualitätsfragebogen zur Erfassung prostataspezifischer Symptome

    Directory of Open Access Journals (Sweden)

    Waldmann A

    2011-01-01

    Full Text Available Einleitung: Bis Sommer 2009 existierte im deutschen Sprachraum zur Erfassung der prostataspezifischen Lebensqualität bei Patienten mit Prostatakarzinom (PCa nur ein validiertes Messinstrument (PSM; seit Sommer 2009 auch EORTC QLQ-PR25. Nach einer Übersetzung der englischen Version des PORPUS sollten die psychometrischen Eigenschaften der deutschen Version getestet werden. Material und Methoden: Veränderungssensitivität und Validität wurden anhand von Daten aus der San-BKK- (Allgemeinbevölkerung; ein Messzeitpunkt [MZP], der CHEDY- (Männer mit erektiler Dysfunktion; ein MZP und der ProCaSP-Studie (Männer mit lokal begrenztem PCa; 5 MZP überprüft. In allen Studien war die Lebensqualität die primäre Zielgröße. Zur Messung wurden u. a. der EORTC QLQC30, der EQ-5D sowie der PORPUS-P eingesetzt. Ergebnisse: 988 Männer der Allgemeinbevölkerung (mittleres Alter 56 Jahre, 87 PCa-Patienten mit Radiotherapie (67 Jahre, 274 PCa-Patienten mit radikaler Prostatektomie (63 Jahre und 48 Männer mit erektiler Dysfunktion (58 Jahre bilden die Datenbasis. Korrelationen der LQ-Skalen zeigen eine gute Konvergenzvalidität an (PORPUS-P vs. EORTC QLQ-C30 global health, EQ-5D VAS und Indexwert; Spannweite rs = 0,518– 0,630; je p 0,001. Außerdem diskriminiert PORPUS-P zwischen Altersgruppen, Gesundheitszuständen und Bevölkerungsschichten. Die Veränderungssensitivität wird durch die Antwortverteilung in der Allgemeinbevölkerung und den zeitlichen Verlauf von PORPUS-P-Werten im Kollektiv der PCa-Patienten angezeigt. Im Mittel werden rund 3,5 Minuten zum Ausfüllen des PORPUS (10 Fragen benötigt. Schlussfolgerungen: Der PORPUS ist ein weiteres valides Instrument zur Erfassung prostataspezifischer Symptome in deutscher Sprache. Der entscheidende Vorteil liegt in der Kürze, die eine gute Patientenakzeptanz und Praxistauglichkeit ermöglicht.

  11. Josef Umlauf - bedingt gesprächsbereit : das Wirken eines Planers im Nationalsozialismus und in der jungen Bundesrepublik im Spiegel zeitgenössischer Dokumente ; ein Rekonstruktionsversuch

    OpenAIRE

    Zakrzewski, Philipp

    2008-01-01

    Josef Umlauf war ein typischer Vertreter des – im eigenen Selbstverständnis – objektiv und unpolitisch eingestellten Fachmanns, der jedoch zu Zugeständnissen gegenüber den politischen Zielen des Nationalsozialismus bereit gewesen ist und damit Verletzungen der Objektivität und Humanität in Kauf genommen hat. Umlauf war Teil einer bundesrepublikanischen Planerelite, die ihre gemeinsamen Erfahrungen aus der NS-Zeit verband und die in Netzwerken wie der Akademie für Raumforschung ...

  12. Flowdrill screw connections - a new fastening method for brake and fuel lines; Fliessformschrauben - ein neues Befestigungsverfahren fuer Brems- und Kraftstoffleitungen

    Energy Technology Data Exchange (ETDEWEB)

    Hilgert, T.; Huehnert, T. [Opel (A.) AG, Ruesselsheim (Germany)

    2000-02-01

    In the automobile industry, the demands made on productivity, process reliability and the optimisation of the working conditions of the employees are increasing constantly. Prefabricated modules, freely programmable screw connection systems and fully automatic assembly of the brake and fuel lines via an innovative fastening method are the key to meeting these demands. This article presents flowdrill screw connection using the example of the Opel Astra, for which this method is being used in the industrial-scale manufacture of automobiles for the first time. (orig.) [German] In der Automobilindustrie wachsen staendig die Anforderungen an eine hoehere Produktivitaet, groessere Prozesssicherheit und weiter zu optimierende Arbeitsbedingungen der dort Beschaeftigten. Vorgefertigte Module, frei programmierbare Schraubsysteme und eine vollautomatische Montage der Brems- und Kraftstoffleitungen durch ein neuartiges Befestigungsverfahren sind ein Schluessel dazu. In diesem Beitrag wird das erstmals in der Automobil-Grossserienfertigung praktizierte Fliessformschrauben am Opel Astra vorgestellt. (orig.)

  13. [Anja Wilhelmi. Lebensweltlen von Frauen der deutschen Oberschicht im Baltikum (1800-1939). Eine Untersuchung anhand von Autobiographien] / Alexander Ewig

    Index Scriptorium Estoniae

    Ewig, Alexander, 1980-

    2011-01-01

    Arvustus: Wilhelmi, Anja. Lebenswelten von Frauen der deutschen Oberschicht im Baltikum (1800-1939). Eine Untersuchung anhand von Autobiographien. (Veröffentlichungen des Nordost-Instituts, 10.) (Wiesbaden : HArrassowitz 2008)

  14. [Sven Jüngerkes. Deutsche Besatzungsverwaltung in Lettland 1941-1945. Eine Kommunikations- und Kulturgeschichte nationalsozialistischer Organisationen] / Toomas Hiio

    Index Scriptorium Estoniae

    Hiio, Toomas, 1965-

    2012-01-01

    Arvustus: Jüngerkes, Sven.Deutsche Besatzungsverwaltung in Lettland 1941-1945. Eine Kommunikations- und Kulturgeschichte nationalsozialistischer Organisationen (Historische Kulturwissenschaft, 15). (Konstanz: UVK Verlagsgesellschaft mbH, 2010)

  15. MAGIC: an integrated concept for diagnosis management and operator support; MAGIC: Ein integriertes Konzept zum Diagnosemanagement und Operator Support

    Energy Technology Data Exchange (ETDEWEB)

    Koeppen-Seliger, B.; Marcu, T. [Duisburg Univ. (Gesamthochschule) (Germany). Lehrstuhl Automatisierungstechnik und Komplexe Systeme; Capobianco, M. [SATE-Systems and Advanced Technologies, Venezia (Italy); Gentil, S. [Institut National Polytechnique de Grenoble, 38 - Saint-Martin-d' Heres (France). Lab. d' Automatique de Grenoble; Albert, M. [Karlsruhe Univ. (T.H.) (Germany). Inst. fuer Prozessrechentechnik, Automation und Robotik; Latzel, S. [SMS Demag AG, Elektrik und Automation, Hilchenbach (Germany). Warmwalzwerke

    2003-07-01

    In this contribution a European research project funded by the European Commission in the framework of the IST programme is introduced. The goal is to present the basic concepts, innovations and solutions of the project 'Multi-Agents-based Diagnostic Data Acquisition and Management in Complex Systems (MAGIC)'. MAGIC is based on a multi-level-multi-agents architecture which integrates all levels necessary for a comprehensive diagnosis into a diagnostic system. A wide range of industrial applications is envisaged. (orig.) [German] In diesem Beitrag wird ein von der Europaeischen Kommission gefoerdertes Forschungsprojekt im Rahmen des IST Programms vorgestellt. Das Ziel ist die Praesentation der Grundkonzepte, Innovationen und Loesungen des Projektes 'Multi-Agents-based Diagnostic Data Acquisition and Management in Complex Systems' (MAGIC). MAGIC basiert auf einer Multi-Agenten Architektur, welche alle notwendigen Ebenen fuer eine umfassende Diagnose in ein Diagnosesystem integriert. Eine weite Spanne industrieller Anwendungen wurde dabei ins Auge gefasst. (orig.)

  16. Vom Gewohnheitstier zur reflektierten Nutzung – Ein Diskussionsanstoß über Betriebssysteme und Programmnutzung nachzudenken

    Directory of Open Access Journals (Sweden)

    Christian Berger

    2010-06-01

    Full Text Available Das Nutzungsverhalten bei digitalen Medien entspringt mehr der Gewohnheit als dem vorhandenen Angebot. Ein kleiner Einblick in die Philosophie und Möglichkeiten der Nutzung von Freier Software.

  17. Wirksamkeit und Verträglichkeit von Mepartricin (Iperplasin® bei benigner Prostatahyperplasie: Ergebnisse eine Anwendungsbeobachtung

    Directory of Open Access Journals (Sweden)

    Madersbacher H

    2000-01-01

    Full Text Available Ziel der Studie: Das Ziel dieser Anwendungsbeobachtung war es, Wirksamkeit und Verträglichkeit von Mepartricin-Filmtabletten (Iperplasin® bei der Behandlung von Patienten mit benigner Prostatahyperplasie (BPH bzw. Prostatavergrößerung (BPE zu untersuchen. Patienten und Methoden: Im Rahmen einer österreichweiten Anwendungsbeobachtung wurden Patienten mit unterer Harntraktsymptomatik (LUTS, verursacht durch eine BPH/BPE, untersucht. Die wichtigsten Einschlußkriterien waren eine reduzierte maximale Harnflußrate (Qmax von 6-15 ml/sec und ein Restharn 100 ml. Als Studienmedikation erhielten die Patienten 3 x 1 Tbl. Iperplasin®. Ein, drei und sechs Monate nach Studienbeginn wurden die Patienten nachkontrolliert. Die wichtigsten Zielparameter waren eine Verbesserung des Internationalen Prostata Symptomen Scores (IPSS, der Lebensqualitätsfrage des IPSS (IPSS-Ql sowie des Qmax. Ein Einfluß auf die Sexualität wurde anhand des GRISS-Scores erhoben. Ergebnisse: Insgesamt wurden 130 Patienten (67,4 ± 8,4 Jahre; Durchschnitt ± Standardabweichung in diese Studie aufgenommen. Der IPSS sank von 16,4 ± 5,0 zu Studienbeginn auf 9,4 ± 6,0 (-41 %; p 0,0001 nach 6 Monaten Therapie, der IPSS-Ql von 3,3 ± 0,8 auf 2,0 ± 1,1 (-39 %; p 0,0001. Im gleichen Zeitraum stieg der Qmax von 11,3 ± 6,0 auf 12,5 ± 6,4 ml/sec (+11 %; p 0,0001, der Restharn sank von 49 ± 36 ml auf 33 ± 35 ml (-33 %; p 0,0001. Insgesamt war die Therapie mit Iperplasin® gut verträglich, bei 10 % traten im Rahmen der Studie unerwünschte Ereignisse oder interkurrente Erkrankungen auf, bei zwei Patienten mußte eine TURP durchgeführt werden. Der GRISS-Score blieb über den gesamten Studienzeitraum konstant. Schlußfolgerung: Diese Anwendungsbeobachtung belegt die Sicherheit von Iperplasin® bei Patienten mit LUTS und BPH/BPE, vor allem kommt zu keiner Beeinträchtigung der Vita sexualis. Obwohl eine signifikante Verbesserung von subjektiven und objektiven Parametern in dieser

  18. Beurteilung biochemischer Stoffwechselaktivitäten eines hybriden Leberunterstützungssystems während erster klinischer Anwendungen

    OpenAIRE

    Mundt, Adrian Phillip

    2002-01-01

    Ziel der Arbeit ist die Beurteilung der biochemischen Stoffwechselaktivität eines hybriden, extrakorporalen Leberunterstützungssystems während initialer therapeutischer Anwendungen. Das System basiert auf der Nutzung porciner Hepatozyten, die in einem Bioreaktor kultiviert werden. Acht Patienten in akutem Leberversagen, Komagrad III-IV, wurden unter kontinuierlicher Plasmaseparation mit dem System behandelt. Es wird ein Modell zur Bestimmung der Netto-Stoffwechselbilanz des Bioreaktors vorg...

  19. Korrektur des Exophthalmus bei Morbus Basedow assoziierter Ophthalmopathie durch en bloc Teilresektion der lateralen und inferioren Orbitawand : eine klinische Untersuchung

    OpenAIRE

    Santo, Gregor

    2008-01-01

    Im Rahmen der Autoimmunthyreoiditis vom Typ Basedow kommt es in fast der Hälfte der Fälle zu einer klinisch relevanten Mitbeteiligung der Augen im Sinne einer endokrinen Orbitopathie. Autoantikörper verursachen in der Orbita eine entzündliche Reaktion, die eine Bindegewebsvermehrung nach sich zieht. Das expandierende Retrobulbärgewebe führt zu einem stigmatisierenden Exophthalmus. Die endokrine Ophthalmopathie kann mit konservativen Therapieansätzen bestenfalls in ihrer Progression gestopp...

  20. Bedeutung, Ansätze und organisatorische Verankerungen von Employer und Behavioral Branding in Unternehmen: Eine explorative empirische Untersuchung

    OpenAIRE

    Kalka, Regine; Lux, Dorothee

    2010-01-01

    Die Mitarbeiter tragen entscheidend zum Erfolg eines Unternehmens bei. Doch die passenden Mitarbeiter zu finden und diese über einen langen Zeitraum zu binden, ist nicht leicht. Der Wettbewerb auf dem Arbeitsmarkt wird zunehmend härter, die Vorstellungen der potenziellen Bewerber von ihrem idealen Arbeitgeber werden immer konkreter. In der Theorie greift hier das Employer Branding. Ein Konzept zum Aufbau einer Arbeitgebermarke, die es Unternehmen ermöglicht, die besten unter den passenden Mit...

  1. Klimazonierung von Georgien : Dokumentation und Kritik bestehender Klimaklassifikationen anhand von langjährigen Klimadaten und mittels eines Geographischen Informationssystems

    OpenAIRE

    Schäfer, Michael Christian

    2003-01-01

    Im Mittelpunkt der Arbeit steht die Klimazonierung des südkaukasischen Staates Georgien. Basierend auf Klimadaten von 1961 bis 1990 für 101 Klimastationen wird innerhalb eines Geographischen Informationssystems (GIS) die räumliche Temperatur- und Niederschlagsverteilung berechnet und eine Klimazonierung durchgeführt. Bestehende Klimazonierungen und Klimaklassifikationen werden dokumentiert und verglichen. In Georgien treten mit einer Staatsfläche von 69.700 km² auf kleinem Raum viele unt...

  2. Untersuchung zur Realisierung selbstgesteuerten Lernens im naturwissenschaftlichen Unterricht : eine Studie zum computergestützten Mind Mapping im Unterricht

    OpenAIRE

    Neumann, Anja

    2007-01-01

    In der vorliegenden Arbeit wird der Frage nachgegangen, ob selbstgesteuertes ressourcenbasiertes Lernen im naturwissenschaftlichen Kontext durch Mind Mapping unterstützt werden kann. Eingesetzt wird dabei mit dem Computerprogramm "Mind Manager" ein Visualisierungswerkzeug, das u. a. persönliches Wissensmanagement unterstützen kann. Die Arbeit zeigt eine Forschungsreihe auf, welche von der Evaluierung des Programms in verschiedenen Klassenstufen bis hin zu einer Hauptuntersuchung reicht, die d...

  3. Der lange Weg zur Verbesserung der Unterrichtsqualität. Ein Rückblick auf die Interventionsstudie APU

    OpenAIRE

    Eberle, F; S. Schumann; Oepke, M; Müller, C; Pflüger, M.; Hesske, S; Marti, C; Haefelin, M; Blum, R

    2009-01-01

    Mit der in der Zeit von August 2006 bis Februar 2008 an sieben schweizerischen Gymnasien vorgenommenen Implementation des anwendungs- und problemorientierten Unterrichts (APU) war die Absicht vebunden, über eine Orientierung an elf Unterrichtsleitlinien kognitive und nichtkognitive Bildungsziele in den Fächern «Wirtschaft und Recht» und «Geografie» gleichermassen zu fördern. Die empirischen Analysen zeigen, dass eine Anlaufphase von zwölf Monaten notwendig war, bevor erste intendierte Effekte...

  4. Entwicklung von Benchmarks für die Umweltleistung innerhalb der Maschinenbaubranche - Eine Benchmarkingstudie im Auftrag der SIEMENS AG

    OpenAIRE

    Becker, Simon; Kornek, Sascha; Kreutzfeldt, Claudia; Opitz, Sebastian; Richter, Lars; Ulmschneider, Maik; Werner, Anja

    2004-01-01

    Die vorliegende Arbeit hat das Ziel, ökologische Benchmarks zur Bestimmung der Umweltleistung am Fallbeispiel der SIEMENS AG zu entwickeln. Anhand generierter Indikatoren ist die Umweltleistung im Rahmen eines Öko-Benchmarking nicht nur darstellbar, sondern auch verbesserbar. Das Instrument Benchmarking wird daher einleitend theoretisch beleuchtet und von anderen Instrumenten wie Ranking oder Rating abgegrenzt. Grundsätze für die erfolgreiche Durchführung eines Öko-Benchmarking werden erörter...

  5. Ein modulares Simulationskonzept zur Evaluierung von Positionssensoren sowie Filter- und Regelalgorithmen am Beispiel des automatisierten Straßenbaus

    OpenAIRE

    Beetz, Alexander

    2012-01-01

    Im Bereich des automatisierten Straßenbaus gab es in den letzten Jahren sehr große Fortschritte, sodass auf großen Autobahnbaustellen schon vielfach automatisierte Baumaschinen eingesetzt werden. Bei diesen Maschinen findet hauptsächlich nur eine automatische Höhenregelung der Werkzeuge statt. Eine vollständige automatische Steuerung von Lage und Höhe des Fahrzeuges und Werkzeuges ist nur bei langsam fahrenden Baumaschinen, wie z.B. bei Asphaltfertigern und Randsteinfertigern, umgesetzt. Der ...

  6. Die Auswirkungen Ketamin-basierter Narkoseprotokolle auf den intraokularen Druck bei der Katze – eine prospektive randomisierte Blindstudie

    OpenAIRE

    McIntosh, Jenny

    2013-01-01

    Der Einsatz von Ketamin erfolgt in der Humananästhesie, vor allem aufgrund seiner vielfältigen Nebenwirkungen, nur noch nach strenger Indikation. In der Veterinärmedizin ist Ketamin tierartenübergreifend für die Injektionsnarkose weit verbreitet. Um den bekannten Nebenwirkungen vorzubeugen, wird Ketamin mit verschiedenen anderen Anästhetika kombiniert und stellt so ein sicheres Narkoseverfahren bei Tieren dar. Eine besondere Herausforderung ist die Anästhesie bei ophthalmologischen Patienten ...

  7. Ein neuer Algorithmus für die quantifizierte Aussagenlogik, basierend auf Zero-suppressed BDDs und Memoization

    OpenAIRE

    Ghasemzadeh, Mohammad

    2006-01-01

    In der Dissertation stellen wir einen neuen Algorithmus vor, welcher Formeln der quantifizierten Aussagenlogik (engl. Quantified Boolean formula, kurz QBF) löst. QBFs sind eine Erweiterung der klassischen Aussagenlogik um die Quantifizierung über aussagenlogische Variablen. Die quantifizierte Aussagenlogik ist dabei eine konservative Erweiterung der Aussagenlogik, d.h. es können nicht mehr Theoreme nachgewiesen werden als in der gewöhnlichen Aussagenlogik. Der Vorteil der Verwendung von QBFs ...

  8. KaViDo - Ein web-basiertes System für kooperative Forschungs- und Entwicklungsprozesse

    OpenAIRE

    Taminé, Oliver; Dillmann, Rüdiger

    2016-01-01

    Im folgenden wird ein web-basiertes System namens KaViDo für die kollaborative Forschung und Entwicklung vorgestellt. Nach der Erläuterung, weshalb Bedarf für ein solches System besteht, wird dessen Aufbau geschildert. Im Detail werden die drei Schichten (Präsentationsschicht, Entwicklungsschicht und Persistenzschicht) vorgestellt. Die Zielsetzungen des KaViDo-Systems sind die Aufzeichnung der Entwicklungsprozesse, das Verwalten der Kompetenzen der verteilten Experten, der Austausch von Entwi...

  9. Störung der Demokratie: der Europäische Gerichtshof engt den Spielraum der Regierungen ein

    OpenAIRE

    Höpner, M.

    2009-01-01

    Der Europäische Gerichtshof greift zunehmend in Rechtsbestände ein, die eigentlich in den Zuständigkeitsbereich der Mitgliedstaaten fallen. Neben die politische Integration durch Vertragsschlüsse und Richtlinien hat sich eine „Integration durch Recht“ geschoben, die zunehmend an politischer Brisanz gewinnt. Der Handlungsspielraum auf nationaler Ebene wird eingeschränkt, ohne dass auf kurze bis mittlere Sicht neue Gestaltungsoptionen marktkorrigierender Politik auf europäischer Ebene eröffnet ...

  10. Kinder depressiver und psychiatrisch unauffälliger Eltern in der Kinder- und Jugendpsychiatrie - eine vergleichende Studie

    OpenAIRE

    Krohn, Lucia; Deneke, Christiane; Wiegand-Grefe, Silke

    2008-01-01

    Die vorliegende Arbeit untersucht die pathogenethischen Auswirkungen elterlicher Depressionen auf die Kinder und Jugendlichen in den Familien. Dazu werden insgesamt 100 kinder- und jugendpsychiatrische Patienten 2 der Klinik für Psychiatrie und Psychotherapie des Kindes- und Jugendalters am Universitätsklinikum Hamburg-Eppendorf (UKE) untersucht. Eine Untersuchungsgruppe von 50 Kindern und Jugendlichen, von denen mindestens ein Elternteil depressiv erkrankt ist, wird einer parallelisierten V...

  11. Laser-SNMS-Analysen an Aerosol-Partikeln mit Hilfe eines neu implementierten VUV-Excimer-Lasersystems zur Einphotonenionisierung

    OpenAIRE

    Dambach, S

    2009-01-01

    Im Rahmen dieser Arbeit wurde für Laser-SNMS-Analysen ein VUV-Excimer-Lasersystem an ein bestehendes Flugzeitmassenspektrometer implementiert. Mit der nun für den nicht-resonanten Nachionisierungsprozess zur Verfügung stehenden Photonenenergie von 7,9 eV lassen sich 2/3 der Elemente des Periodensystems im Einphotonenprozess ionisieren. Die Analysen an Modellsystemen polyzyklischer aromatischer Kohlenwasserstoffe (PAK) führten aufgrund der Einphotonenionisierung zu deutlich...

  12. Ein bunter Hund, die tool-box und lipstick lesbians A Sore Thumb, the Tool-Box, and Lipstick Lesbians

    OpenAIRE

    Ruben Marc Hackler

    2007-01-01

    Sara Mills legt eine Einführung in die Diskursanalyse vor, die durch ihre Ausrichtung am Forschungsprozess und ihr Interesse an der Vielzahl von Diskursen überzeugt. Aus dem Wald von Einführungen ragt sie heraus durch ihre Konzentration auf gesellschaftskritische Fragen, wie sie unter anderem vom Feminismus aufgeworfen wurden, und vertritt ein engagiertes Wissenschaftsverständnis.Sara Mills presents an introduction to discourse analysis made convincing through her concentration on the researc...

  13. Biomechanisch-kinemetrische Bewegungsanalyse und Ansätze zur Bewegungssteuerung für ein Training im Wellenreiten

    OpenAIRE

    Matschkur, Tina

    2008-01-01

    Neben der biomechanisch-kinemetrischen Bewegungsanalyse einzelner ausgewählter Techniken im Wellenreiten beschäftigt sich diese Dissertation auch ansatzweise im Rahmen einer elektromyographischen Fallstudie mit der muskulären Koordination bei der Bewegungsausführung im Surfen, um daraus Schlussfolgerungen für das Training im Wellenreiten treffen zu können. Ein geschichtlicher und wissenschaftlicher Überblick über das Wellenreiten leitet das Thema ein und macht somit auf die besondere Ausgangs...

  14. Faszinierende Physik ein bebilderter Streifzug vom Universum bis in die Welt der Elementarteilchen

    CERN Document Server

    Bahr, Benjamin; Riebe, Kristin

    2013-01-01

    Von den Rätseln der Quantenwelt bis zum Polarlicht - von Schwarzen Löchern bis zum GPS-System -von Teilchenbeschleunigern, dem Higgs und der Supersymmetrie bis zum Foucaultschen Pendel – dieses Buch bietet einen packenden Streifzug durch die spannendsten und aktuellsten Themen der modernen Physik! Auf jeweils einer Doppelseite wird dem Leser dabei mit vielen Bildern ein kompakter und klar verständlicher Einstieg in jeweils ein Thema und den Stand der Forschung geboten – und so insgesamt etwa 140 verschiedene Themen beleuchtet und jedes treffend erläutert. Dabei liegt die besondere Stärke des Buches in der klaren Sprache und den Erklärungen, die nahezu ganz ohne Formeln auskommen – begleitet von atemberaubenden und weltweit eingeholten Bildern renommierter Forscher und Institute, die uns die Schönheit unserer Welt vor Augen führen.

  15. „Es ist ein Kick, den man befriedigen muss!“

    Directory of Open Access Journals (Sweden)

    Katharina Piechocki

    2004-07-01

    Full Text Available Der Band Jugend, Mode, Geschlecht. Die Inszenierung des Körpers in der Konsumkultur ist das Ergebnis qualitativer Feldstudien, die im Rahmen eines „interdisziplinären Seminars mit dem Titel ‚Jugendmode und Geschlechterkonstruktion‘ an der Erziehungswissenschaftlichen Fakultät der Universität zu Köln“ (S. 221 von Studierenden durchgeführt wurde. Bei den interviewten Kindern und Jugendlichen handelt es sich um „Mainstream“-Jugendliche und nicht um spezifische Jugendgruppen. Das Buch ist in vier thematische Kapitel gegliedert: „S-HE Mades“, „Angezogen: Fashion Mades“, „Anverleibt: Body Mades“ und „Angesehen: Media Mades“. Ein theoretisch orientiertes Kapitel mit Beiträgen von Wissenschaftlern aus den Bereichen Jugendkultur, Modedesign, Geschlechterforschung und Cultural Studies schließt diesen Band ab.

  16. Einführung in die hochschul-lehre ein didaktik-coach

    CERN Document Server

    Boss-Ostendorf, Andreas

    2010-01-01

    Mit diesem Coach in Buchform bekommen Hochschullehrende Unterstützung bei der Entfaltung ihrer eigenen Lehrkompetenz. In vier Schritten vermitteln die Autoren zentrale didaktische Fähigkeiten. Auf der Grundlage einer Lehre, die sich am Lernen der Studierenden orientiert, hilft der Didaktik-Coach dabei, elementare Fertigkeiten auszubilden: die eigene Kontaktfähigkeit weiter zu entfalten, ein von der Gehirnforschung gestütztes Lernverständnis zu entwickeln, sich mit Hilfe gruppenanalytischer Erkenntnisse sicher in Seminaren zu bewegen und schließlich eine Methodenkompetenz zu erwerben, die deshalb effizient ist, weil sie sich an den Bedürfnissen der Lerngruppe orientiert. Die Autoren sind ausgewiesene Fachleute für Coaching und Beratung im Hochschulbereich. Methoden für die professionelle Lehre an Hochschulen: So macht die Lehre Freude!

  17. The framework directive on water policy - an overview; Die EU-Wasserrahmenrichtlinie - ein Ueberblick

    Energy Technology Data Exchange (ETDEWEB)

    Brockett, S. [European Commission, Brussels (Belgium). Directorate General XI

    2000-11-01

    The increasing demand by citizens and environmental organizations for cleaner rivers and lakes, groundwater and coastal beaches is evident. A thorough restructuring of European Water Policy is in progress, and the new Water Framework Directive will be the main operational tool, setting the objectives for water protection well into the next century. The following will provide an overview on development, present state and future of European Water Policy. (orig.) [German] Die zunehmende Forderungen von Buergern und Umweltorganisationen in Bezug auf sauberere Fluesse und Seen, Grundwasser und Kuestenstraende sind offensichtlich. Eine gruendliche Umstrukturierung der europaeischen Wasserpolitik ist angelaufen und die neue Wasserrahmenrichtlinie wird das wichtigste operative Instrument sein, um die Ziele des Wasserschutzes bis ins naechste Jahrhundert festzulegen. Im Folgenden soll ein Ueberblick ueber die Entwicklung, den derzeitigen Stand und die Perspektiven der europaeischen Wasser Politik gegeben werden. (orig.)

  18. Touristification in Berlin. Ein Bericht zur Workshop-Reihe des Vereins Kritische Geographie Berlin

    Directory of Open Access Journals (Sweden)

    Kritische Geographie Berlin

    2014-05-01

    Full Text Available Die Gruppe Kritische Geographie Berlin beschäftigt sich seit Längerem mit Phänomenen, Ursachen, Akteuren und Wirkungsweisen des neuen touristischen Interesses an Berliner ‚Trend-Bezirken’ wie etwa Mitte, Friedrichshain-Kreuzberg und den nördlichen Teilen Neuköllns. Nachdem zunächst in mehreren Diskussionen und internen Workshops ein Überblick über das Thema und einzelne Facetten jener ‚Touristifizierung der Stadt’ erarbeitet wurde, folgte in den Jahren 2012/13 eine öffentliche Workshop-Reihe. Hier wurde der Versuch unternommen, in einer strukturierten Annäherung an unterschiedliche Dimensionen der ‚Touristification’ diese in ihrem komplexen Charakter lesbarer zu machen und sich über Fragen der Analyse und Bewertung, aber auch zu möglichen Interventionen und Initiativen auszutauschen.

  19. Ein umfassendes Standardwerk der Väterforschung A Comprehensive Standard Work on Fatherhood Studies

    Directory of Open Access Journals (Sweden)

    Martin Textor

    2004-11-01

    Full Text Available In dem umfangreichen Band wird in 23 Kapiteln ein detaillierter Überblick über die deutschsprachige Väterforschung geboten, wobei selbstverständlich die in anderen Ländern gesammelten Erkenntnisse berücksichtigt werden. Alle relevanten Wissenschaftsdisziplinen sind mit Beiträgen vertreten. Die einzelnen Aufsätze sind entweder eher theoretisch ausgerichtet, enthalten Literaturübersichten oder stellen empirische Untersuchungen vor. Der Sammelband präsentiert somit eine Gesamtschau des Forschungsstandes.In its 23 chapters, this extensive volume offers a detailed overview of German-language fatherhood research, whereby findings collected in other countries are, of course, recognized. All relevant academic disciplines are represented with contributions. The individual essays are either theoretically oriented, contain surveys of literature, or present empirical examinations. The collection thus presents a consummate digest of the current state of research.

  20. Zur Aktualität der Etikettierungsperspektive als Ideologiekritik. Ein Beitrag zur Debatte um kritische Polizeiforschung

    Directory of Open Access Journals (Sweden)

    Helga Cremer-Schäfer

    2014-10-01

    Full Text Available Zu kritischer Institutionenforschung gehört, über die Herrschaftsfunktionen von gesellschaftlichen Institutionen, ihrer Organisationen (Apparate/Instanzen und die von ihnen verwalteten und angewendeten Kategorisierungen aufzuklären. Mit der Anwendung des Etiketts ,Verbrechen‘ beteiligt sich die Polizei als eine Instanz an der Institution ,Verbrechen und Strafe‘, das heißt an legitimierter sozialer Ausschließung (Zuarbeit zu Bestrafung, Inszenierung von Bedrohungsszenarien, Verwaltung der Paria-Bevölkerung. Zu kritischer Polizeiforschung gehört daher auch ein Dauer-Monitoring polizeilich betriebener ,Kriminalisierung‘ von Konflikten, Lebensweisen, Ärgernissen und Lebenskatastrophen. Einen theoretischen Rahmen bieten Etikettierungstheorien und Ideologiekritik. Positiv gewendet: Im Verbund mit kritischer Alltags- und Kulturforschung kann kritische Polizeiforschung zudem für die intellektuelle Verstehbarkeit kriminalisierter Konflikte und Lebensweisen sorgen und damit für die Wiederaneignung von Konflikten.

  1. Mobile Business - Schaffung eines Bewusstseins für mobile Potenziale im Geschäftsprozesskontext

    OpenAIRE

    Scherz, Marian

    2008-01-01

    Ziel dieser Arbeit ist, den ganzheitlichen Nutzen der mobilen Informations- und Kommunikationssysteme zu erklären und aufzuzeigen wie die vorhandene Potenziale in Geschäftsprozesse integriert werden können, um diese effizienter und effektiver zu gestalten. Damit Mobile Business im Rahmen von Prozessverbesserungen oder Business Process Engineering gezielt anwendbar wird, müssen die Effekte und Potenziale identifiziert und kategorisiert werden. Der Wert eines einzelnen Geschäftsprozesses zur mo...

  2. Konzeption und Entwicklung eines synchronen Kommunikationssystems für die verteilte Produktentwicklung

    OpenAIRE

    Tippmann, Volker

    2009-01-01

    Ziel dieser Arbeit war es, auf der Grundlage einer detaillierten Anforderungserhebung ein synchrones Kommunikations- und Kooperationssystem zu entwickeln, das erweiterbare Basistechnologien zur Verfügung stellt. Dabei wurden für die Zusammenarbeit in der Produktentwicklung spezifische Werkzeuge prototypisch implementiert und unter Gesichtspunkten der Benutzerfreundlichkeit evaluiert. Die in der Forschung zum Thema Collaborative Virtual Environments (CVE) häufig verwendete Raummetapher wurd...

  3. Biotechnologie-Gründungen im Ruhrgebiet – Eine vergleichende Analyse

    OpenAIRE

    Engel, Dirk; Heneric, Oliver

    2005-01-01

    *Auch im Ruhrgebiet sind Anzeichen einer regionalen Häufung von Biotechnologie-Gründern zu beobachten. *In qualitativer Hinsicht ist das Ruhrgebiet wenig attraktiv für Gründer aus anderen Regionen und solchen mit hohem Innovationspotenzial. *Das Ruhrgebiet hat bisher keine einzige Risikokapital-finanzierte Biotechnologie-Gründung. Deutschlandweit hingegen wird Risikokapital von jeder fünften Biotechnologie-Gründung genutzt. Die bayerischen Biotechnologie-Regionen spielen dabei eine Vorreiterr...

  4. Thermographie zur Temperaturmessung beim Laser-Sintern – ein Beitrag zur Qualitätssicherung?

    OpenAIRE

    Wegner, Andreas; Witt, Gerd

    2011-01-01

    Beim Laser-Sintern wird das Pulverbett durch Heizstrahler vorgeheizt, um an der Pulveroberfläche eine Temperatur knapp unterhalb des Materialschmelzpunktes zu erzielen. Dabei soll die Temperaturverteilung auf der Oberfläche möglichst homogen sein, um gleiche Bauteileigenschaften im gesamten Bauraum zu erzielen und den Bauteilverzug gering zu halten. Erfahrungen zeigen jedoch sehr inhomogene Temperaturverteilungen, weshalb oftmals die Integration von neuen oder optimierten Prozessüberwachungs...

  5. Ursachen für eine mangelnde Reproduzierbarkeit beim Laser-Sintern von Kunststoffbauteilen

    OpenAIRE

    Wegner, Andreas; Witt, Gerd

    2013-01-01

    Das Laser-Sintern hat sich in den letzten Jahren zunehmend als Kleinserienfertigungsverfahren für Kunststoffbauteile etabliert. Dennoch entspricht die Bauteilqualität aufgrund von Verzug oder mangelnder Reproduzierbarkeit der Eigenschaften oftmals nicht den Anforderungen. Ein Grund hierfür ist die inhomogene Temperaturführung während des Prozesses. So ergeben sich aufgrund einer inhomogenen Temperaturverteilung auf der Pulverbettoberfläche sowie durch unterschiedliche Abkühlgeschwindigkeiten ...

  6. Determinanten herkunftsspezifischer Kriminalitätsraten in der Schweiz. Eine Analyse der polizeiliche Kriminalstatistik

    OpenAIRE

    Jann, Ben

    2013-01-01

    Im Rahmen von Abstimmungskampagnen zu Migrationsfragen wurde in der schweizerischen Presse und in politischen Diskussionen wiederholt auf die vermeintlich divergierende Kriminalitätsrate zwischen Personen unterschiedlicher Staatszugehörigkeit hingewiesen. Die weit verbreitete Auffassung, dass "Ausländer" ein erhöhtes Kriminalitätspotenzial aufwiesen, wurde dabei kaum in Frage gestellt und zum Teil mit irreführenden Zahlen untermauert. Aus kriminologischen Untersuchungen ist jedoch bekannt, da...

  7. Der Jour fixe Bildungstheorie | Bildungspraxis. Eine Kooperation zwischen Erwachsenenbildung und Universität

    OpenAIRE

    Dausien, Bettina; Kellner, Wolfgang; Rothe, Daniela

    2016-01-01

    Die in Wien angesiedelte Veranstaltungsreihe „Jour fixe Bildungstheorie | Bildungspraxis“ ist eine Kooperation zwischen Erwachsenenbildung und Universität, in der das Theorie-Praxis-Verhältnis der Erwachsenenbildung als lebendiger Diskurs gepflegt wird. Im Zentrum der Diskussions- und Vortragsabende, ExpertInnengespräche und Workshops an vier bis fünf Terminen pro Semester stehen offener Austausch, Perspektivenwechsel, theoretische Reflexion und Kritik. Der Jour fixe, der vom Ring Österreichi...

  8. Erzählung und Reflexivität in der Handlungsforschung: Ein diskursiver Ansatz

    OpenAIRE

    Colombo, Monica

    2003-01-01

    In diesem Beitrag soll gezeigt werden, dass Erzählungen in unterschiedlichen Phasen des Forschungsprozesses reflexiv genutzt werden können, um zu verstehen, wie Handelnde ihre Sicht von Ereignissen konstruieren und ihrem eigenen Handeln Sinn verleihen. In der Handlungsforschung kommt der Intersubjektivität eine besondere Bedeutung zu, da in der Interaktion zwischen den Beteiligten (hierzu gehören auch die Forschenden) Versionen von Wissen produziert werden. In diesem Sinne kann Handlungsforsc...

  9. Friedliche Großveranstaltungen organisieren: das Beispiel eines Fußballspiels

    OpenAIRE

    Hylander, Ingrid; Granström, Kjell

    2010-01-01

    Gewalt in großen Menschenmengen ist ein Thema, für das sich die Sozialpsychologie seit Langem interessiert, und das auch für die Sportpsychologie von Belang ist (STOTT, ADANG, LIVINGSTONE & SCHREIBER 2007; STOTT, HUTCHINSON & DRURY 2001; RUSSELL 2004; MUSTONEN, ARMS & RUSSELL 1996). Die Entstehung von Krawallen wurden aus unterschiedlichen theoretischen Perspektiven heraus erklärt (HYLANDER 2008), z.B. im Sinn individueller Differenzen, als Deindividuations-Phänomen (PRENTICE-DUNN & ROGERS 1...

  10. Bewegungsbeobachtung und Bewegungsbeurteilung im Tanz : eine Explorationsstudie unter besonderer Berücksichtigung des Blickverhaltens.

    OpenAIRE

    Bornemann, Claudia

    2010-01-01

    Ziel der vorliegenden Arbeit ist es, das Blickverhalten unterschiedlicher Beobachter bei der filmischen Darbietung von längeren Bewegungsabläufen im Tanz zu erkunden. Zur Theoriebildung wird zunächst auf die anatomisch-physiologischen Grundlagen des Bewegungssehens eingegangen, und es werden die objektbezogenen und psychologischen Einflüsse auf die visuelle Wahrnehmung dargestellt. Unterschiedliche Formen von Bewegungsbeobachtung im Sport werden unterschieden und ein Überblick über die gängig...

  11. Mein Kind im Tragetuch. Eine qualitative Forschung über das Erleben tragender Mütter.

    OpenAIRE

    Schindler, Josephine

    2012-01-01

    Die vorliegende Arbeit stellt einen Beitrag zur Forschung über das Tragen von Kindern dar. Dem Titel ist zu entnehmen, dass der Fokus hierbei auf der tragenden Mutter liegt. Das Erleben tragender Mütter ist in Wissenschaft und Forschung eher ein Randthema: Sowohl die Empfindungen der Mutter beim Tragen ihres Kindes als auch die Auswirkungen des Tragens auf die Mutter sind wesentlich weniger untersucht und theoretisch durchdacht, als die Aspekte des Tragens im Bezug auf die kindliche Entwicklu...

  12. Kieferorthopädische Behandlungsprinzipien bei Juveniler Idiopathischer Arthritis : ein Systematic Review

    OpenAIRE

    Nau, Daniel

    2011-01-01

    Ziel dieser Arbeit war die Durchführung einer systematischen Literaturrecherche zu kieferorthopädischen Behandlungsprinzipien bei Patienten mit Juveniler Idiopathischer Arthritis (JIA) und Kiefergelenkbefall. Mehrere elektronische Datenbanken (PubMed, Medpilot, Web of Science, DIMDI) wurden systematisch nach Studien durchsucht, die bis einschließlich April 2008 publiziert worden waren. Des Weiteren wurde eine Handsuche der kieferorthopädischen und rheumatologischen Fachliteratur vorgenomme...

  13. Entwicklung und Einsatz eines Instrumentariums zur systematischen Untersuchung des Impacts von HTA- und Evidenzberichten

    OpenAIRE

    Dorendorf, Evelyn

    2012-01-01

    Hintergrund: Zur Steuerung einer angemessenen Gesundheitsversorgung wird zunehmend auf Instrumente der evidenzbasierten Medizin zurückgegriffen. In diesem Zuge haben Health Technology Assessments (HTAs) und die Bewertung ihres Impacts im letzten Jahrzehnt stark an Bedeutung gewonnen. Die Effekte von HTA- und Evidenzberichten werden jedoch noch viel zu wenig und größtenteils unsystematisch erfasst, da ein einsatzfähiges Evaluationsinstrument fehlt. Ziel: Die vorliegende Arbeit greift den B...

  14. Pyramidenbau mit Rampen und Seilwinden - ein Beitrag zur Bautechnik im Alten Reich

    OpenAIRE

    Müller-Römer, Frank

    2008-01-01

    Ziel der Dissertation war es die wichtigsten der bisher bekannt gewordenen Hypothesen zum Bau der Pyramiden und entsprechende Bauvorschläge nach wissenschaftlichen Methoden zu analysieren und daraufhin zu überprüfen, inwieweit die Pyramiden des AR danach errichtet werden konnten. Darauf aufbauend wurde eine eigene, aus den archäologischen Befunden ableitbare und in sich widerspruchsfreie Hypothese für den Bau der Stufenpyramiden im AR entwickelt. Verschiedenen bisher veröffentlichten Hypothe...

  15. Psychotherapie körperbehinderter Kinder und Jugendlicher: Implikationen eines Paradigmawechsels

    OpenAIRE

    Mindell, Robin; Zimmermann, Daniel

    2009-01-01

    Im Lichte neuerer wissenschaftlicher Entwicklungen erscheint der biopsychosoziale Ansatz in der Psychotherapie als revisionsbedürftig. In den Neurowissenschaften vollzog sich unter dem Stichwort Neuroplastizität in den letzten zehn Jahren ein Paradigmawechsel von einer linearen zu einer dynamischen Vorstellung von Entwicklung als einem selbstorganisierenden, durch Interaktion mit der Aussenwelt gelenkten Prozess. Dies impliziert, dass die Entwicklungsvoraussetzungen für körperbehinderte Kinde...

  16. Cholesteatome im Kindesalter - Erfahrungen mit offener und geschlossener Technik - eine retrospektive Analyse

    OpenAIRE

    Becker, Swetlana

    2009-01-01

    Das Mittelohrcholesteatom ist eine häufige Erkrankung, die sowohl Erwachsene als auch Kinder betrifft. Unbehandelt kann das Cholesteatom schwerwiegende Komplikationen wie z.B. Ertaubung, Fazialisparese oder intrakranielle Abszedierung verursachen. Die operative Ohrsanierung stellt die einzige kurative Therapiemöglichkeit dar. Im Laufe der Zeit hat sich das Operationsverfahren des Cholesteatoms deutlich verbessert. Während früher die Anlage einer Radikalhöhle (offene Technik) als Standartverfa...

  17. Eine finanzwirtschaftliche Analyse der Risikovorsorge für erwartete Verluste im Kreditgeschäft

    OpenAIRE

    Nippel, Peter

    2015-01-01

    Ab 2018 sollen Kreditinstitute in der internationalen Rechnungslegung eine Risikovorsorge für erwartete Verluste bilden. Diese Risikovorsorge für erwartete Verluste wird hier verknüpft mit dem finanzwirtschaftlichen Kalkül in der Kreditvergabeentscheidung. Auf Basis dieses Entscheidungskalküls wird in einer normativen Analyse hergeleitet, wie die Risikovorsorge für erwartete Verluste im Kreditgeschäft im Rahmen der Bilanzierung und Periodenerfolgsmessung zweckmäßigerweise auszugestalten und z...

  18. Ein virtueller Besuch der Mahn-und Gedenkstätte Ravensbrück

    Directory of Open Access Journals (Sweden)

    Johanna Muschelknautz

    2000-11-01

    Full Text Available Seit März 2000 ist die Mahn- und Gedenkstätte Ravensbrück im Internet präsent. Unter www.ravensbrueck.de finden sich mehrsprachige Informationen zum Frauenkonzentrationslager Ravensbrück, zur Geschichte der Gedenkstätte von 1945 bis heute sowie zu den aktuellen Aktivitäten in Museumsarbeit, Forschung und Pädagogik. Besonders empfehlenswert ist ein virtueller Rundgang über das Gelände.

  19. Review Essay: Erzähltheorie als Möglichkeit eines gemeinsamen Nenners von Humanwissenschaften

    OpenAIRE

    Weilnböck, Harald

    2006-01-01

    Es liegt ein Konferenzband vor, der verschiedene Arbeitsfelder der Psychotherapie-, Beratungs- und Sozialforschung in einen narratologischen Rahmen stellt. Dabei nehmen die Autor/inn/en in interdisziplinärer Weise nicht nur auf qualitativ-soziologische und tiefenpsychologische, sondern mitunter auch auf literaturwissenschaftliche sowie gesprächslinguistische Ressourcen Bezug. Die Bandbreite der Einzelprojekte ist groß; sie reicht von der narratologischen Analyse von Psychotherapiesitzungen, v...

  20. Untersuchung innermotorischer Einflussgrößen auf die Partikelemission eines Ottomotors mit Direkteinspritzung

    OpenAIRE

    Dageförde, Helge

    2015-01-01

    Die Arbeit befasst sich mit der Ermittlung der Ursachen von Partikelemissionen und der Ableitung von Maßnahmen zu ihrer Reduktion. Dabei spielt die Betrachtung der Gemischbildung eine wesentliche Rolle. Es werden innermotorische optische Untersuchungen an einem Einhubtriebwerk sowie einem Einzylindermotor durchgeführt und mehrere Faktoren auf ihren Einfluss auf die Partikelbildung und -oxidation diskutiert. Die motorischen Untersuchungen werden mit Partikelmessungen im Abgas begleitet.

  1. Charakterisierung und Manipulation der Plasmon-Resonanz eines einzelnen Gold-Nanopartikels

    OpenAIRE

    Kalkbrenner, Thomas

    2002-01-01

    In dieser Arbeit wurde die Plasmon-Resonanz einzelner Gold-Nanopartikel untersucht und durch die Wechselwirkung mit ihrer lokalen Umgebung modifiziert. Dazu wurden einzelne Goldkolloide gezielt an einer Rastersondenspitze befestigt, um ihre beliebige Positionierbarkeit auf Nanometerskala zu erreichen. Zusätzlich wurde die Plasmon-Resonanz der Goldteilchen spektral untersucht, wodurch ihr Einsatz als Sensor möglich wurde.Zunächst wurde ein experimenteller Aufbau erstellt, der die flexible Komb...

  2. Virtuelle Nothilfe - Ein Experiment zum Effekt von virtueller Hilfe, Gewalt und Nothilfe auf Hilfe- und Gewaltverhalten

    OpenAIRE

    Mohseni, M. Rohangis

    2013-01-01

    Eine aktuelle Meta-Analyse von Anderson et al. (2010) zeigt, dass Gewaltverhalten in Computerspielen das Gewaltverhalten im realen Leben erhöht, während es prosoziales Verhalten verringert. Daneben führen einige Studien von Greitemeyer und Osswald (2010) sowie von Gentile et al. (2009) zu der Schlussfolgerung, dass das Hilfeverhalten in Computerspielen das Hilfeverhalten im realen Leben erhöht. Bisher gibt es aber keine Studien, die die kombinierte Wirkung von Gewalt und Hilfe in Computerspie...

  3. Nanotechnologie: eine Übersicht : Vorarbeiten zu einer sozial-ökologischen Risikoforschung

    OpenAIRE

    Walz, Anna; Völker, Carolin; Klöppel, Lea

    2014-01-01

    Vorarbeiten zu einer sozial-ökologischen RisDie Nanotechnologie gilt als eine der Schlüsseltechnologien der Zukunft: Die Verringerung der Teilchengröße in den nanoskaligen Bereich führt zu neuartigen physikalischen und chemischen Stoffeigenschaften, welche Innovationspotenzial in vielfältigen Anwendungsfeldern versprechen. Besonders in den letzten zwei Jahrzehnten hat die Nanotechnologie wirtschaftlich an Bedeutung gewonnen, da immer mehr nanotechnologische Entwicklungen kommerziell umgesetzt...

  4. Messung und Auswertung von Lastkollektiven am hydrostatischen Antriebsstrang eines selbstfahrenden Feldhäckslers

    OpenAIRE

    Heckmann, Markus

    2014-01-01

    Um eine bestmögliche Anpassung der Landmaschine an die zu erledigende Aufgabe zu erreichen, werden in Landmaschinen zuerst Synchrongetriebe eingebaut. Diese werden stetig bis zu stufenlosen Getrieben weiterentwickelt. Vor allem für selbstfahrende Erntemaschinen hat sich diese Stufenlosigkeit frühzeitig in der Entwicklung durchgesetzt. Damit einhergehend werden Methoden notwendig, diese Getriebe entsprechend auslegen zu können. Für den Mähdrescherantrieb sind erste Ergebnisse solcher Lastkolle...

  5. Etablierung eines in-vitro Biofilmmodelles aus drei dentalen Bakterienstämmen

    OpenAIRE

    Tabenski, Laura Karla

    2012-01-01

    Monoinfektionen treten in der freien Natur so gut wie nie auf, daher liefert die Verwendung von planktonisch kultivierten Bakterien zur Testung antimikrobieller Substanzen zwar zufriedenstellende Ergebnisse, diese können jedoch nicht mit klinischen Ergebnissen korrelieren [168,236]. Mikroorganismen haben verglichen zu planktonisch lebenden Bakterien eine gesteigerte Resistenz gegen äußere Einflüsse, wie Austrocknung, Scherkräfte, antibakterielle Substanzen und Phagozytose [53,71,83]. Um einen...

  6. Konzeption und Umsetzung eines Bewertungskonzepts für das Gemeinschaftsmarketing im Bereich der Kommunikationspolitik

    OpenAIRE

    Rosner, Regina

    2006-01-01

    Die Arbeit untersucht, inwiefern Institutionen des Gemeinschaftsmarketing ihre Kommunikationsmaßnahmen in praktikablem Rahmen auf Erfolg überprüfen können. Dafür werden die Besonderheiten des Gemeinschaftsmarketing herausgearbeitet und am Fallbeispiel der Landesvereinigung der Bayerischen Milchwirtschaft e. V. gezeigt, wie der klassische Controlling-Ansatz für die Anwendung in kleinsten Organisationen modifiziert werden muss, um eine erfolgreiche Umsetzung zu gewährleisten. Als Alternative da...

  7. Die Dokumentarische Methode in der Unterrichtsforschung : ein integratives Forschungsinstrument für Strukturrekonstruktion und Kompetenzanalyse

    OpenAIRE

    Bonnet, Andreas

    2009-01-01

    "Der Aufsatz geht der Frage nach, inwieweit die dokumentarische Methode es ermöglicht, ein sinnvolles, weil ertragreiches und gegenstandsangemessenes Forschungsinstrumentarium zur Unterrichtsforschung zu konstruieren. Dazu werden erstens theoretische und methodologische Überlegungen angestellt, um die Perspektive der Methode zu beschreiben. Zweitens wird erläutert, wie die klassische Form der Methode erweitert werden kann, um die Bearbeitung spezifischer Fragestellungen der fachdidaktischen U...

  8. Entwickelt sich eine Meningeose beim Medulloblastom gleichmäßig kranial und spinal?

    OpenAIRE

    Trebin, Amelie

    2012-01-01

    In der Nachsorge des Medulloblastoms wird standardmäßig auf die Bildgebung mittels Magnetresonanztomographie zurück gegriffen. Da die Erkrankung vor allem entlang der Liquorwege in Form einer kranialen oder spinalen Meningeose metastasiert, wurde anhand Daten der Therapieoptimierungsstudie "HIT 2000" verglichen, welche Lokalisation am häufigsten betroffen ist. Es zeigte sich, dass zu einem hohen Prozentanteil vor allem eine kombinierte Meningeose im Rezidiv oder Progress auftritt, gefolgt von...

  9. Synthese von Melanin und Pityriacitrin bei Exophiala dermatitidis : ein Vergleich zweier UV-protektiver Substanzen

    OpenAIRE

    Juncu, Christian Gheorghe

    2007-01-01

    Durch Zugabe von Tryptophan als alleiniger Stickstoffquelle zu einem Minimalagar konnten Mayser et al. den Hefepilz M. furfur zur Bildung von Pigmenten und Fluorochromen anregen. Es wurde eine neuartige chemische Verbindung isoliert und erstmalig beschrieben, welche einen komplexen UV-Filter darstellt. Das Indolderivat mit der Summenformel C20H13N30 wurde Pityriacitrin genannt (Mayser et al. 1998; Mayser et al. 2002). Nachdem phylogenetisch weit entfernte Pilze ebenfalls zur Pigmentprodukti...

  10. Abschlussbericht des Projekts EIBE : EIBE 2 - Entwicklung und Integration eines betrieblichen Eingliederungsmanagements

    OpenAIRE

    Eggerer, Reiner; Kaiser, Harald; Jastrow, Birgit

    2009-01-01

    "In diesem Bericht werden Erfahrungen, die die am Projekt 'Entwicklung und Integration eines betrieblichen Eingliederungsmanagements (EIBE)' beteiligten Berufsförderungswerke mit der Implementierung und Durchführung des betrieblichen Eingliederungsmanagements nach § 84 Abs. 2 SGB IX in ihren eigenen Unternehmen und in Unternehmenspartnerschaften sammeln konnten, dargestellt. Besonders kleine Betriebe profitieren von einer schnellen Rückkehr Ihrer Beschäftigten in den Arbeitsprozess. Das Betri...

  11. Entwicklung eines Versuchsstandes für die Zahnriemenprüfung

    OpenAIRE

    Schumann, Paul; Schmidt, Thorsten; Zhakov, Artem

    2014-01-01

    Aussagen zur Lebensdauer von Zahnriemen sind ein wesentlicher Bestandteil zur Auslegung und Überwachung von Zahnriementrieben. An der Professur für Technische Logistik werden endliche Zahnriemen mit Stahlcord beim Einsatz als Tragmittel untersucht, um grundsätzliche Aussagen zur Lebensdauer zu erhalten. For synchronous belts the knowlegde of the endurance is a main point for dimensioning and monitoring synchronous belt drives. Therefore the Professorship of Logistics Engineering does resea...

  12. Von der sprachkritischen zur medienkritischen Wende? Sieben Thesen zur Mediendebatte als eine Einleitung in diese Textsammlung

    OpenAIRE

    Krämer, Sybille

    1998-01-01

    Die Entwicklung der Geisteswissenschaften rankt sich um drei aufeinanderfolgende paradigmatische Ansätze: Das klassische Zeitalter interpretierte "Geist als Bewußtsein", das hermeneutische Zeitalter favorisierte "Geist als Bedeutung", das sprachkritische Zeitalter schließlich behandelt "Geist als Sprache". Gegenwärtig zeichnet sich eine neuerliche Umakzentuierung ab, die mit einer kulturwissenschaftlichen Orientierung Hand in Hand geht und mit dem Kennwort: "Geist als Verkörperung" charakteri...

  13. Einfluss eines veränderten Methylierungspotenzial auf die MGMT-Promotormethylierung

    OpenAIRE

    Geisler, Hermann

    2014-01-01

    Die Methylierung von Nukleinsäuren, Proteinen und Phospholipiden wird durch Methyltransferasen vermittelt, die als Methylgruppendonor S-Adenosyl-Methionin (SAM) verwenden. Die Synthese von SAM wird durch die L-Methionin-S-Adenosyltransferase (MAT) katalysiert. SAM entsteht durch den Transfer einer Adenosylgruppe von ATP auf Methionin. Als Produkt aller SAM-abhängiger Transmethylierungsreaktionen entsteht S-Adenosylhomocystein (SAH). SAH ist ein potenter Inhibitor der meisten, wenn nicht s...

  14. Multifaktormodelle zur Erklärung deutscher Aktienrenditen: eine empirische Analyse

    OpenAIRE

    Stehle, Richard; Schulz, Anja; Schröder, Michael; Eberts, Elke; Ziegler, Andreas

    2003-01-01

    Dieses Papier untersucht, inwieweit Multifaktormodelle nach Fama/French (1993) am deutschen Aktienmarkt die zeitliche Streuung von Renditen abbilden und Portfolio-Renditen im Querschnitt erklären können. Analog zu vergleichbar angelegten Studien am US-amerikanischen, kanadischen und britischen Aktienmarkt ergibt sich aus den linearen Zeitreihen- Regressionen, dass ein Dreifaktorenmodell, das neben der Überschussrendite des Aktienmarktes zwei weitere Risikofaktoren des Aktienmarktes enthält (d...

  15. Chlormadinonacetat - ein progesteronähnliches Gestagen mit antiandrogener Partialwirkung in der oralen Kontrazeption

    OpenAIRE

    Beier HM; Beier-Hellwig K

    2004-01-01

    Beunruhigende Tagesnachrichten der jüngsten Zeit über sprunghaft ansteigende Zahlen von Schwangerschaftsabbrüchen bei sehr jungen Mädchen und jungen Frauen veranlassen uns, das klassische Thema der oralen Kontrazeption, die "Pille", zum aktuellen Thema in diesem Beitrag zu erklären. Diese Problematik wirft weiterreichende als lediglich endokrinologische Fragen auf. In Verantwortung für die jungen Mädchen und Frauen ist unsere Gesellschaft gefordert, ein vorsorglich wirksames Beratungssystem z...

  16. Trajektorienbasierte Teleoperation von Straßenfahrzeugen auf Basis eines Shared-Control-Ansatzes

    OpenAIRE

    Gnatzig, Sebastian

    2015-01-01

    Die Arbeit stellt einen Teleoperations-Ansatz zum sicheren fahrerlosen Fahren von Straßenfahrzeuge im innerstädtischen Verkehr vor. Dazu erfolgt eine Funktionsteilung zwischen Mensch und Maschine mittels Shared Control, wobei der Operator Trajektorien plant, die das Fahrzeug automatisch abfährt. Gegenüber der klassischen direkten Teleoperation hat dies den Vorteil, dass die Steuerung robust gegen Kommunikationszeitverzögerungen ist und im Notfall das Fahrzeug automatisch sicher anhält. Thi...

  17. Konzeption und Evaluation eines fallbasierten Trainingssystems im universitätsweiten Einsatz (CaseTrain

    Directory of Open Access Journals (Sweden)

    Hörnlein, Alexander

    2009-02-01

    Full Text Available Basierend auf umfangreichen Erfahrungen mit fallbasierten Trainingssystemen in der Medizin werden Anforderungen, Umsetzung und eine universitätsweite Evaluation des fachübergreifenden Players und Autorensystem für fallbasiertes Training CaseTrain präsentiert. Die wichtigsten Erfolgsfaktoren waren (1 die Falleingabe mit Standardtextsystemen und einer Webapplikation zum Upload der Falldokumente und zur Fallverwaltung, (2 die Integration mit einer Lernplattform und (3 die curriculare Integration der Trainingsfälle mit automatisierten Evaluationstechniken.

  18. Biochemische und funktionelle Charakterisierung eines anaerob induzierten Ferredoxins aus Chlamydomonas reinhardtii

    OpenAIRE

    Jacobs, Jessica

    2009-01-01

    Im Genom der einzelligen Grünalge Chlamydomonas reinhardtii konnten sechs Gene identifiziert werden, die für (putative) Ferredoxine kodieren. Semiquantitative RT-PCR-Analysen zeigten, dass unter anaeroben Bedingungen nur das Transkript des FDX5-Gens signifikant akkumuliert. Da dies eine vitale Funktion des FDX5-Genproduktes im veränderten Metabolismus anaerober C. reinhardtii Zellen, der durch einen komplexen bakterienartigen Gärungsstoffwechsel und die Produktion von Wasserstoff ...

  19. Wie ein Fisch im Wasser der Zeichenwelt : Spaßguerilla seit den 1960er Jahren

    OpenAIRE

    Teune, Simon

    2008-01-01

    "Subversive Formen des Protestes haben seit der Studentenbewegung einen festen Platz im Aktionsrepertoire sozialer Bewegungen. Das Konzept der Spaßguerilla, dass in der Kommune I entwickelt und umgesetzt wurde, war der Versuch, Protest neu zu erfinden und seine Grenzen zu überschreiten. Eine in der Form angelegte Macht- und Repräsentationskritik, Verfremdung und die Anstiftung zur Selbsttätigkeit sind die Wesentlichen Elemente subversiven Protestes. Der Aufsatz versucht, die Entstehung und En...

  20. Präferenzen und Investitionsabsichten russischer Agrarmessebesucher : eine conjointanalytische und verhaltenswissenschaftliche Betrachtung

    OpenAIRE

    Möser, Nataliya

    2010-01-01

    Die vorliegende Arbeit umfasst zwei empirischen Studien, die der Gewinnung von Ansatzpunkten zur Verbesserung eines Messekonzepts gewidmet sind. Die erste Studie beschäftigt sich direkt mit der Ausgestaltung einer optimalen Fachmesse aus Sicht der Besucher. Die inhaltliche Zielsetzung dieser empirischen Studie ist es, Kenntnisse über die Präferenzen russischer Fachbesucher für ausgewählte Messeleistungen einer Fachmesse zu gewinnen sowie die Zahlungsbereitschaft der Fachbesucher zu bestimmen...

  1. Eine neuartige Roboterkinematik für die laparoskopische Single-Port Chirurgie

    OpenAIRE

    Sanagoo, Arash

    2015-01-01

    Minimal invasive Operationstechniken haben sich in den letzten Jahren sehr schnell weiterentwickelt. Unter anderem konnte sich die roboterassistierte Laparoskopie auf dem Markt etablieren. Solche Systeme können jedoch sehr eingeschränkt für die Single-Port Laparoskopie eingesetzt werden. Im Rahmen dieser Arbeit wurde basierend auf einer sphärischen Parallelkinematik ein kompakter Manipulator entwickelt. Dieser Manipulator wird in erster Linie für die laparoskopische Single-Port Chirurgie g...

  2. Das Konzept Informationskompetenz – Ein Beitrag zur theoretischen und praxisbezogenen Begriffsklärung

    OpenAIRE

    Treude, Linda

    2010-01-01

    Das Konzept Informationskompetenz entwickelt sich im deutschsprachigen Raum seit den 1990er-Jahren zu einem Schlüsselbegriff des Bildungs- und Bibliothekswesens. Es handelt sich um einen Transfer des Konzepts "information literacy", welches im angloamerikanischen Raum bereits seit den 1980er-Jahren etabliert ist und allgemein für eine Fähigkeit im Umgang mit Information benutzt wird. Der Informationsbegriff als Bezugspunkt der Fähigkeit im Umgang mit Information wird in dieser Arbeit etymolog...

  3. A clean energy supply is affordable; Eine saubere Energieversorgung ist bezahlbar

    Energy Technology Data Exchange (ETDEWEB)

    Koenemann, Detlef

    2013-06-06

    Fraunhofer ISE has presented a study based on a holistic view of the power and heat sector and also includes the building refurbishment. To keep the costs as low as possible, the economic optimum was determined from the wealth of possibilities. [German] Das Fraunhofer ISE hat eine Studie vorgelegt, die auf einer ganzheitlichen Betrachtung des Strom- und Waermesektors basiert und auch die Gebaeudesanierung einschliesst. Um die Kosten moeglichst niedrig zu halten, wurde aus der Fuelle der Moeglichkeiten das volkswirtschaftliche Optimum ermittelt.

  4. Die Kosten eines Beitritts Ungarns zur Europäischen Union

    OpenAIRE

    Petsche, Alexander

    1997-01-01

    Als Hauptargument gegen eine Osterweiterung der Europäischen Union werden oft die damit verbundenen Kosten angeführt. Unter Kosten wird in diesem Zusammenhang die Mehrbelastung des EU-Budgets durch den Beitritt der ehemals kommunistischen Staaten verstanden. Diese Mehrkosten würden vor allem aufgrund der Transfers aus der Gemeinsamen Agrarpolitik (GAP) und der Strukturfonds an die neuen mittel- und osteuropäischen Mitgliedstaaten entstehen. Bis dato wurden nur einige wenige Untersuchungen von...

  5. Literaturverzeichnis Kulturvergleichende Psychologie 1965-1986 : eine Bibliographie von Arbeiten deutschsprachiger Autoren

    OpenAIRE

    Trommsdorff, Gisela; Westerman, Maja von

    1986-01-01

    Bei der Vorbereitung des Aufsatzes "Cross-cultural psychology in Germany" (G. Trommsdorff, in: The German Journal of Psychology, 1986) habe ich versucht, einen möglichst umfassenden Überblick über die im deutschsprachigen Raum durchgeführten kulturvergleichenden Arbeiten zu gewinnen. Während ich in diesem Aufsatz nur einige kulturvergleichenende Arbeiten behandelt habe, soll hier eine möglichst vollständige Bibliographie vorgelegt werden.

  6. Shark Fin Test und rheologische Eigenschaften von elastomeren Abformmaterialien : eine Korrelationsanalyse

    OpenAIRE

    Stelzig, Jürgen

    2009-01-01

    Es war das Ziel dieser Arbeit, die Ergebnisse des Shark Fin Tests mit Hilfe von rheologischer Kenngrößen dentaler Abformmaterialien zu beschreiben. Es wurden acht Abformmaterialien, vier Polyether und jeweils zwei A-Silikone und Hybridmaterialien untersucht. Die Prüfung der rheologischen Eigenschaften (komplexe Viskosität, Nullviskosität und Fließgrenze) wurden mit Hilfe eines Rheo Stress 600 Rheometers (Thermo/ Fisher Scientific, Karlsruhe), der Shark Fin Test mit einer Shark ...

  7. Aktiv klicken = Aktiv lernen? : Konzeption und Evaluation eines fallbasierten Lernsystems zur Interventionsplanung (FLIP) im Kontext Gesundheitsverhalten

    OpenAIRE

    Nachbar, Katrin

    2014-01-01

    Für die Rahmenbedingungen der berufsbegleitenden, postgradualen Weiterbildung liegen die Vorteile einer zeitlich und örtlich flexiblen Lernorganisation durch E-Learning auf der Hand. Die vorliegenden Arbeit untersucht, inwieweit eine E-Lernumgebung unter den gegebenen didaktischen Bedingungen in den Masterstudiengängen MASTER:ONLINE Integrierte Gerontologie und MA Gesundheitsförderung der Universität Stuttgart (1) von den Studierenden akzeptiert wird, (2) pädagogisch und technisch nutzbar ist...

  8. Flankenbruch - Eine Grenze der Zahnradtragfähigkeit in der Werkstofftiefe

    OpenAIRE

    Witzig, Jochen

    2012-01-01

    Die vorliegende Arbeit befasst sich mit der Schadensart Flankenbruch. Im Rahmen umfangreicher experimenteller Untersuchungen wurde diese Schadensart systematisch untersucht. Dabei wurden zwei werkstoffspezifische Wöhlerlinien ermittelt, in ergänzenden Untersuchungen wurden maßgebende Einflussparameter wie Geometrie, Wärmebehandlung und Einsatzhärtungstiefe untersucht. Im Rahmen von theoretischen Untersuchungen wird ein höherwertiges Beurteilungsverfahren basierend auf der lokalen Gegenüberste...

  9. "Konvergenz" - Klärung eines kommunikationswissenschaftlichen Schlüsselbegriffs

    OpenAIRE

    Vowe, Gerhard; Henn, Philipp

    2015-01-01

    In diesem Beitrag soll die Frage beantwortet werden: Was sollte in einem kommunikationswissenschaftlichen Kontext unter Konvergenz verstanden werden? Dafür wird zunächst die generelle Bedeutung des Begriffes geklärt. Bei Konvergenz handelt es sich um einen Prozess, nicht um ein Endprodukt. An Beispielen aus der Kommunikationswissenschaft, aber auch aus anderen Disziplinen wird schlaglichtartig gezeigt, wie vielfältig der Begriff Konvergenz in der Wissenschaft zur Beschreibung spezifischer Pro...

  10. Gerichtsnahe Mediation in Niedersachsen; eine juristisch- rechtsökonomische Analyse

    OpenAIRE

    Spindler, Gerald

    2006-01-01

    Die gerichtsnahe Mediation sucht neue Wege zur Streitschlichtung während eines bereits rechtshängigen Verfahrens. Das niedersächsische Projekt hat Modellcharakter für die ganze Bundesrepublik. Im vorliegenden Buch werden die juristischen Probleme der gerichtsnahen Mediation und nötige Reformen untersucht, ebenso wie die ökonomischen Anreizstrukturen für die Beteiligten. In die Untersuchung sind die Ergebnisse einer breit angelegten Befragung der an der gerichtsnahen Mediation Beteiligten eing...

  11. Ein Arachniden-Opisthosoma aus dem Obervisé von NW-Sachsen

    Directory of Open Access Journals (Sweden)

    E. Kahlert

    1998-01-01

    Full Text Available Ein aus dem Unterkarbon von NW-Sachsen stammendes Opisthosoma wird als Cryptomartus sp. beschrieben. Damit liegt stratigraphisch nach bisherigen Erkenntnissen der älteste Fund dieses Genus vor. An Arachnid-Opisthosoma from the Lower Carboniferous of North Western Saxony. An opisthosoma of Cryptomartus sp. is described from the Lower Carboniferous of North Western Saxony. That this my knowledge is the oldest record for the genus. doi:10.1002/mmng.19980010109

  12. Osteoprotegerin - ein neuer Laborparameter zur Unterstützung der radiologischen Diagnostik rezenter Frakturen?

    OpenAIRE

    Krampla W; Newrkla S; Huber K; Hawa G; Posch M; Fendt S; Katschnig I; Kröner A; Hayden E; Kittl E; Eyb R; Hruby W

    2007-01-01

    Ziel der Studie: Im Initialstadium der Frakturheilung treten lokale Regulationsmechanismen in Kraft, die den Knochenumbau vor Ort unabhängig vom Gesamtmetabolismus des Skeletts steuern. Für den Knochenabbau ist die Reifung der Osteoklasten nötig. Diese erfolgt aus unreifen Vorstufen unter dem Einfluß des steoklastendifferenzierungsfaktors sRANKL. Die reifen Osteoklasten produzieren Cathepsin K, die Gegenregulation erfolgt über eine lokale Osteoprotegerin- (OPG-) Ausschüttung. Festgestellt ...

  13. Untersuchung eines möglichen Einflusses der Albedo auf die Mesopausenregion

    OpenAIRE

    Gebhardt, Vera

    2015-01-01

    Der Ausgangspunkt dieser Arbeit war die Tatsache, dass verschiedene Messmethoden der Albedo zu verschiedenen Ergebnissen geführt haben und es schwierig war, diese Ergebnisse zu validieren. Ziel war es, herauszufinden, ob es einen Zusammenhang zwischen der Variablität der Temperatur der oberen Mesopause und der Variabilität der Albedo gibt. Es hat sich gezeigt, dass im Temperaturverlauf der Mesopause zum Zeitpunkt der Äquinoktien ein sogenannter Dip auftritt, welcher auch im Jahresverlauf der ...

  14. Die Bürgerausstellung: Eine Kombination sozialwissenschaftlicher, partizipativer und künstlerischer Elemente

    OpenAIRE

    Böhm, Birgit; Legewie, Heiner; Dienel, Hans-Liudger

    2008-01-01

    Die "Bürgerausstellung" ist durch ihre Verbindung sozialwissenschaftlicher, partizipativer und künstlerischer Elemente ein Umsetzungsbeispiel angewandter performativer Sozialwissenschaft. Die Methode entstand in den 1990er Jahren bei der Vermittlung qualitativer Methoden und gemeindespsychologischer Ansätze an Studierende der Psychologie. Die Bürgerausstellung kombiniert qualitative Methoden wie Interview und Textinterpretation mit künstlerisch-ästhetischen Methoden wie Fotografie und Film zu...

  15. Gesellschaft und Identität : eine literaturwissenschaftliche Untersuchung der Vatnsdoela saga

    OpenAIRE

    Clasen, Barbara

    2005-01-01

    Die Vatnsdoela saga, die Geschichte der Leute aus dem Wassertal, ist eine der fünfunddreißig Isländersagas. Sie berichtet von der Dynastie der Vatnstalgoden und umfasst dabei fünf Generationen. Die vorliegende Untersuchung widmet sich der Vatnsdoela saga in ihrer Komplexität und entschlüsselt unter Einbeziehung dreier literaturwissenschaftlicher Methoden die zentrale Aussage dieser Saga. Vom narrativen Konstrukt (Struktur und Aufbau der Saga), über die sozialanthropologische Dimen...

  16. Zum gegenwärtigen Stellenwert der homologen Insemination - ein Update

    Directory of Open Access Journals (Sweden)

    Katzorke Th

    2009-01-01

    Full Text Available Die Insemination ist häufig die erste invasive therapeutische Maßnahme, die Kinderwunschpaare in Anspruch nehmen. Über ihre Effektivität und Effizienz, insbesondere im Vergleich zu modernen aufwendigen Verfahren wie IVF und ICSI, gibt es zahlreiche, zum Teil sehr kontroverse Publikationen. Dieser Umstand wird bedingt durch die vielen Faktoren, die den Ausgang einer Inseminationstherapie beeinflussen können. Neben rein technischen Aspekten, wie Applikationsort, Spermienaufbereitung, Zeitpunkt der Insemination und Art der ovariellen Stimulation, spielen die weibliche Sterilitätsursache und die Spermienqualität eine entscheidende Rolle. Aus der vorliegenden kritischen Würdigung der wesentlichen Aspekte der Inseminationstherapie und unserer persönlichen über 30-jährigen Erfahrung mit allen anerkannten Methoden der Kinderwunschbehandlung dürfen wir konstatieren: Die Inseminationstherapie sollte nur bei Frauen unter 40 Jahren und kurzer Kinderwunschdauer und entsprechender Tubendiagnostik angewandt werden. Auf der männlichen Seite sollte keine oder nur eine leichte Einschränkung der Spermienparameter vorliegen. Die intrauterine Insemination (IUI ist in den meisten Fällen die Methode der Wahl gegenüber dem Verkehr zum Optimum (VZO und der intrazervikalen Insemination. Sie sollte nach ovarieller Stimulation mit Gonadotropinen erfolgen, trotz der dann ungünstigen Kostenrelation. Nach vier Inseminationen mit vorangegangener Stimulation sollte ein Therapiewechsel hin zu extrakorporalen Verfahren wie die In-vitro-Fertilisation (IVF oder die Intrazytoplasmatische Spermieninjektion (ICSI erwogen werden. Aus reiner Kosten-Nutzen-Sicht und wegen des höheren Erkenntnisgewinns im Hinblick auf die biologischen Vorgänge der Fertilisation und Embryoentwicklung ist eine sofortige Anwendung der IVF/ICSI zu empfehlen.

  17. Knowledge Management : Methoden, Strukturen und Technologien zur Etablierung eines zielgerichteten und ganzheitlichen Knowledge Management

    OpenAIRE

    Stoeber, Marc

    2001-01-01

    Aus der vielschichtigen Knowledge Management Diskussion wird in diesem Buch der Aspekt des Knowledge Management in Unternehmen herausgegriffen. Dabei wird zu Beginn neben den Besonderheiten der Ressource Wissen eine klare Abgrenzung zwischen den Begriffen Informations- und Wissens- bzw. Knowledge Management herausgearbeitet. Daran schließt sich die Diskussion um die Motivation der Unternehmen an, verstärkt Knowledge Management zu beachten. In erster Linie spielen neuere wirtschaft...

  18. Ein Frankfurter Sicherheitsregime. Neoliberale Sicherheitsproduktion in der ,Hauptstadt des Verbrechensʼ

    Directory of Open Access Journals (Sweden)

    Anna Kern

    2014-10-01

    Full Text Available Während sich staatliche Sicherheitspolitik fortwährend verändert, scheint die Kritik an ihr verhältnismäßig unflexibel. Vielmehr wird der ständige Prozess der Ausdifferenzierung und Transformation der staatlichen Sicherheitsapparate von ihren Kritiker_innen seit Jahrzehnten so vehement mit Warnungen vor der Herausbildung eines totalitären Überwachungsstaates begleitet, dass diese zunehmend zu Unkenrufen verkommen. Mit dem Begriff des Sicherheitsregimes wird im Folgenden gegen einen Alarmismus argumentiert, der sich in Hinweisen auf die ständige Eskalation von Sicherheitspolitiken und eine damit einhergehende Beschneidung der Freiheit von Bürger_innen, Prekarisierten, Exkludierten oder sozialen Bewegungen erschöpft. Denn eine Kritik, die bei Skandalisierungen verbleibt, ist einerseits blind für qualitative Veränderungen. Andererseits schreibt sie selbst tradierte Herrschaftsverhältnisse fest, indem sie Vergangenes romantisiert und so an der Erzählung von der grundsätzlichen Alternativlosigkeit einer herrschaftsförmig organisierten Gesellschaft mitwirkt.Dagegen wird eine materialistische Analyseperspektive eingenommen, die die Transformationen von Politiken der Sicherheit im Kontext der historischen Entwicklung der kapitalistischen Produktionsweise begreift. Anhand von Fallbeispielen zum Polizieren der Felder häusliche Gewalt und gewaltaffine Fußballfans in Frankfurt am Main wird die neoliberale Konzeption des umfassenden Zusammenwirkens öffentlicher, privatwirtschaftlicher und zivilgesellschaftlicher Akteure empirisch skizziert und das sich ausdifferenzierende Akteursfeld in diesem Bereich dargestellt. So können auch soziale Konfliktlinien identifiziert werden, die über die herkömmliche Gegenüberstellung von Freiheit und Sicherheit hinausweisen.

  19. ‚Glauben-Lernen’ als Beitrag für eine menschengerechte schulische Bildung. Zugleich eine Auseinandersetzung mit religionspädagogischen Grundgedanken von Hans-Ferdinand Angel

    Directory of Open Access Journals (Sweden)

    Martin Rothgangel

    2016-06-01

    Full Text Available Ausgehend von der Unterscheidung von Religiosität und Glaube wird zunächst der Begriff des ‚Glauben-Lernens’ problematisiert. Anstelle dessen verdient der Begriff ‚religiöse Bildung’ den Vorzug, weil damit deutlicher zum Ausdruck gebracht wird, dass sich alle religionspädagogischen Bemühungen im Bereich der ‚Wegbereitung’ und des ‚Vorletzten’ (D. Bonhoeffer befinden. Im Anschluss daran wird der Frage nachgegangen, in welcher Hinsicht ‚religiöse Bildung’ einen Beitrag für eine menschengerechte schulische Bildung leisten kann. Vor diesem Hintergrund erfolgt schließlich eine Auseinandersetzung mit der von Hans-Ferdinand Angel entwickelten Creditionentheorie. ‘Faith-learning’ as a contribution to a human-oriented school education. (Also a discussion of the religious educational concepts of Hans-Ferdinand Angel Based on the distinction between religiosity and faith, the article critically examines the notion of ‘faith-learning’. We rather propose the term ‘religious education’ since it expresses more clearly that all religious pedagogical endeavors pertain to the realm of ‘paving the way‘ and ‘the penultimate’ (D. Bonhoeffer. Subsequently, we discuss in which sense religious education contributes to a human-oriented school education. Against this background, the article explores Hans-Ferdinand Angel’s ‘creditions theory’.

  20. Development of an integrated system for a SOFC for combined heat and power generation; Entwicklung eines integrierten Systems fuer eine SOFC mit Kraft-Waerme-Stoffkopplung

    Energy Technology Data Exchange (ETDEWEB)

    Stichtenoth, J.; Meyer-Pittroff, R.

    2002-06-01

    The feasibility of CO2 removal from the exhaust of a 250 kW{sub e} SOFC module, with recirculation of the liquefied CO2 is discussed for the example of a German brewery (Bayerische Staatsbrauerei Weihenstephan). An electric efficiency of 50% can be achieved provided that the liquefied CO2 is utilized to substitute CO2 liquefaction in another point of the process. The high-temperature waste heat of the 250 kW SOFC is fed into the brewer's copper via feedwater preheating. [German] In dieser Studie werden die Moeglichkeiten einer technischen Rueckgewinnung von CO{sub 2} aus dem Abgasstrom eines SOFC-Moduls mit 250 kW elektrischer Leistung und Rueckfuehrung des verfluessigten CO{sub 2} in den Wertschoepfungsprozess am Beispiel der Bayerischen Staatsbrauerei Weihenstephan untersucht. Unter der Voraussetzung, dass dieses verfluessigte CO{sub 2} als Produkt Verwendung findet und die CO{sub 2}-Verfluessigung an anderer Stelle substituiert, kann der von der SOFC gelieferte Energiebeitrag zur CO{sub 2}-Verfluessigung dem Gesamtsystem gutgeschrieben werden, so dass der elektrische Wirkungsgrad bei 50% bleibt. Die Hochtemperaturabwaerme der 250 kW-SOFC wird ueber eine Speisewasservorwaermung in den Dampfkessel der Brauerei eingekoppelt.

  1. Untersuchungen zur deutschen Schreibsprache eines spätmittelalterlichen Gebetbuches von Ljubljana

    Directory of Open Access Journals (Sweden)

    Marija Javor Briški

    2015-09-01

    Full Text Available Der vorliegende Aufsatz  bietet eine ausführliche systematische Darstellung der deutschen Schreibsprache des Manuskriptes NUKLj Ms 224, eines spätmittelalterlichen Gebetbuches der National- und Universitätsbibliothek in Ljubljana, welches drei verschiedene Hände aufweist. Die Schreibsprache wird nach den für räumliche und zeitliche Einordnung relevanten Kriterien in drei Bereichen untersucht: im phonetisch-orthographischen, im morphologischen und im lexikalischen. Den methodologischen Untersuchungsansatz bildet ein Vergleich zwischen dem "Normalmhd." (H. Paul 1989, 19 u. 28ff. und dem in der Handschrift in Erscheinung tretenden Sprachzustand unter Berücksichtigung von J. Stanoniks (1957, 41 Bestimmung der Schreibsprache als Südbairisch und der mit Hilfe des Wasserzeichens bestimmbaren Datierung   der Handschrift um 1472. Aufgrund fehlender textimmanenter Angaben zur exakten Datierung soll die Untersuchungder Schreibsprache dazu beitragen, die Entstehungszeit der Aufzeichnung näherzubestimmen.

  2. A flywheel energy storage system with permanent magnet bearing; Ein Schwungrad-Energiespeicher mit permanentmagnetischer Lagerung

    Energy Technology Data Exchange (ETDEWEB)

    Kolk, M.

    1997-12-01

    It is the major objective of the work reported to expand the applications of radially passive permanent magnet bearings for rotors with increased mass and moment of inertia, and to show that partially passive magnetic bearings can be used for systems with high-capacity motors and generators. The following main aspects are discussed and explained: The fundamental principles and applications of flywheels; applicable magnetic bearing systems and their components; dynamic properties of a magnetically suspended rotor; design of the motor/generator unit of a flywheel system; the entire design of the prototype system developed and its essential components; safety aspects of the flywheel; power losses and power output; current applications and possible further applications of magnetically suspended flywheels; results and applications of permanent magnet bearings. (orig./CB) [Deutsch] Ein wesentliches Ziel dieser Arbeit ist, den Einsatzbereich fuer radial passive permanentmagnetische Lager fuer Rotoren mit groesserer Masse und groesserem Traegheitsmoment zu erweitern und zu zeigen, dass partiell passive Magnetlager sich auch fuer grosse Motor- und Generatorleistungen eignen. Auf folgende Schwerpunkte wird eingegangen: die Technik und die Verwendung von Schwungraedern, verschiedene Arten der Magnetlagerung und deren Komponenten, Dynamik eines magnetgelagerten Rotors, Auslegung des Motor/Generators eines Schwungradsystems, Gesamtaufbau des realisierten Prototypen und seine wesentlichen Baugruppen, Sicherheitsaspekte des Schwungrades, Verluste und Leistungsabgabe, Anwendungen und Erweiterungen des magnetgelagerten Schwungrades, Ergebnisse und Einsatzmoeglichkeiten permanentmagnetischer Lager. (orig./GL)

  3. Medienerziehung in Kindertagesstätten - Nachhaltigkeitsüberlegungen im Anschluss an eine Fortbildungsinitiative

    Directory of Open Access Journals (Sweden)

    Henrike Friedrichs

    2015-05-01

    Full Text Available Durch die Einführung und Aktualisierung der Bildungspläne sind Kindertagesstätten seit einigen Jahren vermehrt aufgefordert, medienerzieherisch aktiv zu werden. Auch wenn es inzwischen verschiedene Fortbildungsinitiativen gibt, können aktuelle Studien keine grundlegenden Fortschritte in einer flächendeckenden praktizierten Medienerziehung nachweisen. Im vorliegenden Beitrag wird mit Bezug auf empirische Studien und strukturelle Rahmenbedingungen die aktuelle Situation der Medienerziehung in Deutschland und spezifisch in Nordrhein-Westfalen aufgezeigt. Daran anknüpfend stellen die Autorinnen ein Fortbildungskonzept der medienpädagogischen Initiative Medienkompetenz-Kitas NRW vor, das mittels eines Inhouse-Schulungsansatzes in zwölf Kindertagesstätten in NRW durchgeführt wurde. Im Fokus der Fortbildung standen die Vermittlung technischen Grundlagenwissens und handlungsorientierter Methoden für eine aktive medienpraktische Arbeit sowie die Förderung medienpädagogischen Reflexionswissens. Auf der Grundlage der Evaluation des Projekts und der aktuellen Situation der Medienerziehung werden im Zuge einer angestrebten nachhaltigen Verankerung von Medienerziehung in Kindertagesstätten Implikationen zur Fort- und Ausbildung von Erzieherinnen und Erziehern benannt.

  4. Medienbildung – ein Unterrichtsprinzip mit Mehrwert. - Versuch einer Annäherung.

    Directory of Open Access Journals (Sweden)

    Susanne Krucsay

    2010-06-01

    Full Text Available Unterrichtsprinzipien sind ‚zahnlose Tiger’, meinte vor einigen Jahren Rudolf Scholten, Bundesminister für Unterricht und Kunst. Wenn auch negativ, immerhin klarer als so manche Erklärungen, die die Komplexität von Unterrichtsprinzipien einzufangen versuchen. Mehr als ein Jahrzehnt ist seitdem vergangen, ob sich am Wahrheitsgehalt dieser Feststellung etwas geändert habe, sei der Beurteilung der Leserinnen und Leser überlassen, die die im österreichischen Lehrplan aufgezählten Unterrichtsprinzipien zumindest dem Namen nach kennen. Gemeinsam ist zunächst den Unterrichtsprinzipien, dass sie Querschnittsmaterien sind und daher theoretisch nicht nur in den explizit ihnen zugedachten Schwerpunktgegenständen, sondern in allen Fächern berücksichtigt werden sollen. Ihr Stellenwert in der schulischen Wertehierarchie ist sowohl bei Lehrenden als auch Lernenden gering bis nicht vorhanden. Erst wenn einer Materie aus unterschiedlichen Interessen Wichtigkeit zugestanden wird, erfolgt eine ‚Beförderung’ des Unterrichtsprinzips zum Unterrichtsgegenstand bzw. Bestandteil eines bestehenden Gegenstandes, wie z.B. Politische Bildung. (Zum Thema: Unterrichtsgegenstand oder Unterrichtsprinzip siehe auch http://www.medienimpulse.at/articles/view/189

  5. Overview of the Factors Music Making in Tamhidat by Ein al-Ghozat Hamedani

    Directory of Open Access Journals (Sweden)

    Fatemeh Modarresi

    2013-11-01

    Full Text Available Abstract Figures of speech in addition to their aesthetic functions have different effects on words. Internal music is one of the  effects of figures of speech  which can play an important role in beautifying the word and its effect on the audience. The internal music comes with the use of verbal figures of speech. Figures that make words related by similarity or uniformity of vowels and consonants and create sensible  alliteration. Categories of palilogy, alliteration, parallelism, pun and riming prose are among the figures of speech  that play a major role in creating internal  music of the poem. In this study, with a descriptive-analytical approach, we discuss the roll of music making factors in  Tamhidat as an example of prose poem. The language of Ein ol-Ghozat in Tamhidat is preachy and didactical and in an addressing mode. Despite the intensity and sharpness of his speech, he speaks simple language with his audience. However, his words are in some cases melodious that influences audience and increases its penetration in the listener. The music of his words is natural so the listener can feel it with his spirit and takes its effect. Well syntagmatic arrangement of words is one of his language features that is based on music and phonemes' melody. This music gives words importance and predominance and makes Tamhida's  prose a kind of prose poem. Applying some of the subtle and tiny musical elements such as parallelism (paronomasia /pun makes the music of book more effective and catching. In other words, harmony of sounds and synchronization through which prose becomes rhythmic and melodious is one of the aesthetic aspects of the mystical prose of Ein ol-Ghozat that arises from his word's music and special intonation, so as human nature accepts it and enjoys reading. This word music is found in the form of alliteration, pun, repetition, and meter in important parts of his speech that sometimes becomes close to prosodic meter. In Ein ol

  6. Fermats letzter Satz die abenteuerliche Geschichte eines mathematischen Rätsels

    CERN Document Server

    Singh, Simon

    2000-01-01

    Der Satz des Pythagoras: a²+b²=c² steht im Zentrum des Rätsels, um das es hier geht. Diese »Urformel« gilt immer und überall, aber nur in der Zweier-Potenz, mit keiner anderen ganzen Zahl. In den Notizen des französischen Mathematikers Pierre Fermat, der im 17. Jahrhundert lebte, gibt es einen Hinweis, dass er den Beweis für dieses Phänomen gefunden hat. Doch der Beweis selbst ist verschollen. 350 Jahre lang versuchten nun die Mathematiker der nachfolgenden Generationen, diesen Beweis zu führen. Keinem wollte es gelingen, manche trieb das Problem sogar in den Selbstmord. Schließlich wurde ein Preis für die Lösung des Rätsels ausgesetzt. Nun gelang dem britischen Mathematiker Andrew Wiles 1995 der Durchbruch. Simon Singh wiederum gelang es, diese auf den ersten Blick abgelegene Geschichte so zu erzählen, dass niemand und auch kein Mathematikhasser sich ihrer Faszination entziehen kann: Ein Glanzlicht des modernen Wissenschaftsjournalismus! »Dieses Buch ist ein Wunder.

  7. Fondaparinux bei Herz-Kreislauf-Erkrankungen: Ein neues Antithrombin mit herausragenden Eigenschaften

    Directory of Open Access Journals (Sweden)

    Huber K

    2008-01-01

    Full Text Available Fondaparinux, ein synthetisches Pentasaccharid, führt zu einer indirekten Hemmung des Gerinnungsfaktors Xa und behindert in der Folge die Bildung von Thrombin. Fondaparinux wurde als Vergleichssubstanz gegenüber unfraktioniertem (Standard- Heparin oder dem niedermolekularen Heparin Enoxaparin in der Prophylaxe oder Therapie von venösen Thrombosen getestet. Zuletzt wurde Fondaparinux auch bei Patienten mit akuten Koronarsyndromen (ACS untersucht: bei Patienten mit ACS ohne ST-Hebung (NSTE-ACS waren sowohl die Blutungsrate als auch die Kurz- und Langzeitmortalität im Fondaparinuxarm (2,5 mg/Tag s. c. signifikant geringer als in den Enoxaparin-behandelten Patienten (1 mg/kg KG 2×/Tag s. c. (OASIS-5-Studie. Bei Patienten mit akutem ST-Strecken-Hebungsinfarkt (STEMI war Fondaparinux in den Subgruppen der konservativ behandelten Patienten (ohne Reperfusion und der Patienten, die eine pharmakologische Reperfusion erhielten (Thrombolyse von Vorteil gegenüber Placebo oder unfraktioniertem Heparin. Hingegen zeigte sich bei Patienten mit STEMI, die einer Akut-PCI unterzogen wurden, eine starke Tendenz zugunsten von unfraktioniertem Heparin gegenüber Fondaparinux (OASIS-6-Studie. Daher wird Fondaparinux in den internationalen Richtlinien als das Antithrombin mit der günstigsten Risiko/Nutzen-Ratio bei NSTEMI aber auch bei STEMI-Patienten mit Ausnahme jener Patienten, die sich einer Akut-PCI unterziehen, empfohlen. Fondaparinux könnte schon in der nahen Zukunft die Heparine in diesen Indikationen weitgehend ersetzen.

  8. Ein Kanon ganz für uns allein? A Canon of Our Own?

    Directory of Open Access Journals (Sweden)

    Annette Kliewer

    2007-11-01

    Full Text Available Die Gender-Studies haben sich immer wieder damit hervorgetan, dass sie den traditionellen Kanon im Wissenschaftsbetrieb kritisierten. Nun veranstaltete das Referat Genderforschung der Universität Wien vom 28. bis 29. 11. 2005 eine internationale Tagung, bei der nach Existenz, Entwicklung und Sinn eines Kanons für die Frauen- und Geschlechterforschung selbst gefragt wurde. Mit dieser wissenschaftspolitischen Tagung wurde das Thema einer Ringvorlesung „Ein Kanon ganz für uns allein?“ (Sommersemester 2005 auf Fragen des internationalen Wissenschaftstransfers ausgedehnt. Auch in den Gender Studies gibt es Kanonisierungen, die Wissenschaftlerinnen ausschließen, vor allem aus nichtwestlichen Zusammenhängen, seien es postkoloniale oder postsozialistische Staaten. Eingeladen waren deshalb Referentinnen aus 15 verschiedenen Ländern.Gender Studies always took pride in criticizing the traditional scholarly canon. The Referat Genderforschung (Gender Research Facilities at the University of Vienna, however, hosted an international conference from November 28-29, 2005, which directly questioned themes such as the existence, development, and meaning of a canon for women’s and gender studies. A successful lecture series with the title “A Canon of Our Own” (spring 2005 and the ever-increasing demand for scholarly exchange provided the inspiration for the conference. But canonization exists in Gender Studies as well, which excludes certain female scholars, particularly those from a non-western background, whether from postcolonial or postsocialist states. To combat this, the hosts invited speakers from 15 different countries.

  9. Ende eines Dornröschenschlafs The End of Sleeping Beauty’s Slumber

    Directory of Open Access Journals (Sweden)

    Beate Kennedy

    2005-11-01

    Full Text Available Der gut recherchierte, zum Teil mit Abbildungen versehene Jubiläums-Band Irmgard Keun 1905/2005 bietet u. a. mit den Dokumentationen der Erstrezeption der frühen Romane Gilgi, eine von uns und Das kunstseidene Mädchen in der Weimarer Republik und der Rezeption der Exilromane in den Zeitschriften Das Wort und Internationale Literatur reichlich bisher schwer zugängliches Material. Die neuen Deutungen weisen zudem bei aller Verschiedenheit auf eine Verschiebung der Parameter in der Keun-Forschung hin: weg vom biographischen Zugriff, hin zu einer stärker erzähltheoretischen Orientierung.The well-researched and partially illustrated anniversary volume Imgard Keun 1905/2005 offers abundant material that has, up till now, been difficult to approach. The volume is comprised of, among other items, the documentation of the primary reception of the early novels Gilgi, One of Us (Gilgi, eine von uns and The Artificial Silk Girl (Das kunstseidene Mädchen in the Weimar Republic and the reception in the newspapers Das Wort and Internationale Literatur of the novels written in exile. Though differing highly from one another, the most recent analyses all point to a shift in the parameters of Keun research: away from biographical interpretation and towards a strong narrative theoretical approach.

  10. Osteoprotegerin - ein neuer Laborparameter zur Unterstützung der radiologischen Diagnostik rezenter Frakturen?

    Directory of Open Access Journals (Sweden)

    Krampla W

    2007-01-01

    Full Text Available Ziel der Studie: Im Initialstadium der Frakturheilung treten lokale Regulationsmechanismen in Kraft, die den Knochenumbau vor Ort unabhängig vom Gesamtmetabolismus des Skeletts steuern. Für den Knochenabbau ist die Reifung der Osteoklasten nötig. Diese erfolgt aus unreifen Vorstufen unter dem Einfluß des steoklastendifferenzierungsfaktors sRANKL. Die reifen Osteoklasten produzieren Cathepsin K, die Gegenregulation erfolgt über eine lokale Osteoprotegerin- (OPG- Ausschüttung. Festgestellt werden soll, ob die Serumkonzentrationen dieser drei Substanzen in einer Weise ansteigen, die einen darauf aufbauenden Labortest zum Nachweis einer rezenten Fraktur erlaubt. Material und Methode: Eingeschlossen wurden 19 Patienten mit nachgewiesenen Wirbelkörperfrakturen sowie sechs Probanden nach Wirbelsäulenoperationen. Die Serumkonzentrationen obengenannter Parameter wurden ermittelt und die Werte mit publizierten Daten einer gesunden Normalgruppe verglichen. Ergebnis: Nur für OPG ist eine marginale Konzentrationsänderung zu diskutieren. Die Überschneidung zwischen Normalkollektiv und Patientengruppe ist allerdings so groß, daß ein alleiniger praxisrelevanter Frakturbluttest nicht darauf aufgebaut werden kann.

  11. Warum heute noch religiöse Bildung? Eine geschichtsphilosophische Skizze

    Directory of Open Access Journals (Sweden)

    Hans Schelkshorn

    2016-06-01

    Full Text Available Die Krise religiöser Bildung ist ein Symptom der allgemeinen Krise der Religion in der späten Moderne, die seit dem 18. Jahrhundert sowohl von innen als auch von außen diagnostiziert wird. Ohne die Bedeutung anthropologischer, systemtheoretischer und bildungstheoretischer Religionstheorien zu negieren bedarf es letztlich eines geschichtsphilosophischen Horizonts abseits der klassischen Fortschrittstheorien, in dem Religionen in der Vielfalt ihrer unterschiedlichen Selbstauslegungen begriffen werden können. In dieser Perspektive wird in diesem Artikel eine modifizierte Version von Jaspers‘ Theorie der Achsenzeit vorgeschlagen. Why religious education today? A historical and philosophical approach The crisis of religious education is a symptom of the general crisis of religion in late modernity which has been diagnosed since the 18th century, both from inside and from outside. Without neglecting the importance of anthropological approaches, systems theories of religion and educational reflections on religion, adequate understanding of the plurality of religious traditions including their dynamic of self-interpretations requires a historical and philosophical horizon beside the old theories of progress. In this perspective this article offers a modified version of Jaspers‘ theory of the Axial Age.

  12. Development of a ceramic heat exchanger for a combined cycle plant with pressurized coal dust combustion. Final report; Entwicklung eines keramischen Waermeaustauschers fuer eine Kombianlage mit Kohlenstaubdruckfeuerung. Schlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Leithner, R.; Ehlers, C.

    2001-12-01

    dazu notwendige Gasreinheit vor der Gasturbine ist bislang bei Temperaturen ueber 1000 C nicht erreichbar. Als ein Ansatz wird versucht, die notwendige Abscheidung von Asche und Alkaliverbindungen oberhalb der Aschefliesstemperatur durchzufuehren. Problematisch hierbei sind v.a. der verbleibende Asche- und Alkaliengehalt im Rauchgas und Korrosionsschaeden an den Feuerfestmaterialien. Zielsetzung der Untersuchung: Eine alternative Schaltung sollte untersucht werden, in der die Gasreinigung nach Stand der Technik unterhalb des Ascheerweichungspunktes erfolgt. Dazu ist eine Abkuehlung und anschliessende Wiederaufheizung des Rauchgases in einem Hochtemperatur-Waermeaustauscher erforderlich. Methode: Eine keramischer Rohrbuendel-Waermeaustauscher im Modellmassstab wurde konstruiert und in einer drucklosen Versuchsanlage zusammen mit einer Heissgasentstaubung unter realen Bedingungen betrieben. Ergebnis: Der Waermeaustauscher erwies sich in Konstruktion und Werkstoffwahl als geeignet. Wegen Undichtigkeiten konnten die angestrebten hohen Temperaturen nicht ganz erreicht werden. Bei hohen Temperaturen verstopfte versinternde Asche die Rohreingaenge. Erste Vorversuchen zur Reinigung der Rohr im Betrieb erbrachten positive Ergebnisse. Die Abscheidung der Asche durch Zyklon und keramische Filterkerzen gelang problemlos. Schlussfolgerung: Bei Vermeidung bzw. Verbesserung von undichten Verbindungen liessen sich hoehere Temperaturen erreichen. Gelingt die Reinigung der Rohreingaenge im Betrieb bei hohen Temperaturen, steht ein Verfahren zur Verfuegung, mit dem die fuer den Prozess noetige Gasreinheit erreicht wird. (orig.)

  13. Anabole Wirkungen auf den Knochen durch pulsatiles exogenes Parathormon - ein wiederentdecktes Therapieprinzip

    Directory of Open Access Journals (Sweden)

    Bernecker PM

    2002-01-01

    Full Text Available Parathormon (PTH wird in den Zellen der Nebenschilddrüse produziert und in enger Abhängigkeit vom Serumspiegel des ionisierten Kalziums in die Zirkulation abgegeben. Ein Abfall des Serum-Kalziums führt zu einem augenblicklichen Ansteigen der PTH-Ausschüttung aus der Nebenschilddrüse, ohne daß "second messenger"-Mechanismen zum Tragen kommen; viel mehr wird die Kalziumkonzentration durch einen auf der Oberfläche der Nebenschilddrüsenzellen befindlichen Kalzium-empfindlichen Rezeptor direkt durch die Zelle erfaßt. PTH wirkt auf verschiedene Weise; Ziel der Wirkung ist in jedem Fall eine Anhebung des Serum-Kalzium-Spiegels. Aus der Extrazellulärflüssigkeit (ECF des Knochens, die durch das Havers'sche Kanalsystem zirkuliert, kann recht rasch Kalzium mobilisiert werden. In der Knochen-ECF sind ca. 1-3 Gramm Kalzium in lockerer Ionenbindung gespeichert; diese können unter dem Einfluß von Parathormon sehr rasch in das Blutkompartment übergeführt werden. Am Knochen stimuliert Parathormon die Knochenresorption, auch hier mit dem physiologischen Ziel, Kalzium freizusetzen. Da der Knochenstoffwechsel jedoch in definierten "Knochenumbaueinheiten" (bone remodelling units = BMU erfolgt, in denen Knochenresorption und Knochenformation eng gekoppelt sind und sequentiell ablaufen, wurde die Steuerung dieser Umbauvorgänge durch PTH schon vor längerer Zeit untersucht. Die Überraschung war groß, als man feststellen mußte, daß die den Knochen abbauenden Osteoklasten keinerlei Rezeptoren für PTH, sondern nur für dessen physiologischen Gegenspieler, das Calcitonin, besitzen. PTH-Rezeptoren wurden dagegen in großer Dichte auf Osteoblasten, also Knochen-aufbauenden Zellen, gefunden. Es wird daher angenommen, daß der initiale Reiz für die Knochenresorption auf die Osteoklasten indirekt übermittelt wird, und zwar über bisher unbekannte second-messaging-Mechanismen; Prostaglandine der E- und F-Serien als auch Interleukin-1 wurden hier als solche

  14. Bibliotheken unterstützen Open Access-Zeitschriften: eine Bedarfsabklärung

    Directory of Open Access Journals (Sweden)

    Alice Keller

    2015-12-01

    Full Text Available Der Aufsatz beschreibt eine Studie zur Herausgabe von Open-Access-Zeitschriften an der Universität Zürich. Er geht der Frage nach, welche Bedürfnisse Open-Access-Zeitschriften bzw. ihre Herausgeber haben und welche publikationsunterstützenden Services infolgedessen von Universitätsbibliotheken angeboten werden sollten. Die Studie umfasste zwei Teile: eine ausführliche Online-Evaluation der Zeitschriften und ihrer Funktionalitäten sowie Einzelinterviews mit den Herausgebern. Die Resultate zeigen, dass eine sehr grosse Heterogenität besteht hinsichtlich der Funktionalitäten, der technischen Plattformen, der Finanzierungsmodelle, sowie der Anbindung an Verlag oder Bibliothek. Insbesondere Zeitschriften, die weder einem Verlag noch einer Bibliothek angegliedert sind, weisen Lücken bei den Funktionalitäten und der Nachhaltigkeit auf. Insgesamt stellen die fehlenden finanziellen Ressourcen für viele Herausgeber die größte Sorge dar. Außerdem fehlen den Herausgebern Ansprechpersonen und sie fühlen sich in ihrer Publikationstätigkeit zum Teil sehr allein gelassen. Die Migration einer Open-Access-Zeitschrift auf ein durch die Bibliothek betriebenes Journal Management System stellt insbesondere für Herausgeber von nicht-affiliierten Zeitschriften (also Zeitschriften, die nicht von einem Verlag oder einer Bibliothek unterstützt werden eine interessante Option dar, birgt aus Sicht der Herausgeber aber auch die Gefahr des Verlusts der Unabhängigkeit und bedeutet für sie zusätzlichen Arbeitsaufwand und/oder Kosten. The article describes research on the publication of open access journals at the University of Zurich, Switzerland. In the course of the study, the needs of open access journals, or rather the needs of their respective editors, were evaluated. Based on these perceived needs, the author discusses what kind of publishing support services academic libraries should offer. The study comprised two approaches: a comprehensive online

  15. Cerebrolysin bei Schädel-Hirn-Trauma - Eine neurotrope und neurogene Substanz in der Initialbehandlung akuter Schädel-Hirn-Verletzungen

    OpenAIRE

    König P; Waanders R; Witzmann A; Lanner G; Haffner Z; Haninec P; Gmeinbauer R; Zimmermann-Meinzingen S

    2006-01-01

    Schädel-Hirn-Verletzungen (SHV, SHT) und daraus resultierende akute wie chronische Traumafolgen werden von der WHO als eine der größten Gesundheitsschädigungen weltweit angesehen. Alle Therapeutika, die dazu beitragen, die Folgen eines SHT zu reduzieren, sind daher von besonderem theoretischem wie praktischem Interesse. Cerebrolysin ist ein standardisiert aus Schweinehirn gewonnenes Peptidgemisch, dessen Eiweißkörper aufgrund ihres niedrigen Molekulargewichtes die Bluthirnschranke zu passie...

  16. Ein Lehrbuch über Psychiatrie und Psychotherapie – Geschlechtsunterschiede unter der Lupe? A Textbook for Psychiatry and Psychotherapy—Gender Differences under the Microscope?

    OpenAIRE

    Isabella Heuser; Nicole C. Schommer

    2007-01-01

    Anke Rohde und Andreas Marneros haben sich ein hohes Ziel gesetzt: ein übersichtliches Lehrbuch für Psychiatrie und Psychotherapie, das erstmals eine systematische Zusammenstellung des Wissens über geschlechtsspezifische Aspekte von Symptomatologie, Epidemiologie, Diagnostik, Pharmakotherapie und Psychotherapie psychischer Störungen enthält. Bemerkenswert ist dabei zweierlei: Erstens werden bei der Betrachtung geschlechtsspezifischer Unterschiede im Sinne der Genderforschung Frauen und Männer...

  17. Schneller, höher, stärker... im globalen Vergleich: eine empirische Analyse der Olympischen Spiele 2010/2012

    OpenAIRE

    Pospisil, Jan

    2012-01-01

    "Die USA und China im Kampf um die globale Vormachtstellung im Wettbewerb mit 202 anderen Staaten: wie kaum ein anderes Ereignis verdichten Olympische Spiele die internationalen Machtkonstellationen auf einen zeitlich, räumlich und thematisch eng begrenzten Raum. Eine vertiefende empirische Analyse der Resultate liefert daher auch erhellende Erkenntnisse über die gegenwärtige Verfasstheit des internationalen Systems. Auf Basis eines umfassenden Datensatzes der Ergebnisse der Sommerspiele von ...

  18. Ich ersetze ein Auto: Elektro-Lastenräder für den klimafreundlichen Einsatz im Kuriermarkt. Vorhaben 03KSF029 der Nationalen Klimaschutzinitiative des BMUB. Schlussbericht

    OpenAIRE

    Gruber, Johannes

    2015-01-01

    Status quo Ehrgeizige Klimaschutzziele und ein gleichzeitig kontinuierlich wachsendes Verkehrsaufkommen im städtischen Güterverkehr machen die Entwicklung und den Test von neuen Belieferungskonzepten auf der „letzten Meile“ notwendig. Eine mögliche Maßnahme zur Emissionsreduktion ist der Einsatz von Elektro-Lastenrädern für Kurierdienstleistungen. Ziel Das Projekt "Ich ersetze ein Auto" hatte den Anspruch, Elektro-Lastenräder als innovative und umweltfreundliche Fahrzeugkategorie im...

  19. Zentralnervöse Verarbeitung von essensrelevanten Reizen bei Patienten mit Diabetes mellitus Typ 2 – eine fMRT-Studie

    OpenAIRE

    Klamer, Silke

    2009-01-01

    Diabetes mellitus Typ 2 wird aufgrund weltweit zunehmender Inzidenz bereits in naher Zukunft eine der führenden Ursachen von Morbidität und Mortalität darstellen. Das Risiko diabetesassoziierter Folgeerkrankungen kann jedoch durch eine erfolgreiche Modifikation der Essgewohnheiten anhand spezifischer Ernährungsempfehlungen reduziert werden. Allerdings haben viele Patienten Schwierigkeiten, diese Diätvorschriften dauerhaft einzuhalten. Bereits bei Gesunden führen eine temporäre Essensdeprivati...

  20. "... ein stattlicher schwäbischer Ritter, kühn und tapfer ..." : Johann Gottfried Pahls Ritterroman "Ulrich von Rosenstein" (Basel 1795) im Internet

    OpenAIRE

    Graf, Klaus

    2010-01-01

    "An der nördlichen Grenze des Aalbuchs, wo sich das Gebürge in den Gauen, die der Kocher und die Rems bewässern verliehrt, erhebt sich an der Spitze eines in das Thal hervorspringenden Hügels, kühn und trotzig, ein ungeheurer Felsen, auf drei Seiten durch senkrechte Wände unzugänglich, und auf der vierten, durch einen schmalen Fußsteig mit der Ebene des Gebürgs verbunden. Eine hohe Mauer, aus mächtigen Quadern aufgeführt, und an der westlichen Eke ein runder Thurm, stark verletzt durch den Za...