WorldWideScience

Sample records for benzimidazole-2-acetic acid synthesis

  1. Levulinic acid in organic synthesis

    International Nuclear Information System (INIS)

    Timokhin, Boris V; Baransky, V A; Eliseeva, G D

    1999-01-01

    Data concerning the methods of synthesis, chemical transformations and application of levulinic acid are analysed and generalised. The wide synthetic potential of levulinic acid, particularly as a key compound in the synthesis of various heterocyclic systems, saturated and unsaturated ketones and diketones, difficultly accessible acids and other compounds is demonstrated. The accessibility of levulinic acid from hexose-containing wood-processing and agricultural wastes is noted. The bibliography includes 260 references.

  2. Conjugated Fatty Acid Synthesis

    Science.gov (United States)

    Rawat, Richa; Yu, Xiao-Hong; Sweet, Marie; Shanklin, John

    2012-01-01

    Conjugated linolenic acids (CLNs), 18:3 Δ9,11,13, lack the methylene groups found between the double bonds of linolenic acid (18:3 Δ9,12,15). CLNs are produced by conjugase enzymes that are homologs of the oleate desaturases FAD2. The goal of this study was to map the domain(s) within the Momordica charantia conjugase (FADX) responsible for CLN formation. To achieve this, a series of Momordica FADX-Arabidopsis FAD2 chimeras were expressed in the Arabidopsis fad3fae1 mutant, and the transformed seeds were analyzed for the accumulation of CLN. These experiments identified helix 2 and the first histidine box as a determinant of conjugase product partitioning into punicic acid (18:3 Δ9cis,11trans,13cis) or α-eleostearic acid (18:3 Δ9cis,11trans,13trans). This was confirmed by analysis of a FADX mutant containing six substitutions in which the sequence of helix 2 and first histidine box was converted to that of FAD2. Each of the six FAD2 substitutions was individually converted back to the FADX equivalent identifying residues 111 and 115, adjacent to the first histidine box, as key determinants of conjugase product partitioning. Additionally, expression of FADX G111V and FADX G111V/D115E resulted in an approximate doubling of eleostearic acid accumulation to 20.4% and 21.2%, respectively, compared with 9.9% upon expression of the native Momordica FADX. Like the Momordica conjugase, FADX G111V and FADX D115E produced predominantly α-eleostearic acid and little punicic acid, but the FADX G111V/D115E double mutant produced approximately equal amounts of α-eleostearic acid and its isomer, punicic acid, implicating an interactive effect of residues 111 and 115 in punicic acid formation. PMID:22451660

  3. Dibutylphosphoric acid synthesis

    International Nuclear Information System (INIS)

    Elias, H.; Boumaout, R.; Kellou, N.; Amedjkouh, A.; Hamidi, A.

    1995-09-01

    This work consists on the synthesis of dibutylphosphoric acis (DBP) by reaction of butanol with phosphorus pentoxid and on its separation by liquid-liquid extraction. It also deals with the characterization of DBP by some physicochemical analysis methods such as : chromatography, pH-metry and infrared and ultraviolet spectrophotometries. this study showed essentialy, that DBP can be formed in an appreciable amount (55%) when the reaction is realised with butanol/pentoxid molar ratio upper than 3 at temperature of 95 C

  4. Synthesis of aminoaldonic acids

    DEFF Research Database (Denmark)

    Jørgensen, Christel Thea

    With the aim of synthesising aminoaldonic acids, two 2-acetamido-2-deoxyaldonolactones with D-galacto (6) and D-arabino (11) configuration were prepared from acetylated sugar formazans in analogy with a known procedure. Empolying the same procedure to acetylated sugar phenylhydrazones gave mixtures......,4-lactone, respectively. A 2,3-aziridino-2,3-dideoxypentonamide 70 was also prepared from D-glucono-1,5-lactone. The lactones were converted into methyl 3,4-O-isopropylidene-2-O-sulfonyl esters 42, 50, 62 and 68, which upon treatment with concentrated aqueous ammonia yielded the aziridino compounds...... and 82, respectively. The aminolactone 84 was converted into the corresponding amino sugar 89.With the aim of synthesising substrates for the Pictet-Spengler reaction three 4-aldehydo acetamidodideoxytetronolactones 92, 97 and 103 were prepared by periodate cleavage of the corresponding hexonolactones...

  5. Fatty acid synthesis by spinach chloroplasts, 2

    International Nuclear Information System (INIS)

    Yamada, Mitsuhiro; Nakamura, Yasunori

    1975-01-01

    By incorporation of 3 H 2 O into the fatty acid chain in the presence of unlabelled precursor, we showed that fatty acids are synthesized from PGA, PEP and pyruvate by intact spinach chloroplasts in the light. 13 C-tracer experiments confirmed that 1-C of pyruvate is decarboxylated and 2-C is incorporated into fatty acids by the chloroplasts. The patterns of fatty acids synthesized from PGA and pyruvate were the same as that from acetate. The highest rate of fatty acid synthesis was reached at the physiological concentration of PGA (3 mM) and pyruvate (1 mM). These results indicate the operation of the following path in the chloroplasts in light: PGA→PEP→pyruvate→acetylCoA→fatty acids. Since citrate and OAA were much less active and malate and glyoxylate were inert as precursors for fatty acid synthesis, PEP or pyruvate carboxylation, citrate lyase reaction and malate synthetase reaction are not involved in the formation of acetylCoA and fatty acids. Since pyruvate was much more effective as a substrate for fatty acid synthesis than lactate, acetaldehyde or acetate, direct decarboxylation path is considered to be the primary path from pyruvate to acetylCoA. The insignificant effect of chloroplast-washing on fatty acid synthesis from PGA and pyruvate indicates that the glycolytic path from PGA to pyruvate is associated with the chloroplasts. Since pyruvate was more effectively incorporated into fatty acids than acetylCoA, it is unlikely that pyruvate decarboxylation to acetylCoA is due to mitochondria contaminating the chloroplast preparation. On the basis of measurements of 3 H 2 O incorporation in the light and dark, the activity of fatty acid synthesis in spincah leaves appears to be shared by the activities in chloroplasts (87%) and other organelles (13%). (author)

  6. Synthesis of derivatives of tetronic acid and pulvinic acid. Total synthesis of norbadione A

    International Nuclear Information System (INIS)

    Mallinger, A.

    2008-11-01

    When vegetables like mushrooms are contaminated by radioactive caesium 137, this radioactive caesium is associated to norbadione A, a natural pigment present in two mushroom species and which can be used as a caesium decorporation agent or maybe as protection agent against ionizing radiations. Within this perspective, this research report describes the biosynthesis and the structure and properties of the norbadione A and of pulvinic acids (physicochemical properties, anti-oxidizing properties). Then, it presents the various tetronic acids (3-acyl-, 3-alkyl-, 3-alkoxy-, 3-aryl-tetronic acids and non 3-substituted tetronic acids), their synthesis path as they are described in the literature, and presents a new synthesis approach using a tandem reaction (with different esters or hydroxy esters) and the synthesis of tetronic acids. The author also proposes a new synthesis way for methyl pulvinates, and finally reports the work on the development of a total synthesis of the norbadione A

  7. Synthesis of Trishomocubane Amino Acid Derivatives | Govender ...

    African Journals Online (AJOL)

    The synthesis of four novel trishomocubane amino acid derivatives is described. The hydantoin precursor and bis-Boc protected hydantoin (>95% yield) were previously reported. A mild hydrolysis of the bis-Boc hydantoin with lithium hydroxide at room temperature quantitatively yielded the corresponding novel cage amino ...

  8. Synthesis of carbon-13-labeled tetradecanoic acids.

    Science.gov (United States)

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines.

  9. Benzene-free synthesis of adipic acid.

    Science.gov (United States)

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  10. A new regulatory mechanism for bacterial lipoic acid synthesis

    OpenAIRE

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60?years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physi...

  11. Chemistry of Fluorinated Carbon Acids: Synthesis, Physicochemical Properties, and Catalysis.

    Science.gov (United States)

    Yanai, Hikaru

    2015-01-01

    The bis[(trifluoromethyl)sulfonyl]methyl (Tf2CH; Tf=SO2CF3) group is known to be one of the strongest carbon acid functionalities. The acidity of such carbon acids in the gas phase is stronger than that of sulfuric acid. Our recent investigations have demonstrated that this type of carbon acids work as novel acid catalysts. In this paper, recent achievements in carbon acid chemistry by our research group, including synthesis, physicochemical properties, and catalysis, are summarized.

  12. Negishi cross-couplings in the synthesis of amino acids.

    OpenAIRE

    Brittain, W.D.G.; Cobb, S.L.

    2018-01-01

    The Negishi cross-coupling is a powerful C–C bond-forming reaction widely utilised in many areas of organic synthesis. This review details the use of Negishi cross-couplings in the synthesis of unnatural amino acids. The application of this reaction in the preparation of aromatic, heteroaromatic, and, complex amino acid derivatives are reviewed and presented herein.

  13. Synthesis of Biobased Succinonitrile from Glutamic Acid and Glutamine

    NARCIS (Netherlands)

    Lammens, T.M.; Nôtre, Le J.; Franssen, M.C.R.; Scott, E.L.; Sanders, J.P.M.

    2011-01-01

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the

  14. Protein synthesis in the presence of carbamoyl-amino acids

    International Nuclear Information System (INIS)

    Kraus, L.M.; Stephens, M.C.

    1987-01-01

    The role of exogenous carbamoyl-amino acids in protein biosynthesis has been examined in vitro using a mixture of 14 C amino acids to label newly synthesized protein in human reticulocyte rich (8-18%) peripheral blood. Aliquots of the radiolabeled newly synthesized protein were acid precipitated, washed and the radioactivity measured. Control samples which measured the synthetic capacity of the blood were aliquots of the same blood- 14 C amino acid mixture without added carbamoyl-amino acids or cyanate. N-carbamoyl leucine alone or a 3 N-carbamoyl amino acid mixture of leucine, aspartic acid and tyrosine were used to test inhibition of protein synthesis. Also carbamoyl-amino acids were synthesized using cyanate and Pierce hydrolyzate amino acid calibration standards or the mixture of 14 C amino acids. In this system the carbamoylation of endogenous amino acids by cyanate up to 8 μmol/100μl showed a linear decrease in protein synthesis with time which is inversely related to the cyanate concentration. At greater cyanate levels the inhibition of protein synthesis reaches a plateau. When N-carbamoyl-amino acids only are present there is about a 50% decrease in the 14 C protein at 30 minutes as compared to the synthesis of 14 C protein without N-carbamoyl-amino acids. These results indicate that the presence of carbamoyl-amino acids interferes with protein synthesis

  15. High yield synthesis of some phosphonic acid derivatives as surface ...

    African Journals Online (AJOL)

    Efficient synthesis of novel 6-(2-bromo-2-methyl propanoyloxy)hexyl phosphonic acid, dodecane di-phosphonic acid, 6-(thiophene-3-carbonyloxy)hexyl phosphonic acid, octadecyl phosphonic acid and such other derivatives are reported here. These derivatives have a potential application as tethers to nanoparticle ...

  16. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    Science.gov (United States)

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  17. Synthesis of some labelled non-proteinogenic amino acids

    International Nuclear Information System (INIS)

    Adrianens, P.; Vanderhaeghe, H.

    1987-01-01

    The literature on the synthesis of labeled non-proteinogenic amino acids contains approximately 300 papers, whereas syntheses of labeled proteinogenic amino acids are dealt with in some 800-1000 publications. However, most of the methods described in this paper for the synthesis of non-proteinogenic amino acids are also used for the preparation of the essential amino acids addition, the first category also contains β, γ...amino acids, seleno amino acids, N-methyl and α-methyl amino acids and sometimes have atoms or groups which are not present in the protein building blocks. Furthermore the latter group is more easily available so that methods for synthesis of non-proteinogenic amino acids are more needed

  18. SYNTHESIS OF FLAVANONE-6-CARBOXYLIC ACID DERIVATIVES FROM SALICYLIC ACID DERIVATIVE

    OpenAIRE

    Mardjan, Muhammad Idham Darussalam; Ambarwati, Retno; Matsjeh, Sabirin; Wahyuningsih, Tutik Dwi; Haryadi, Winarto

    2012-01-01

    Synthesis of flavanone-6-carboxylic acid derivatives had been conducted via the route of chalcone. The synthesis was carried out from salicylic acid derivative, i.e. 4-hydroxybenzoic acid, via esterification, Fries rearrangement, Claisen-Schmidt condensation and 1,4-nucleophilic addition reactions. Structure elucidation of products was performed using FT-IR, 1H-NMR, GC-MS and UV-Vis spectrometers. Reaction of 4-hydroxybenzoic acid with methanol catalyzed with sulfuric acid produced methyl 4-h...

  19. Methane Sulphonic Acid is Green Catalyst in Organic Synthesis

    OpenAIRE

    Pramod Kulkarni

    2015-01-01

    Methane sulphonic acid is an alkanesulphonic acid and its chemical formula is CH3SO3H. MSA is a strong acid having pKa= 1.9 and completely ionized in 0.1 M in an aqueous solution and has small affinity to oxidize organic compounds, less corrosive and toxic than other mineral acids. MSA is also biodegradable and not evolve toxic gases. Therefore MSA is considered as green acid. Therefore its use in organic synthesis attracts many chemists to use in organic synthesis. In this review we describe...

  20. Succinct synthesis of saturated hydroxy fatty acids and

    DEFF Research Database (Denmark)

    Kaspersen, Mads Holmgaard; Jenkins, Laura; Dunlop, Julia

    2017-01-01

    Saturated hydroxy fatty acids make up a class of underexplored lipids with potentially interesting biological activities. We report a succinct and general synthetic route to saturated hydroxy fatty acids hydroxylated at position 6 or higher, and exemplify this with the synthesis of hydroxylauric...... acids. All regioisomers of hydroxylauric acids were tested on free fatty acid receptors FFA1, FFA4 and GPR84. The results show that the introduction of a hydroxy group and its position have a high impact on receptor activity....

  1. Synthesis of 2-Diethyl- and 2-Diisopropylaminoethanesulfonic Acids

    National Research Council Canada - National Science Library

    Hsu, Fu-Lian

    1997-01-01

    Methods for the synthesis of 2-diethyl- and diisopropylaminoethanesulfonic acids have been developed by the reaction of the corresponding 2-aminoethyl chloride hydrochloride and sodium sulfite in water at 110 deg C...

  2. CYCLOSPORINE-A BLOCKS BILE-ACID SYNTHESIS IN CULTURED-HEPATOCYTES BY SPECIFIC-INHIBITION OF CHENODEOXYCHOLIC ACID SYNTHESIS

    NARCIS (Netherlands)

    PRINCEN, HMG; WOLTHERS, BG; VONK, RJ; KUIPERS, F

    1991-01-01

    Bile acid synthesis, determined by conversion of [4-C-14]cholesterol into bile acids in rat and human hepatocytes and by measurement of mass production of bile acids in rat hepatocytes, was dose-dependently decreased by cyclosporin A, with 52% (rat) and 45% (human) inhibition at 10-mu-M. The

  3. Prebiotic synthesis of carboxylic acids, amino acids and nucleic acid bases from formamide under photochemical conditions⋆

    Science.gov (United States)

    Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele

    2017-07-01

    The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.

  4. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    Science.gov (United States)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  5. Rewiring protein synthesis: From natural to synthetic amino acids.

    Science.gov (United States)

    Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang

    2017-11-01

    The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Mitochondrial Fatty Acid Synthesis Type II: More than Just Fatty Acids*

    OpenAIRE

    Hiltunen, J. Kalervo; Schonauer, Melissa S.; Autio, Kaija J.; Mittelmeier, Telsa M.; Kastaniotis, Alexander J.; Dieckmann, Carol L.

    2009-01-01

    Eukaryotes harbor a highly conserved mitochondrial pathway for fatty acid synthesis (FAS), which is completely independent of the eukaryotic cytosolic FAS apparatus. The activities of the mitochondrial FAS system are catalyzed by soluble enzymes, and the pathway thus resembles its prokaryotic counterparts. Except for octanoic acid, which is the direct precursor for lipoic acid synthesis, other end products and functions of the mitochondrial FAS pathway are still largel...

  7. Concise synthesis of a novel antifungal agent 4-methoxydecanoic acid

    Directory of Open Access Journals (Sweden)

    Pagudala Narsimha

    2013-12-01

    Full Text Available 4-Methoxy decanoic acid is belongs to a fatty acid family and has a novel anti- fungal activity. The aliphatic molecule has been synthesized in seven steps with an overall yield 41%. The synthesis was started from a commercially available epichloro hydrin and all the reactions were very clean.

  8. Unsaturated fatty acid: Metabolism, synthesis and gene regulation ...

    African Journals Online (AJOL)

    In both plants and animals, unsaturated fatty acids are considered to be essential membrane components. Also they play key roles in many cellular events. The synthesis and metabolism of unsaturated fatty acid are very complex processes, involving a variety of enzymes and regulated pathways. Most recently, research has ...

  9. Synthesis of fatty acid starch esters in supercritical carbon dioxide

    NARCIS (Netherlands)

    Muljana, Henky; van der Knoop, Sjoerd; Keijzer, Danielle; Picchioni, Francesco; Janssen, Leon P. B. M.; Heeres, Hero J.

    2010-01-01

    This manuscript describes an exploratory study on the synthesis of fatty acid/potato starch esters using supercritical carbon dioxide (scCO(2)) as the solvent. The effects of process variables such as pressure (6-25 MPa), temperature (120-150 degrees C) and various basic catalysts and fatty acid

  10. Acetylsalicylic acid: Incoming 150 years of the first synthesis

    OpenAIRE

    Mijin Dušan Ž.; Stanković Milena; Petrović Slobodan D.; Blagojević Milorad

    2002-01-01

    Acetylsalicylic acid is one of the most fascinating and versatile drugs known to medicine, as well as one of the oldest. Acetylsalicylic acid is a drug which is safe, with analgetic, antirheumatic, anti-inflammatory antiplatelet and antithrombotic action. It may be applied not only in clinical practice, but also as prevention. The first known use of an acetylsalicylic acid-like preparation can be traced to ancient Greece. In 1853 Charles Gerhardt published the first synthesis of acetylsalicyl...

  11. Synthesis of [1-14C] palmitic acid

    International Nuclear Information System (INIS)

    Tian Yuan; Han Peizhen; Tian Shuhao

    1997-01-01

    The synthesis of [1- 14 C] palmitic acid via Grignard Reaction is reported. The carbon-C 14 dioxide was liberated by dropping sulfuric acid onto barium carbonate-C 14 . The yield of [1- 14 C] palmitic acid was 44.8%. A radiochemical purity of more than 99.5% was determined by HPLC and the product was proved to be free of impurity by TLC

  12. Synthesis of L-2-amino-8-oxodecanoic acid: an amino acid component of apicidins

    OpenAIRE

    Linares de la Morena, María Lourdes; Agejas Chicharro, Francisco Javier; Alajarín Ferrández, Ramón; Vaquero López, Juan José; Álvarez-Builla Gómez, Julio

    2001-01-01

    The synthesis Of L-2-amino-8-oxodecanoic acid (Aoda) is described. This is a rare amino acid component of apicidins, a family of new cyclic tetrapeptides, inhibitors of histone deacetylase. Aoda was synthesised in seven steps from L-glutamic acid along with some derivatives. Universidad de Alcalá Fundación General de la Universidad de Alcalá FEDER

  13. Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.

    Science.gov (United States)

    Jiang, Jianghui; Xu, Jiaxi

    2017-04-16

    4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.

  14. Synthesis and anticonvulsant activity of novel bicyclic acidic amino acids

    DEFF Research Database (Denmark)

    Conti, Paola; De Amici, Marco; Joppolo Di Ventimiglia, Samuele

    2003-01-01

    Bicyclic acidic amino acids (+/-)-6 and (+/-)-7, which are conformationally constrained homologues of glutamic acid, were prepared via a strategy based on a 1,3-dipolar cycloaddition. The new amino acids were tested toward ionotropic and metabotropic glutamate receptor subtypes; both of them...

  15. Synthesis of High Purity Nonsymmetric Dialkylphosphinic Acid Extractants.

    Science.gov (United States)

    Wang, Junlian; Xie, Meiying; Liu, Xinyu; Xu, Shengming

    2017-10-19

    We present the synthesis of (2,3-dimethylbutyl)(2,4,4'-trimethylpentyl)phosphinic acid as an example to demonstrate a method for the synthesis of high purity nonsymmetric dialkylphosphinic acid extractants. Low toxic sodium hypophosphite was chosen as the phosphorus source to react with olefin A (2,3-dimethyl-1-butene) to generate a monoalkylphosphinic acid intermediate. Amantadine was adopted to remove the dialkylphosphinic acid byproduct, as only the monoalkylphosphinic acid can react with amantadine to form an amantadine∙mono-alkylphosphinic acid salt, while the dialkylphosphinic acid cannot react with amantadine due to its large steric hindrance. The purified monoalkylphosphinic acid was then reacted with olefin B (diisobutylene) to yield nonsymmetric dialkylphosphinic acid (NSDAPA). The unreacted monoalkylphosphinic acid can be easily removed by a simple base-acid post-treatment and other organic impurities can be separated out through the precipitation of the cobalt salt. The structure of the (2,3-dimethylbutyl)(2,4,4'-trimethylpentyl)phosphinic acid was confirmed by 31 P NMR, 1 H NMR, ESI-MS, and FT-IR. The purity was determined by a potentiometric titration method, and the results indicate that the purity can exceed 96%.

  16. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    International Nuclear Information System (INIS)

    Pooler, P.A.; Duane, W.C.

    1988-01-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from [26-14C]cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man

  17. Biobased synthesis of acrylonitrile from glutamic acid

    NARCIS (Netherlands)

    Notre, le J.E.L.; Scott, E.L.; Franssen, M.C.R.; Sanders, J.P.M.

    2011-01-01

    Glutamic acid was transformed into acrylonitrile in a two step procedure involving an oxidative decarboxylation in water to 3-cyanopropanoic acid followed by a decarbonylation-elimination reaction using a palladium catalyst

  18. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    Science.gov (United States)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  19. Synthesis of new fatty acids amides from aminolysis of fatty acid methyl esters (FAMEs)

    International Nuclear Information System (INIS)

    Lopes, Carolina R.; Montes D'Oca, Caroline da Ros; Duarte, Rodrigo da C.; Kurz, Marcia H.S.; Primel, Ednei G.; Clementin, Rosilene M.; Villarreyes, Joaquin Ariel M.; Montes D'Oca, Marcelo G.

    2010-01-01

    Recent biochemical and pharmacological studies have led to the characterization of different fatty acid amides as a new family of biologically active lipids. Here, we describe the synthesis of new amides from C16:0, 18:0, 18:1 and 18:1, OH fatty acids (FFA) families with cyclic and acyclic amines and demonstrate for the first time that these compounds produce cytotoxic effects. Application of this method to the synthesis of fatty acid amides was performed using the esters aminolysis as a key step and various carboxylic amides were prepared in good yield from fatty acid methyl esters (FAMEs). (author)

  20. New hydrazones of ferulic acid: synthesis, characterization and biological activity.

    Science.gov (United States)

    Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa

    2014-01-01

    The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.

  1. Magnetic solid acid catalyst for biodiesel synthesis from waste oil

    International Nuclear Information System (INIS)

    Li, Junqiao; Liang, Xuezheng

    2017-01-01

    Highlights: • A new magnetic solid acid has been synthesized. • A new solid acid showed high activities for biodiesel synthesis from waste oils under mild condition. • A simple magnetic separation and high stability were the key properties of the new catalyst. - Abstract: A new magnetic solid acid catalyst was synthesized by immobilizing an ionic liquid precursor obtained from (3-aminopropyl)trimethoxysilane onto a magnetic core. The magnetic solid acid catalyst has a core–shell structure, and the acid sites on the shell were easily accessible to reactants. The catalytic activities of the magnetic solid acid were investigated by biodiesel synthesis from waste oils. The solid acid exhibited a higher activity than traditional acid catalysts and the ionic liquid precursor. The core–shell structure and magnetic attraction between the particles provided strong ionic interactions, resulting in the high activity and stability. The main characteristics of the magnetic solid acid catalyst were as follows: easily accessible acidic sites, simple magnetic separation and high waste oil utilization.

  2. Acetylsalicylic acid: Incoming 150 years of the first synthesis

    Directory of Open Access Journals (Sweden)

    Mijin Dušan Ž.

    2002-01-01

    Full Text Available Acetylsalicylic acid is one of the most fascinating and versatile drugs known to medicine, as well as one of the oldest. Acetylsalicylic acid is a drug which is safe, with analgetic, antirheumatic, anti-inflammatory antiplatelet and antithrombotic action. It may be applied not only in clinical practice, but also as prevention. The first known use of an acetylsalicylic acid-like preparation can be traced to ancient Greece. In 1853 Charles Gerhardt published the first synthesis of acetylsalicylic acid. Felix Hoffmann, a chemist for Friedrich Bayer, a German dye company obtained a patent on acetylsalicylic acid some 40 years later. Bayer coined the name Aspirin for the new product. The 20 in century was the century in which many researchers in many companies tried to improve the synthesis of acetylsalicylic acid not only in terms of yield but also purity. This paper describes the history, use, mechanism of action, synthesis and production as well as the purification and stability of acetylsalicylic acid.

  3. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    Science.gov (United States)

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  4. Pimelic acid, the first precursor of the Bacillus subtilis biotin synthesis pathway, exists as the free acid and is assembled by fatty acid synthesis.

    Science.gov (United States)

    Manandhar, Miglena; Cronan, John E

    2017-05-01

    Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.

  5. Modular Regiospecific Synthesis of Nitrated Fatty Acids

    DEFF Research Database (Denmark)

    Hock, Katharina J.; Grimmer, Jennifer; Göbel, Dominik

    2016-01-01

    Endogenous nitrated fatty acids are an important class of signaling molecules. Herein a modular route for the efficient and regiospecific preparation of nitrooleic acids as well as various analogues is described. The approach is based on a simple set of alkyl halides as common building blocks...

  6. Uronic Acids in Oligosaccharide and Glycoconjugate Synthesis

    NARCIS (Netherlands)

    Codee, Jeroen D. C.; Christina, Alphert E.; Walvoort, Marthe T. C.; Overkleeft, Herman S.; Van der Marel, Gijsbert A.; FraserReid, B; Lopez, JC

    2011-01-01

    This chapter describes the assembly of uronic acid containing oligosaccharides and glycoconjugates. Two strategies are available to access these target molecules, namely a pre-glycosylation oxidation approach, in which uronic acid building blocks are used, and a post-glycosylation oxidation

  7. Kynurenic acid synthesis by human glioma

    DEFF Research Database (Denmark)

    Vezzani, A; Gramsbergen, J B; Versari, P

    1990-01-01

    Biopsy material from human gliomas obtained during neurosurgery was used to investigate whether pathological human brain tissue is capable of producing kynurenic acid (KYNA), a natural brain metabolite which can act as an antagonist at excitatory amino acid receptors. Upon in vitro exposure to 40...

  8. Automatic synthesis apparatus for 11C-fatty acids

    International Nuclear Information System (INIS)

    Iida, Shigenori

    1981-01-01

    Such short-lived nuclides as 11 C, 13 N and 15 O for nuclear-medicine diagnosis are produced with the in-house cyclotrons in hospitals. After the production, their compounds are synthesized, and used for diagnosis immediately. Of these nuclides, 11 C with relatively long half-life is the most useful. In the synthesis of its compounds, first the rapid procedure is required. Then, the start from large quantity of radioactivity is frequently carried out to secure the activity sufficient for the imaging of organs. Therefore, the synthesis must be conducted by remote operation for the radiation protection of personnel. The development of an automatic synthesis apparatus for labeled-compounds is made along this line. Taking up the case of 11 C-fatty acids, the following matters are described: synthetic reactions, the synthesis of 11 C-fatty acids, an automatic synthesis apparatus for 11 C-fatty acid made for trial, and applications. (J.P.N.)

  9. Stereoselective synthesis of unsaturated α-amino acids.

    Science.gov (United States)

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  10. New catalytic processes for the synthesis of adipic acid

    OpenAIRE

    Raabová, Katerina

    2011-01-01

    The aim of my Ph.D. research was to study the new synthetic ways for the production of adipic acid. Three different pathways were studied: i) oxidation of cyclohexanone with molecular oxygen using Keggin – heteropolycompounds as the catalyst, ii) Baeyer – Villiger oxidation of cyclohexanone with hydrogen peroxide in the presence of two different heterogeneous catalysts, titanium silicalite and silica grafted decatungstate, iii) two step synthesis of adipic acid starting from cyclohexene ...

  11. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    International Nuclear Information System (INIS)

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-01-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution

  12. Succinic Acid Synthesis by Ethanol-Grown Yeasts

    Directory of Open Access Journals (Sweden)

    Svetlana V. Kamzolova

    2009-01-01

    Full Text Available The synthesis of succinic acid in ethanol-containing media has been tested in 32 yeasts of different genera (Debaryomyces, Candida, Pichia, Saccharomyces, Torulopsis. The capability of succinic acid synthesis was revealed in 29 strains, from which two most effective producers were selected. When grown in a fermentor under high aeration in mineral medium with pulsed addition of ethanol, the strain Candida catenulata VKM Y-5 produced succinic acid up to 5.2 g/L with mass yield of 32.6 % and energy yield of 14.8 %; the other strain, Candida zeylanoides VKM Y-2324, excreted 9.4 g/L of succinic acid with mass and energy yields of 39 and 17.8 %, respectively. It was indicated that succinic acid formation in the yeasts was accompanied by the synthesis of considerable amounts of malic acid, which was apparently due to a high activity of the glyoxylate cycle. Growth characteristics of both strains were studied in dependence on the concentrations of ethanol, zinc ions and nitrogen in the medium.

  13. An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid

    Directory of Open Access Journals (Sweden)

    Bisht Surendra S

    2006-12-01

    Full Text Available Abstract Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.

  14. Phenylboronic acid catalysed synthesis of 1, 5-benzodiazepines via ...

    Indian Academy of Sciences (India)

    Phenylboronic acid has been found to be an efficient catalyst for the synthesis of 1,5-benzodiazepine derivatives via cyclocondensation of -phenylenediamine and various ketones in good to excellent yields (82-91%) using acetonitrile as solvent at reflux condition. The remarkable advantages offered by this method are ...

  15. Phenylboronic acid catalysed synthesis of 1,5-benzodiazepines via ...

    Indian Academy of Sciences (India)

    J. Chem. Sci. Vol. 125, No. 4, July 2013, pp. 745–749. c Indian Academy of Sciences. Phenylboronic acid catalysed synthesis of 1,5-benzodiazepines via cyclocondensation of ... active compounds and gaining great consideration in the field of .... thesis of this heterocycles was accomplished by con- densation reaction of ...

  16. Acyl-meldrum's acid in regiospecific synthesis of isotopjcally ...

    African Journals Online (AJOL)

    Acyl-meldrum's acid in regiospecific synthesis of isotopjcally labelled compounds for polyketide biosynthetic studies. Isaiah o. Ndiege, James Staunton. Abstract. Bull. Chem. Soc. Ethiop. 1995, 9(1), 43-49. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  17. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  18. Phenylboronic acid catalysed synthesis of 1,5-benzodiazepines via ...

    Indian Academy of Sciences (India)

    Phenylboronic acid has been found to be an efficient catalyst for the synthesis of 1,5-benzodiazepine derivatives via cyclocondensation of -phenylenediamine and various ketones in good to excellent yields (82-91%) using acetonitrile as solvent at reflux condition. The remarkable advantages offered by this method are ...

  19. A novel synthesis of chromone based unnatural -amino acid ...

    Indian Academy of Sciences (India)

    VENU KANDULA

    bromomethyl chromone has been described. Using this method ... inal work on synthesis of unnatural amino acids has been done by O'Donnell22 and ... To a solution of compound 6a (20 g, 147.12 mmol) in DMF. (57 mL, 735.02 mmol) was added ...

  20. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    Science.gov (United States)

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    Directory of Open Access Journals (Sweden)

    Akiyoshi Hoshino

    2009-06-01

    Full Text Available Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1 system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source and keto acids (oxylic acid sources. In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin.

  2. Stereoselective synthesis of stable-isotope-labeled amino acids

    International Nuclear Information System (INIS)

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-01-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the α-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids

  3. Synthesis and chirality of amino acids under interstellar conditions.

    Science.gov (United States)

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  4. Fatty Acid Synthesis by Indonesian Marine Diatom, Chaetoceros gracilis

    Directory of Open Access Journals (Sweden)

    ALBERTA RIKA PRATIWI

    2009-12-01

    Full Text Available Since the primary storage nutrients in diatoms consist of lipid, they are potential for the industrial fatty acid production. High value fatty acids include arachidonic acid, eicosapentaenoic acid and docosahexaenoic acid. This study aimed to analyze fatty acid synthesis by Chaetoceros gracilis diatom during growth. There was a large increase in lipid yield from 4pg cell−1 mass of lipid per cell at the exponential phase to 283pg cell−1 at stationary phase. The lipid concentrations also increased significantly from the stationary phase to the death phase, but not significantly from the end exponential phase to the stationary phase. The relative percentage of saturated fatty acid (SAFA of the total fatty acid was higher than that of monounsaturated fatty acid (MUFA and polyunsaturated fatty acid (PUFA at all of growth phase. The highest PUFA was found at stationary phase at the same time when SAFA was being the lowest. The majority of SAFA was palmitic acid (24.03–40.35%. MUFA contained significant proportion of oleic acid (19.6–20.9%. Oleic acid, linoleic acid and á-linolenic acid were found at every stage growth. These fatty acids are considered as precursor for production of long chain PUFA-Docosahexaenoic acid (DHA/22:6ù3 through series of desaturation and elongation step with all of desaturase enzyme (Ä8-D, Ä9-D, Ä12-D, Ä15-D, Ä17-D, Ä6-D, Ä5-D, and Ä4-D and elongase enzyme (E.

  5. Photolabile linker for the synthesis of hydroxamic acids

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to a photolabile hydroxamate linker based on the o - nitroveratryl group and its application for multistep solid-phase synthesis and controlled photolytic release of hydroxamic acids. The invention provides a method for producing a solid support comprising...... a hydroxylamine - functionalized photolabile linker, and the so produced hydroxylamine - functionalized photolabile solid support. The invention further provides a method for synthesizing a one-bead-one compound library of hydroxamic acid derivatives on a photolabile linker, as well as a method for screening...... a library of hydroxamic acid derivatives....

  6. Synthesis and antimicrobial activity of cholic acid hydrazone analogues.

    Science.gov (United States)

    Rasras, Anas J M; Al-Tel, Taleb H; Al-Aboudi, Amal F; Al-Qawasmeh, Raed A

    2010-06-01

    Synthesis and antimicrobial activity of cholic acid analogues 4a-t are reported. The synthesis of 4a-t was accomplished from ethylcholate 2. The hydrazone moiety was introduced via coupling of the cholic acid hydrazide (3) with appropriately functionalized aldehyde utilizing acetic acid as a catalyst. Quiet of interest in relation to the synthesized hydrazones is the formation of two rotamers s-cis.E and s-trans.E. Most compounds showed stronger antimicrobial activity against Gram-positive bacteria than Cefaclor and Cefixime. Compounds 4d, 4i and 4j indicated 15-fold stronger antimicrobial activities against Enterobacter faecalis compared to Cefaclor and Cefixime. Some of the synthesized compounds (e.g. 4a, 4c, 4d, 4i, and 4l) reflected two-folds less activity against Escherichia coli relative to Cefixime. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

  7. Transition Metal Catalyzed Synthesis of Carboxylic Acids, Imines, and Biaryls

    DEFF Research Database (Denmark)

    Santilli, Carola; Madsen, Robert

    Dehydrogenative synthesis of carboxylic acids catalyzed by a ruthenium N- heterocycliccarbene complex. A new methodology for the synthesis of carboxylic acids from primary alcohols and hydroxide has been developed. The reaction is catalyzed by the ruthenium N-heterocycliccarbene complex [RuCl2(Ii...... to the carboxylic acids can be explained by the involvement of a competing Cannizzaro reaction. The scope of the dehydrogenation was further extended to linear and branched saturated aliphatic alcohols, although longer reaction times are necessary to ensure complete substrate conversions. The kinetic isotope effect...... the carboxylate.  Manganese catalyzed radical Kumada-type reaction between aryl halidesand aryl Grignard reagents. The reaction between aryl halides and aryl Grignard reagents catalyzed by MnCl2 has been extended to several methyl-substituted aryl iodide reagents byperforming the reaction at 120 ˚C in a microwave...

  8. Boronic Acid Accelerated Three-Component Reaction for the Synthesis of α-Sulfanyl-Substituted Indole-3-acetic Acids.

    Science.gov (United States)

    Das, Amrita; Watanabe, Kenji; Morimoto, Hiroyuki; Ohshima, Takashi

    2017-11-03

    Boronic acid was used to accelerate a three-component reaction of indoles, thiols, and glyoxylic acids for the synthesis of α-sulfanyl-substituted indole-3-acetic acids. Boronic acid catalysis to activate the α-hydroxy group in α-hydroxycarboxylic acid intermediates and intramolecular assistance by free carboxylic acid were the keys to accelerating the product formation.

  9. High yielding synthesis of N-ethyl dehydroamino acids.

    Science.gov (United States)

    Monteiro, Luís S; Suárez, Ana S

    2012-10-01

    Recently we reported the use of a sequence of alkylation and dehydration methodologies to obtain N-ethyl-α, β-dehydroamino acid derivatives. The application of this N-alkylation procedure to several methyl esters of β,β-dibromo and β-bromo, β-substituted dehydroamino acids protected with standard amine protecting groups was subsequently reported. The corresponding N-ethyl, β-bromo dehydroamino acid derivatives were obtained in fair to high yields and some were used as substrates in Suzuki cross-coupling reactions to give N-ethyl, β,β-disubstituted dehydroalanine derivatives. Herein, we further explore N-ethylation of β-halo dehydroamino acid derivatives using triethyloxonium tetrafluoroborate as alkylating agent, but substituting N,N-diisopropylethylamine for potassium tert-butoxide as auxiliary base. In these conditions, for all β-halo dehydroamino acid derivatives, reactions were complete and the N-ethylated derivative could be isolated in high yield. This method was also applied for N-ethylation of non-halogenated dehydroamino acids. Again, with all compounds the reactions were complete and the N-ethyl dehydroamino acid derivatives could be isolated in high yields. Some of these N-ethyl dehydroamino acid methyl ester derivatives were converted in high yields to their corresponding acids and coupled to an amino acid methyl ester to give N-ethyl dehydrodipeptide derivatives in good yields. Thus, this method constitutes a general procedure for high yielding synthesis of N-ethylated dehydroamino acids, which can be further applied in peptide synthesis.

  10. Synthesis and characterization of Trichloroisocyanouric acid ...

    Indian Academy of Sciences (India)

    Abstract. Trichloroisocyanouric acid (TCCA)-functionalized mesoporous silica nanocomposites (SBA/. TCCA) were synthesized and characterized for the acylation of indole. The uniform incorporation of TCCA inside the SBA-15 matrix was confirmed by standard characterization techniques (PXRD, Adsorption studies,. FT-IR ...

  11. Synthesis and Characterization of Oleic Acid Stabilized ...

    African Journals Online (AJOL)

    Oleic acid stabilized magnetite nanocrystals have been synthesized by the organic phase thermal decomposition of iron oleate complex in 1-octadecene for potential application as magnetic resonance imaging (MRI) contrast agent. The synthetic process resulted in 13.5 and 15.1 nm highly monodisperse nanocrystals as ...

  12. The optimisation study of tbp synthesis process by phosphoric acid

    International Nuclear Information System (INIS)

    Amedjkouh, A.; Attou, M.; Azzouz, A.; Zaoui, B.

    1995-07-01

    The present work deals with the optimisation study of TBP synthesis process by phosphoric acid. This way of synthesis is more advantageous than POCL3 or P2O5 as phosphatant agents. these latters are toxic and dangerous for the environnement. The optimisation study is based on a series of 16 experiences taking into account the range of variation of the following parameters : temperature, pressure, reagents mole ratio, promoter content. the yield calculation is based on the randomisation of an equation including all parameters. the resolution of this equation gave a 30% TBP molar ratio. this value is in agreement with that of experimental data

  13. Synthesis of azido derivatives of mucobromic acid

    Directory of Open Access Journals (Sweden)

    N. Mbebe

    2013-04-01

    Full Text Available Mucobromic acid is a highly reactive multicentered molecule. It was converted to its corresponding but unstable diazido derivative by reaction with two equivalents of sodium azide. The resultant 3,4-diazido-5-hydroxyfuran-2(5H-one was obtained in moderate yield (42% but decomposed readily even at low temperatures. Its more stable analogue 3,4-diazido-5-methoxyfuran-2(5H-one was obtained in excellent yield after reacting 5-methoxy-3,4-dibromofuranone with two equivalents of sodium azide. The 4,5-dibromopyridazinones which are in effect masked mucobromic acid derivatives, underwent nucleophilic substitution reactions with various nucleophiles, including azides and afforded corresponding azidopyridazinones in good yields. The synthesized azido-furanone and pyridazinone derivatives are earmarked for click reactions.DOI: http://dx.doi.org/10.4314/bcse.v27i1.17

  14. Fatty acid effects on fibroblast cholesterol synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  15. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    Science.gov (United States)

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Synthesis and antifungal activity of new salicylic acid derivatives

    Directory of Open Access Journals (Sweden)

    Wodnicka Alicja

    2017-03-01

    Full Text Available A simple one-step procedure for synthesis of 1-methoxy-1-oxoalkan-2-yl salicylates and 1-methoxy-1-oxoalkan-2-yl 2-[(1-methoxy-1-oxoalkan-2-yloxy]benzoates by reaction of salicylic acid with several methyl 2-bromoalkanoates was developed. The reactions were carried out in N,N-dimethylformamide (DMF in the presence of anhydrous potassium carbonate. Conditions for regioselective synthesis of target compounds were established. The developed procedure could be easily applied in the industrial production process. The new salicylic acid derivatives were obtained with satisfactory yields and were characterized by MS and 1H NMR spectra. The fungicidal activity of the prepared compounds was tested in vitro against seven species of plant pathogenic fungi. The best results were observed for 1-methoxy-1-oxoalkan-2-yl salicylates which showed moderate or good activity against Botrytis cinerea and Rhizoctonia solani.

  17. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    Science.gov (United States)

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  18. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    Science.gov (United States)

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  19. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation

    OpenAIRE

    Cádiz, V.; Galià, M.; Ronda, J.C.; Lligadas, G.; Bordons, A.; Esteve-Zarzoso, B.; Lluch, C.

    2014-01-01

    10.1002/mabi.201400017 In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylen...

  20. Synthesis of pure monetite by heterogeneous acid-base reaction

    OpenAIRE

    Luis Carlos Moreno Aldana; Davier Olarte Cárdenas; Edgar Delgado Mejía

    2017-01-01

    Five variations of the monetite (M) synthesis were evaluated modifying the stirring, the phosphoric acid addition rate, the homogeneity and the drying temperature. Products were assessed by means of XRD, FTIR, SEM-EDS analysis and chemical assay of Ca/P (calcium by titration with potassium permanganate and phosphorus by colorimetric assessment of the molybdenum blue complex). X-ray diffraction, infrared spectroscopy and Ca/P ratio indicate that the synthesized phosphate corresponds to pure mo...

  1. Computer Aided Synthesis of Innovative Processes: Renewable Adipic Acid Production

    DEFF Research Database (Denmark)

    Rosengarta, Alessandro; Bertran, Maria-Ona; Manenti, Flavio

    2017-01-01

    A promising biotechnological route for the production of adipic acid from renewables has been evaluated, applying a systematic methodology for process network synthesis and optimization. The method allows organizing in a structured database the available knowledge from different sources...... (preliminary scientific studies, techno-economic process specifications), generating a network of process alternatives and solving it as a MILP. The best processing route provides also an estimate of the production cost of bio-adipic acid at the current state of the art, assessing the sensitivity...

  2. A new regulatory mechanism for bacterial lipoic acid synthesis.

    Science.gov (United States)

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  3. Facile Synthesis of Oleanolic Acid Monoglycosides and Diglycosides

    Directory of Open Access Journals (Sweden)

    Mao-Sheng Cheng

    2008-07-01

    Full Text Available Oleanolic acid and its glycosides are important natural products, possessing various attractive biological activities such as antitumor, antivirus and anti-inflammatory properties. In the present work, fifteen oleanolic acid saponins bearing various saccharide moieties, including 3-monoglycoside, 28-monoglycoside and 3,28-diglycoside, were easily synthesized in high yields. Benzyl was chosen as the protective group for the COOH(28 group, instead of commonly used methyl and allyl, to avoid difficulties in the final deprotection. Alkali-promoted condensation of the carboxylic acid with bromoglycosides was found to be more efficient in the synthesis of 28-glycosides. Two approaches were investigated and proved practicable in the preparation of 3,28- diglycosides. This method is suitable for preparing oleanolic acid glycosides with structural diversity for extensive biological evaluation and structure-activity relationship study, and it also apply new idea for the corresponding synthetic methods to the glycoside derivatives of other triterpenoid.

  4. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    Science.gov (United States)

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  5. Age-related changes in cyclic phosphatidic acid-induced hyaluronic acid synthesis in human fibroblasts.

    Science.gov (United States)

    Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko

    2018-01-01

    Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.

  6. Synthesis of Orthogonally Protected Muramic Acid Building Blocks for Solid Phase Peptide Synthesis

    Directory of Open Access Journals (Sweden)

    Kristina Vlahoviček-Kahlina

    2015-07-01

    Full Text Available Muramic acid is found in many peptide natural products containing oligo(polysaccharide moieties. Taking into consideration that the Fmoc methodology is routinely used for solid-phase peptide synthesis, preparation of orthogonally protected muramic acid building blocks for total solid-phase synthesis of these natural products is of particular practical importance. Herein a simple and efficient synthesis of benzyl 2-amino-4,6-O-benzylidene-3-O-[(R-1-carboxyethyl]-2-deoxy-N-9-fluorenylmethyloxycarbonyl-α-D-glucopyranoside (6 from N-acetylglucosamine (1 is described. Important improvements over previous synthetic approaches to glucopyranosides 2 (benzyl 2-acetamido-2-deoxy-α-D-glucopyranoside and 3 (benzyl 2-acetamido-4,6-O-benzylidene-2-deoxy-α-D-glucopyranoside, key building blocks in preparation of 6, include synthesis simplification and efficient isolation and purification. Optically pure (S-2-chloropropionic acid 7 was prepared and introduced to the positon 3-O of sugar moiety to give compound 4 (benzyl 2-acetamido-4,6-O-benzylidene-3-O-[(R-1-carboxyethyl]-2-deoxy-α-D-glucopyranoside with the (R-configuration of the lactyl side-chain in excellent overall yield and optical purity. Deacetylation of amino group gave compound 5 (benzyl 2-amino-4,6-O-benzylidene-3-O-[(R-1-carboxyethyl]-2-deoxy-α-D-glucopyranoside suitable for incorporation of the Fmoc protecting group to give protected muramic acid derivative 6, a useful building block in peptide synthesis.

  7. SYNTHESIS OF FLAVANONE-6-CARBOXYLIC ACID DERIVATIVES FROM SALICYLIC ACID DERIVATIVE

    Directory of Open Access Journals (Sweden)

    Muhammad Idham Darussalam Mardjan

    2012-02-01

    Full Text Available Synthesis of flavanone-6-carboxylic acid derivatives had been conducted via the route of chalcone. The synthesis was carried out from salicylic acid derivative, i.e. 4-hydroxybenzoic acid, via esterification, Fries rearrangement, Claisen-Schmidt condensation and 1,4-nucleophilic addition reactions. Structure elucidation of products was performed using FT-IR, 1H-NMR, GC-MS and UV-Vis spectrometers. Reaction of 4-hydroxybenzoic acid with methanol catalyzed with sulfuric acid produced methyl 4-hydroxybenzoate in 87% yield. The acid-catalyzed-acetylation of the product using acetic anhydride gave methyl 4-acetoxybenzoate in 75% yield. Furthermore, solvent-free Fries rearrangement of methyl 4-acetoxybenzoate in the presence of AlCl3 produced 3-acetyl-4-hydroxybenzoic acid as the acetophenone derivatives in 67% yield. Then, Claisen-Schmidt condensation of the acetophenone and benzaldehyde derivatives of p-anisaldehyde and veratraldehyde in basic condition gave 2'-hydroxychalcone-5'-carboxylic acid derivatives  in 81 and 71 % yield, respectively. Finally, the ring closure reaction of the chalcone yielded the corresponding flavanone-6-carboxylic acids in 67 and 59% yield, respectively.

  8. Synthesis of a tetrasaccharide fragment of hyaluronic acid having a glucuronic acid at the reducing end

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Slaghek, T.M.; Hyppönen, T.K.; Ogawa, T.; Kamerling, J.P.

    1993-01-01

    A stereocontrolled synthesis of a tetrasaccharide fragment of hyaluronic acid, beta-p-methoxyphenyl glycoside of beta-D-GlcNAc-(1¨4)-beta-D-GlcNAc-(1¨3)-beta-D-GlcNAc-(1¨4)-D-GlcA, is presented.

  9. Synthesis of derivatives of tetronic acid and pulvinic acid. Total synthesis of norbadione A; Synthese de derives de l'acide tetronique et de l'acide pulvinique. Synthese totale de la norbadione A

    Energy Technology Data Exchange (ETDEWEB)

    Mallinger, A

    2008-11-15

    When vegetables like mushrooms are contaminated by radioactive caesium 137, this radioactive caesium is associated to norbadione A, a natural pigment present in two mushroom species and which can be used as a caesium decorporation agent or maybe as protection agent against ionizing radiations. Within this perspective, this research report describes the biosynthesis and the structure and properties of the norbadione A and of pulvinic acids (physicochemical properties, anti-oxidizing properties). Then, it presents the various tetronic acids (3-acyl-, 3-alkyl-, 3-alkoxy-, 3-aryl-tetronic acids and non 3-substituted tetronic acids), their synthesis path as they are described in the literature, and presents a new synthesis approach using a tandem reaction (with different esters or hydroxy esters) and the synthesis of tetronic acids. The author also proposes a new synthesis way for methyl pulvinates, and finally reports the work on the development of a total synthesis of the norbadione A.

  10. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    Energy Technology Data Exchange (ETDEWEB)

    Mamani, J.B., E-mail: javierbm@einstein.br [Instituto do Cérebro-InCe, Hospital Israelita Albert Einstein-HIAE, 05651-901 São Paulo (Brazil); Costa-Filho, A.J. [Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto (Brazil); Cornejo, D.R. [Instituto de Física Universidade de São Paulo, USP, São Paulo (Brazil); Vieira, E.D. [Instituto de Física, Universidade Federal de Goiás, Goiânia (Brazil); Gamarra, L.F. [Instituto do Cérebro-InCe, Hospital Israelita Albert Einstein-HIAE, 05651-901 São Paulo (Brazil)

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  11. A Novel Approach in Cinnamic Acid Synthesis: Direct Synthesis of Cinnamic Acids from Aromatic Aldehydes and Aliphatic Carboxylic Acids in the Presence of Boron Tribromide

    Directory of Open Access Journals (Sweden)

    M. Onciu

    2005-02-01

    Full Text Available Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP and pyridine (Py as bases and N-methyl-2-pyrolidinone (NMP as solvent, at reflux (180-190°C for 8-12 hours.

  12. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    Science.gov (United States)

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity.

  13. [Synthesis and degradation of hyaluronic acid by bacteria of Streptococcus genus].

    Science.gov (United States)

    Beloded, A V; Samoĭlenko, I I; Tsepilov, R N

    2010-01-01

    Modern data on metabolism of hyaluronic acid by bacteria from Streptococcus genus are presented. Several species of bacteria forming capsule from hyaluronic acid, which is analogous to glycosaminoglycan of vertebrates, are considered. Different aspects of hyaluronic acid synthesis are described: biochemical synthesis pathway, genetic basis, regulation of expression of genes belonging to hyaluronic acid synthesis operon. Biological role and physiologic importance of hyaluronic acid for bacteria, including its role in overcoming immune barrier by pathogenic species, are discussed. Process of depolymerization of hyaluronic acid in presence of hyaluronatlyases secreted by certain streptococci is considered. Characteristic of streptococcal enzyme hyaluronatlyase, its mechanism of catalytic effect, and biological function are presented.

  14. Synthesis of pure monetite by heterogeneous acid-base reaction

    Directory of Open Access Journals (Sweden)

    Luis Carlos Moreno Aldana

    2017-01-01

    Full Text Available Five variations of the monetite (M synthesis were evaluated modifying the stirring, the phosphoric acid addition rate, the homogeneity and the drying temperature. Products were assessed by means of XRD, FTIR, SEM-EDS analysis and chemical assay of Ca/P (calcium by titration with potassium permanganate and phosphorus by colorimetric assessment of the molybdenum blue complex. X-ray diffraction, infrared spectroscopy and Ca/P ratio indicate that the synthesized phosphate corresponds to pure monetite. It was found that the most influential factors affecting composition, crystal size and Ca/P were stoichiometry and ballmilling mechanoactivation.

  15. Optimization of Butylphosphate synthesis from O-Phosphoric Acid

    International Nuclear Information System (INIS)

    Amedjkouh, A.; Attou, M.; Azzouz, A.; Zaoui, B.

    1995-07-01

    This work was carried out in order to confirm results of previous work and to enhance the yield of TBP synthesis. This, many reactions have been realised under differents experimental condition (temperature, acid/ alcool molar ratio, pressure and the quantity of promoter agent 'POCL3'). the TBP yield variations as function the experimental parameters, has been expressed, using the 2n factorial plan mathematical model. The experimental results were compared to those given by the theoritical model, and the optimal conditions were then drawn out

  16. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    Science.gov (United States)

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Synthesis and Antiangiogenic Properties of Tetrafluorophthalimido and Tetrafluorobenzamido Barbituric Acids.

    Science.gov (United States)

    Ambrożak, Agnieszka; Steinebach, Christian; Gardner, Erin R; Beedie, Shaunna L; Schnakenburg, Gregor; Figg, William D; Gütschow, Michael

    2016-12-06

    The development of novel thalidomide derivatives as immunomodulatory and anti-angiogenic agents has revived over the last two decades. Herein we report the design and synthesis of three chemotypes of barbituric acids derived from the thalidomide structure: phthalimido-, tetrafluorophthalimido-, and tetrafluorobenzamidobarbituric acids. The latter were obtained by a new tandem reaction, including a ring opening and a decarboxylation of the fluorine-activated phthalamic acid intermediates. Thirty compounds of the three chemotypes were evaluated for their anti-angiogenic properties in an ex vivo assay by measuring the decrease in microvessel outgrowth in rat aortic ring explants. Tetrafluorination of the phthalimide moiety in tetrafluorophthalimidobarbituric acids was essential, as all of the nonfluorinated counterparts lost anti-angiogenic activity. An opening of the five-membered ring and the accompanying increased conformational freedom, in case of the corresponding tetrafluorobenzamidobarbituric acids, was well tolerated. Their activity was retained, although their molecular structures differ in torsional flexibility and possible hydrogen-bond networking, as revealed by comparative X-ray crystallographic analyses. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Lactic acid demineralization of shrimp shell and chitosan synthesis

    Directory of Open Access Journals (Sweden)

    Alewo Opuada AMEH

    2015-05-01

    Full Text Available The use of lactic acid was compared to hydrochloric acid for shrimp shell demineralization in chitosan synthesis. Five different acid concentrations were considered for the study: 1.5M, 3.0M, 4.5M, 6.0M and 7.5M. After demineralization, the shrimp shell were deproteinized and subsequently deacetylated to produce chitosan using sodium hydroxide solution. The synthesized chitosan samples were characterized using solubility, FTIR, SEM, XRD and viscosity. The SEM, FTIR and XRD analysis indicated that chitosan was synthesized with a high degree of deacetylation (83.18±2.11 when lactic acid was used and 84.2±5.00 when HCl was used. The degree of deacetylation and the molecular weight of the chitosan samples were also estimated. ANOVA analysis (at 95% confidence interval indicated that acid type and concentration did not significantly affect the solubility, degree of deacetylation, viscosity and molecular weight of the chitosan within the range considered.

  19. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    Science.gov (United States)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  20. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    Science.gov (United States)

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  1. Proteasome inhibitor treatment reduced fatty acid, triacylglycerol and cholesterol synthesis.

    Science.gov (United States)

    Oliva, Joan; French, Samuel W; Li, Jun; Bardag-Gorce, Fawzia

    2012-08-01

    In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly downregulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to downregulate the enzyme 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were downregulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly downregulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one month and

  2. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    Directory of Open Access Journals (Sweden)

    Tonali eBlanco Ayala

    2015-05-01

    Full Text Available Kynurenic acid (KYNA, an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN by kynurenine aminotransferases (KATs. However, alternative routes, including KYNA formation from D-kynurenine (D-KYN by D-amino acid oxidase (DAAO and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS, have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO- and hydroxyl radicals (OH•, resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 µM each attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO- (25 µM potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO- but not from D-KYN + ONOO-. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO- and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 µM. Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative routes

  3. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    International Nuclear Information System (INIS)

    Amikam, D.; Benziman, M.

    1989-01-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of 32 P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with [ 14 C]glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes

  4. Synthesis of new indolecarboxylic acids related to the plant hormone indoleacetic acid IAA

    Directory of Open Access Journals (Sweden)

    Rosa Flávia A. F. da

    2003-01-01

    Full Text Available The synthesis of 5,6-methylenedioxy-indol-3-yl-methanoic acid 8 and 5,6-methylenedioxy-indol-3-yl-acetic acid 13 is described. Piperonal was employed as starting material, and the construction of the heterocyclic ring based on the Hemetsberger reaction of the corresponding beta-azidostyrene was highly regiospecific. Compound 8 was obtained as a key intermediate towards 13, and a Mannich reaction was used to introduce the required alkyl side chain. The route comprised eight steps giving 13 in 26% overall yield. The formation of the indolic ring via reductive cyclisation of o,beta-dinitrostyrene is also presented.

  5. Asymmetric synthesis of propargylamines as amino acid surrogates in peptidomimetics

    Directory of Open Access Journals (Sweden)

    Matthias Wünsch

    2017-11-01

    Full Text Available The amide moiety of peptides can be replaced for example by a triazole moiety, which is considered to be bioisosteric. Therefore, the carbonyl moiety of an amino acid has to be replaced by an alkyne in order to provide a precursor of such peptidomimetics. As most amino acids have a chiral center at Cα, such amide bond surrogates need a chiral moiety. Here the asymmetric synthesis of a set of 24 N-sulfinyl propargylamines is presented. The condensation of various aldehydes with Ellman’s chiral sulfinamide provides chiral N-sulfinylimines, which were reacted with (trimethylsilylethynyllithium to afford diastereomerically pure N-sulfinyl propargylamines. Diverse functional groups present in the propargylic position resemble the side chain present at the Cα of amino acids. Whereas propargylamines with (cycloalkyl substituents can be prepared in a direct manner, residues with polar functional groups require suitable protective groups. The presence of particular functional groups in the side chain in some cases leads to remarkable side reactions of the alkyne moiety. Thus, electron-withdrawing substituents in the Cα-position facilitate a base induced rearrangement to α,β-unsaturated imines, while azide-substituted propargylamines form triazoles under surprisingly mild conditions. A panel of propargylamines bearing fluoro or chloro substituents, polar functional groups, or basic and acidic functional groups is accessible for the use as precursors of peptidomimetics.

  6. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    Directory of Open Access Journals (Sweden)

    Kamran Jawed

    Full Text Available Short-chain fatty acids (SCFAs, such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product.

  7. Mechanisms of Ascorbic Acid Stimulation of Norepinephrine Synthesis in Neuronal Cells

    OpenAIRE

    May, James M.; Qu, Zhi-chao; Meredith, M. Elizabeth

    2012-01-01

    Ascorbic acid is well known to acutely stimulate norepinephrine synthesis in neurosecretory cells, but it has also been shown over several days to increase tyrosine hydroxylase mRNA and norepinephrine synthesis in cultured neurons. Since tyrosine hydroxylase is the rate-limiting step in catecholamine synthesis, an effect of ascorbate to increase tyrosine hydroxylase protein could contribute to its ability to increase or sustain catecholamine synthesis. Therefore, we evaluated whether tyrosine...

  8. Pd(II)/Bipyridine-Catalyzed Conjugate Addition of Arylboronic Acids to α,β-Unsaturated Carboxylic Acids. Synthesis of β-Quaternary Carbons Substituted Carboxylic Acids.

    Science.gov (United States)

    Liu, Rui; Yang, Zhenyu; Ni, Yuxin; Song, Kaixuan; Shen, Kai; Lin, Shaohui; Pan, Qinmin

    2017-08-04

    Pd(II)/bipyridine-catalyzed conjugate addition of arylboronic acids to α,β-unsaturated carboxylic acids (including β,β-disubstituted acrylic acids) was developed and optimized, which provided a mild and convenient method for the highly challenging synthesis of β-quaternary carbons substituted carboxylic acids.

  9. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    Science.gov (United States)

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    Science.gov (United States)

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  11. ETBE synthesis over silicotungstic acid and tungstophosphoric acid catalysts calcined at different temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Degirmenci, Levent; Oktar, Nuray; Dogu, Gulsen [Department of Chemical Engineering, Gazi University, 06570 Maltepe, Ankara (Turkey)

    2010-07-15

    Vapor phase ethyl tertiary butyl ether synthesis was investigated using heat treated heteropoly acid catalysts, namely silicotungtsic acid (STA) and tungstophosphoric acid-Keggin (TPA-K) and these results were compared with the results obtained with untreated catalysts. ETBE synthesis experiments showed that heat treatment of TPA-K at temperatures over 473 K had caused significant decrease of its catalytic activity. Activity of STA was more stable and deactivation of this catalyst was observed by heat treatment at 673 K and above. Heat treatment at high temperatures caused loss of constitutional water of STA and TPA-K, causing loss of protons, consequently the loss of acidity of the catalysts, resulting deactivation. FT-IR, TGA-DTA and DRIFTS analyses on pyridine-adsorbed catalysts supported the conclusions related to structural changes of STA and TPA-K with heat treatment. Highest ETBE yields were obtained at around 368 K, while at temperatures over 423 K formation of DEE and ethylene were observed due to dehydration of ethanol. (author)

  12. Xanthine oxidase catalyzes the synthesis of retinoic acid.

    Science.gov (United States)

    Taibi, G; Paganini, A; Gueli, M C; Ampola, F; Nicotra, C M

    2001-01-01

    Milk xanthine oxidase (xanthine: oxygen oxidoreductase; XO; EC 1.1.3.22) was found to catalyze the conversion of retinaldehyde to retinoic acid. The ability of XO to synthesize all trans-retinoic acid efficiently was assessed by its turnover number of 31.56 min-1, determined at pH 7.0 with 1 nM XO and all trans-retinaldehyde varying between 0.05 to 2 microM. The determination of both retinoid and purine content in milk was also considered in order to correlate their concentrations with kinetic parameters of retinaldehyde oxidase activity. The velocity of the reaction was dependent on the isomeric form of the substrate, the all trans- and 9-cis-forms being the preferred substrates rather than 13-cis-retinaldehyde. The enzyme was able to oxidize retinaldehyde in the presence of oxygen with NAD or without NAD addition. In this latter condition the catalytic efficiency of the enzyme was higher. The synthesis of retinoic acid was inhibited 87% and 54% by 4 microM and 2 microM allopurinol respectively and inhibited 48% by 10 microM xanthine in enzyme assays performed at 2 microM all trans-retinaldehyde. The Ki value determined for xanthine as an inhibitor of retinaldehyde oxidase activity was 4 microM.

  13. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    Directory of Open Access Journals (Sweden)

    Lei Anping

    2012-03-01

    Full Text Available Abstract Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP, 3-ketoacyl-ACP-synthase (KAS, and acyl-ACP thioesterase (FATA gene expression had significant correlations with monounsaturated FA (MUFA synthesis and polyunsaturated FA (PUFA synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production.

  14. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    Science.gov (United States)

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  15. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    Science.gov (United States)

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Studies on biphenyl disulphonic acid doped polyanilines: Synthesis ...

    Indian Academy of Sciences (India)

    zed protonic acids, such as camphorsulfonic acid, dodecyl- benzene sulfonic acid, para-toluene sulfonic acid, benzene sulfonic acid, sulfanilic acid, sulfamic acid, octyl-benzene sulfonic acid, sulfosalicylic acid or methane sulfonic acid as dopants (Epstein et al 1987; Li et al 1987; Dhawan and Trivedi 1991, 1992; Kobayashi ...

  17. Injury-induced inhibition of small intestinal protein and nucleic acid synthesis

    International Nuclear Information System (INIS)

    Carter, E.A.; Hatz, R.A.; Yarmush, M.L.; Tompkins, R.G.

    1990-01-01

    Small intestinal mucosal weight and nutrient absorption are significantly diminished early after cutaneous thermal injuries. Because these intestinal properties are highly dependent on rates of nucleic acid and protein synthesis, in vivo incorporation of thymidine, uridine, and leucine into small intestinal deoxyribonucleic acid, ribonucleic acid, and proteins were measured. Deoxyribonucleic acid synthesis was markedly decreased with the lowest thymidine incorporation in the jejunum (p less than 0.01); these findings were confirmed by autoradiographic identification of radiolabeled nuclei in the intestinal crypts. Protein synthesis was decreased by 6 h postinjury (p less than 0.01) but had returned to normal by 48 h. Consistent with a decreased rate of protein synthesis, ribonucleic acid synthesis was also decreased 18 h postinjury (p less than 0.01). These decreased deoxyribonucleic acid, ribonucleic acid, and protein synthesis rates are not likely a result of ischemia because in other studies of this injury model, intestinal blood flow was not significantly changed by the burn injury. Potentially, factors initiating the acute inflammatory reaction may directly inhibit nucleic acid and protein synthesis and lead to alterations in nutrient absorption and intestinal barrier function after injury

  18. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    OpenAIRE

    Heemstra, Jennifer M.; Liu, David R.

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  19. Reviewing the Tannic Acid Mediated Synthesis of Metal Nanoparticles

    International Nuclear Information System (INIS)

    Ahmad, T.

    2014-01-01

    Metal nanoparticles harbour numerous exceptional physiochemical properties absolutely different from those of bulk metal as a function of their extremely small size and large superficial area to volume. Naked metal nanoparticles are synthesized by various physical and chemical methods. Chemical methods involving metal salt reduction in solution enjoy an extra edge over other protocols owing to their relative facileness and capability of controlling particle size along with the attribute of surface tailoring. Although chemical methods are the easiest, they are marred by the use of hazardous chemicals such as borohydrides. This has led to inclination of scientific community towards eco-friendly agents for the reduction of metal salts to form nanoparticles. Tannic acid, a plant derived polyphenolic compound, is one such agent which embodies characteristics of being harmless and environmentally friendly combined with being a good reducing and stabilizing agent. In this review, first various methods used to prepare metal nanoparticles are highlighted and further tannic acid mediated synthesis of metal nanoparticles is emphasized. This review brings forth the most recent findings on this issue.

  20. Reviewing the Tannic Acid Mediated Synthesis of Metal Nanoparticles

    Directory of Open Access Journals (Sweden)

    Tufail Ahmad

    2014-01-01

    Full Text Available Metal nanoparticles harbour numerous exceptional physiochemical properties absolutely different from those of bulk metal as a function of their extremely small size and large superficial area to volume. Naked metal nanoparticles are synthesized by various physical and chemical methods. Chemical methods involving metal salt reduction in solution enjoy an extra edge over other protocols owing to their relative facileness and capability of controlling particle size along with the attribute of surface tailoring. Although chemical methods are the easiest, they are marred by the use of hazardous chemicals such as borohydrides. This has led to inclination of scientific community towards eco-friendly agents for the reduction of metal salts to form nanoparticles. Tannic acid, a plant derived polyphenolic compound, is one such agent which embodies characteristics of being harmless and environmentally friendly combined with being a good reducing and stabilizing agent. In this review, first various methods used to prepare metal nanoparticles are highlighted and further tannic acid mediated synthesis of metal nanoparticles is emphasized. This review brings forth the most recent findings on this issue.

  1. Inhibition of fatty acid synthesis in rat hepatocytes by exogenous polyunsaturated fatty acids is caused by lipid peroxidation

    DEFF Research Database (Denmark)

    Mikkelsen, L.; Hansen, Harald S.; Grunnet, N.

    1993-01-01

    Rat hepatocyte long-term cultures were utilized to investigate the impact of different polyunsaturated fatty acids (PUFA) on the insulin-induced de novo fatty acid synthesis in vitro. The addition of 0.5 mM albumin-complexed oleic, linoleic, columbinic, arachidonic, eicosapentaenoic...... by the peroxidized PUFA. Arachidonic acid and eicosapentaenoic acid showed a dose- and time-dependent cytotoxicity. Two other antioxidants: 50 µM a-tocopherol acid succinate and 1 µM N,N'-diphenyl-1,4-phenylenediamine, both proved more efficient than a-tocopherol phosphate. There was a significant correlation...... or docosahexaenoic acid resulted in a marked suppression of fatty acid synthesis. By evaluation of cell viability (determined as the leakage of lactate dehydrogenase (LDH)) it turned our, that the antioxidant used (50 µM a-tocopherol phosphate) had a low antioxidant activity, resulting in cytotoxic effects...

  2. Rational design, synthesis, and pharmacological evaluation of 2-azanorbornane-3-exo,5-endo-dicarboxylic acid

    DEFF Research Database (Denmark)

    Bunch, Lennart; Liljefors, Tommy; Greenwood, Jeremy R

    2003-01-01

    conformationally restricted (S)-glutamic acid (Glu) analogue intended as a mimic of the folded Glu conformation. The synthesis of 1 was completed in its racemic form in eight steps from commercially available starting materials. As a key step, the first facially selective hydroboration of a 5-methylidene[2......The design and synthesis of conformationally restricted analogues of alpha-amino acids is an often used strategy in medicinal chemistry research. Here we present the rational design, synthesis, and pharmacological evaluation of 2-azanorbornane-3-exo,5-endo-dicarboxylic acid (1), a novel...... studies on native 2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid (AMPA) (IC(50) > 300 microM, [(3)H]AMPA) or kainic acid (IC(50) > 160 microM, [(3)H]kainic acid) receptors nor in binding studies on the cloned iGluR5,6 subtypes (IC(50) > 300 microM, [(3)H]kainic acid)....

  3. Synthesis of zeolite-like crystals by means of sorption of bases on polysilicic acids

    International Nuclear Information System (INIS)

    Belyakova, L.A.; Il'in, V.G.; Peresun'ko, T.F.; Kryuchkova, I.I.; Nejmark, I.E.

    1974-01-01

    Investigation into the sorption of bases on crystalline polysilicic acids is of particular interest from the viewpoint of synthesis of new types of porous zeolite-like materials. A synthesis of polysilicate acids was carried out by treating respective sodium polysilicates with mineral acid solutions. The sorption of alkali metal hydroxides in the neutral and alkaline pH region was studied by the method of potentiometric titration of individual weighed quantities. A marked sorption of alkali metal hydroxides on polysilicic acids starts in the weakly acid and neutral regions and reaches saturation at pHapproximately10.5. The process of ion exchange is accompanied by a change in the crystal structure of polysilicic acids. The sorption of bases on polysilicic acids may be used as a method of synthesis of zeolite-like porous crystals in different cationic forms

  4. Synthesis of L-ascorbic acid in the phloem

    Directory of Open Access Journals (Sweden)

    Haupt Sophie

    2003-11-01

    Full Text Available Abstract Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone. Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs.

  5. [Synthesis of phosphonic acid and phosphinic acid derivatives for development of biologically active compounds].

    Science.gov (United States)

    Shibuya, Shiroshi

    2004-11-01

    This paper covers recent publications from our laboratory on the synthesis of a variety of phosphonate and phosphinate derivatives. New methods for the enantioselective synthesis of alpha-hydroxyphosphonates were established by Lewis acid-mediated cleavage of homochiral 1,3-dioxaneacetals with P(OEt)(3) and chiral metal ligand-mediated hydrophosphonylation of aldehydes. Two diastereomers of HPmp derivatives were prepared by an application of these methods. The HPmp derivatives were convered to FPmp derivatives but with low diastereoselectivity. Hydrophosphonylation of alpha-aminoaldehydes afforded threo- and erythro-beta-amino-alpha-hydroxyphosphonates under chelation and nonchelation controlled conditions, respectively. The asymmetric dihydroxylation of alpha, beta-, and beta, gamma-unsaturated phosphonates with AD-mix-alpha and AD-mix-beta reagents gave alpha, beta- and beta, gamma-dihydroxyphosphonates with high enantioselectivity. The method was applied to the kinetic resolution of racemic alpha-oxygetated beta, gamma-unsaturated phosphonates. Treatment of allyloxymethylphosphonates with the base afforded alpha-hydroxyphosphonates via the [2,3]-Wittig reaction. Threo- and erythro-beta-amino-alpha-hydroxyphosphinates were obtained with high diastereoselectivity by phosphinylation of alpha-aminoaldehydes in the presence of (R)- and (S)-ALB, respectively. The phosphinylation of alpha-oxygenated aldehydes afforded the corresponding alpha, beta-dioxygenated phosphinates, but with low diastereoselectivity. Sphingomyelin analogues containing CF(2)PO(OH)(2) were synthesized starting from (S)- and (R)-Garner aldehyde for the purpose of obtaining potent sphyngomyelinase inhibitors. A useful method for the synthesis of alpha, alpha-difluorobenzylphosphonates was established based on the cross coupling reaction of an iodobenzene derivative with ZnCuBr(2)CF(2)PO(OEt)(2). The synthetic utility of ZnCuBr(2)CF(2)PO(OEt)(2) was examined to obtain alpha, alpha

  6. One-Pot Enantiomeric Synthesis of Thiazole-Containing Amino Acids: Total Synthesis of Venturamides A and B.

    Science.gov (United States)

    Liu, Yi; He, Peng; Zhang, Yang; Zhang, Xiangyu; Liu, Jun; Du, Yuguo

    2018-04-06

    An effective one-pot procedure for enantiomerical synthesis of thiazole-containing amino acid (TCAA) has been established via a cascade disulfide cleavage/thiocarbonylation/intramolecular Staudinger reduction/aza-Wittig/oxidation reaction. Starting from the commercially available amino acid building blocks, a number of TCAAs were prepared in good yields and with excellent optical purities. This method bears features of mild reaction conditions, wide substrate adaptability, and good functional group tolerance. The power of this method was also demonstrated through the concise total synthesis of cyclic hexapeptide Venturamides A and B.

  7. Redefining the role of de novo fatty acid synthesis in Plasmodium parasites.

    Science.gov (United States)

    Tarun, Alice S; Vaughan, Ashley M; Kappe, Stefan H I

    2009-12-01

    Fatty acids are essential components of membranes, and are also involved in cell signalling. Plasmodium, the parasite that causes malaria, scavenges fatty acids from its hosts. However, Plasmodium also possesses enzymes for a prokaryotic-like de novo fatty acid synthesis pathway, which resides in the apicoplast. Recent research has demonstrated that Plasmodium parasites depend on de novo fatty acid synthesis only for liver-stage development. This finding demonstrates that basic anabolic functions of Plasmodium parasites are not necessary for the growth and replication of every life cycle stage. We discuss the role of fatty acid metabolism in Plasmodium and why we believe that de novo fatty acid synthesis is only required for parasite late liver-stage development.

  8. The Synthesis of cis- and trans-Fused Bicyclic Sugar Amino Acids

    NARCIS (Netherlands)

    Risseeuw, Martijn D.P.; Grotenbreg, Gijsbert M.; Witte, Martin D.; Tuin, Adriaan W.; Leeuwenburgh, Michiel A.; Marel, Gijsbert A. van der; Overkleeft, Herman S.; Overhand, Mark

    2006-01-01

    Four isomeric bicyclic sugar amino acids (SAAs) were prepared from an α-acetylenic-C-glucoside by employing a Petasis olefination and a ring-closing metathesis (RCM) as key steps. The applicability of the resulting SAAs in solid-phase peptide synthesis was demonstrated by the synthesis of a

  9. [3,3]Paracyclophanes as planar chiral scaffolds for the synthesis of new phosphoric acids.

    Science.gov (United States)

    Stemper, Jérémy; Isaac, Kevin; Duret, Véronique; Retailleau, Pascal; Voituriez, Arnaud; Betzer, Jean-François; Marinetti, Angela

    2013-07-11

    Cyclic phosphoric acids displaying planar chiral paracyclophane structures, which include a 1,1'-ferrocenediyl unit, have been designed as a new class of chiral organocatalysts. Their synthesis, optical resolution, structural characterization and preliminary catalytic tests are reported.

  10. A novel synthesis of chromone based unnatural α-amino acid ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 129; Issue 8. A novel synthesis of chromone based unnatural α-amino acid derivatives. VENU KANDULA RAMAKRISHNA GUDIPATI ANINDITA CHATTERJEE MURALIDARAN KALIYAPERUMALA SATYANARAYANA YENNAM MANORANJAN BEHERA. REGULAR ...

  11. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    International Nuclear Information System (INIS)

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-01-01

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, 16 are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions

  12. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    Science.gov (United States)

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  13. Radiation-induced synthesis of poly(acrylic acid) nanogels

    Science.gov (United States)

    Matusiak, Malgorzata; Kadlubowski, Slawomir; Ulanski, Piotr

    2018-01-01

    Nanogel is a two-component system of a diameter in the range of tens of nanometers, consisting of an intramolecularly crosslinked polymer chain and solvent, typically water, filling the space between segments of the macromolecule. Microgels are bigger than nanogels and their size range is between 100 nm to 100 μm. One of the methods used for synthesizing nanogels is linking the segments of a single macromolecule with the use of ionizing radiation, by intramolecular recombination of radiation-generated polymer radicals. The main advantage of this technique is absence of monomers, catalysts, surfactants or crosslinking agents. This method is an interesting alternative way of synthesizing polymeric carriers for biomedical applications. The aim of the study was radiation synthesis and characterization of poly(acrylic acid) - PAA - nanogels and microgels. The physico-chemical properties were described by determination of weight-average molecular weight and dimensions (radius of gyration, hydrodynamic radius) of the nanogels and microgels. Influence of polymer concentration and dose on these parameters was analyzed. Adjusting the PAA concentration and absorbed dose, one can control the molecular weight and dimensions of nanogels. The solutions of PAA were irradiated with two sources of ionizing radiation: γ-source and electron accelerator. The former method yields mainly microgels due to prevailing intermolecular crosslinking, while the latter promotes intramolecular recombination of PAA-derived radicals and in consequence formation of nanogels. In the future radiation-synthesized PAA nanogels, after functionalization, will be tested as carriers for delivering radionuclides to the tumor cells.

  14. Highly Efficient Procedure for the Synthesis of Fructone Fragrance Using a Novel Carbon based Acid

    Directory of Open Access Journals (Sweden)

    Xuezheng Liang

    2010-08-01

    Full Text Available The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and β-keto esters make this novel carbon based acid one of the best choices for the reaction.

  15. Regulation of bile acid synthesis in man. Presence of a diurnal rhythm.

    OpenAIRE

    Duane, W C; Levitt, D G; Mueller, S M; Behrens, J C

    1983-01-01

    Regulation of bile acid synthesis in man is incompletely understood, in part because of difficulty in making measurements over short time periods when the enterohepatic circulation is intact. We investigated the possibility of a diurnal rhythm of bile acid synthesis in three human subjects given [26-14C]cholesterol. When this isotope of cholesterol, which is randomly labeled in the 26 and 27 positions, is converted to bile acid, the 14C is released as propionic acid randomly labeled in the 1 ...

  16. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    International Nuclear Information System (INIS)

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-01-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis

  17. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    Energy Technology Data Exchange (ETDEWEB)

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  18. Early effects of dietary orotic acid upon liver lipid synthesis and bile cholesterol secretion in rats

    International Nuclear Information System (INIS)

    Tokmakjian, S.D.; Haines, D.S.

    1985-01-01

    Dietary orotic acid is known to cause impaired fatty acid synthesis and increased cholesterol synthesis in rats. The authors found that the impaired fatty acid synthesis occurs during the first day of orotic acid feeding and, in studies with albumin-bound [1- 14 C]palmitic acid, an associated decrease in the rate of esterification of this fatty acid into triacylglycerol, phospholipid, and cholesteryl ester was observed. These changes may result from the known decreases in liver levels of adenine nucleotides or, as reported here, from decreased liver CoASH levels in orotic acid-fed rats. The increase in hepatic cholesterol synthesis occurred during the second day of orotic acid feeding. It was detected by increased incorporation of [1,2- 14 C]acetate into cholesterol by liver slices and by a 7-fold increase in HMG-CoA reductase activity. At the same time the biliary output of cholesterol was increased 2-fold and studies using 3 H 2 O revealed that the output of newly synthesized cholesterol in bile was increased 5-fold. The content of cholesteryl ester in hepatic microsomes decreased during orotic acid feeding but free cholesterol was unchanged. The findings are interpreted to suggest that the increased bile cholesterol secretion caused by orotic acid is a result of impaired hepatic cholesterol esterification and that the increase in HMG-CoA reductase activity is a result of diminished negative feedback due to the depleted content of cholesteryl ester in the hepatic microsomes

  19. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    Energy Technology Data Exchange (ETDEWEB)

    Standaert, Robert F [ORNL; Park, Dr Seung Bum [Seoul National University

    2006-01-01

    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  20. First synthesis of phosphonobile acids and preliminary studies on their aggregation properties.

    Science.gov (United States)

    Maitra, Uday; Babu, Ponnusamy

    2003-05-01

    The synthesis of three novel phosphonobile acids from natural bile acids is reported. The CMC of phosphonodeoxycholic acid (PDCA) at pH 8.2 was found to be lower than that of the parent deoxycholic acid (DCA). PDCA micelles were also found to have higher microviscosity compared to DCA micelles, suggesting higher hydrophobicity and tighter packing in the interior of PDCA micelles. PDCA aggregated further to form an aqueous gel at pH 4.

  1. Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.

    Science.gov (United States)

    Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2017-08-01

    Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.

  2. Amino acid-assisted synthesis of strontium hydroxyapatite bone ...

    Indian Academy of Sciences (India)

    adhesives and for treatment of osteoporosis (Ni et al 2006). The synthesis of strontium hydroxyapatite can be accom- plished by using various methods of synthesis like sol–gel. (Balamurugan et al 2009), solid titrations (Pan et al 2009), wet chemical (Bigi et al 2007) and sol–gel- supercritical fluid drying (SCFD) methods ...

  3. Amino acid-assisted synthesis of strontium hydroxyapatite bone ...

    Indian Academy of Sciences (India)

    Strontium hydroxyapatite, a bioac- tive bone cement, is used in spinal and bone fracture surgery and it is also used in bone replacement, bone fillings, bone adhesives and for treatment of osteoporosis (Ni et al 2006). The synthesis of strontium hydroxyapatite can be accom- plished by using various methods of synthesis like ...

  4. Synthesis of the Demospongic Compounds, (6Z, 11Z-Octadecadienoic Acid and (6Z, 11Z-Eicosadienoic Acid

    Directory of Open Access Journals (Sweden)

    V. R. Mamdapur

    1997-01-01

    Full Text Available A stereoselective synthesis of (6Z, 11Z-octadecadienoic acid (1 and (6Z, 11Z-eicosadienoic acid (2 from easily accessible pentane-1,5-diol (3 is described. Thus, compound 3 on pyranylation and oxidation gave the aldehyde 5 which was converted to the acid 7 by Wittig reaction with a suitable phosphorane. Its depyranylation and oxidation furnished the key aldehyde 9 which upon Wittig reaction with n-heptylidene and n-nonylidene phosphoranes, respectively followed by alkaline hydrolysis afforded the title acids.

  5. Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis.

    Science.gov (United States)

    Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan

    2018-01-01

    It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.

  6. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    OpenAIRE

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching; Sun, Dianqing

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity.

  7. Synthesis and NMR Elucidation of Novel Octa-Amino Acid Resorcin ...

    African Journals Online (AJOL)

    The synthesis of nine novel protected amino acid cavitands is reported. All have four pendant n-undecyl chains and 'headgroups' connected by a two-carbon spacer at eight positions on the aromatic rings. The amino acids employed are glycine, alanine, phenylalanine, leucine, proline, tryptophan, serine, glutamine and ...

  8. Asymmetric Synthesis of (S)-2-Indolinecarboxylic Acid by Combining Biocatalysis and Homogeneous Catalysis

    NARCIS (Netherlands)

    Lange, Ben de; Hyett, David J.; Maas, Peter J.D.; Mink, Daniel; Assema, Friso B.J. van; Sereinig, Natascha; Vries, André H.M. de; Vries, Johannes G. de

    2011-01-01

    (S)-2-Indolinecarboxylic acid, an intermediate for ACE inhibitors, was until recently produced by Fischer indole synthesis and classical resolution in seven steps. However, Perkin condensation to form ortho-chlorocinnamic acid, which is converted to (S)-ortho-chlorophenylalanine using the enzyme

  9. Stereoselective synthesis of a-hydroxy-b-amino acids: the chiral pool approach

    Directory of Open Access Journals (Sweden)

    RADOMIR N. SAICIC

    2004-11-01

    Full Text Available A method for the stereoselective homologation of a-amino acids into syn-a-hydroxy-b-amino acids is described, based on the conversion of stereoisomeric cyanohydrins into trans-oxazolines. The synthetic potential of the method is illustrated in the enantioselective formal synthesis of Bestatin.

  10. Boric acid as a mild and efficient catalyst for one-pot synthesis of 1 ...

    Indian Academy of Sciences (India)

    Multicomponent reaction; amidoalkyl naphthol; boric acid; catalyst; solvent-free synthesis. 1. Introduction. Multicomponent reactions (MCRs), in ... silica-sodium hydrogen sul- phate,14 molybdophosphoric acid (H3[P(Mo3O10)4]),15 ... The solid obtained was collected by filtration and purified by recrystallization from ethanol.

  11. The effect of nalidixic acid, rifampicin and chloramphenicol on the synthesis of phospholipase C in Bacillus cereus

    International Nuclear Information System (INIS)

    Valle, K.J.; Prydz, H.

    1978-01-01

    The effect of nalidixic acid, rifampicin and chloramphenicol on the synthesis of phospholipase C (EC 3.1.4.3) has been studied in washed Bacillus cereus cells resuspended in nutrient broth. In the absence of inhibitors, the synthesis showed a biphasic pattern. No synthesis or release of enzyme was found in the presence of chloramphenicol. When rifampicin was added, phospholipase C synthesis for 10-15 min. Nalidixic acid, at concentrations which inhibited DNA synthesis completely, permitted the synthesis of phospholipase C at the same rate and for a similar length of time as rifampicin. (author)

  12. Radiotracer studies on the synthesis of prorennin and rennin using 14C-amino acids

    International Nuclear Information System (INIS)

    Angelo, I.A.; Ganguli, N.C.

    1976-01-01

    In vivo incorporation of 14 C-amino acids into the prorennin and rennin fractions of the abomasal tissue of the intact animal (i.e. calf) has been investigated by : (1) intravenous injection of the label and subsequent isolation of rennin and prorennin fractions from the excised abomasum and (2) feeding. of milk whey fortified with the label to a fistulated kid and subsequent processing of the abomasal juice for rennet extraction. Prorennin incorporates more radioactivity than rennin. This indicates that abomasal tissue uses blood amino acids for prorennin synthesis, but amino acids fed through dietary channels may not be used for rennin synthesis. (M.G.B.)

  13. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    Energy Technology Data Exchange (ETDEWEB)

    Lake, April D. [University of Arizona, Department of Pharmacology and Toxicology, Tucson, AZ 85721 (United States); Novak, Petr [Biology Centre ASCR, Institute of Plant Molecular Biology, Ceske Budejovice 37001 (Czech Republic); Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D. [Pharmaceutical Candidate Optimization, Bristol-Myers Squibb Co., Princeton, NJ 08543 (United States); Lu, Zhenqiang [The Arizona Statistical Consulting Laboratory, University of Arizona, Tucson, AZ 85721 (United States); Lehman-McKeeman, Lois D. [Pharmaceutical Candidate Optimization, Bristol-Myers Squibb Co., Princeton, NJ 08543 (United States); Cherrington, Nathan J., E-mail: cherrington@pharmacy.arizona.edu [University of Arizona, Department of Pharmacology and Toxicology, Tucson, AZ 85721 (United States)

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  14. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    International Nuclear Information System (INIS)

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-01-01

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  15. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.

    Science.gov (United States)

    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru

    2016-09-01

    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids.

  16. Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease

    International Nuclear Information System (INIS)

    Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.; Malagelada, J.R.

    1983-01-01

    We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess [ 14 C]arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative nor quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism

  17. Effect of Lauric Acid on Cell Division, Macromolecular Synthesis and Membrane Lipid Organization in Escherichia coli

    OpenAIRE

    Hakobu, Nakamura; Atsushi, Hase; Biological Institute, Faculty of Science, Konan University; Biological Institute, Faculty of Science, Konan University:(Present)Osaka City Institute of Public Health and Environmental Sciences

    1984-01-01

    Lauric acid (1mg/ml) sharply suppressed the cell division of an acrA mutant strain of Escherichia coli K12. However, the wild type acrA+ strain was resistant to the fatty acid. Capric acid and myristic acid were not so toxic. Lauric acid inhibited both DNA and protein synthesis of the acrA mutant strain, with the former being more sensitive than the latter. On the other hand, DNA polymerase activity of toluene-treated cells was stimulated rather than inhibited by the presence of 1mg/ml of lau...

  18. Reaction of Hydrazine Hydrate with Oxalic Acid: Synthesis and ...

    African Journals Online (AJOL)

    NICO

    2013-11-28

    hydrazinium (+1)] and N2H6. 2+ [hydrazinium (+2)] ionic salts with mineral as well as carboxylic acids. Hydrazinium. (+1) salts are more common and they can be obtained with a wide variety of acids whereas hydrazinium (+2) ...

  19. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance

    International Nuclear Information System (INIS)

    Kovács, Viktória; Gondor, Orsolya K.; Szalai, Gabriella; Darkó, Éva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-01-01

    Highlights: • Cd induces the salicylic acid metabolism in wheat. • Salicylic acid is synthesized via benzoic acid and/or ortho-hydroxy-cinnamic acid. • Cd tolerance can be explained by the highly induced glutathione metabolism. • Salicylic acid signalling is correlated with glutathione-related mechanisms. - Abstract: Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress

  20. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance

    Energy Technology Data Exchange (ETDEWEB)

    Kovács, Viktória; Gondor, Orsolya K.; Szalai, Gabriella; Darkó, Éva; Majláth, Imre; Janda, Tibor; Pál, Magda, E-mail: pal.magda@agrar.mta.hu

    2014-09-15

    Highlights: • Cd induces the salicylic acid metabolism in wheat. • Salicylic acid is synthesized via benzoic acid and/or ortho-hydroxy-cinnamic acid. • Cd tolerance can be explained by the highly induced glutathione metabolism. • Salicylic acid signalling is correlated with glutathione-related mechanisms. - Abstract: Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  1. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    International Nuclear Information System (INIS)

    Junker, L.H.; Davis, R.A.

    1989-01-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of [14C]cholesterol from [2-14C]acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of [14C]cholesterol from [2-14C]acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis

  2. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    Science.gov (United States)

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  3. Synthesis and accumulation of free amino acids during somatic and ...

    African Journals Online (AJOL)

    In ZE, glutamine and asparagine appeared to be fundamental to the process of induction of zygotic embryos. On the other hand, the induction of somatic embryos that appeared require glutamine, gamma-aminobutyric acid (GABA) and glutamic acid. The results suggest the involvement of amino acids in the ontogenesis of ...

  4. Selective synthesis of thiodiglycol dicarboxylic acid esters via p ...

    Indian Academy of Sciences (India)

    The esterification of thiodiglycol and long alkyl-chain carboxylic acids is reported. Reaction of thiodiglycol with carboxylic acid via -TsOH/C-catalysed direct esterification afforded thiodiglycol dicarboxylic acid esters in good yields and chemoselectivity. The use of immobilized -TsOH on activated carbon as catalyst is ...

  5. A Convenient Synthesis of Amino Acid Methyl Esters

    Directory of Open Access Journals (Sweden)

    Yaowu Sha

    2008-05-01

    Full Text Available A series of amino acid methyl ester hydrochlorides were prepared in good toexcellent yields by the room temperature reaction of amino acids with methanol in thepresence of trimethylchlorosilane. This method is not only compatible with natural aminoacids, but also with other aromatic and aliphatic amino acids.

  6. Synthesis and anticancer activity of new isatin-benzoic acid ...

    African Journals Online (AJOL)

    A series of new isatin-benzoic acid conjugates (9a - n) were synthesized via conjugation of isatin (3a) and its derivatives (3b - d, 4, 5 and 6) with 4-amino-5 chloro-2-ethoxybenzoic acid or 4-amino-5-(ethylsulfonyl)-2- methoxybenzoic acid by using chloroacetyl chloride as a bifunctional linker. Compounds 3a - d were ...

  7. Aqueous Microwave-Assisted Solid-Phase Synthesis Using Boc-Amino Acid Nanoparticles

    Directory of Open Access Journals (Sweden)

    Yoshinobu Fukumori

    2013-07-01

    Full Text Available We have previously developed water-based microwave (MW-assisted peptide synthesis using Fmoc-amino acid nanopaticles. It is an organic solvent-free, environmentally friendly method for peptide synthesis. Here we describe water-based MW-assisted solid-phase synthesis using Boc-amino acid nanoparticles. The microwave irradiation allowed rapid solid-phase reaction of nanoparticle reactants on the resin in water. We also demonstrated the syntheses of Leu-enkephalin, Tyr-Gly-Gly-Phe-Leu-OH, and difficult sequence model peptide, Val-Ala-Val-Ala-Gly-OH, using our water-based MW-assisted protocol with Boc-amino acid nanoparticles.

  8. The role of tannic acid and sodium citrate in the synthesis of silver nanoparticles

    Science.gov (United States)

    Ranoszek-Soliwoda, Katarzyna; Tomaszewska, Emilia; Socha, Ewelina; Krzyczmonik, Pawel; Ignaczak, Anna; Orlowski, Piotr; Krzyzowska, Małgorzata; Celichowski, Grzegorz; Grobelny, Jaroslaw

    2017-08-01

    We describe herein the significance of a sodium citrate and tannic acid mixture in the synthesis of spherical silver nanoparticles (AgNPs). Monodisperse AgNPs were synthesized via reduction of silver nitrate using a mixture of two chemical agents: sodium citrate and tannic acid. The shape, size and size distribution of silver particles were determined by UV-Vis spectroscopy, dynamic light scattering (DLS) and scanning transmission electron microscopy (STEM). Special attention is given to understanding and experimentally confirming the exact role of the reagents (sodium citrate and tannic acid present in the reaction mixture) in AgNP synthesis. The oxidation and reduction potentials of silver, tannic acid and sodium citrate in their mixtures were determined using cyclic voltammetry. Possible structures of tannic acid and its adducts with citric acid were investigated in aqueous solution by performing computer simulations in conjunction with the semi-empirical PM7 method. The lowest energy structures found from the preliminary conformational search are shown, and the strength of the interaction between the two molecules was calculated. The compounds present on the surface of the AgNPs were identified using FT-IR spectroscopy, and the results are compared with the IR spectrum of tannic acid theoretically calculated using PM6 and PM7 methods. The obtained results clearly indicate that the combined use of sodium citrate and tannic acid produces monodisperse spherical AgNPs, as it allows control of the nucleation, growth and stabilization of the synthesis process. [Figure not available: see fulltext.

  9. Differential effects of 17α-ethinylestradiol on the neutral and acidic pathways of bile salt synthesis in the rat

    NARCIS (Netherlands)

    Koopen, N.R.; Post, S.M.; Wolters, H.; Havinga, R.; Stellaard, F.; Boverhof, R.; Kuipers, F.; Princen, H.M.G.

    1999-01-01

    Effects of 17α-ethinylestradiol (EE) on the neutral and acidic biosynthetic pathways of bile salt (BS) synthesis were evaluated in rats with an intact enterohepatic circulation and in rats with long-term bile diversion to induce BS synthesis. For this purpose, bile salt pool composition, synthesis

  10. Communic Acids: Occurrence, Properties and Use as Chirons for the Synthesis of Bioactive Compounds

    Directory of Open Access Journals (Sweden)

    Alejandro F. Arteaga

    2012-02-01

    Full Text Available Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae. In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.. This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal, abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  11. Electroenzymatic strategies for deracemization, stereoinversion and asymmetric synthesis of amino acids

    International Nuclear Information System (INIS)

    Maerkle, Wolfgang; Luetz, Stephan

    2008-01-01

    A combination of a selective enzymatic oxidation with an unselective electrochemical reduction step was applied for deracemization, stereoinversion and asymmetric synthesis of L-leucine (starting from racemic leucine, D-leucine or 4-methyl-2-oxovaleric acid) in a batch reactor. D-Amino acid oxidase (D-AAO) from Trigonopsis variabilis was used as enzyme. Reaction conditions for the electrochemical and enzymatic reactions were investigated separately and finally combined to an electroenzymatic synthesis, yielding 3.5 mmol L -1 d -1 of L-leucine (ee 91%)

  12. Communic acids: occurrence, properties and use as chirons for the synthesis of bioactive compounds.

    Science.gov (United States)

    Barrero, Alejandro F; Herrador, M Mar; Arteaga, Pilar; Arteaga, Jesús F; Arteaga, Alejandro F

    2012-02-06

    Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae). In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.). This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal), abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  13. synthesis and optical characterization of acid-doped polyaniline thin ...

    African Journals Online (AJOL)

    HOD

    biological sensors, actuators, micro electronic devices, etc. It is a good material for applications in photocells, transducers, circuit boards, rechargeable batteries, .... with Silver Nanoparticles”, Advances in Materials. Physics and Chemistry,Vol. 2, pp 75-81, 2012. [5] Fernando, J., and Vedhi, C.,“Synthesis, Spectral and.

  14. Triazole-linked glycosyl amino acids and peptides : synthesis

    NARCIS (Netherlands)

    Kuijpers, B.H.M.

    2008-01-01

    Naturally occurring glycosylated peptides play an important role in various biological processes and are therefore interesting lead molecules for the preparation of new therapeutic drugs.Synthesis of these natural glycopeptides is frequently hampered by the sensitivity of the natural glycosidic

  15. Photochemical Synthesis of the Bioconjugate Folic Acid-Gold Nanoparticles

    DEFF Research Database (Denmark)

    León, John Jairo Castillo; Bertel, Linda; Páez-Mozo, Edgar

    2013-01-01

    In this paper we present a rapid and simple onepot method to obtain gold nanoparticles functionalized with folic acid using a photochemistry method. The bioconjugate folic acid-gold nanoparticle was generated in one step using a photo-reduction method, mixing hydrogen tetrachloroaurate with folic...... at 4°C prolongs the stability of folic acid-gold nanoparticle suspensions to up to 26 days. Ultraviolet visible and Fourier transform infrared spectroscopy showed a surface plasmon band of around 534nm and fluorescence spectroscopy exhibited a quenching effect on gold nanoparticles in the fluorescence...... emission of folic acid and thus confirmed the conjugation of folic acid to the surface of gold nanoparticles. In this study we demonstrate the use of a photochemistry method to obtain folic acid-gold nanoparticles in a simple and rapid way without the use of surfactants and long reaction times...

  16. Amino acid starvation has opposite effects on mitochondrial and cytosolic protein synthesis.

    Directory of Open Access Journals (Sweden)

    Mark A Johnson

    Full Text Available Amino acids are essential for cell growth and proliferation for they can serve as precursors of protein synthesis, be remodelled for nucleotide and fat biosynthesis, or be burnt as fuel. Mitochondria are energy producing organelles that additionally play a central role in amino acid homeostasis. One might expect mitochondrial metabolism to be geared towards the production and preservation of amino acids when cells are deprived of an exogenous supply. On the contrary, we find that human cells respond to amino acid starvation by upregulating the amino acid-consuming processes of respiration, protein synthesis, and amino acid catabolism in the mitochondria. The increased utilization of these nutrients in the organelle is not driven primarily by energy demand, as it occurs when glucose is plentiful. Instead it is proposed that the changes in the mitochondrial metabolism complement the repression of cytosolic protein synthesis to restrict cell growth and proliferation when amino acids are limiting. Therefore, stimulating mitochondrial function might offer a means of inhibiting nutrient-demanding anabolism that drives cellular proliferation.

  17. THE ADDITION EFFECT OF SULPHANILIC ACID TO THE SYNTHESIS OF 3,4-METHYLENEDIOXYBENZALDEHYDE

    Directory of Open Access Journals (Sweden)

    Feti Fatimah

    2011-12-01

    Full Text Available It was conducted a research about the addition effect of sulphanilic acid to the synthesis 3,4-methylenedioxybenzaldehyde from the isosafrole using reagents of sodium dichromate, sulphuric acid, and sulphanilic acid. The separation and purification of product were performed using the chromatography column. The purity of the result was tested using thin layer chromatography and determination of the melting point. Furthermore, it was identified its structure using infrared spectrophotometer, 1H and 13C nuclear magnetic resonance spectrometry, and mass spectrometry. The experimental result showed that the percentage yield of 3,4-methylenedioxybenzaldehyde with addition sulphanilic acid was 79.54%.

  18. Synthesis of glycosyl-amino acids of biological interest; Sintese de glicoaminoacidos de interesse biologico

    Energy Technology Data Exchange (ETDEWEB)

    Campo, Vanessa Leiria; Carvalho, Ivone [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Ciencias Farmaceuticas]. E-mail: carronal@usp.br

    2008-07-01

    This work describes the synthesis of the glycosylated amino acids {alpha}GlcNAc-Thr, {beta}GlcNAc-Thr and {alpha}LacNAc-Thr by the glycosylation reaction of the amino acid threonine with the corresponding glycosyl donors {alpha}GlcNAcCl and {alpha}LacN3Cl. The glycosylated amino acids containing the sugar units {alpha}-D-GlcNAc and {alpha}-D-LacNAc O-linked to threonine amino acids are related to O-glycans found in mucins of the parasite Trypanosoma cruzi, while the corresponding {beta}-D-GlcNAc isomer is involved in cellular signaling events. (author)

  19. Synthesis of hyper branched polyol from palm oil oleic acid

    International Nuclear Information System (INIS)

    Mek Zah Salleh; Mohd Hilmi Mahmood

    2010-01-01

    Hyper branched polyol from oleic acid of palm oil has been synthesized by a two-step reaction. Dipentaerythritol was initially reacted with 2, 2-bis (hydroxymethyl) propionic acid in a solution medium aided by p-toluene sulfonic acid as a catalyst. This mixture was then used as core and reacted with the oleic acid. Optimization parameters such as processing temperature and reaction time, and chemical analysis (for example OHV, AV, FTIR, NMR and GPC) of the macromolecule synthesized is presented in this paper. (author)

  20. Synthesis of a Series of Caffeic Acid Phenethyl Amide (CAPA) Fluorinated Derivatives: Comparison of Cytoprotective Effects to Caffeic Acid Phenethyl Ester (CAPE)

    Science.gov (United States)

    2010-06-11

    Synthesis of a series of caffeic acid phenethyl amide (CAPA) fluorinated derivatives: Comparison of cytoprotective effects to caffeic acid phenethyl...to induce genes with the downstream effect of counter- acting oxidative stress.5,6 Caffeic acid phenethyl ester (CAPE), a plant polyphenolic con... synthesis and investigation of catechol ring-fluorinated derivatives of CAPE with regard to cytoprotective ability against oxidative stress in vitro.14

  1. Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli

    Science.gov (United States)

    Luzzati, Denise

    1966-01-01

    Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402

  2. EVALUATION OF THE SYNTHESIS AND STRUCTURE OF NEW AZETIDIN-2-ONES OF FERULIC ACID.

    Science.gov (United States)

    Stan, Cătălina Daniela; Drăgan, Maria; Pânzariu, Andreea; Profire, Lenuţa

    2016-01-01

    To synthesize some new azetidin-2-ones of ferulic acid and to evaluate them from physicochemical and spectral point of view. The synthesis was carried out in several steps: (i) obtaining the ferulic acid chloride; (ii) obtaining the ferulic acid hydrazide with hydrazine hydrate (98%); (iii) condensation of ferulic acid hydrazide with different benzaldehydes (2-hydroxy-/2-nitro-/4-chloro-/4- fluoro-/4-bromo-benzaldehyde) in order to obtain the corresponding hydrazones; (iv) cy- clization of ferulic acid hydrazones with chloroacethyl chloride in freshly distilled toluene medium and in the presence of triethylamine, resulting in the corresponding azetidin-2-ones. Six new azetidin-2-ones of ferulic acid were synthesized. They were characterized in terms of their physicochemical properties and their structure was confirmed by IR and 1H-NMR spectroscopy. Six new azetidin-2-ones of ferulic acid were synthesized, physicochemically characterized and validated spectrally. A

  3. Synthesis of novel carbon/silica composites based strong acid ...

    Indian Academy of Sciences (India)

    hydrophobic acid-catalyzed reactions proceed in poor or with no catalytic activity (Nakajima et al 2009). The novel car- bon/silica composites based solid acid was synthesized for the purpose. However, the new method added the step of impregnating sucrose to the channels of SBA-15, which fur- ther added to the cost for ...

  4. SYNTHESIS OF FATTY ACID ETHYL ESTER FROM CHICKEN FAT ...

    African Journals Online (AJOL)

    eobe

    out using two-step procedures of acid pretreatment by esterification and transesterification of the pretreated oil. step procedures of acid pretreatment .... the transesterification of vegetable oils; however, ethanol was employed in the present .... further refining for use as a biodiesel feedstock. Its properties were established to ...

  5. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    Permanent link: http://www.ias.ac.in/article/fulltext/jcsc/125/01/0041-0049. Keywords. Ferrocene/Lewis acid; optical rotation; frustrated Lewis pairs; organoborane. Abstract. Optically active Lewis acids and Lewis pairs were synthesized and characterized by multinuclear NMR, UV/Vis spectroscopy and elemental analysis.

  6. Phenazines and natural products; Novel synthesis of saphenic acid

    DEFF Research Database (Denmark)

    Petersen, Lars; Jensen, Knud Jørgen; Nielsen, John

    1999-01-01

    The natural product saphenic acid (6-(1-hydroxyethyl)1-phenazinecarboxylic acid) was synthesized from readily accessible starting materials. The desired product was obtained in an overall yield of 22% for four steps with the key steps being formation of a diphenylamine, followed by cyclization...

  7. Improved synthesis of isostearic acid using zeolite catalysts

    Science.gov (United States)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  8. Vapour phase synthesis of salol over solid acids via transesterification

    Indian Academy of Sciences (India)

    Administrator

    salicylic acid in phenol is very low, this method requires the use of the latter in higher molar ratios. Hence, the method of transesterification of methyl salicylate with phenol is employed wherein the reac- tants, being mutually soluble in one another, can be mixed in different molar ratios. Also, the solid acid catalysts that have ...

  9. Synthesis and application of dyes derived from Schaeffer's acid on ...

    African Journals Online (AJOL)

    A monoazo dye was synthesized and applied to nylon 6,6 fibers. The effect of heat-set and auxiliary treatment on the absorption of acid dyes by nylon fibers was investigated. The dye was synthesized by the diazotization of primary amine to form a diazonium salt and coupling it to a coupling component (Schaeffer's acid).

  10. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    Energy Technology Data Exchange (ETDEWEB)

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  11. Gold/acid-co-catalyzed direct microwave-assisted synthesis of fused azaheterocycles from propargylic hydroperoxides.

    Science.gov (United States)

    Alcaide, Benito; Almendros, Pedro; Quirós, M Teresa

    2014-03-17

    The gold-acid-co-catalyzed synthesis of nine series of fused azaheterocycles with structural diversity starting from the same synthons as readily available propargylic hydroperoxides and aromatic amines has been achieved. The overall tandem process consists in a gold-catalyzed hydroperoxide rearrangement/Michael reaction followed by a final acid-catalyzed cyclization. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Synthesis of branched amino acids : isonorstatine, phenylisothreonine, lactacystin analogues, and amino polyols

    OpenAIRE

    Li, Feng

    2007-01-01

    The 1,2-aminoalcohol fragment is found in many natural products and drugs, for example as a central moiety of non-proteinogenic amino acids. It is also an integral part of doxorubicin and daunomycin, which have been used for the treatment of human malignancies. There is, therefore, a particular interest in the synthesis of branched amino hydroxy acids such as isonorstatine, phenylisothreonine, amino polyols and lactacystin derivatives. Norstatine is part of amastatin, an inhibitor of leuc...

  13. Enzymatic synthesis of 11C-pyruvic acid and 11C-L-lactic acid

    International Nuclear Information System (INIS)

    Cohen, M.B.; Spolter, L.; Chang, C.C.; Cook, J.S.; Macdonald, N.S.

    1980-01-01

    L-Lactic acid is formed as the end product of glycolysis under anaerobic conditions in all cells, but this reaction is of special significance in the myocardium. L-Lactic acid is reversibly formed from and is in equilibrium with myocardial pyruvic acid, which is its sole metabolic pathway. 11 C-Pyruvic acid is synthesized from 11 C carbon dioxide using pyruvate-ferredoxin oxidoreductase and coenzymes. The 11 C-pyruvic acid is then converted to 11 -L-lactic acid by lactic acid dehydrogenase. The availability of 11 C-pyruvic acid and 11 C-L-lactic acid will permit the in vivo investigation of lactate metabolism. (author)

  14. Parallel fluorescent probe synthesis based on the large-scale preparation of BODIPY FL propionic acid.

    Science.gov (United States)

    Katoh, Taisuke; Yoshikawa, Masato; Yamamoto, Takeshi; Arai, Ryosuke; Nii, Noriyuki; Tomata, Yoshihide; Suzuki, Shinkichi; Koyama, Ryoukichi; Negoro, Nobuyuki; Yogo, Takatoshi

    2017-03-01

    We describe a methodology for quick development of fluorescent probes with the desired potency for the target of interest by using a method of parallel synthesis, termed as Parallel Fluorescent Probe Synthesis (Parallel-FPS). BODIPY FL propionic acid 1 is a widely used fluorophore, but it is difficult to prepare a large amount of 1, which hinders its use in parallel synthesis. Optimization of a synthetic scheme enabled us to obtain 50g of 1 in one batch. With this large quantity of 1 in hand, we performed Parallel-FPS of BODIPY FL-labeled ligands for estrogen related receptor-α (ERRα). An initial trial of the parallel synthesis with various linkers provided a potent ligand for ERRα (Reporter IC 50 =80nM), demonstrating the usefulness of Parallel-FPS. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. AMP-activated kinase restricts Rift Valley fever virus infection by inhibiting fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Theresa S Moser

    Full Text Available The cell intrinsic innate immune responses provide a first line of defense against viral infection, and often function by targeting cellular pathways usurped by the virus during infection. In particular, many viruses manipulate cellular lipids to form complex structures required for viral replication, many of which are dependent on de novo fatty acid synthesis. We found that the energy regulator AMPK, which potently inhibits fatty acid synthesis, restricts infection of the Bunyavirus, Rift Valley Fever Virus (RVFV, an important re-emerging arthropod-borne human pathogen for which there are no effective vaccines or therapeutics. We show restriction of RVFV both by AMPK and its upstream activator LKB1, indicating an antiviral role for this signaling pathway. Furthermore, we found that AMPK is activated during RVFV infection, leading to the phosphorylation and inhibition of acetyl-CoA carboxylase, the first rate-limiting enzyme in fatty acid synthesis. Activating AMPK pharmacologically both restricted infection and reduced lipid levels. This restriction could be bypassed by treatment with the fatty acid palmitate, demonstrating that AMPK restricts RVFV infection through its inhibition of fatty acid biosynthesis. Lastly, we found that this pathway plays a broad role in antiviral defense since additional viruses from disparate families were also restricted by AMPK and LKB1. Therefore, AMPK is an important component of the cell intrinsic immune response that restricts infection through a novel mechanism involving the inhibition of fatty acid metabolism.

  16. Synthesis and characterization of covalent diphenylalanine nanotube-folic acid conjugates

    DEFF Research Database (Denmark)

    León, John Jairo Castillo; Rindzevicius, Tomas; Wu, Kaiyu

    2014-01-01

    Herein, we describe the synthesis and characterization of a covalent nanoscale assembly formed between diphenylalanine micro/nanotubes (PNT) and folic acid (FA). The conjugate was obtained via chemical functionalization through coupling of amine groups of PNTs and carboxylic groups of FA. The sur......Herein, we describe the synthesis and characterization of a covalent nanoscale assembly formed between diphenylalanine micro/nanotubes (PNT) and folic acid (FA). The conjugate was obtained via chemical functionalization through coupling of amine groups of PNTs and carboxylic groups of FA...... performed on a large area silver-capped (diameter of 62 nm) silicon nanopillars with an approximate height of 400 nm and a width of 200 nm. The results showed that the PNT-FA synthesis procedure preserves the molecular structure of FA. The PNT-FA conjugate presented in this study is a promising candidate...

  17. Easy synthesis of graphene sheets from alfalfa plants by treatment of nitric acid

    International Nuclear Information System (INIS)

    Qu, Jiao; Luo, Chunqiu; Zhang, Qian; Cong, Qiao; Yuan, Xing

    2013-01-01

    Highlights: ► An easy method for synthesis of graphene sheets using alfalfa plants was introduced. ► An novelty formation mechanism of graphene sheets using alfalfa plants was proposed. ► This method exploits a new carbon source and provides a novel idea to synthesize graphene sheets. -- Abstract: This letter focuses on synthesis of graphene sheets from alfalfa plants by treatment of nitric acid. The transmission electron microscopy image (TEM) demonstrates that the graphene sheets are agglomerated and overlapped, the energy dispersive spectrum (EDS) indicates that the products are pure, and the Raman spectrum shows the graphene sheets are well graphitized. In addition, the formation mechanism of the graphene sheets from alfalfa plants by treatment nitric acid is discussed. These findings inspire the search for a new strategy for synthesis of graphene sheets from renewable natural products, and the lower cost of this new process and carbon source may facilitate industrial production

  18. Glutathione synthesis rates after amino acid administration directly after birth in preterm infants

    NARCIS (Netherlands)

    te Braake, Frans W. J.; Schierbeek, Henk; de Groof, Karien; Vermes, Andras; Longini, Mariangela; Buonocore, Giuseppe; van Goudoever, Johannes B.

    2008-01-01

    The availability of glutathione, the main intracellular antioxidant, is compromised in preterm neonates. A possible explanation is the low availability of substrate for synthesis, because many neonatologists are reluctant to administer amino acids in the direct postnatal period for fear of

  19. Facile synthesis of CdS nanocrystals using thioglycolic acid as a ...

    African Journals Online (AJOL)

    A novel method has been developed for the synthesis of CdS nanocrystals (NCs) using thioglycolic acid (TGA) as a sulfur source and stabilizer with the presence of hydrogen peroxide in an aqueous medium. The products were characterized by X-ray powder diffraction (XRD), transmission electron microscopy (TEM) and ...

  20. Methods for the synthesis of tritium-labelled fatty acids and their derivatives, oxylipins and steroids

    International Nuclear Information System (INIS)

    Shevchenko, Valerii P; Nagaev, Igor Yu; Myasoedov, Nikolai F

    1999-01-01

    The achievements in the field of synthesis and application of tritium-labelled oxylipins, steroids, fatty acids, phospho-, sphingo- and other lipids are reviewed. The importance of these studies for the solution of current problems of biochemistry, biology and pharmacology is exemplified in the application of labelled compounds. The bibliography includes 148 references.

  1. A convenient procedure for the solid-phase synthesis of hydroxamic acids on PEGA resins

    DEFF Research Database (Denmark)

    Nandurkar, Nitin Subhash; Petersen, Rico; Qvortrup, Katrine

    2011-01-01

    An efficient method for the solid-phase synthesis of hydroxamic acids is described. The method comprises the nucleophilic displacement of esters immobilized on PEGA resins with hydroxylamine/sodium hydroxide in isopropanol. The hydroxyaminolysis protocol is compatible with a broad range of PEGA...

  2. Synthesis, Characterization, and Saccharide Binding Studies of Bile Acid − Porphyrin Conjugates

    Directory of Open Access Journals (Sweden)

    Vladimír Král

    2007-01-01

    Full Text Available Synthesis and characterization of bile acid-porphyrin conjugates (BAPs are reported. Binding of saccharides with BAPs in aqueous methanol was studied by monitoring changes in the visible absorption spectral of the porphyrin-moieties. Although these studies clearly showed absorbance changes, suggesting quite high if non-selective binding, the mass spectral studies do not unambiguously support these results.

  3. Fluorine-containing 2,4-dioxo acids in the synthesis of heterocyclic compounds

    International Nuclear Information System (INIS)

    Saloutin, Viktor I; Burgart, Yanina V; Chupakhin, Oleg N

    1999-01-01

    The review surveys the data on the synthesis, tautomerism, electronic structures and chemical transformations of 4-polyfluoroalkyl- and 4-pentafluorophenyl-2,4-dioxo acids and their derivatives. The reactions yielding fluorinated heterocyclic compounds and their further conversions are considered. The bibliography includes 86 references.

  4. Mass transfer effects in the H2SO4 catalyzed pivalic acid synthesis

    NARCIS (Netherlands)

    Brilman, D.W.F.; Meesters, N.G.; Swaaij, W.P.M. van; Versteeg, G.F.

    2001-01-01

    The synthesis of carboxylic acids from alkenes, carbon monoxide and water according to the Koch process is usually carried out in a stirred gas–liquid–liquid multiphase reactor. Due to the complex reaction system with fast, equilibrium reactions and fast, irreversible reactions the yield and product

  5. Mass transfer effects in H2SO4 catalyzed pivalic acid synthesis

    NARCIS (Netherlands)

    Brilman, Derk Willem Frederik; Meesters, N.G.; van Swaaij, Willibrordus Petrus Maria; Versteeg, Geert

    2001-01-01

    The synthesis of carboxylic acids from alkenes, carbon monoxide and water according to the Koch process is usually carried out in a stirred gas–liquid–liquid multiphase reactor. Due to the complex reaction system with fast, equilibrium reactions and fast, irreversible reactions the yield and product

  6. Boric acid as a mild and efficient catalyst for one-pot synthesis of 1 ...

    Indian Academy of Sciences (India)

    Abstract. An efficient green chemistry method has been developed for the synthesis of 1-amidoalkyl-2-naphthol derivatives via a one-pot three-component condensation of 2-naphthol, aldehydes and amide in the presence of boric acid as a mild catalyst.

  7. Biobased furandicarboxylic acids (FDCAs): effects of isomeric substitution on polyester synthesis and properties

    NARCIS (Netherlands)

    Thiyagarajan, S.; Vogelzang, W.; Knoop, J.R.I.; Frissen, A.E.; Haveren, van J.; Es, van D.S.

    2014-01-01

    In this study we present the application of different isomers of furandicarboxylic acid, or FDCA, obtained from agro-residues, in polyester synthesis. New polyesters based on 2,4-FDCA and 3,4-FDCA isomers with (linear) diols were thoroughly characterised and compared with their as-synthesised

  8. Synthesis of Novel N-9-Substituted Purine Derivatives from Polymer Supported alpha-Amino Acids

    Czech Academy of Sciences Publication Activity Database

    Vanda, D.; Jorda, Radek; Lemrová, B.; Volná, T.; Kryštof, Vladimír; McMaster, C.; Soural, M.

    2015-01-01

    Roč. 17, č. 7 (2015), s. 426-432 ISSN 2156-8952 R&D Projects: GA MŠk(CZ) LO1204; GA MŠk(CZ) LO1304 Institutional support: RVO:61389030 Keywords : alpha-amino acids * solid-phase synthesis * purine derivatives Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.317, year: 2015

  9. Boric acid as a mild and efficient catalyst for one-pot synthesis of 1

    Indian Academy of Sciences (India)

    Abstract. An efficient green chemistry method has been developed for the synthesis of 1-amidoalkyl-2-naphthol derivatives via a one-pot three-component condensation of 2-naphthol, aldehydes and amide in the presence of boric acid as a mild catalyst.

  10. Selectivity Enhancement in methylamine synthesis via postsynthesis modification of bronsted acidic mordenite

    NARCIS (Netherlands)

    Grundling, C.; Gründling, Christian; Mirth, G.C.; Eder-Mirth, Gabriele C.; Lercher, J.A.

    1996-01-01

    Methylamine synthesis from methanol and ammonia over parent and modified Brønsted acidic mordenites is studied byin situinfrared spectroscopy and kinetic analysis to elucidate the role of elementary steps for activity and selectivity.In situinfrared spectroscopy reveals that all methylammonium ions

  11. Kinetic Resolution and Stereoselective Synthesis of 3-Substituted Aspartic Acids by Using Engineered Methylaspartate Ammonia Lyases

    NARCIS (Netherlands)

    Raj, Hans; Szymanski, Wiktor; Villiers, Jandré de; Puthan Veetil, Vinod; Quax, Wim J.; Shimamoto, Keiko; Janssen, Dick B.; Feringa, Ben L.; Poelarends, Gerrit J.

    2013-01-01

    Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described.

  12. Synthesis and pharmacology of 3-hydroxy-delta2-isoxazoline-cyclopentane analogues of glutamic acid

    DEFF Research Database (Denmark)

    Conti, P; De Amici, M; Bräuner-Osborne, Hans

    2002-01-01

    The synthesis and pharmacology of two potential glutamic acid receptor ligands are described. Preparation of the bicyclic 3-hydroxy-delta2-isoxazoline-cyclopentane derivatives (+/-)-7 and (+/-)-8 was accomplished via 1,3-dipolar cycloaddition of bromonitrile oxide to suitably protected 1-amino-cy...

  13. Synthesis and biological evaluation of new salicylate macrolactones from anacardic acids

    Energy Technology Data Exchange (ETDEWEB)

    Logrado, Lucio P.L.; Santos, Maria Lucilia dos [Brasilia Univ., DF (Brazil). Inst. de Quimica. Lab. de Isolamento e Transformacao de Moleculas Organicas]. E-mail: mlsantos@unb.br; Silveira, Damaris [Brasilia Univ., DF (Brazil). Faculdade de Ciencias da Saude; Romeiro, Luiz A.S. [Universidade Catolica de Brasilia, Taguatinga, DF (Brazil). Nucleo de Quimica Bioorganica e Medicinal; Moraes, Manoel O. de; Cavalcanti, Bruno C.; Costa-Lotufo, Leticia V.; Pessoa, Claudia do O [Ceara Univ., Fortaleza, CE (Brazil). Lab. de Oncologia Experimental

    2005-11-15

    onnection with our ongoing investigation in the search for new bioactive compounds using non-isoprenoid phenolic lipids from Anacardium occidentale as starting material, we describe the synthesis and cytotoxicity screening of some novel salicylate macrolactones prepared from anacardic acids, the major constituents of natural cashew nut-shell liquid (CNSL). (author)

  14. Recent advances in the catalytic asymmetric synthesis of β-amino acids

    NARCIS (Netherlands)

    Weiner, Barbara; Szymanski, Wiktor; Janssen, Dick B.; Minnaard, Adriaan J.; Feringa, Ben L.

    2010-01-01

    In this critical review, the progress in catalytic asymmetric synthesis of β-amino acids is discussed, covering the literature since 2002. The review treats transition metal catalysis, organocatalysis and biocatalysis and covers the most important synthetic methods, such as hydrogenation, the

  15. Synthesis of 2,2'-Dipyrryl Ketones from Pyrrole-2-carboxylic Acids with Trifluoroacetic Anhydride

    International Nuclear Information System (INIS)

    Kim, Se Hee; Lim, Jin Woo; Yu, Jin; Kim, Jae Nyoung

    2013-01-01

    An efficient synthesis of 2,2'-dipyrryl ketones has been carried out from pyrrole-2-carboxylic acids using trifluoroacetic anhydride (TFAA). Simultaneous generation of both mixed anhydride and 2-unsubstituted pyrrole, via facile decarboxylation with in-situ generated TFA, made their cross reaction (intermolecular Friedel-Crafts acylation) possible and efficient

  16. Silica sulfuric acid promoted one-pot synthesis of benzo[4,5]imidazo ...

    African Journals Online (AJOL)

    A simple and efficient synthesis of benzo[4,5]imidazo[1,2-a]pyrimidine derivatives has been accomplished by the reaction of 2-aminobenzimidazole, aldehydes and β-dicarbonyl compounds under solvent-free conditions in the presence of silica sulfuric acid. KEY WORDS: Benzo[4,5]imidazo[1,2-a]pyrimidine, Silica sulfuric ...

  17. Silica Sulfuric Acid: An Eco-Friendly and Reusable Catalyst for Synthesis of Benzimidazole Derivatives

    Directory of Open Access Journals (Sweden)

    Bahareh Sadeghi

    2013-01-01

    Full Text Available Silica sulfuric acid (SiO2-OSO3H as an eco-friendly, readily available, and reusable catalyst is applied to benzimidazole derivatives synthesis under reflux in ethanol. The procedure is very simple and the products are isolated with an easy workup in good-to-excellent yields.

  18. An improved solvent-free synthesis of flunixin and 2-(arylamino) nicotinic acid derivatives using boric acid as catalyst.

    Science.gov (United States)

    Yarhosseini, Mahsa; Javanshir, Shahrzad; Dolatkhah, Zahra; Dekamin, Mohammad G

    2017-12-01

    A simple solvent-free protocol for the preparation of flunixin, a potent non-narcotic, non-steroidal anti-inflammatory drugs is reported using boric acid as catalyst. Its salt, flunixin meglumine are then prepared under reflux in EtOH. This sustainable method are then extended for the synthesis of a series of 2-(arylamino) nicotinic acid derivatives. The present protocol combines non-hazardous neat conditions with associated benefits like excellent yield, straightforward workup, and use of readily available and safe catalyst in the absence of any solvent, which are important factors in the pharmaceutical industry. The pathway for catalytic activation of 2-chloronicotic acid with boric acid was also investigated using Gaussian 03 program package.

  19. Synthesis of 5'-deoxy-5'-nucleosideacetic acid derivatives

    Science.gov (United States)

    Harada, Kazuo; Orgel, Leslie E.

    1990-01-01

    Several new 5'-deoxy-5'-nucleosideacetic acid derivatives have been synthesized by the reactions of alkoxycarbonylmethylene triphenylphosphoranes with nucleoside 5'-aldehydes. The oligomerization of adenine derivatives IIa, IIIa, IV, V and guanine derivatives IIc and IIIc in aqueous solution was studied using a water-soluble carbodiimide as a condensing agent. It is found that the saturated acid (IV) tends to cyclize to the lactone, while IIa and unsaturated acids (IIIa and V) oligomerized efficiently, especially in the presence of poly (U) as a template.

  20. Effect of Whole-Body X-Irradiation of the Synthesis of Individual Fatty Acids in Liver Slices from Normal and Fasted Rats

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Hansen, Lisbeth Grænge; Faber, M.

    1965-01-01

    (1) Using (2-14C) acetate and (1-14C) butyrate as precursors, rat-liver fatty acids were synthesized in vitro and assayed by paper chromatography. (2) Whole-body x-irradiation induced a change in the synthetic pattern of hepatic fatty acids towards a relatively enhanced synthesis of palmitic acid....... (3) X-irradiation and fasting seem to have opposite effects on fatty-acid synthesis. X-irradiation counteracts the drop in total synthesis and the relatively enhanced synthesis of palmitoleic acid induced by fasting. The relative enhancement of palmitic-acid synthesis mentioned under (2) stands...

  1. Asymmetric synthesis of α-deuterated α-amino acids.

    Science.gov (United States)

    Takeda, Ryosuke; Abe, Hidenori; Shibata, Norio; Moriwaki, Hiroki; Izawa, Kunisuke; Soloshonok, Vadim A

    2017-08-23

    α-Deuterated-α-amino acids represent a very special class of stable isotopically labeled compounds, used in advanced biomedical research. Herein, we disclose a generalized approach for the preparation of α- 2 H-α-amino acids in enantiomerically pure form and with up to 99% deuteration. The reaction chemistry involved in this process is based on the dynamic kinetic resolution of racemates or (S)-(R) interconversion via the formation of intermediate Ni(ii) complexes derived from unprotected amino acids and recyclable tridentate ligands. Operationally convenient conditions, excellent chemical yields, diastereoselectivity and the degree of the deuteration bode well for the wide application of this methodology for the preparation of tailor-made α- 2 H-α-amino acids.

  2. Enzymatic stereoselective synthesis of B-amino acids

    CSIR Research Space (South Africa)

    Chhiba, V

    2014-06-01

    Full Text Available , antimicrobials, and as nonstandard amino acids in therapeutic peptides or peptidomimetics. Access to these compounds can be achieved through diverse synthetic routes with enantioselective steps catalyzed in different ways, including by means of nitrile hydrolysis...

  3. Synthesis and mesomorphic behaviour of lithocholic acid derivatives

    Indian Academy of Sciences (India)

    Unknown

    It was further purified by Soxhlet extraction and recrystallized from acetone and dried under vacuum (yield 56%, m.p. 163°C). 3-(3-Carboxy propio- nyl) lithocholic acid, (II), was prepared in a similar man- ner as (I), except that lithocholic acid was used in place of. LAMe (yield 59⋅3%, m.p. 228°C). 3-acetyl lithocholic.

  4. Synthesis and Antimicrobial Activity of Amino Acids Conjugated Diphenylmethylpiperazine Derivatives

    Directory of Open Access Journals (Sweden)

    K. N. Shivakumara

    2009-01-01

    Full Text Available A series of amino acid conjugated diphenylmethylpiperazine derivatives were synthesized by coupling diphenylmethylpiperazine with different Boc-amino acids using EDCI/HOBt as coupling agent and NMM as base. The synthesized compounds were characterized by 1H-NMR and elemental analysis. The Boc-deblocked derivatives were tested for their antimicrobial activity. We are here reporting that Phe and Trp conjugated diphenylmethylpiperazine showed equally good antibacterial activities as that of conventional antimicrobial drugs.

  5. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    International Nuclear Information System (INIS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M.S.A.

    2016-01-01

    Non-aggregated magnetite nanorods with average diameters of 20–30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications. - Highlights: • We synthesize nicotinic acid coated magnetite nanorods via hydrothermal technique • Effect of nicotinic acid concentration on the nanorods properties was significant • Nanorods maintained uniform shape with increased concentration of nicotinic acid • Alterations occurred in particle size, mineral phases and magnetics of coated samples.

  6. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    Energy Technology Data Exchange (ETDEWEB)

    Attallah, Olivia A., E-mail: olivia.adly@hu.edu.eg [Center of Nanotechnology, Nile University, 12677 Giza (Egypt); Pharmaceutical Chemistry Department, Heliopolis University, 11777 El Salam, Cairo (Egypt); Girgis, E. [Solid State Physics Department, National Research Center, 12622 Dokki, Giza (Egypt); Advanced Materials and Nanotechnology Lab, CEAS, National Research Center, 12622 Dokki, Giza (Egypt); Abdel-Mottaleb, Mohamed M.S.A. [Center of Nanotechnology, Nile University, 12677 Giza (Egypt)

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20–30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications. - Highlights: • We synthesize nicotinic acid coated magnetite nanorods via hydrothermal technique • Effect of nicotinic acid concentration on the nanorods properties was significant • Nanorods maintained uniform shape with increased concentration of nicotinic acid • Alterations occurred in particle size, mineral phases and magnetics of coated samples.

  7. Synthesis, biological distribution and radiation dosimetry of Te-123m analogues of hexadecenoic acid

    International Nuclear Information System (INIS)

    Basmadjian, G.P.; Ice, R.D.; Mills, S.L.

    1982-01-01

    The synthesis and biological distribution of four Te-123m analogues of hexadecenoic acid in rats, rabbits and dogs were described for use as possible myocardial imaging agents. The heart-to-blood ratios ranged from 0.13 for 3-telluranonadecenoic acid in rats at 5 mins to 6.25 for 18-methyl-17-tellura-9-nonadecenoic acid in dogs at 24 hrs. The biological half-life of the Te-123m labelled fatty acids ranged from 26 to 583 hrs in the hearts of the test animals. These Te-123m fatty acids were retained in the heart longer than radioiodinated fatty acids and have acceptable absorbed doses to the various target organs. (U.K.)

  8. Bile acids exert negative feedback control on bile acid synthesis in cultured pig hepatocytes by suppression of cholesterol 7α-hydroxylase activity

    NARCIS (Netherlands)

    Kwekkeboom, J.; Princen, H.M.G.; Voorthuizen, E.M. van; Kempen, H.J.M.

    1990-01-01

    Feedback regulation of bile acid synthesis by its end products was studied in cultured hepatocytes of young weaned pigs. We previously showed that conversion of exogenous [14C] cholesterol into bile acids was suppressed by addition of bile acids to the culture medium. In the present study, the

  9. Synthesis of N,N-Bis(nonaflyl) Squaric Acid Diamide and its Application to Organic Reactions

    International Nuclear Information System (INIS)

    Cheon, Cheol Hong; Yamamoto, Hisashi

    2010-01-01

    We have developed a new strong Brφnsted acid bearing two nonaflyl groups based on the squaric acid scaffold. The Brφnsted acid 2 showed the almost same reactivity as bistriflyl squaramide 1 in Mukaiyama aldol and Michael reactions of benzaldehyde with silyl enol ether. Moreover, the utility of Brφnsted acid 2 could be expanded to carbonyl ene reaction of rac-citronellal. Further application of this new Brφnsted acid to organic reactions and to flow system reactors is currently underway in our laboratory. Brφnsted acid catalysis is one of the growing fields in modern organic synthesis.1 Although several Brφnsted acids, such as urea/thiourea, TADDOL, and phosphoric acid, have been applied to a variety of organic reactions, other Brφnsted acid scaffolds have been much less explored. Recently, Rawal et al have developed a Brφnsted acid catalyst based on squaric acid moiety and successfully applied it as a catalyst for conjugate addition of 1,3-dicarbonyl compounds to nitroolefins. More recently, we have developed a strong Brφnsted acid derived from squaric acid by introducing a strong electron withdrawing trifluoromethanesulfonyl (Tf) group and applied it to Mukaiyama aldol and Michael reaction of a variety of aldehydes, ketones, and α,β-unsaturated ketones. As a continuing effort to develop strong Brφnsted acids based on the squaric acid scaffold, it was expected that replacement of Tf group with a longer perfluoro-alkanesulfonyl group would be able to tune the physical properties, such as solubilities in organic solvents and fluoro-philicity, without loss of reactivity. Herein, we report the development of a new Brφnsted acid based on the squaric acid scaffold carrying two nonafluorobutanesulfonyl (Nf) groups and the preliminary results of its reactivity to various organic reactions

  10. A simple synthesis of L-[35S]cysteine sulfinic acid

    International Nuclear Information System (INIS)

    Spears, R.M.; Martin, D.L.

    1981-01-01

    The synthesis of L-[ 35 S]cysteine sulfinic acid (L-2-amino-3-[ 35 S]sulfino-propanoic acid) in 65% yield from S-[ 35 S]cystine is described. The procedure was designed for use with milligram quantities of starting material and requires no purification of intermediates. L-[ 35 S]Cystine was converted first to its thiosulfonate. Subsequent reaction of the thiosulfonate with ammonium hydroxide generated L-[ 35 S]cysteine sulfinic acid and L-[ 35 S]cystine as the major products. The L-[ 35 S]cystine was recovered and reprocessed thereby increasing the yield. (author)

  11. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    OpenAIRE

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established ...

  12. Kinetics of acetic acid synthesis from ethanol over a Cu/SiO2 catalyst

    DEFF Research Database (Denmark)

    Voss, Bodil; Schjødt, Niels Christian; Grunwaldt, Jan-Dierk

    2011-01-01

    The dehydrogenation of ethanol via acetaldehyde for the synthesis of acetic acid over a Cu based catalyst in a new process is reported. Specifically, we have studied a Cu on SiO2 catalyst which has shown very high selectivity to acetic acid via acetaldehyde compared to competing condensation routes....... The dehydrogenation experiments were carried out in a flow through lab scale tubular reactor. Based on 71 data sets a power law kinetic expression has been derived for the description of the dehydrogenation of acetaldehyde to acetic acid. The apparent reaction order was 0.89 with respect to water and 0...

  13. Synthesis and applications of silicon-containing alpha-amino acids.

    Science.gov (United States)

    Mortensen, Matthew; Husmann, Ralph; Veri, Elisabetta; Bolm, Carsten

    2009-04-01

    Amino acids serve not only as monomers for proteins and enzymes but also as important players in signal transduction pathways. They belong to the abundant feedstock of the pharmaceutical, food science and agrochemical industries, and some are used as catalysts or ligand components. In recent years, non-proteogenic amino acids have taken on important roles. This tutorial review summarises the progress in the development of strategies to construct silicon-containing alpha-amino acid frameworks and the studies concerned with their structure and activity. It shall be of interest for the synthesis and biosciences communities.

  14. A novel stereospecific synthesis of 14C labeled 1-glutamic acid

    International Nuclear Information System (INIS)

    Wurz, R.E.; Kepner, R.E.; Webb, A.D.

    1989-01-01

    A stereospecific synthesis of 4- 14 C-1-glutamic acid was completed in five steps from sodium 2- 14 C-acetate. The morpholine derived enamine of ethyl pyruvate was reacted with ethyl 2- 14 C-bromoacetate to give after hydrolysis diethyl 4- 14 C-2-oxoglutarate. The 2-oxoglutarate was reacted with hydroxylamine hydrochloride to give diethyl 4-14C-2-hydroxyiminoglutarate which was then reduced with a LiAlH4, (-)-N-methylephedrine and 3,5-dimethylphenol mixture to give 4- 14 C-1-glutamic acid. The 4- 14 C-1-glutamic acid was used in investigations into the biosynthesis of gamma-lactones in sherries

  15. Effect of O-acetylsalicylic acid on lipid synthesis by guinea pig gastric mucosa in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Spohn, M.; McColl, I.

    1987-01-01

    The aim of this work was to investigate the involvement of lipids as possible components of the gastric mucosal barrier by studying the synthesis and secretion of lipids by the epithelial cell lining of gastric mucosa and the effect of salicylate on these processes. O-Acetylsalicylic acid reversibly reduced in vitro incorporation of (U-/sup 14/C) and of DL-(2-/sup 14/C) mevalonic acid into lipids by isolated epithelial cells and by intact mucosa of guinea pig stomach, indicating reversible inhibition of lipid synthesis by the tissue in the presence of the drug. Inhibition of incorporation of both precursors into total lipids, into their fatty acid components, and into cholesterol is demonstrated. 19 refs.

  16. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.

    Science.gov (United States)

    Heemstra, Jennifer M; Liu, David R

    2009-08-19

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling.

  17. The Use of Supported Acidic Ionic Liquids in Organic Synthesis

    Directory of Open Access Journals (Sweden)

    Rita Skoda-Földes

    2014-06-01

    Full Text Available Catalysts obtained by the immobilisation of acidic ionic liquids (ILs on solid supports offer several advantages compared to the use of catalytically active ILs themselves. Immobilisation may result in an increase in the number of accessible active sites of the catalyst and a reduction of the amount of the IL required. The ionic liquid films on the carrier surfaces provide a homogeneous environment for catalytic reactions but the catalyst appears macroscopically as a dry solid, so it can simply be separated from the reaction mixture. As another advantage, it can easily be applied in a continuous fixed bed reactor. In the present review the main synthetic strategies towards the preparation of supported Lewis acidic and Brønsted acidic ILs are summarised. The most important characterisation methods and structural features of the supported ionic liquids are presented. Their efficiency in catalytic reactions is discussed with special emphasis on their recyclability.

  18. Synthesis, antimicrobial evaluation and QSAR studies of gallic acid derivatives

    Directory of Open Access Journals (Sweden)

    Anurag Khatkar

    2017-05-01

    Full Text Available A series of gallic acid derivatives (1–33 was synthesized and characterized by physicochemical and spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity against different Gram positive and Gram negative bacterial and fungal strains by the tube dilution method. Results of antimicrobial screening indicated that compound 6 was the most active antimicrobial agent (pMICam = 1.92 μM/mL. The results of QSAR studies demonstrated that antibacterial, antifungal and overall antimicrobial activities of synthesized gallic acid derivatives were governed by the electronic parameters, cosmic total energy (Cos E. and nuclear energy (Nu. E..

  19. Prolinol-based nucleoside phosphonic acids: Synthesis and properties

    Czech Academy of Sciences Publication Activity Database

    Vaněk, Václav; Buděšínský, Miloš; Liboska, Radek; Hurychová, Vladimíra; Rosenberg, Ivan

    -, č. 52 (2008), s. 537-538 ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06061; GA MŠk(CZ) LC06077; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506 Keywords : oligonucleotide phosphonate * nucleoside analogue * pyrrolidine * prolinol Subject RIV: CC - Organic Chemistry

  20. Synthesis and properties of catalysts prepared from silicomolybdovanadium heteropoly acid

    International Nuclear Information System (INIS)

    Chumachenko, N.N.; Tarasova, D.V.; Nikoro, T.A.; Yaroslavtseva, I.V.

    1984-01-01

    Catalytic properties of samples prepared of silicomolybdovanadium heteropoly acid (HPA) have been investigated. The massive catalyst is shown to be comparatively low effective in the reaction of acrolein oxidation to acrylic acid. Impregnation of coarse-dispersed silica gel by the HPA solution results in the formation of active and selective catalyst, whereas low-active catalyst of deep oxidation is formed on the base of high-dispersed silica gel. The obtained data are explained by the formation and stabilization of different forms of vanadium- and molybdenum-containing compounds on the carrier surface

  1. Synthesis and in vitro Cytotoxicity of Novel Ursolic Acid Derivatives

    Directory of Open Access Journals (Sweden)

    Yanqiu Meng

    2010-06-01

    Full Text Available In an effort to improve potential hepatoprotective and anti-tumor activities, eight novel ursolic acid (UA derivatives were designed and synthesized with substitution at positions of C-3, C-11and C-28 of UA. Their structures were confirmed using IR, MS and 1H-NMR and elemental analysis. Their in vitro cytotoxicity against various cancer cell lines (HeLa, SKOV3 and BGC-823 was evaluated by the standard MTT assay. Among them, compound 13 exhibited more potent cytotoxicity than ursolic acid.

  2. Synthesis and complex forming property of phosphor acid derivatives

    International Nuclear Information System (INIS)

    Babaev, B.N.

    2004-01-01

    Full text:With the aim to get new effective and selective extra gents of noble and non-ferrous metals from acid solution and industrial sewage, research of the dependence of 'structure effectiveness' the various phosphor acid derivatives with logical changeable structure (thio phosphor acids, derivatives of dialkoxythiophosphor, O-alkyl-methylphosphon, alkylphenylphosphon, diphenylphosphine acids also 4 methyl-1,3,2 dioxaphosphorinane) which contain different functional groups, the remains of heterocyclic amines and alkaloids, new derivatives of some analytical reagents were synthesized. The structure of synthesized compounds is approved by the results of IR-, PMR-, mass-spectrum analyze. Researching mass-spectrum decay of synthesized phosphor acid derivatives we defined that differing from O-dihexyl-S-propargyl-benzylthio phosphat, mass spectrum decay of O-dialkyl-S-(piperdynobutin-2-il)thio phosphat is characterized by the appearing [M-H] + ions and during the decay ions with high intensiveness are formed. Fragmentation of M + O-alkyl-O-(aminoalkyl)phenylphosphonate proceeds in various directions and characterized with the great number of phosphor containing ions, the possession of the second phenyl radical in the molecule of diphenylphosphon acid derivatives changes the fragmentation of molecular ion of diphenylphosphon acid derivatives. The process of extraction of noble (Au, Ag, Pt, Pd, Os) metals from hydrochloric-sulphur-nitrogen acid medium was analyzed by radioactive indicator's method. It was noticed that structure, strength, conformation of compounds, the temperature, of acid medium (0,1-10 M) and the nature of acids (HCL, H 2 SO 4 , HNO 3 ) could have strong influence to the effectiveness of metal extraction. During the research of metals extraction from pure solutions we can see the followings: 1) There are such substances, which can be used as effective group reagent towards the Au, Ag and Pd. 2) Derivatives with acetylene extract ions of gold from

  3. The promoting effects of geniposidic acid and aucubin in Eucommia ulmoides Oliver leaves on collagen synthesis.

    Science.gov (United States)

    Li, Y; Sato, T; Metori, K; Koike, K; Che, Q M; Takahashi, S

    1998-12-01

    We have reported that collagen synthesis was stimulated by the administration of a hot water extract from the leaves of Eucommia ulmoides OLIVER, Eucommiaceae (Du-Zhong leaves) in false aged model rats. In this paper, we set out to examine the compounds in Du-Zhong leaves that stimulated collagen synthesis in false aged model rats. In experiment 1, a methanol extract of Du-Zhong leaves also stimulated collagen synthesis in aged model rats. An acetone fraction was derived from the methanol extract by silica gel chromatography in experiment 2. The acetone fraction mainly contained iridoides mono-glycosides such as geniposidic acid and aucubin. The administration of geniposidic acid or aucubin stimulated collagen synthesis in aged model rats in experiments 3 and 4 (significance (p<0.05)). The reported pharmacological effects of Du-Zhong leaves, including healing organs and strengthening bone and muscle, are closely related to collagen metabolism. It appears that geniposidic acid and aucubin are the actual compounds in Du-Zhong which caused the effect in our experiments.

  4. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    Directory of Open Access Journals (Sweden)

    Angel Catalá

    2013-01-01

    Full Text Available I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others.

  5. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    Science.gov (United States)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  6. Metabolic adaptations during lactogenesis. Fatty acid synthesis in rabbit mammary tissue during pregnancy and lactation

    Science.gov (United States)

    Mellenberger, R. W.; Bauman, D. E.

    1974-01-01

    1. Mammary tissue was obtained from rabbits at various stages of pregnancy and lactation and used for tissue-slice incubations (to measure the rate of fatty acid synthesis and CO2 production) and to determine relevant enzymic activities. A biphasic adaptation in fatty acid synthetic capacity during lactogenesis was noted. 2. The first lactogenic response occurred between day 15 and 24 of pregnancy. Over this period fatty acid synthesis (from acetate) increased 14-fold and the proportions of fatty acids synthesized changed to those characteristic of milk fat (77–86% as C8:0+C10:0 acids). 3. The second lactogenic response occurred post partum as indicated by increased rates of fatty acid synthesis and CO2 production (from acetate and glucose) and increased enzymic activities. 4. Major increases in enzymic activities between mid-pregnancy and lactation were noted for ATP citrate lyase (EC 4.1.3.8), acetyl-CoA synthetase (EC 6.2.1.1), acetyl-CoA carboxylase (EC 6.4.1.2), fatty acid synthetase, glucose 6-phosphate dehydrogenase (EC 1.1.1.49), and 6-phosphogluconate dehydrogenase (EC 1.1.1.44). Smaller increases in activity occurred with glycerol 3-phosphate dehydrogenase (EC 1.1.1.8) and NADP+–isocitrate dehydrogenase (EC 1.1.1.42) and the activity of NADP+–malate dehydrogenase (EC 1.1.1.40) was negligible at all periods tested. 5. During pregnancy and lactation there was a close temporal relationship between fatty acid synthetic capacity and the activities of ATP citrate lyase (r=0.94) and acetyl-CoA carboxylase (r=0.90). PMID:4154742

  7. Effect of nerve growth factor on the synthesis of amino acids in PC12 cells

    International Nuclear Information System (INIS)

    Zielke, H.R.; Tildon, J.T.; Kauffman, F.C.; Baab, P.J.

    1989-01-01

    Radioactive short-chain fatty acids preferentially label glutamine relative to glutamate in brain due to compartmentation of glutamine and glutamate. To determine whether this phenomenon occurs in a single cell culture model, we examined the effect of fatty acid chain length on the synthesis as well as pool size of selected amino acids in rat pheochromocytoma PC12 cells, a cell culture model of the large glutamate compartment in neurons. Intracellular 14C-amino acids were quantitated by HPLC, and the incorporation of [U-14C]-glucose, [1-14C]-butyrate, [1-14C]-octanoate, and [1-14C]-palmitate into five amino acids was measured in native and NGF-treated PC12 cells. NGF pretreatment decreased the intracellular concentration of amino acids as did addition of fatty acids but these effects were not additive. Specific activities of amino acids in native cells labelled by 14C-octanoate were 1,300 DPM/nmol, 490 DPM/nmol, 200 DPM/nmol, and 110 DPM/nmol for glutamate, aspartate, glutamine, and serine, respectively. No radioactivity was detected in alanine. Similar specific activities were noted when 14C-butyrate was the precursor; however, there was at least 5-fold less if 14C-palmitate was the precursor. Pretreatment of cells with NGF decreased the specific activity of amino acids by 25-65%. Specific activities of amino acids synthesized from 14C-glucose decreased in the following order: glutamate, 1,640 DPM/nmol; aspartate, 1,210 DPM/nmol; alanine, 580 DPM/nmol; glutamine, 275 DPM/nmol; and serine, 80 DPM/nmol for native cells. NGF pretreatment decreased the specific activities of glutamate and glutamine, but not of the other 3 amino acids. The preferred precursor for glutamate synthesis in native PC12 cells was glucose followed by octanoate, butyrate and palmitate (16:6:3:1)

  8. Deoxyribonucleic acid synthesis in synchronized mammalian KB cells infected with herpes simplex virus.

    Science.gov (United States)

    Cohen, G H; Vaughan, R K; Lawrence, W C

    1971-06-01

    We examined the patterns of host cell and virus deoxyribonucleic acid (DNA) synthesis in synchronized cultures of KB cells infected at different stages of the cell cycle with herpes simplex virus (HSV). We found that the initiation of HSV DNA synthesis, we well as the production of new infectious virus, is independent of the S, G1, and G2 phases of the mitotic cycle of the host cell. This is in contrast to data previously found with equine abortion virus. Because HSV replicates independently of the cell cycle, we were able to establish conditions that would permit the study of rates of HSV DNA synthesized in logarithmically growing cells in the virtual absence of cellular DNA synthesis. This eliminates the need for separation of viral and cellular DNA by isopycnic centrifugation in CsCl. We found that HSV DNA synthesis was initiated between 2 to 3 hr after infection. The rate of DNA synthesis increased rapidly, reaching a maximum 4 hr after infection, and decreased to 50% of maximum by 8 hr. Evidence is also presented which suggests that HSV infection can inhibit both the ongoing synthesis of host DNA as well as the initiation of the S phase.

  9. Synthesis of Novel Piperazine-linked Anthranilic Acids as Potential ...

    African Journals Online (AJOL)

    NICO

    being that they would exhibit biochemical activity as small molecule kinase inhibitors. The synthesized anthranilamide- piperazine compounds were subsequently tested against a panel of kinases including EGFR, Abl, Akt and Aurora B. KEYWORDS. Small molecule kinase inhibitors, anthranilic acid, piperazines, EGFR. 1.

  10. Exploring the Potential of Fungal Arylacetonitrilases in Mandelic Acid Synthesis

    Czech Academy of Sciences Publication Activity Database

    Veselá, Alicja Barbara; Křenková, Alena; Martínková, Ludmila

    2015-01-01

    Roč. 57, č. 5 (2015), s. 466-474 ISSN 1073-6085 R&D Projects: GA ČR(CZ) GAP504/11/0394 Institutional support: RVO:61388971 Keywords : Fungal arylacetonitrilases * (R)-Mandelic acid manufacture * (R,S)-Mandelonitrile hydrolysis Subject RIV: CE - Biochemistry Impact factor: 1.752, year: 2015

  11. Synthesis of copolymer from lactic acid-polyethylene terephthalate ...

    African Journals Online (AJOL)

    Bio-plastic has been a need of the hour for the past few decades and the usage of lactic acid (LA) in the production of bio plastic opens a new window to the field. Polyethylene terephthalate (PET) thermoplastic polyester with excellent tensile and impact strength, chemical resistance, clarity, process ability, and transparency ...

  12. Reaction of Hydrazine Hydrate with Oxalic Acid: Synthesis and ...

    African Journals Online (AJOL)

    The reaction of oxalic acid with hydrazine hydrate (in appropriate mole ratio) forms the dihydrazinium oxalate under specific experimental condition. The title compound is a molecular salt containing two discrete hydrazinium cations and an oxalate anion. The oxalate anion is perfectly planar and there is a crystallographic ...

  13. Synthesis and Biological Evaluation of some Anthranilic Acid and 2 ...

    African Journals Online (AJOL)

    In the present investigation a novel series of N-(phenyl) chalconyl anthranilic acids containing pyrazolines (4a–j), tetrahydropyrimidines (4k–o), tetrahydrothiopyrimidines (4p–t) and 2-phenylquinazolin-4(3H)-ones containing pyrazolines (8a–f), isoxazolines (8g–l), tetrahydropyrimidines (8m–r) and tetrahydrothiopyrimidines ...

  14. Synthesis and Biological Evaluation of some Anthranilic Acid and 2 ...

    African Journals Online (AJOL)

    NJD

    In the present investigation a novel series of N-(phenyl) chalconyl anthranilic acids containing pyrazolines (4a–j), tetra- hydropyrimidines (4k–o), tetrahydrothiopyrimidines (4p–t) and 2-phenylquinazolin-4(3H)-ones containing pyrazolines (8a–f), isoxazolines (8g–l), tetrahydropyrimidines (8m–r) and ...

  15. Pyrene appended bile acid conjugates: Synthesis and a structure ...

    Indian Academy of Sciences (India)

    us to connect the existing gelator motifs into hybrid structures and study their gelation properties in solu- tion. We envisioned that by adding a pyrene moiety ...... seen with the simplest pyrene molecule 1-pyrene car- boxylic acid (19) or its mixture with 1-aminopyrene. (20) (prepared by heating the 1:1 mixture of the amine.

  16. Synthesis of New L-Ascorbic Ferulic Acid Hybrids

    Directory of Open Access Journals (Sweden)

    Sylvain Rault

    2007-11-01

    Full Text Available A feasibility and chemical study of the coupling conditions of L-ascorbic acidwith ferulic acid derivatives are described on the basis of the known synergistic effects ofmixtures of various antioxidants. Novel L-ascorbic ferulic hybrids linked at the C-3hydroxyl group were prepared with the aim to protect the alcohol function and the enediolsystem.

  17. Iodophilic polysaccharide synthesis, acid production and growth in oral streptococci

    NARCIS (Netherlands)

    Houte, J. van; Winkler, K.C.; Jansen, H.M.

    The relation between iodophilic polysaccharide formation, acid production and growth in α-haemolytic streptococci, isolated from human dental plaque, was studied. In experiments with resting cell suspensions, or with cells growing at a low rate, all strains synthesizing iodophilic polysaccharide

  18. Synthesis of Novel Piperazine-linked Anthranilic Acids as Potential ...

    African Journals Online (AJOL)

    Substituted anthranilic acid and piperazines were used as building blocks to prepare two libraries of compounds, with the aim being that they would exhibit biochemical activity as small molecule kinase inhibitors. The synthesized anthranilamidepiperazine compounds were subsequently tested against a panel of kinases ...

  19. Synthesis of azido derivatives of mucobromic acid | D. Jumbam ...

    African Journals Online (AJOL)

    Mucobromic acid is a highly reactive multicentered molecule. It was converted to its corresponding but unstable diazido derivative by reaction with two equivalents of sodium azide. The resultant 3,4-diazido-5-hydroxyfuran-2(5H)-one was obtained in moderate yield (42%) but decomposed readily even at low temperatures.

  20. Synthesis and characterization of ultraviolet light-emitting organic acids.

    Science.gov (United States)

    An, Chun-Ai; Guo, Yanchao; Si, Zhenjun; Duan, Qian

    2014-05-01

    Three ultraviolet light-emitting organic acids of 3,3'-(4-phenyl-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-1), 4,4',4″-(4H-1,2,4-triazole-3,4,5-triyl)tribenzoic acid (Tz-2), and 4,4'-(4-(4'-carboxy-[1,1'-biphenyl]-4-yl)-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-3) were successfully synthesized and fully characterized by the (1)H NMR, the IR absorption spectra, and the X-ray single crystal diffraction. It was found that Tz-1, Tz-2, and Tz-3 could give out the ultraviolet photoluminescent spectra centered at 369 nm, 365 nm and 350 nm, respectively. The luminescence quantum yields of Tz-1 and Tz-2 were measured to be 0.20 and 0.14, respectively. Additionally, the density functional theory (DFT) and the time-dependent DFT calculations were also carried out for Tz-1, Tz-2, and Tz-3.

  1. Vapour phase synthesis of salol over solid acids via transesterification

    Indian Academy of Sciences (India)

    The catalytic materials were prepared and characterized for their total surface acidity, BET surface area and powder XRD patterns. The effect of mole-ratio of the reactants, catalyst bed temperature, catalyst weight, flowrate of reactants, WHSV and time-on-stream on the conversion (%) of phenol and selectivity (%) of salol ...

  2. Total synthesis of five lipoteichoic acids of Clostridium difficile

    DEFF Research Database (Denmark)

    Hogendorf, Wouter Frederik Johan; Gisch, Nicolas; Schwudke, Dominik

    2014-01-01

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA...

  3. Synthesis of dopamine analogue containing benzeneboronic acid group, a target compound for BNCT

    Energy Technology Data Exchange (ETDEWEB)

    Mizuno, T.; Yoshino, K. [Shinshu Univ., Faculty of Science, Matsumoto, Nagano (Japan); Hiratsuka, J. [Kawasaki Medical School, Dept. of Radiation Oncology, Kurashiki, Okayama (Japan); Ichihashi, M. [Kobe Univ. (Japan). School of Medicine

    2000-10-01

    Melanin synthesis is accentuated in the melanoma cells. DOPA is one of the melanin precursors, and has been found to be the substrates for tyrosinase. Since Dopamine has the similar structure to DOPA, we have thought that the Dopamine containing boron atom has a possibility to be incorporated into the melanin synthesis pathway, resulting in both higher {sup 10}B-delivery and long lasting {sup 10}B-accumulation in melanoma. Thus, we tried to synthesize a new amide compound between Dopamine and p-carboxybenzeneboronic acid (PCBA). (author)

  4. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    Directory of Open Access Journals (Sweden)

    Trevor A. Feagin

    2012-01-01

    Full Text Available The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA.

  5. Automated synthesis system with computer control for the production of [1-11C]fatty acids

    International Nuclear Information System (INIS)

    Takahashi, Toshihiro; Ido, Tatsuo; Iwata, Ren; Hatano, Kentaro; Nakanishi, Hiroaki; Shinohara, Makoto; Iida, Shigenori

    1988-01-01

    To accommodate the increasing need for [1- 11 C]fatty acids for use in routine medical studies and the large amounts of radioactivity required, a more advanced automated synthesis system for the preparation of [1- 11 C]fatty acids has been constructed. The synthesis of [1- 11 C]fatty acids has been completely automated using a new separation unit (isobaric Sepaltor) for the extraction procedure, which had caused some difficulties with automation. The yield of [1- 11 C]palmitic acid was 20-30 mCi, and that of 3-methyl [1- 11 C]heptadecanoic acid was 2-7 mCi. The time required for the synthesis was less than 30 min from the start of the 11 CO 2 trapping. This system has been used for more than 20 preparations of [1- 11 C]palmitic acid and more than 20 preparations of 3-methyl [1- 11 C]heptadecanoic acid. (author)

  6. Synthesis of hydroxymethylfurfural from sucrose using brönsted-lewis acidic ionic liquid

    Directory of Open Access Journals (Sweden)

    L. Yao

    2016-08-01

    Full Text Available The synthesis of 5-hydroxymethylfurfural (HMF from sucrose was investigated in the presence of the Brönsted-Lewis acidic ionic liquids (ILs. It was concluded that IL 1-(3-sulfonic acid-propyl-3-methylimidazole chlorochrominate [HO3S-(CH23-mim]Cl-CrCl3 (molar fraction of CrCl3x = 0.55 had a good catalytic performance with 78.8% yield of HMF. The acid type of IL played a significant role in the reaction. Lewis acid site acted more effectively than its Brönsted counterpart and a synergetic effect of Brönsted and Lewis acid sites enhanced the IL catalytic performance. The reusability of IL was good.

  7. Synthesis of glycerol mono-laurate from lauric acid and glycerol for food antibacterial additive

    Science.gov (United States)

    Setianto, W. B.; Wibowo, T. Y.; Yohanes, H.; Illaningtyas, F.; Anggoro, D. D.

    2017-05-01

    Synthesis of glycerol mono-laurate (GML) has been performed using esterification reaction of glycerol and lauric acid. The reaction was performed at the condition of temperature of 120-140 °C within 7 hour, variation of molar ratio of glycerol - lauric acid, and was using heterogeneous catalyst of zeolist Y. Without catalyst dealumination the maximum acid conversion was 78%, with GML contained in the sample was 38.6%, and it was obtained at the reaction condition of 140 oC, 15wt% catalyst, and 8:1 molar ratio of glycerol - lauric acid. At the same condition, using dealuminated catalyst, the maximum acid conversion was increased up to 98%, with GML contained in the sample was 50.4%. The GML antibacterial activity was examined. It was observed that the GML has antibacterial activity against gram positive bacterial such as B. cereus and S. aureus.

  8. Convergent synthesis of degradable dendrons based on L-malic acid

    DEFF Research Database (Denmark)

    Meyhoff, Ulrich; Riber, Ulla; Boas, Ulrik

    2015-01-01

    New degradable polyester dendrons based on the cellular tricarboxylic acid cycle component L-malic acid were synthesized up to the third generation by convergent synthesis. The dendron wedges could be introduced in a stepwise, highly regioselective fashion. HMBC-NMR revealed that the C1-carbonyl...... on malic acid was exclusively esterified, before the reaction of the second dendron wedge at C4 took place. Degradation studies on a first generation dendron analyzed by HPLC showed that hydrolytic degradation of the dendron most profoundly takes place at pH 4 and pH 9 with the highest degradation rate...... at alkaline pH. NMR shows that the dendron degrades to malic acid and fumaric acid derivatives. Preliminary studies performed in the cell culture show low toxicity of the dendrons in concentrations of up to 50 μg mL-1....

  9. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    Science.gov (United States)

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  10. Synthesis and curing of alkyd enamels based on ricinoleic acid

    Directory of Open Access Journals (Sweden)

    Jovičić Mirjana C.

    2010-01-01

    Full Text Available A combination of an alkyd resin with a melamine-formaldehyde resin gives a cured enamel film with the flexibility of the alkyd constituent and the high chemical resistance and hardness of the melamine resin at the same time. The melamine resin is a minor constituent and plays the role of a crosslinking agent. In this paper, alkyd resins of high hydroxyl numbers based on trimethylolpropane, ricinoleic acid and phthalic anhydride were synthesized. Two alkyds having 30 and 40 wt% of ricinoleic acid were formulated by calculation on alkyd constant. Alkyds were characterized by FTIR and by the determination of acid and hydroxyl numbers. Then synthesized alkyds were made into baking enamels by mixing with melamine-formaldehyde resins (weight ratio of 70:30 based on dried mass. Two types of commercial melamine resins were used: threeisobutoxymethyl melamine-formaldehyde resin (TIMMF and hexamethoxymethyl melamine resin (HMMMF. Prepared alkyd/melamine resin mixtures were cured in a differential scanning calorimeter (DSC under non-isothermal mode. Apparent degree of curing as a function of temperature was calculated from the curing enthalpies. Kinetic parameters of curing were calculated using Freeman-Carroll method. TIMMF resin is more reactive with synthesized alkyds than HMMMF resin what was expected. Alkyd resin with 30 wt% of ricinoleic acid is slightly more reactive than alkyd with 40 wt% of ricinoleic acid, probably because it has the high contents of free hydroxyl and acid groups. The gel content, Tg, thermal stability, hardness, elasticity and impact resistance of coated films cured at 150°C for 60 min were measured. Cured films show good thermal stability since the onset of films thermal degradation determined by thermogravimetric analysis (TGA is observed at the temperatures from 281 to 329°C. Films based on alkyd 30 are more thermal stable than those from alkyd 40, with the same melamine resin. The type of alkyd resin has no significant

  11. Synthesis of novel adamantyl and homoadamantyl-substituted β-hydroxybutyric acids.

    Science.gov (United States)

    Matković, Marija; Vukelić, Stella; Cirimotić, Ružica; Kragol, Goran; Molčanov, Krešimir; Mlinarić-Majerski, Kata

    2013-11-01

    Several new adamantyl and homoadamantyl-substituted [Formula: see text]-hydroxybutyric acids, 2-[2-(1-adamantyl)ethyl]-3-hydroxybutyric acid (2), 2-(3-homoadamantyl)-3-hydroxybutyric acid (3), and 2-(1-homoadamantyl)-3-hydroxybutyric acid (4), analogues of the 2-(1-adamantyl)-3-hydroxybutyric acid (1), have been prepared as mixtures of diastereoisomers using selective reduction of corresponding [Formula: see text]-keto esters or aldol condensation of the corresponding carboxylic acid and acetaldehyde. The rearrangement of adamantylmethyl and 3-homoadamantyl groups provided entry to both 3-homoadamantyl and 1-homoadamantyl-substituted hydroxy acids 3 and 4, respectively. The relative configurations of diastereoisomers 3 and 4 have been determined by NMR spectroscopy comparing the values of coupling constants. Adamantyl-substituted [Formula: see text]-hydroxybutyric acid 2 has also been prepared in enantiomerically pure form by Evan's asymmetric synthesis and the absolute configuration has been determined by X-ray crystallography. Contrary to the long-chain acid 2, the attempt to prepare short-chain hydroxy acids 1 and 4 by the same method failed indicating pronounced sensitivity of the used method to the vicinity of the bulky cage group.

  12. Synthesis, antimicrobial evaluation and QSAR studies of propionic acid derivatives

    Directory of Open Access Journals (Sweden)

    Sanjiv Kumar

    2017-02-01

    Full Text Available A series of Schiff bases (1–17 and esters (18–24 of propionic acid was synthesized in appreciable yield and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity against Gram-positive bacteria Staphylococcus aureus, Bacillus subtilis, Gram negative bacterium Escherichia coli and fungal strains Candida albicans and Aspergillus niger by tube dilution method. Results of antimicrobial screening indicated that besides having good antibacterial activity, the synthesized compounds also displayed appreciable antifungal activity and compound 10 emerged as the most active antifungal agent (pMICca and pMICan = 1.93. The results of QSAR studies demonstrated that antibacterial, antifungal and overall antimicrobial activities of synthesized propionic acid derivatives were governed by the topological parameters, Kier’s alpha first order shape index (κα1 and valence first order molecular connectivity index (1χv.

  13. Synthesis of new fatty acids amides from aminolysis of fatty acid methyl esters (FAMEs); Sintese de novas amidas graxas a partir da aminolise de esteres metilicos

    Energy Technology Data Exchange (ETDEWEB)

    Lopes, Carolina R.; Montes D' Oca, Caroline da Ros; Duarte, Rodrigo da C.; Kurz, Marcia H.S.; Primel, Ednei G.; Clementin, Rosilene M.; Villarreyes, Joaquin Ariel M.; Montes D' Oca, Marcelo G., E-mail: dqmdoca@furg.b [Universidade Federal do Rio Grande, RS (Brazil). Escola de Quimica e Alimentos

    2010-07-01

    Recent biochemical and pharmacological studies have led to the characterization of different fatty acid amides as a new family of biologically active lipids. Here, we describe the synthesis of new amides from C16:0, 18:0, 18:1 and 18:1, OH fatty acids (FFA) families with cyclic and acyclic amines and demonstrate for the first time that these compounds produce cytotoxic effects. Application of this method to the synthesis of fatty acid amides was performed using the esters aminolysis as a key step and various carboxylic amides were prepared in good yield from fatty acid methyl esters (FAMEs). (author)

  14. Synthesis and curing of alkyd enamels based on ricinoleic acid

    OpenAIRE

    Jovičić Mirjana C.; Radičević Radmila Ž.; Simendić Vesna B.

    2010-01-01

    A combination of an alkyd resin with a melamine-formaldehyde resin gives a cured enamel film with the flexibility of the alkyd constituent and the high chemical resistance and hardness of the melamine resin at the same time. The melamine resin is a minor constituent and plays the role of a crosslinking agent. In this paper, alkyd resins of high hydroxyl numbers based on trimethylolpropane, ricinoleic acid and phthalic anhydride were synthesized. Two alkyds having 30 and 40 wt% of ricino...

  15. Synthesis, antimicrobial evaluation and QSAR studies of propionic acid derivatives

    OpenAIRE

    Kumar, Sanjiv; Kumar, Pradeep; Marwaha, Rakesh Kumar; Narasimhan, Balasubramanian

    2012-01-01

    A series of Schiff bases (1–17) and esters (18–24) of propionic acid was synthesized in appreciable yield and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity against Gram-positive bacteria Staphylococcus aureus, Bacillus subtilis, Gram negative bacterium Escherichia coli and fungal strains Candida albicans and Aspergillus niger by tube dilution method. Results of antimicrobial screening indicated th...

  16. Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.

    Science.gov (United States)

    Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song

    2018-04-01

    Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.

  17. Increase of uric acid synthesis in irradiated chicken's embryos

    International Nuclear Information System (INIS)

    Loyda, H.J.

    1984-01-01

    Several important intermediate and end products of uric acid metabolism as well as their corresponding enzymatic reactions were studied in 16 day-old chicken embryos which had been one or more times irradiated or respectively treated with ammonium chloride. After sublethal X-irradiation and at the time of the second irradiation with 800 R, the activity of the glutamine synthetase and the xanthin dehydrogenase in the kidneys of the embryos was increased. In contrast to this the glutamate dehydrogenase activity was moderately decreased. Two hours after the main irradiation the uric acid values as well as the amount of fixed nitrogen in the blood serum of previously-irradiated embryos are noticeably higher than the comparative data in non-previously irradiated animals. The glutamic acid values increase after the second irradiation, but still remain lower than with the non-previously irradiated animals. I achieved concuring ressults when I treated the embryos with ammonium chloride instead of radiation. (orig./MG) [de

  18. Mig-6 plays a critical role in the regulation of cholesterol homeostasis and bile acid synthesis.

    Directory of Open Access Journals (Sweden)

    Bon Jeong Ku

    Full Text Available The disruption of cholesterol homeostasis leads to an increase in cholesterol levels which results in the development of cardiovascular disease. Mitogen Inducible Gene 6 (Mig-6 is an immediate early response gene that can be induced by various mitogens, stresses, and hormones. To identify the metabolic role of Mig-6 in the liver, we conditionally ablated Mig-6 in the liver using the Albumin-Cre mouse model (Alb(cre/+Mig-6(f/f; Mig-6(d/d. Mig-6(d/d mice exhibit hepatomegaly and fatty liver. Serum levels of total, LDL, and HDL cholesterol and hepatic lipid were significantly increased in the Mig-6(d/d mice. The daily excretion of fecal bile acids was significantly decreased in the Mig-6(d/d mice. DNA microarray analysis of mRNA isolated from the livers of these mice showed alterations in genes that regulate lipid metabolism, bile acid, and cholesterol synthesis, while the expression of genes that regulate biliary excretion of bile acid and triglyceride synthesis showed no difference in the Mig-6(d/d mice compared to Mig-6(f/f controls. These results indicate that Mig-6 plays an important role in cholesterol homeostasis and bile acid synthesis. Mice with liver specific conditional ablation of Mig-6 develop hepatomegaly and increased intrahepatic lipid and provide a novel model system to investigate the genetic and molecular events involved in the regulation of cholesterol homeostasis and bile acid synthesis. Defining the molecular mechanisms by which Mig-6 regulates cholesterol homeostasis will provide new insights into the development of more effective ways for the treatment and prevention of cardiovascular disease.

  19. Synthesis, physicochemical properties, and biological activity of bile acids 3-glucuronides: Novel insights into bile acid signalling and detoxification.

    Science.gov (United States)

    Mostarda, Serena; Passeri, Daniela; Carotti, Andrea; Cerra, Bruno; Colliva, Carolina; Benicchi, Tiziana; Macchiarulo, Antonio; Pellicciari, Roberto; Gioiello, Antimo

    2018-01-20

    Glucuronidation is considered an important detoxification pathway of bile acids especially in cholestatic conditions. Glucuronides are less toxic than the parent free forms and are more easily excreted in urine. However, the pathophysiological significance of bile acid glucuronidation is still controversial and debated among the scientific community. Progress in this field has been strongly limited by the lack of appropriate methods for the preparation of pure glucuronides in the amount needed for biological and pharmacological studies. In this work, we have developed a new synthesis of bile acid C3-glucuronides enabling the convenient preparation of gram-scale quantities. The synthesized compounds have been characterized in terms of physicochemical properties and abilities to modulate key nuclear receptors including the farnesoid X receptor (FXR). In particular, we found that C3-glucuronides of chenodeoxycholic acid and lithocholic acid, respectively the most abundant and potentially cytotoxic species formed in patients affected by cholestasis, behave as FXR agonists and positively regulate the gene expression of transporter proteins, the function of which is critical in human conditions related to imbalances of bile acid homeostasis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  20. Synthesis and pharmacology of 3-isoxazolol amino acids as selective antagonists at group I metabotropic glutamic acid receptors

    DEFF Research Database (Denmark)

    Madsen, U; Bräuner-Osborne, H; Frydenvang, Karla Andrea

    2001-01-01

    GluRs), the few analogues of (RS)-2-amino-3-(3-hydroxy-5-isoxazolyl)propionic acid [HIBO, (RS)-4] so far known typically interact with iGluRs as well as metabotropic Glu receptors (mGluRs). We here report the synthesis and pharmacology of a series of 4-substituted analogues of HIBO. The hexyl analogue 9 was shown......Using ibotenic acid (2) as a lead, two series of 3-isoxazolol amino acid ligands for (S)-glutamic acid (Glu, 1) receptors have been developed. Whereas analogues of (RS)-2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid [AMPA, (RS)-3] interact selectively with ionotropic Glu receptors (i...... to originate in (S)-11 (EC(50) = 395 microM, K(b) = 86 and 90 microM, respectively). Compound 9, administered icv, but not sc, was shown to protect mice against convulsions induced by N-methyl-D-aspartic acid (NMDA). Compounds 9 and 11 were resolved using chiral HPLC, and the configurational assignments...

  1. Synthesis and pharmacology of 3-isoxazolol amino acids as selective antagonists at group I metabotropic glutamic acid receptors

    DEFF Research Database (Denmark)

    Madsen, U; Bräuner-Osborne, H; Frydenvang, Karla Andrea

    2001-01-01

    Using ibotenic acid (2) as a lead, two series of 3-isoxazolol amino acid ligands for (S)-glutamic acid (Glu, 1) receptors have been developed. Whereas analogues of (RS)-2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid [AMPA, (RS)-3] interact selectively with ionotropic Glu receptors (i......GluRs), the few analogues of (RS)-2-amino-3-(3-hydroxy-5-isoxazolyl)propionic acid [HIBO, (RS)-4] so far known typically interact with iGluRs as well as metabotropic Glu receptors (mGluRs). We here report the synthesis and pharmacology of a series of 4-substituted analogues of HIBO. The hexyl analogue 9 was shown...... to originate in (S)-11 (EC(50) = 395 microM, K(b) = 86 and 90 microM, respectively). Compound 9, administered icv, but not sc, was shown to protect mice against convulsions induced by N-methyl-D-aspartic acid (NMDA). Compounds 9 and 11 were resolved using chiral HPLC, and the configurational assignments...

  2. Enzymatic synthesis of arbutin undecylenic acid ester and its inhibitory effect on melanin synthesis.

    Science.gov (United States)

    Tokiwa, Yutaka; Kitagawa, Masaru; Raku, Takao; Yanagitani, Shusaku; Yoshino, Kenji

    2007-06-01

    Transesterification of arbutin and undecylenic acid vinyl ester was catalyzed by alkaline protease, Bioprase, in dimethylformamide to get arbutin derivative having undecylenic acid at 6-position of glucose moiety, 6-O-undecylenoyl p-hydroxyphenyl beta-D-glucopyranoside. The reaction rate increased with increase of arbutin concentration, and when its concentration was 0.9 M, the conversion rate was more than 90% under addition of 2 M undecylenic acid vinyl ester. The obtained arbutin ester significantly suppressed melanin production in murine B16 melanoma cells.

  3. Activities of Heterogeneous Acid-Base Catalysts for Fragrances Synthesis: A Review

    Directory of Open Access Journals (Sweden)

    Hartati Hartati

    2013-06-01

    Full Text Available This paper reviews various types of heterogeneous acid-base catalysts for fragrances preparation. Catalytic activities of various types of heterogeneous acid and base catalysts in fragrances preparation, i.e. non-zeolitic, zeolitic, and mesoporous molecular sieves have been reported. Generally, heterogeneous acid catalysts are commonly used in fragrance synthesis as compared to heterogeneous base catalysts. Heteropoly acids and hydrotalcites type catalysts are widely used as heterogeneous acid and base catalysts, respectively. © 2013 BCREC UNDIP. All rights reservedReceived: 20th January 2013; Revised: 31st March 2013; Accepted: 1st April 2013[How to Cite: Hartati, H., Santoso, M., Triwahyono, S., Prasetyoko, D. (2013. Activities of Heterogeneous Acid-Base Catalysts for Fragrances Synthesis: A Review. Bulletin of Chemical Reaction Engineering & Catalysis, 8 (1: 14-33. (doi:10.9767/bcrec.8.1.4394.14-33][Permalink/DOI: http://dx.doi.org/10.9767/bcrec.8.1.4394.14-33] | View in  |

  4. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    Science.gov (United States)

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  5. Squalene mono-oxygenase, a key enzyme in cholesterol synthesis, is stabilized by unsaturated fatty acids.

    Science.gov (United States)

    Stevenson, Julian; Luu, Winnie; Kristiana, Ika; Brown, Andrew J

    2014-08-01

    SM (squalene mono-oxygenase) catalyses the first oxygenation step in cholesterol synthesis, immediately before the formation of the steroid backbone at lanosterol. SM is an important control point in the pathway, and is regulated at the post-translational level by accelerated cholesterol-dependent ubiquitination and proteasomal degradation, which is associated with the accumulation of squalene. Using model cell systems, we report that SM is stabilized by unsaturated fatty acids. Treatment with unsaturated fatty acids such as oleate, but not saturated fatty acids, increased protein levels of SM or SM-N100-GFP (the first 100 amino acids of SM fused to GFP) at the post-translational level and partially overcame cholesterol-dependent degradation, as well as reversing cholesterol-dependent squalene accumulation. Maximum stabilization required activation of fatty acids, but not triacylglycerol or phosphatidylcholine synthesis. The mechanism of oleate-mediated stabilization appeared to occur through reduced ubiquitination by the E3 ubiquitin ligase MARCH6. Stabilization of a cholesterol biosynthetic enzyme by unsaturated fatty acids may help maintain a constant cholesterol/phospholipid ratio.

  6. Aspergillus niger whole-cell catalyzed synthesis of caffeic acid phenethyl ester in ionic liquids.

    Science.gov (United States)

    Rajapriya, Govindaraju; Morya, Vivek Kumar; Mai, Ngoc Lan; Koo, Yoon-Mo

    2018-04-01

    Synthesis of caffeic acid ester essentially requires an efficient esterification process to produce various kinds of medicinally important ester derivatives. In the present study, a comprehensive and comparative analysis of whole-cell catalyzed caffeic acid esters production in ionic liquids (ILs) media was performed. Olive oil induced mycelial mass of halotolerant Aspergillus niger (A.niger) EXF 4321 was freeze dried and used as a catalyst. To ensure maximum solubilization of caffeic acid for highest substrate loading several ILs were screened and 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([Emim][Tf 2 N]) was found to have the maximum solubility and favoured for enzymatic activity of freeze dried mycelia. The whole-cell catalyzed synthesis of caffeic acid phenethyl ester (CAPE) conditions were optimized and bioconversion up to 84% was achieved at a substrate molar ratio of 1:20 (caffeic acid:2-phenyl ethanol), 30°C for 12h. Results obtained during this study were encouraging and helpful to design a bioreactor system to produce caffeic acid derived esters. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Synthesis, characterization and corrosion inhibition properties of benzamide-2-chloro-4-nitrobenzoic acid and anthranilic acid-2-chloro-4-nitrobenzoic acid for mild steel corrosion in acidic medium

    Science.gov (United States)

    Pandey, Archana; Verma, Chandrabhan; Singh, B.; Ebenso, Eno E.

    2018-03-01

    The present study deals with the synthesis of two new compounds namely, benzamide - 2-chloro-4-nitrobenzoic acid (BENCNBA) and anthranilic acid-2-chloro-4-nitrobenzoic acid (AACNBA) using solid phase reactions. The phase diagram studies revealed that formation of the investigated compounds occurs in 1:1 molar ratio. The synthesized compounds were characterized using several spectral techniques such as FT-IR, 1H and 13C NMR, UV-Vis, powder X-ray diffraction (PXRD). Single crystal XRD (SCXRD) study showed that both BENCNBA and AACNBA compounds crystallize in triclinic crystal system with P-1 space group. Further, the presence of intermolecular hydrogen bonding between the constituent components was also supported by single crystal X-ray diffraction (SCXRD) method. Heat of mixing, entropy of fusion, roughness parameter, interfacial energy and excess thermodynamic functions have also been computed using the enthalpy of fusion values derived from differential scanning calorimeter (DSC) study. The inhibition effect of BENCNBA and AACNBA on the mild steel corrosion in hydrochloric acid solution was tested using electrochemical methods. Electrochemical impedance spectroscopy (EIS) study revealed that both BENCNBA and AACNBA behaved as interface corrosion inhibitors and showed maximum inhibition efficiencies of 95.71% and 96.42%, respectively at 400 ppm (1.23 × 10-3 M) concentration. Potentiodynamic polarization (PDP) measurements suggested that BENCNBA and AACNBA acted as mixed type corrosion inhibitors. EIS and PDP results showed that BENCNBA and AACNBA act as efficient corrosion inhibitors for mild steel and their inhibition efficiencies enhances on increasing their concentrations.

  8. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    Science.gov (United States)

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-12-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure-activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11.

  9. Ribonucleic Acid Synthesis Associated with a Developmental Change in the Gametophyte of Pteridium aquilinum.

    Science.gov (United States)

    Sobota, A E

    1972-06-01

    When bacteria are subjected to step-down conditions, there is an enhanced production of a messenger-type of RNA for a short time after the shift. A cultural shift, which appears to be similar to step-down, is described for gametophytes of Pteridium aquilinum. When the cultures are grown in white light, a population of rapidly dividing cells is produced, whereas in red light cell elongation predominates. If the cultures growing in white light are shifted to red light, a transition occurs which involves a rapid decrease in growth and nucleic acid synthesis. In particular, there is a marked decline in RNA synthesis for a short time following the shift and prior to the initiation of the new mode of growth. It appears that this observed change in RNA synthesis is related to the initiation of the new mode of growth.

  10. Improved conventional synthesis for 14C-labeled polyglutamates of folic acid

    International Nuclear Information System (INIS)

    Ferenz, C.R.; Graham, D.Y.

    1989-01-01

    The majority of folates existing in nature are of the pteroylpolyglutamyl form and are unable to support Lactobacillus casei growth until the γ-linked glutamyls are digested by conjugase enzymes. Most studies involving folate absorption have utilized monoglutamyl forms of folate, primarily folic acid. Synthetic pteroylpolyglutamates prepared by solid phase or conventional synthesis provided conjugated materials with which to study the absorption and metabolism of natural derivatives; however, the synthetic hepataglutamates support microbiological growth prior to enzymatic hydrolysis whereas the natural conjugates do not. Incomplete purification of intermediate peptides during the synthesis would be the most likely explanation of this growth phenomenon. A modified solution synthesis has been developed which improves upon intermediate peptide condensations, increases product yields, and provides a heptapeptide which does not support microbiological growth until after enzymatic hydrolysis. (author)

  11. Sodium iron (III) ethylenediaminetetraacetic acid synthesis to reduce iron deficiency globally.

    Science.gov (United States)

    Loots, Du T; van Lieshout, M; Lieshout, M V; Lachmann, G

    2007-02-01

    Despite major interest in sodium iron (III) ethylenediaminetetraacetic acid's (EDTA) potential use in food fortification programs in potentially curbing the global problem of iron deficiency and its anemia, synthesis methods of stable isotope-labeled sodium iron (III) EDTA for use in human bioavailability studies are incomplete, incorrect or totally lacking. Owing to a number of clinical research groups requiring this compound in bioavailability studies, in both developing and already developed countries, we simplified and optimized the synthesis of sodium iron (III) EDTA from a block of isotopically enriched iron metal, in order that it be easily reproduced, cheaply, using simple basic laboratory apparatus. The resulting product is of high purity (>99.0%), and may be used for human stable isotope bioavailability studies. The simplicity of this method allows for the many research groups, currently doing such studies, to perform their own syntheses. Additionally, more uniformity in this synthesis will reduce the variation observed between such studies.

  12. Gamma-amino butyric acid (GABA) synthesis of Lactobacillus in fermentation of defatted rice bran extract

    Science.gov (United States)

    Dat, Lai Quoc; Ngan, Tran Thi Kim; Nu, Nguyen Thi Xuan

    2017-09-01

    This research focused on the synthesis of GABA by Lactobacillus bacteria in fermentation of defatted rice bran extract without adding glutamate. Two strains of Lactobacillus were investigated into capacity of GABA synthesis. Result indicates that, Lactobacillus brevis VTCC - B - 454 exhibited the higher capacity of GABA synthesis in fermentation of defatted rice bran extract than that of Lactobacillus plantarum VTCC - B - 890. Total dissolved solid (TDS), free amino acids (AA) and reducing sugar (RS) contents in fermentation of defatted rice bran extract with two strains also significantly decreased. At pH 5 and 9 %w/w of TDS content in defatted rice bran extract, Lactobacillus brevis VTCC - B - 454 accumulated 2,952 ppm of GABA in 24 hours of fermentation. The result implies that fermentation with Lactobacillus brevis VTCC - B - 454 can be applied for GABA production from defatted rice bran extract.

  13. Liquid-Phase Synthesis of Cyanuric Acid from Urea

    Directory of Open Access Journals (Sweden)

    Fen-Ming Li

    2010-03-01

    Full Text Available The focus of this paper was to identify a cheaper solvent from among diesel fuel, kerosene, sulfolane or a mixture of sulfolane and cyclohexanol for the preparation of cyanuric acid heterocyclization of urea. To obtain a higher yield, the effects of catalyst (sodium, ammonium, calcium and zinc salts and temperature (160 °C to 220 °C on the trimerization of urea were also carefully studied. We established the optimal reaction conditions and further validated them in our scale-up experiments.

  14. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    Directory of Open Access Journals (Sweden)

    Zhiqian Liu

    2014-05-01

    Full Text Available A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification.

  15. Synthesis of Ethylene diamine tetra methylene phosphonic acid EDTMP

    International Nuclear Information System (INIS)

    Assaad, Th.

    2009-06-01

    Ethylenediamine tetramethylene phosphonic acid (EDTMP) is one of the most widely used ligands which forms stable complexes with various radionuclides all of which have shown high bone affinity and other favorable pharmacological characteristics in biodistribution studies. The EDTMP is very important precursor in the preparation of radiopharmaceutical kits which is used in the applications for bone diagnosis and therapy was synthesized in one step with Mannich type reaction. The obtained product was fully characterized by its multi-nuclear NMR and IR spectroscopy. The purity of the product was confirmed by HPLC. (author)

  16. Synthesis and preliminary biological evaluation of beta-carotene and retinoic acid oxidation products.

    Science.gov (United States)

    Kithsiri Wijeratne, E M; Liu, Manping X; Kantipudi, Narendra B; Brochini, Claudia B; Leslie Gunatilaka, A A; Canfield, Louise M

    2006-12-01

    Synthesis of the beta-carotene oxidation product, 2,3-dihydro-5,8-endoperoxy-beta-apo-carotene-13-one (1) was achieved in six steps starting from beta-ionone. Photo-oxygenation of all trans-retinoic acid (8) and 13-cis-retinoic acid (9) produced a mixture of 5S*,8S*-epidioxy-5,8-dihydroretinoic acid (10) and 13-cis-5S*,8S*-epidioxy-5,8-dihydroretinoic acid (11). Methylation of the crude photo-oxygenation mixture afforded the corresponding methyl esters 12 and 13, respectively, both of which underwent ready aerial oxidation yielding hitherto unknown oxidation products of retinoic acid identified as methyl 5S*,8S*-epidioxy-9,10beta-epoxy-5,8,9,10-tetrahydroretinoate (14) and methyl 13-cis-5S*,8S*-epidioxy-9,10beta-epoxy-5,8,9,10-tetrahydroretinoate (15). Evaluation of 1, all trans-retinoic acid (8), 13-cis-retinoic acid (9), and the photo-oxygenation products 10-15 in a panel of five cancer cell lines showed 1 to be inactive and that 11 is significantly cytotoxic compared with the other retinoic acid analogs suggesting the requirement of the carboxylic acid moiety and the cis-geometry of the 13(14) double bond for cytotoxic activity.

  17. Effects of Long Chain Fatty Acid Synthesis and Associated Gene Expression in Microalga Tetraselmis sp.

    Directory of Open Access Journals (Sweden)

    T. Catalina Adarme-Vega

    2014-06-01

    Full Text Available With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA to C20:4 eicosatetraenoic acid (ETA, correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4, but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt.

  18. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives

    Directory of Open Access Journals (Sweden)

    José Luis Viveros-Ceballos

    2016-08-01

    Full Text Available α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.

  19. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    Science.gov (United States)

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  20. Synthesis of a nano-crystalline solid acid catalyst from fly ash and its catalytic performance

    Energy Technology Data Exchange (ETDEWEB)

    Chitralekha Khatri; Ashu Rani [Government P.G. College, Kota (India). Environmental Chemistry Laboratory

    2008-10-15

    The synthesis of nano-crystalline activated fly ash catalyst (AFAC) with crystallite size of 12 nm was carried out by chemical and thermal treatment of fly ash, a waste material generated from coal-burning power plants. Fly ash was chemically activated using sulfuric acid followed by thermal activation at 600{sup o}C. The variation of surface and physico-chemical properties of the fly ash by activation methods resulted in improved acidity and therefore, catalytic activity for acid catalyzed reactions. The AFAC was characterized by X-ray diffraction, FT-IR spectroscopy, N{sub 2}-adsorption-desorption isotherm, scanning electron microscopy, flame atomic absorption spectrophotometry and sulfur content by CHNS/O elemental analysis. It showed amorphous nature due to high silica content (81%) and possessed high BET surface area (120 m{sup 2}/g). The catalyst was found to be highly active solid acid catalyst for liquid phase esterification of salicylic acid with acetic anhydride and methanol giving acetylsalicylic acid and methyl salicylate respectively. A maximum yield of 97% with high purity of acetylsalicylic acid (aspirin) and a very high conversion 87% of salicylic acid to methyl salicylate (oil of wintergreen) was obtained with AFAC. The surface acidity and therefore, catalytic activity in AFAC was originated by increased silica content, hydroxyl content and higher surface area as compared to fly ash. The study shows that coal generated fly ash can be converted into potential solid acid catalyst for acid catalyzed reactions. Furthermore, this catalyst may replace conventional environmentally hazardous homogeneous liquid acids making an ecofriendly; solvent free, atom efficient, solid acid based catalytic process. 27 refs., 5 figs., 2 tabs.

  1. Green Chemistry in the Organic Teaching Laboratory: An Environmentally Benign Synthesis of Adipic Acid

    Science.gov (United States)

    Reed, Scott M.; Hutchison, James E.

    2000-12-01

    Environmentally benign ("green") chemical techniques are growing in importance in academic and industrial research laboratories. Such chemistry has been slow to appear in teaching laboratories, owing in part to a lack of published material on this subject. Recent developments in green synthesis provide opportunities to introduce this material in teaching laboratories. We present a synthesis of adipic acid that utilizes green reagents (hydrogen peroxide as the oxidant), solvents (water), and methods (phase-transfer catalysis, catalyst recycling). The synthesis works well and provides an excellent forum for emphasizing green chemical concepts while teaching laboratory skills. It demonstrates reuse of a product, synthesis using a nonhazardous solvent, elimination of deleterious by-products, and use of a recyclable catalyst. It can be carried out on either the macroscale or microscale and generates little waste if the catalyst solution is recycled. This experiment fits well in a sophomore organic sequence; it covers the topics of oxidation, phase-transfer catalysis, and the technique of recrystallization, reinforces lecture topics such as alkene synthesis and reactivity, and provides an opportunity to introduce polymer chemistry.

  2. Correction: Synthesis of pyrrolidine-3-carboxylic acid derivatives via asymmetric Michael addition reactions of carboxylate-substituted enones.

    Science.gov (United States)

    Yin, Feng; Garifullina, Ainash; Tanaka, Fujie

    2018-04-25

    Correction for 'Synthesis of pyrrolidine-3-carboxylic acid derivatives via asymmetric Michael addition reactions of carboxylate-substituted enones' by Feng Yin et al., Org. Biomol. Chem., 2017, 15, 6089-6092.

  3. Amino acids attached to 2'-amino-LNA: Synthesis of DNA mixmer oligonucleotides with increased duplex stability

    DEFF Research Database (Denmark)

    Johannsen, Marie Willaing; Wengel, Jesper; Wamberg, Michael Chr.

    2010-01-01

    -LNA nucleosides derivatized with amino acids have been synthesized and incorporated into DNA oligonucleotides. Following oligonucleotide synthesis, peptides have been added using solid phase peptide coupling chem. Modification of oligonucleotides with pos. charged residues greatly improves thermal stability....

  4. Synthesis of labelled compound of ferulic acid and caffeic acid with tritium

    International Nuclear Information System (INIS)

    Yi Mingguang; Wang Caiyun

    1986-01-01

    Effective components of Chinese traditional herbs consist of many compounds, but some of the compounds usually contain unsaturated carbon-carbon double bonds. The unsaturated organic compounds 3 H-Ferulic acid and 3 H-Caffeic acid are prepared with their tritiated intermediates made by electric-dischange exposure method, which ensures the compounds contaning double bonds not hydrogenated. The 3 H-Ferulic acid is composed of 3 H-vanillin and Malonic acid. The 3 H-Caffeic acid is composed of 3 H-protocatechuyl aldehyde and Malonic acid and the specific activity of the products is 0.2 mCi/mg. The radiochemicaly purity is greater than 90%

  5. NOVEL 3-ACETYLCOUMARIN SCHIFF’S BASE SYNTHESIS FROM DIFFERENT ACID HYDRAZIDE

    OpenAIRE

    Anees Pangal; Javed A. Shaikh; Gazge Muiz; Vijay Mane; Khursheed Ahmed

    2013-01-01

    A new series of Schiff’s bases, SB1, SB2 and SB3 were synthesized from 3-acetylcoumarin and different acid hydrazides. The 3-acetyl coumarin was synthesized starting from salicylaldehyde and ethylacetoacetate. The structures of the synthesized compounds have been established on the basis of physical and spectral data. They shows a prominent absorption of -(C=N-) in FTIR. A survey of existing literature revealed that there are no reports describing the synthesis of such hydrazones.

  6. Lewis acid free high speed synthesis of nimesulide-based novel N-substituted cyclic imides

    Energy Technology Data Exchange (ETDEWEB)

    Kankanala, Kavitha; Mukkanti, Khagga [JNT University Hyderabad, Kukatpally (India); Pal, Sarbani, E-mail: sarbani277@yahoo.co [MNR Degree and PG College, Kukatpally, Hyderabad (India). Dept. of Chemistry; Reddy, Vangala Ranga [Dr. Reddy' s Laboratories Ltd. Integrated Product Development, Bachupally, Hyderabad (India)

    2010-07-01

    The first synthesis of nimesulide-based novel cyclic imides has been accomplished via the reaction of an amine prepared from nimesulide with appropriate anhydrides in the presence of sodium acetate. Using this process a variety of N-substituted cyclic imides was prepared in good yields in glacial acetic acid. Some of the compounds synthesized showed anti-inflammatory activities when tested in vivo. (author)

  7. Synthesis of 2-(6-Acetamidobenzothiazolethioacetic Acid Esters as Photosynthesis Inhibitors

    Directory of Open Access Journals (Sweden)

    Dusan Loos

    1998-04-01

    Full Text Available The synthesis and photosynthesis-inhibiting activity of 13 new 2-(6-acetamidobenzothiazolethioacetic acid esters are reported. The new compounds were prepared by acetylation of 2-(alkoxycarbonylmethylthio-6-aminobenzothiazoles with acetic anhydride. The structure of the compounds was verified by 1H NMR spectra. The compounds inhibit photosynthetic electron transfer in spinach chloroplasts. The structure - activity relation was studied. Lipophilicity was found to influence substantially photosynthetic electron transfer.

  8. Synthesis and Application of Phenyl Nitrone Derivatives as Acidic and Microbial Corrosion Inhibitors

    OpenAIRE

    Chen, Shijun; Zhao, Kang; Chen, Gang

    2015-01-01

    Nitrone has drawn great attention due to its wide applications as a 1,3-dipole in heterocyclic compounds synthesis and the bioactivities. With the special structure, nitrone can also be used as ligand in inorganic chemistry. Based on the current research, the nitrones are anticipated to be effective inhibitors against acidic and microbial corrosion. The aim of this work is to investigate the inhibitory action of nitrones. In this work, a series of phenyl nitrone derivatives (PN) was synthesiz...

  9. Amino Acid Based Synthesis of Chiral Long Chain Diamines and Tetramines

    Directory of Open Access Journals (Sweden)

    George Kokotos

    2002-10-01

    Full Text Available A method for the synthesis of long chain diamines and tetramines starting from natural α-amino acids is reported. Diamines and tetramines were prepared through the Wittig olefination reaction of N-protected amino aldehydes obtained from phenylalanine and lysine. A 1,2,17,18-tetramine was synthesized using (2S-1-azido-2-[bis(tert-butoxycarbonyl-amino]-5-oxopentane as key-intermediate compound.

  10. Synthesis and radioiodinated labelling of ω-p-iodophenyl pentadecanoic acid

    International Nuclear Information System (INIS)

    Ji Shuren; Wu Chunying; Fang Ping

    1997-01-01

    A method different from literature has been developed for the preparation of ω-p-iodophenyl pentadecanoic acid (IPPA). The synthesis and physical properties of IPPA is described. It is characterized by IR, 1 HNMR, elementary analysis and MS. 125 I-IPPA can be easily prepared by two methods: direct labelling and iodo-exchange labelling, the yields of labelling are 80% and 65% respectively confirmed by TLC and HPLC. The radiochemical purity are higher than 95% after extraction

  11. Synthesis and 125I labelling of β-methyl-p-iodophenyl pentadecanoic acid

    International Nuclear Information System (INIS)

    Ji Shuren; Wu Chunying; Lu Chunxiong; Fang Ping

    1999-01-01

    The method of the preparation of β-methyl-p-iodophenyl pentadecanoic acid (BMIPP) is developed. The synthesis and physical properties of BMIPP are described. BMIPP is characterized by IR, HNMR, elementary analysis and MS. 125 I-BMIPP can be easily prepared by two methods: direct labelling and iodo-exchange labelling. The labelling yield is 80% confirmed by TLC, and the radiochemical purity is higher than 98% after extraction

  12. Influence of peroxometallic intermediaries present on polyoxometalates nanoparticles surface on the adipic acid synthesis

    OpenAIRE

    Alcañiz Monge, Juan; Trautwein, Guido; García García, Avelina

    2014-01-01

    The cyclohexene oxidation by hydrogen peroxide catalysed by polyoxometalates (POM) has been shown as an adequate green route for the adipic acid synthesis. In this study, it has been demonstrated that POM's salts are effective catalysts for this reaction and how peroxopolyoxometalates intermediaries are the truly responsible species of the POM's salts catalytic activity and solubility. However, the latter can be reduced by calcining the catalyst previously. Polyoxomolybdates salts generally p...

  13. Aqueous citric acid as green reaction media for the synthesis of octahydroxanthenes

    Directory of Open Access Journals (Sweden)

    Camilo A. Navarro D.

    2013-08-01

    Full Text Available A simple, convenient and environmentally friendly one-pot procedure for the synthesis of 1,8-dioxo-octahydroxanthenes by the reaction of dimedone and aromatic aldehydes in aqueous citric acid is described. In this green synthetic protocol promoted by the reaction media, the use of any other catalysts and hazardous organic solvents are avoided, making the work up procedure greener and easier. The isolation of the products, obtained in good yields, is readily performed by filtration and crystallization from ethanol when required and the aqueous acidic media can be easily recycled and reused several times without significant loss of catalytic activity.

  14. ENANTIOPURE R(--3-AMINOISOBUTYRIC ACID SYNTHESIS USING Pseudomonas aeruginosa AS ENANTIOSPECIFIC BIOCATALYST

    Directory of Open Access Journals (Sweden)

    M. V. C. B. Cortes

    2015-03-01

    Full Text Available Abstract The main goal of this research was the synthesis of enantiopure R(--3-aminoisobutyric acid from dihydrothymine with good yield, high stereospecificity and relative simplicity. Seventy two percent yield of the product was obtained in three steps. Step one consisted of dihydrothymine racemization. Step two was a dihydropyrimidinase reaction involving the Pseudomonas aeruginosa 10145 bacterial strain as the biocatalyst. Step three was performed with a diazotization reaction. The bacteria's enzymes determined the stereochemistry of the process since the diazotization reaction did not interfere at this point. The results of this work provide an interesting method for the production of commercial β-amino acids from other substituteddihydrothymines.

  15. Concise and Straightforward Asymmetric Synthesis of a Cyclic Natural Hydroxy-Amino Acid

    Directory of Open Access Journals (Sweden)

    Mario J. Simirgiotis

    2014-11-01

    Full Text Available An enantioselective total synthesis of the natural amino acid (2S,4R,5R-4,5-di-hydroxy-pipecolic acid starting from D-glucoheptono-1, 4-lactone is presented. The best sequence employed as a key step the intramolecular nucleophilic displacement by an amino function of a 6-O-p-toluene-sulphonyl derivative of a methyl D-arabino-hexonate and involved only 12 steps with an overall yield of 19%. The structures of the compounds synthesized were elucidated on the basis of comprehensive spectroscopic (NMR and MS and computational analysis.

  16. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    DEFF Research Database (Denmark)

    Rabe, Patrick; Klapschinski, Tim A.; Brock, Nelson L.

    2014-01-01

    aureus and Vibrio anguillarum for a structure-activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues......Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus...... is presented and the bioactivity of the synthetic compounds is discussed....

  17. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    Directory of Open Access Journals (Sweden)

    Atul A. Dhavan

    2016-07-01

    Full Text Available The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments.

  18. Integrated process of distillation with side reactors for synthesis of organic acid esters

    Energy Technology Data Exchange (ETDEWEB)

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  19. Synthesis of gamma-aminobutyric acid analogs based on carbohydrate scaffolds.

    Science.gov (United States)

    Zhong, Ming; Meng, Xiang-Bao; Li, Zhong-Jun

    2010-06-16

    Gamma-aminobutyric acid analogs based on sugar scaffolds were prepared in six to nine steps starting from D-glucal and D-galactal. The key step in the synthesis is the Vilsmeier-Haack reaction that affords the corresponding 2-C-formyl glycal on treatment with DMF and POCl(3). Oxidation of the aldehyde and reduction of the 4-azido group provided the corresponding GABA analog. Acylamide and tetrazole analogs were also prepared as the bioisosteres of the carboxylic acid. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  20. Oxidation-resistant acidic resins prepared by partial carbonization as cocatalysts in synthesis of adipic acid.

    Science.gov (United States)

    Wei, Huijuan; Li, Hongbian; Liu, Yangqing; Jin, Peng; Wang, Xiangyu; Li, Baojun

    2012-08-01

    The oxidation-resistant acidic resins are of great importance for the catalytic oxidation systems. In this paper, the oxidatively stable acidic resins are obtained from the cation ion exchange resins (CIERs) through the thermal treatment in N(2) atmosphere. The structure and properties of the thermally treated CIERs were characterized by chemical analysis, Fourier transform infrared (FT-IR) spectra, acid capacity measurement and scanning electron microscope (SEM). The thermally treated CIERs possess high acid capacity up to 4.09 mmol g(-1). A partial carbonization is observed in the thermal treatment process of CIERs, but the morphology of resin spheres maintains well. The as-prepared CIERs are used as solid acids to assist the hydrogen peroxide oxidation of cyclohexene to adipic acid (ADA) with tungstic acid as the catalyst precursor. The improved yields of ADA in the recycling reaction are obtained in the presence of acidic CIERs. Meanwhile, the unproductive decomposition of H(2)O(2) is effectively suppressed. The high yields of ADA (about 81%) are kept by the thermally treated CIERs even after the fifth cycle. The thermally treated CIERs exhibit excellent acid-catalytic performance and possess remarkable oxidation-resistant capability.

  1. Green synthesis of carbon dots from pork and application as nanosensors for uric acid detection

    Science.gov (United States)

    Zhao, Chunxi; Jiao, Yang; Hu, Feng; Yang, Yaling

    2018-02-01

    In this work, a green, simple, economical method was developed in the synthesis of fluorescent carbon dots using pork as carbon source. The as-prepared carbon dots exhibit exceptional advantages including high fluorescent quantum yield (17.3%) and satisfactory chemical stability. The fluorescence of carbon dots based nanosensor can be selectively and efficiently quenched by uric acid. This phenomenon was used to develop a fluorescent method for facile detection of uric acid within a linear range of 0.1-100 μM and 100-500 μM, with a detection limit of 0.05 μM (S/N = 3). Finally, the proposed method was successfully applied in the determination of uric acid in human serum and urine samples with satisfactory recoveries, which suggested that the new nanosensors have great prospect toward the detection of uric acid in human fluids.

  2. Synthesis and pharmacology of 3-hydroxy-delta2-isoxazoline-cyclopentane analogues of glutamic acid

    DEFF Research Database (Denmark)

    Conti, P; De Amici, M; Bräuner-Osborne, Hans

    2002-01-01

    The synthesis and pharmacology of two potential glutamic acid receptor ligands are described. Preparation of the bicyclic 3-hydroxy-delta2-isoxazoline-cyclopentane derivatives (+/-)-7 and (+/-)-8 was accomplished via 1,3-dipolar cycloaddition of bromonitrile oxide to suitably protected 1-amino......-cyclopent-3-enecarboxylic acids. Their structure was established using a combination of 1H NMR spectroscopy and molecular mechanics calculations carried out on the intermediate cycloadducts (+/-)-11 and (+/-)-12. Amino acid derivatives (+/-)-7 and (+/-)-8 were assayed at ionotropic and metabotropic glutamic...... acid receptor subtypes and their activity compared with that of trans-ACPD and cis-ACPD. The results show that the replacement of the omega-carboxylic group of the model compounds with the 3-hydroxy-delta2-isoxazoline moiety abolishes or reduces drastically the activity at the metabotropic glutamate...

  3. A new synthesis of [3-11C]pyruvic acid using alanine racemase

    International Nuclear Information System (INIS)

    Ikemoto, M.; Okamoto, E.; Sasaki, M.; Haradahira, T.; Omura, H.; Furuya, Y.; Suzuki, K.; Watanabe, Y.

    1998-01-01

    The synthesis of [3- 11 C]pyruvic acid was attempted by two reaction systems (A: alanine racemase and D-amino acid oxidase, B: alanine racemase and L-alanine dehydrogenase) utilizing a new thermostable enzyme, alanine racemase. Conversion rates from D,L-[3- 11 C]alanine to [3- 11 C]pyruvic acid were almost 100% in both methods. Similar results were obtained with immobilized enzymes packed in a single column. Furthermore, the same column could be used repeatedly without a remarkable decrease of the [3- 11 C]pyruvic acid yield. Various matrices were tested for the immobilizing enzyme, and Aminopropyl-CPG was concluded to be the most suitable since the loss of the enzyme activity was the least in the studied matrices

  4. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    Science.gov (United States)

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  5. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    Directory of Open Access Journals (Sweden)

    Adrián Ochoa-Terán

    2014-01-01

    Full Text Available A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic acids and N,N′-disubstituted bis(carbamoyl terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1 and 1,2,4,5-benzenetetracarboxylic dianhydride (2 with arylalkyl primary amines (A-N. The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT. All products were characterized by NMR, FTIR, and MS.

  6. Selective conversion of cellulose to levulinic acid via microwave-assisted synthesis in ionic liquids.

    Science.gov (United States)

    Ren, Huifang; Zhou, Yonggui; Liu, Li

    2013-02-01

    A highly selective approach to produce levulinic acid from cellulose was developed via microwave-assisted synthesis in SO3H-functionalized ionic liquids (SFILs). The effects of reaction conditions and ionic liquid structures on the yield of levulinic acid have been investigated, where the highest yield of 55.0% was obtained. The catalytic activities of SFILs depend on the anions and decrease in the order: HSO4->CH3SO3->H2PO4-, which is in good agreement with their acidity order. The SFILs are efficient catalysts for cellulose conversion into levulinic acid and the subsequent esterification, which facilitates the separation of product and reuse of ionic liquids. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Effect of amino acids on the repression of alkaline protease synthesis in haloalkaliphilic Nocardiopsis dassonvillei

    Directory of Open Access Journals (Sweden)

    Amit K. Sharma

    2016-12-01

    Full Text Available A newly isolated salt-tolerant alkaliphilic actinomycete, Nocardiopsis dassonvillei strain OK-18 grows on mineral salts medium with glucose as carbon source. It also grows and produces protease with amino acids as sole carbon source. The synthesis of extracellular alkaline protease parallel to growth was repressible by substrate concentrations. The absolute production of the protease was delinked with growth under nutritional stress, as protease production was high, despite poor growth. When amino acids served as the sole source of carbon and nitrogen, the enzyme production was significantly controlled by the number of amino acids. Maximal protease production was achieved with proline, asparagine, tyrosine, alanine, methionine and valine as sole source of carbon and nitrogen in minimal medium. With the increasing number of different amino acids in the presence and absence of glucose, the protease production was synergistically lower as compared to complex medium.

  8. Synthesis of nalidixic acid based hydrazones as novel pesticides.

    Science.gov (United States)

    Aggarwal, Nisha; Kumar, Rajesh; Srivastva, Chitra; Dureja, Prem; Khurana, J M

    2010-03-10

    Thirty-one substituted hydrazones of nalidixic acid hydrazide were synthesized and characterized by spectral techniques. These compounds were evaluated for various biological activities, namely, fungicidal, insecticidal, and nitrification inhibitory activities. The antifungal activity was evaluated against five pathogenic fungi, namely, Rhizoctonia bataticola , Sclerotium rolfsii , Rhizoctonia solani , Fusarium oxysporum , and Alternaria porii . They showed maximum inihibition against A. porii with ED(50) = 34.2-151.3 microg/mL. The activity was comparable to that of a commercial fungicide, hexaconazole (ED(50) = 25.4 microg/mL). They were also screened for insecticidal activity against third-instar larvae of Spodoptera litura and adults of Callosobruchus maculatus and Tribollium castaneum . Most of them showed 70-100% mortality against S. litura through feeding method at 0.1% dose. These compounds were not found to be effective nitrification inhibitors.

  9. Insulin-independent regulation of hepatic triglyceride synthesis by fatty acids.

    Science.gov (United States)

    Vatner, Daniel F; Majumdar, Sachin K; Kumashiro, Naoki; Petersen, Max C; Rahimi, Yasmeen; Gattu, Arijeet K; Bears, Mitchell; Camporez, João-Paulo G; Cline, Gary W; Jurczak, Michael J; Samuel, Varman T; Shulman, Gerald I

    2015-01-27

    A central paradox in type 2 diabetes is the apparent selective nature of hepatic insulin resistance--wherein insulin fails to suppress hepatic glucose production yet continues to stimulate lipogenesis, resulting in hyperglycemia, hyperlipidemia, and hepatic steatosis. Although efforts to explain this have focused on finding a branch point in insulin signaling where hepatic glucose and lipid metabolism diverge, we hypothesized that hepatic triglyceride synthesis could be driven by substrate, independent of changes in hepatic insulin signaling. We tested this hypothesis in rats by infusing [U-(13)C] palmitate to measure rates of fatty acid esterification into hepatic triglyceride while varying plasma fatty acid and insulin concentrations independently. These experiments were performed in normal rats, high fat-fed insulin-resistant rats, and insulin receptor 2'-O-methoxyethyl chimeric antisense oligonucleotide-treated rats. Rates of fatty acid esterification into hepatic triglyceride were found to be dependent on plasma fatty acid infusion rates, independent of changes in plasma insulin concentrations and independent of hepatocellular insulin signaling. Taken together, these results obviate a paradox of selective insulin resistance, because the major source of hepatic lipid synthesis, esterification of preformed fatty acids, is primarily dependent on substrate delivery and largely independent of hepatic insulin action.

  10. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    Science.gov (United States)

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. The effects of borate minerals on the synthesis of nucleic acid bases, amino acids and biogenic carboxylic acids from formamide.

    Science.gov (United States)

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; Di Mauro, Ernesto; Crestini, Claudia

    2011-08-01

    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  12. Sequential enzymatic synthesis and separation of 13N-L-glutamic acid and 13N-L-alanine

    International Nuclear Information System (INIS)

    Cohen, M.B.; Spolter, L.; MacDonald, M.; Chang, C.C.; Takahashi, J.

    1975-01-01

    The sequential enzymatic synthesis and separation of 13 N-L-glutamic acid and 13 N-L-alanine are described. Basically, that involves the synthesis of 13 N-L-glutamic acid by one enzyme, the transamination of the labeled glutamic acid to form 13 N-L-alanine by a second enzyme, and the separation of the two amino acids by rapid column chromatography. The 13 N-L-alanine was evaluated in animals by imaging and tissue distribution studies and showed good potential as a pancreatic imaging agent

  13. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    Energy Technology Data Exchange (ETDEWEB)

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  14. Ionotropic excitatory amino acid receptor ligands. Synthesis and pharmacology of a new amino acid AMPA antagonist

    DEFF Research Database (Denmark)

    Madsen, U; Sløk, F A; Stensbøl, T B

    2000-01-01

    We have previously described the potent and selective (RS)-2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl)propionic acid (AMPA) receptor agonist, (RS)-2-amino-3-(3-carboxy-5-methyl-4-isoxazolyl)propionic acid (ACPA), and the AMPA receptor antagonist (RS)-2-amino-3-[3-(carboxymethoxy)-5-methyl-4......-isoxazolyl]propionic acid (AMOA). Using these AMPA receptor ligands as leads, a series of compounds have been developed as tools for further elucidation of the structural requirements for activation and blockade of AMPA receptors. The synthesized compounds have been tested for activity at ionotropic...... excitatory amino acid (EAA) receptors using receptor binding and electrophysiological techniques, and for activity at metabotropic EAA receptors using second messenger assays. Compounds 1 and 4 were essentially inactive. (RS)-2-Amino-3-[3-(2-carboxyethyl)-5-methyl-4-isoxazolyl]propionic acid (ACMP, 2...

  15. Synthesis of (S)-2-Boc-Amino-8-(R)-(tert-butyldimethylsilanyloxy) decanoic acid, a Precursor to the Unusual Amino Acid Residue of the Anticancer Agent Microsporin B

    OpenAIRE

    Gu, Wenxin; Silverman, Richard B.

    2011-01-01

    (S)-2-Boc-Amino-8-(R)-(tert-butyldimethylsilanyloxy) decanoic acid, the Boc-protected precursor of an unusual amino acid residue for the synthesis of microsporin B, was synthesized. The key steps include a Suzuki coupling followed by asymmetric homogeneous hydrogenation.

  16. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    Science.gov (United States)

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  17. Neptunium salts with certain acetic acid derivatives, synthesis and properties

    International Nuclear Information System (INIS)

    Charushnikova, I.A.; Afonas'eva, T.V.; Krot, N.N.

    1995-01-01

    A study was performed to develop preparation of neptunium (V) salts with aminoacetic, glycolic, and trichloroacetic acids. Crystalline NpO 2 (CH 2 OHCOO). H 2 O (I) and NpO 2 (CC1 3 COO).H 2 O (II) were synthesized. Their lattice parameters [I: rhombic, a = 13.440(2), b = 8.755(2), c = 5.711(1) Angstrom; II; monoclinic, a - 12.836(4), b = 11.308(3), c = 5.875(1) Angstrom,β - 99.83(4)degrees] were determined, and IR and electronic absorption spectra were measured. The main band of NpO + 2 ion (980 nm) is electronic absorption spectra of I and II is shifted toward longer waves by 16 and 21 nm, indicating cation-cation interactions in the lattice. Behavior of the compounds at heating in air was studied. Compound I loses water in the 200-350 degrees C range with simultaneous decomposition to NpO 2 . At 210 degrees C, compound II is converted into intermediate NpOC1 2 , which then decomposes to NpO 2 . Main physiochemical properties of I and II were compared with properties of Np(V) acetate

  18. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  19. Increasing the fidelity of noncanonical amino acid incorporation in cell-free protein synthesis.

    Science.gov (United States)

    Gan, Qinglei; Fan, Chenguang

    2017-11-01

    Cell-free protein synthesis provides a robust platform for co-translational incorporation of noncanonical amino acid (ncAA) into proteins to facilitate biological studies and biotechnological applications. Recently, eliminating the activity of release factor 1 has been shown to increase ncAA incorporation in response to amber codons. However, this approach could promote mis-incorporation of canonical amino acids by near cognate suppression. We performed a facile protocol to remove near cognate tRNA isoacceptors of the amber codon from total tRNAs, and used the phosphoserine (Sep) incorporation system as validation. By manipulating codon usage of target genes and tRNA species introduced into the cell-free protein synthesis system, we increased the fidelity of Sep incorporation at a specific position. By removing three near cognate tRNA isoacceptors of the amber stop codon [tRNA Lys , tRNA Tyr , and tRNA Gln (CUG)] from the total tRNA, the near cognate suppression decreased by 5-fold without impairing normal protein synthesis in the cell-free protein synthesis system. Mass spectrometry analyses indicated that the fidelity of ncAA incorporation was improved. Removal of near cognate tRNA isoacceptors of the amber codon could increase ncAA incorporation fidelity towards the amber stop codon in release factor deficiency systems. We provide a general strategy to improve fidelity of ncAA incorporation towards stop, quadruplet and sense codons in cell-free protein synthesis systems. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    Science.gov (United States)

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  1. Synthesis of Furandicarboxylic Acid Esters From Nonfood Feedstocks Without Concomitant Levulinic Acid Formation.

    Science.gov (United States)

    van der Klis, Frits; van Haveren, Jacco; van Es, Daan S; Bitter, Johannes H

    2017-04-10

    5-Hydroxymethylfurfural (HMF) is a versatile intermediate in biomass conversion pathways. However, the notoriously unstable nature of HMF imposes challenges to design selective routes to chemicals such as furan-2,5-dicarboxylic acid (FDCA). Here, a new strategy for obtaining furans is presented, bypassing the formation of the unstable HMF. Instead of starting with glucose/fructose and thus forming HMF as an intermediate, the new route starts from uronic acids, which are abundantly present in many agro residues such as sugar beet pulp, potato pulp, and citrus peels. Conversion of uronic acids, via ketoaldonic acids, to the intermediate formylfuroic acid (FFA) esters, and subsequently to FDCA esters, proceeds without formation of levulinic acid or insoluble humins. This new route provides an attractive strategy to valorize agricultural waste streams and a route to furanic building blocks without the co-production of levulinic acid or humins. © 2015 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  2. Regulation of ascorbic acid and of xylulose synthesis in liver extracts. The effect of starvation in various animals

    Science.gov (United States)

    Stirpe, F.; Comporti, M.; Della Corte, E.

    1965-01-01

    1. The effect of starvation on the synthesis of ascorbic acid and of xylulose from glucuronolactone and from gulonate has been studied with liver extracts from cats, rabbits, hamsters, mice and guinea pigs. 2. The synthesis of ascorbic acid from glucuronolactone is decreased in all species except cats, and that from gulonate is decreased in hamsters and mice only. 3. The synthesis of xylulose from glucuronolactone was decreased in all species except cats and mice, whereas from gulonate it was enhanced in all the species examined. PMID:14340085

  3. Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.

    Science.gov (United States)

    Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P

    2016-09-01

    Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media.

    Science.gov (United States)

    Moret, Séverine; Dyson, Paul J; Laurenczy, Gábor

    2014-06-02

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes.

  5. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    Science.gov (United States)

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  6. An Efficient Synthesis of 1-Alkyl-2-phenyl-4-quinolones from 2-Halobenzoic Acids

    International Nuclear Information System (INIS)

    Song, Yoon Ju; Choi, Jin Sun; Lee, Jae In

    2013-01-01

    The present method offers an efficient synthesis of 1-alkyl-2-phenyl-4-quinolones from 2-haloben-zoic acids. It has the advantages with respect to (i) synthesis of 2 equiv of alkynones 5 from 1 equiv of 4,6-pyrimidyl di(2-halobenzoates) 3, (ii) synthesis of versatile 1-alkyl-2-phenyl-4-quinolones in high overall yields, and (iii) use of readily available and cheap starting materials. Therefore, this method could be utilized as a practical synthesis of 1-alkyl-2-phenyl-4-quinolones. Several methods have been developed to synthesize 1-alkyl-2-phenyl-4-quinolones from 2'-substituted acetophenones, anilines, and 2-halobenzoyl chlorides as starting materials. The reaction of N-methylisatoic anhydride with the lithium enolate of an 4'-methoxyacetophenone afforded the 1-methyl-2-phenyl-4-quinolone in a short sequence, but the yield was low. N-(2-Acetylphenyl)benzamides, prepared by Friedel-Crafts acylation of N-phenyl benzamides with acetyl chloride or benzoylation of 2'-aminoacetophenones with benzoyl chlorides,8 were cyclized with potassium t-butoxide to yield 2-aryl-4-quinolones, which were further alkylated with alkyl iodides to give 1-alkyl-2-aryl-4-quinolones

  7. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    Science.gov (United States)

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. De novo fatty acid synthesis by Schwann cells is essential for peripheral nervous system myelination.

    Science.gov (United States)

    Montani, Laura; Pereira, Jorge A; Norrmén, Camilla; Pohl, Hartmut B F; Tinelli, Elisa; Trötzmüller, Martin; Figlia, Gianluca; Dimas, Penelope; von Niederhäusern, Belinda; Schwager, Rachel; Jessberger, Sebastian; Semenkovich, Clay F; Köfeler, Harald C; Suter, Ueli

    2018-02-06

    Myelination calls for a remarkable surge in cell metabolism to facilitate lipid and membrane production. Endogenous fatty acid (FA) synthesis represents a potentially critical process in myelinating glia. Using genetically modified mice, we show that Schwann cell (SC) intrinsic activity of the enzyme essential for de novo FA synthesis, fatty acid synthase (FASN), is crucial for precise lipid composition of peripheral nerves and fundamental for the correct onset of myelination and proper myelin growth. Upon FASN depletion in SCs, epineurial adipocytes undergo lipolysis, suggestive of a compensatory role. Mechanistically, we found that a lack of FASN in SCs leads to an impairment of the peroxisome proliferator-activated receptor (PPAR) γ-regulated transcriptional program. In agreement, defects in myelination of FASN-deficient SCs could be ameliorated by treatment with the PPARγ agonist rosiglitazone ex vivo and in vivo . Our results reveal that FASN-driven de novo FA synthesis in SCs is mandatory for myelination and identify lipogenic activation of the PPARγ transcriptional network as a putative downstream functional mediator. © 2018 Montani et al.

  9. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    International Nuclear Information System (INIS)

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of [14C]-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated

  10. Metabolic adaptations during lactogenesis. Fatty acid and lactose synthesis in cow mammary tissue.

    Science.gov (United States)

    Mellenberger, R W; Bauman, D E; Nelson, D R

    1973-11-01

    1. Mammary-tissue biopsies were obtained from multiparous cows at 30 and 7 days pre partum and 7 and 40 days post partum. Investigations of the effect of lactogenesis on fatty acid and lactose synthesis involved measurements of biosynthetic capacity (tissue-slice incubations in vitro) and activities of relevant enzymes. 2. Fatty acid synthesis from acetate increased over 20-fold from 30 days pre partum to 40 days post partum. Changes in the lipogenic capacity of mammary-tissue slices more closely paralleled increases in the activities of acetyl-CoA carboxylase (EC 6.4.1.2) and acetyl-CoA synthetase (EC 6.2.1.1) than of other enzymes involved in acetate incorporation into fatty acids or in NADPH generation. 3. Lactose biosynthesis by mammary-tissue slices, lactose synthetase activity (EC 2.4.1.22) and alpha-lactalbumin concentration were all negligible at 30 days pre partum but increased 2.5-4-fold between 7 days pre partum and 40 days post partum. Phosphoglucomutase (EC 2.7.5.1), UDP-glucose pyrophosphorylase (EC 2.7.7.9) and UDP-glucose 4-epimerase (EC 5.1.3.2) had substantial activities at 30 days pre partum and increased less dramatically during lactogenesis. 4. Results are consistent with acetyl-CoA carboxylase and perhaps acetyl-CoA synthetase representing the regulatory enzyme(s) in fatty acid synthesis, with lactose synthetase (alpha-lactalbumin) serving a similar function in lactose biosynthesis.

  11. New hydrazide-hydrazones of isonicotinic acid: synthesis, lipophilicity and in vitro antimicrobial screening.

    Science.gov (United States)

    Popiołek, Łukasz; Biernasiuk, Anna; Berecka, Anna; Gumieniczek, Anna; Malm, Anna; Wujec, Monika

    2018-04-01

    This study describes the synthesis, lipophilicity and in vitro antimicrobial assays of 15 new hydrazide-hydrazones of isonicotinic acid. New derivatives were obtained on the basis of the condensation reaction of isonicotinic acid hydrazide with different aromatic aldehydes. The chemical structure of synthesized compounds was confirmed by spectral methods. Experimental lipophilicity of new isonicotinic acid derivatives was determined using reversed-phase thin-layer chromatography. All synthesized compounds were subjected to in vitro antimicrobial assays against reference strains of Gram-positive bacteria, Gram-negative bacteria and fungi belonging to Candida spp. Some of the synthesized hydrazide-hydrazones proved to be significant antibacterial compounds and more potent than commonly used chemotherapeutic agents. © 2017 John Wiley & Sons A/S.

  12. Synthesis of phosphonic acid derivatized bipyridine ligands and their ruthenium complexes.

    Science.gov (United States)

    Norris, Michael R; Concepcion, Javier J; Glasson, Christopher R K; Fang, Zhen; Lapides, Alexander M; Ashford, Dennis L; Templeton, Joseph L; Meyer, Thomas J

    2013-11-04

    Water-stable, surface-bound chromophores, catalysts, and assemblies are an essential element in dye-sensitized photoelectrosynthesis cells for the generation of solar fuels by water splitting and CO2 reduction to CO, other oxygenates, or hydrocarbons. Phosphonic acid derivatives provide a basis for stable chemical binding on metal oxide surfaces. We report here the efficient synthesis of 4,4'-bis(diethylphosphonomethyl)-2,2'-bipyridine and 4,4'-bis(diethylphosphonate)-2,2'-bipyridine, as well as the mono-, bis-, and tris-substituted ruthenium complexes, [Ru(bpy)2(Pbpy)](2+), [Ru(bpy)(Pbpy)2](2+), [Ru(Pbpy)3](2+), [Ru(bpy)2(CPbpy)](2+), [Ru(bpy)(CPbpy)2](2+), and [Ru(CPbpy)3](2+) [bpy = 2,2'-bipyridine; Pbpy = 4,4'-bis(phosphonic acid)-2,2'-bipyridine; CPbpy = 4,4'-bis(methylphosphonic acid)-2,2'-bipyridine].

  13. Hybrid Compounds Strategy in the Synthesis of Oleanolic Acid Skeleton-NSAID Derivatives

    Directory of Open Access Journals (Sweden)

    Anna Pawełczyk

    2016-04-01

    Full Text Available The current study focuses on the synthesis of several hybrid individuals combining a natural oleanolic acid skeleton and synthetic nonsteroidal anti-inflammatory drug moieties (NSAIDs. It studied structural modifications of the oleanolic acid structure by use of the direct reactivity of hydroxyl or hydroxyimino groups at position C-3 of the triterpenoid skeleton with the carboxylic function of anti-inflammatory drugs leading to new perspective compounds with high potential pharmacological activities. Novel ester- and iminoester-type derivatives of oleanolic unit with the different NSAIDs, such as ibuprofen, aspirin, naproxen, and ketoprofen, were obtained and characterized. Moreover, preliminary research of compounds obtaining structure stability under acidic conditions was examined and the PASS method of prediction of activity spectra for substances was used to estimate the potential biological activity of these compounds.

  14. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.

    Science.gov (United States)

    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P

    2016-03-01

    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA. © 2015 International Society for Neurochemistry.

  15. Synthesis of aminocarbonyl N-acylhydrazones by a three-component reaction of isocyanides, hydrazonoyl chlorides, and carboxylic acids.

    Science.gov (United States)

    Giustiniano, Mariateresa; Meneghetti, Fiorella; Mercalli, Valentina; Varese, Monica; Giustiniano, Francesco; Novellino, Ettore; Tron, Gian Cesare

    2014-10-17

    A novel one-pot multicomponent synthesis of α-aminocarbonyl N-acylhydrazones starting from readily available hydrazonoyl chlorides, isocyanides, and carboxylic acids is reported. The strategy exploits the ability of the carboxylic acid as a third component to suppress all competing reactions between nitrile imines and isocyanides, channeling the course of the reaction toward the formation of this novel class of compounds.

  16. The Synthesis of a Dipeptide from its Component Amino Acids: Protecting Groups in the Elementary Organic Laboratory.

    Science.gov (United States)

    Young, Paul E.; Campbell, Andrew

    1982-01-01

    A simple, three-step procedure for synthesizing a dipeptide from its component amino acids is described. The dipeptide synthesized uses inexpensive amino acids having hydrocarbon side-chains and can be observed in E/Z forms by nuclear magnetic resonance spectroscopy. Each step in the synthesis produces white crystalline products using standard…

  17. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    OpenAIRE

    Moret Severine; Dyson Paul J.; Laurenczy Gabor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M...

  18. Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis

    International Nuclear Information System (INIS)

    Bai, Xupeng; Hong, Weipeng; Cai, Peiheng; Chen, Yibei; Xu, Chuncao; Cao, Di; Yu, Weibang; Zhao, Zhongxiang; Huang, Min; Jin, Jing

    2017-01-01

    Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36), an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the hepatic

  19. Synthesis and disappearance of cholesterol and bile acids in miniature swine

    International Nuclear Information System (INIS)

    Dupont, J.; Butterfield, A.B.; Clow, D.J.; Lumb, W.V.; McClellan, M.A.; O'Deen, L.; Oh, S-Y.

    1986-01-01

    Minerature swine were fitted with indwelling cannulae at two sites in the gut and catheters in the aorta, portal vein and posterior vena cava. Radioactive acetate, alanine and glucose were administered via the duodenal cannula or the portal vein catheter and synthesis of cholesterol by gut or liver monitored via the aortic serum cholesterol specific activity. Ring labeled cholesterol was administered via jejunum and portal vein and various parameters of disappearance measured during 17 to 66 days. Conversion of cholesterol to bile acids and their subsequent disappearance from gut lumen were measured. Differences were observed in substrate preference of gut and liver and in fate of newly synthesized cholesterol. Cholesterol disappearance was found to follow a two component exponential in serum and a three component exponential in gut. Serum curves were similar to those reported for humans. Two hepatic pools of cholesterol, one accessible to lipoprotein synthesis (anabolic) and another accessible to enterohepatic circulation and 7-α-hydroxylase, were inducated

  20. Synthesis of the mono- and di(4-(1,1,3,3-tetramethylbutyl)) phosphoric acids

    International Nuclear Information System (INIS)

    Elias, H.; Zaoui, A.; Attou, M.; Hadj Bachir, D.; Bouzidi, N.; Didi, M.

    1995-09-01

    This work is related to the synthesis of organophosphorus extracting agents used in purification of heavy metals such as uranium. The mono- and di (4-(1,1,3,3- tetramethylbutyl)) phenyl phosphoric acids, respectively MOPPA and DOPPA, are synthesizd by reaction of phosphorus pentoxid with 4(1,1,3,3-tetramethylbuthyl)) phenol. the separation of MOPPA from DOPPA is realised by liquid-liquid extraction. The Characterization, carried out by infrared uv-visible spectrophotometries, ph-metry and mass spectrometry, has confirmed the identity of the synthesized products. This study also showed that the products proportions are comporable to those of the homologous products obtained with 2-ethylbexanol in the same synthesis conditions

  1. Green Synthesis of Silver Nanoparticles Using Sodium Alginate and Lignosulphonic Acid Blends

    Science.gov (United States)

    Thakur, Amrita; Reddy, Giridhar

    2017-08-01

    A simple method based on the principles of green chemistry has been developed to synthesize stable silver nanoparticles (AgNP) for possible biomedical applications. Blend of sodium alginate (SA) and lignosulphonic acid (LS) prepared in the ratio of 80/20 mass percent respectively was used as reducing and stabilizing agent. This blend is biocompatible and has shown drug release ability under physiological conditions. Use of blend has an added advantage as LS has the ability to reduce silver while the blend matrix acts as a stabilizing agent. Effect of precursor concentration (AgNO3) and temperature was investigated. Progress of synthesis was monitored using UV-Vis spectroscopy. Higher temperature and lower silver nitrate concentration showed better synthesis of AgNP.

  2. Synthesis and characterization of 12-phosphotungstic acid supported on BEA zeolite

    Energy Technology Data Exchange (ETDEWEB)

    Jović, A.; Bajuk-Bogdanović, D.; Nedić Vasiljević, B. [Faculty of Physical Chemistry, University of Belgrade, Studentski trg 12-16, 11000 Belgrade (Serbia); Milojević-Rakić, M., E-mail: maja@ffh.bg.ac.rs [Faculty of Physical Chemistry, University of Belgrade, Studentski trg 12-16, 11000 Belgrade (Serbia); Krajišnik, D. [Department of Pharmaceutical Technology and Cosmetology, University of Belgrade-Faculty of Pharmacy, Vojvode Stepe 450, 11000 Belgrade (Serbia); Dondur, V. [Faculty of Physical Chemistry, University of Belgrade, Studentski trg 12-16, 11000 Belgrade (Serbia); Popa, A. [Institute of Chemistry Timisoara, Bl. Mihai Viteazul 24, 300223 Timisoara (Romania); Uskoković-Marković, S. [Department of Analytical Chemistry, University of Belgrade-Faculty of Pharmacy, Vojvode Stepe 450, 11000 Belgrade (Serbia); Holclajtner-Antunović, I. [Faculty of Physical Chemistry, University of Belgrade, Studentski trg 12-16, 11000 Belgrade (Serbia)

    2017-01-15

    An optimized synthetic route for obtaining heteropoly acid (HPA) species supported on BEA zeolite was applied, and different samples, comprising 20 to 50 wt% of 12-phosphotungstic acid (HPW) were prepared. The as-synthesized supported HPW were subjected to different post-synthesis routes, which involved calcination and ultrasound treatment. Characterization of these materials was performed by means of Scanning Electron Microscopy, zeta potential measurements, Infrared Spectroscopy and X-ray Powder Diffraction analysis. Results suggest strong interaction of HPW with the support and revealed that ultrasound treatment resulted in better dispersion of active phase and thus homogeneous morphology of the samples. The zeta potential was found to be dependent on the preparation procedure and HPW content in these materials, while higher HPW loadings induced its agglomeration. Catalytic activity of the synthesized materials was investigated in an ethanol dehydration reaction, where lower HPW loadings induced higher ethanol conversion. Acid sites distribution and accessibility for ethanol molecules were found to be more essential for catalytic activity than HPW loadings, i.e., amount of active sites present in these hybrid materials. - Highlights: • An optimized route for supporting heteropoly acid on beta zeolite is applied. • Ultrasound treatment of the composites gives dispersed morphology. • Lower heteropoly acid amount induces higher conversion in ethanol dehydration. • Acid sites distribution and accessibility for ethanol are essential for catalytic activity.

  3. Phospholyl(borane) Amino Acids and Peptides: Stereoselective Synthesis and Fluorescent Properties with Large Stokes Shift.

    Science.gov (United States)

    Arribat, Mathieu; Rémond, Emmanuelle; Clément, Sébastien; Lee, Arie Van Der; Cavelier, Florine

    2018-01-24

    The synthesis of phospholyl(borane) amino acids was stereoselectively achieved by reaction of phospholide anion with iodo α-amino ester derived from l-aspartic acid or l-serine, followed by in situ complexation with borane. Phospholyl(borane) amino acids are easy to store and can be subjected to direct transformation into the corresponding free phospholyl, gold complex, oxide or sulfur derivatives as well as phospholinium salts, thus offering a variety of side chains. After selective deprotection of carboxylic function or amine, C- or N- peptide coupling with an alanine moiety proved the possible incorporation into peptides. Such phospholyl amino acid and peptide derivatives exhibit fluorescent properties with a large Stokes shift (160 nm) and fluorescence up to 535 nm, depending on the phosphole aromaticity and the chemical environment. These phospholyl(borane) amino acids constitute a new class of unnatural amino acids useful for structure-activities relationship studies and appear to be promising fluorophores for the development of labeled peptides.

  4. Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT

    International Nuclear Information System (INIS)

    Brissette, J.L.; Pieringer, R.A.

    1985-01-01

    Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of [2- 14 C] acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of 14 C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indication of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing 14 C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of [ 14 C]-acetate into fatty acids

  5. A Linker for the Solid-Phase Synthesis of Hydroxamic Acids and Identification of HDAC6 Inhibitors

    DEFF Research Database (Denmark)

    Bang, Claus Gunnar; Jensen, Jakob Feldthusen; Cohrt, Anders Emil O'Hanlon

    2017-01-01

    We herein present broadly useful, readily available and nonintegral hydroxylamine linkers for the routine solid-phase synthesis of hydroxamic acids. The developed protocols enable the efficient synthesis and release of a wide range of hydroxamic acids from various resins, relying on high control...... and flexibility with respect to reagents and synthetic processes. A trityl-based hydroxylamine linker was used to synthesize a library of peptide hydroxamic acids. The inhibitory effects of the compounds were examined for seven HDAC enzyme subtypes using a chemiluminescence-based assay....

  6. Synthesis of a metabolically stable modified long-chain fatty acid salt and its photolabile derivative

    Energy Technology Data Exchange (ETDEWEB)

    Stoll, G.H.; Voges, R.; Gerok, W.; Kurz, G. (Institut fuer Organische Chemie and Biochemie, Universitaet Freiburg (Germany))

    1991-05-01

    An analogue of the long-chain fatty acid salt, sodium stearate, was synthesized in which the hydrogen atoms at carbons 2, 3, and 18 were replaced by fluorine. The key step in the synthesis was the addition of 3-iodo-2,2,3,3-tetrafluoropropanoic acid amide to 15,15,15-trifluoro-1-pentadecene. Radioactivity was introduced by catalytic reduction of 2,2,3,3,18,18,18-heptafluoro-4-octadecenoic acid amide with carrier-free tritium gas yielding a product with the specific radioactivity of 2.63 TBq/mmol. The resulting 2,2,3,3,18,18,18-heptafluoro-4-octadecenoic acid has a pKa of about 0.5 and is completely dissociated under normal physiological conditions. The fluorinated fatty acid salt analogue is readily taken up into hepatocytes and proved to be metabolically inert. In an approach to the identification of proteins involved in long-chain fatty acid salt transport across membranes and intracellular compartments, the photolabile derivative 11,11-azo-2,2,3,3,18,18,18-heptafluoro(G-3H)octadecanoic acid sodium salt was synthesized with a specific radioactivity of 2.63 TBq/mmol. Photolysis of the photolabile derivative, using a light source with a maximum emission at 350 nm, occurred with a half-life of 1.5 min. The generated carbene reacted with 14C-labeled methanol and acetonitrile with covalent bond formation of 6-13%. Its efficacy for photoaffinity labeling was demonstrated by incorporation into serum albumin, the extracellular fatty acid salt-binding protein, as well as into the intracellular fatty acid salt-binding protein (FABP) of rat liver with the molecular weight of 14,000.

  7. Engineering CRISPR interference system in Klebsiella pneumoniae for attenuating lactic acid synthesis.

    Science.gov (United States)

    Wang, Jingxuan; Zhao, Peng; Li, Ying; Xu, Lida; Tian, Pingfang

    2018-04-05

    Klebsiella pneumoniae is a promising industrial species for bioproduction of bulk chemicals such as 1,3-propanediol, 2,3-butanediol and 3-hydroxypropionic acid (3-HP). However, lactic acid is a troublesome by-product when optimizing for 3-HP production. Therefore, it is highly desirable to minimize lactic acid. Here, we show that lactic acid synthesis can be largely blocked by an engineered CRISPR interference (CRISPRi) system in K. pneumoniae. EGFP was recruited as a reporter of this CRISPRi system. Fluorescence assay of this CRISPRi system showed that enhanced green fluorescent protein (EGFP) expression level was repressed by 85-90%. To further test this CRISPRi system, guide RNAs were designed to individually or simultaneously target four lactate-producing enzyme genes. Results showed that all lactate-producing enzyme genes were significantly repressed. Notably, D-lactate dehydrogenase (ldhA) was shown to be the most influential enzyme for lactic acid formation in micro-aerobic conditions, as inhibiting ldhA alone led to lactic acid level similar to simultaneously repressing four genes. In shake flask cultivation, the strain coexpressing puuC (an aldehyde dehydrogenase catalyzing 3-hydroxypropionaldehyde to 3-HP) and dCas9-sgRNA inhibiting ldhA produced 1.37-fold 3-HP relative to the reference strain. Furthermore, in bioreactor cultivation, this CRISPRi strain inhibiting ldhA produced 36.7 g/L 3-HP, but only generated 1 g/L lactic acid. Clearly, this engineered CRISPRi system largely simplified downstream separation of 3-HP from its isomer lactic acid, an extreme challenge for 3-HP bioprocess. This study offers a deep understanding of lactic acid metabolism in diverse species, and we believe that this CRISPRi system will facilitate biomanufacturing and functional genome studies of K. pneumoniae or beyond.

  8. Loss of glycogen debranching enzyme AGL drives bladder tumor growth via induction of hyaluronic acid synthesis

    Science.gov (United States)

    Guin, Sunny; Ru, Yuanbin; Agarwal, Neeraj; Lew, Carolyn R.; Owens, Charles; Comi, Giacomo P.; Theodorescu, Dan

    2015-01-01

    Purpose We demonstrated that Amylo-alpha-1-6-glucosidase-4-alpha-glucanotransferase (AGL) is a tumor growth suppressor and prognostic marker in human bladder cancer. Here we determine how AGL loss enhances tumor growth, hoping to find therapeutically tractable targets/pathways that could be used in patients with low AGL expressing tumors. Experimental Design We transcriptionally profiled bladder cell lines with different AGL expression. By focusing on transcripts overexpressed as a function of low AGL and associated with adverse clinicopathologic variables in human bladder tumors, we sought to increase the chances of discovering novel therapeutic opportunities. Results One such transcript was hyaluronic acid synthase 2 (HAS2), an enzyme responsible for hyaluronic acid (HA) synthesis. HAS2 expression was inversely proportional to that of AGL in bladder cancer cells and immortalized and normal urothelium. HAS2 driven HA synthesis was enhanced in bladder cancer cells with low AGL and this drove anchorage dependent and independent growth. siRNA mediated depletion of HAS2 or inhibition of HA synthesis by 4-Methylumbelliferone (4MU) abrogated in vitro and xenograft growth of bladder cancer cells with low AGL. AGL and HAS2 mRNA expression in human tumors was inversely correlated in patient datasets. Patients with high HAS2 and low AGL tumor mRNA expression had poor survival lending clinical support to xenograft findings that HAS2 drives growth of tumors with low AGL. Conclusion Our study establishes HAS2 mediated HA synthesis as a driver of growth of bladder cancer with low AGL and provides preclinical rationale for personalized targeting of HAS2/HA signaling in patients with low AGL expressing tumors. PMID:26490312

  9. Synthesis of Furandicarboxylic Acid Esters From Nonfood Feedstocks Without Concomitant Levulinic Acid Formation

    NARCIS (Netherlands)

    Klis, van der Frits; Haveren, van Jacco; Es, van Daan S.; Bitter, Harry

    2017-01-01

    5-Hydroxymethylfurfural (HMF) is a versatile intermediate in biomass conversion pathways. However, the notoriously unstable nature of HMF imposes challenges to design selective routes to chemicals such as furan-2,5-dicarboxylic acid (FDCA). Here, a new strategy for obtaining furans is presented,

  10. Stereocontrolled synthesis of syn-β-Hydroxy-α-amino acids by direct aldolization of pseudoephenamine glycinamide.

    Science.gov (United States)

    Seiple, Ian B; Mercer, Jaron A M; Sussman, Robin J; Zhang, Ziyang; Myers, Andrew G

    2014-04-25

    β-Hydroxy-α-amino acids figure prominently as chiral building blocks in chemical synthesis and serve as precursors to numerous important medicines. Reported herein is a method for the synthesis of β-hydroxy-α-amino acid derivatives by aldolization of pseudoephenamine glycinamide, which can be prepared from pseudoephenamine in a one-flask protocol. Enolization of (R,R)- or (S,S)-pseudoephenamine glycinamide with lithium hexamethyldisilazide in the presence of LiCl followed by addition of an aldehyde or ketone substrate affords aldol addition products that are stereochemically homologous with L- or D-threonine, respectively. These products, which are typically solids, can be obtained in stereoisomerically pure form in yields of 55-98 %, and are readily transformed into β-hydroxy-α-amino acids by mild hydrolysis or into 2-amino-1,3-diols by reduction with sodium borohydride. This new chemistry greatly facilitates the construction of novel antibiotics of several different classes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. CO- and HCl-free synthesis of acid chlorides from unsaturated hydrocarbons via shuttle catalysis

    Science.gov (United States)

    Fang, Xianjie; Cacherat, Bastien; Morandi, Bill

    2017-11-01

    The synthesis of carboxylic acid derivatives from unsaturated hydrocarbons is an important process for the preparation of polymers, pharmaceuticals, cosmetics and agrochemicals. Despite its industrial relevance, the traditional Reppe-type carbonylation reaction using pressurized CO is of limited applicability to laboratory-scale synthesis because of: (1) the safety hazards associated with the use of CO, (2) the need for special equipment to handle pressurized gas, (3) the low reactivity of several relevant nucleophiles and (4) the necessity to employ different, often tailor-made, catalytic systems for each nucleophile. Herein we demonstrate that a shuttle-catalysis approach enables a CO- and HCl-free transfer process between an inexpensive reagent, butyryl chloride, and a wide range of unsaturated substrates to access the corresponding acid chlorides in good yields. This new transformation provides access to a broad range of carbonyl-containing products through the in situ transformation of the reactive acid chloride intermediate. In a broader context, this work demonstrates that isodesmic shuttle-catalysis reactions can unlock elusive catalytic reactions.

  12. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    Science.gov (United States)

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  13. Gluconeogenesis, non-essential amino acid synthesis and substrate partitioning in chicken embryos during later development.

    Science.gov (United States)

    Hu, Q; Agarwal, U; Bequette, B J

    2017-02-01

    We aimed to quantify the rate of gluconeogenesis (GNG), non-essential amino-acid (NEAA) synthesis, and substrate partitioning to the Krebs cycle in embryonic (e) day e14 and e19 chicken embryos. An in ovo continuous tracer infusion approach was employed to test the hypotheses that GNG and NEAA synthesis in developing chicken embryo increases from e14 to e19. [ 13 C 6 ]Glucose or [ 13 C 3 ]glycerol was continuously infused (8 h) into the chorio-allantoic compartment of eggs on e14 and e19. Glucose entry rate, Cori cycling, and GNG were higher (P < 0.05) in e19 compared to e14 embryos, presumably to support higher glycogen deposition in liver and muscle. Whereas de novo synthesis of alanine, aspartate, and glutamate via glycolysis and the Krebs cycle was higher (P < 0.01) in e14 embryos, synthesis of these NEAA from glycerol was higher (P < 0.05) in e19 compared to e14 embryos. These patterns of glucose and glycerol utilization suggest a metabolic shift to conserve glucose for glycogen synthesis and an increased utilization of yolk glycerol (from triacylglyceride) after e14. Although the contribution of glycerol to GNG in e19 embryos was higher (P < 0.05) than that in e14 embryos, the contribution of glycerol to GNG (1.3 to 6.0%) was minor. Based on [ 13 C 6 ]glucose tracer kinetics, the activities of both pyruvate carboxylase (PC) and pyruvate dehydrogenase (PDH) in the liver were higher (P < 0.05) in e19 embryos; whereas the higher (P < 0.01) relative activity of liver PC compared to PDH in e14 embryos suggests a greater anaplerotic flux into the Krebs cycle. In summary, the in ovo continuous tracer infusion approach allowed for a measurement of chicken embryo whole body and liver metabolism over a shorter window of development. This study provided quantitative estimates of the developmental shifts in substrate utilization, GNG, and NEAA synthesis by chicken embryos, as well as qualitative estimates of the activities of enzymes central to the Krebs cycle

  14. Synthesis and antimicrobial activities of new higher amino acid Schiff base derivatives of 6-aminopenicillanic acid and 7-aminocephalosporanic acid

    Science.gov (United States)

    Özdemir (nee Güngör), Özlem; Gürkan, Perihan; Özçelik, Berrin; Oyardı, Özlem

    2016-02-01

    Novel β-lactam derivatives (1c-3c) (1d-3d) were produced by using 6-aminopenicillanic acid (6-APA), 7-aminocephalosporanic acid (7-ACA) and the higher amino acid Schiff bases. The synthesized compounds were characterized by elemental analysis, IR, 1H/13C NMR and UV-vis spectra. Antibacterial activities of all the higher amino acid Schiff bases (1a-3a) (1b-3b) and β-lactam derivatives were screened against three gram negative bacteria (Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, Acinetobacter baumannii RSKK 02026), three gram positive bacteria (Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 07005, Bacillus subtilis ATCC 6633) and their drug-resistant isolates by using broth microdilution method. Two fungi (Candida albicans and Candida krusei) were used for antifungal activity.

  15. Microbial synthesis of polyhydroxyalkanoate using seaweed-derived crude levulinic acid as co-nutrient.

    Science.gov (United States)

    Bera, Anupam; Dubey, Sonam; Bhayani, Khushbu; Mondal, Dibyendu; Mishra, Sandhya; Ghosh, Pushpito K

    2015-01-01

    Production of polyhydroxyalkanoates (PHAs) from Jatropha biodiesel residues, namely crude glycerol and oil cake hydrolysate, has been reported previously. Halomonas hydrothermalis (MTCC accession no. 5445; NCBI Genbank accession no. GU938192), a wild marine strain, was used in the bio-synthesis. The present study was initiated to vary the properties of the polymer. Seaweed-derived crude levulinic acid (SDCLA), containing formic acid, residual sugars and dissolved minerals additionally, was proposed as co-feed along with the biodiesel residues. Experiments were conducted at 100mL scale in batch process. Whereas the PHA yield was only 0.40 ± 0.01 g when only biodiesel residues were employed, it rose to 1.07 ± 0.02 g in presence of 0.35% (w/v) of SDCLA. The corresponding carbon utilisation efficiencies were 29.3% and 57.5%, respectively. 3-Hydroxy valerate incorporation in the PHA was pronounced in presence of SDCLA, with associated changes in polymer properties. The microbial synthesis fared poorly when SDCLA was substituted with pure levulinic acid. Thus, Halomonas hydrothermalis had a poor response to levulinic acid, as such, and other constituents present in SDCLA appear to have played a vital role in bacterial cell division and accumulation of PHA. Biodegradability tests in moist soil were also conducted as part of the study. Marine microalgal cultivation for biodiesel and seaweed cultivation for fuels may help generate biodiesel residues and crude levulinic acid in proximity, which would open up the possibility of large scale PHA manufacture in efficient and practical manner in the future through the methodology of the present study. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Green synthesis of gold nanoparticles using chlorogenic acid and their enhanced performance for inflammation.

    Science.gov (United States)

    Hwang, Su Jung; Jun, Sang Hui; Park, Yohan; Cha, Song-Hyun; Yoon, Minho; Cho, Seonho; Lee, Hyo-Jong; Park, Youmie

    2015-10-01

    Here we developed a novel green synthesis method for gold nanoparticles (CGA-AuNPs) using chlorogenic acid (CGA) as reductants without the use of other chemicals and validated the anti-inflammatory efficacy of CGA-AuNPs in vitro and in vivo. The resulting CGA-AuNPs appeared predominantly spherical in shape with an average diameter of 22.25±4.78nm. The crystalline nature of the CGA-AuNPs was confirmed by high-resolution X-ray diffraction and by selected-area electron diffraction analyses. High-resolution liquid chromatography/electrospray ionization mass spectrometry revealed that the caffeic acid moiety of CGA forms quinone structure through a two-electron oxidation causing the reduction of Au(3+) to Au(0). When compared to CGA, CGA-AuNPs exhibited enhanced anti-inflammatory effects on NF-κB-mediated inflammatory network, as well as cell adhesion. Collectively, green synthesis of CGA-AuNPs using bioactive reductants and mechanistic studies based on mass spectrometry may open up new directions in nanomedicine and CGA-AuNPs can be an anti-inflammatory nanomedicine for future applications. Gold nanoparticles (Au NPs) have been shown to be very useful in many applications due to their easy functionalization capability. In this article, the authors demonstrated a novel method for the synthesis of gold nanoparticles using chlorogenic acid (CGA) as reductants. In-vitro experiments also confirmed biological activity of the resultant gold nanoparticles. Further in-vivo studies are awaited. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Hepatic inflammation caused by dysregulated bile acid synthesis is reversible by butyrate supplementation.

    Science.gov (United States)

    Sheng, Lili; Jena, Prasant Kumar; Hu, Ying; Liu, Hui-Xin; Nagar, Nidhi; Kalanetra, Karen M; French, Samuel William; French, Samuel Wheeler; Mills, David A; Wan, Yu-Jui Yvonne

    2017-12-01

    Dysregulated bile acid (BA) synthesis or reduced farnesoid X receptor (FXR) levels are found in patients having metabolic diseases, autoimmune hepatitis, and liver cirrhosis or cancer. The objective of this study was to establish the relationship between butyrate and dysregulated BA synthesis-induced hepatitis as well as the effect of butyrate in reversing the liver pathology. Wild-type (WT) and FXR knockout (KO) male mice were placed on a control (CD) or western diet (WD) for 15 months. In the presence or absence of butyrate supplementation, feces obtained from 15-month-old WD-fed FXR KO mice, which had severe hepatitis and liver tumors, were transplanted to 7-month-old WD-fed FXR KO for 3 months. Hepatic phenotypes, microbiota profile, and BA composition were analyzed. Butyrate-generating bacteria and colonic butyrate concentration were reduced due to FXR inactivation and further reduced by WD intake. In addition, WD-fed FXR KO male mice had the highest concentration of hepatic β-muricholic acid (β-MCA) and bacteria-generated deoxycholic acid (DCA) accompanied by serious hepatitis. Moreover, dysregulated BA and reduced SCFA signaling co-existed in both human liver cancers and WD-fed FXR KO mice. Microbiota transplantation using butyrate-deficient feces derived from 15-month-old WD-fed FXR KO mice increased hepatic lymphocyte numbers as well as hepatic β-MCA and DCA concentrations. Furthermore, butyrate supplementation reduced hepatic β-MCA as well as DCA and eliminated hepatic lymphocyte infiltration. In conclusion, reduced butyrate contributes to the development of hepatitis in the FXR KO mouse model. In addition, butyrate reverses dysregulated BA synthesis and its associated hepatitis. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  18. Stereospecific synthesis of syn-α-oximinoamides by a three-component reaction of isocyanides, syn-chlorooximes, and carboxylic acids.

    Science.gov (United States)

    Pirali, Tracey; Mossetti, Riccardo; Galli, Simona; Tron, Gian Cesare

    2011-07-15

    A stereospecific multicomponent reaction among isocyanides, syn-chlorooximes, and carboxylic acids provides an efficient synthesis of biologically relevant syn-α-oximinoamides. © 2011 American Chemical Society

  19. The Process of Acetonitrile Synthesis over γ-Al2O3 Promoted by Phosphoric Acid Catalysts

    OpenAIRE

    Galanov, Sergey I.; Sidorova, Olga I.; Gavrilenko, Mikhail A.

    2014-01-01

    The influence of principal parameters (reaction temperature, ratio of acetic acid and ammonia, composition of reactionary mixture and promotion of catalysts) on the selectivity and yield of the desired product was studied in the reaction of catalytic acetonitrile synthesis by ammonolysis of acetic acid. The processing of [gamma]-Al[2]O[3] by phosphoric acid increases amount of the centers, on which carries out reaction of acetamide dehydration. The kinetic model of a limiting stage of reactio...

  20. Bis-pyrene-modified unlocked nucleic acids: synthesis, hybridization studies, and fluorescent properties

    DEFF Research Database (Denmark)

    Perlíková, Pavla; Ejlersen, Maria; Langkjaer, Niels

    2014-01-01

    Efficient synthesis of a building block for the incorporation of a bis-pyrene-modified unlocked nucleic acid (UNA) into oligonucleotides (DNA*) was developed. The presence of bis-pyrene-modified UNA within a duplex leads to duplex destabilization that is more profound in DNA*/RNA and less distinct......)uracil:pyrene exciplex emission in the single-stranded form. Such fluorescent properties enable the application of bis-pyrene-modified UNA in the development of fluorescence probes for DNA/RNA detection and for detection of deletions at specific positions....

  1. Asymmetric synthesis of quaternary aryl amino acid derivatives via a three-component aryne coupling reaction

    Directory of Open Access Journals (Sweden)

    Elizabeth P. Jones

    2011-11-01

    Full Text Available A method was developed for the synthesis of α-alkyl, α-aryl-bislactim ethers in good to excellent yields and high diastereoselectivities, consisting of a facile one-pot procedure in which the aryl group is introduced by means of a nucleophilic addition to benzyne and the alkyl group by alkylation of a resultant benzylic anion. Hydrolysis of the sterically less hindered adducts gave the corresponding quaternary amino acids with no racemization, whereas hydrolytic ring opening gave the corresponding valine dipeptides from bulkier bislactims.

  2. Synthesis, characterization and catalytic activity of oxovanadium (IV) complexes of heterocyclic acid hydrazones

    International Nuclear Information System (INIS)

    Pandey, Manju; Sunaja Devi, K.R.; Sreeja, P.B.

    2014-01-01

    Two acid hydrazones, Furan-2-carbaldehyde nicotinic hydrazone (L 1 ) and Furan-2-carbaldehyde benzhydrazone (L 2 ) have been synthesised and they are characterized by elemental analysis, IR, NMR and UV spectral analysis. Oxovanadium (IV) complexes of these two hydrazones were synthesised and characterised by elemental analysis, IR, UV, EPR, molar conductivity and magnetic susceptibility measurements. Conductivity measurements reveal that the complexes are nonelectrolytes. Spectral data indicates the square pyramidal geometry for the monomeric give coordinated oxovanadium (IV) complexes with the general formula (VO(L)(OCH 3 )). The complex was studied for its catalytic activity and was found to be a good catalyst in quinoxaline synthesis. (author)

  3. Solvent free one pot synthesis of amidoalkyl naphthols over phosphotungstic acid

    Directory of Open Access Journals (Sweden)

    Divya P. Narayanan

    2017-07-01

    Full Text Available Montmorillonite KSF clay was effectively modified by the encapsulation of phosphotungstic acid into the clay layers via sonication followed by incipient wet impregnation method. The prepared catalysts were characterized by X-ray diffraction (XRD, Fourier-transform infrared spectroscopy (FTIR and scanning electron microscopy (SEM techniques. The catalytic activities of the prepared systems were investigated in the solvent free synthesis of amidoalkyl naphthols by the multicomponent one-pot condensation of an aldehyde, β-naphthol and an amide or urea. Excellent yield, shorter reaction time, easy work-up, and reusability of the catalyst are the main attractions of this green procedure.

  4. Synthesis and characterization of organic-inorganic hybrids formed between conducting polymers and crystalline antimonic acid

    Directory of Open Access Journals (Sweden)

    Beleze Fábio A.

    2001-01-01

    Full Text Available In this paper we report the synthesis and characterization of novel organic-inorganic hybrid materials between the crystalline antimonic acid (CAA and two conductive polymers: polypyrrole and polyaniline. The hybrids were obtained by in situ oxidative polymerization of monomers by the Sb(V present in the pyrochlore-like CAA structure. The materials were characterized by infrared and Raman spectroscopy, X-ray diffraction, cyclic voltammetry, CHN elemental analysis and electronic paramagnetic resonance spectroscopy. The results showed that both polymers were formed in their oxidized form, with the CAA structure acting as a counter anion.

  5. Studies on protein synthesis by protoplasts of Saccharomyces carlsbergensis II. Reversal of the RNase effect of protein synthesis by polymethacrylic acid

    NARCIS (Netherlands)

    Kloet, S.R. de; Wermeskerken, R.K.A. van; Koningsberger, V.V.

    1961-01-01

    The ribonuclease inhibited protein synthesis and respiration of yeast protoplasts can be restored by the addition of several polyanionic compounds, among which polymethacrylic acid proved to be the most effective one. The results of preliminary experiments with the ultracentrifuge indicate a

  6. Iron-substituted cubic silsesquioxane pillared clays: Synthesis, characterization and acid catalytic activity.

    Science.gov (United States)

    Potsi, Georgia; Ladavos, Athanasios K; Petrakis, Dimitrios; Douvalis, Alexios P; Sanakis, Yiannis; Katsiotis, Marios S; Papavassiliou, Georgios; Alhassan, Saeed; Gournis, Dimitrios; Rudolf, Petra

    2018-01-15

    Novel pillared structures were developed from the intercalation of iron-substituted cubic silsesquioxanes in a sodium and an acid-activated montmorillonite nanoclay and evaluated as acid catalysts. Octameric cubic oligosiloxanes were formed upon controlled hydrolytic polycondensation of the corresponding monomer (a diamino-alkoxysilane) and reacted with iron cations to form complexes that were intercalated within the layered nanoclay matrices. Upon calcination iron oxide nanoparticles are formed which are located on the silica cubes (pillars) and on the surfaces of the clay platelets. Acid activation of the nanoclay was performed in order to increase the number of acid active sites in the pristine clay and thus increase its catalytic activity. A plethora of analytical techniques including X-ray diffraction, thermal analyses, Fourier transform infrared, electron paramagnetic resonance, Raman, Mössbauer and X-ray photoelectron spectroscopies and porosimetry measurements were used in order to follow the synthesis steps and to fully characterize the final catalysts. The resulting pillared clays exhibit a high specific area and show significant acid catalytic activity that was verified using the catalytic dehydration of isopropanol asa probe reaction. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Semi-synthesis of new antimicrobial esters from the natural oleanolic and maslinic acids.

    Science.gov (United States)

    Chouaïb, Karim; Hichri, Fayçal; Nguir, Asma; Daami-Remadi, Majda; Elie, Nicolas; Touboul, David; Ben Jannet, Hichem; Hamza, M'hamed Ali

    2015-09-15

    In this article, we report an effective procedure for the selective isolation of oleanolic acid 1 and maslinic acid 2 (3.4 and 8.5mg/g DW, respectively) from pomace olive (Olea europaea L.) using an ultrasonic bath, and the synthesis of a series of new triterpenic acid esters. The compounds were characterized by their spectral data and were evaluated for their antimicrobial activity. Among the compounds tested, those having sulfur and chlorine atoms were found to be antibacterial. They showed activity against two Gram-positive bacteria Staphylococcus aureus and Enterococcus faecalis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa (MICs within a range of 5-25μg/mL). The fungus Penicillium italicum was found to be the most sensitive to both sulfur derivatives: (3β)-3-((thiophene-2-carbonyl)oxy)-olean-12-en-28-oic acid (1a) (IZ=22mm) and (2α,3β-2,3-bis((thiophene-2-carbonyl)oxy)olean-12-en-28-oic acid (2a) (IZ=24mm). Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Microwave-Assisted Synthesis of (±-Mandelic Acid-d5, Optical Resolution, and Absolute Configuration Determination

    Directory of Open Access Journals (Sweden)

    Claudio Bruno

    2013-01-01

    Full Text Available An efficient microwave-assisted synthesis of (±-mandelic acid-d5 was developed. The racemic mixture was resolved by diastereomeric salt formation using 1-phenylethylamine enantiomers as resolving agents. At each step, the resolution process was checked by determining mandelic acid-d5 enantiomer ee values directly on fractional crystallized diastereomeric salts by chiral capillary electrophoresis analysis. Highly enriched (−- and (+-mandelic acid-d5 (95% and 90% ee, resp. were obtained and their absolute configurations—R and S, respectively—were determined by correlation of the (−-mandelic acid-d5 circular dichroism spectrum to the (R-mandelic acid one.

  9. Synthesis and characterization of boric acid mediated metal-organic frameworks based on trimesic acid and terephthalic acid

    Science.gov (United States)

    Ozer, Demet; Köse, Dursun A.; Şahin, Onur; Oztas, Nursen Altuntas

    2017-08-01

    The new metal-organic framework materials based on boric acid reported herein. Sodium and boron containing metal-organic frameworks were synthesized by one-pot self-assembly reaction in the presence of trimesic acid and terephthalic acid in water/ethanol solution. Boric acid is a relatively cheap boron source and boric acid mediated metal-organic framework prepared mild conditions compared to the other boron source based metal-organic framework. The synthesized compounds were characterized by FT-IR, p-XRD, TGA/DTA, elemental analysis, 13C-MAS NMR, 11B-NMR and single crystal measurements. The molecular formulas of compounds were estimated as C18H33B2Na5O28 and C8H24B2Na2O17 according to the structural analysis. The obtained complexes were thermally stable. Surface properties of inorganic polymer complexes were investigated by BET analyses and hydrogen storage properties of compound were also calculated.

  10. Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

    Science.gov (United States)

    Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

    2017-04-01

    Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Intracellular synthesis of glutamic acid in Bacillus methylotrophicus SK19.001, a glutamate-independent poly(γ-glutamic acid)-producing strain.

    Science.gov (United States)

    Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo

    2016-01-15

    Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.

  12. Convenient Synthesis and Antimicrobial Activity of Some Novel Amino Acid Coupled Triazoles

    Directory of Open Access Journals (Sweden)

    S. M. El Rayes

    2010-09-01

    Full Text Available This study describes a promising one-pot synthesis of [2-(5-benzyl-4-phenyl-4H-[1,2,4]triazol-3-thio-acetyl]-amino acid methyl esters 6a-h and dipeptides 10a-e, which were successfully synthesized starting from amino acid esters 5a-h, 9a-e and azides 4, 8a,b, respectively. On the other hand, azide 4 underwent Curtius rearrangement to the corresponding isocyanate, which subsequently reacted with selected aliphatic amine and/or aniline derivatives to give the corresponding urea derivatives 11 and 12a,b. Reactions of the isocyanate with secondary amines gave amide derivatives 13a,b. The structural elucidation of products is reported and some of the products were also screened for their antimicrobial activity.

  13. A facile "green" synthesis of ascorbic acid-capped ZnSe nanoparticles.

    Science.gov (United States)

    Oluwafemi, Oluwatobi S; Revaprasadu, N; Adeyemi, Olufemi O

    2010-08-01

    A simple, green room temperature synthesis of ascorbic acid-capped ZnSe nanoparticles is hereby reported. By varying the pH of the solution, the temporal evolution of the optical properties and shape of the nanocrystals was investigated. The nanoparticles were characterized by UV-vis absorption and photoluminescence spectroscopy (PL), transmission electron microscope (TEM) and infra-red spectroscopy (IR). All the particles exhibited quantum confinement in their optical spectra. An atypical optical spectrum was observed at pH 11 after 5h attributed to digestive ripening and shrinkage of ZnSe core. From the TEM image we inferred that the reaction is kinetically driven at pH 7 producing elongated particles as the reaction times increases, while spherical particles are produced at pH 4 and 11. The IR spectroscopy confirmed the capping of ascorbic acid and its deprotonation to give ascorbate ions. Copyright 2010 Elsevier B.V. All rights reserved.

  14. Synthesis of Chiral 1,4-Disubstituted-1,2,3-Triazole Derivatives from Amino Acids

    Directory of Open Access Journals (Sweden)

    Morten Grøtli

    2009-12-01

    Full Text Available A versatile method for the synthesis of chiral 1,4-disubstituted-1,2,3-triazole derivatives starting from easily accessible naturally occurring D-or L-amino acids as chiral synthons is described. The amino acids were converted into azido alcohols, followed by copper catalyzed [3+2] cycloaddition reactions between the azido alcohols and methyl propiolate and subsequent ester aminolysis with primary and secondary amines furnished the target compounds, which were obtained in excellent yields with no racemization. Docking of selected target compounds shows that the chiral 1,4-disubstituted-1,2,3-triazoles derivatives has the potential of mimicking the binding mode of known purine analogues.

  15. Calcium regulates glutamate dehydrogenase and poly-γ-glutamic acid synthesis in Bacillus natto.

    Science.gov (United States)

    Meng, Yonghong; Dong, Guiru; Zhang, Chen; Ren, Yuanyuan; Qu, Yuling; Chen, Weifeng

    2016-04-01

    To study the effect of Ca(2+) on glutamate dehydrogenase (GDH) and its role in poly-γ-glutamic acid (γ-PGA) synthesis in Bacillus natto HSF 1410. When the concentration of Ca(2+) varied from 0 to 0.1 g/l in the growth medium of B. natto HSF 1410, γ-PGA production increased from 6.8 to 9.7 g/l, while GDH specific activity and NH4Cl consumption improved from 183 to 295 U/mg and from 0.65 to 0.77 g/l, respectively. GDH with α-ketoglutarate as substrate primarily used NADPH as coenzyme with a K m of 0.08 mM. GDH was responsible for the synthesis of endogenous glutamate. The specific activity of GDH remained essentially unchanged in the presence of CaCl2 (0.05-0.2 g/l) in vitro. However, the specific activity of GDH and its expression was significantly increased by CaCl2 in vivo. Therefore, the regulation of GDH and PGA synthesis by Ca(2+) is an intracellular process. Calcium regulation may be an effective approach for producing γ-PGA on an industrial scale.

  16. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    Science.gov (United States)

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.

  17. Synthesis of hemicellulose-acrylic acid graft copolymer super water absorbent resin by ultrasonic irradiation technology

    Directory of Open Access Journals (Sweden)

    Fangfang LIU

    2015-12-01

    Full Text Available The hemicellulose super water absorbent resin is prepared by using ultrasonic irradiation technology, with the waste liquid produced during the preparation of viscose fiber which contains a large amount of hemicellulose as raw material, acrylic acid as graft monomer, N,N’-methylene bis acrylamide (NMBA as cross linking agent, and (NH42S2O8-NaHSO3 as the redox initiation system. The synthesis conditions, structure and water absorption ability of resin are discussed. The results indicate that water absorbency of the resin is 311 g/g, the tap water absorbency is 102 g/g, the normal saline absorbency is 55 g/g, and the artificial urine absorbency is 31 g/g under the optimal synthesis conditions, so the resin has great water absorption rate and water retaining capacity. The FT-IR and SEM analysis shows that the resin with honeycomb network structure is prepared. The successfully synthesized of the resin means that the hemicellulose waste liquid can be highly effectively recycled, and it provides a kind of new raw material for the synthesis of super water absorbent resin.

  18. Lanthanide nitrates as Lewis acids in the one-pot synthesis of 1,2,4-oxadiazole derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Vale, Juliana A.; Faustino, Wagner M., E-mail: julianadqf@yahoo.com.br [Departamento de Quimica, Universidade Federal da Paraiba, Joao Pessoa, PB (Brazil); Zampieri, Davila de S.; Moran, Paulo J.S.; Rodrigues, Jose A.R. [Instituto de Quimica, Universidade Estadual de Campinas, SP (Brazil); Sa, Gilberto F. de [Departamento de Quimica Fundamental, CCEN, Universidade Federal de Pernambuco, Recife, PE (Brazil)

    2012-08-15

    In this work we report the use of lanthanide nitrates [Ln(NO{sub 3}){sub 3}] acting as catalyst in direct one pot synthesis of 3-benzoyl- and 3-acetyl-1,2,4-oxadiazoles derivatives from ketones, nitriles and nitric acid. This is the first example of one-pot synthesis of benzoyl- and acetyl 1,2,4-oxadiazoles derivatives preparation using acetophenones derivates with electron-donator groups. (author)

  19. Synthesis of nucleotide–amino acid conjugates designed for photo-CIDNP experiments by a phosphotriester approach

    Directory of Open Access Journals (Sweden)

    Tatyana V. Abramova

    2013-12-01

    Full Text Available Conjugates of 2’-deoxyguanosine, L-tryptophan and benzophenone designed to study pathways of fast radical reactions by the photo Chemically Induced Dynamic Nuclear Polarization (photo-CIDNP method were obtained by the phosphotriester block liquid phase synthesis. The phosphotriester approach to the oligonucleotide synthesis was shown to be a versatile and economic strategy for preparing the required amount of high quality samples of nucleotide–amino acid conjugates.

  20. Synthesis of 2-phenyl- and 2,3-diphenyl-quinolin-4-carboxylic acid derivatives

    International Nuclear Information System (INIS)

    Elhadi, S. A.

    2004-09-01

    Quinolin derivatives are a group of compounds known to possess a wide range of biological activities. The chemistry of quinolines together with their corresponding aldehydes were dealt with in chapter one of this study. Special emphasis was given to the chemistry of benzaldehyde. Twenty five 2-phenyl- and 2,3-diphenyl-quinolin-4-carboxylic acid derivatives together with their corresponding intermediates were prepared in this work. Basically, the synthetic design of these compounds arise from the appropriate disconnections of the target 2-phenyl and 2,3-diphenyl-quinolin-4-carboxylic acids. The retro synthesis analysis of these compounds reveals pyruvic acid, aromatic amine and benzaldehyde or phenyl pyruvic acid, aromatic amine and benzaldehyde as possible logical precursors for 2-phenyl-and 2,3-diphenyl- quinoline-4-carboxylic acids respectively. The purity and identities of the synthesized compounds were elucidated through chromatographic and spectroscopic techniques. The compounds were heavily subjected to spectroscopic analysis (UV, IR, GC/MS, 1 H-and 13 C- NMR). The appropriate disconnections and the mechanisms of the corresponding reactions were given and discussed in chapter three. The spectral data were interpreted and correlated with the target structures. The prepared 2-phenyl- and 2,3-diphenyl-quinoline-4-carboxylic acid derivatives were screened for their antibacterial activity. The compounds were tested against the standard bacterial organisms B. subtilis, S. aureus, E. coli and P. vulgaris. Some of these compounds were devoid of antibacterial activity against S. aureus and P. vulgaris, while others showed moderate activity. All of the tested compounds showed an activity against B. subtilis and E. coli. 2,3-diphenyl -6-sulphanilamide-quinolin-4-carboxylic acid showed the highest activity against the four standard tested organisms.(Author)

  1. Inhibition of in vitro CO2 production and lipid synthesis by 2-hydroxybutyric acid in rat brain

    Directory of Open Access Journals (Sweden)

    Silva A.R.

    2001-01-01

    Full Text Available 2-Hydroxybutyric acid appears at high concentrations in situations related to deficient energy metabolism (e.g., birth asphyxia and also in inherited metabolic diseases affecting the central nervous system during neonatal development, such as "cerebral" lactic acidosis, glutaric aciduria type II, dihydrolipoyl dehydrogenase (E3 deficiency, and propionic acidemia. The present study was carried out to determine the effect of 2-hydroxybutyric acid at various concentrations (1-10 mM on CO2 production and lipid synthesis from labeled substrates in cerebral cortex of 30-day-old Wistar rats in vitro. CO2 production was significantly inhibited (30-70% by 2-hydroxybutyric acid in cerebral cortex prisms, in total homogenates and in the mitochondrial fraction. We also demonstrated a significant inhibition of lipid synthesis (20-45% in cerebral cortex prisms and total homogenates in the presence of 2-hydroxybutyric acid. However, no inhibition of lipid synthesis occurred in homogenates free of nuclei and mitochondria. The results indicate an impairment of mitochondrial energy metabolism caused by 2-hydroxybutyric acid, a fact that may secondarily lead to reduction of lipid synthesis. It is possible that these findings may be associated with the neuropathophysiology of the situations where 2-hydroxybutyric acid is accumulated.

  2. TORC1 Inhibits GSK3-Mediated Elo2 Phosphorylation to Regulate Very Long Chain Fatty Acid Synthesis and Autophagy

    DEFF Research Database (Denmark)

    Zimmermann, Christine; Santos, Aline; Gable, Kenneth

    2013-01-01

    Very long chain fatty acids (VLCFAs) are essential fatty acids with multiple functions, including ceramide synthesis. Although the components of the VLCFA biosynthetic machinery have been elucidated, how their activity is regulated to meet the cell's metabolic demand remains unknown. The goal...... of autophagy. Together, our data reveal a function for TORC1 and GSK3 in the regulation of VLCFA synthesis that has important implications for autophagy and cell homeostasis....... of this study was to identify mechanisms that regulate the rate of VLCFA synthesis, and we discovered that the fatty acid elongase Elo2 is regulated by phosphorylation. Elo2 phosphorylation is induced upon inhibition of TORC1 and requires GSK3. Expression of nonphosphorylatable Elo2 profoundly alters...

  3. Consequences of PPARα Invalidation on Glutathione Synthesis: Interactions with Dietary Fatty Acids

    Directory of Open Access Journals (Sweden)

    Najoua Guelzim

    2011-01-01

    Full Text Available Glutathione (GSH derives from cysteine and plays a key role in redox status. GSH synthesis is determined mainly by cysteine availability and γ-glutamate cysteine ligase (γGCL activity. Because PPARα activation is known to control the metabolism of certain amino acids, GSH synthesis from cysteine and related metabolisms were explored in wild-type (WT and PPARα-null (KO mice, fed diets containing either saturated (COCO diet or 18 : 3 n-3, LIN diet. In mice fed the COCO diet, but not in those fed the LIN diet, PPARα deficiency enhanced hepatic GSH content and γGCL activity, superoxide dismutase 2 mRNA levels, and plasma uric acid concentration, suggesting an oxidative stress. In addition, in WT mice, the LIN diet increased the hepatic GSH pool, without effect on γGCL activity, or change in target gene expression, which rules out a direct effect of PPARα. This suggests that dietary 18 : 3 n-3 may regulate GSH metabolism and thus mitigate the deleterious effects of PPARα deficiency on redox status, without direct PPARα activation.

  4. Type II fatty acid synthesis is essential only for malaria parasite late liver stage development.

    Science.gov (United States)

    Vaughan, Ashley M; O'Neill, Matthew T; Tarun, Alice S; Camargo, Nelly; Phuong, Thuan M; Aly, Ahmed S I; Cowman, Alan F; Kappe, Stefan H I

    2009-03-01

    Intracellular malaria parasites require lipids for growth and replication. They possess a prokaryotic type II fatty acid synthesis (FAS II) pathway that localizes to the apicoplast plastid organelle and is assumed to be necessary for pathogenic blood stage replication. However, the importance of FAS II throughout the complex parasite life cycle remains unknown. We show in a rodent malaria model that FAS II enzymes localize to the sporozoite and liver stage apicoplast. Targeted deletion of FabB/F, a critical enzyme in fatty acid synthesis, did not affect parasite blood stage replication, mosquito stage development and initial infection in the liver. This was confirmed by knockout of FabZ, another critical FAS II enzyme. However, FAS II-deficient Plasmodium yoelii liver stages failed to form exo-erythrocytic merozoites, the invasive stage that first initiates blood stage infection. Furthermore, deletion of FabI in the human malaria parasite Plasmodium falciparum did not show a reduction in asexual blood stage replication in vitro. Malaria parasites therefore depend on the intrinsic FAS II pathway only at one specific life cycle transition point, from liver to blood.

  5. Synergistic effect of natural chickpea leaf exudates acids in heterocyclization: a greener protocol for benzopyran synthesis

    Science.gov (United States)

    Mali, Snehali; Shinde, Sachin; Damte, Shashikant

    2018-01-01

    Without using any toxic or hazardous reagent, ligand, acid, transition metal catalyst, additives/promoters and organic solvent, green Knoevenagel condensation and tandem Knoevenagel–Michael reactions have been successfully carried out by using chickpea leaf exudates as a naturally sourced Bronsted acid type bio-catalyst. The reaction proceeds in neat chickpea leaf exudates at room temperature in aqueous conditions in very short reaction times, and therefore, it is an evergreen and environmentally sound alternative to the existing protocols for benzopyran synthesis. In comparison to the conventional methods, this synthetic pathway complies with several key requirements of green chemistry principles such as the utilization of biodegradable catalyst obtained from renewable feedstock, auxiliary aqueous conditions, along with waste prevention. The same protocol was also extended to the synthesis of 2H-xanthene-1,8-diones by condensation of aromatic aldehydes with dimedone achieving excellent yields. Thus, the reported protocol offers an attractive option because of its ecological safety, environmental acceptance, sustainability, low-cost straightforward work-up procedure and with excellent values of green chemistry metrics as compared with other reported methods. PMID:29515817

  6. Whole-Body Docosahexaenoic Acid Synthesis-Secretion Rates in Rats Are Constant across a Large Range of Dietary α-Linolenic Acid Intakes.

    Science.gov (United States)

    Domenichiello, Anthony F; Kitson, Alex P; Metherel, Adam H; Chen, Chuck T; Hopperton, Kathryn E; Stavro, P Mark; Bazinet, Richard P

    2017-01-01

    Docosahexaenoic acid (DHA) is an ω-3 (n-3) polyunsaturated fatty acid (PUFA) thought to be important for brain function. Although the main dietary source of DHA is fish, DHA can also be synthesized from α-linolenic acid (ALA), which is derived from plants. Enzymes involved in DHA synthesis are also active toward ω-6 (n-6) PUFAs to synthesize docosapentaenoic acid n-6 (DPAn-6). It is unclear whether DHA synthesis from ALA is sufficient to maintain brain DHA. The objective of this study was to determine how different amounts of dietary ALA would affect whole-body DHA and DPAn-6 synthesis rates. Male Long-Evans rats were fed an ALA-deficient diet (ALA-D), an ALA-adequate (ALA-A) diet, or a high-ALA (ALA-H) diet for 8 wk from weaning. Dietary ALA concentrations were 0.07%, 3%, and 10% of the fatty acids, and ALA was the only dietary PUFA that differed between the diets. After 8 wk, steady-state stable isotope infusion of labeled ALA and linoleic acid (LA) was performed to determine the in vivo synthesis-secretion rates of DHA and DPAn-6. Rats fed the ALA-A diet had an ∼2-fold greater capacity to synthesize DHA than did rats fed the ALA-H and ALA-D diets, and a DHA synthesis rate that was similar to that of rats fed the ALA-H diet. However, rats fed the ALA-D diet had a 750% lower DHA synthesis rate than rats fed the ALA-A and ALA-H diets. Despite enrichment into arachidonic acid, we did not detect any labeled LA appearing as DPAn-6. Increasing dietary ALA from 3% to 10% of fatty acids did not increase DHA synthesis rates, because of a decreased capacity to synthesize DHA in rats fed the ALA-H diet. Tissue concentrations of DPAn-6 may be explained at least in part by longer plasma half-lives. © 2017 American Society for Nutrition.

  7. Synthesis, characterization and biocompatibility evaluation of hydroxyapatite - gelatin polyLactic acid ternary nanocomposite

    Directory of Open Access Journals (Sweden)

    Z. Nabipour

    2016-04-01

    Full Text Available Objective(s: The current study reports the production and biocompatibility evaluation of a ternary nanocomposite consisting of HA, PLA, and gelatin for biomedical application.Materials and Methods: Hydroxyapatite nanopowder (HA: Ca10(PO46(OH2 was produced by burning the bovine cortical bone within the temperature range of 350-450 oC followed by heating in an oven at 800. Synthesis of the ternary nanocomposite was carried out in two steps: synthesis of gelatin-hydroxyapatite binary nanocomposite and addition of poly lactic acid with different percentages to the resulting composition. The crystal structure was determined by X-ray diffraction (XRD, while major elements and impurities of hydroxyapatite were identified by elemental analysis of X-ray fluorescence (XRF. Functional groups were determined by Fourier transform infrared spectroscopy (FTIR. Morphology and size of the nanocomposites were evaluated using field emission scanning electron microscope (FE-SEM.Biocompatibility of nanocomposites was investigated by MTT assay. Results: XRD patterns verified the ideal crystal structure of the hydroxyapatite, which indicated an appropriate synthesis process and absence of disturbing phases. Results of FTIR analysis determined the polymers’ functional groups, specified formation of the polymers on the hydroxyapatite surface, and verified synthesis of nHA/PLA/Gel composite. FESEM images also indicated the homogeneous structure of the composite in the range of 50 nanometers. MTT assay results confirmed the biocompatibility of nanocomposite samples.Conclusion: This study suggested that the ternary nanocomposite of nHA/PLA/Gel can be a good candidate for biomedical application such as drug delivery systems, but for evaluation of its potential in hard tissue replacement, mechanical tests should be performed.

  8. Methylene-bis[(aminomethyl)phosphinic acids]: synthesis, acid-base and coordination properties.

    Science.gov (United States)

    David, Tomáš; Procházková, Soňa; Havlíčková, Jana; Kotek, Jan; Kubíček, Vojtěch; Hermann, Petr; Lukeš, Ivan

    2013-02-21

    Three symmetrical methylene-bis[(aminomethyl)phosphinic acids] bearing different substituents on the central carbon atom, (NH(2)CH(2))PO(2)H-C(R(1))(R(2))-PO(2)H(CH(2)NH(2)) where R(1) = OH, R(2) = Me (H(2)L(1)), R(1) = OH, R(2) = Ph (H(2)L(2)) and R(1),R(2) = H (H(2)L(3)), were synthesized. Acid-base and complexing properties of the ligands were studied in solution as well as in the solid state. The ligands show unusually high basicity of the nitrogen atoms (log K(1) = 9.5-10, log K(2) = 8.5-9) if compared with simple (aminomethyl)phosphinic acids and, consequently, high stability constants of the complexes with studied divalent metal ions. The study showed the important role of the hydroxo group attached to the central carbon atom of the geminal bis(phosphinate) moiety. Deprotonation of the hydroxo group yields the alcoholate anion which tends to play the role of a bridging ligand and induces formation of polynuclear complexes. Solid-state structures of complexes [H(2)N=C(NH(2))(2)][Cu(2)(H(-1)L(2))(2)]CO(3)·10H(2)O and Li(2)[Co(4)(H(-1)L(1))(3)(OH)]·17.5H(2)O were determined by X-ray diffraction. The complexes show unexpected geometries forming dinuclear and cubane-like structures, respectively. The dinuclear copper(II) complex contains a bridging μ(2)-alcoholate group with the (-)O-P(=O)-CH(2)-NH(2) fragments of each ligand molecule chelated to the different central ion. In the cubane cobalt(II) complex, one μ(3)-hydroxide and three μ(3)-alcoholate anions are located in the cube vertices and both phosphinate groups of one ligand molecule are chelating the same cobalt(II) ion while each of its amino groups are bound to different neighbouring metal ions. All such three metal ions are bridged by the alcoholate group of a given ligand.

  9. Synthesis of two hyaluronic-acid-related oligosaccharide 4-methoxyphenyl glycosides having a beta-D-glucuronic acid residue at the reducing end

    NARCIS (Netherlands)

    Halkes, K.M.; Slaghek, T.M.; Hypponen, T.K.; Kamerling, J.P.; Vliegenthart, J.F.G.

    1999-01-01

    Synthesis of two hyaluronic-acid-related oligosaccharides, the 4-methoxyphenyl β-glycosides of β-D-GlcpA-(1→3)-β-D-GlcpNAc-(1→4)-D-GlcpA and β-D-GlcpA-(1→3)-β-D-GlcpNAc-(1→4)-β-D-GlcpA-(1→3)- β-D-GJcpNAc-(1→4)-D-GlcpA, is described. D-Glucopyranosyluronic acid residues were obtained by selective

  10. Synthesis of two hyaluronic-acid-related oligosaccharide 4-methoxyphenyl glycosides having a β-D-glucuronic acid residue at the reducing end

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Halkes, K.M.; Slaghek, T.M.; Hyppönen, T.K.; Kamerling, J.P.

    1999-01-01

    Synthesis of two hyaluronic-acid-related oligosaccharides, the 4-methoxyphenyl beta-glycosides of beta-D-GlcpA-(1->3)-beta-D-GlcpNAc-(1->4)-D-GlcpA and beta-D-GlcpA-(1->3)-beta-D-GlcpNAc-(1->4)-beta-D-GlcpA-(1->3)-beta-D-GlcpNAc-(1->4)-D-GlcpA, is described. D-Glucopyranosyluronic acid residues were

  11. Synthesis of copper graphene materials functionalized by amino acids and their catalytic applications.

    Science.gov (United States)

    Huang, Qiang; Zhou, Limei; Jiang, Xiaohui; Zhou, Yafen; Fan, Hongwei; Lang, Wencheng

    2014-08-27

    Graphene oxide and its derivative have attracted extensive interests in many fields, including catalytic chemistry, organic synthesis, and electrochemistry, recently. We explored whether the use of graphene after chemical modification with amino acids to immobilize copper nanoparticles could achieve a more excellent catalytic activity for N-arylation reactions. A facile and novel method to prepare copper supported on amino-acid-grafted graphene hybrid materials (A-G-Cu) was first reported. The as-prepared hybrid materials were characterized by a variety of techniques, including Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, X-ray diffraction, scanning electron microscopy, atomic force microscopy, transmission electron microscopy, and inductively coupled plasma-atomic emission spectrometry. The results showed that the morphology, distribution, and loading of copper nanoparticles could be well-adjusted by controlling the type of amino acids grafted on graphene. Moreover, most A-G-Cu hybrid materials could catalyze N-arylation of imidazole with iodobenzene with yields more than 90%, while the copper supported on graphene (G-Cu) displayed a yield of just 65.8%. The high activity of A-G-Cu can be ascribed to the good synergistic effects of copper nanoparticles (Cu NPs) and amino-acid-grafted graphene.

  12. Synthesis of Ricinoleic Acid Estolides by the Esterification of Ricinoleic Acids Using Functional Acid Ionic Liquids as Catalysts.

    Science.gov (United States)

    Wang, Gaoshang; Sun, Shangde

    2017-07-01

    Estolides of ricinoleic acid (RA) have been used as lubricants and pigment dispersant in many industries. In this paper, functional acid ionic liquids (ILs) were firstly used as catalysts to prepare RA estolides by the esterification of RAs in solvent-free system. Different ILs were used as catalysts for the esterification. Effect of reaction variables (IL amount, reaction temperature and reaction time) on the esterification were also investigated and optimized using response surface methodology (RSM). Among all tested ILs, [BSO 3 HMIM]TS showed the best performance for the esterification. Arrhenius equation for the esterification was lnV 0 =14.897-7558.7/T, and the activation energy (Ea) was 62.84 kJ/mol. A high degree of polymerization with an acid value of 48.0±2.5 mg KOH/g was achieved at the optimized conditions (IL load 12%, reaction temperature 140°C, and reaction time 12 h). The effect of reaction variables on the esterification decreased in the order of catalyst loading of IL > reaction temperature > reaction time.

  13. Synthesis of new isoxazoline-based acidic amino acids and investigation of their affinity and selectivity profile at ionotropic glutamate receptors

    DEFF Research Database (Denmark)

    Pinto, Andrea; Conti, Paola; Grazioso, Giovanni

    2011-01-01

    The synthesis of four new isoxazoline-based amino acids being analogues of previously described glutamate receptor ligands is reported and their affinity for ionotropic glutamate receptors is analyzed in comparison with that of selected model compounds. Molecular modelling investigations have been...

  14. Scalable and chromatography-free synthesis of 2-(2-formylalkyl) arenecarboxylic acid derivatives through the supramolecularly controlled hydroformylation of vinylarene-2-carboxylic acids

    NARCIS (Netherlands)

    Dydio, P.; Reek, J.N.H.

    2014-01-01

    This protocol describes how to prepare 2-(2-formylalkyl)-arenecarboxylic acid derivatives, common building blocks for the synthesis of various valuable chemicals (e.g., anti-obesity and Alzheimer's disease treatment pharmaceuticals), by using the fully regioselective hydroformylation of vinyl arene

  15. Synthesis of colloidal silver nanoparticle clusters and their application in ascorbic acid detection by SERS.

    Science.gov (United States)

    Cholula-Díaz, Jorge L; Lomelí-Marroquín, Diana; Pramanick, Bidhan; Nieto-Argüello, Alfonso; Cantú-Castillo, Luis A; Hwang, Hyundoo

    2018-03-01

    Ascorbic acid (vitamin C) has an essential role in the human body mainly due to its antioxidant function. In this work, metallic silver nanoparticle (AgNP) colloids were used in SERS experiments to detect ascorbic acid in aqueous solution. The AgNPs were synthesized by a green method using potato starch as reducing and stabilizing agent, and water as the solvent. The optical properties of the yellowish as-synthesized silver colloids were characterized by UV-vis spectroscopy, in which besides a typical band at 410 nm related to the localized surface plasmon resonance of the silver nanoparticles, a shoulder band around 500 nm, due to silver nanoparticle cluster formation, is presented when relatively higher concentrations of starch are used in the synthesis. These starch-capped silver nanoparticles show an intrinsic Raman peak at 1386 cm -1 assigned to deformation modes of the starch structure. The increase of the intensity of the SERS peak at 1386 cm -1 with an increase in the concentration of the ascorbic acid is related to a decrease of the gap between dimers and trimers of the silver nanoparticle clusters produced by the presence of ascorbic acid in the colloid. The limit of detection of this technique for ascorbic acid is 0.02 mM with a measurement concentration range of 0.02-10 mM, which is relevant for the application of this method for detecting ascorbic acid in biological specimen. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Relative utilization of fatty acids for synthesis of ketone bodies and complex lipids in the liver of developing rats.

    Science.gov (United States)

    Yeh, Y Y; Streuli, V L; Zee, P

    1977-04-01

    The regulation of hepatic ketogenesis, as related to the metabolism of fatty acids through oxidative and synthetic pathways, was studied in developing rats. [1-14C] palmitate was used as a substrate to determine the proportions of free fatty acids utilized for the production of ketone bodies, CO2 and complex lipids. Similar developmental patterns of hepatic ketogenesis were obtained by measuring the production of either [14C] acetoacetate from exogenous [1-14C] palmitate or the sum of unlabeled acetoacetate and beta-hydroxybutyrate from endogenous fatty acids. The production of total ketone bodies was low during the late fetal stage and at birth, but increased rapidly to a miximum value within 24 hr after brith. The maximal ketogenic capacity appeared to be maintained for the first 10 days of life. 14CO2 production from [1-14C] palmitate increased by two- to fourfold during the suckling period, from its initial low rate seen at birth. The capacity for synthesis of total complex lipids was low at birth and had increased by day 3 to a maximal value, which was comparable to that of adult fed rats. The high lipogenic capacity lasted throughout the remaining suckling period. When ketogenesis was inhibited by 4-pentenoic acid, the rate of synthesis of complex lipids did not increase despite an increase in unutilized fatty acids. During the mid-suckling period, approximately equal amounts of [1-14C] palmitate were utilized for the synthesis of ketone plus CO2 and for complex lipid synthesis. By contrast, in adult fed rats, the incorporation of fatty acids into complex lipids was four times higher than that of ketone plus CO2. These observations suggest that stimulated hepatic ketogenesis in suckling rats results from the rapid oxidation of fatty acids and consequent increased production of acetyl CoA, but not from impaired capacity for synthesis of complex lipids.

  17. Synthesis of the Galactosyl Derivative of Gluconic Acid With the Transglycosylation Activity of β-Galactosidase

    Directory of Open Access Journals (Sweden)

    Aleksandra Wojciechowska

    2017-01-01

    Full Text Available Bionic acids are bioactive compounds demonstrating numerous interesting properties. They are widely produced by chemical or enzymatic oxidation of disaccharides. This paper focuses on the galactosyl derivative of gluconic acid as a result of a new method of bionic acid synthesis which utilises the transglycosylation properties of β-galactosidase and introduces lactose as a substrate. Products obtained in such a process are characterised by different structures (and, potentially, properties than those resulting from traditional oxidation of disaccharides. The aim of this study is to determine the effect of selected parameters (concentration and ratio of substrates, dose of the enzyme, time, pH, presence of salts on the course of the reaction carried out with the enzymatic preparation Lactozym, containing β-galactosidase from Kluyveromyces lactis. Research has shown that increased dry matter content in the baseline solution (up to 50 %, by mass per volume and an addition of NaCl contribute to higher yield. On the other hand, reduced content of the derivative is a result of increased pH from 7.0 to 9.0 and an addition of magnesium and manganese salts. Moreover, exceeding the β-galactosidase dose over approx. 35 000 U per 100 g of lactose also leads to reduced yield of the process. The most favourable molar ratio of sodium gluconate to lactose is 2.225:0.675. Depending on the conditions of the synthesis, the product concentration ranged between 17.3 and 118.3 g/L of the reaction mixture, which corresponded to the mass fraction of 6.64–23.7 % of dry matter. The data obtained as a result of the present study may be useful for designing an industrial process.

  18. Only Acyl Carrier Protein 1 (AcpP1 Functions in Pseudomonas aeruginosa Fatty Acid Synthesis

    Directory of Open Access Journals (Sweden)

    Jin-Cheng Ma

    2017-11-01

    Full Text Available The genome of Pseudomonas aeruginosa contains three open reading frames, PA2966, PA1869, and PA3334, which encode putative acyl carrier proteins, AcpP1, AcpP2, and AcpP3, respectively. In this study, we found that, although these apo-ACPs were successfully phosphopantetheinylated by P. aeruginosa phosphopantetheinyl transferase (PcpS and all holo-forms of these proteins could be acylated by Vibrio harveyi acyl-ACP synthetase (AasS, only AcpP1 could be used as a substrate for the synthesis of fatty acids, catalyzed by P. aeruginosa cell free extracts in vitro, and only acpP1 gene could restore growth in the Escherichia coliacpP mutant strain CY1877. And P. aeruginosaacpP1 could not be deleted, while disruption of acpP2 or acpP3 in the P. aeruginosa genome allowed mutant strains to grow as well as the wild type strain. These findings confirmed that only P. aeruginosa AcpP1 functions in fatty acid biosynthesis, and that acpP2 and acpP3 do not play roles in the fatty acid synthetic pathway. Moreover, disruption of acpP2 and acpP3 did not affect the ability of P. aeruginosa to produce N-acylhomoserine lactones (AHL, but replacement of P. aeruginosaacpP1 with E. coliacpP caused P. aeruginosa to reduce the production of AHL molecules, which indicated that neither P. aeruginosa AcpP2 nor AcpP3 can act as a substrate for synthesis of AHL molecules in vivo. Furthermore, replacement of acpP1 with E. coliacpP reduced the ability of P. aeruginosa to produce some exo-products and abolished swarming motility in P. aeruginosa.

  19. Isomerization of all-(E)-Retinoic Acid Mediated by Carbodiimide Activation - Synthesis of ATRA Ether Lipid Conjugates

    DEFF Research Database (Denmark)

    Christensen, Mikkel Stochkendahl; Pedersen, Palle Jacob; Andresen, Thomas Lars

    2010-01-01

    Treatment of the lysolipid 1-O-hexadecyl-sn-phosphatidylcholine with all-(E)-retinoic acid, DCC and DMAP resulted in poor acylation and caused (Z)/(E) isomerization of the alpha-beta double bond. In the presence of a proton source, the carbodiimide-activated all-(E)-retinoic acid undergoes fast...... isomerization to give a final mixture of (13E)/(13Z) isomers in a 3:1 ratio. Similar treatment of (13Z)-retinoic acid leads to the same isomer ratio. The isomerization was circumvented successfully by using a Mitsunobu reaction, which provided an efficient synthesis of all-(E)-retinoic acid sn-2-conjugated...

  20. Highly Atom Economic Synthesis of d?2?Aminobutyric Acid through an In?Vitro Tri?enzymatic Catalytic System

    OpenAIRE

    Chen, Xi; Cui, Yunfeng; Cheng, Xinkuan; Feng, Jinhui; Wu, Qiaqing; Zhu, Dunming

    2017-01-01

    Abstract d?2?Aminobutyric acid is an unnatural amino acid serving as an important intermediate in pharmaceutical production. Developing a synthetic method that uses cheaper starting materials and produces less by?product is a pressing demand. A tri?enzymatic catalytic system, which is composed of l?threonine ammonia lyase (l?TAL), d?amino acid dehydrogenase (d?AADH), and formate dehydrogenase (FDH), has thus been developed for the synthesis of d?2?aminobutyric acid with high optical purity. I...

  1. Synthesis, characterization and application of lipase-conjugated citric acid-coated magnetic nanoparticles for ester synthesis using waste frying oil.

    Science.gov (United States)

    Patel, Unisha; Chauhan, Kishor; Gupte, Shilpa

    2018-04-01

    In the present work, magnetic nanoparticles (MNPs) were prepared by chemical precipitation of trivalent and divalent iron ions which were functionalized using citric acid. The bacterial isolate Staphylococcus epidermidis KX781317 was isolated from oil-contaminated site. The isolate produced lipase, which was purified and immobilized on magnetic nanoparticles (MNPs) for ester synthesis from waste frying oil (WFO). The characterization of MNPs employed conventional TEM, XRD and FTIR techniques. TEM analysis of MNPs showed the particle size in the range of 20-50 nm. FTIR spectra revealed the binding of citric acid to Fe 3 O 4 and lipase on citric acid-coated MNPs. The citric acid-coated MNPs and lipase-conjugated citric acid-coated MNPs had similar XRD patterns which indicate MNPs could preserve their magnetic properties. The maximum immobilization efficiency 98.21% of lipase-containing citric acid-coated MNPs was observed at ratio 10:1 of Cit-MNPs:lipase. The pH and temperature optima for lipase conjugated with Cit-MNPs were 7 and 35 °C, respectively. Isobutanol was found to be an effective solvent for ester synthesis and 1:2 ratio of oil:alcohol observed significant for ester formation. The ester formation was determined using TLC and the % yield of ester conversion was calculated. The rate of ester formation is directly proportional to the enzyme load. Formed esters were identified as isobutyl laurate ester and isobutyl myristate ester through GC-MS analysis.

  2. In vivo synthesis of cholecystokinin in the rat cerebral cortex: identification of COOH-terminal peptides with labeled amino acids

    International Nuclear Information System (INIS)

    Goltermann, N.R.

    1982-01-01

    The synthesis of the COOH-terminal octa- and tetrapeptides of cholecystokinin (CCK) has been studied in rat cerebral cortex after intraventricular administration of radioactive amino acids characteristic of the porcine COOH-terminal octapeptide of CCK, CCK-8. After immunosorption with a COOH-terminal directed antibody, cortical CCK was fractionated on Sephadex G-50 columns. The experiments demonstrated newly synthesized CCK forms which coeluted with porcine CCK-8 and CCK-4. Except for threonine the amino acids employed, methionine, tryptophan, aspartic acid, glycine and phenylalanine were incorporated. The sequence-specific radioimmunoassay, the incorporation of the employed labeled amino acids, and the elution pattern by gel filtration, suggest an almost identical structure of porcine and rat cortical CCK-8, and a concomitant synthesis of CCK-8 and CCK-4 in rat cerebral cortex

  3. Continuous multistep synthesis of perillic acid from limonene by catalytic biofilms under segmented flow.

    Science.gov (United States)

    Willrodt, Christian; Halan, Babu; Karthaus, Lisa; Rehdorf, Jessica; Julsing, Mattijs K; Buehler, Katja; Schmid, Andreas

    2017-02-01

    The efficiency of biocatalytic reactions involving industrially interesting reactants is often constrained by toxification of the applied biocatalyst. Here, we evaluated the combination of biologically and technologically inspired strategies to overcome toxicity-related issues during the multistep oxyfunctionalization of (R)-(+)-limonene to (R)-(+)-perillic acid. Pseudomonas putida GS1 catalyzing selective limonene oxidation via the p-cymene degradation pathway and recombinant Pseudomonas taiwanensis VLB120 were evaluated for continuous perillic acid production. A tubular segmented-flow biofilm reactor was used in order to relieve oxygen limitations and to enable membrane mediated substrate supply as well as efficient in situ product removal. Both P. putida GS1 and P. taiwanensis VLB120 developed a catalytic biofilm in this system. The productivity of wild-type P. putida GS1 encoding the enzymes for limonene bioconversion was highly dependent on the carbon source and reached 34 g L tube -1  day -1 when glycerol was supplied. More than 10-fold lower productivities were reached irrespective of the applied carbon source when the recombinant P. taiwanensis VLB120 harboring p-cymene monooxygenase and p-cumic alcohol dehydrogenase was used as biocatalyst. The technical applicability for preparative perillic acid synthesis in the applied system was verified by purification of perillic acid from the outlet stream using an anion exchanger resin. This concept enabled the multistep production of perillic acid and which might be transferred to other reactions involving volatile reactants and toxic end-products. Biotechnol. Bioeng. 2017;114: 281-290. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. Synthesis and Characterization of Tin (IV Tungstate Nanoparticles – A Solid Acid Catalyst

    Directory of Open Access Journals (Sweden)

    Manoj Sadanandan

    2012-12-01

    Full Text Available Tin (IV tungstate, a tetravalent metal acid salt was synthesized in the nanoform by chemical coprecipitation method using EDTA as capping agent. The material was found to be stable in mineral acids, bases and organic solvents except  in HF and aquaregia. The material was characterized using EDS, TG/DTA, FTIR, XRD, SEM, HRTEM and BET surface area measurement. The molecular formula of the compound is 2SnO2 3WO3.5H2O determined from elemental analysis using TG/DTA. Surface morphology and particle size were obtained using SEM and HRTEM. The surface area was found to be 205-225m2/g. The Na+ exchange capacity found to be 3.8 meq/g, indicates the presence of surface hydroxyl group and hence the presence of Bronsted acid sites. The catalytic activity of the material was tested by using esterification and oxidation as model reactions. For the esterification of different alcohols, the percentage yield was found to be high for n-alcohol compared to isomeric alcohols. Oxidation of benzyl alcohol gives benzaldehyde and benzoic acid as the only products. Copyright © 2012 by BCREC UNDIP. All rights reservedReceived: 12nd June 2012, Revised: 23rd July 2012, Accepted: 29th July 2012[How to Cite: S. Manoj, R. Beena, (2012. Synthesis and Characterization of tin(IV Tungstate Nanoparticles – A Solid Acid Catalyst. Bulletin of Chemical Reaction Engineering & Catalysis, 7 (2: 105-111. doi:10.9767/bcrec.7.2.3622.105-111] [How to Link / DOI: http://dx.doi.org/10.9767/bcrec.7.2.3622.105-111 ] | View in 

  5. Continuous-flow synthesis of adipic acid from cyclohexene using hydrogen peroxide in high-temperature explosive regimes.

    Science.gov (United States)

    Damm, Markus; Gutmann, Bernhard; Kappe, C Oliver

    2013-06-01

    Safe only in a microreactor! The synthesis of adipic acid from cyclohexene by tungstic acid-catalyzed oxidation using hydrogen peroxide following the classical Noyori protocol can be accomplished in good yields with residence times as short as 20 min at 140 °C using a safe and scalable microreactor environment. Under these intensified conditions the use of a phase-transfer catalyst is not required. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Use of carbonyl group addition--elimination reactions for synthesis of nucleic acid conjugates.

    Science.gov (United States)

    Zatsepin, Timofei S; Stetsenko, Dmitry A; Gait, Michael J; Oretskaya, Tatiana S

    2005-01-01

    This review outlines the synthesis of covalent conjugates of oligonucleotides and their analogues that are obtained by reactions of carbonyl compounds with various nucleophiles such as primary amines, N-alkoxyamines, hydrazines, and hydrazides. The products linked by imino, oxime, hydrazone, or thiazolidine groups are shown to be useful intermediates for a wide range of chemical biology applications. Methods for their preparation, isolation, purification, and analysis are highlighted, and the comparative stabilities of the respective linkages are evaluated. The relative merits of incorporation of a carbonyl group, particularly an aldehyde group, into either the oligonucleotide or the ligand parts are considered. Examples of harnessing of aldehyde-nucleophile coupling for the labeling of nucleic acids are given, as well as their conjugation to various biomolecules (e.g. peptides and small molecule ligands), site-specific cross-linking of oligonucleotides to nucleic acid-binding proteins, assembly of multibranched supramolecular structures, and immobilization on functionalized surfaces. Future perspectives of bioconjugation and complex molecular engineering via carbonyl group addition-elimination reactions in nucleic acids chemistry are discussed.

  7. Hydrothermal synthesis spherical TiO2 and its photo-degradation property on salicylic acid

    International Nuclear Information System (INIS)

    Guo Wenlu; Liu Xiaolin; Huo Pengwei; Gao Xun; Wu Di; Lu Ziyang; Yan Yongsheng

    2012-01-01

    Anatase TiO 2 spheres have been prepared using hydrothermal synthesis. The prepared spheres were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM) and UV-vis diffuse reflectance spectra (UV-vis DRS). The TiO 2 consisted of well-defined spheres with size of 3-5 μm. The photocatalytic activity of spherical TiO 2 was determined by degradation of salicylic acid under visible light irradiation. It was revealed that the degradation rate of the spherical TiO 2 which was processed at 150 °C for 48 h could reach 81.758%. And the kinetics of photocatalytic degradation obeyed first-order kinetic, which the rate constant value was 0.01716 S -1 of the salicylic acid onto TiO 2 (temperature: 150, time: 48 h). The kinetics of adsorption followed the pseudo-second-order model and the rate constant was 1.2695 g mg -1 of the salicylic acid onto TiO 2 (temperature: 150, time: 48 h).

  8. An Efficient and Versatile Synthesis of Isoflavones from 2-Methoxybenzoic Acids

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jae In [Duksung Women' s University, Seoul (Korea, Republic of)

    2016-07-15

    Isoflavones (3-aryl-4H-1-benzopyran-4-ones) are found naturally in soybeans and many plants of the Leguminosae family. They have attracted much attention due to their biological activities, such as their anti-cancer, anti-inflammatory, and antifungal properties. Isoflavones intake through foods is important to human health, because they potentially regulate fatty acid metabolism and methoxy-substituted isoflavones in particular increase cell permeability. Isoflavones have also been synthesized by the coupling of 3-iodochromones with arylboronic acids. The condensation of 2'-hydroxyacetophenones with DMF dimethyl acetal formed 3-(dimethylamino)-2'-hydroxyphenylpropenones, which were cyclized using iodine to form 3-iodochromones. This process was followed by Suzuki coupling with arylboronic acids or aryl boronates to obtain isoflavones. The synthesis of isoflavones (6) from 5 was based on the formylation of the methylene group of 5 using DMF-POCl{sub 3}. Previously, the reaction of the DMF-POCl{sub 3} complex on benzyl 2-hydroxyphenyl ketones led to isoflavones, for which DMF was used as the reagent and solvent for 18 h at gentle reflux.

  9. Synthesis of sulfur-containing lubricant additives on the basis of fatty acid ethyl esters

    Directory of Open Access Journals (Sweden)

    Iurii S. Bodachivskyi

    2016-12-01

    Full Text Available The study reveals an energy-, resource- and eco-friendly method for preparation of sulfur-containing lubricant additives via interaction of fatty acid ethyl esters of rapeseed oil with elemental sulfur. The structure of synthesized compounds under various reactants ratio (5–50 wt.% of sulfur, duration (30–240 min and temperature of the process (160–215°С was investigated using various analytical techniques. According to the established data, aside from addition to double bonds, the side reaction of hydrogen substitution at α-methylene groups near these bonds occurs and induces the formation of conjugated systems and chromophoric sulfur-rich derivatives. Also, we found that increase of process duration evokes growth of polysulfane chains, in contrast to the raise of temperature, which leads to the formation of sulfur-containing heterocycles and hydrogen sulfide, as a result of elimination. Influence of accelerators on sulfurization of fatty acid ethyl esters was also examined. The most effective among them are mixtures of zinc dibutyldithiocarbamate with zinc oxide or stearic acid, which soften synthesis conditions and doubly decrease duration of the high-temperature stage. In addition, sulfur-containing compositions of ethyl esters and α-olefins, vulcanized esters by benzoyl peroxide, nonylphenols and zinc dinonylphenyldithiophosphate were designed. The study identified that lithium lubricant with sulfurized vulcanized esters provides improved tribological properties, in comparison with base lubricant or lubricant with the non-modified product.

  10. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    Science.gov (United States)

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Synthesis and evaluation of anti-oxidant and cytotoxic activities of novel 10-undecenoic acid methyl ester based lipoconjugates of phenolic acids

    Directory of Open Access Journals (Sweden)

    Naganna Narra

    2017-01-01

    Full Text Available The synthesis of five novel methyl 10-undecenoate-based lipoconjugates of phenolic acids from undecenoic acid was carried out. Undecenoic acid was methylated to methyl 10-undecenoate which was subjected to a thiol–ene reaction with cysteamine hydrochloride. Further amidation of the amine was carried out with different phenolic acids such as caffeic, ferulic, sinapic, coumaric and cinnamic acid. All synthesized compounds were fully characterized and their structures were confirmed by spectral data. The anti-oxidant activity of the synthesized lipoconjugates of phenolic acids was studied by the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical scavenging assay and also by the inhibition of linoleic acid oxidation in micellar medium by differential scanning calorimetry (DSC. The prepared compounds were also screened for their cytotoxic activity against five cell lines. It was observed that the lipoconjugates of caffeic acid, sinapic acid, ferulic acid, and coumaric acid displayed anticancer and anti-oxidant properties. The anticancer properties of these derivatives have been assessed by their IC50 inhibitory values in the proliferation of MDA-MB231, SKOV3, MCF7, DU 145 and HepG2 cancer cell lines.

  12. Regioselective Synthesis of 3-Bromoquinoline Derivatives and Diastereoselective Synthesis of Tetrahydroquinolines via Acid-Promoted Rearrangement of Arylmethyl Azides.

    Science.gov (United States)

    Tummatorn, Jumreang; Poonsilp, Piyapratch; Nimnual, Phongprapan; Janprasit, Jindaporn; Thongsornkleeb, Charnsak; Ruchirawat, Somsak

    2015-05-01

    Regioselective synthesis of 3-bromoquinoline derivatives was achieved via a formal [4 + 2]-cycloaddition between N-aryliminium ion, generated from arylmethyl azides, and 1-bromoalkynes. This method could also be applied to other quinoline derivatives using appropriate alkynes. Moreover, the current strategy could be utilized for the diastereoselective synthesis of tetrahydroquinoline derivatives employing alkenyl substrates in good to excellent yields.

  13. Synthesis and characterization of nanometric magnetite coated by oleic acid and the surfactant CTAB

    Energy Technology Data Exchange (ETDEWEB)

    Celis, J. Almazán, E-mail: jony-jac-5@hotmail.com; Olea Mejía, O. F., E-mail: oleaoscar@yahoo.com [Universidad Autónoma del Estado de México, Centro Conjunto de Investigación en Química Sustentable UAEMéx-UNAM (Mexico); Cabral-Prieto, A., E-mail: agustin.cabral@inin.gob.mx; García-Sosa, I., E-mail: irma.garcia@inin.gob.mx [Instituto Nacional de Investigaciones Nucleares (Mexico); Derat-Escudero, R., E-mail: escu@unam.mx [Instituto de Investigación de materiales de la UNAM (Mexico); Baggio Saitovitch, E. M., E-mail: esaitovitch@yahoo.com.br; Alzamora Camarena, M., E-mail: mariella.alzamora@gmail.com [Centro Brasileiro de Pesquizas Físicas (Brazil)

    2017-11-15

    Nanometric magnetite (nm-Fe{sub 3}O{sub 4}) particles were prepared by the reverse co-precipitation synthesis method, obtaining particle sizes that ranged from 4 to 8.5 nm. In their synthesis, the concentration of iron salts of ferric nitrate, Fe(NO{sub 3}){sub 3}⋅9H{sub 2}O, and ferrous sulfate, FeSO{sub 4}⋅7H{sub 2}O, were varied relative to the chemical reaction volume and by using different surfactants such as oleic acid (OA) and hexadecyltrimethylammonium bromide (CTAB). The nm-Fe{sub 3}O{sub 4} particles were characterized by transmission electron microscopy (TEM), Mössbauer spectroscopy (MS), magnetic and X-ray diffraction (XRD) measurements. Typical asymmetrical and/or broad lines shapes appeared in all Mössbauer spectra of the as prepared samples suggesting strong magnetic inter-particle interactions, reducing these interactions to some extent by gentle mechanical grinding. For the smallest particles, maghemite instead of magnetite was the main preparation product as low temperature Mössbauer and magnetic measurements indicated. For the intermediate and largest particles a mixture of magnetite and maghemite phases were produced as the saturation magnetization values of M{sub S} ∼ 60 emu/g indicated; these values were measured for most samples, independently of the coating surfactant concentration, and according to the ZFC-FC curves the blocking temperatures were 225K and 275K for the smallest and largest magnetite nanoparticles, respectively. The synthesis method was highly reproducible.

  14. Novel aspect of ketone action: β-hydroxybutyrate increases brain synthesis of kynurenic acid in vitro.

    Science.gov (United States)

    Chmiel-Perzyńska, Iwona; Kloc, Renata; Perzyński, Adam; Rudzki, Sławomir; Urbańska, Ewa M

    2011-07-01

    Ketone bodies formed during ketogenic diet or non-treated diabetes mellitus may exert neuroprotective and antiepileptic effects. Here, we assessed the influence of ketone body, β-hydroxybutyrate (BHB) on the brain synthesis of kynurenic acid (KYNA), an endogenous antagonist of glutamatergic and α7-nicotinic receptors. In brain cortical slices and in primary glial cultures, BHB enhanced KYNA production. KT 5270, an inhibitor of protein kinase A, has prevented this action. At hypoglycemia, under pH 7.0 and 7.4, profound (15 mM BHB), but not mild (3 mM) ketosis increased synthesis of KYNA. In paradigm resembling diabetic ketoacidosis in vitro (30 mM glucose, pH 7.0), neither mild nor profound ketosis influenced the production of KYNA. At pH 7.4 and in 30 mM glucose though, both mild and severe ketonemia evoked an increase of KYNA production. The activity of KYNA biosynthetic enzymes, KAT I and KAT II, in cortical homogenate was not altered by BHB (0.05-10.0 mM). However, in cultured glial cells exposed to BHB (10 mM), the activity of KATs increased. This effect was reversed by the co-incubation of cells with KT 5270. Presented data reveal a novel mechanism of action of BHB. Increased synthesis of KYNA in the presence of BHB is most probably mediated by protein kinase A-dependent stimulation of KATs expression/activity leading to an increase of KYNA formation. Ensuing attenuation of the excessive excitatory glutamate-mediated neurotransmission may, at least in part, explain the neuroprotective actions of BHB.

  15. Nitrogen in dietary glutamate is utilized exclusively for the synthesis of amino acids in the rat intestine.

    Science.gov (United States)

    Nakamura, Hidehiro; Kawamata, Yasuko; Kuwahara, Tomomi; Torii, Kunio; Sakai, Ryosei

    2013-01-01

    Although previous studies have shown that virtually the entire carbon skeleton of dietary glutamate (glutamate-C) is metabolized in the gut for energy production and amino acid synthesis, little is known regarding the fate of dietary glutamate nitrogen (glutamate-N). In this study, we hypothesized that dietary glutamate-N is an effective nitrogen source for amino acid synthesis and investigated the fate of dietary glutamate-N using [(15)N]glutamate. Fischer male rats were given hourly meals containing [U-(13)C]- or [(15)N]glutamate. The concentration and isotopic enrichment of several amino acids were measured after 0-9 h of feeding, and the net release of each amino acid into the portal vein was calculated. Most of the dietary glutamate-C was metabolized into CO(2), lactate, or alanine (56, 13, and 12% of the dietary input, respectively) in the portal drained viscera (PDV). Most of the glutamate-N was utilized for the synthesis of other amino acids such as alanine and citrulline (75 and 3% of dietary input, respectively) in the PDV, and only minor amounts were released into the portal vein in the form of ammonia and glutamate (2 and 3% of the dietary input, respectively). Substantial incorporation of (15)N into systemic amino acids such as alanine, glutamine, and proline, amino acids of the urea cycle, and branched-chain amino acids was also evident. These results provide quantitative evidence that dietary glutamate-N distributes extensively to amino acids synthesized in the PDV and, consequently, to circulating amino acids.

  16. Attempt to Determine the Prevalence of Two Inborn Errors of Primary Bile Acid Synthesis : Results of a European Survey

    NARCIS (Netherlands)

    Jahnel, Jörg; Zöhrer, Evelyn; Fischler, Björn; D'Antiga, Lorenzo; Debray, Dominique; Dezsofi, Antal; Haas, Dorothea; Hadzic, Nedim; Jacquemin, Emmanuel; Lamireau, Thierry; Maggiore, Giuseppe; McKiernan, Pat J; Calvo, Pier Luigi; Verkade, Henkjan J; Hierro, Loreto; McLin, Valerie; Baumann, Ulrich; Gonzales, Emmanuel

    2017-01-01

    Objective: Inborn errors of primary bile acid (BA) synthesis are genetic cholestatic disorders leading to accumulation of atypical BA with deficiency of normal BA. Unless treated with primary BA, chronic liver disease usually progresses to cirrhosis and liver failure before adulthood. We sought to

  17. Synthesis of 2-Iodoazulenes by the Iododeboronation of Azulen-2-ylboronic Acid Pinacol Esters with Copper(I) Iodide.

    Science.gov (United States)

    Narita, Masahiro; Murafuji, Toshihiro; Yamashita, Saki; Fujinaga, Masayuki; Hiyama, Kumiko; Oka, Yurie; Tani, Fumito; Kamijo, Shin; Ishiguro, Katsuya

    2018-02-02

    Azulen-2-ylboronic acid pinacol ester, prepared by iridium-catalyzed C-H borylation of azulene, efficiently underwent iododeboronation with a stoichiometric amount of copper(I) iodide. This reaction allowed the synthesis of 2-iodoazulene in only two steps starting from azulene. This methodology was successfully applied to analogous azulenes.

  18. Synthesis of the [beta]-D-glucosyl ester of [carbonyl-[sup 13]C]-indole-3-acetic acid

    Energy Technology Data Exchange (ETDEWEB)

    Jakas, A.; Magnus, V. (Rudjer Boskovic Inst., Zagreb (Croatia)); Horvat, S.; Sandberg, G. (Swedish Univ. of Agricultural Sciences, Uppsala (Sweden))

    1993-10-01

    An efficient, operationally simple synthetic approach to 1-O-([carbonyl-[sup 13]C]-indole-3'-ylacetyl)-[beta]-D-glucopyranose is described. The synthesis was carried out by fusing a fully benzylated 1-O-glucosylpseudourea intermediate with [carbonyl-[sup 13]C]-indole-3-acetic acid, followed by hydrogenolytic removal of the protective groups. (Author).

  19. Selective Synthesis of Unsaturated N-Acylethanolamines by Lipase-Catalyzed N-Acylation of Ethanolamine with Unsaturated Fatty Acids

    NARCIS (Netherlands)

    Plastina, P.; Vincken, J.P.; Gruppen, H.; Witkamp, R.F.; Gabriele, B.

    2009-01-01

    The selective synthesis of unsaturated N-acylethanolamines 1b-6b by lipase-catalyzed direct condensation between unsaturated fatty acids 1a-6a and ethanolamine is reported. Reactions were carried out in hexane at 40 °C, in the presence of Candida antarctica Lipase B as the catalyst, to give the

  20. Facile synthesis of improved room temperature gas sensing properties of TiO2 nanostructures: Effect of acid treatment

    CSIR Research Space (South Africa)

    Tshabalala, Zamaswazi P

    2016-03-01

    Full Text Available and Actuators B: Chemical Facile synthesis of improved room temperature gas sensing properties of TiO2 nanostructures: Effect of acid treatment Z.P. Tshabalalaa,b, D.E. Motaunga,∗, G.H. Mhlongoa,∗, O.M. Ntwaeaborwab,∗ a DST/CSIR, National Centre for Nano...

  1. Facile synthesis of improved room temperature gas sensing properties of TiO2 nanostructures: Effect of acid treatment

    CSIR Research Space (South Africa)

    Tshabalala, Zamaswazi P

    2016-03-01

    Full Text Available and Actuators B: Chemical Facile synthesis of improved room temperature gas sensing properties of TiO2 nanostructures: Effect of acid treatment Z.P. Tshabalalaa,b, D.E. Motaunga,∗, G.H. Mhlongoa,∗, O.M. Ntwaeaborwab,∗ a DST/CSIR, National Centre...

  2. The effect of epidermal levels of urocanic acid on 25-hydroxyvitamin D synthesis and inflammatory mediators upon narrowband UVB irradiation

    NARCIS (Netherlands)

    Landeck, Lilla; Jakasa, Ivone; Dapic, Irena; Lutter, René; Thyssen, Jacob P.; Skov, Lone; Braun, Andrea; Schön, Michael P.; John, Swen M.; Kezic, Sanja; Brans, Richard

    2016-01-01

    Urocanic acid (UCA) absorbs ultraviolet (UV)B radiation in the epidermis which may interfere with phototherapy. Therefore, the influence of individual levels of UCA on immune reactivity and vitamin D synthesis induced by narrowband UVB radiation was assessed. Twenty-eight subjects with irritant

  3. Stereo- and regio-selective one-pot synthesis of triazole-based unnatural amino acids and β- amino triazoles

    Science.gov (United States)

    Synthesis of triazole based unnatural amino acids and β-amino triazole has been described via stereo and regioselective one-pot multi-component reaction of sulfamidates, sodium azide, and alkynes under MW conditions. The developed method is applicable to a broad substrate scope a...

  4. Kinetics of enzymatic synthesis of liquid wax ester from oleic acid and oleyl alcohol.

    Science.gov (United States)

    Radzi, Salina Mat; Mohamad, Rosfarizan; Basri, Mahiran; Salleh, Abu Bakar; Ariff, Arbakariya; Rahman, Mohammad Basyaruddin Abdul; Rahman, Raja Noor Zaliha Raja Abdul

    2010-01-01

    The kinetics of wax ester synthesis from oleic acid and oleyl alcohol using immobilized lipase from Candida antartica as catalyst was studied with different types of impeller (Rushton turbine and AL-hydrofoil) to create different mixing conditions in 2l stirred tank reactor. The effects of catalyst concentration, reaction temperature, and impeller tip speed on the synthesis were also evaluated. Rushton turbine impeller exhibited highest conversion rate at lower impeller tip speed as compared to AL-hydrofoil impeller. A second-order reversible kinetic model from single progress curve for the prediction of fractional conversion at given reaction time was proposed and the corresponding kinetic parameter values were calculated by non-linear regression method. The results from the simulation using the proposed model showed satisfactory agreement with the experimental data. Activation energy shows a value of 21.77 Kcal/mol. The thermodynamic parameters of the process, enthalpy and entropy, were 21.15 Kcal/mol and 52.07 cal/mol.K, respectively.

  5. Enhanced dipicolinic acid production during the stationary phase in Bacillus subtilis by blocking acetoin synthesis.

    Science.gov (United States)

    Toya, Yoshihiro; Hirasawa, Takashi; Ishikawa, Shu; Chumsakul, Onuma; Morimoto, Takuya; Liu, Shenghao; Masuda, Kenta; Kageyama, Yasushi; Ozaki, Katsuya; Ogasawara, Naotake; Shimizu, Hiroshi

    2015-01-01

    Bacterial bio-production during the stationary phase is expected to lead to a high target yield because the cells do not consume the substrate for growth. Bacillus subtilis is widely used for bio-production, but little is known about the metabolism during the stationary phase. In this study, we focused on the dipicolinic acid (DPA) production by B. subtilis and investigated the metabolism. We found that DPA production competes with acetoin synthesis and that acetoin synthesis genes (alsSD) deletion increases DPA productivity by 1.4-fold. The mutant showed interesting features where the glucose uptake was inhibited, whereas the cell density increased by approximately 50%, resulting in similar volumetric glucose consumption to that of the parental strain. The metabolic profiles revealed accumulation of pyruvate, acetyl-CoA, and the TCA cycle intermediates in the alsSD mutant. Our results indicate that alsSD-deleted B. subtilis has potential as an effective host for stationary-phase production of compounds synthesized from these intermediates.

  6. Synthesis of diethylenetriaminepentaacetic acid conjugated inulin and utility for cellular uptake of liposomes

    International Nuclear Information System (INIS)

    Essien, H.; Lai, J.Y.; Hwang, K.J.

    1988-01-01

    The synthesis, binding of radioactive cations, liposomal encapsulation, and biodistribution of the oxidized-inulin reaction product with ethylenediamine and diethylenetriaminepentaacetic acid (4) are described. The four-step synthesis of the inulin derivative proceeded in a good overall yield of 72%. The complex of the inulin derivative with either 67 Ga3+ or 111 In3+ was stable in vivo and did not readily distribute into tissues, being excreted primarily in urine after intravenous administration to mice. The liposome-entrapped inulin derivative can be loaded with radioactive heavy metal cations by mobile ionophores in high radiochemical yields of 80-91%. Following the intravenous administration of the liposomal encapsulation of the indium-111-labeled inulin derivative, the entrapped compound had a biodistribution characteristic of liposomes and allowed an estimation of the extent of the intracellular uptake of liposomes. The ability of the inulin derivative to chelate many different types of metals will allow the use of this probe for studying subtle differences in tissue distribution resulting from different drug targeting or delivery protocols in the same animal by multiple labeling techniques. Moreover, the chelate-conjugated inulin permits studies of the applications of drug delivery systems in primates or human subjects by noninvasive techniques such as gamma-scintigraphic or nuclear magnetic resonance imaging methods

  7. Lipoteichoic acid synthesis inhibition in combination with antibiotics abrogates growth of multidrug-resistant Enterococcus faecium.

    Science.gov (United States)

    Paganelli, Fernanda L; van de Kamer, Tim; Brouwer, Ellen C; Leavis, Helen L; Woodford, Neil; Bonten, Marc J M; Willems, Rob J L; Hendrickx, Antoni P A

    2017-03-01

    Enterococcus faecium is a multidrug-resistant (MDR) nosocomial pathogen causing significant morbidity in debilitated patients. New antimicrobials are needed to treat antibiotic-resistant E. faecium infections in hospitalised patients. E. faecium incorporates lipoteichoic acid (LTA) (1,3-polyglycerol-phosphate linked to glycolipid) in its cell wall. The small-molecule inhibitor 1771 [2-oxo-2-(5-phenyl-1,3,4-oxadiazol-2-ylamino)ethyl 2-naphtho[2,1-b]furan-1-ylacetate] specifically blocks the activity of Staphylococcus aureus LtaS synthase, which polymerises 1,3-glycerolphosphate into LTA polymers. Here we characterised the effects of the small-molecule inhibitor 1771 on the growth of E. faecium isolates, alone (28 strains) or in combination with the antibiotics vancomycin, daptomycin, ampicillin, gentamicin or linezolid (15 strains), and on biofilm formation (16 strains). Inhibition of LTA synthesis at the surface of the cell by compound 1771 in combination with current antibiotic therapy abrogates enterococcal growth in vitro but does not affect mature E. faecium biofilms. Targeting LTA synthesis may provide new possibilities to treat MDR E. faecium infections. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  8. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  9. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  10. A straightforward and efficient synthesis of 3-(pyrimidinyl)propanoates from levulinic acid

    Energy Technology Data Exchange (ETDEWEB)

    Flores, Alex F.C.; Malavolta, Juliana L.; Souto, Alynne A.; Goularte, Rayane B.; Flores, Darlene C., E-mail: alex.fcf@ufsm.br [Universidade Federal de Santa Maria (UFSM/NUQUIMHE), RS (Brazil). Departamento de Quimica. Nucleo de Quimica de Heterociclos

    2013-04-15

    The cyclocondensation of methyl 7,7,7-trifluoro-4-methoxy-6-oxo-4-heptenoate and methyl 7,7,7-trichloro-4-methoxy-6-oxo-4-heptenoate, derived from levulinic acid with amidines [NH{sub 2}CONH{sub 2}, NH{sub 2}CR(NH) (R = H, Me, Ph, NH{sub 2}, SMe and 1H-pyrazol-1-yl), 5-amino-3-methyl-1H-pyrazol and 2-aminothiazole] into pyrimidine and pyrimidine-like derivatives as a new type of glutamate-like 3-(trihalomethylatedpyrimidinyl)propanoate is reported. Preparation of 3-(trihalomethylatedpyrimidinyl) propanohydrazides is also described. The synthetic potential of this straightforward protocol was established by the synthesis of fourteen new 3-(pyrimidinyl) propanoates in regular to good yields (38-92%). The structural assignments were based on the analysis of their {sup 1}H and {sup 13}C nuclear magnetic resonance (NMR) and gas chromatography-mass spectrometry (GC-MS) data. (author)

  11. Properties and synthesis of D2EHPA and of alkylphosphoric acid

    International Nuclear Information System (INIS)

    Elias, Abdelhamid

    1996-07-01

    A great interest has been devoted to alkylphosphates which are used in various field of chemical industry as: agents for extracting metals (uranium, actinides and lanthanides), flame-retardant solid plasticizers for cellulose acetate,cellulose ethers and vinyls,ignition control agents for gasoline, lubricant additive,antifoam agents for water-based paints and in inks and paper manufacture. In this context, the present work is achieved in order to supply a selected bibliography and the main theoretical aspects concerning physical and chemical properties, analysis techniques, synthesis and purification processes and some applications of D2EHPA (di(2-ethylhexyl)phosphoric acid or di(2-ethylhexyl)phosphate) and of alkylphosphates in general

  12. Synthesis of the mevalonic acid labelled with 14C, 13C and 3H

    International Nuclear Information System (INIS)

    Rousseau, Bernard

    1982-01-01

    This thesis describes five new methods of synthesis of the (R,S) mevalonic acid adapted to the labelling with 14 C and 13 C in positions 4,5 or 5 or 3', or with tritium in position 3'. Three of them use the tri-oxa-2,4,10 adamantyl group as masked carboxyl function. The two others take benefit from the regioselectivity of the bis-hydro-boration of terminal acetylenics by the 9-borabicyclo [3-3-1]nonane. The acylation of the bis-trimethylsilyl lithiomalonate, and the chemistry of dithiannes are also involved. Acetylene and methyl iodide labelled with isotopes are used as cheap base products [fr

  13. Synthesis and characterization of a novel versatile poly(amic acid) derived from ethylenediaminetetraacetic dianhydride

    Energy Technology Data Exchange (ETDEWEB)

    Padavan, Donna T. [Biomedical Engineering Graduate Program, University of Western Ontario, London, Ontario, N6A 5B9 (Canada); Fordham Center for Biomedical Engineering, Department of Chemical and Biochemical Engineering, University of Western Ontario, London, Ontario, N6A 5B9 (Canada); Wan, W.K., E-mail: wkwan@eng.uwo.ca [Biomedical Engineering Graduate Program, University of Western Ontario, London, Ontario, N6A 5B9 (Canada) and Fordham Center for Biomedical Engineering, Department of Chemical and Biochemical Engineering, University of Western Ontario, London, Ontario, N6A 5B9 (Canada); Robarts Research Institute, University of Western Ontario, London, Ontario, N6A 5B9 (Canada)

    2010-11-01

    The polycondensation reaction between ethylenediaminetetraacetic dianhydride and 1,4-diaminobutane in various aprotic polar solvents is being exploited to create a novel linear aliphatic polymer poly(amic acid) (PAA). PAA samples were characterized by Fourier transform infrared, Proton nuclear magnetic resonance and Carbon nuclear magnetic resonance spectroscopy resulting in the identification of characteristic absorption bands and thereby verifying successful synthesis. Gel permeation chromatography confirmed narrow molecular weight distributions with polydispersity indices ranging from 1.2 to 2.2 and reported low number average molecular weights ranging from 4000 to 6000 g mol{sup -1}. X-ray photoelectron spectroscopy and energy dispersive X-ray analysis showed the presence of nitrogen on the surface and also found nitrogen to be homogenously distributed throughout the bulk of the PAA samples.

  14. A Straightforward Route to Tetrachloroauric Acid from Gold Metal and Molecular Chlorine for Nanoparticle Synthesis

    Directory of Open Access Journals (Sweden)

    Shirin R. King

    2015-08-01

    Full Text Available Aqueous solutions of tetrachloroauric acid of high purity and stability were synthesised using the known reaction of gold metal with chlorine gas. The straightforward procedure developed here allows the resulting solution to be used directly for gold nanoparticle synthesis. The procedure involves bubbling chlorine gas through pure water containing a pellet of gold. The reaction is quantitative and progressed at a satisfactory rate at 50 °C. The gold(III chloride solutions produced by this method show no evidence of returning to metallic gold over at least twelve months. This procedure also provides a straightforward method to determine the concentration of the resulting solution using the initial mass of gold and volume of water.

  15. Synthesis of 5-hydroxymethylfurfural (HMF) by acid catalyzed dehydration of glucose-fructose mixtures

    DEFF Research Database (Denmark)

    Pedersen, Asbjørn Toftgaard; Ringborg, Rolf Hoffmeyer; Grotkjær, Thomas

    2015-01-01

    Synthesis of 5-hydroxymethylfurfural (HMF) from hexoses has been studied extensively in the scientific literature. However, a process has yet to be implemented at industrial scale. In this paper the simultaneous dehydration of glucose and fructose was investigated, in order to develop a process...... allowing the use of the cheapest available source of fructose: high fructose corn syrup. The dehydration was catalyzed by hydrochloric acid and conducted in acetone-water mixtures, which ensured good selectivity towards HMF and eliminated precipitation of polymer by-products (insoluble humins). Through...... and glucose dimers) are recirculated to the dehydration reactor. The model predicts an HMF selectivity of close to 70% in a recirculating reactor at conditions where HMF degradation is avoided....

  16. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  17. Synthesis of Fe Nanoparticles Functionalized with Oleic Acid Synthesized by Inert Gas Condensation

    Directory of Open Access Journals (Sweden)

    L. G. Silva

    2014-01-01

    Full Text Available In this work, we study the synthesis of monodispersed Fe nanoparticles (Fe-NPs in situ functionalized with oleic acid. The nanoparticles were self-assembled by inert gas condensation (IGC technique by using magnetron-sputtering process. Structural characterization of Fe-NPs was performed by transmission electron microscopy (TEM. Particle size control was carried out through the following parameters: (i condensation zone length, (ii magnetron power, and (iii gas flow (Ar and He. Typically the nanoparticles generated by IGC showed diameters which ranged from ~0.7 to 20 nm. Mass spectroscopy of Fe-NPs in the deposition system allowed the study of in situ nanoparticle formation, through a quadrupole mass filter (QMF that one can use together with a mass filter. When the deposition system works without quadrupole mass filter, the particle diameter distribution is around +/−20%. When the quadrupole is in line, then the distribution can be reduced to around +/−2%.

  18. Role of acid-base interactions in synthesis of cordierite from talc and sillimanite group minerals

    Directory of Open Access Journals (Sweden)

    Avvakumov E.G.

    2013-01-01

    Full Text Available It has been found that the mechanical activation of mixtures of sillimanite group minerals with talc and silica additives in grinding-activating devices with periodic and flow action provides significant acceleration of their interaction with formation of cordierite at the subsequent high-temperature treatment. It is shown that the output of cordierite depends on nature of mineral: in mixture with a sillimanite it is considerably higher, than with an andalusite and kyanite, while the rate of mullitization of these minerals has opposite character. It means that the formation of mullite during heat treatment is not a limiting step in synthesis of cordierite. It is shown that the rate of reaction is determined by the difference in the acid-base properties of these minerals, which depend on the coordination of aluminum cations by oxygen ions, different for each of the modifications.

  19. Synthesis of 2-monoacylglycerols and structured triacylglycerols rich in polyunsaturated fatty acids by enzyme catalyzed reactions.

    Science.gov (United States)

    Rodríguez, Alicia; Esteban, Luis; Martín, Lorena; Jiménez, María José; Hita, Estrella; Castillo, Beatriz; González, Pedro A; Robles, Alfonso

    2012-08-10

    This paper studies the synthesis of structured triacylglycerols (STAGs) by a four-step process: (i) obtaining 2-monoacylglycerols (2-MAGs) by alcoholysis of cod liver oil with several alcohols, catalyzed by lipases Novozym 435, from Candida antartica and DF, from Rhizopus oryzae, (ii) purification of 2-MAGs, (iii) formation of STAGs by esterification of 2-MAGs with caprylic acid catalyzed by lipase DF, from R. oryzae, and (iv) purification of these STAGs. For the alcoholysis of cod liver oil, absolute ethanol, ethanol 96% (v/v) and 1-butanol were compared; the conditions with ethanol 96% were then optimized and 2-MAG yields of around 54-57% were attained using Novozym 435. In these 2-MAGs, DHA accounted for 24-31% of total fatty acids. In the operational conditions this lipase maintained a stable level of activity over at least 11 uses. These results were compared with those obtained with lipase DF, which deactivated after only three uses. The alcoholysis of cod liver oil and ethanol 96% catalyzed by Novozym 435 was scaled up by multiplying the reactant amounts 100-fold and maintaining the intensity of treatment constant (IOT=3g lipase h/g oil). In these conditions, the 2-MAG yield attained was about 67%; these 2-MAGs contained 36.6% DHA. The synthesized 2-MAGs were separated and purified from the alcoholysis reaction products by solvent extraction using solvents of low toxicity (ethanol and hexane); 2-MAG recovery yield and purity of the target product were approximately 96.4% and 83.9%, respectively. These 2-MAGs were transformed to STAGs using the optimal conditions obtained in a previous work. After synthesis and purification, 93% pure STAGs were obtained, containing 38% DHA at sn-2 position and 60% caprylic acid (CA) at sn-1,3 positions (of total fatty acids at these positions), i.e. the major TAG is the STAG with the structure CA-DHA-CA. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Improved synthesis of glycine, taurine and sulfate conjugated bile acids as reference compounds and internal standards for ESI-MS/MS urinary profiling of inborn errors of bile acid synthesis.

    Science.gov (United States)

    Donazzolo, Elena; Gucciardi, Antonina; Mazzier, Daniela; Peggion, Cristina; Pirillo, Paola; Naturale, Mauro; Moretto, Alessandro; Giordano, Giuseppe

    2017-04-01

    Bile acid synthesis defects are rare genetic disorders characterized by a failure to produce normal bile acids (BAs), and by an accumulation of unusual and intermediary cholanoids. Measurements of cholanoids in urine samples by mass spectrometry are a gold standard for the diagnosis of these diseases. In this work improved methods for the chemical synthesis of 30 BAs conjugated with glycine, taurine and sulfate were developed. Diethyl phosphorocyanidate (DEPC) and diphenyl phosphoryl azide (DPPA) were used as coupling reagents for glycine and taurine conjugation. Sulfated BAs were obtained by sulfur trioxide-triethylamine complex (SO 3 -TEA) as sulfating agent and thereafter conjugated with glycine and taurine. All products were characterized by NMR, IR spectroscopy and high resolution mass spectrometry (HRMS). The use of these compounds as internal standards allows an improved accuracy of both identification and quantification of urinary bile acids. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Synthesis of 2-18F-fluoroisonicotinic acid hydrazide and initial biological evaluation

    International Nuclear Information System (INIS)

    Al Jammaz, I.; Abu Durrah, B.; Amartey, J.

    2002-01-01

    Isonicotinic acid hydrazide (isonizide) is one of the most effective agents in tuberculosis therapy. This agent rapidly permeates the bacterial cell membrane via passive diffusion. The central nervous system tuberculosis is being observed in patients who are intravenous drug abusers, with AIDS and AIDS-related complex. Therefore, radiopharmaceuticals for diagnosis of tuberculosis may become important. Very few attempts have been made to develop isonicotinic acid and derivatives for the same application. As part of an on-going research effort to develop radiotracers for fluorination of proteins and peptides via prosthetic groups approach, we have synthesized ethyl 2-[18F]-fluoroisonicotinate and 2-[18F]-fluoroisonicotinic acid hydrazide. The synthetic approach starts from treatment of ethyl-2-(trimethylammonium)-isonicotinate precursor using no-carrier-added radiofluoride produced by the 18O(p,n)18F nuclear reaction on 18O-enriched (95 %) water and Kryptofix 222 as nucleophilic catalyst in anhydrous acetonitrile at 100 0 C, gave ethyl 2-[18F]-fluoroisonicotinate in greater than 90% radiochemical yield (decay corrected) within two minutes reaction time. The ether extract of fluorinated ethylester evaporated and residue was re-dissolved in ethanol and treated with hydrazine for 15 minutes in boiling water to obtain 2-[18F]-fluoroisonicotinic acid hydrazide in excellent radiochemical yield. The overall radiochemical yield was greater that 70% with total synthesis time of approximately one hour. This synthetic approach hold considerable promise as a rapid and simple method for fluorination of radiopharmaceuticals of high radiochemical yield. Biological evaluation was performed in normal mice. The data obtained shown that the lungs appear to retain some activity that someone may presume that such radiotracer maybe useful in detection of tuberculosis

  2. Ultrasound-assisted acid hydrolysis of cellulose to chemical building blocks: Application to furfural synthesis.

    Science.gov (United States)

    Santos, Daniel; Silva, Ubiratan F; Duarte, Fabio A; Bizzi, Cezar A; Flores, Erico M M; Mello, Paola A

    2018-01-01

    In this work, the use of ultrasound energy for the production of furanic platforms from cellulose was investigated and the synthesis of furfural was demonstrated. Several systems were evaluated, as ultrasound bath, cup horn and probe, in order to investigate microcrystalline cellulose conversion using simply a diluted acid solution and ultrasound. Several acid mixtures were evaluated for hydrolysis, as diluted solutions of HNO 3 , H 2 SO 4 , HCl and H 2 C 2 O 4 . The influence of the following parameters in the ultrasound-assisted acid hydrolysis (UAAH) were studied: sonication temperature (30 to 70°C) and ultrasound amplitude (30 to 70% for a cup horn system) for 4 to 8molL -1 HNO 3 solutions. For each evaluated condition, the products were identified by ultra-performance liquid chromatography with high-resolution time-of-flight mass spectrometry (UPLC-ToF-MS), which provide accurate information regarding the products obtained from biomass conversion. The furfural structure was confirmed by nuclear magnetic resonance ( 1 H and 13 C NMR) spectroscopy. In addition, cellulosic residues from hydrolysis reaction were characterized using scanning electron microscopy (SEM), which contributed for a better understanding of physical-chemical effects caused by ultrasound. After process optimization, a 4molL -1 HNO 3 solution, sonicated for 60min at 30°C in a cup horn system at 50% of amplitude, lead to 78% of conversion to furfural. This mild temperature condition combined to the use of a diluted acid solution represents an important contribution for the selective production of chemical building blocks using ultrasound energy. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Synthesis of amino acid rare earth complexes and its application in agriculture

    International Nuclear Information System (INIS)

    Luo, G.-T.; Lian, P.; Hu, Y.H.; Guo, G.-R.

    1998-01-01

    Full text: The application of rare-earth compounds in agriculture has been widely reported. So far, most rare-earth compounds used in agriculture were inorganic salt and they were difficult to be absorbed by croup. The synthesis method and structure of amino acid rare-earth complexes have been reported. In this paper, we reported the preparation of mixed amino acids rare-earth complexes and their application in agriculture. The mixed amino acids were obtained by hydrolysis of waste natural protein. Rare earth was lanthanum oxide(99%). Mixed amino acids lanthanum complexes(MALa) was prepared according to the previous method. Investigation to the effect of croup by MALa, we have make tests of citrus, rice and mung bean. The results show as follows: 1) When the experiment group citrus was sprinkled twice 400ppm MALa at bouquet stage and young fruit stage, the sugar, morose, sucrose, soluble solid matter and vitamin C of fruit were increased 21%, 20%, 22%, 22% and 6% as compared to the control group, respectively. The area of leaf and foliage branch in Spring were also increased 4.6% and 2.2%. 2) When the rice was sprinkled 300ppm MALa at early tillering stage, the productively of rice was addition to 10-15%, and the relative effect of prevention was 45.61% for sheath and culm blight of rice. 3) In the test of mungbean growth, the low consistency of MALa ( 250ppm) retain from sprouting seed. As the same time, it was similar action to seeding growth. Preliminary results indicated MLAa could used as the plant growth regulation agent on the croup. Investigation to the effect of MALa on other croup and the mechanism of biological effect on the croup are still going on

  4. Green synthesis of 3,4-dihydropyrimidinones using nano Fe3O4@meglumine sulfonic acid as a new efficient solid acid catalyst under microwave irradiation

    Directory of Open Access Journals (Sweden)

    Leila Moradi

    2018-01-01

    Full Text Available Design, synthesis and characterization of nano Fe3O4@meglumine sulfonic acid as a new solid acid catalyst for the simple and green one pot multicomponent synthesis of 3,4-dihydropyrimidin-2(1H-ones/thiones was studied. New solid acid catalyst was prepared through a clean and simple protocol and characterized using FTIR, VSM, TGA, SEM, elemental analysis (CHN and XRD techniques. Heterogenization of homogeneous catalyst as a green approach is a useful method for enhancing the efficiency of catalyst. Presented study was a new method for attachment of homogeneous highly soluble catalyst (meglumine sulfate to the magnetite nanoparticle surfaces for preparing a heterogeneous and effective catalyst. Obtained heterogeneous and reusable solid acid catalyst has high performance in the synthesis of Biginelli compounds. The reaction was performed under microwave irradiation as a rapid and green condition. Easy work up as well as excellent yield (90–98% of products in short reaction times (40–200 s and reusable catalyst are the main advantages of presented procedure. Reaction products were characterized in details using physical and chemical techniques such as melting point, 1H NMR, 13C NMR and FTIR.

  5. Impact of high altitude on the hepatic fatty acid oxidation and synthesis in rats

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Qian [Department of General Surgery, Hepatic-biliary-pancreatic Institute, Lanzhou University Second Hospital, Lanzhou (China); Department of Pediatrics, Lanzhou University Second Hospital, Lanzhou (China); Shao, Yuan; Wang, Ying Zhen [Department of General Surgery, Hepatic-biliary-pancreatic Institute, Lanzhou University Second Hospital, Lanzhou (China); Jing, Yu Hong [Institute of Anatomy, School of Basic Medicine, Lanzhou University, Lanzhou (China); Zhang, You Cheng, E-mail: zhangychmd@126.com [Department of General Surgery, Hepatic-biliary-pancreatic Institute, Lanzhou University Second Hospital, Lanzhou (China)

    2014-04-04

    Highlights: • Acute exposure to high altitude (HA) increased hepatic fatty acid (FA) β-oxidation. • Acute exposure of rats to HA increased hepatic FA synthesis. • PPARα and AMPK can regulate the FA metabolism. • FA may be a key energy fuel and a compensation for CHO during acute exposure to HA. • The acute changes of FA metabolism may be a mechanism of acclimatization. - Abstract: High altitude (HA) affects energy metabolism. The impact of acute and chronic HA acclimatization on the major metabolic pathways is still controversial. In this study, we aimed to unveil the impact of HA on the key enzymes involved in the fatty acid (FA) metabolism in liver. Rats were exposed to an altitude of 4300 m for 30 days and the expressions of two key proteins involved in FA β-oxidation (carnitine palmitoyl transferase I, CPT-I; and peroxisome proliferator-activated receptor alpha, PPARα), two proteins involved in FA synthesis (acetyl CoA carboxylase-1, ACC-1; and AMP-activated protein kinase, AMPK), as well as the total ketone body in the liver and the plasma FFAs were examined. Rats without HA exposure were used as controls. We observed that the acute exposure of rats to HA (3 days) led to a significant increase in the expressions of CPT-I and PPARα and in the total hepatic ketone body. Longer exposure (15 days) caused a marked decrease in the expression of CPT-I and PPARα. By 30 days after HA exposure, the expression levels of CPT-I and PPARα returned to the control level. The hepatic ACC-1 level showed a significant increase in rats exposed to HA for 1 and 3 days. In contrast, the hepatic level of AMPK showed a significant reduction throughout the experimental period. Plasma FFA concentrations did not show any significant changes following HA exposure. Thus, increased hepatic FA oxidation and synthesis in the early phase of HA exposure may be among the important mechanisms for the rats to respond to the hypoxic stress in order to acclimatize themselves to the

  6. Antioxidant activity of phenolic acids and their metabolites: synthesis and antioxidant properties of the sulfate derivatives of ferulic and caffeic acids and of the acyl glucuronide of ferulic acid.

    Science.gov (United States)

    Piazzon, A; Vrhovsek, U; Masuero, D; Mattivi, F; Mandoj, F; Nardini, M

    2012-12-19

    The main metabolites of caffeic and ferulic acids (ferulic acid-4'-O-sulfate, caffeic acid-4'-O-sulfate, and caffeic acid-3'-O-sulfate), the most representative phenolic acids in fruits and vegetables, and the acyl glucuronide of ferulic acid were synthesized, purified, and tested for their antioxidant activity in comparison with those of their parent compounds and other related phenolics. Both the ferric reducing antioxidant power (FRAP) assay and the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging method were used. Ferulic acid-4'-O-sulfate and ferulic acid-4'-O-glucuronide exhibited very low antioxidant activity, while the monosulfate derivatives of caffeic acid were 4-fold less efficient as the antioxidant than caffeic acid. The acyl glucuronide of ferulic acid showed strong antioxidant action. The antioxidant activity of caffeic acid-3'-O-glucuronide and caffeic acid-4'-O-glucuronide was also studied. Our results demonstrate that some of the products of phenolic acid metabolism still retain strong antioxidant properties. Moreover, we first demonstrate the ex vivo synthesis of the acyl glucuronide of ferulic acid by mouse liver microsomes, in addition to the phenyl glucuronide.

  7. Synthesis of six epoxyketooctadecenoic acid (EKODE) isomers, their generation from nonenzymatic oxidation of linoleic acid, and their reactivity with imidazole nucleophiles.

    Science.gov (United States)

    Lin, De; Zhang, Jianye; Sayre, Lawrence M

    2007-12-07

    As a class of linoleic acid oxidation products, epoxyketooctadecenoic acids (EKODEs), are formed in vivo and in vitro by a free radical mechanism initiated by either enzymatic or nonenzymatic pathways. They have so far been made available in small-scale quantities, often as isomeric mixtures, from reductive decomposition of linoleic acid-derived hydroperoxides. There is major interest in these compounds owing to their highly potent biological activities and their ability to covalently modify proteins. The synthesis of six EKODE regio- and stereoisomers, two trans alpha',beta'-epoxy-alpha,beta-enones, and two trans and the two cis gamma,delta,-epoxy-alpha,beta-enones was accomplished, with the key steps being Wittig-type reactions and aldol condensations. All six EKODE isomers were confirmed by HPLC to be generated in the autoxidation of linoleic acid promoted by Fe(II)/ascorbic acid through spiking in of authentic samples. On the basis of evidence for EKODE modification of protein His residues, the reactions of Nalpha-benzoyl-L-histidine with autoxidizing linoleic acid and with the individual EKODE isomers were compared, as were the kinetics of the various EKODE reactions with imidazole nucleophiles. The structures of His-EKODE-(E)-I adducts were confirmed to reflect conjugate addition (epoxide ring remains intact) through an NMR study of the reaction of imidazole with a generic EKODE-(E)-I analog. The synthesis of the EKODE isomers makes these important molecules available for further chemical and biological evaluation.

  8. Biosynthetic control of the natural abundance of carbon 13 at specific positions within fatty acids in Escherichia coli. Evidence regarding the coupling of fatty acid and phospholipid synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Monson, K.D.; Hayes, J.M.

    1980-12-10

    Stable carbon isotope ratios (/sup 13/C//sup 12/C) at natural abundance levels have been determined for individual carbon atoms in each of the major phospholipid fatty acids of Escherichia coli grown on glucose as the sole carbon source. Two models were constructed for the isotope effects and carbon flow pathways which must be responsible for the observed isotopic fractionations. Both models incorporate a branch in the carbon flow at which fatty acyl-acyl carrier protein (acyl-ACP) is utilized either for complex lipid synthesis or for elongation by fatty acid synthetase. Depletion of carbon 13 in the carboxyl groups of myristic and palmitoleic acids (relative to carbonyl groups in precursor acyl-ACP's) was observed to occur at this branching site. Only one of the models was consistent both with this observation and with the observation that exogenous fatty acids are incorporated into phospholipids but are not elongated. The successful model has free fatty acid as the intermediate product coupling fatty acid biosynthesis to phospholipid synthesis. Essential to this pathway are those reactions catalyzed by thioesterases I and II as well as acyl-ACP synthetase, enzymes whose roles have previously been unknown in vivo.

  9. Selective antagonists at group I metabotropic glutamate receptors: synthesis and molecular pharmacology of 4-aryl-3-isoxazolol amino acids

    DEFF Research Database (Denmark)

    Kromann, Hasse; Sløk, Frank A; Stensbøl, Tine B

    2002-01-01

    Homologation of (S)-glutamic acid (Glu, 1) and Glu analogues has previously provided ligands with activity at metabotropic Glu receptors (mGluRs). The homologue of ibotenic acid (7), 2-amino-3-(3-hydroxy-5-isoxazolyl)propionic acid (HIBO, 8), and the 4-phenyl derivative of 8, compound 9a, are bot...... antagonists at group I mGluRs. Here we report the synthesis and molecular pharmacology of HIBO analogues 9b-h containing different 4-aryl substituents. All of these compounds possess antagonist activity at group I mGluRs but are inactive at group II and III mGluRs....

  10. Ascorbic acid as a bifunctional hydrogen bond donor for the synthesis of cyclic carbonates from CO2 under ambient conditions

    KAUST Repository

    Arayachukiat, Sunatda

    2017-07-14

    Readily available ascorbic acid was discovered as an environmentally benign hydrogen bond donor (HBD) for the synthe-sis of cyclic organic carbonates from CO2 and epoxides in the presence of nucleophilic co-catalysts. The ascorbic acid/TBAI (TBAI: tetrabutylammonium iodide) binary system could be applied for the cycloaddition of CO2 to various epoxides under ambient or mild conditions. DFT calculations and catalysis experiments revealed an intriguing bifunctional mechanism in the step of CO2 insertion involving different hydroxyl moieties (enediol, ethyldiol) of the ascorbic acid scaffold.

  11. Merging Photoredox and Nickel Catalysis: The Direct Synthesis of Ketones by the Decarboxylative Arylation of α-Oxo Acids.

    Science.gov (United States)

    Chu, Lingling; Lipshultz, Jeffrey M; MacMillan, David W C

    2015-06-26

    The direct decarboxylative arylation of α-oxo acids has been achieved by synergistic visible-light-mediated photoredox and nickel catalysis. This method offers rapid entry to aryl and alkyl ketone architectures from simple α-oxo acid precursors via an acyl radical intermediate. Significant substrate scope is observed with respect to both the oxo acid and arene coupling partners. This mild decarboxylative arylation can also be utilized to efficiently access medicinal agents, as demonstrated by the rapid synthesis of fenofibrate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    Science.gov (United States)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  13. Synthesis and antioxidant efficiency of a new amphiphilic spin-trap derived from PBN and lipoic acid.

    Science.gov (United States)

    Durand, G; Polidori, A; Salles, J P; Prost, M; Durand, P; Pucci, B

    2003-08-18

    The synthesis of a new amphiphilic antioxidant called PBNLP and derived from both alpha-phenyl-N-tert-butyl nitrone (PBN) and lipoic acid was described. Grafting a lactobionamide moiety onto the aromatic group of the PBN provided the water solubility of this compound. In vitro preliminary biological evaluations of its antioxidant capacity were performed using the KRL biological test based on free radical-induced hemolysis. The PBNLP induces a protection of erythrocytes against exogenous free radicals higher than that measured with lipoic acid or PBN alone or with lipoic acid or PBN derivatives in admixtures.

  14. Abridged acid-base wet-milling synthesis of high purity hydroyapatite

    Directory of Open Access Journals (Sweden)

    Sandi Carolina Ruiz-Mendoza

    2008-06-01

    Full Text Available There is a plethora of routes to produce hydroxyapatite(HA and in general calcium phosphates(CP but production usually leads to a mixture of several phases. Besides ionic contamination, most of these methods are cumbersome, restricted to small volumes of product and require a lot of thermal energy. The acid-base route eliminates foreign ions or additives and its only byproduct is water. Heterogeneous reaction drawback is that solid reactants do not easily come in contact with each other and therefore addition and stirring times become very lengthy and still the product is a mixture. The synthesis started from calcium hydroxide and phosphoric acid (PA. Ball milling was used to favor kinetics and stoichiometry. Six sets of PA addition, paddle stirring and ball milling times were used. Products were evaluated by X ray diffraction (XRD, Fourier Transform Infrared (FTIR, scanning electron microscopy (SEM, X ray fluorescence (XRF and Ca/P ratio. Chemical analysis for calcium proceeded through oxalate precipitate and phosphorus by the phosphomolibdate technique. A set of conditions yielding high purity HA was established.

  15. Synthesis and Application of Phenyl Nitrone Derivatives as Acidic and Microbial Corrosion Inhibitors

    Directory of Open Access Journals (Sweden)

    Shijun Chen

    2015-01-01

    Full Text Available Nitrone has drawn great attention due to its wide applications as a 1,3-dipole in heterocyclic compounds synthesis and the bioactivities. With the special structure, nitrone can also be used as ligand in inorganic chemistry. Based on the current research, the nitrones are anticipated to be effective inhibitors against acidic and microbial corrosion. The aim of this work is to investigate the inhibitory action of nitrones. In this work, a series of phenyl nitrone derivatives (PN was synthesized and used as acidic and microbial corrosion inhibitors. The results indicate that several compounds show moderate to high inhibition efficiency (IE in 3% HCl. Accompanied with HMTA or BOZ, the IEs greatly increase, and the highest efficiency of 98.5% was obtained by using PN4 + BOZ. Investigation of the antibacterial activity against oilfield microorganism shows that the nitrone derivatives can inhibit SRB, IB, and TGB with moderate to high efficiency under 1,000 mg/L, which makes them potential to be used as bifunctional oilfield chemicals.

  16. Characterization of a nitrilase from Arthrobacter aurescens CYC705 for synthesis of iminodiacetic acid.

    Science.gov (United States)

    Cai, Wenwen; Su, Erzheng; Zhu, Shujing; Ren, Yuhong; Wei, Dongzhi

    2014-01-01

    A nitrilase gene cyc705 from Arthrobacter aurescens CYC705 for synthesis of iminodiacetic acid (IDA) was cloned. This gene contained a 930 bp ORF, which encoded a polypeptide of 310 amino acids. A recombinant Escherichia coli BL21(DE3)/pET28a-cyc705 was constructed to achieve the heterologous expression of cyc705. This recombinant nitrilase was purified to homogeneity with a molecular weight of 36.7 kDa on SDS-PAGE and mass spectrometry, and characterized to be an oligomer of 14 subunits by gel permeation chromatography. Using iminodiacetonitrile (IDAN) as the substrate, the Vmax, Km, kcat and kcat/Km were 9.05 U mg(-1), 43.17 mM(-1), 94.1 min(-1) and 2.18×10(3) min(-1) M(-1), respectively. The optimum temperature and pH were 25°C and 5.8. The suitable substrates for the purified nitrilase were short-chain aliphatic dinitriles. High concentration of IDAN could be hydrolyzed to IDA in a shorter time.

  17. Synthesis and photophysicochemical studies of a water soluble conjugate between folic acid and zinc tetraaminophthalocyanine

    Energy Technology Data Exchange (ETDEWEB)

    Khoza, Phindile; Antunes, Edith [Department of Chemistry, Rhodes University, PO Box 94, Grahamstown (South Africa); Chen, Ji-Yao [State Key Laboratory of Surface Physics and Department of Physics, Fudan University, Shanghai 200433 (China); Nyokong, Tebello, E-mail: t.nyokong@ru.ac.za [Department of Chemistry, Rhodes University, PO Box 94, Grahamstown (South Africa)

    2013-02-15

    This work reports on the synthesis of zinc tetraaminophthalocyanine (ZnTAPc) functionalized with folic acid (FA), forming ZnTAPcFA. The conjugate between FA and ZnTAPc was soluble in water whereas ZnTAPc alone is not. The structure of ZnTAPcFA conjugate was elucidated by {sup 1}H NMR, MALDI-TOF mass and FTIR spectra. Photophysical and photochemical studies of ZnTAPcFA were conducted in DMSO. The increase in fluorescence quantum yield of the conjugate was accompanied by a decrease in the triplet and singlet oxygen quantum yields. The changes in triplet quantum and singlet oxygen quantum yields were marginal when ZnTAPc was simply mixed with FA without a chemical bond. - Highlights: Black-Right-Pointing-Pointer A conjugate between folic acid and a zinc tetraaminophthalocyanine was formed. Black-Right-Pointing-Pointer The conjugate is water soluble even though the phthalocyanine alone is not. Black-Right-Pointing-Pointer The fluorescence quantum yield of the conjugate was enhanced compared to the phthalocyanine alone. Black-Right-Pointing-Pointer Triplet quantum yields decreased for the conjugate.

  18. Synthesis and Characterization of Mercaptoacetic Acid Capped Cadmium Sulphide Quantum Dots.

    Science.gov (United States)

    Wageh, S; Maize, Mai; Donia, A M; Al-Ghamdi, Ahmed A; Umar, Ahmad

    2015-12-01

    This paper reports the facile synthesis and detailed characterization of mercaptoacetic acid capped cadmium sulphide (CdS) quantum dots using various cadmium precursors. The mercaptoacetic acid capped CdS quantum dots were prepared by facile and simple wet chemical method and characterized by several techniques such as energy dispersive spectroscopy (EDS), X-ray diffraction, Fourier transform infrared (FTIR) spectroscopy, UV-vis. spectroscopy, photoluminescence spectroscopy, high-resolution transmission microscopy (HRTEM) and thremogravimetric analysis. The EDS studies revealed that the prepared quantum dots possess higher atomic percentage of sulfur compared to cadmium due to the coordination of thiolate to the quantum dots surfaces. The X-ray and absorption analyses exhibited that the size of quantum dots prepared by cadmium acetate is larger than the quantum dots prepared by cadmium chloride and cadmium nitrate. The increase in size can be attributed to the low stability constant of cadmium acetate in comparison with cadmium chloride and cadmium nitrate. The FTIR and thermogravimetric analysis showed that the nature of capping molecule on the surface of quantum dots are different depending on the cadmium precursors which affect the emission from CdS quantum dots. Photoemission spectroscopy revealed that the emission of quantum dots prepared by cadmium acetate has high intensity band edge emission along with low intensity trapping state emission. However the CdS quantum dots prepared by cadmium chloride and cadmium nitrate produced only trapping state emissions.

  19. Synthesis of 1- and 3-11C-labelled L-lactic acid using multi-enzyme catalysis

    International Nuclear Information System (INIS)

    Bjurling, P.; Laangstroem, B.

    1990-01-01

    The synthesis of 1- and 3- 11 C-labelled L-lactic acid from the corresponding racemic 1- or 3- 11 C-labelled alanine using a multi-enzymatic reaction route, is presented. DL-[1- 11 C]Alanine was synthesised by reacting sodium 1-hydroxy-ethyl sulfite with hydrogen [ 11 C]cyanide, obtained from [ 11 C]carbon dioxide, and ammonia followed by acid hydrolysis. DL-[3- 11 C]-Alanine was synthesised by a methylation of a glycine derivative, N-(diphenylmethylene)-glycine tert-butyl ester, with [ 11 C]methyl iodide, obtained from [ 11 C]carbon dioxide, and subsequent hydrolysis. The racemic 1- or 3- 11 C-labelled alanine was then converted to pyruvic acid, by D-amino acid oxidase/catalase and glutamic-pyruvic transaminase, which was directly reduced to L-lactic acid by L-lactic dehydrogenase in a one-pot procedure. The total synthesis time was 40 minutes, counted from release of [ 11 C]carbon dioxide. The decay corrected radiochemical yields were ca. 80% for L-[1- 11 C]lactic acid, based on hydrogen cyanide, and ca. 60% for L-[3- 11 C]lactic acid, based on carbon dioxide. The radiochemical purities were higher than 99% analysed by HPLC. (author)

  20. Development of a method for environmentally friendly chemical peptide synthesis in water using water-dispersible amino acid nanoparticles

    Directory of Open Access Journals (Sweden)

    Fukumori Yoshinobu

    2011-08-01

    Full Text Available Abstract Due to the vast importance of peptides in biological processes, there is an escalating need for synthetic peptides to be used in a wide variety of applications. However, the consumption of organic solvent is extremely large in chemical peptide syntheses because of the multiple condensation steps in organic solvents. That is, the current synthesis method is not environmentally friendly. From the viewpoint of green sustainable chemistry, we focused on developing an organic solvent-free synthetic method using water, an environmentally friendly solvent. Here we described in-water synthesis technology using water-dispersible protected amino acids.

  1. Bile acid synthesis in man. In vivo activity of the 25-hydroxylation pathway

    International Nuclear Information System (INIS)

    Duane, W.C.; Pooler, P.A.; Hamilton, J.N.

    1988-01-01

    During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side-chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. We have previously shown in the rat that the contribution of the 25-hydroxylation pathway can be quantitated in vivo by measuring production of [ 14 C]acetone from [ 14 C]26-cholesterol. In the present study, we adapted this method to human subjects. 4 d after oral administration of 100 microCi of [ 14 C]26-cholesterol and 1 d after beginning a constant infusion of 16.6 mumol/min unlabeled acetone, three men and two women underwent breath collections. Expired acetone was trapped and purified as the 2,4 dinitrophenylhydrazine derivative. 14 CO 2 was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied by the acetone infusion rate to calculate production of [ 14 C]acetone. [ 14 C]Acetone production averaged 4.9% of total release of 14 C from [ 14 C]26-cholesterol, estimated by 14 CO2 output. The method was validated by showing that [ 14 C]acetone production from [ 14 C]isopropanol averaged 86.9% of the [ 14 C]-isopropanol infusion rate. We conclude that in man, as in the rat, the 25-hydroxylation pathway accounts for less than 5% of bile acid synthesis

  2. Synthesis and HNO Donating Properties of the Piloty's Acid Analogue Trifluoromethanesulphonylhydroxamic acid: Evidence for Quantitative Release of HNO at Neutral pH Conditions.

    Science.gov (United States)

    Adas, Sonya K; Bharadwaj, Vinay; Zhou, Yang; Zhang, Jiuhong; Seed, Alexander J; Brasch, Nicola Elizabeth; Sampson, Paul

    2018-03-11

    Trifluoromethanesulphonylhydroxamic acid, CF3SO2NHOH, is shown to release HNO under physiological pH conditions. A two-step synthesis is presented with the first complete characterization of CF3SO2NHOH. This molecule rapidly decomposes in neutral aqueous solution to cleanly release HNO and CF3SO2-, demonstrated using the HNO traps TXPTS and HOCbl, and by 19F NMR spectroscopy. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Nb-Based Zeolites: Efficient bi-Functional Catalysts for the One-Pot Synthesis of Succinic Acid from Glucose

    Directory of Open Access Journals (Sweden)

    Magdi El Fergani

    2017-12-01

    Full Text Available The one-pot production of succinic acid from glucose was investigated in pure hot water as solvent using Nb (0.02 and 0.05 moles%-Beta zeolites obtained by a post-synthesis methodology. Structurally, they are comprised of residual framework Al-acid sites, extra-framework isolated Nb (V and Nb2O5 pore-encapsulated clusters. The Nb-modified Beta-zeolites acted as bi-functional catalysts in which glucose is dehydrated to levulinic acid (LA which, further, suffers an oxidation process to succinic acid (SA. After the optimization of the reaction conditions, that is, at 180 °C, 18 bar O2, and 12 h reaction time, the oxidation of glucose occurred with a selectivity to succinic acid as high as 84% for a total conversion.

  4. Alginic acid: A mild and renewable bifunctional heterogeneous biopolymeric organocatalyst for efficient and facile synthesis of polyhydroquinolines.

    Science.gov (United States)

    Dekamin, Mohammad G; Karimi, Zahra; Latifidoost, Zahra; Ilkhanizadeh, Siamand; Daemi, Hamed; Naimi-Jamal, M Reza; Barikani, Mehdi

    2018-03-01

    Alginic acid, a widely used naturally occurring carbohydrate which is generally derived from brown seaweeds, can be considered as a bifunctional heterogeneous and green biopolymeric organocatalyst. Alginic acid, without any post-modification with active Bronsted or Lewis acid centers, was found to be a highly active, cost-effective, commercially-available, renewable and recoverable heterogeneous biopolymeric organocatalyst for the expeditious synthesis of polyhydroquinolines (PHQs). Polyhydroquinolines were synthesized from the four-component Hantzsch reaction of ethyl acetoacetate, different aldehydes, ammonium acetate and cyclic 1,3-diones under mild conditions in high to quantitative yields, 75-97%, using alginic acid. Furthermore, alginic acid was found to be reusable for at least 6 consecutive cycles without considerable loss of its catalytic activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Synthesis of biodiesel from a model waste oil feedstock using a carbon-based solid acid catalyst: reaction and separation.

    Science.gov (United States)

    Shu, Qing; Nawaz, Zeeshan; Gao, Jixian; Liao, Yuhui; Zhang, Qiang; Wang, Dezheng; Wang, Jinfu

    2010-07-01

    A solid acid catalyst that can keep high activity and stability is necessary when low cost feedstocks are utilized for biodiesel synthesis because the reaction medium contains a large amount of water. Three solid acid catalysts were prepared by the sulfonation of carbonized vegetable oil asphalt and petroleum asphalt. The structure of these catalysts was characterized by a variety of techniques. A new process that used the coupling of the reaction and separation was employed, which greatly improved the conversion of cottonseed oil (triglyceride) and free fatty acids (FFA) when a model waste oil feedstock was used. The vegetable oil asphalt-based catalyst showed the highest catalytic activity. This was due to the high density and stability of its acid sites, its loose irregular network, its hydrophobicity that prevented the hydration of -OH species, and large pores that provided more acid sites for the reactants. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  6. ANTITUMOR ACTIVITY OF HYALURONIC ACID SYNTHESIS INHIBITOR 4-METHYLUMBELLIFERONE IN PROSTATE CANCER CELLS

    Science.gov (United States)

    Lokeshwar, Vinata B.; Lopez, Luis E.; Munoz, Daniel; Chi, Andrew; Shirodkar, Samir P.; Lokeshwar, Soum D.; Escudero, Diogo O.; Dhir, Neetika; Altman, Norman

    2010-01-01

    4-methylumbelliferone (4-MU) is a hyaluronic acid (HA) synthesis inhibitor with anticancer properties; the mechanism of its anticancer effects is unknown. We evaluated the effects of 4-MU on prostate cancer cells. 4-MU inhibited proliferation, motility and invasion of DU145, PC3-ML, LNCaP, C4-2B and/or LAPC-4 cells. At IC50 for HA synthesis (0.4 mM), 4-MU induced > 3-fold apoptosis in prostate cancer cells, which could be prevented by HA addition. 4-MU induced caspase-8, -9 and -3 activation, PARP cleavage, up-regulation of Fas-L, Fas, FADD and DR4 and down regulation of bcl-2, phospho-bad, bcl-XL, phospho-Akt, phospho-IKB, phospho-ErbB2 and phospho-EGFR. At IC50, 4-MU also caused > 90% inhibition of NFkB reporter activity which was prevented partially by HA addition. With the exception of caveolin-1, HA prevented the 4-MU induced down regulation of HA receptors (CD44, RHAMM), matrix-degrading enzymes (MMP-2, MMP-9), IL-8, and chemokine receptors (CXCR1, CXCR4, CXCR7) at protein and mRNA levels. Expression of myristoylated-Akt rescued 4-MU induced apoptosis and inhibition of cell growth and IL-8, RHAMM, HAS2, CD44 and MMP-9 expression. Oral administration of 4-MU significantly decreased PC3-ML tumor growth (> 3-fold), when treatment was started either on the day of tumor cell injection or after the tumors became palpable, without organ toxicity, changes in serum chemistry or body weight. Tumors from 4-MU treated animals showed reduced microvessel density (~ 3-fold) and HA expression but increased TUNEL positive cells and expression of apoptosis-related molecules. Therefore, anticancer effects of 4-MU, an orally bioavailable and relatively non-toxic agent, are primarily mediated by inhibition of HA signaling. PMID:20332231

  7. Assessment of modes of action and efficacy of plasma cholesterol-lowering drugs : measurement of cholesterol absorption, cholesterol synthesis and bile acid synthesis and turnover using novel stable isotope techniques

    NARCIS (Netherlands)

    Stellaard, Frans; Kuipers, Folkert

    Several processes are involved in control of plasma cholesterol levels, e.g., intestinal cholesterol absorption, endogenous cholesterol synthesis and transport and bile acid synthesis. Adaptation of either of these processes allows the body to adapt to changes in dietary cholesterol intake.

  8. Bile acid synthesis is increased in Chilean Hispanics with gallstones and in gallstone high-risk Mapuche Indians.

    Science.gov (United States)

    Gälman, Cecilia; Miquel, Juan Francisco; Pérez, Rosa Maria; Einarsson, Curt; Ståhle, Lars; Marshall, Guillermo; Nervi, Flavio; Rudling, Mats

    2004-03-01

    Gallstone disease is an important, costly health-care problem in Western societies. It is still unclear whether hepatic lipid regulatory enzymes play primary or secondary roles in gallstone formation. In this study, the aim was to investigate whether the synthesis of bile acids and cholesterol is increased in gallstone disease and to test whether such a metabolic change, if present, might occur before gallstone formation. A total of 125 Chilean Hispanic women (80 without gallstones and 45 with gallstones) matched for age and body mass index were investigated, along with 40 Chilean Mapuche Indian women (20 without gallstones and 20 with gallstones), a population group in which the prevalence for gallstone disease is very high. Fasting blood plasma samples were assayed for 7 alpha-hydroxy-4-cholesten-3-one and lathosterol, 2 strong indicators for hepatic bile acid and body cholesterol synthesis, respectively. Plasma 7 alpha-hydroxy-4-cholesten-3-one levels, corrected for plasma cholesterol, were significantly increased by 50% in Hispanic women with gallstones as compared with gallstone-free Hispanics (P or =100% (P Mapuche Indian women, independently of whether gallstones were present. Plasma lathosterol, corrected for plasma cholesterol, was significantly increased by 22% in Hispanic women with gallstones and in Mapuche Indian women compared with Hispanic women. The results indicate that the synthesis of bile acids and cholesterol is induced in gallstone disease and precedes gallstone development. These inductions presumably occur as a response to an increased intestinal loss of bile acids.

  9. Catabolism of Branched Chain Amino Acids Contributes Significantly to Synthesis of Odd-Chain and Even-Chain Fatty Acids in 3T3-L1 Adipocytes.

    Directory of Open Access Journals (Sweden)

    Scott B Crown

    Full Text Available The branched chain amino acids (BCAA valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0 and odd chain length (C15:0 and C17:0 fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA.

  10. The effects of enhanced methionine synthesis on amino acid and anthocyanin content of potato tubers

    Directory of Open Access Journals (Sweden)

    Bánfalvi Zsófia

    2008-06-01

    Full Text Available Abstract Background Potato is a staple food in the diet of the world's population and also being used as animal feed. Compared to other crops, however, potato tubers are relatively poor in the essential amino acid, methionine. Our aim was to increase the methionine content of tubers by co-expressing a gene involved in methionine synthesis with a gene encoding a methionine-rich storage protein in potato plants. Results In higher plants, cystathionine γ-synthase (CgS is the first enzyme specific to methionine biosynthesis. We attempted to increase the methionine content of tubers by expressing the deleted form of the Arabidopsis CgS (CgSΔ90, which is not regulated by methionine, in potato plants. To increase the incorporation of free methionine into a storage protein the CgSΔ90 was co-transformed with the methionine-rich 15-kD β-zein. Results demonstrated a 2- to 6-fold increase in the free methionine content and in the methionine content of the zein-containing protein fraction of the transgenic tubers. In addition, in line with higher methionine content, the amounts of soluble isoleucine and serine were also increased. However, all of the lines with high level of CgSΔ90 expression were phenotypically abnormal showing severe growth retardation, changes in leaf architecture and 40- to 60% reduction in tuber yield. Furthermore, the colour of the transgenic tubers was altered due to the reduced amounts of anthocyanin pigments. The mRNA levels of phenylalanine ammonia-lyase (PAL, the enzyme catalysing the first step of anthocyanin synthesis, were decreased. Conclusion Ectopic expression of CgSΔ90 increases the methionine content of tubers, however, results in phenotypic aberrations in potato. Co-expression of the 15-kD β-zein with CgSΔ90 results in elevation of protein-bound methionine content of tubers, but can not overcome the phenotypical changes caused by CgSΔ90 and can not significantly improve the nutritional value of tubers. The level

  11. Position 228 in Paenibacillus macerans cyclodextrin glycosyltransferase is critical for 2-O-d-glucopyranosyl-l-ascorbic acid synthesis.

    Science.gov (United States)

    Chen, Sheng; Xiong, Yanjun; Su, Lingqia; Wang, Lei; Wu, Jing

    2017-04-10

    The markedly stable l-ascorbic acid (L-AA) derivative 2-O-d-glucopyranosyl-l-ascorbic acid (AA-2G) has been widely used in the fields of food, medicine, cosmetics, and husbandry. Cyclodextrin glycosyltransferase (CGTase) is considered suitable for the large-scale production of AA-2G. In this work, Paenibacillus macerans CGTase was used to produce AA-2G and the production was 13.5g/l. An amino-acid sequence alignment of α-, β-, and α⁄β-CGTase indicated that the Phe at position 228 of P. macerans CGTase was different from the amino acids at this position in other CGTases (Met, Val, or Ile). In addition, the CGTases from Anaerobranca gottschalkii and Bacillus circulans 251, which have Val and Met at position 228, were shown to produce 28.9 and 35.7g/l AA-2G, respectively, which verified the importance of this position for AA-2G synthesis. Subsequently, P. macerans CGTase mutants F228M and F228V were constructed and shown to produce 24.8g/l and 24.0g/l AA-2G, respectively, which are 84% and 78% higher than that of wild-type P. macerans CGTase, respectively. Kinetic analysis of AA-2G synthesis showed that affinities of the two mutants for L-AA and the catalytic efficiencies increased. Meanwhile, the mutants had lower cyclization activity but higher disproportionation activities, which is beneficial for AA-2G synthesis. All these results indicated that amino acid at position 228 of P. macerans CGTase is crucial to AA-2G synthesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Kinetics and Optimization of Lipophilic Kojic Acid Derivative Synthesis in Polar Aprotic Solvent Using Lipozyme RMIM and Its Rheological Study

    Directory of Open Access Journals (Sweden)

    Nurazwa Ishak

    2018-02-01

    Full Text Available The synthesis of kojic acid derivative (KAD from kojic and palmitic acid (C16:0 in the presence of immobilized lipase from Rhizomucor miehei (commercially known as Lipozyme RMIM, was studied using a shake flask system. Kojic acid is a polyfunctional heterocycles that acts as a source of nucleophile in this reaction allowing the formation of a lipophilic KAD. In this study, the source of biocatalyst, Lipozyme RMIM, was derived from the lipase of Rhizomucor miehei immobilized on weak anion exchange macro-porous Duolite ES 562 by the adsorption technique. The effects of solvents, enzyme loading, reaction temperature, and substrate molar ratio on the reaction rate were investigated. In one-factor-at-a-time (OFAT experiments, a high reaction rate (30.6 × 10−3 M·min−1 of KAD synthesis was recorded using acetone, enzyme loading of 1.25% (w/v, reaction time of 12 h, temperature of 50 °C and substrate molar ratio of 5:1. Thereafter, a yield of KAD synthesis was optimized via the response surface methodology (RSM whereby the optimized molar ratio (fatty acid: kojic acid, enzyme loading, reaction temperature and reaction time were 6.74, 1.97% (w/v, 45.9 °C, and 20 h respectively, giving a high yield of KAD (64.47%. This condition was reevaluated in a 0.5 L stirred tank reactor (STR where the agitation effects of two impellers; Rushton turbine (RT and pitch-blade turbine (PBT, were investigated. In the STR, a very high yield of KAD synthesis (84.12% was achieved using RT at 250 rpm, which was higher than the shake flask, thus indicating better mixing quality in STR. In a rheological study, a pseudoplastic behavior of KAD mixture was proposed for potential application in lotion formulation.

  13. Kinetics and Optimization of Lipophilic Kojic Acid Derivative Synthesis in Polar Aprotic Solvent Using Lipozyme RMIM and Its Rheological Study.

    Science.gov (United States)

    Ishak, Nurazwa; Lajis, Ahmad Firdaus B; Mohamad, Rosfarizan; Ariff, Arbakariya B; Mohamed, Mohd Shamzi; Halim, Murni; Wasoh, Helmi

    2018-02-24

    The synthesis of kojic acid derivative (KAD) from kojic and palmitic acid (C16:0) in the presence of immobilized lipase from Rhizomucor miehei (commercially known as Lipozyme RMIM), was studied using a shake flask system. Kojic acid is a polyfunctional heterocycles that acts as a source of nucleophile in this reaction allowing the formation of a lipophilic KAD. In this study, the source of biocatalyst, Lipozyme RMIM, was derived from the lipase of Rhizomucor miehei immobilized on weak anion exchange macro-porous Duolite ES 562 by the adsorption technique. The effects of solvents, enzyme loading, reaction temperature, and substrate molar ratio on the reaction rate were investigated. In one-factor-at-a-time (OFAT) experiments, a high reaction rate (30.6 × 10 -3 M·min -1 ) of KAD synthesis was recorded using acetone, enzyme loading of 1.25% ( w / v ), reaction time of 12 h, temperature of 50 °C and substrate molar ratio of 5:1. Thereafter, a yield of KAD synthesis was optimized via the response surface methodology (RSM) whereby the optimized molar ratio (fatty acid: kojic acid), enzyme loading, reaction temperature and reaction time were 6.74, 1.97% ( w / v ), 45.9 °C, and 20 h respectively, giving a high yield of KAD (64.47%). This condition was reevaluated in a 0.5 L stirred tank reactor (STR) where the agitation effects of two impellers; Rushton turbine (RT) and pitch-blade turbine (PBT), were investigated. In the STR, a very high yield of KAD synthesis (84.12%) was achieved using RT at 250 rpm, which was higher than the shake flask, thus indicating better mixing quality in STR. In a rheological study, a pseudoplastic behavior of KAD mixture was proposed for potential application in lotion formulation.

  14. C15 FUNCTIONALIZED DERIVATIVES OF ent-KAUR-16-EN-19-OIC ACID: ISOLATION FROM THE SUNFLOWER HELIANTHUS ANNUUS L. AND SYNTHESIS

    Directory of Open Access Journals (Sweden)

    Marina Grinco

    2010-06-01

    Full Text Available The known diterpenic ester – 15α-angeloyl-ent-kaur-16-en-19-oic (angeloylgrandifl oric acid has been isolated from the dry wastes of Helianthus annuus L. The synthesis of 15α-hydroxy- and 15-oxo-ent-kaur-16-en-19- oic acids starting from ent-kaur-16-en-19-oic acid has been performed.

  15. Synthesis of metabolites of the insecticide Deltamethrine: 3-phenoxy (carboxyl-14C) benzoic acids and 3-phenoxy (hydroxymethyl-14C) benzyl alcohols

    International Nuclear Information System (INIS)

    Do-Cao-Thang; Nguyen-Hoang-Nam; Hoellinger, H.; Pichat, L.; CEA Centre d'Etudes Nucleaires de Saclay, 91 - Gif-sur-Yvette

    1985-01-01

    Procedures are described for the synthesis of the following metabolites of Deltamethrin, the pyrethroid insecticide: 3-phenoxy (carboxyl- 14 C) benzoic acid, 3-(4'-hydroxyphenoxy) (carboxyl- 14 C) benzoic acid, 3-(2'-hydroxyphenoxy) (carboxyl- 14 C) benzoic acid and the corresponding 3-phenoxybenzyl alcohols, specific activity = 47-57 mCi/mmol. (author)

  16. Primordial Synthesis of Amines and Amino Acids in a 1958 Miller H2S-Rich Spark Discharge Experiment

    Science.gov (United States)

    Parker, Eric T.; Cleaves, Henderson J.; Dworkin, Jason P.; Glavin, Daniel P.; Callahan, Michael; Aubrey, Andrew; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Archived samples from a previously unreported 1958 Stanley Miller electric discharge experiment containing hydrogen sulfide (H2S) were recently discovered and analyzed using high-performance liquid chromatography and time-of-flight mass spectrometry. We report here the detection and quantification of primary amine-containing compounds in the original sample residues, which were produced via spark discharge using a gaseous mixture of H2S, CH4, NH3, and CO2. A total of 23 amino acids and 4 amines, including 7 organosulfur compounds, were detected in these samples. The major amino acids with chiral centers are racemic within the accuracy of the measurements, indicating that they are not contaminants introduced during sample storage. This experiment marks the first synthesis of sulfur amino acids from spark discharge experiments designed to imitate primordia! environments. The relative yield of some amino acids, in particular the isomers of aminobutyric acid, are the highest ever found in a spark discharge experiment. The simulated primordial conditions used by Miller may serve as a model for early volcanic plume chemistry and provide insight to the possible roles such plumes may have played in abiotic organic synthesis. Additionally, the overall abundances of the synthesized amino acids in the presence of H2S are very similar to the abundances found in some carbonaceous meteorites, suggesting that H2S may have played an important role in prebiotic reactions in early solar system environments.

  17. The Influence of Tallow on Rumen Metabolism, Microbial Biomass Synthesis and Fatty Acid Composition of Bacteria and Protozoa

    DEFF Research Database (Denmark)

    Weisbjerg, Martin Riis; Børsting, Christian Friis; Hvelplund, Torben

    1992-01-01

    Rumen metabolism, microbial biomass synthesis and microbial long chain fatty acid composition were studied in lactating cows fed at two levels of dry matter intake (L, 8.6 kg DM and H, 12.6 kg DM) with 0, 4 and 6% added tallow at the low feed level (L0, L4 and L6) and 0, 2, 4 and 6% at the high...... feed level (H0, H2, H4 and H6). Fibre digestibility was not significantly affected by tallow addition. Increasing tallow level in the diet decreased the total VFA concentration, the ratio of acetic acid to propionic acid and the ammonia concentration in the rumen. Crude fat and fatty acid content...... in bacterial and protozoal dry matter increased with increased tallow level, especially due to an increase in fatty acids originating from the feeds. Microbial synthesis in the rumen and flow of amino acids to the duodenum was highest for medium fat intake at the high feed level....

  18. Requirements of glycerol and fatty acid for triglyceride synthesis and ketogenesis by hepatocytes from normal and triiodothyronine-treated rats

    Energy Technology Data Exchange (ETDEWEB)

    Olubadewo, J.O.; Heimberg, M.

    1985-11-15

    Hepatocytes from T3-treated rats synthesized less triglyceride and more ketone bodies from (1-/sup 14/C)oleate at all concentrations from 0-2 mM, than did hepatocytes from euthyroid animals; addition of 1.0 mM glycerol increased triglyceride synthesis and reduced ketogenesis in hepatocytes from T3-treated rats to the rates observed in euthyroid hepatocytes in the absence of added glycerol. Glycerol did not alter triglyceride synthesis, but reduced ketogenesis genesis by euthyroid hepatocytes. It is probable from these and other data that, in the hyperthyroid rat, glycero-3-P, and not fatty acid, is rate limiting for synthesis of triglyceride, and, secondarily for reducing rates of ketogenesis in the hepatocyte.

  19. Metal-Free, Multicomponent Synthesis of Pyrrole-Based π-Conjugated Polymers from Imines, Acid Chlorides, and Alkynes.

    Science.gov (United States)

    Kayser, Laure V; Vollmer, Moritz; Welnhofer, Merve; Krikcziokat, Hanna; Meerholz, Klaus; Arndtsen, Bruce A

    2016-08-24

    Multicomponent coupling reactions (MCRs) are becoming increasingly used in the synthesis of macromolecules, as they can allow the rapid generation of libraries of materials as a method to tune properties. MCRs could prove particularly useful in the synthesis of π-conjugated polymers in which structural changes are necessary for fine-tuning of electronic properties. We describe here the first metal-free multicomponent approach to conjugated polymers. This reaction exploits the coupling of imines, acid chlorides, and (catechyl)PPh to generate phospha-münchnone-containing polymers, which can be converted to poly(pyrroles) via cycloaddition. The platform allows for the efficient synthesis of families of high molecular weight polymers in one step from readily available monomers.

  20. The effect of eicosapentaenoic and docosahexaenoic acid on protein synthesis and breakdown in murine C2C12 myotubes

    Energy Technology Data Exchange (ETDEWEB)

    Kamolrat, Torkamol [Musculoskeletal Research Programme, Institute of Medical Sciences, University of Aberdeen, AB25 2ZD (United Kingdom); Gray, Stuart R., E-mail: s.r.gray@abdn.ac.uk [Musculoskeletal Research Programme, Institute of Medical Sciences, University of Aberdeen, AB25 2ZD (United Kingdom)

    2013-03-22

    Highlights: ► EPA can enhance protein synthesis and retard protein breakdown in muscle cells. ► These effects were concurrent with increases in p70s6k and FOXO3a phosphorylation. ► EPA may be a useful tool in the treatment of muscle wasting conditions. -- Abstract: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been found to stimulate protein synthesis with little information regarding their effects on protein breakdown. Furthermore whether there are distinct effects of EPA and DHA remains to be established. The aim of the current study was to determine the distinct effects of EPA and DHA on protein synthesis, protein breakdown and signalling pathways in C2C12 myotubes. Fully differentiated C2C12 cells were incubated for 24 h with 0.1% ethanol (control), 50 μM EPA or 50 μM DHA prior to experimentation. After serum (4 h) and amino acid (1 h) starvation cells were stimulated with 2 mM L-leucine and protein synthesis measured using {sup 3}H-labelled phenylalanine. Protein breakdown was measured using {sup 3}H-labelled phenylalanine and signalling pathways (Akt, mTOR, p70S6k, 4EBP1, rps6 and FOXO3a) via Western blots. Data revealed that after incubation with EPA protein synthesis was 25% greater (P < 0.05) compared to control cells, with no effect of DHA. Protein breakdown was 22% (P < 0.05) lower, compared to control cells, after incubation with EPA, with no effect of DHA. Analysis of signalling pathways revealed that both EPA and DHA incubation increased (P < 0.05) p70s6k phosphorylation, EPA increased (P < 0.05) FOXO3a phosphorylation, with no alteration in other signalling proteins. The current study has demonstrated distinct effects of EPA and DHA on protein metabolism with EPA showing a greater ability to result in skeletal muscle protein accretion.