WorldWideScience

Sample records for benzamidine derivatives substituted

  1. Thermodynamic evaluation and modeling of proton and water exchange associated with benzamidine and berenil binding to ß-trypsin

    Directory of Open Access Journals (Sweden)

    M.T. Pereira

    2005-11-01

    Full Text Available Serine-proteases are involved in vital processes in virtually all species. They are important targets for researchers studying the relationships between protein structure and activity, for the rational design of new pharmaceuticals. Trypsin was used as a model to assess a possible differential contribution of hydration water to the binding of two synthetic inhibitors. Thermodynamic parameters for the association of bovine ß-trypsin (homogeneous material, observed 23,294.4 ± 0.2 Da, theoretical 23,292.5 Da with the inhibitors benzamidine and berenil at pH 8.0, 25ºC and with 25 mM CaCl2, were determined using isothermal titration calorimetry and the osmotic stress method. The association constant for berenil was about 12 times higher compared to the one for benzamidine (binding constants are K = 596,599 ± 25,057 and 49,513 ± 2,732 M-1, respectively; the number of binding sites is the same for both ligands, N = 0.99 ± 0.05. Apparently the driving force responsible for this large difference of affinity is not due to hydrophobic interactions because the variation in heat capacity (DCp, a characteristic signature of these interactions, was similar in both systems tested (-464.7 ± 23.9 and -477.1 ± 86.8 J K-1 mol-1 for berenil and benzamidine, respectively. The results also indicated that the enzyme has a net gain of about 21 water molecules regardless of the inhibitor tested. It was shown that the difference in affinity could be due to a larger number of interactions between berenil and the enzyme based on computational modeling. The data support the view that pharmaceuticals derived from benzamidine that enable hydrogen bond formation outside the catalytic binding pocket of ß-trypsin may result in more effective inhibitors.

  2. Synthesis and characterization of chiral thorium(IV) and uranium(IV) benzamidinate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Schoene, Sebastian; Maerz, Juliane; Kaden, Peter; Patzschke, Michael; Ikeda-Ohno, Atsushi [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Chemistry of the F-Elements

    2017-06-01

    Two chiral benzamidinate complexes of tetravalent actinides (Th(IV) and U(IV)) were synthesized using a salt metathesis reaction of the corresponding actinide(IV) tetrachlorides and the potassium salt of the chiral benzamidine (S,S)-N,N-Bis-(1-phenylethyl)-benzamidine ((S)-HPEBA). The structure of the complexes was determined with single crystal X-ray diffraction. These are the first examples of chiral amidinate complexes of actinides.

  3. Synthesis of 2-azetidinones substituted quinoline derivative

    Directory of Open Access Journals (Sweden)

    Mashelkar Uday C.

    2013-01-01

    Full Text Available Acetanilide is converted into 2-chloro-3-formyl quinoline by reacting with DMF-POCl3 at 80-90ºC and then condensed with aromatic primary amines to give Schiff bases (3a-3c. These Schiff bases are then reacted with acid chlorides in the presence of base in toluene to give 1, 3, 4-substituted 2-azetidinones.

  4. Potential radiosensitizing agents. 5. 2-Substituted benzimidazole derivatives

    International Nuclear Information System (INIS)

    Gupta, R.P.; Larroquette, C.A.; Agrawal, K.C.

    1982-01-01

    A series of 2-substituted benzimidazoles and their derivatives have been synthesized and tested for their ability to selectively sensitize hypoxic Chinese hamster cells (V-79) toward the lethal effect of ionizing radiation. These compounds were prepared by reacting the 2-substituted benzimidazoles with 1,2-epoxy-3-methoxypropane in the presence of potassium carbonate. Reaction of the 2-nitro and 2-methylfonyl analogue with the epoxide also yielded a cyclized material, which was confirmed to be a benzimidazo[2,1-b]oxazole. In an attempt to increase the electron affinity, 5- or 6-nitro-2-substituted-benzimidazoles were also synthesized and then reacted with the epoxide to yield the corresponding 1-substituted derivatives. The results of the biological tests for the radiosensitizing activity of these agents against Chinese hamster cells (V-79) in culture indicated that the 2-nitro-substituted analogues were the most effective sensitizers in this series

  5. Preparation of 7-substituted ginkgolide derivatives

    DEFF Research Database (Denmark)

    Vogensen, Stine Byskov; Strømgaard, Kristian; Shindou, Hideo

    2003-01-01

    alpha-fluoro ginkgolide B was equipotent to ginkgolide B underlining the critical importance of the 7-position of ginkgolides for PAF receptor activity. Herein we describe the synthesis of a series of ginkgolide B derivatives with modifications at the 7-position and the pharmacological evaluation...... of these derivatives as assayed by cloned PAF receptors. In two cases nucleophilic attack on a 7beta-O-triflate ginkgolide B did not lead to the expected products, but gave rise to two unprecedented ginkgolide derivatives, one with a novel rearranged skeleton. Furthermore, standard reduction of 7alpha-azido ginkgolide......-chloro ginkgolide B, the most potent nonaromatic ginkgolide derivative described to date with a K(i) value of 110 nM....

  6. SYNTHESIS OF SUBSTITUTED FLAVONE DERIVATIVES AS ...

    African Journals Online (AJOL)

    Preferred Customer

    Flavone (2-phenylchromone) derivatives are naturally occurring heterocyclic compound belongs to the flavanoid group. It showed significant role in pharmaceutical effects [1] including leishmanicidal activity, oviposter stimulant phytoalexins, anti-HIV, vasodilator, antiviral, anti- oxidants, bactericidal, DNA cleavage, ...

  7. Synthesis and biological evaluation of 2-substituted benzimidazole derivatives

    Directory of Open Access Journals (Sweden)

    Gurusamy Mariappan

    2015-09-01

    Full Text Available A novel series of 2-substituted benzimidazole derivatives (3a–3j were synthesized by the reaction of 2-chloro methyl benzimidazole with substituted primary aromatic amines. All the compounds were characterized by UV, IR, 1H NMR, mass spectral data and CHN elemental analysis. The synthesized derivatives were screened for analgesic and anti-inflammatory activities. All the compounds showed significant effect at 100 mg/kg p.o. and the experimental data are statistically significant at p < 0.01 level.

  8. Computational study of some benzamidine-based inhibitors of thrombin-like snake venom proteinases

    Science.gov (United States)

    Henriques, Elsa S.; Nascimento, Marco A. C.; Ramos, Maria João

    Pit viper venoms contain a number of serine proteinases that, despite their observed coagulant thrombin-like action in vitro, exhibit a paradoxical benign defibrinogenating (anticoagulant) action in vivo, with clinical applications in preventing thrombi and improved blood circulation. Considering that several benzamidine-based inhibitors, some highly selective to thrombin, also inhibit the enzymatic activity of such venombins, the modeling of their enzyme-inhibitor interactions could provide valuable information on the topological factors that determine the divergences in activity. The first step, and the object of the present study, was to derive the necessary set of parameters, consistent with the CHARMM force field, and to perform molecular dynamics (MD) simulations on a few selected representatives of the inhibitors in question under physiological conditions. Bonding and van der Waals parameters were derived by analogy to similar ones in the existing force field. Net atomic charges were obtained with a restrained fitting to the molecular electrostatic potential generated at B3LYP/6-31G(d) level. The parameters were refined to reproduce the available experimental geometries and crystal data, and the MD simulations of the free inhibitors in aqueous solution at 298 K provided an insightful description of their available conformational space.

  9. Synthesis, characterization and pharmacological evaluation of substituted phenoxy acetamide derivatives

    Directory of Open Access Journals (Sweden)

    Rani Priyanka

    2015-01-01

    Full Text Available A novel series of 2-(substituted phenoxy-N-(1,7,7-trimethylbicyclo[2.2.1]heptan-2-ylacetamide and N-(2-bromocyclohexyl-2-(substituted phenoxyacetamide derivatives having cyclohexyl nucleus as common in both types were synthesized and assessed for their anti-inflammatory activity by a carrageenan induced rat paw oedema method, analgesic activity by Eddy’s hot plate method and antipyretic activity by brewer’s yeast induced pyrexia method. All the novel derivatives have been synthesized by the reaction of camphor and similar ketone having cyclohexane nucleus (e.g. 2-bromocyclohexanone with ammonium carbonate and formic acid resulting in the formation of aromatic amines (1a-b. These amines on further chloroacetylation with chloroacetylchloride give compounds (2a-b. Compounds (2a-b are converted to 2-(substituted phenoxy-N-(1,7,7-trimethylbicyclo[2.2.1]heptan-2-yl acetamide and N-(2-bromocyclohexyl-2-(substituted phenoxyacetamide derivatives on treatment with substituted phenol. Among the series 3a-f, 3i, 3k, 3l compounds showed significant anti-inflammatory activity as compared to the standard drug diclofenac sodium and also compound 3a-f, 3h, 3j, 3k exhibit significant analgesic activity as compared to the standard drug. Compounds 3a-f and 3k showed antipyretic activity nearly to the standard drug indomethacin. Compounds 3a-f and 3k possess anti-inflammatory, analgesic and antipyretic activities near to the standard.

  10. Subpicosecond pulse radiolysis in liquid methyl-substituted benzene derivatives

    International Nuclear Information System (INIS)

    Okamoto, Kazumasa; Kozawa, Takahiro; Saeki, Akinori; Yoshida, Yoichi; Tagawa, Seiichi

    2007-01-01

    The early processes of radiation chemistry in the picosecond time region in methyl-substituted benzene derivatives have been investigated using subpicosecond pulse radiolysis. In o-xylene, a fairly slow geminate ion recombination was observed within 50 ps after the electron beam irradiation; this is due to the smaller electron mobility. The kinetic traces were analyzed using the Smoluchowski equation with exponential and modified-Gaussian (YGP) functions as the distribution of thermalized electrons. Only exponential functions well reproduced the experimental data within 50 ps after the electron pulse

  11. Amino acid derived 1,4-dialkyl substituted imidazolones

    DEFF Research Database (Denmark)

    Diness, Frederik; Meldal, Morten Peter

    2010-01-01

    A general method for synthesis of 1,4-substituted imidazolones from amino acids on solid support or in solution has been developed. Amino acid derived 3-Boc-(1,3)-oxazinane (Box) protected amino aldehyde building blocks were coupled through urea bonds to the amino terminal of dipeptides or amino...... acids. Upon acidic release, the aldehyde instantaneously formed the cyclic N-carbamyliminium ion, which rearranged to the corresponding imidazolone. Under strongly acidic conditions the imidazolones acted as nuclophiles in the Pictet-Spengler reaction....

  12. UV action spectroscopy of protonated PAH derivatives. Methyl substituted quinolines

    DEFF Research Database (Denmark)

    Klærke, Benedikte; Holm, Anne; Andersen, Lars Henrik

    2011-01-01

    using the electrostatic storage ring ELISA, an electrospray ion source and 3 ns UV laser pulses. Results. It is shown that the absorption profile is both redshifted and broadened when moving the methyl group from the heterocycle containing nitrogen to the homoatomic ring. The absorption profiles......Aims. We investigate the production of molecular photofragments upon UV excitation of PAH derivatives, relevant for the interstellar medium. Methods. The action absorption spectra of protonated gas-phase methyl-substituted quinolines (CH3−C9H7NH+) have been recorded in the 215–338 nm spectral range...

  13. Effects of Substitutions on the Biodegradation Potential of Benzotriazole Derivatives

    Science.gov (United States)

    Abu-Dalo, M. A.; O'Brien, I.; Hernandez, M. T.

    2018-02-01

    Fourteen benzotriazole derivatives were subjected to microcosm tests to study the influence of substitutions on their biodegradation potential. Methylated, nitrated, carboxylated, and propionated bezotriazoles, a heterocyclic triazole, as well as methylated benzimidazoles, were introduced to activated sludge and soil enrichment cultures as the only carbon source. Some of the enrichment cultures were derived from airport soils that had been previously contaminated with aircraft deicing fluids and subsequently enriched with the commercially significant corrosion inhibitor methylbenzotriazole. The 5-methylbenzotriazole and only the carboxylated derivatives were degraded by soil or activated sludge biomass regardless of acclimation conditions. Radiotracer studies of [U-14C] 5-methylbenzotriazole, and [U-14C] 5-carboxybenzotriazole confirmed that relatively high concentrations (25mg L-1) of these derivatives can be completely mineralized in relatively short time frames by microbial consortia regardless of prior exposure. Observations suggested that the growth yield on these compounds is likely low. Biodegradation patterns suggested that carboxylated benzotriazole derivatives are more readily biodegradable than their more popular methylated counterparts.

  14. Conformational Network and Residence Time Estimation of Trypsin-Benzamidine Unbinding Pathways

    OpenAIRE

    Dickson, Alex; Lotz, Samuel D.

    2016-01-01

    In this poster we present results from molecular dynamics sampling of benzamidine unbinding from trypsin. We give background on the weighted ensemble technique used (WExplore) and the Markovian state model construction. Our network shows three unique unbinding pathways including a never before observed unbinding pathway. We also estimate residence time to within one order of magnitude to the experimental value.

  15. Biochemical response of Anticarsia gemmatalis fed with soybean plants pulverized with the synthetic trypsin inhibitor benzamidine

    International Nuclear Information System (INIS)

    Oliveira, M.G.A.; Pilon, A.M.; Pilon, F.M.; Ribeiro, F.R.; Silva, F.C.; Ribon, A.O.B.; Reis, A.P.; Visotto, L.E.; Guedes, R.N.C.; Oliveira, J.A.

    2008-01-01

    Full text: Insects are responsible for severe crop losses. New alternatives for pest control other than agrochemicals have been investigated. Protease inhibitors are one of the prime candidates effective against insect pests. In this work we studied the effect of the synthetic trypsin inhibitor benzamidine on the development of Anticarsia gemmatalis, an important pest of the soybean culture. Larvae were reared on soybean plants containing 0.00, 0.15, 0.30, 0.45, 0.60 and 0.75% (w/w) of benzamidine. After 6, 12, 24 and 48 h of feeding midgut extracts were prepared and assayed for enzymatic activity (proteolytic, amidasic and stearic). Benzamidine altered the activity patterns but was not able to totally abolish enzyme activity. The proteolytic, amidasic and stearic activity showed the higher time of inhibition in 48 h in concentration of 0,75%, the inhibition was the around 93%, 63.1% and 36.6%, respectively. We suggest that the presence of inhibitor has made insects to adapt and produce proteases which are insensitive to the action of benzamidine. (author)

  16. Biochemical response of Anticarsia gemmatalis fed with soybean plants pulverized with the synthetic trypsin inhibitor benzamidine

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, M.G.A.; Pilon, A.M.; Pilon, F.M.; Ribeiro, F.R.; Silva, F.C.; Ribon, A.O.B.; Reis, A.P.; Visotto, L.E. [Universidade Federal de Vicosa (UFV), Belo Horizonte, MG (Brazil). Dept. de Bioquimica e Biologia Molecular; Guedes, R.N.C. [Universidade Federal de Vicosa (UFV), Belo Horizonte, MG (Brazil). Dept. de Biologia Animal; Oliveira, J.A. [Universidade Federal de Vicosa (UFV), Belo Horizonte, MG (Brazil). Dept. de Quimica

    2008-07-01

    Full text: Insects are responsible for severe crop losses. New alternatives for pest control other than agrochemicals have been investigated. Protease inhibitors are one of the prime candidates effective against insect pests. In this work we studied the effect of the synthetic trypsin inhibitor benzamidine on the development of Anticarsia gemmatalis, an important pest of the soybean culture. Larvae were reared on soybean plants containing 0.00, 0.15, 0.30, 0.45, 0.60 and 0.75% (w/w) of benzamidine. After 6, 12, 24 and 48 h of feeding midgut extracts were prepared and assayed for enzymatic activity (proteolytic, amidasic and stearic). Benzamidine altered the activity patterns but was not able to totally abolish enzyme activity. The proteolytic, amidasic and stearic activity showed the higher time of inhibition in 48 h in concentration of 0,75%, the inhibition was the around 93%, 63.1% and 36.6%, respectively. We suggest that the presence of inhibitor has made insects to adapt and produce proteases which are insensitive to the action of benzamidine. (author)

  17. Photophysical investigation of cyano-substituted terrylenediimide derivatives.

    Science.gov (United States)

    Kennes, Koen; Baeten, Yannick; Vosch, Tom; Sempels, Wouter; Yordanov, Stoyan; Stappert, Sebastian; Chen, Long; Müllen, Klaus; Hofkens, Johan; Van der Auweraer, Mark; Fron, Eduard

    2014-12-18

    Two new terrylenediimide (TDI) chromophores with cyano substituents in the bay and core area (BCN-TDI and OCN-TDI, respectively) have been characterized by a wide range of techniques, and their applicability for stimulated emission depletion (STED) microscopy has been tested. By cyano substitution an increase of the fluorescence quantum yield and a decrease of the nonradiative rate constant is achieved and attributed to a reduced charge-transfer character of the excited state due to a lower electron density of the TDI core. For BCN-TDI, the substitution in the bay area induces a strong torsional twist in the molecule which, similar to phenoxy bay-perylenediimide (PDI), has a strong effect on the fluorescence lifetime but appears to prevent the aggregation that is observed for OCN-TDI. The single-molecule photobleaching stability of BCN- and OCN-TDI is lower than that of a reference TDI without cyano substitution (C7-TDI), although less so for OCN-TDI. The photophysical properties of the excited singlet state are only slightly influenced by the cyano groups. The observed intense stimulated emission, the pump-dump-probe experiments, and STED single-molecule imaging indicate that STED experiments with the cyano-substituted TDIs are possible. However, because of aggregation and more efficient photobleaching, the performance of BCN- and OCN-TDI is worse than that of the reference compound without cyano groups (C7-TDI). Bay-substituted TDIs are less suitable for STED microscopy.

  18. Biological relevance and synthesis of C-substituted morpholine derivatives

    NARCIS (Netherlands)

    Wijtmans, R.; Vink, M.K.S.; Schoemaker, H.E.; Delft, F.L. van; Blaauw, R.H.; Rutjes, F.P.J.T.

    2004-01-01

    C-Functionalized morpholines are found in a variety of natural products and biologically active compounds, but have also for other reasons been applied in organic synthesis. This review deals with the biological relevance of C-substituted morpholines, their synthesis and important applications in

  19. Synthesis of Substituted α-Trifluoromethyl Piperidinic Derivatives

    Directory of Open Access Journals (Sweden)

    Sarah Rioton

    2017-03-01

    Full Text Available A comprehensive survey of pathways leading to the generation of α-trifluoromethyl monocyclic piperidinic derivatives is provided (65 references. These compounds have been synthesized either from 6-membered rings e.g., pipecolic acid or lactam derivatives by introduction a trifluoromethyl group, from pyridine or pyridinone derivatives by reduction, and from 5-membered rings e.g., prolinol derivatives by ring expansion, from linear amines by cyclization or from dienes/dienophiles by [4 + 2]-cycloaddition.

  20. Multicomponent One-Pot Synthesis of Substituted Hantzsch Thiazole Derivatives Under Solvent Free Conditions

    Directory of Open Access Journals (Sweden)

    Bhaskar S. Dawane

    2009-01-01

    Full Text Available Thiazole derivatives were prepared by one-pot procedure by the reaction of α-haloketones, thiourea and substituted o-hydroxybenzaldehyde under environmentally solvent free conditions.

  1. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  2. N-6 substituted deoxygenated derivatives of L-like 5'-noraristeromycin

    African Journals Online (AJOL)

    Several N-6 substituted derivatives (4-11) of (+)-4'-deoxy-5'-noraristeromycin (2) and its unsaturated counterpart (3) have been prepared. The derivatives are designed to systematically vary the hydrophobic/hydrophilic balance of the lead compounds. These compounds were evaluated against a large number of viruses but ...

  3. Banana-shaped molecules derived from substituted isophthalic acids

    Indian Academy of Sciences (India)

    In this paper we present a review of five-rings banana-shaped molecules derived from isophthalic acids. This study deals with about a hundred compounds and most of them have not been published. By a combination of several linking groups and different selected substituents either on the outer rings or on the central core ...

  4. Structural investigations of substituted indolizine derivatives by NMR studies

    International Nuclear Information System (INIS)

    Furdui, Bianca; Dinica, Rodica; Demeunynck, Martine; Druta, Ioan

    2008-01-01

    Owing to the increasing importance of indolizine heterocycles in the field of biology and pharmacology we have synthesized and investigated the obtained heterocycles by NMR techniques. In order to investigate the substituent effects on the spectroscopic properties, a series of indolizine derivatives were studied by 1 H-NMR, 13 C-NMR and 2D NMR (GCOSY, GHMBC and GHMQC spectra). (authors)

  5. Evaluation of substituted ebselen derivatives as potential trypanocidal agents.

    Science.gov (United States)

    Gordhan, Heeren M; Patrick, Stephen L; Swasy, Maria I; Hackler, Amber L; Anayee, Mark; Golden, Jennifer E; Morris, James C; Whitehead, Daniel C

    2017-02-01

    Human African trypanosomiasis is a disease of sub-Saharan Africa, where millions are at risk for the illness. The disease, commonly referred to as African sleeping sickness, is caused by an infection by the eukaryotic pathogen, Trypanosoma brucei. Previously, a target-based high throughput screen revealed ebselen (EbSe), and its sulfur analog, EbS, to be potent in vitro inhibitors of the T. brucei hexokinase 1 (TbHK1). These molecules also exhibited potent trypanocidal activity in vivo. In this manuscript, we synthesized a series of sixteen EbSe and EbS derivatives bearing electron-withdrawing carboxylic acid and methyl ester functional groups, and evaluated the influence of these substituents on the biological efficacy of the parent scaffold. With the exception of one methyl ester derivative, these modifications ablated or blunted the potent TbHK1 inhibition of the parent scaffold. Nonetheless, a few of the methyl ester derivatives still exhibited trypanocidal effects with single-digit micromolar or high nanomolar EC 50 values. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Synthesis and Analgesic Properties of Lidocaine Derivatives with Substituted Aminobenzothiazoles.

    Science.gov (United States)

    Ahmadi, Abbas; Khalili, Mohsen; Mohammadinoude, Mohammad Kazem; Nahri-Niknafs, Babak

    2016-01-01

    Local anesthetics are the most widely consumed drugs in the practice of medicine which provide a loss of sensation in a certain body part without loss of consciousness or impairment of central control of essential functions. Lidocaine (I) is the most commonly local anaesthetic drug which is widely used in all species due to its fabulous diffusing and penetrating properties as well as prompt onset of surgical analgesia. In this study, new aminobenzothiazole (with many useful biological and pharmacological properties) analogues were synthesized by changing of amine moiety of I. Both acute and chronic pain properties of new compounds (II-VI) were studied by using the tail immersion and formalin tests on mice and the outcomes were compared with control and lidocaine groups. According to the results, aminobenzothiazole derivatives are better candidates than diethylamine group for replacement on amine moiety of I. Also, derivatives with electron-withdrawing groups on this amine (V and VI) could decrease pain better than electron-donating ones (II and III) (specially on position 6 of this amine, II and V) which may be of concern for blockade of specific sodium channels by these new compounds.

  7. Synthesis of New Cytotoxic Aminoanthraquinone Derivatives via Nucleophilic Substitution Reactions

    Directory of Open Access Journals (Sweden)

    Hasimah Alimon

    2013-07-01

    Full Text Available Aminoanthraquinones were successfully synthesized via two reaction steps. 1,4-Dihydroxyanthraquinone (1 was first subjected to methylation, reduction and acylation to give an excellent yield of anthracene-1,4-dione (3, 1,4-dimethoxyanthracene-9,10-dione (5 and 9,10-dioxo-9,10-dihydroanthracene-1,4-diyl diacetate (7. Treatment of 1, 3, 5 and 7 with BuNH2 in the presence of PhI(OAc2 as catalyst produced seven aminoanthraquinone derivatives 1a, b, 3a, and 5a–d. Amination of 3 and 5 afforded three new aminoanthraquinones, namely 2-(butylaminoanthracene-1,4-dione (3a, 2-(butylaminoanthracene-9,10-dione (5a and 2,3-(dibutylaminoanthracene-9,10-dione (5b. All newly synthesised aminoanthraquinones were examined for their cytotoxic activity against MCF-7 (estrogen receptor positive human breast and Hep-G2 (human hepatocellular liver carcinoma cancer cells using MTT assay. Aminoanthraquinones 3a, 5a and 5b exhibited strong cytotoxicity towards both cancer cell lines (IC50 1.1–13.0 µg/mL.

  8. Synthesis and Fungicidal activity of some sulphide derivatives of O-Ethyl-N-substituted phenylcarbamates

    International Nuclear Information System (INIS)

    Imeokparia, F.A.

    2006-01-01

    Monosulphides of O-ethyl-N-substituted phenylcarbamates were prepared by the reaction between O-ethyl-N-substituted phenylcarbamates and sulphur dichloride, while the corresponding disulphides were prepared by the reaction between O-ethyl-N-substituted phenylcarbamates and sulphur monochloride. The synthesized compounds were characterized by elemental analysis, thin layer chromatography (TLC), Fourier-transform infrared, and /sup 1/H and /sup 13/C nuclear magnetic resonance spectroscopic techniques. In vitro fungicidal assay of these sulphides against Fusarium oxysporum, Aspergillus niger, Aspergillus flavus and Rhizopus stolonifer showed that they had Greater fungicidal activity than their parent carbamates. The synthesized sulphides were more active towards A. Niger and A. flavus. Unlike the parent carbamates, the type of substituents attached to the aromatic nucleus of these sulphides had little or no effect on their fungicidal activity as there was insignificant variation in the fungicidal activity of the monosulphide and the disulphide derivatives of O-ethyl-N-substituted phenylcarbamates. (author)

  9. Antiseptic Effects of New 3'-N-Substituted Carbazole Derivatives In Vitro and In Vivo.

    Science.gov (United States)

    Lee, Wonhwa; Kwak, Soyoung; Yun, Eunju; Lee, Jee Hyun; Na, MinKyun; Song, Gyu-Yong; Bae, Jong-Sup

    2015-08-01

    Inhibition of high-mobility group box 1 (HMGB1) protein and restoration of endothelial integrity are emerging as attractive therapeutic strategies in the management of sepsis. Here, new five structurally related 3'-N-substituted carbazole derivatives were examined for their effects on lipopolysaccharide (LPS)-mediated or cecal ligation and puncture (CLP)-mediated release of HMGB1 and on modulation of HMGB1-mediated inflammatory responses. We accessed this question by monitoring the effects of posttreatment carbazole derivatives on LPS- and CLP-mediated release of HMGB1 and HMGB1-mediated regulation of proinflammatory responses in human umbilical vein endothelial cells (HUVECs) and septic mice. The new 3'-N-substituted carbazole derivatives 1-5 inhibited the release of HMGB1 and downregulated HMGB1-dependent inflammatory responses in human endothelial cells. New compounds also inhibited HMGB1-mediated hyperpermeability and leukocyte migration in mice. In addition, treatment with each compound reduced CLP-induced release of HMGB1 and sepsis-related mortality and pulmonary injury in mice. These results indicate that the new 3'-N-substituted carbazole derivatives could be candidate therapeutic agents for various severe vascular inflammatory diseases owing to their inhibition of the HMGB1 signaling pathway.

  10. Optical properties of new 5-(4-phenylethynyl)-substituted-1,10-phenanthroline derivatives

    International Nuclear Information System (INIS)

    Guerin, Juliette; Aronica, Christophe; Boeuf, Gaelle; Chauvin, Jerome; Moreau, Juliette; Lemercier, Gilles

    2011-01-01

    The synthesis and optical properties of a novel family of 5-substituted-1,10-phenanthroline derivatives are reported herein. One carbon-carbon triple-bond function was introduced using a Sonogashira cross-coupling reaction. The effects on optical properties, of the substitution with electro-withdrawing or -donating substituents in the 5th position of the 1,10-phenanthroline are investigated. Experimental chemical structure-polarisability relationship is analyzed according to the Lippert-Mataga correlation and compared to a theoretical study carried out with DFT calculations. These compounds are promising candidates for a fine-tuning of the internal charge-transfers but also as potential nonlinear chromophores and ligands within multifunctional coordination complexes. - Highlights: → Synthesis and optical properties of new 5-substituted-1,10-phenanthroline derivatives. → Sonogashira reaction was used for the substitution. → Structure-polarisability relationship analyzed according to Lippert-Mataga correlation. → Theoretical study was carried out with DFT calculations. → Fine-tuning of the internal charge-transfers within nonlinear compounds.

  11. Copper-catalyzed aerobic oxidative C-H functionalization of substituted pyridines: synthesis of imidazopyridine derivatives.

    Science.gov (United States)

    Yu, Jipan; Jin, Yunhe; Zhang, Hao; Yang, Xiaobo; Fu, Hua

    2013-12-02

    A novel, efficient, and practical method for the synthesis of imidazopyridine derivatives has been developed through the copper-catalyzed aerobic oxidative C-H functionalization of substituted pyridines with N-(alkylidene)-4H-1,2,4-triazol-4-amines. The procedure occurs by cleavage of the N-N bond in the N-(alkylidene)-4H-1,2,4-triazol-4-amines and activation of an aryl C-H bond in the substituted pyridines. This is the first example of the preparation of imidazopyridine derivatives by using pyridines as the substrates by transition-metal-catalyzed C-H functionalization. This method should provide a novel and efficient strategy for the synthesis of other nitrogen heterocycles. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Synthetic Methods and Exploring Biological Potential of Various Substituted Quinoxalin-2-one Derivatives

    OpenAIRE

    Mohammad Asif

    2016-01-01

    Substituted quinoxaline have considerable interest in chemistry, biology and pharmacology. Quinoxaline derivatives are capable with variety of biological activities and possess different biological activities, of which the most potent are anti-microbial, analgesic and anti-inflammatory activities. It facilitated the researchers to develop various methods for their synthesis and their applications. In this review represented different methods of synthesis, reactivity and various biological act...

  13. Synthesis and solar-cell applications of novel furanyl-substituted anthracene derivatives

    Science.gov (United States)

    Kivrak, Arif; Er, Ömer Faruk; Kivrak, Hilal; Topal, Yasemin; Kuş, Mahmut; Çamlısoy, Yesim

    2017-11-01

    At present, novel furanyl-substituted anthracene derivatives; namely 9,10-di(furan-2-yl)anthracene (DFA), 5,5‧-(anthracene-9,10-diyl)bis(furan-2-carbaldehyde) (DAFA) and 2,2‧-((5,5‧-(anthracene-9,10-diyl)bis(furan-5,2-diyl))bis(methanylylidene))dimalononitrile (DCNFA) were designed and synthesized successfully by employing Stille Cross-Coupling, Vilsmeier-Haack and Knoevenagel condensation reactions, respectively. This methodology provides a practical new route for the synthesis of furanyl-substituted anthracene derivatives bearing strong electron-withdrawing groups. The electrochemical and electro-optical properties of these novel furanyl-substituted anthracene derivatives were also examined with strong acceptor-π-donor-π-acceptor interactions. Furthermore, Highest occupied molecular orbital (HOMO), Lowest Unoccupied molecular orbital (LUMO), and band gap (Eg) values were investigated by using spectroscopic methods. Electrochemical and electro-optical properties were calculated and compared to DFA, DAFA and DCNFA. Eg was found as 2.85, 2.71, and 2.33 eV, respectively. Consequently, Organic Solar Cells (OSC) were fabricated to investigate their solar cell performances. The strong electron withdrawing groups did not increase the solar cell performance of furanyl-anthracenes. Surprisingly, DFA was found to exhibit the best OSCs performance (Efficiency = 3.36). As a result, one could note that these novel furanyl-substituted anthracene derivatives are good candidate for the applications of the OSCs. Our results might help in the development of new materials with important electrochemical functions by giving the advantage of designing and further derivatization of new generation small organic molecules for photovoltaic device applications.

  14. Synthesis of substituted 1-metallyl derivatives of o- and m-carboranes and some their transformations

    International Nuclear Information System (INIS)

    Kovredov, A.I.; Shemyakin, N.F.; Zakharkin, L.I.

    1985-01-01

    Synthesis of 1-metallyl substituted o- and m- carbonates is carried out, and alkylation of benzene by them is investigated. Synthesis with 30-95% yield has been carried out by the reaction of lithium derivatives with metallylchloride in the ester-benzene solution. The reaction of benzene alkylation is studied in the presence of aluminium chloride and H 2 SO 4 . Reaction mechanisms are considered

  15. Synthesis and Analgesic Activity of Novel Derivatives of 1,2-Substituted Benzimidazoles

    Directory of Open Access Journals (Sweden)

    Shobhit Srivastava

    2013-01-01

    Full Text Available A series of novel 2-phenylhydrazinomethyl and 2-(2-hydroxyphenyl-benzimidazole derivatives substituted at the N1-position of benzimidazole nucleus were synthesized as well as screened for analgesic activity. Some of these compounds showed promising analgesic activity when compared with the standard drug diclofenac sodium. The incorporation of a phenylhydrazinomethyl nucleus at 2-position of benzimidazole compound gave a biologically active pharmacophore.

  16. SYNTHESIS AND EVALUATION OF NEW PHTHALAZINE SUBSTITUTED β-LACTAM DERIVATIVES AS CARBONIC ANHYDRASE INHIBITORS.

    Science.gov (United States)

    Berber, Nurcan; Arslan, Mustafa; Bilen, Çiğdem; Sackes, Zübeyde; Gençer, Nahit; Arslan, Oktay

    2015-01-01

    A new series of phthalazine substituted β-lactam derivatives were synthesized and their inhibitory effects on the activity of purified human carbonic anhydrase (hCA I and II) were evaluated. 2H-Indazolo[2,1-b]phthala- zine-trione derivative was prepared with 4-nitrobenzaldehyde, dimedone, and phthalhydrazide in the presence of TFA in DMF, and the nitro group was reduced to 13-(4-aminophenyl)-3,3-dimethyl-3,4-dihydro- 2H-indazolo[1,2-b]phthalazine-1,6,11(13H)-trione with SnCl2 · 2H2O. The reduced compound was re- acted with different aromatic aldehydes, and phthalazine substituted imines were synthesized. The imine compounds undergo (2+2) cycloaddition reactions with ketenes to produce 2H-indazolo[2,1-b]phthala-zine-trione substituted β-lactam derivatives. The β-lactam compounds were tested as inhibitors of the CA isoenzyme activity. The results showed that all the synthesized compounds inhibited the CA isoenzyme activity. 1-(4-(3,3-dimethyl- 1,6,1 1-trioxo-2,3,4,6,11,13-hexahydro-1H-indazolo[1,2-b]phthalazin-13- yl)phenyl)-2-oxo-4-p-tolylazetidin-3-yl acetate (IC50 = 6.97 µM for hCA I and 8.48 µM for hCA II) had the most inhibitory effect.

  17. Chemical Synthesis and Biological Activities of Novel Pleuromutilin Derivatives with Substituted Amino Moiety

    Science.gov (United States)

    Shang, Ruofeng; Wang, Shengyu; Xu, Ximing; Yi, Yunpeng; Guo, Wenzhu; YuLiu; Liang, Jianping

    2013-01-01

    Novel pleuromutilin derivatives designed based on the structure of valnemulin were synthesized and evaluated for their in vitro antibacterial activities. These pleuromutilin derivatives with substituted amino moiety exhibited excellent activities against methicillin-resistant Staphylococcus aureus, methicillin-resistant Staphylococcus epidermidis, Escherichia coli, and Streptococcus agalactiae. Compound 5b showed the highest antibacterial activities and even exceeded tiamulin. Moreover, the docking experiments provided information about the binding model between the synthesized compounds and peptidyl transferase center (PTC) of 23S rRNA. PMID:24376551

  18. Chemical synthesis and biological activities of novel pleuromutilin derivatives with substituted amino moiety.

    Directory of Open Access Journals (Sweden)

    Ruofeng Shang

    Full Text Available Novel pleuromutilin derivatives designed based on the structure of valnemulin were synthesized and evaluated for their in vitro antibacterial activities. These pleuromutilin derivatives with substituted amino moiety exhibited excellent activities against methicillin-resistant Staphylococcus aureus, methicillin-resistant Staphylococcus epidermidis, Escherichia coli, and Streptococcus agalactiae. Compound 5b showed the highest antibacterial activities and even exceeded tiamulin. Moreover, the docking experiments provided information about the binding model between the synthesized compounds and peptidyl transferase center (PTC of 23S rRNA.

  19. Synthesis of D-fructose-derived spirocyclic 2-substituted-2-oxazoline ribosides

    Directory of Open Access Journals (Sweden)

    Madhuri Vangala

    2015-11-01

    Full Text Available The TMSOTf-mediated synthesis of β-configured spirocyclic 2-substituted-2-oxazoline ribosides was achieved using a “Ritter-like” reaction in toluene through nucleophilic addition of electron-rich nitriles to the oxacarbenium ion intermediate of 1,2;3,4-di-O-isopropylidene-β-D-psicofuranose derivatives with concomitant intramolecular trapping of the C2 hydroxymethyl group on the electrophilic nitrilium carbon. These carbohydrate-derived spirooxazolines are stable and were obtained in good yield with high stereoselectivity due to the conformational rigidity imparted by the 3,4-isopropylidene group.

  20. Computational Study on Substituted s-Triazine Derivatives as Energetic Materials

    Directory of Open Access Journals (Sweden)

    Vikas D. Ghule

    2012-01-01

    Full Text Available s-Triazine is the essential candidate of many energetic compounds due to its high nitrogen content, enthalpy of formation and thermal stability. The present study explores s-triazine derivatives in which different -NO2, -NH2 and -N3 substituted azoles are attached to the triazine ring via C-N linkage. The density functional theory is used to predict geometries, heats of formation and other energetic properties. Among the designed compounds, -N3 derivatives show very high heats of formation. The densities for designed compounds were predicted by using the crystal packing calculations. Introduction of -NO2 group improves density as compared to -NH2 and -N3, their order of increasing density can be given as NO2>N3>NH2. Analysis of the bond dissociation energies for C-NO2, C-NH2 and C-N3 bonds indicates that substitutions of the -N3 and -NH2 group are favorable for enhancing the thermal stability of s-triazine derivatives. The nitro and azido derivatives of triazine are found to be promising candidates for the synthetic studies.

  1. Synthesis and Structural Characterization of 1- and 2-Substituted Indazoles: Ester and Carboxylic Acid Derivatives

    Directory of Open Access Journals (Sweden)

    Isabel Bento

    2006-11-01

    Full Text Available A series of indazoles substituted at the N-1 and N-2 positions with ester-containing side chains -(CH2nCO2R of different lengths (n = 0-6, 9, 10 are described.Nucleophilic substitution reactions on halo esters (X(CH2nCO2R by 1H-indazole inalkaline solution lead to mixtures of N-1 and N-2 isomers, in which the N-1 isomerpredominates. Basic hydrolysis of the ester derivatives allowed the synthesis of thecorresponding indazole carboxylic acids. All compounds were fully characterised bymultinuclear NMR and IR spectroscopies, MS spectrometry and elemental analysis; theNMR spectroscopic data were used for structural assignment of the N-1 and N-2 isomers.The molecular structure of indazol-2-yl-acetic acid (5b was determined by X-raydiffraction, which shows a supramolecular architecture involving O2-H...N1intermolecular hydrogen bonds.

  2. Synthesis of Various Polyaniline / Clay Nanocomposites Derived from Aniline and Substituted Aniline Derivatives by Mechanochemical Intercalation Method

    Directory of Open Access Journals (Sweden)

    N. Kalaivasan

    2010-01-01

    Full Text Available Polyaniline clay nanocomposite can be prepared by mechano-chemical method in which intercalation of anilinium ion into the clay lattices accomplished by mechanical grinding of sodium montmorillonite (Na+MMT in presence of anilinium hydrochloride at room temperature using mortar & pestle for about 30 min and subsequent grinding with oxidizing agent, ammonium peroxysulfate. The appearance of green colour indicates the formation of polyaniline/clay nanocomposite (PANI/Clay. Similarly aniline derivatives like o-toludine and o-anisidine in the form of HCl salt can form intercalation into the clay lattices. The intercalated aniline derivatives were ground mechanically in presence of oxidizing agent ammonium peroxysulfate lead to formation of substituted polyaniline/ clay nanocomposites. The characteristics of various polyaniline-clay nanocomposites were investigated using UV-Visible, FT-IR, cyclic voltammetry studies.

  3. Noval 1-substituted-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazole derivatives: Synthesis and pharmacological activity

    Directory of Open Access Journals (Sweden)

    Sabir Hussain

    2015-05-01

    Full Text Available Several-1-carbothioamide-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazoles 2a–d, 1-(pyridine-4-ylcarbonyl-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazoles 3a–d, 1-(5-chloro-6-fluoro-1,3-benzothiazole-2-ylthiocarbamoyl-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazoles 4a–d and 1-[(1,2,4-triazole-4-yl carbothioamide]-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazoles 5a–d were synthesized. The structures of the newly synthesized compounds were supported by IR, 1H NMR and mass spectral data. These compounds were investigated for their, anti-inflammatory, analgesic, ulcerogenic, lipid peroxidation, antibacterial and antifungal activities. Some of the synthesized compounds showed potent anti-inflammatory activity along with minimal ulcerogenic effect and lipid peroxidation, compared to ibuprofen and flurbiprofen. Some of the tested compounds also showed moderate antimicrobial activity against tested bacterial and fungal strains.

  4. Correction: Synthesis of pyrrolidine-3-carboxylic acid derivatives via asymmetric Michael addition reactions of carboxylate-substituted enones.

    Science.gov (United States)

    Yin, Feng; Garifullina, Ainash; Tanaka, Fujie

    2018-04-25

    Correction for 'Synthesis of pyrrolidine-3-carboxylic acid derivatives via asymmetric Michael addition reactions of carboxylate-substituted enones' by Feng Yin et al., Org. Biomol. Chem., 2017, 15, 6089-6092.

  5. Substitution pattern elucidation of hydroxypropyl Pinus pinaster (Ait.) bark polyflavonoid derivatives by ESI(-)-MS/MS.

    Science.gov (United States)

    García Marrero, Danny E; Glasser, Wolfgang G; Pizzi, Antonio; Paczkowski, Sebastian; Laborie, Marie-Pierre G

    2014-10-01

    The structure of condensed tannins (CTs) from Pinus pinaster bark extract and their hydroxypropylated derivatives with four degrees of substitution (DS 1, 2, 3 and 4) has been characterized for the first time using negative-ion mode electrospray ionization tandem mass spectrometry (ESI(-)-MS/MS). The results showed that P. pinaster bark CTs possess structural homogeneity in terms of monomeric units (C(15), catechin). The oligomer sizes were detected to be dimers to heptamers. The derivatives showed typical phenyl-propyl ether mass fragmentation by substituent elimination (58 amu) and inherent C(15) flavonoid fissions. The relative abundance of the product ions revealed a preferential triple, tetra-/penta- and octa- hydroxypropylation substitution pattern in the monomer, dimer and trimer derivatives, respectively. A defined order of -OH reactivity towards propylene oxide was established by means of multistage experiments (A-ring ≥ B-ring > C-ring). A high structural heterogeneity of the modified oligomers was detected. Copyright © 2014 John Wiley & Sons, Ltd.

  6. Crystallographic characterization of single-ortho, N-substituted acetanilide derivatives

    International Nuclear Information System (INIS)

    Boeyens, J.C.A.; Denner, L.; Painter, S.; Staskun, B.

    1987-01-01

    The crystal and molecular structures of the three single-ortho, N-substituted amide derivatives, acet-2'-bromo-N-(p-nitrobenzyl)anilide, 3',5'-dimethyl-N-ethyl-2,2,2',4'-tetrachlorobenzoylacetanilide, and difluoro[(1-phenyl-2-(o-ethylphenyl-N-benzylcarbamoyl)vinyl)oxy]borane, have been determined by X-ray diffraction analysis. In each case, the amide carbonyl group was found in the exo-conformation, independent of the nature of the acyl group. The observed conformations correlate well with solution structures, inferred from n.m.r. data

  7. Synthesis and antiproliferative activity of novel limonene derivatives with a substituted thiourea moiety

    International Nuclear Information System (INIS)

    Figueiredo, Isis M.; Santos, Luciane V. dos; Costa, Willian F. da; Silva, Cleuza C. da; Sarragiotto, Maria H.; Carvalho, Joao E. de; Sacoman, Juliana L.; Kohn, Luciana K.

    2006-01-01

    A series of R-(+)-limonene derivatives bearing a substituted thiourea moiety (3-13) and five S-methyl analogs (14-18) were synthesized and evaluated for their in vitro antiproliferative activity against human cancer cell lines. Compounds bearing aromatic substituents (3-6) exhibit cytostatic activity in the full panel of cell lines tested, with GI 50 values in the range of 2.5 to 24 μmol L -1 . Compounds 3, 10, 12 and 16 were the most active with GI 5 )0 values in the range of 0.41 to 3.0 μmol L -1 , against different cell lines. (author)

  8. Natural derivatives of diphenolic acid as substitutes for bisphenol-A

    Science.gov (United States)

    Ertl, Johanna; Cerri, Elisa; Rizzuto, Matteo; Caretti, Daniele

    2014-05-01

    Diphenolic acid had been originally used in the first epoxy resins and was later on forgotten as it was substituted by the cheaper bisphenol A. But in the recent years major health concerns have been raised as bisphenol A has a pseudo-hormonal effect on the body, playing the role of estrogen it can cause a severe impact on the organism, especially in males. Moreover it is produced from acetone and phenol, both from fossil, and thus limited resources. On the contrary, diphenolic acid is synthesized from levulinic acid and phenol. Levulinic acid being directly produced by hydrolysis of biomass. By substituting the fossil phenol with natural phenols from lignin or plant extraction we are able to synthesize a fully renewable substitute for bisphenol A. The reactions to yield an epoxy resin have been examined and the reactivity with epichlorohydrin is satisfying. Moreover, some of the derivatives of diphenolic acid have interesting curing properties and preliminary results show excellent properties of the cured resin, including thermal stability and pencil hardness.

  9. Synthesis and Biological Evaluation of Novel 2-Methoxypyridylamino-Substituted Riminophenazine Derivatives as Antituberculosis Agents

    Directory of Open Access Journals (Sweden)

    Dongfeng Zhang

    2014-04-01

    Full Text Available Clofazimine, a member of the riminophenazine class, is one of the few antibiotics that are still active against multidrug-resistant Mycobacterium tuberculosis (M. tuberculosis. However, the clinical utility of this agent is limited by its undesirable physicochemical properties and skin pigmentation potential. With the goal of maintaining potent antituberculosis activity while improving physicochemical properties and lowering skin pigmentation potential, a series of novel riminophenazine derivatives containing a 2-methoxypyridylamino substituent at the C-2 position of the phenazine nucleus were designed and synthesized. These compounds were evaluated for antituberculosis activity against M. tuberculosis H37Rv and screened for cytotoxicity. Riminophenazines bearing a 3-halogen- or 3,4-dihalogen-substituted phenyl group at the N-5 position exhibited potent antituberculosis activity, with MICs ranging from 0.25~0.01 μg/mL. The 3,4-dihalogen- substituted compounds displayed low cytotoxicity, with IC50 values greater than 64 μg/mL. Among these riminophenazines, compound 15 exhibited equivalent in vivo efficacy against M. tuberculosis infection and reduced skin discoloration potential in an experimental mouse infection model as compared to clofazimine. Compound 15, as compared to clofazimine, also demonstrated improved physicochemical properties and pharmacokinetic profiles with a short half-life and less drug tissue accumulation. This compound is being evaluated as a potential drug candidate for the treatment of multidrug resistant tuberculosis.

  10. Basicity comparison for di-substituted 4-nitropyridine derivatives in polar non-aqueous media

    International Nuclear Information System (INIS)

    Gurzynski, Lukasz; Puszko, Aniela; Chmurzynski, Lech

    2007-01-01

    Acid dissociation, as well as cationic homoconjugation equilibria have been studied potentiometrically in systems involving four di-substituted 4-nitropyridines and conjugate cationic acids in the polar non-aqueous solvents - aprotic protophobic acetonitrile (AN) and propylene carbonate (PC), the amphiprotic methanol (MeOH), and in the aprotic protophilic dimethyl sulfoxide (DMSO). The influence of solvent effect on the obtained acidity constants has been discussed. The acidity constants (expressed as pK a values) were compared with those previously determined in another polar protophobic aprotic solvent - acetone (AC), and obtained for the unsubstituted pyridine (Py). A comparison of the acid dissociation constants determined in all media studied has proved that the strength of the cationic acids increases on going from acetonitrile through propylene carbonate, acetone, and methanol to dimethyl sulfoxide. Furthermore, the values of acidity constants in the non-aqueous media have shown that in all the solvents studied they change according to the substituent effects. It has been also found that substituted 4-nitropyridine derivatives studied exhibit no tendency towards cationic homoconjugation in acetonitrile, propylene carbonate, and methanol and dimethyl sulfoxide. Moreover, it has been demonstrated that the acid dissociation constants determined by potentiometric titration method in all the solutions investigated correlate well with the calculated energy parameters of the protonation reactions in the gaseous phase

  11. Basicity comparison for di-substituted 4-nitropyridine derivatives in polar non-aqueous media

    Energy Technology Data Exchange (ETDEWEB)

    Gurzynski, Lukasz [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Puszko, Aniela [Department of Organic Chemistry, School of Economics, Wroclaw (Poland); Chmurzynski, Lech [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland)], E-mail: lech@chemik.chem.univ.gda.pl

    2007-12-15

    Acid dissociation, as well as cationic homoconjugation equilibria have been studied potentiometrically in systems involving four di-substituted 4-nitropyridines and conjugate cationic acids in the polar non-aqueous solvents - aprotic protophobic acetonitrile (AN) and propylene carbonate (PC), the amphiprotic methanol (MeOH), and in the aprotic protophilic dimethyl sulfoxide (DMSO). The influence of solvent effect on the obtained acidity constants has been discussed. The acidity constants (expressed as pK{sub a} values) were compared with those previously determined in another polar protophobic aprotic solvent - acetone (AC), and obtained for the unsubstituted pyridine (Py). A comparison of the acid dissociation constants determined in all media studied has proved that the strength of the cationic acids increases on going from acetonitrile through propylene carbonate, acetone, and methanol to dimethyl sulfoxide. Furthermore, the values of acidity constants in the non-aqueous media have shown that in all the solvents studied they change according to the substituent effects. It has been also found that substituted 4-nitropyridine derivatives studied exhibit no tendency towards cationic homoconjugation in acetonitrile, propylene carbonate, and methanol and dimethyl sulfoxide. Moreover, it has been demonstrated that the acid dissociation constants determined by potentiometric titration method in all the solutions investigated correlate well with the calculated energy parameters of the protonation reactions in the gaseous phase.

  12. Silica-Supported Polyphosphoric Acid in the Synthesis of 4-Substituted Tetrahydroisoquinoline Derivatives

    Directory of Open Access Journals (Sweden)

    Iliyan Ivanov

    2013-02-01

    Full Text Available We report herein an application of an α-amidoalkylation reaction, as an alternative efficient synthesis of 4-aryl- and 4-methyl-1,2,3,4-tetrahydroisoquinoline derivatives. The amides required for this purpose would result from reaction of aminoacetaldehyde dimethylacetal with different substituted benzenes in polyphosphoric acid, followed by acylation of the obtained amines with different acid chlorides or sulfochlorides. We compared the cyclisation step using conventional (milieu of acetic-trifluoracetic acid = 4:1 and solid supported reagents (SiO2/PPA, as recovered, regenerated and reused without loss of its activity catalyst. We found that in comparison to conventional methods, the yields of the reaction are greater and the reaction time is shorter.

  13. Nonpeptidic angiotensin II AT₁ receptor antagonists derived from 6-substituted aminocarbonyl and acylamino benzimidazoles.

    Science.gov (United States)

    Zhang, Jun; Wang, Jin-Liang; Yu, Wei-Fa; Zhou, Zhi-Ming; Tao, Wen-Chang; Wang, Yi-Cheng; Xue, Wei-Zhe; Xu, Di; Hao, Li-Ping; Han, Xiao-Feng; Fei, Fan; Liu, Ting; Liang, Ai-Hua

    2013-11-01

    Both 6-substituted aminocarbonyl and acylamino benzimidazole derivatives were designed and synthesized as nonpeptidic angiotensin II AT₁ receptor antagonists. Compounds 6f, 6g, 11e, 11f, 11g, and 12 showed nanomolar AT₁ receptor binding affinity and high AT₁ receptor selectivity over AT₂ receptor in a preliminary pharmacological evaluation. Among them, the two most active compounds 6f (AT₁ IC₅₀ = 3 nM, AT₂ IC₅₀ > 10,000 nM, PA₂ = 8.51) and 11g (AT₁ IC₅₀ = 0.1 nM, AT₂ IC₅₀ = 149 nM, PA₂ = 8.43) exhibited good antagonistic activity in isolated rabbit aortic strip functional assay. In addition, they were orally active AT₁ receptor antagonists in spontaneous hypertensive rats. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. Photo-fragmentation behavior of methyl- and methoxy-substituted derivatives of hexa-peri-hexabenzocoronene (HBC) cations

    Science.gov (United States)

    Zhen, Junfeng; Castellanos, Pablo; Linnartz, Harold; Tielens, Alexander G. G. M.

    2016-11-01

    A systematic study, using ion trap time-of-flight mass spectrometry, is presented for the photo-fragmentation of methyl- and methoxy-substituted derivatives of HBC cations, (OCH3)6HBC+ and (CH3)4(OCH3)2HBC+. Both substituted HBC cations fragment through sequential loss of CH3CO units upon laser (595nm) irradiation, resulting in a PAH-like derivative C36H12+ and a methyl-substituted PAH derivative C44H24+ , respectively. Upon ongoing irradiation, these species further fragment. For lower laser energy C44H24+ dehydrogenates and photo-fragments through CH3 and CHCH2 unit losses; for higher laser energy isomerization takes place, yielding a regular PAH-like configuration, and both stepwise dehydrogenation and C2/C2H2 loss pathways are found. C36H12+ follows largely this latter fragmentation scheme upon irradiation. It is concluded that the photo-dissociation mechanism of the substituted PAH cations studied here is site selective in the substituted subunit. This work also shows experimental evidence that photo-fragmentation of substituted PAHs may contribute to the formation in space of smaller species that are normally considered to form by merging atoms and molecules.

  15. [Glycosilated derivatives of substituted hydroxylamine. II. Phase transfer synthesis and investigation of glycosyl transfer reaction of glucosaminides of substituted hydroxylavine].

    Science.gov (United States)

    Kur'ianov, V O; Lushchik, A A; Chupakhina, T A

    2013-01-01

    1-(2-Acetamido-3,4,6,-tri-O-acetyl-2-deoxy-beta-D-glucopyranosyloxy)-benzotriazole reacted in boiling dichloromethane, in the presence of Luis acids as a promotors with primary and secondary aliphatic and cycloaliphatic alcohols and diisopropilidene galactose with alkyl-O-1,2-trans-glucosaminides formation. It was shown that the other glucosaminides of substituted hydroxylamine are not participated in this reaction. Structures of glucosaminides were identify by 1H-NMR-spectroscopy and comparison with known compounds.

  16. Pyridine-substituted thiazolylphenol derivatives: Synthesis, modeling studies, aromatase inhibition, and antiproliferative activity evaluation.

    Science.gov (United States)

    Ertas, Merve; Sahin, Zafer; Berk, Barkin; Yurttas, Leyla; Biltekin, Sevde N; Demirayak, Seref

    2018-04-01

    Drugs used in breast cancer treatments target the suppression of estrogen biosynthesis. During this suppression, the main goal is to inhibit the aromatase enzyme that is responsible for the cyclization and structuring of estrogens either with steroid or non-steroidal-type inhibitors. Non-steroidal derivatives generally have a planar aromatic structure attached to the triazole ring system in their structures, which inhibits hydroxylation reactions during aromatization by coordinating the heme group. Bioisosteric replacement of the triazole ring system and development of aromatic/cyclic structures of the side chain can increase the selectivity for aromatase enzyme inhibition. In this study, pyridine-substituted thiazolylphenol derivatives, which are non-steroidal triazole bioisosteres, were synthesized using the Hantzsch method, and physical analysis and structural determination studies were performed. The IC 50 values of the compounds were determined by a fluorescence-based aromatase inhibition assay. Then, their antiproliferative activities on the MCF7 and HEK 293 cell lines were evaluated with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Furthermore, the crystal structure of human placental aromatase was subjected to a series of docking experiments to identify the possible interactions between the most active structure and the active site. Lastly, an in silico technique was performed to analyze and predict the drug-likeness, molecular and ADME properties of the synthesized molecules. © 2018 Deutsche Pharmazeutische Gesellschaft.

  17. Emitting materials based on phenylanthracene-substituted naphthalene derivatives for organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyun Woo; Kim, Hye Jeong; Kim, Young Seok; Kim, Jwajin [Department of Chemistry, Sungkyunkwan University, Suwon 440‐746 (Korea, Republic of); Lee, Song Eun; Lee, Ho Won [Department of Information Display, Hongik University, Seoul 121-791 (Korea, Republic of); Kim, Young Kwan, E-mail: kimyk@wow.hongik.ac.kr [Department of Information Display, Hongik University, Seoul 121-791 (Korea, Republic of); Yoon, Seung Soo, E-mail: ssyoon@skku.edu [Department of Chemistry, Sungkyunkwan University, Suwon 440‐746 (Korea, Republic of)

    2015-09-15

    This study reports the emitting materials based on phenylanthracene-substituted naphthalene derivatives to achieve efficient electroluminescent properties for OLED applications. An OLED device using 4,4′-bis(10-phenylanthracen-9-yl)-1,1′-binaphthalene exhibited the blue emission with the CIE coordinates of (0.19, 0.16) and efficient electroluminescent properties with the luminance, power and external quantum efficiency of 1.70 cd/A, 0.79 lm/W and 1.26% at 20 mA/cm{sup 2}, respectively. Also, the other device using 1,4-bis(10-phenylanthracene-9-yl)naphthalene exhibited white emission with the CIE coordinates of (0.34, 0.43) at 7V, respectively. This device exhibits the luminance, power and external quantum efficiency of 2.22 cd/A, 1.13 lm/W and 0.86% at 20 mA/cm{sup 2}, respectively. - Highlights: • We synthesized fluorescent materials based on phenylanthracene derivatives. • Electroluminescence properties of these materials depend on the molecular structures. • These blue and white materials have great potential for application in OLEDs.

  18. Design, Synthesis and Evaluation of N13-Substituted Evodiamine Derivatives against Human Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Senchuan Song

    2013-12-01

    Full Text Available Attempting to improve the anticancer activity and solubility of evodiamine in simulated gastric fluid (SGF and simulated intestinal fluid (SIF solutions, thirty-eight N13-substituted evodiamine derivatives were designed, synthesized and tested for antitumor activities against six kinds of human cancer cell lines, namely prostate cancer (DU-145 and PC-3, lung cancer (H460, breast cancer (MCF-7, colon cancer (HCT-5 and glioblastoma (SF-268. The solubility of these compounds in SGF and SIF solutions was evaluated, and apoptosis induced by 2-2, 2-3, 2-16 and 3-2 was determined. The results showed: (1 among all compounds examined, 2-16 showed the highest antitumor activity and a broader spectrum of activity, with IC50 values ranging from 1–2 µM; (2 their solubility was obviously improved; (3 2-3, 2-16 and 3-2 had a significant impact inducing apoptosis in some cancer cell lines. The preliminary structure-activity relationships of these derivatives were discussed.

  19. Emitting materials based on phenylanthracene-substituted naphthalene derivatives for organic light-emitting diodes

    International Nuclear Information System (INIS)

    Lee, Hyun Woo; Kim, Hye Jeong; Kim, Young Seok; Kim, Jwajin; Lee, Song Eun; Lee, Ho Won; Kim, Young Kwan; Yoon, Seung Soo

    2015-01-01

    This study reports the emitting materials based on phenylanthracene-substituted naphthalene derivatives to achieve efficient electroluminescent properties for OLED applications. An OLED device using 4,4′-bis(10-phenylanthracen-9-yl)-1,1′-binaphthalene exhibited the blue emission with the CIE coordinates of (0.19, 0.16) and efficient electroluminescent properties with the luminance, power and external quantum efficiency of 1.70 cd/A, 0.79 lm/W and 1.26% at 20 mA/cm 2 , respectively. Also, the other device using 1,4-bis(10-phenylanthracene-9-yl)naphthalene exhibited white emission with the CIE coordinates of (0.34, 0.43) at 7V, respectively. This device exhibits the luminance, power and external quantum efficiency of 2.22 cd/A, 1.13 lm/W and 0.86% at 20 mA/cm 2 , respectively. - Highlights: • We synthesized fluorescent materials based on phenylanthracene derivatives. • Electroluminescence properties of these materials depend on the molecular structures. • These blue and white materials have great potential for application in OLEDs

  20. Induction of discrete apoptotic pathways by bromo-substituted indirubin derivatives in invasive breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Nicolaou, Katerina A. [Department of Biological Sciences, University of Cyprus, Nicosia (Cyprus); Liapis, Vasilis; Evdokiou, Andreas [Department of Surgery, Basil Hetzel Institute, Adelaide University, Adelaide (Australia); Constantinou, Constantina [St. George' s University of London Medical School at the University of Nicosia, Nicosia (Cyprus); Magiatis, Prokopios; Skaltsounis, Alex L. [Faculty of Pharmacy, University of Athens, Athens (Greece); Koumas, Laura; Costeas, Paul A. [Center for Study of Hematological Malignancies, Nicosia (Cyprus); Constantinou, Andreas I., E-mail: andreasc@ucy.ac.cy [Department of Biological Sciences, University of Cyprus, Nicosia (Cyprus)

    2012-08-17

    Highlights: Black-Right-Pointing-Pointer The effects of 6BIO and 7BIO are evaluated against five breast cancer cell lines. Black-Right-Pointing-Pointer 6BIO induces a caspase dependent apoptotic effect via the intrinsic pathway. Black-Right-Pointing-Pointer 7BIO promotes G{sub 2}/M cells cycle arrest. Black-Right-Pointing-Pointer 7BIO triggers a caspase-8 mediated apoptotic pathway. Black-Right-Pointing-Pointer 7BIO triggers and a caspase independent pathway. -- Abstract: Indirubin derivatives gained interest in recent years for their anticancer and antimetastatic properties. The objective of the present study was to evaluate and compare the anticancer properties of the two novel bromo-substituted derivatives 6-bromoindirubin-3 Prime -oxime (6BIO) and 7-bromoindirubin-3 Prime -oxime (7BIO) in five different breast cancer cell lines. Cell viability assays identified that 6BIO and 7BIO are most effective in preventing the proliferation of the MDA-MB-231-TXSA breast cancer cell line from a total of five breast cancer cell lined examined. In addition it was found that the two compounds induce apoptosis via different mechanisms. 6BIO induces caspase-dependent programmed cell death through the intrinsic (mitochondrial) caspase-9 pathway. 7BIO up-regulates p21 and promotes G{sub 2}/M cell cycle arrest which is subsequently followed by the activation of two different apoptotic pathways: (a) a pathway that involves the upregulation of DR4/DR5 and activation of caspase-8 and (b) a caspase independent pathway. In conclusion, this study provides important insights regarding the molecular pathways leading to cell cycle arrest and apoptosis by two indirubin derivatives that can find clinical applications in targeted cancer therapeutics.

  1. Synthesis of selected 5-thio-substituted tetrazole derivatives and evaluation of their antibacterial and antifungal activities

    Directory of Open Access Journals (Sweden)

    NALILU SUCHETHA KUMARI

    2011-02-01

    Full Text Available Several 5-thio-substituted tetrazole derivatives were efficiently synthesized by a three-step process. The substituted tetrazol-5-thiol, namely, 1-benzyl-1H-tetrazole-5-thiol (2 was prepared by refluxing commercially available benzyl isothiocyanate (1 with sodium azide in water. The second step was the synthesis of 1-benzyl-5-[(3-bromopropylthio]-1H-tetrazole (3 by thioalkylation of tetrazole-5-thiol 2 with 1,3-dibromopropane in tetrahydrofuran. Finally, the 5-thio-substituted tetrazole derivatives 4a–i were prepared by condensation of 3 with the corresponding amine or thiol. The structures of the newly synthesized compounds were characterized by NMR, LC/MS/MS, IR spectral data and elemental analysis. All the synthesized compounds were screened for their antibacterial and antifungal activities.

  2. Novel Substituted Heteroaromatic Piperazine and Piperidine Derivatives as Inhibitors of Human Enterovirus 71 and Coxsackievirus A16

    Directory of Open Access Journals (Sweden)

    Xian Zhang

    2013-04-01

    Full Text Available A series of substituted heteroaromatic piperazine and piperidine derivatives were found through virtual screening based on the structure of human enterovirus 71 capsid protein VP1. The preliminary biological evaluation revealed that compounds 8e and 9e have potent activity against EV71 and Coxsackievirus A16 with low cytotoxicity.

  3. Synthesis and Biological Activity of Some 3, 5-Diarylisoxazoline Derivatives: Reaction of Substituted Chalcones with Hydroxylamine Hydrochloride

    Directory of Open Access Journals (Sweden)

    Vandana Sharma

    2010-01-01

    Full Text Available A series of 3-aryl-5-styrylisoxazoline/ 3,5-diarylisoxazoline derivatives were synthesized by the reaction of appropriately substituted chalcones and hydroxylamine hydrochloride in presence of alkali in ethanol. The synthesized heterocycles have been characterized on the basis of their chemical properties and spectroscopic data. These compounds were tested for biological activity against a variety of test organisms

  4. Paracetamol, 3-monoalkyl- and 3,5-dialkyl-substituted derivatives. Antioxidant activity and relationship between lipid peroxidation and cytotoxicity

    NARCIS (Netherlands)

    Van de Straat, R; Bijloo, G.J.; Vermeulen, N P

    1988-01-01

    The analgesic drug paracetamol is known to cause lipid peroxidation and hepatotoxicity after overdosage. In this paper, the relationship between lipid peroxidation and toxicity in freshly isolated hepatocytes was studied using paracetamol and three 3-monoalkyl-substituted derivatives of paracetamol.

  5. Novel 5-Fluorouracil Derivatives: Synthesis and Cytotoxic Activity of 2-Butoxy-4-Substituted 5-Fluoropyrimidines

    International Nuclear Information System (INIS)

    Sun, Jian; Zhou, Wei; Hu, Weixiao; Shan, Shang; Zhang, Shijie; Li, Haibo

    2013-01-01

    Twenty two new 5-fluorouracil (5-FU) derivatives, 2-butoxy-4-substituted 5-fluoropyrimidines, were synthesized and characterized by IR, 1 H NMR, MS, HRMS. All compounds were preliminarily evaluated by MTT assay on human liver BEL-7402 cancer cell line in vitro. Ten compounds were selected to test their cytotoxic activity against A549, HL-60 and MCF-7 cancer cell lines in vitro. These compounds were more sensitive to BEL-7402 than other cell lines, particularly, cytotoxic activity of compounds 6b, 6d-f, 6p, 6s-u were in sub-micromolar scale. The highest cytotoxic potency against A549, HL-60 and MCF-7 was shown by 2-butoxy-4-chloro-5-fluoropyrimidine (5) with IC 50 values of 0.10, 1.66 and 0.59 μM, respectively. Compounds 6d and 6e were effective against MCF-7 with IC 50 9.73 μM and HL-60 with IC 50 8.83 μM, respectively

  6. Progesterone radioimmunoassay with the use of progesterone derivative substituted at 12α position

    International Nuclear Information System (INIS)

    Kula, E.; Stupnicka, R.

    1981-01-01

    A direct (non-extraction) radioimmunoassay method for progesterone determination in blood plasma has been presented. A new progesterone derivative substituted at 12α position was used as antigen for production of antibody. Cheap and easily accessible substrate -deoxycholic acid - was used as starting material for 9 step degradation procedure yielding 12α-hydroxy-progesterone. The latter compound was subsequently esterified with succinic anhydrine and conjugated with bovine serum albumin. The conjugate was then used for the immunization of rabbits to obtain immune antisera. After the detailed characterization, the obtained antibodies have been used for the determination of progesterone in human and cattle blood plasma. Transcortin present in samples used for the determinations was saturated with the excess of cortisol. The sensitivity of the method was found to be 5 pg in a sample, which corresponds to the concentration of about 0.25 ng/ml in blood plasma, in as much as the volume of plasma used for analysis was 20 ml. The within-series error was 7% when progesterone concentration in plasma samples was higher than 2.5 ng/ml. (author)

  7. Design, synthesis, and herbicidal activity of novel substituted 3-(pyridin-2-yl)benzenesulfonamide derivatives.

    Science.gov (United States)

    Xie, Yong; Chi, Hui-Wei; Guan, Ai-Ying; Liu, Chang-Ling; Ma, Hong-Juan; Cui, Dong-Liang

    2014-12-31

    A series of novel substituted 3-(pyridin-2-yl)benzenesulfonamide derivatives were designed and synthesized using 2-phenylpridines as the lead compound by intermediate derivatization methods in an attempt to obtain novel compound candidates for weed control. The herbicidal activity assay in glasshouse tests showed several compounds (II6, II7, II8, II9, II10, II11, III2, III3, III4, and III5) could efficiently control velvet leaf, youth-and-old age, barnyard grass, and foxtail at the 37.5 g/ha active substance. Especially, the activities of II6, II7, III2, and III4 were proved roughly equivalent to the saflufenacil and better than 95% sulcotrione at the same concentration. The result of the herbicidal activity assay in field tests demonstrated that II7 at 60 g/ha active substance could give the same effect as bentazon at 1440 g/ha active substance to control dayflower and nightshade, meanwhile II7 showed better activity than oxyfluorfen to control arrowhead and security to rice. The present work indicates that II7 may be a novel compound candidate for potential herbicide.

  8. Design, synthesis and inhibitory activities of 8-(substituted styrol-formamido)phenyl-xanthine derivatives on monoamine oxidase B.

    Science.gov (United States)

    Hu, Suwen; Nian, Siyun; Qin, Kuiyou; Xiao, Tong; Li, Lingna; Qi, Xiaolu; Ye, Faqing; Liang, Guang; Hu, Guoxin; He, Jincai; Yu, Yinfei; Song, Bo

    2012-01-01

    The design and synthesis of two series of 8-(substituted styrol-formamido)phenyl-xanthine derivatives are described. Their in vitro monoamine oxidase B (MAO-B) inhibition were tested and the effect of substituents on the N-7, phenyl and the substituted positions are discussed. It was observed that compound 9b displayed significant MAO-B inhibition activity and selectivity, fluorine substitution plays a key role in the selectivity of MAO-B inhibition, and the styrol-formamido group at position-3' may enhance the activity and selectivity of 8-phenyl-xanthine analogues. These results suggest that such compounds may be utilized for the development of new candidate MAO-B inhibitors for treatment of Parkinson's disease.

  9. Srtucture and properties of intracomplexes of 2-substituted 8-mercaptoquinoline derivatives

    International Nuclear Information System (INIS)

    Sturis, A.P.; Bankovskij, Yu.A.; Pech, L.Ya.

    1990-01-01

    The results of investigation of the molecular and crystal structure of 2-substituted 8-mercaptoquinoline internal complexes (in particular complexes of cadmium and indium) have been reviewed. Substitution of hydrogen atom in o-position in relation to the nitrogen atom in the ligand molecule causes the steric hindrance in the molecules of complexes. Due to it the changes in structure of the central atom coordination center in the MR 2 complexes from the planar (8-mercaptoquinolinates) to the distored tetrahedral (2-substituted 8-mercaptoquinolinates) occur. The ascertainment of such effect allows to explain the changes in physicochemical properties of 2-substituted 8-mercaptoquinolinates (hypsochromic shift of absorption maxima, decrease of the amount of ligands connected to the central atom, decrease of stability, increase of solubility in organic solvents) in comparison with 8-mercaptoquinolinates

  10. Asymmetric syntheses of 3,4-disubstituted tetrahydroquinoline derivatives using (+)- sparteine-mediated electrophilic substitution

    International Nuclear Information System (INIS)

    Choi, Yun Soo; Kang, Kyoung Hee; Park, Yong Sun

    2015-01-01

    Tetrahydroquinolines bearing substituents are frequently found as a substructure in a number of alkaloids and natural products. Since their individual stereoisomers displays different biological activities, it is desirable to develop a highly stereoselective synthetic method for tetrahydroquinolines. While some progress has recently been made toward the development of asymmetric synthetic methods for tetrahydroquinolines, it is still a challenging topic in organic synthesis. In order to investigate the source of diastereoselection attained in the substitution reaction with a racemic epoxide, we examined the substitution of 2 with an excess amount of racemic p-chlorophenyl-substituted oxirane. We have developed a novel method for the asymmetric synthesis of trans-3,4-diaryl-substituted tetrahy- droquinolines from ortho-substituted N-pivaloyl anilines. The enantioselective process includes (+)-sparteine-mediated stereoselective lithiati on, kinetic resolution of epoxides in substitution, and stereospecific Mitsu nobu cyclization as the key reactions. The simple protocol can provide highly functionalized tetrahydroqu inoline rings and would allow their further functionalization to access more complex target molecules

  11. Asymmetric syntheses of 3,4-disubstituted tetrahydroquinoline derivatives using (+)- sparteine-mediated electrophilic substitution

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Yun Soo; Kang, Kyoung Hee; Park, Yong Sun [Dept. of Chemistry, Konkuk University, Seoul (Korea, Republic of)

    2015-05-15

    Tetrahydroquinolines bearing substituents are frequently found as a substructure in a number of alkaloids and natural products. Since their individual stereoisomers displays different biological activities, it is desirable to develop a highly stereoselective synthetic method for tetrahydroquinolines. While some progress has recently been made toward the development of asymmetric synthetic methods for tetrahydroquinolines, it is still a challenging topic in organic synthesis. In order to investigate the source of diastereoselection attained in the substitution reaction with a racemic epoxide, we examined the substitution of 2 with an excess amount of racemic p-chlorophenyl-substituted oxirane. We have developed a novel method for the asymmetric synthesis of trans-3,4-diaryl-substituted tetrahy- droquinolines from ortho-substituted N-pivaloyl anilines. The enantioselective process includes (+)-sparteine-mediated stereoselective lithiati on, kinetic resolution of epoxides in substitution, and stereospecific Mitsu nobu cyclization as the key reactions. The simple protocol can provide highly functionalized tetrahydroqu inoline rings and would allow their further functionalization to access more complex target molecules.

  12. The inhibition performance of long-chain alkyl-substituted benzimidazole derivatives for corrosion of mild steel in HCl

    International Nuclear Information System (INIS)

    Zhang, Dongqin; Tang, Yongming; Qi, Sijun; Dong, Dawei; Cang, Hui; Lu, Gang

    2016-01-01

    Highlights: • Inhibition performance of long-chain alkyl-substituted benzimidazole. • Benzimidazole segment donating electrons to metal surface. • Non-polar long chain enhancing inhibition by the barrier effect. • Molecular form of DBI more tightly adsorbs on the steel than its protonated form. - Abstract: The corrosion inhibition of a new benzimidazole derivative, 6-(dodecyloxy)-1H-benzo[d]imidazole (DBI), for mild steel in 1 M HCl was investigated in this paper. Computational chemistry was performed to explore the adsorption of DBI on metal surface. Inhibition performance of DBI is attributed to both the direct interaction of benzimidazole segment with iron surface and the barrier effect of the non-polar long chain against aggressive solution. Compared to the protonated form, the molecular form of DBI could more tightly interact with iron surface. These results show that the long-chain alkyl-substituted benzimidazole derivative is of great potential application as corrosion inhibitor.

  13. Novel N-substituted aminobenzamide scaffold derivatives targeting the dipeptidyl peptidase-IV enzyme

    Directory of Open Access Journals (Sweden)

    Al-Balas QA

    2014-01-01

    Full Text Available Qosay A Al-Balas,1 Munia F Sowaileh,1 Mohammad A Hassan,1 Amjad M Qandil,1,2 Karem H Alzoubi,3 Nizar M Mhaidat,3 Ammar M Almaaytah,4 Omar F Khabour51Department of Medicinal Chemistry and Pharmacognosy, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid, Jordan; 2Pharmaceutical Sciences Department, College of Pharmacy, King Saud bin Abdulaziz University for Health Sciences, Riyadh, Saudi Arabia; 3Department of Clinical Pharmacy, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid, Jordan; 4Department of Pharmaceutical Technology, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid, Jordan; 5Department of Medical Laboratory Sciences, Faculty of Applied Medical Sciences, Jordan University of Science and Technology, Irbid, JordanBackground: The dipeptidyl peptidase-IV (DPP-IV enzyme is considered a pivotal target for controlling normal blood sugar levels in the body. Incretins secreted in response to ingestion of meals enhance insulin release to the blood, and DPP-IV inactivates these incretins within a short period and stops their action. Inhibition of this enzyme escalates the action of incretins and induces more insulin to achieve better glucose control in diabetic patients. Thus, inhibition of this enzyme will lead to better control of blood sugar levels.Methods: In this study, computer-aided drug design was used to help establish a novel N-substituted aminobenzamide scaffold as a potential inhibitor of DPP-IV. CDOCKER software available from Discovery Studio 3.5 was used to evaluate a series of designed compounds and assess their mode of binding to the active site of the DPP-IV enzyme. The designed compounds were synthesized and tested against a DPP-IV enzyme kit provided by Enzo Life Sciences. The synthesized compounds were characterized using proton and carbon nuclear magnetic resonance, mass spectrometry, infrared spectroscopy, and determination of melting point.Results: Sixty

  14. Microwave Assisted Synthesis of N-Arylheterocyclic Substituted-4-aminoquinazoline Derivatives

    Directory of Open Access Journals (Sweden)

    Ping Lu

    2006-04-01

    Full Text Available A simple, efficient, and general method has been developed for the synthesis of various N-aryl heterocylic substituted-4-aminoquinazoline compounds from 4-chloro- quinazoline and aryl heterocyclic amines under microwave irradiation using 2-propanol as solvent. The advantages of the use of microwave irradiation in relation to the classical method were demonstrated.

  15. Novel fluoroquinolone derivatives bearing N-thiomide linkage with 6-substituted-2-aminobenzothiazoles: Synthesis and antibacterial evaluation

    Directory of Open Access Journals (Sweden)

    Prabodh Chander Sharma

    2017-02-01

    Full Text Available A series of novel fluoroquinolone derivatives bearing N-thiomide linkage with 6-substituted-2-aminobenzothiazole substituents at the C-7 position were synthesized to obtain potent analogs active against bacterial strains. Some compounds exhibited excellent antibacterial activity against Staphylococcus auerus, Escherichia coli, Bacillus subtilis, Pseudomonas aeruginosa bacterial strains. Among all the synthesized compounds 6-nitro substituted benzothiazole along with norfloxacin (4b and gatifloxacin (4l showed MIC 05 μg/ml when tested against S. auerus. Moreover, compounds 4d, 4f and 4l showed superior MIC (15, 10, and 15 μg/ml respectively against B. subtilis. The results of the present study reveal that the compounds have significant antibacterial potential and are suitable candidates for further exploration.

  16. Design, Synthesis and Optoelectronic Properties of Unsymmetrical Oxadiazole Based Indene Substituted Derivatives as Deep Blue Fluoroscent Materials.

    Science.gov (United States)

    Belavagi, Ningaraddi S; Deshapande, Narahari; Pujar, G H; Wari, M N; Inamdar, S R; Khazi, Imtiyaz Ahmed M

    2015-09-01

    A series of novel unsymmetrically substituted indene-oxadiazole derivatives (3a-f) have been designed and synthesized by employing palladium catalysed Suzuki cross coupling reaction in high yields. The structural integrity of all the novel compounds was established by (1)H, (13)C NMR and LC/MS analysis. These compounds are amorphous in nature and are remarkably stable to long term storage under ambient conditions. The optoelectronic properties have been studied in detail using UV-Vis absorption and Fluorescence spectroscopy. All compounds emit intense blue to green-blue fluoroscence with high quantum yields. Time resolved measurments have shown life times in the range of 1.28 to 4.51 ns. The density functional theory (DFT) calculations were carried out for all the molecules to understand their structure-property relationships. Effect of concentration studies has been carried out in different concentrations for both absorption and emission properties and from this we have identified the optimized fluoroscence concentrations for all these compounds. The indene substituted anthracene-oxadiazole derivative (3f) showed significant red shift (λmax (emi) = 490 nm) and emits intense green-blue fluoroscence with largest stokes shift of 145 nm. This compound also exhibited highest fluoroscence life time (τ) of 4.51 ns, which is very close to the standard dye coumarin-540A (4.63 ns) and better than fluorescein-548 (4.10 ns). The results demonstrated that the novel unsymmetrical indene-substituted oxadiazole derivatives could play important role in organic optoelectronic applications, such as organic light-emitting diodes (OLEDs) or as models for investigating the fluorescent structure-property relationship of the indene-functionalized oxadiazole derivatives.

  17. Effect of five-membered ring and heteroatom substitution on charge transport properties of perylene discotic derivatives: A theoretical approach

    Energy Technology Data Exchange (ETDEWEB)

    Navarro, Amparo, E-mail: anavarro@ujaen.es; Fernández-Liencres, M. Paz; Peña-Ruiz, Tomás; Granadino-Roldán, José M.; Fernández-Gómez, Manuel [Departamento de Química Física y Analítica, Universidad de Jaén, Campus Las Lagunillas, E23071 Jaén (Spain); García, Gregorio [Instituto de Energía Solar and Departamento TFB, E.T.S.I. Telecomunicación, Universidad Politécnica de Madrid, Ciudad Universitaria, Madrid 28040 (Spain)

    2016-08-07

    Density functional theory calculations were carried out to investigate the evolvement of charge transport properties of a set of new discotic systems as a function of ring and heteroatom (B, Si, S, and Se) substitution on the basic structure of perylene. The replacement of six-membered rings by five-membered rings in the reference compound has shown a prominent effect on the electron reorganization energy that decreases ∼0.2 eV from perylene to the new carbon five-membered ring derivative. Heteroatom substitution with boron also revealed to lower the LUMO energy level and increase the electron affinity, therefore lowering the electron injection barrier compared to perylene. Since the rate of the charge transfer between two molecules in columnar discotic systems is strongly dependent on the orientation of the stacked cores, the total energy and transfer integral of a dimer as a disc is rotated with respect to the other along the stacking axis have been predicted. Aimed at obtaining a more realistic approach to the bulk structure, the molecular geometry of clusters made up of five discs was fully optimized, and charge transfer rate and mobilities were estimated for charge transport along a one dimensional pathway. Heteroatom substitution with selenium yields electron transfer integral values ∼0.3 eV with a relative disc orientation of 25°, which is the preferred angle according to the dimer energy profile. All the results indicate that the tetraselenium-substituted derivative, not synthetized so far, could be a promising candidate among those studied in this work for the fabrication of n-type semiconductors based on columnar discotic liquid crystals materials.

  18. Pyridine substituted spirofluorene derivative as an electron transport material for high efficiency in blue organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Soon Ok; Yook, Kyoung Soo; Lee, Jun Yeob, E-mail: leej17@dankook.ac.k

    2010-11-01

    The quantum efficiency of blue fluorescent organic light-emitting diodes was enhanced by 20% using a pyridine substituted spirofluorene-benzofluorene derivative as an electron transport material. 2',7'-Di(pyridin-3-yl)spiro[benzofluorene-7,9'-fluorene] (SPBP) was synthesized and it was used as the electron transport material to block the hole leakage from the emitting layer. The improvement of the quantum efficiency and power efficiency of the blue fluorescent organic light-emitting diodes using the SPBP was investigated.

  19. Synthesis of N-substituted acetamide derivatives of azinane-bearing ...

    African Journals Online (AJOL)

    The search for new drug candidates with more bioactivity potential is a key research interest in synthetic organic chemistry [1]. The derivatives of heterocyclic compounds have been found to be bioactive, including naturally occurring and synthetically prepared ones [2]. Among these compounds, 1,3,4-oxadiazole derivatives ...

  20. 265 nm laser flash photolysis of some ortho-substituted anilides and related N-formylkynurenine derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Pileni, M P; Santus, R [Museum National d' Histoire Naturelle, 75 - Paris (France); Land, E J

    1978-06-01

    The physical and chemical properties of the triplet state of eight ortho-substituted anilides including N-formylkynurenine(FK), the major trp UV-photooxidation product and a remarkable photodynamic agent, have been investigated using both pulse radiolysis and 265 nm laser flash photolysis techniques. The molar extinction coefficient, the inter-system-crossing quantum yield and the oscillator strength of the T/sub 1/..-->..Tsub(n) absorption band (lambdasub(max)approximately equal 450nm) have been determined. It is shown that anilides having n..pi..* triplets readily react with most solvents whereas those having ..pi..,..pi..* triplets slowly react with alcohols. In both cases, the semi-reduced species are formed. In water, the formation of the semi-reduced species most probably involves the first excited singlet state. The triplet state properties of the FK derivatives (i.e. ortho-substituted anilides having a side chain bearing charged groups such as carboxylic or amino groups) are strongly modified by the ionization state of the charged side chain. In the case of the FK derivatives possessing an uncharged amino group, quenching of the triplet state occurs via a fast reversible electron transfer reaction from the NH/sub 2/ to the triplet anilide.

  1. Micro-, to nano-structural relationships in natural serpentines, derived from cationic substitutions.

    Science.gov (United States)

    Munoz, M.; Farges, F.; Andreani, M.; Ulrich, M.; Marcaillou, C.; Mathon, O.

    2014-12-01

    The understanding of the crystal chemistry of serpentine minerals (incl. antigorite, lizardite and chrysotile) is fundamental since serpentinization processes concern very large scientific domains: e.g., natural abiotic hydrogen production (Marcaillou et al., 2011), origins of life (Russell et al., 2010), fluid properties and mobility of metals in subduction zones (Kelley and Cottrell, 2009). This study aims at characterizing relations between the micro-, and nano-structures of the most abundant serpentine polytypes in the oceanic crust. Serpentine theoretical formula is Mg3Si2O5(OH)4 but several natural substitutions are possible and the formula may be written such as: (Mg,Fe2+,Fe3+,Al)3(Si,Al,Fe3+)2O5(OH)4; showing that Fe and Al may play an important role in the crystallization of serpentines. Preliminary crystal chemistry studies, suggest that, 1) the Al content alone cannot be directly correlated to serpentine polytypes (Andreani et al., 2008), 2) the amounts of tetrahedral iron can be significant in the presence of ferric iron (Marcaillou et al., 2011). Because magnetite is usually associated to serpentine, the Fe-speciation characterization of serpentine is delicate. Here, we provide the study of 33 magnetite-free serpentines containing various amounts of Fe and Al. The samples were characterized by SEM, Raman, XRF, as well as XANES, pre-edge, and EXAFS spectroscopy at the Fe K-edge. XANES experimental data were crosschecked and interpreted thanks to ab initio calculations and EXAFS shell-fitting. Also, preliminary 27Al-RMN data is presented. Results suggest relationships between the type and amount of substitution of trivalent cations in minerals, and the microstructures observed. Chrysotile incorporates less trivalent cations than other varieties, which tends to preserve the so-called misfit between the TO layers, and therefore the tubular structure of the mineral. Lizardites mainly involve Fe/Al Tschermak-type substitutions, while M-site vacancy charge

  2. Ugi-Smiles couplings of 4-substituted pyridine derivatives : a fast access to chloroquine analogues

    NARCIS (Netherlands)

    El Kaïm, Laurent; Grimaud, Laurence; Pravin, Patil; Patil, Pravin

    2012-01-01

    4-Hydroxy and mercapto pyridines were successfully tested in Ugi-Smiles couplings. Such multicomponent reactions applied to quinoline derivatives afford a very convenient and short synthesis of antimalarial analogues.

  3. Ugi-Smiles couplings of 4-substituted pyridine derivatives: a fast access to chloroquine analogues.

    Science.gov (United States)

    El Kaïm, Laurent; Grimaud, Laurence; Pravin, Patil

    2012-01-20

    4-Hydroxy and mercapto pyridines were successfully tested in Ugi-Smiles couplings. Such multicomponent reactions applied to quinoline derivatives afford a very convenient and short synthesis of antimalarial analogues. © 2011 American Chemical Society

  4. "CH"/N substituted mer-Gaq3 and mer-Alq3 derivatives: an effective approach for the tuning of emitting color.

    Science.gov (United States)

    Gahungu, Godefroid; Zhang, Jingping

    2005-09-22

    Equilibrium geometry configurations of the "CH"/N substituted Alq3 and Gaq3 derivatives are calculated by density functional theory (B3LYP/6-31G). The frontier molecular orbital and gap energy calculations for all complexes have been performed at the HF/6-31G level. It was shown that, compared to the pristine molecules, the HOMO and LUMO are stabilized, the net effect being however an increasing/decreasing of the gap (Eg) depending on the position of the substituted group. On the basis of the equilibrium geometries, the effect of the substitution on the absorption and emission spectra was evaluated using TDB3LYP/3-21G. It was shown that the change of "CH"/N substituted position on 8-hydroxyquinoline ligand is a powerful approach for the tuning of emitting color. An important blue shift was predicted for 5-substituted 8-hydroxyquinoline derivatives, an important red one being observed for 4-substituted ones. Interestingly, relatively significant blue and red shifts were also predicted for the 7- and 2-substituted derivatives. In this work, the correlation between the spectrum shifts and the metal-ligand bonding is also discussed.

  5. Transient negative ions in benzene. Some N-heterocyclic and mono-substituted derivatives

    International Nuclear Information System (INIS)

    Nenner, Irene

    1975-01-01

    Electron transmission spectroscopy is used to study transient negative ions or shape resonances in various benzene derivatives. Because of the long lifetime of these ions (τ > 10 -14 S) the vibrational structure of their first two electronic states is observed superposed on the total electron cross section curves in the energy range 0-6 eV and the corresponding adiabatic electron affinities are determined. The comparison of the first electron affinity with the first ionization potential and the energy on the first excited state of each of the derivatives is used to characterize the 'donor' substituents on the benzene ring. As a complementary study, these derivatives are studied in the liquid phase using polarography (cyclic voltametry). The linear correlation established between polarographic potentials measured in dimethyl formamide and the electron affinities was used to deduce electron affinities for several molecules which are difficult to measure in the gas phase. (author) [fr

  6. A triphenylamine substituted quinacridone derivative for solution processed organic light emitting diodes

    NARCIS (Netherlands)

    Pilz da Cunha, M.; Do, T.T.; Yambem, S.D.; Pham, H.D.; Chang, S.; Manzhos, S.; Katoh, R.; Sonar, P.

    2018-01-01

    We report on a novel quinacridone derivative design, namely, 2,9-bis(4-(bis(4-methoxyphenyl)amino)phenyl)-5,12-bis(2-ethylhexyl)-5,12-dihydroquinolino[2,3-b]acridine-7,14-dione (TPA-QA-TPA) for possible use as a solution processable emissive layer in organic light emitting diodes (OLEDs). TPA-QA-TPA

  7. Antitumour activity of N 6 -substituted PMEDAP derivatives against T-cell lymphoma

    Czech Academy of Sciences Publication Activity Database

    Valeriánová, M.; Votruba, Ivan; Holý, Antonín; Mandys, Václav; Otová, B.

    2001-01-01

    Roč. 21, - (2001), s. 2057-2064 ISSN 0250-7005 R&D Projects: GA ČR GV203/96/K128; GA MZd NL5423 Institutional research plan: CEZ:AV0Z4055905 Keywords : PMEDAP derivatives Subject RIV: CC - Organic Chemistry Impact factor: 1.416, year: 2001

  8. Novel substituted and fused pyrrolizine derivatives: synthesis, anti-inflammatory and ulcerogenecity studies.

    Science.gov (United States)

    Abbas, Safinaz E; Awadallah, Fadi M; Ibrahim, Nashwa A; Gouda, Ahmed M

    2010-02-01

    Synthesis of several substituted pyrrolizines 10a-f, 11a-f, 13a-c, pyrimidopyrrolizines 14a-c, 15a-c, and pyrrolizinopyrimidoisoindoles 12a-c was discussed. The starting compounds 6-amino-7-cyano-N-(4-(un)substitutedphenyl)-2,3-dihydro-1H-pyrrolizine-5-carboxamides 9a-c were reacted with different aldehydes, acid chlorides, and acid anhydrides to give the target compounds. The structures of the new compounds were characterized by spectral and elemental analyses. All compounds were tested for their anti-inflammatory activity using the carrageenan-induced rat paw oedema model and exhibited weak to good activities compared to ketorolac as the reference drug. Also, analgesic activity of selected compounds, which are the most active in the anti-inflammatory screening, was measured using the acetic acid-induced writhing model; revealing activities comparable to or higher than ketorolac. Ulcer indices for the most active compounds were calculated and some compounds showed no or minimal ulcerogenic effect compared to ketorolac. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  9. Optoelectronic properties of higher acenes, their BN analogue and substituted derivatives

    International Nuclear Information System (INIS)

    Armaković, Stevan; Armaković, Sanja J.; Holodkov, Vladimir; Pelemiš, Svetlana

    2016-01-01

    We have investigated optoelectronic properties of higher acenes: pentacene, hexacene, heptacene, octacene, nonacene, decacene and their boron-nitride (BN) analogues, within the framework of density functional theory (DFT). We have also investigated the optoelectronic properties of acenes modified by BN substitution. Calculated optoelectronic properties encompasses: oxidation and reduction potentials, electron and hole reorganization energies and energy difference between excited first singlet and triplet states ΔE(S_1−T_1). Oxidation and reduction potentials indicate significantly better stability of BN analogues, comparing with their all-carbon relatives. Although higher acenes possess lower electron and hole reorganization energies, with both best values much lower than 0.1 eV, their BN analogues also have competitive values of reorganization energies, especially for holes for which reorganization energy is also lower than 0.1 eV. On the other hand ΔE(S_1−T_1) is much better for BN analogues, having values that indicate that BN analogues are possible applicable for thermally activated delayed fluorescence. - Highlights: • Optoelectronic properties of structures based on higher acenes have been investigated. • Oxidation and reduction potentials together with reorganization energies are calculated. • TADF is analyzed through calculation of ΔE(S_1−T_1), which is much better for BN analogues. • Reorganization energies of acenes improve with the increase of number of benzene rings.

  10. Optoelectronic properties of higher acenes, their BN analogue and substituted derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Armaković, Stevan, E-mail: stevan.armakovic@df.uns.ac.rs [University of Novi Sad, Faculty of Sciences, Department of Physics, Trg Dositeja Obradovića 4, 21000, Novi Sad (Serbia); Armaković, Sanja J. [University of Novi Sad, Faculty of Sciences, Department of Chemistry, Biochemistry and Environmental Protection, Trg Dositeja Obradovića 3, 21000, Novi Sad (Serbia); Holodkov, Vladimir [Educons University, Faculty of Sport and Tourism - TIMS, Radnička 30a, 21000, Novi Sad (Serbia); Pelemiš, Svetlana [University of East Sarajevo, Faculty of Technology, Karakaj bb, 75400, Zvornik, Republic of Srpska, Bosnia and Herzegovina (Bosnia and Herzegovina)

    2016-02-15

    We have investigated optoelectronic properties of higher acenes: pentacene, hexacene, heptacene, octacene, nonacene, decacene and their boron-nitride (BN) analogues, within the framework of density functional theory (DFT). We have also investigated the optoelectronic properties of acenes modified by BN substitution. Calculated optoelectronic properties encompasses: oxidation and reduction potentials, electron and hole reorganization energies and energy difference between excited first singlet and triplet states ΔE(S{sub 1}−T{sub 1}). Oxidation and reduction potentials indicate significantly better stability of BN analogues, comparing with their all-carbon relatives. Although higher acenes possess lower electron and hole reorganization energies, with both best values much lower than 0.1 eV, their BN analogues also have competitive values of reorganization energies, especially for holes for which reorganization energy is also lower than 0.1 eV. On the other hand ΔE(S{sub 1}−T{sub 1}) is much better for BN analogues, having values that indicate that BN analogues are possible applicable for thermally activated delayed fluorescence. - Highlights: • Optoelectronic properties of structures based on higher acenes have been investigated. • Oxidation and reduction potentials together with reorganization energies are calculated. • TADF is analyzed through calculation of ΔE(S{sub 1}−T{sub 1}), which is much better for BN analogues. • Reorganization energies of acenes improve with the increase of number of benzene rings.

  11. Optical, thermal and electrical properties of polybenzimidazoles derived from substituted benzimidazoles

    Science.gov (United States)

    Anand, Siddeswaran; Muthusamy, Athianna

    2017-11-01

    Three benzimidazole monomers synthesized by condensing various substituted phenolic aldehydes with 4-methylphenylenediamine were converted in to polymers by oxidative polycondensation. The structure of the monomers and polymers were confirmed by various spectroscopic techniques. Electronic distribution of molecular frontier orbitals and optimized geometries of monomers were calculated by Gaussian 09 package. The spectral results showed that the repeating units are connected through both Csbnd C and Csbnd Osbnd C linkages. Both polymers and monomers are showing good fluorescence emission in blue region. The electrical conductivity of I2 doped PBIs was measured using two point probe technique. The conductivities of PBIs were compared on the basis of the charge densities obtained from Huckel method on imidazole nitrogen which is involved in iodine coordination. The conductivity of polymers increases with increase in iodine vapour contact time. The dielectric properties of the synthesized polymers have been investigated at different temperature and frequency. Among the PBIs, PBIOP is having greater thermal stability and is shown by high carbines residues of around 50% at 500 °C in thermogravimetric analysis.

  12. Synthesis and Bioactivity of N-Benzoyl-N'-[5-(2'-substituted phenyl-2-furoyl] Semicarbazide Derivatives

    Directory of Open Access Journals (Sweden)

    Zining Cui

    2010-06-01

    Full Text Available In order to find novel chitin synthesis inhibitors (CSIs with good activity, benzoylphenylurea, a typical kind of CSIs, was chosen as the lead compound and 15 novel derivatives containing furan moieties were designed by converting the urea linkage of benzoylphenylureas into a semicarbazide and changing the aniline part into furoyl groups. The title compounds were synthesized by the reaction of substituted benzoyl isocyanates with 5-(substituted phenyl-2-furoyl hydrazine, and the structures were confirmed by IR, 1H-NMR, elemental analysis and single crystal X-ray diffraction analyses (compound E2. The bioassay results indicated that the title compounds exhibit good insecticidal activity, especially towards Plutella xylostella L., but had lower fungicidal activity. Inspiringly, the title compounds possessed obvious anticancer activity against human promyelocytic leukemic cell line (HL-60, and some of the title compounds also had activity against human hepatocellular carcinoma cell line (Bel-7402, human gastric carcinoma cell line (BGC-823, and human nasopharyngeal carcinoma cell line (KB. The results indicated that the linkage in the lead compounds was important to the bioactivity and spectra. The modification on the urea linkage is an effective strategy to discover new pesticide and drug candidates.

  13. Effect of a bulky lateral substitution by chlorine atom and methoxy group on self-assembling properties of lactic acid derivatives

    Czech Academy of Sciences Publication Activity Database

    Stojanović, M.; Bubnov, Alexej; Obadović, D.Ž.; Hamplová, Věra; Cvetinov, M.; Kašpar, Miroslav

    2014-01-01

    Roč. 146, 1-2 (2014), s. 18-25 ISSN 0254-0584 R&D Projects: GA ČR GA13-14133S Grant - others:AVČR(CZ) M100101204 Institutional support: RVO:68378271 Keywords : ferroelectric liquid crystal * lactic acid derivative * lateral substitution * methoxy group * chlorine substitution * dielectric spectroscopy Subject RIV: JJ - Other Materials Impact factor: 2.259, year: 2014

  14. S-Substituted cysteine derivatives and thiosulfinate formation in Petiveria alliacea-part II.

    Science.gov (United States)

    Kubec, Roman; Kim, Seokwon; Musah, Rabi A

    2002-11-01

    Three cysteine derivatives, (R)-S-(2-hydroxyethyl)cysteine, together with (R(S)R(C))- and (S(S)R(C))-S-(2-hydroxyethyl)cysteine sulfoxides, have been isolated from the roots of Petiveria alliacea. Furthermore, three additional amino acids, S-methyl-, S-ethyl-, and S-propylcysteine derivatives, were detected. They were present only in trace amounts (<3 microg g(-1) fr. wt), precluding determination of their absolute configurations and oxidation states. In addition, four thiosulfinates, S-(2-hydroxyethyl) (2-hydroxyethane)-, S-(2-hydroxyethyl) phenylmethane-, S-benzyl (2-hydroxyethane)- and S-benzyl phenylmethanethiosulfinates, have been found in a homogenate of the roots. The formation pathways of various benzyl/phenyl-containing compounds previously found in the plant were also discussed.

  15. Towards physical interpretation of substituent effects: the case of N- and C3-substituted pyrrole derivatives

    Czech Academy of Sciences Publication Activity Database

    Zborowski, K. K.; Szatylowicz, H.; Stasyuk, Olga A.; Krygowski, T. M.

    2017-01-01

    Roč. 28, č. 4 (2017), s. 1223-1227 ISSN 1040-0400 Institutional support: RVO:61388963 Keywords : substituent effect * pyrrole derivatives * Hammett equation * charges of the substituent active region Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 1.582, year: 2016 https://link.springer.com/article/10.1007%2Fs11224-017-0938-7

  16. Regiospecificity in the heterocyclization of b-oxonitriles to 5-substituted 4-oxothiazolidine derivatives

    Directory of Open Access Journals (Sweden)

    PETER STEEL

    2003-05-01

    Full Text Available A study on the regiospecificity of the base-catalyzed reaction of activated b-oxonitriles 1 with diethyl mercaptosuccinate affording the title compounds 3 is reported. Other competitive heterocyclic products, that is 4-oxo-1,3-thiazinanes 4, derivatives of tetrahydrothiophene 5 and/or thiacyclohexane 6 which on the grounds of mechanistic considerations could be formed, were not observed. Spectroscopic and experimental evidence, together with theoretical considerations, provides a reasonable explanation for the observed regiospecificity.

  17. Synthesis and Antibacterial Evaluation of Novel 3-Substituted Ocotillol-Type Derivatives as Leads

    Directory of Open Access Journals (Sweden)

    Yi Bi

    2017-04-01

    Full Text Available Due to the rapidly growing bacterial antibiotic-resistance and the scarcity of novel agents in development, bacterial infection is still a global problem. Therefore, new types of antibacterial agents, which are effective both alone and in combination with traditional antibiotics, are urgently needed. In this paper, a series of antibacterial ocotillol-type C-24 epimers modified from natural 20(S-protopanaxadiol were synthesized and evaluated for their antibacterial activity. According to the screening results of Gram-positive bacteria (B. subtilis 168 and MRSA USA300 and Gram-negative bacteria (P. aer PAO1 and A. baum ATCC19606 in vitro, the derivatives exhibited good antibacterial activity, particularly against Gram-positive bacteria with an minimum inhibitory concentrations (MIC value of 2–16 µg/mL. The subsequent synergistic antibacterial assay showed that derivatives 5c and 6c enhanced the susceptibility of B. subtilis 168 and MRSA USA300 to chloramphenicol (CHL and kanamycin (KAN (FICI < 0.5. Our data showed that ocotillol-type derivatives with long-chain amino acid substituents at C-3 were good leads against antibiotic-resistant pathogens MRSA USA300, which could improve the ability of KAN and CHL to exhibit antibacterial activity at much lower concentrations with reduced toxicity.

  18. Structure-activity relationships for novel drug precursor N-substituted-6-acylbenzothiazolon derivatives: A theoretical approach

    Science.gov (United States)

    Sıdır, Yadigar Gülseven; Sıdır, İsa

    2013-08-01

    In this study, the twelve new modeled N-substituted-6-acylbenzothiazolon derivatives having analgesic analog structure have been investigated by quantum chemical methods using a lot of electronic parameters and structure-activity properties; such as molecular polarizability (α), dipole moment (μ), EHOMO, ELUMO, q-, qH+, molecular volume (Vm), ionization potential (IP), electron affinity (EA), electronegativity (χ), molecular hardness (η), molecular softness (S), electrophilic index (ω), heat of formation (HOF), molar refractivity (MR), octanol-water partition coefficient (log P), thermochemical properties (entropy (S), capacity of heat (Cv)); as to investigate activity relationships with molecular structure. The correlations of log P with Vm, MR, ω, EA, EHOMO - ELUMO (ΔE), HOF in aqueous phase, χ, μ, S, η parameters, respectively are obtained, while the linear relation of log P with IP, Cv, HOF in gas phase are not observed. The log P parameter is obtained to be depending on different properties of compounds due to their complexity.

  19. Halogeno-substituted 2-aminobenzoic acid derivatives for negative ion fragmentation studies of N-linked carbohydrates.

    Science.gov (United States)

    Harvey, David J

    2005-01-01

    Negative ion electrospray mass spectra of high-mannose N-linked glycans derivatised with 2-aminobenzoic acids and ionised from solutions containing ammonium hydroxide gave prominent [M-H](-) ions accompanied by weaker [M-2H](2-) ions. Fragmentation of both types of ions gave prominent singly charged glycosidic cleavage ions containing the derivatised reducing terminus and ions from the non-reducing terminus that appeared to be products of cross-ring cleavages. Differentiation of these two groups of ions was conveniently achieved in a single spectrum by use of chloro- or bromo-substituted benzoic acids in order to label ions containing the derivative with an atom with a distinctive isotope pattern. Fragmentation of the doubly charged ions gave more abundant fragments, both singly and doubly charged, than did fragmentation of the singly charged ions, but information of chain branching was masked by the appearance of prominent ions produced by internal cleavages. Copyright (c) 2005 John Wiley & Sons, Ltd.

  20. Use of bark-derived pyrolysis oils ass a phenol substitute in structural panel adhesives

    Energy Technology Data Exchange (ETDEWEB)

    Louisiana Pacific Corp

    2004-03-01

    The main objective of this program was to pilot the world's first commercial-scale production of an acceptable phenol formaldehyde (PF) resin containing natural resin (NR) ingredients, for use as an adhesive in Oriented-Strand Board (OSB) and plywood panel products. Natural Resin products, specifically MNRP are not lignin ''fillers''. They are chemically active, natural phenolics that effectively displace significant amounts of phenol in PF resins, and which are extracted from bark-derived and wood-derived bio-oils. Other objectives included the enhancement of the economics of NR (MNRP) production by optimizing the production of certain Rapid Thermal Processing (RTP{trademark}) byproducts, particularly char and activated carbon. The options were to activate the char for use in waste-water and/or stack gas purification. The preliminary results indicate that RTP{trademark} carbon may ultimately serve as a feedstock for activated carbon synthesis, as a fuel to be used within the wood product mill, or a fuel for an electrical power generating facility. Incorporation of the char as an industrial heat source for use in mill operations was L-P's initial intention for the carbon, and was also of interest to Weyerhaeuser as they stepped into in the project.

  1. Thioxopyrimidine in Heterocyclic Synthesis I: Synthesis of Some Novel 6-(Heteroatom-substituted-(thiopyrimidine Derivatives

    Directory of Open Access Journals (Sweden)

    Yuh-Wen Ho

    2013-01-01

    Full Text Available A series of novel N-cycloalkanes, morpholine, piperazines, pyrazole, pyrimidine, benzimidazolo[1,2-a]pyrimidine, 1,2,3,4-tetrazolo[1,5-a]pyrimidine, azopyrazolo[1,5- a]pyrimidine, pyrimido[4', 5':3,4]pyrazolo[1,5-a]pyrimidines and pyridine derivatives incorporating a 5-cyano-4-methyl-2-phenyl-(thiopyrimidine moiety were obtained by the intramolecular cyclization of 6-methylthio-pyrimidine, 6-(benzoylmethylthio- pyrimidine and 2-[(5-cyano-4-methyl-2-phenylpyrimidin-6-ylthio]-3-dimethyl- amino-1-phenyl-prop-2-en-1-one with appropriate amines and enaminone compounds, respectively. The structure of all new synthesized compounds was established from their spectral data, elemental analysis and the X-ray crystal analysis.

  2. Identification of ortho-Substituted Benzoic Acid/Ester Derivatives via the Gas-Phase Neighboring Group Participation Effect in (+)-ESI High Resolution Mass Spectrometry.

    Science.gov (United States)

    Blincoe, William D; Rodriguez-Granillo, Agustina; Saurí, Josep; Pierson, Nicholas A; Joyce, Leo A; Mangion, Ian; Sheng, Huaming

    2018-04-01

    Benzoic acid/ester/amide derivatives are common moieties in pharmaceutical compounds and present a challenge in positional isomer identification by traditional tandem mass spectrometric analysis. A method is presented for exploiting the gas-phase neighboring group participation (NGP) effect to differentiate ortho-substituted benzoic acid/ester derivatives with high resolution mass spectrometry (HRMS 1 ). Significant water/alcohol loss (>30% abundance in MS 1 spectra) was observed for ortho-substituted nucleophilic groups; these fragment peaks are not observable for the corresponding para and meta-substituted analogs. Experiments were also extended to the analysis of two intermediates in the synthesis of suvorexant (Belsomra) with additional analysis conducted with nuclear magnetic resonance (NMR), density functional theory (DFT), and ion mobility spectrometry-mass spectrometry (IMS-MS) studies. Significant water/alcohol loss was also observed for 1-substituted 1, 2, 3-triazoles but not for the isomeric 2-substituted 1, 2, 3-triazole analogs. IMS-MS, NMR, and DFT studies were conducted to show that the preferred orientation of the 2-substituted triazole rotamer was away from the electrophilic center of the reaction, whereas the 1-subtituted triazole was oriented in close proximity to the center. Abundance of NGP product was determined to be a product of three factors: (1) proton affinity of the nucleophilic group; (2) steric impact of the nucleophile; and (3) proximity of the nucleophile to carboxylic acid/ester functional groups. Graphical Abstract ᅟ.

  3. Preparation of Substituted Enol Derivatives From Terminal Alkynes and Their Synthetic Utility

    Science.gov (United States)

    DeBergh, John R.; Spivey, Kathleen M.; Ready, Joseph M.

    2009-01-01

    Stereodefined enol derivatives of aldehydes are prepared from terminal alkynes. Specifically, terminal alkynes are known to undergo Cp2ZrCl2-catalyzed methylalumination. Here, we show that the resultant vinylalanes can be oxygenated with peroxyzinc species to generate trisubstituted enolates. Electrophilic trapping with carboxylic anydrides or silyl triflates yields trisubstituted enol esters or silanes, respectively. The tandem carbometalation/oxygenation tolerates free and protected alcohols, heterocycles, olefins and nitriles. Likewise, amination can be accomplished using azodicarboxylates. Stereodefined enol esters can undergo asymmetric dihydroxylation to yield optically-active α-hydroxy aldehydes. Reduction with NaBH4 provides the diols of 1,1-disubstituted olefins in excellent ee. An application of this methodology to the enantioselective synthesis of the insect pheromone frontalin is presented. Finally, α-hydroxy aldehydes are shown to undergo homologation to a terminal alkyne, reductive amination, oxidation and olefination. Preliminary results indicate that tandem carbometalation/amination can be accomplished with azodicarboxylates. In this way, ene-hydrazines are formed in excellent yield. PMID:18517202

  4. Preparation of Cyano-Substituted Tetraphenylethylene Derivatives and Their Applications in Solution-Processable OLEDs

    Directory of Open Access Journals (Sweden)

    Xiaoyi Sun

    2018-01-01

    Full Text Available Creation of organic luminescent materials with high solid-state efficiency is of vital importance for their applications in optoelectronic fields. Here, a series of AIE luminogens (AIE gens, (Z-2,3-bis(4-(9,9-bis(6-(9H-carbazol-9-ylhexyl-9H-fluoren-2-ylphenyl-3-phenylacrylonitrile (SFC, and 2,3-bis(4-(9,9-bis(6-(9H-carbazol-9-ylhexyl-9H-fluoren-2-ylphenylfumaronitrile (DFC, utilizing 2,3,3-triphenylacrylonitrile and 2,3-diphenylfumaronitrile as respective centers, are designed and synthesized by Suzuki coupling reactions with high yields. The cis- and trans-isomers of DFC are also successfully obtained. All of them are thermally stable and show good solubility in common organic solvents. They all emit weakly in solution, but become strong emitters when fabricated into solid films. It is found introduction of one additional cyano group in DFC induced a big red-shift in solid-state emission, owing to its high electron-withdrawing ability. The cis- and trans-DFC show similar photophysical and Cyclic voltammogram (CV behaviors. Non-doped solution-processed organic light-emitting diodes (OLEDs using the three compounds as light-emitting layers are fabricated. SFC gives the best device performance with a maximum luminance of 5201 cd m−2, a maximum current efficiency of 3.67 cd A−1 and a maximum external quantum efficiencies (EQE of 1.37%. Red-shifted EL spectra are observed for cis- and trans-DFC-based device, and the OLED using trans-DFC as active layer exhibits better performance, which might derive from their different conformation in film state.

  5. Pyrole-substituted barbituric derivatives as pharmaceutically significant compounds and intermediates

    International Nuclear Information System (INIS)

    Bijev, A.; Prodanova, P.

    2004-01-01

    Pyrrole- and indolecarbaldehydes are condensed with 5-unsubstituted barbituric acids targeting 16 new heterocyclic structures with a prospective pharmacological profile. So 1H-2-pyrrolecarbaldehyde, diethyl 5-formyl-3-methyl-1H-2,4-pyrroledicarboxylate, ethyl 5-formy 1-2,4-dimethyl-l.fl'-3-pyrrolecarboxylate, ethyl 4-formyl-3,5-dimethyl-1H-2-pyrrolecarboxylate, ethyl 4-formyl-2,5-dimethyl-1H-3-pyrrolecarboxylate and l-acetyl-1H-3-indolecarbaldehyde have been condensed in a molar ratio with hexahydro-2,4,6-pyrimidinetrione (barbituric acid) and its 1,3-dimethyl-, 1,3-diphenyl- and 1,3-dicyclohexyl- derivatives. The synthesis takes place in ethanol (or in ethanol/water in the cases of unsubstituted barbituric acid) within several hours at 20 0 - 60 0 C in the absence of any catalyst with yields in the range of 70-95%. An insufficient carbonyl activity of N-unsubstituted indole-3-carbaldehyde has been observed and overcome by a preliminary N-acethylation avoiding the inactive vinylene-carboxamide form. In addition to their pharmaceutical significance based on the interaction of two heterocyclic pharmacophores, the condensation products could also be useful as versatile intermediates for further synthesis of new heterocyclic systems. The synthesis of 5-[(4-acetyl-3,5-dimethyl-1H-2-pyrrolyl)(l-acetyl-1H-3-indolyl)methyl] hexahydr= o-2,4,6-pyrimidinetrione (60% in enol-form according to 1 H-NMR) by refluxing of [(1-acetyl-1H-3-indolyl) methylene]hexahydro-2,4,6-pyrimidinetrione] and 3-acethyl-2,4-dimethylpyrrole for 6 h in CH 3 CN illustrates their capability to add C-nucleophiles to the double bound bridging 3 heterocyclic units together. The new 17 products are TLC pure and their structures are proved by 1 H-NMR/IR-spectra which interpretation is displayed. (authors)

  6. Removal potential of toxic 2378-substituted PCDD/F from incinerator flue gases by waste-derived activated carbons.

    Science.gov (United States)

    Hajizadeh, Yaghoub; Onwudili, Jude A; Williams, Paul T

    2011-06-01

    The application of activated carbons has become a commonly used emission control protocol for the removal or adsorption of persistent organic pollutants from the flue gas streams of waste incinerators. In this study, the 2378-substituted PCDD/F removal efficiency of three types of activated carbons derived from the pyrolysis of refuse derived fuel, textile waste and scrap tyre was investigated and compared with that of a commercial carbon. Experiments were carried out in a laboratory scale fixed-bed reactor under a simulated flue gas at 275°C with a reaction period of four days. The PCDD/F in the solid matrices and exhaust gas, were analyzed using gas chromatography coupled with a triple quadrupole mass spectrometer. In the absence of activated carbon adsorbent, there was a significant increase in the concentration of toxic PCDD/F produced in the reacted flyash, reaching up to 6.6 times higher than in the raw flyash. In addition, there was a substantial release of PCDD/F into the gas phase, which was found in the flue gas trapping system. By application of the different commercial, refuse derived fuel, textile and tyre activated carbons the total PCDD/F toxic equivalent removal efficiencies in the exhaust gas stream were 58%, 57%, 64% and 52%, respectively. In general, the removal of the PCDDs was much higher with an average of 85% compared to PCDFs at 41%. Analysis of the reacted activated carbons showed that there was some formation of PCDD/F, for instance, a total of 60.6 μg I-TEQ kg(-1) toxic PCDD/F was formed in the refuse derived fuel activated carbon compared to 34 μg I-TEQ kg(-1) in the commercial activated carbon. The activated carbons derived from the pyrolysis of waste, therefore, showed good potential as a control material for PCDD/F emissions in waste incinerator flue gases. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Operator substitution

    NARCIS (Netherlands)

    Hautus, M.L.J.

    1994-01-01

    Substitution of an operator into an operator-valued map is defined and studied. A Bezout-type remainder theorem is used to derive a number of results. The tensor map is used to formulate solvability conditions for linear matrix equations. Some applications to system theory are given, in particular

  8. Synthesis and in vitro antibacterial activity of N-methylnitrone and nitrovinyl derivatives of some N-substituted 2-chloroindol-3-carboxaldehydes

    Energy Technology Data Exchange (ETDEWEB)

    Gatti, R.; Cavrini, V.; Roveri, P.; Bianucci, F.; Legnani, P.

    1981-02-01

    N-methylnitrones and nitrovinyl derivatives from 1-substituted-2-chloroindol-3-carboxaldehydes were synthesized and evaluated for their in vitro antibacterial activity. Some nitrovinyl derivatives displayed good in vitro activity against Gram-positive bacteria; the compound (II e), 1-(o-chlorobenzyl)-2-chloro-3-(2-nitroethenyl)indole, was more active than nitrofurantoin against Staphylococcus aureus and Streptococcus pyogenes. Some structure-activity relationships are discussed.

  9. 2D QSAR studies of the inhibitory activity of a series of substituted purine derivatives against c-Src tyrosine kinase

    OpenAIRE

    Mukesh C. Sharma

    2016-01-01

    A series of 34 substituted purine analogues derivatives were subjected to quantitative structure-activity relationship analyses as inhibitors of c-Src tyrosine kinase. Partial least squares regression was applied to derive QSAR models, which were further validated for statistical significance by internal and external validation. The best QSAR model developed had a good predictive correlation coefficient (r2) of 0.8319, a significant cross-validated correlation coefficient (q2) of 0.7550, and ...

  10. N9-Substituted N(6)-[(3-methylbut-2-en-1-yl)amino]purine derivatives and their biological activity in selected cytokinin bioassays

    Czech Academy of Sciences Publication Activity Database

    Mik, V.; Szüčová, Lucie; Spíchal, Lukáš; Plíhal, O.; Nisler, Jaroslav; Zahajská, L.; Doležal, Karel; Strnad, Miroslav

    2011-01-01

    Roč. 19, č. 23 (2011), s. 7244-7251 ISSN 0968-0896 R&D Projects: GA MŠk ED0007/01/01; GA ČR GA522/09/1576 Keywords : N6-[(3-Methylbut-2-en-1-yl)amino]purine * Isopentenyladenine derivatives * N9-Substituted derivatives * Cytokinins * Cytokinin receptors Subject RIV: EF - Botanics Impact factor: 2.921, year: 2011

  11. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  12. Effect of a bulky lateral substitution by chlorine atom and methoxy group on self-assembling properties of lactic acid derivatives

    International Nuclear Information System (INIS)

    Stojanović, Maja; Bubnov, Alexej; Obadović, Dušanka Ž.; Hamplová, Věra; Cvetinov, Miroslav; Kašpar, Miroslav

    2014-01-01

    Several chiral liquid crystalline materials derived from the lactic acid have been studied with the aim to establish the effect of bulky lateral substituents on their self-assembling properties. A chlorine atom and methoxy group have been used as lateral substituents in ortho position to ether group position on phenyl ring far from the chiral centre. All the studied materials possess tilted ferroelectric smectic C* phase in a broad temperature range. In dependence on the molecular structure namely type of lateral substituent and length of the chiral chain, the cholesteric mesophase, orthogonal paraelectric smectic A* and crystal mesophases have been detected. Lateral chlorine substitution results in decrease of both the clearing point and crystallisation temperature as well as in a distinct increase of spontaneous polarization. Bulky methoxy substitution slightly suppresses the spontaneous polarisation but strongly increases the melting point that results in monotropic peculiarity of the SmC* phase. Mesomorphic, spontaneous, structural and dielectric properties of the substituted compounds were established and compared to those of the non-substituted ones in order to contribute to better understanding of the structure–property relationship for such chiral self-assembling materials. - Highlights: • Chiral liquid crystalline materials derived from the lactic acid have been studied. • Effect of bulky lateral substituents on self-assembling properties has been established. • Bulky methoxy substitution suppresses spontaneous polarisation but increases the melting point. • The compounds might have a strong potential for many advanced electro-optic applications

  13. Azomethines, isoxazole, N-substituted pyrazoles and pyrimidine containing curcumin derivatives: Urease inhibition and molecular modeling studies.

    Science.gov (United States)

    Ahmed, Mahmood; Qadir, Muhammad Abdul; Hameed, Abdul; Arshad, Muhammad Nadeem; Asiri, Abdullah M; Muddassar, Muhammad

    2017-08-19

    Curcumin has shown large number of pharmacological properties against different phenotypes of various disease models. Different synthetic routes have been employed to develop its various derivatives for diverse biological functions. In this study, curcumin derived azomethine, isoxazole, pyrimidines and N-substituted pyrazoles were synthesized to investigate their urease enzyme inhibition. The structures of newly synthesized compounds were described by IR, MS, 1 H NMR and 13 C NMR spectral data. Urease enzyme inhibition was evaluated through in vitro assays in which compound 8b was found to be the most potent (IC 50  = 2.44 ± 0.07 μM) among the tested compounds. The compounds with diazine ring system except the 4d showed better urease inhibition (IC 50  = 11.43 ± 0.21-19.63 ± 0.28 μM) than the standard urease inhibitor thiourea (IC 50  = 22.61 ± 0.23 μM). Similarly enzyme kinetics data revealed that compounds 3c-3e and 8b were competitive inhibitors with Ki values of 20.0, 19.87, 20.23 and 19.11 μM respectively while the compounds 4b, 4c and 4e were mixed type of inhibitors with Ki values 6.72, 19.69 and 6.72 μM respectively. Molecular docking studies were also performed to identify the plausible binding modes of the most active compounds. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Synthesis of Some O-Substituted Derivatives of Natural 6-hydroxymethyl-4-methoxy-2H-pyran-2-one (opuntiol)

    International Nuclear Information System (INIS)

    Shahzadi, T.; Akhtar, M.; Rehman, A.; Riaz, T.; Ashraf, M.

    2013-01-01

    This manuscript reports the synthesis of a series of new O-substituted derivatives of opuntiol (1) which is a naturally occurring compound isolated from a plant Opuntia dillenii Haw belonging to family Cactaceae. These derivatives 3a-t, were characterized by FAB-MS, IR, and 1H-NMR and then screened against acetylcholinesterase, butyrylcholinesterase, lipoxygenase and H-chymotrypsin enzymes. The screening results revealed that 6-(acetyloxy) methyl- 4-methoxy-2H-pyran-2-one (3b) and N-(2,5-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl) methoxy)acetamide (3p) were found to be the inhibitor of butyrylcholinesterase while 6-(acetyloxy) methyl- 4-methoxy-2H-pyran-2-one (3b), 6-(ethoxymethyl)-4-methoxy-2H-pyran-2-one (3c), 4-methoxy-6-((phenylmethoxy)methyl)-2H-pyran-2-one (3g), 6-((2-bromoethyloxy)methyl)-4-methoxy-2H-pyran-2-one (3j), N-(5-chloro-2-ethoxyphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy) acetamide (3r), N-(3,4-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy)acetamide (3s) N-(3,5-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy)acetamide (3t) were found to be active against H-chymotrypsin and among these 3s was the good inhibitor of this enzyme having IC50 value of 142.71 +- 0.22 micro moles/L. (author)

  15. Substituted group and side chain effects for the porphyrin and zinc(II)–porphyrin derivatives: A DFT and TD-DFT study

    International Nuclear Information System (INIS)

    Tai, Chin-Kuen; Chuang, Wen-Hua; Wang, Bo-Cheng

    2013-01-01

    The DFT/B3LYP/LANL2DZ and TD-DFT calculations have been performed to generate the optimized structures, electronic and photo-physical properties for the porphyrin and zinc(II)–porphyrin (metalloporphyrin) derivatives. The substituted group and side chain effects for these derivatives are discussed in this study. According to the calculation results, the side chain moiety extends the π-delocalization length from the porphyrin core to the side chain moiety. The substituted group with a stronger electron-donating ability increases the energy level of highest occupied molecular orbital (E HOMO ). The side chain moiety with a lower resonance energy decreases E HOMO , the energy level of the lowest unoccupied molecular orbital (E LUMO ), and the energy gap (E g ) between HOMO and LUMO in the porphyrin and zinc(II)–porphyrin derivatives. The natural bonding orbital (NBO) analysis determines the possible electron transfer mechanism from the electron-donating to -withdrawing groups (the side chain moiety) in these porphyrin derivatives. The projected density of state (PDOS) analysis shows that the electron-donating group affects the electron density distribution in both HOMO and LUMO, and the side chain moiety influence the electron density distribution in LUMO. The calculated photo-physical properties (absorption wavelengths and the related oscillator strength, f) in dichloromethane environment for porphyrin and zinc(II)–porphyrin derivatives have been simulated by using the TD-DFT method within the Polarizable Continuum Model (PCM). The present of both of the substituted group and the side chain moiety in these derivatives results in a red shift and broadening of the range of the absorption peaks of the Q/Soret band as compared to porphin. -- Highlights: • Side chain moiety extends the π-delocalization for the porphyrins. • Substituted group increases the energy of highest occupied molecular orbital. • Side chain moiety influences the Q/Soret band of

  16. Synthesis of novel 4,6-di(substituted)amino-1,2-dihydro-1,3,5-triazine derivatives as topical antiseptic agents.

    Science.gov (United States)

    Maeda, Shirou; Kita, Toshiko; Meguro, Kanji

    2009-02-12

    A series of novel 4,6-di(substituted)amino-1,2-dihydro-1,3,5-triazine derivatives designed to have ClogP of 5.1-7.5 was synthesized and evaluated for their antiseptic properties by MIC and MBC tests against Gram-positive and Gram-negative bacteria, including MRSA, VRE, and P. aeruginosa. Among these compounds, 4-alkyl-6-aralkyl derivatives having ClogP of 6.6-7.1 and 4-alkyl-6-aryl or 4,6-dialkyl derivatives with ClogP of 6.0-6.4 showed pronounced antibacterial activities in both tests.

  17. Structure-Activity Relationships of Truncated C2- or C8-Substituted Adenosine Derivatives as Dual Acting A2A and A3 Adenosine Receptor Ligands

    Science.gov (United States)

    Hou, Xiyan; Majik, Mahesh S.; Kim, Kyunglim; Pyee, Yuna; Lee, Yoonji; Alexander, Varughese; Chung, Hwa-Jin; Lee, Hyuk Woo; Chandra, Girish; Lee, Jin Hee; Park, Seul-gi; Choi, Won Jun; Kim, Hea Ok; Phan, Khai; Gao, Zhan-Guo; Jacobson, Kenneth A.; Choi, Sun; Lee, Sang Kook; Jeong, Lak Shin

    2011-01-01

    Truncated N6-substituted-4′-oxo- and 4′-thioadenosine derivatives with C2 or C8 substitution were studied as dual acting A2A and A3 adenosine receptor (AR) ligands. The lithiation-mediated stannyl transfer and palladium-catalyzed cross coupling reactions were utilized for functionalization of the C2 position of 6-chloropurine nucleosides. An unsubstituted 6-amino group and a hydrophobic C2 substituent were required for high affinity at the hA2AAR, but hydrophobic C8 substitution abolished binding at the hA2AAR. However, most of synthesized compounds displayed medium to high binding affinity at the hA3AR, regardless of C2 or C8 substitution, and low efficacy in a functional cAMP assay. Several compounds tended to be full hA2AAR agonists. C2 substitution probed geometrically through hA2AAR-docking, was important for binding in order of hexynyl > hexenyl > hexanyl. Compound 4g was the most potent ligand acting dually as hA2AAR agonist and hA3AR antagonist, which might be useful for treatment of asthma or other inflammatory diseases. PMID:22142423

  18. Synthesis, crystal structure, and transport properties of Fe substituted rhombohedral skutterudite derivatives Co4−xFexGe6Se6

    KAUST Repository

    Wei, Kaya

    2014-11-01

    We report on the synthesis and low temperature transport properties of rhombohedral derivatives of the cubic skutterudite CoSb3, namely Co4-xFexGe6Se6 with x = 0, 1, 1.5. Rietveld refinement and elemental analyses were used to identify the structure and stoichiometry of the compositions. The thermal conductivity was investigated by employing the Debye model with different phonon-scattering parameters. This investigation demonstrates that Fe substitution is feasible in these skutterudite derivatives and can significantly affect the transport properties as compared with Co4Ge6Se6. © 2014 Elsevier B.V. All rights reserved.

  19. Ultrasound-Promoted Greener Synthesis of Novel Trifurcate 3-Substituted-chroman-2,4-dione Derivatives and Their Drug-Likeness Evaluation

    Directory of Open Access Journals (Sweden)

    Yu Xue

    2012-11-01

    Full Text Available An efficient and convenient approach for one-pot synthesis of 3-substituted chroman-2,4-diones via a three-component reaction of aromatic aldehydes, 4-hydroxy- coumarins and diverse pyrazolone derivatives was described. The combinatorial synthesis for this methodology was achieved by applying ultrasound irradiation in the absence of activator while making use of water as green solvent. Additionally, novel chroman-2,4-dione derivatives attached to an edaravone moiety represent an exploitable source of brand new anticancer agents. In comparison with conventional methods, experimental simplicity, good functional group tolerance, excellent yields, short routine, and atom efficiency are prominent features of this sonocatalyzed procedure.

  20. Synthesis, crystal structure, and transport properties of Fe substituted rhombohedral skutterudite derivatives Co4−xFexGe6Se6

    KAUST Repository

    Wei, Kaya; Dong, Yongkwan; Puneet, Pooja; Tritt, Terry M.; Nolas, George S.

    2014-01-01

    We report on the synthesis and low temperature transport properties of rhombohedral derivatives of the cubic skutterudite CoSb3, namely Co4-xFexGe6Se6 with x = 0, 1, 1.5. Rietveld refinement and elemental analyses were used to identify the structure and stoichiometry of the compositions. The thermal conductivity was investigated by employing the Debye model with different phonon-scattering parameters. This investigation demonstrates that Fe substitution is feasible in these skutterudite derivatives and can significantly affect the transport properties as compared with Co4Ge6Se6. © 2014 Elsevier B.V. All rights reserved.

  1. Activated carbon modified with 4-(8-hydroxyquinoline-azo)benzamidine for selective solid-phase extraction and preconcentration of trace lead from environmental samples

    International Nuclear Information System (INIS)

    Tian, H.; Chang, X.; Hu, Z.; Yang, K.; He, Q.; Zhang, L.; Tu, Z.

    2010-01-01

    Activated carbon was chemically modified with 4-(8-hydroxyquinoline-azo)benzamidine and used for separation and preconcentration of trace amounts of Pb(II) in environmental samples by solid-phase extraction prior to the measurement by inductively coupled plasma atomic emission spectrometry. The effects of pH, shaking time, eluent concentration and volume, sample flow rate and potential interfering ions were studied. Under the optimum conditions, the enrichment factor was 100, the detection limits is 0. 43 ng mL -1 , and the relative standard deviations are <2. 1% (n = 8). The adsorption capacity of the sorbent is 53. 58 mg of lead(II) per gram of the material. The sorbent was successfully applied to the preconcentration of trace Pb(II) in the reference materials GBW 08301 (river sediment) and GBW 08302 (Tibet soil). The recovery of lead(II) from Yellow river water, Huangshui water, and tap water is in range of 99. 3-101. 6%. (author)

  2. Determination of Structural Requirements of N-Substituted Tetrahydro-β-Carboline Imidazolium Salt Derivatives Using in Silico Approaches for Designing MEK-1 Inhibitors

    Directory of Open Access Journals (Sweden)

    Jingwei Liang

    2017-06-01

    Full Text Available Novel N-substituted tetrahydro-β-carboline imidazolium salt derivatives proved to have potent antitumor activity in past research. The Topomer CoMFA and CoMSIA function in Sybyl-X 2.0 software was applied for the identification of important features of N-substituted tetrahydro-β-carboline-imidazolium salt derivative moieties. In the case of Topomer CoMFA, all the compounds were split into two fragments which were used to generate a 3D invariant representation, the statistical results of the Topomer CoMFA model: q2 value of 0.700; r2 value of 0.954; with 5 optimum components. The database alignment was utilized for building the CoMSIA model, and the CoMSIA model had q2 and r2 values of 0.615 and 0.897, with 4 optimum components. Target fishing of the PharmMapper platform was utilised for finding potential targets, the human mitogen-activated protein kinase 1 (MEK-1 was found to be the primary potential target for the three compounds with the fit scores of 6.288, 5.741, and 6.721. The molecular docking technique of MOE 2015 was carried out to identify the interactions of amino acids surrounding the ligand, and correlating QASR contour maps were used to identify structural requirements of N-substituted tetrahydro-β-carboline imidazolium salt moieties. Molecular dynamics and simulation studies proved that the target protein was stable for 0.8–5 ns. The pivotal moieties of N-substituted tetrahydro-β-carboline imidazolium salt derivatives and its potential targets were verified by the QASR study, PharmMapper, and the molecular docking study which would be helpful to design novel MEK-1 inhibitors for anticancer drugs.

  3. Efficient continuous-flow synthesis of novel 1,2,3-triazole-substituted β-aminocyclohexanecarboxylic acid derivatives with gram-scale production

    Directory of Open Access Journals (Sweden)

    Sándor B. Ötvös

    2013-07-01

    Full Text Available The preparation of novel multi-substituted 1,2,3-triazole-modified β-aminocyclohexanecarboxylic acid derivatives in a simple and efficient continuous-flow procedure is reported. The 1,3-dipolar cycloaddition reactions were performed with copper powder as a readily accessible Cu(I source. Initially, high reaction rates were achieved under high-pressure/high-temperature conditions. Subsequently, the reaction temperature was lowered to room temperature by the joint use of both basic and acidic additives to improve the safety of the synthesis, as azides were to be handled as unstable reactants. Scale-up experiments were also performed, which led to the achievement of gram-scale production in a safe and straightforward way. The obtained 1,2,3-triazole-substituted β-aminocyclohexanecarboxylates can be regarded as interesting precursors for drugs with possible biological effects.

  4. Exploring the potential of high resolution mass spectrometry for the investigation of lignin-derived phenol substitutes in phenolic resin syntheses.

    Science.gov (United States)

    Dier, Tobias K F; Fleckenstein, Marco; Militz, Holger; Volmer, Dietrich A

    2017-05-01

    Chemical degradation is an efficient method to obtain bio-oils and other compounds from lignin. Lignin bio-oils are potential substitutes for the phenol component of phenol formaldehyde (PF) resins. Here, we developed an analytical method based on high resolution mass spectrometry that provided structural information for the synthesized lignin-derived resins and supported the prediction of their properties. Different model resins based on typical lignin degradation products were analyzed by electrospray ionization in negative ionization mode. Utilizing enhanced mass defect filter techniques provided detailed structural information of the lignin-based model resins and readily complemented the analytical data from differential scanning calorimetry and thermogravimetric analysis. Relative reactivity and chemical diversity of the phenol substitutes were significant determinants of the outcome of the PF resin synthesis and thus controlled the areas of application of the resulting polymers. Graphical abstract ᅟ.

  5. Design and synthesis of dimethylaminomethyl-substituted curcumin derivatives/analogues: potent antitumor and antioxidant activity, improved stability and aqueous solubility compared with curcumin.

    Science.gov (United States)

    Fang, Xubin; Fang, Lei; Gou, Shaohua; Cheng, Lin

    2013-03-01

    A series of dimethylaminomethyl-substituted curcumin derivatives/analogues were designed and synthesized. All compounds effectively inhibited HepG2, SGC-7901, A549 and HCT-116 tumor cell lines proliferation in MTT assay. Particularly, compounds 2a and 3d showed much better activity than curcumin against all of the four tumor cell lines. Antioxidant test revealed that these compounds had higher free radical scavenging activity than curcumin towards both DPPH and galvinoxyl radicals. Furthermore, the aqueous solubility and stability of the target compounds were also significantly improved compared with curcumin. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Synthesis and Positive Inotropic Activity of [1,2,4]Triazolo[4,3-a] Quinoxaline Derivatives Bearing Substituted Benzylpiperazine and Benzoylpiperazine Moieties

    Directory of Open Access Journals (Sweden)

    Xue-Kun Liu

    2017-02-01

    Full Text Available In an attempt to search for more potent positive inotropic agents, two series of [1,2,4]triazolo[4,3-a] quinoxaline derivatives bearing substituted benzylpiperazine and benzoylpiperazine moieties were synthesized and their positive inotropic activities evaluated by measuring left atrial stroke volume in isolated rabbit heart preparations. Several compounds showed favorable activities compared with the standard drug, milrinone. Compound 6c was the most potent agent, with an increased stroke volume of 12.53% ± 0.30% (milrinone: 2.46% ± 0.07% at 3 × 10−5 M. The chronotropic effects of compounds having considerable inotropic effects were also evaluated.

  7. Synthesis and antitumor evaluation of some new N4 substituted sulfa pyridine derivatives with studying the synergistic effect of γ-irradiation

    International Nuclear Information System (INIS)

    Elsaid Agha, H.M.S.

    2011-01-01

    The aim of the present investigation is to synthesize a new class of N 4 substituted sulfa pyridine derivatives with anticipated cytotoxic activity. All the newly synthesized compounds were screened for their in-vitro cytotoxic activity against breast cancer cell line (MCF-7) compared to the reference drug Doxorubicin. Also the synergism of the most potent synthesized compounds with γ- radiation was studied. Moreover, a molecular docking study was carried out by docking the most active synthesized compounds in the active site of Cyclin Dependent Kinase 2 receptor to assess their inhibitory effect upon this enzyme as this may have a role in their anticancer activity.

  8. Synthesis and In Vitro Antiproliferative Activity of Novel Phenyl Ring-Substituted 5-Alkyl-12(H-quino[3,4-b][1,4]benzothiazine Derivatives

    Directory of Open Access Journals (Sweden)

    Andrzej Zięba

    2016-11-01

    Full Text Available A novel series of tetracyclic quinobenzothiazine derivatives was synthetized. Compounds containing a substituent (hydroxyl, methyl, phenyl, piperidyl, or piperazinyl in positions 9 and 11 were obtained by cyclization of suitable 4-aminoquinolinium-3-thiolates. Quinobenzothiazine 10-O-substituted derivatives were obtained by alkylating the hydroxyl group in position 10 of the parent (quinobenzothiazine system. Antiproliferative activity of the synthesized compounds was studied using cultured neoplastic cells (MDA-MB-231, SNB-19, and C-32 cell lines. Four selected compounds were investigated in more detail for cytotoxicity and antiproliferative effect. Transcriptional activity of genes regulating cell cycle (TP53, apoptosis (BAX, BCL-2, as well as proliferation (H3 were assessed. Finally, the ability of the selected compounds to bind DNA was checked in the presence of ethidium bromide.

  9. 2D QSAR studies of the inhibitory activity of a series of substituted purine derivatives against c-Src tyrosine kinase

    Directory of Open Access Journals (Sweden)

    Mukesh C. Sharma

    2016-07-01

    Full Text Available A series of 34 substituted purine analogues derivatives were subjected to quantitative structure-activity relationship analyses as inhibitors of c-Src tyrosine kinase. Partial least squares regression was applied to derive QSAR models, which were further validated for statistical significance by internal and external validation. The best QSAR model developed had a good predictive correlation coefficient (r2 of 0.8319, a significant cross-validated correlation coefficient (q2 of 0.7550, and an r2 for the external test set (pred_r2 of 0.7983. It was developed from the PLS method with descriptors including the SsCH3E-index, H-Donor Count, T_2_Cl_3, and negative correlation with SsOHcount. The current study provides better insight into the future design of more potent c-Src tyrosine kinase inhibitors prior to synthesis.

  10. Thermochemical studies on two alkyl-bulky substituted xanthene derivatives: 9,9-dimethylxanthene and 2,7-di-tert-butyl-9,9-dimethylxanthene

    International Nuclear Information System (INIS)

    Freitas, Vera L.S.; Gomes, José R.B.; Ribeiro da Silva, Maria D.M.C.

    2017-01-01

    Highlights: • Energetic characterization of two alkyl-bulky substituted xanthene derivatives. • Massic energies of combustion of xanthene derivatives. • Enthalpies of sublimation determined by vacuum drop microcalorimetry technique. • Temperature-vapour pressure dependence by mass-loss Knudsen effusion method. • Gas-phase enthalpies of formation of alkyl xanthene derivatives. - Abstract: Thermodynamic properties of 9,9-dimethylxanthene and 2,7-di-tert-butyl-9,9-dimethylxanthene for the condensed and gas states were derived from experimental and computational studies. Static-bomb combustion calorimetry, vacuum drop microcalorimetry and the Knudsen effusion techniques were used. Computational calculations of the enthalpies of hypothetical reactions in the gaseous phase, using the G3(MP2)//B3LYP composite method, were performed for the two xanthene derivatives. Natural bond orbital (NBO) calculations were also performed to ascertain the structure and reactivity of these compounds. The energetic effects caused by replacing hydrogen atoms in the xanthene moiety by methyl and tert-butyl groups yielding 9,9-dimethylxanthene and 2,7-di-tert-butyl-9,9-dimethylxanthene species were determined from direct comparison of their standard (p o = 0.1 MPa) molar enthalpies of formation in the gaseous phase, at T = 298.15 K.

  11. A zeta potential value determines the aggregate's size of penta-substituted [60]fullerene derivatives in aqueous suspension whereas positive charge is required for toxicity against bacterial cells.

    Science.gov (United States)

    Deryabin, Dmitry G; Efremova, Ludmila V; Vasilchenko, Alexey S; Saidakova, Evgeniya V; Sizova, Elena A; Troshin, Pavel A; Zhilenkov, Alexander V; Khakina, Ekaterina A; Khakina, Ekaterina E

    2015-08-08

    The cause-effect relationships between physicochemical properties of amphiphilic [60]fullerene derivatives and their toxicity against bacterial cells have not yet been clarified. In this study, we report how the differences in the chemical structure of organic addends in 10 originally synthesized penta-substituted [60]fullerene derivatives modulate their zeta potential and aggregate's size in salt-free and salt-added aqueous suspensions as well as how these physicochemical characteristics affect the bioenergetics of freshwater Escherichia coli and marine Photobacterium phosphoreum bacteria. Dynamic light scattering, laser Doppler micro-electrophoresis, agarose gel electrophoresis, atomic force microscopy, and bioluminescence inhibition assay were used to characterize the fullerene aggregation behavior in aqueous solution and their interaction with the bacterial cell surface, following zeta potential changes and toxic effects. Dynamic light scattering results indicated the formation of self-assembled [60]fullerene aggregates in aqueous suspensions. The measurement of the zeta potential of the particles revealed that they have different surface charges. The relationship between these physicochemical characteristics was presented as an exponential regression that correctly described the dependence of the aggregate's size of penta-substituted [60]fullerene derivatives in salt-free aqueous suspension from zeta potential value. The prevalence of DLVO-related effects was shown in salt-added aqueous suspension that decreased zeta potential values and affected the aggregation of [60]fullerene derivatives expressed differently for individual compounds. A bioluminescence inhibition assay demonstrated that the toxic effect of [60]fullerene derivatives against E. coli cells was strictly determined by their positive zeta potential charge value being weakened against P. phosphoreum cells in an aquatic system of high salinity. Atomic force microscopy data suggested that the

  12. Synthesis of new oxovanadium (IV) complexes of potential insulinmimetic activity with coumarin-3-carboxylic acid ligands and substituted derivatives

    International Nuclear Information System (INIS)

    Salas Fernandez, Paloma; Alvino de la Sota, Nora; Galli Rigo-Righi, Carla

    2013-01-01

    This work comprises the design and synthesis of four new oxovanadium (IV) complexes, a metal which possesses insulin-mimetic action. Coumarin-3-carboxylic acid and three of its 6 -and 6,8- derivatives were used as ligands. Coumarins are of interest due to their well-known biological properties and pharmacological applications; these include the insulino-sensibilizing effect of certain alcoxy-hydroxy-derivatives which might lead to the eventual existence of a synergetic effect with the active metal center. The synthesis of the vanadyl complexes was preceded by the synthesis of the coumarin-3-carboxylic acid and its 6-bromo- derivative, as well as the syntheses of three derivatives not previously reported: 6-bromo-8-metoxi-, 6-bromo-8-nitro-, and 6-bromo-8-hydroxy-, which were prepared by a Knoevenagel condensation reaction. The complexes, on their part, were prepared by a metathesis reaction between VOSO 4 and the corresponding ligands, on the basis of methods reported for other vanadyl complexes and under strict pH control. The coumarin-3-carboxylic ligands and the derivatives were characterized by 1 H-NMR-, FTIR- and UV-Vis-spectroscopy. In the case of the complexes, their paramagnetic character did not allow for NMR characterization, being thus identified by FT-IR-spectroscopy and by the quantitative determination of their vanadium contents. (author)

  13. Synthesis, antiviral evaluation and molecular docking studies of N4-aryl substituted/unsubstituted thiosemicarbazones derived from 1-indanones as potent anti-bovine viral diarrhea virus agents.

    Science.gov (United States)

    Soraires Santacruz, María C; Fabiani, Matías; Castro, Eliana F; Cavallaro, Lucía V; Finkielsztein, Liliana M

    2017-08-01

    A series of N 4 -arylsubstituted thiosemicarbazones derived from 1-indanones and a set of compounds lacking such substitution in the N 4 position of the thiosemicarbazone moiety were synthesized and evaluated for their anti-bovine viral diarrhea virus (BVDV) activity. Among these, derivatives 2 and 15 displayed high activity (EC 50 =2.7±0.4 and 0.7±0.1µM, respectively) as inhibitors of BVDV replication. Novel key structural features related to the anti-BVDV activity were identified by structure-activity relationship (SAR) analysis. In a previous study, the thiosemicarbazone of 5,6-dimethoxy-1-indanone (5,6-TSC) was characterized as a non-nucleoside inhibitor (NNI) of the BVDV RNA-dependent RNA polymerase. In the present work, cross-resistance assays were performed with the most active compounds. Such studies were carried out on 5,6-TSC resistant BVDV (BVDV-TSC r T1) carrying mutations in the viral polymerase. This BVDV mutant was also resistant to compound 15. Molecular docking studies and MM/PBSA calculations were performed to assess the most active derivatives at the 5,6-TSC viral polymerase binding site. The differences in the interaction pattern and the binding affinity of derivative 15 either to the wild type or BVDV-TSC r T1 polymerase were key factors to define the mode of action of this compound. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Correlations between retention indices and molecular structure of their benzoyl derivatives on phenyl substituted polysiloxane stationary phases

    International Nuclear Information System (INIS)

    Pias, J.B.; Gasco, L.

    1976-01-01

    The retention indices of aliphaticalcohols of carbon number up to Csub(g), and of their benzoyl derivatives up to C 7 , were determined in columns packed with Chromosorb G (AW-DMCS-HP) coated previously with 5% methyl, and methyl phenyl polysiloxanes with increasing polarity (SE-30, OV-3, OV-7; OV-11, OV-17 and OV-25). Correlations between retention indices and chain length for 1-alcohols, 2-alcohols, 3-alcohols, 1, on -3-alcohols, 2-methyl-1-alcohols and for their corresponding benzoyl derivatives were calculated at 100, 120 and 140 0 C. In alcohols, a -CH 2 - group increases I approximately 100 units, and in their benzoyl derivatives from 80 to 100 units. Dispersion indices ΔI, and positional and structural increments of I were evaluated for -OH and benzoyl groups in terms for phase polarity and chain length. Effects of chain length, chain branching and double bond location on retention parameters were also studied. (author)

  15. Novel derivatives of 5,6-dimethoxy-1-indanone coupled with substituted pyridine as potential antimicrobial agents

    Directory of Open Access Journals (Sweden)

    Vimal M. Patel

    2018-01-01

    Full Text Available Synthesis of novel derivatives of 5,6-dimethoxy-1-indanone was carried out via its Schiff’s base using 2-cyanoacetohydrazide followed by cyclization with 2-arylidenemalononitrile in the presence of a catalytical amount of piperidine to get 6-amino-1-(5,6-dimethoxy-2,3-dihydro-1H-inden-1-ylideneamino-2-oxo-4-aryl-1,2-dihydropyridine-3,5-dicarbonitrile derivatives. The structures of the synthesized compounds were confirmed on the basis of their spectral and elemental analysis. The synthesized compounds were also screened for antimicrobial activity and found to have promising antibacterial activity.

  16. Novel derivatives of 5,6-dimethoxy-1-indanone coupled with substituted pyridine as potential antimicrobial agents

    OpenAIRE

    Vimal M. Patel; Nilay D. Bhatt; Pralav V. Bhatt; Hasmukh D. Joshi

    2018-01-01

    Synthesis of novel derivatives of 5,6-dimethoxy-1-indanone was carried out via its Schiff’s base using 2-cyanoacetohydrazide followed by cyclization with 2-arylidenemalononitrile in the presence of a catalytical amount of piperidine to get 6-amino-1-(5,6-dimethoxy-2,3-dihydro-1H-inden-1-ylideneamino)-2-oxo-4-aryl-1,2-dihydropyridine-3,5-dicarbonitrile derivatives. The structures of the synthesized compounds were confirmed on the basis of their spectral and elemental analysis. The synthesized ...

  17. Isovanillin derived N-(un)substituted hydroxylamines possessing an ortho-allylic group: valuable precursors to bioactive N-heterocycles.

    Science.gov (United States)

    Dulla, Balakrishna; Tangellamudi, Neelima D; Balasubramanian, Sridhar; Yellanki, Swapna; Medishetti, Raghavender; Kumar Banote, Rakesh; Hari Chaudhari, Girish; Kulkarni, Pushkar; Iqbal, Javed; Reiser, Oliver; Pal, Manojit

    2014-04-28

    The intramolecular 1,3-dipolar cycloaddition of isovanillin derived N-aryl hydroxylamines possessing ortho-allylic dipolarophiles affords novel benzo analogues of tricyclic isoxazolidines that can be readily transformed into functionalized lactams, γ-aminoalcohols and oxazepines. The corresponding N-unsubstituted hydroxylamines give rise to tetrahydroisoquinolines. Anxiogenic properties of these compounds are tested in zebra fish.

  18. Novel iron complexes bearing N6-substituted adenosine derivatives: Synthesis, magnetic, Fe-57 Mossbauer, DFT, and in vitro cytotoxicity studies

    Czech Academy of Sciences Publication Activity Database

    Trávníček, Zdeněk; Mikulík, J.; Čajan, Michal; Zbořil, R.; Popa, Igor

    2008-01-01

    Roč. 16, č. 18 (2008), s. 8719-8728 ISSN 0968-0896 Institutional research plan: CEZ:AV0Z50380511 Keywords : iron complexes * adenosine derivatives * Fe-57 Mossbauer spectroscopy Subject RIV: CE - Biochemistry Impact factor: 3.075, year: 2008

  19. Synthesis and Biological Activity of Substituted Urea and Thiourea Derivatives Containing 1,2,4-Triazole Moieties

    Science.gov (United States)

    2013-03-19

    reader. Sp -1 was used as a control transcription factor to evaluate the toxicity of tested compounds in the same assay and parthenolide was used as a...enantiomers of chiral γ-Aryl-1H-1,2,4-triazole derivatives and Penicillium digitatum. J. Agric. Food Chem. 2009, 57, 6914–6919. 22. Crank, G.; Neville, M

  20. Three Component Synthesis of Substituted 4H-[1,3]Dioxin Derivatives Under Solvent-Free Conditions

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Hosseini-Tabatabaei

    2012-01-01

    Full Text Available Reaction between aryl aldehydes, acetylacetone and alkyl isocyanides in solvent-free conditions provided a simple and efficient one-pot route for the synthesis of 1-(2-alkylamino-6-methyl-4-aryl-4H-[1,3]dioxin-5-ylethanone derivatives in excellent yields.

  1. Substitutional Carbon-Modified Anatase TiO2 Decahedral Plates Directly Derived from Titanium Oxalate Crystals via Topotactic Transition.

    Science.gov (United States)

    Niu, Ping; Wu, Tingting; Wen, Lei; Tan, Jun; Yang, Yongqiang; Zheng, Shijian; Liang, Yan; Li, Feng; Irvine, John Ts; Liu, Gang; Ma, Xiuliang; Cheng, Hui-Ming

    2018-03-30

    Changing the composition and/or structure of some metal oxides at the atomic level can significantly improve their performance in different applications. Although many strategies have been developed, the introduction of heteroatoms, particularly anions to the internal part of metal oxide particles, is still not adequate. Here, an effective strategy is demonstrated for directly preparing polycrystalline decahedral plates of substitutional carbon-doped anatase TiO 2 from titanium (IV) oxalate by a thermally induced topotactic transition in an inert atmosphere. Because of the carbon concentration gradient introduced in side of the plates, the carbon-doped TiO 2 (TiO 2- x C x ) shows an increased visible light absorption and a two orders of magnitude higher electrical conductivity than pure TiO 2 . Consequently, it can be used as a photocatalyst and an active material for lithium storage and shows much superior activity in generating hydroxyl radicals under visible light and greatly increased electrical-specific capacity at high charge-discharge rates. The strategy developed could also be applicable to the atomic-scale modification of other metal oxides. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Electric Dipole Transition Moments and Solvent-Dependent Interactions of Fluorescent Boron-Nitrogen Substituted Indole Derivatives.

    Science.gov (United States)

    Saif, Mari; Widom, Julia R; Xu, Senmiao; Abbey, Eric R; Liu, Shih-Yuan; Marcus, Andrew H

    2015-06-25

    Fluorescent analogues of the indole side chain of tryptophan can be useful spectroscopic probes of protein-protein and protein-DNA interactions. Here we present linear dichroism and solvent-dependent spectroscopic studies of two fluorescent analogues of indole, in which the organic C═C unit is substituted with the isosteric inorganic B-N unit. We studied the so-called "external" BN indole, which has C2v symmetry, and the "fused" BN indole with Cs symmetry. We performed a combination of absorption and fluorescence spectroscopy, ultraviolet linear dichroism (UV-LD) in stretched poly(ethylene) (PE) films, and quantum chemical calculations on both BN indole compounds. Our measurements allowed us to characterize the degree of alignment for both molecules in stretched PE films. We thus determined the orientations and magnitudes of the two lowest energy electric dipole transition moments (EDTMs) for external BN indole, and the two lowest energy EDTMs for fused BN indole within the 30 000-45 000 cm(-1) spectral range. We compared our experimental results to those of quantum chemical calculations using standard density functional theory (DFT). Our theoretical predictions for the low-energy EDTMs are in good agreement with our experimental data. The absorption and fluorescence spectra of the external and the fused BN indoles are sensitive to solvent polarity. Our results indicate that the fused BN indole experiences much greater solvation interactions with polar solvents than does the external BN indole.

  3. Synthesis, structurale elucidation and antioxidant study of Ortho-substituted N,N’-bis(benzamidothiocarbonyl)hydrazine derivatives

    Science.gov (United States)

    Firdausiah, Syadza; Hasbullah, S. A.; Yamin, B. M.

    2018-03-01

    Some bis(thiourea) compounds have been reported to posses excellent performance in pharmaceutical and environmental fields because of their ability to form chelating complexes with various anions and metal ions. Structurally for carbonyl thiourea derivatives, to become a chelating agent, it must adopt cis-configuration. In the present study, four new bis(thiourea) derivatives namely N,N’-bis(o-fluorobenzamidothiocarbonyl)hydrazine (1), N,N’- bis(o-chloro-benzamidothiocarbonyl)hydrazine (2), N,N’-bis(o-nitrobenzamidothiocarbonyl)-hydrazine (3), and N,N’-bis(o-methylbenzamidothiocarbonyl)hydrazine (4) were successfully synthesized and characterized by CHNS microelemental analysis, FTIR, UV-Vis, and 1H and 13C NMR spectroscopy. However chemical crystallography study showed that both thiourea moieties in compound (2) and (3) adopt trans geometry. Therefore they are potential monodentate ligand with two active moieties. DPPH radical scavenging experiment showed that compound (1), (2), and (4) exhibited higher antioxidant activity than ascorbic acid (Vitamin C).

  4. Design, synthesis and anticonvulsant activity evaluation of 7-substituted-4H-[1,2,4]triazino[3,4-alpha]phthalazin-4-one derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Xian-Yu; Quan, Zhe-Shan [Yanbian Univ., Yanji, Jilin (China). Key Lab. of Organism Functional Factors of the Changbai Mountain; Yanbian Univ., Yanji, Jilin (China). Coll. of Pharmacy; Guan, Li-Ping; Zhang, Lei; Wei, Cheng-Xi; Piao, Hu-Ri [Yanbian Univ., Yanji, Jilin (China). Key Lab. of Organism Functional Factors of the Changbai Mountain

    2009-07-01

    In this study, a novel series of 7-substituted-4H-[1,2,4]triazino[3,4-a]phthalazin-4-one derivatives was synthesized as potential anticonvulsant agents. Their anticonvulsant activities were evaluated by the maximal electroshock (MES) test, and their neurotoxicities were evaluated by the rotarod neurotoxicity test. The pharmacological results showed that 7-hexyloxy-4H-[1,2,4]triazino[3,4-alpha]phthalazin-4-one 4e was the most potent with median effective dose (ED{sub 50}) value of 6.6 mg kg-1, median toxicity dose (TD{sub 50}) of 39.4 mg kg{sup -1}, providing a protective index (PI=TD{sub 50} /ED{sub 50}) value of 6.0. (author)

  5. One-step synthesis of an {sup 18}F-labeled boron-derived methionine analog. A substitute for {sup 11}C-methionine?

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhen; Lan, Xiaoli [Huazhong University of Science and Technology, Department of Nuclear Medicine, Union Hospital, Tongji Medical College, Wuhan (China); Huazhong University of Science and Technology, Hubei Key Laboratory of Molecular Imaging, Union Hospital, Tongji Medical College, Wuhan (China); Ehlerding, Emily B. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Cai, Weibo [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Carbone Cancer Center, Madison, WI (United States)

    2018-04-15

    Amino acid-based tracers have been extensively investigated for positron emission tomography (PET) imaging of brain tumors, and {sup 11}C-methionine ({sup 11}C-MET) is one of the most extensively investigated. However, widespread clinical use of {sup 11}C-MET is challenging due to the short half-life of {sup 11}C and low radiolabeling yield. In this issue of the European Journal of Nuclear Medicine and Molecular Imaging, Yang and colleagues report an {sup 18}F-labeled boron-derived methionine analog, {sup 18}F-B-MET, as a potential substitute for {sup 11}C-MET in PET imaging of glioma. The push-button synthesis, highly efficient radiolabeling, and good imaging performance in glioma models make this tracer a promising candidate for future clinical translation. (orig.)

  6. Substituent effects on the electronic characteristics of pentacene derivatives for organic electronic devices: dioxolane-substituted pentacene derivatives with triisopropylsilylethynyl functional groups.

    Science.gov (United States)

    Griffith, Olga Lobanova; Anthony, John E; Jones, Adolphus G; Shu, Ying; Lichtenberger, Dennis L

    2012-08-29

    The intramolecular electronic structures and intermolecular electronic interactions of 6,13-bis(triisopropylsilylethynyl)pentacene (TIPS pentacene), 6,14-bis-(triisopropylsilylethynyl)-1,3,9,11-tetraoxa-dicyclopenta[b,m]-pentacene (TP-5 pentacene), and 2,2,10,10-tetraethyl-6,14-bis-(triisopropylsilylethynyl)-1,3,9,11-tetraoxa-dicyclopenta[b,m]pentacene (EtTP-5 pentacene) have been investigated by the combination of gas-phase and solid-phase photoelectron spectroscopy measurements. Further insight has been provided by electrochemical measurements in solution, and the principles that emerge are supported by electronic structure calculations. The measurements show that the energies of electron transfer such as the reorganization energies, ionization energies, charge-injection barriers, polarization energies, and HOMO-LUMO energy gaps are strongly dependent on the particular functionalization of the pentacene core. The ionization energy trends as a function of the substitution observed for molecules in the gas phase are not reproduced in measurements of the molecules in the condensed phase due to polarization effects in the solid. The electronic behavior of these materials is impacted less by the direct substituent electronic effects on the individual molecules than by the indirect consequences of substituent effects on the intermolecular interactions. The ionization energies as a function of film thickness give information on the relative electrical conductivity of the films, and all three molecules show different material behavior. The stronger intermolecular interactions in TP-5 pentacene films lead to better charge transfer properties versus those in TIPS pentacene films, and EtTP-5 pentacene films have very weak intermolecular interactions and the poorest charge transfer properties of these molecules.

  7. Novel biotransformation process of podophyllotoxin to 4 β-sulfur-substituted podophyllum derivates with anti-tumor activity by Penicillium purpurogenum Y.J. Tang.

    Science.gov (United States)

    Bai, J-K; Zhao, W; Li, H-M; Tang, Y-J

    2012-01-01

    According to the structure-function relationship of podophyllotoxin (PTOX) and its analogue of 4'- demethylepipodophyllotoxin (DMEP), the 4 β-substitution of sulfur-containing heterocyclic compounds with a carbon-sulfur bond at 4 position of PTOX or DMEP is an essential modification direction for improving the anti-tumor activity. So, four novel 4 β-sulfursubstituted podophyllum derivatives (i.e., 4β -(1,2,4-triazole-3-yl)sulfanyl-4-deoxy-podophyllotoxin (4-MT-PTOX), 4β-(1,3,4- thiadiazole-2-yl)sulfanyl-4-deoxy-podophyllotoxin (4-MTD-PTOX), 4β-(1,2,4-triazole-3-yl)sulfanyl-4-deoxy-4' -demethylepipodophyllotoxin (4-MT-DMEP), and 4β-(1,3,4-thiadiazole-2-yl)sulfanyl-4-deoxy-4'-demethylepipodophyllotoxin (4-MTD-DMEP)) were designed and then successfully biosynthesized in this work. In the novel sulfur-substituted biotransformation processes, PTOX and DMEP was linked with sulfur-containing compounds (i.e., 3-mercapto-1,2,4-triazole (MT) and 2-mercapto-1,3,4-thiadiazole (MTD)) at 4 position of cycloparaffin to produce 4-MT-PTOX (1), 4-MTD-PTOX (2), 4-MT-DMEP (3), and 4-MTD-DMEP (4) by Penicillium purpurogenum Y.J. Tang, respectively, which was screened out from Diphylleia sinensis Li (Hubei, China). All the novel compounds exhibited promising in vitro bioactivity, especially 4-MT-PTOX (1). Compared with etoposide (i.e., a 50 % effective concentration [EC(50)] of 25.72, 167.97, and 1.15 M), the EC(50) values of 4-MT-PTOX (1) against tumor cell line BGC-823, A549 and HepG2 (i.e., 0.28, 0.76, and 0.42 M) were significantly improved by 91, 221 and 2.73 times, respectively. Moreover, the EC(50) value of 4-MT-PTOX (1) against the normal human cell line HK-2 (i.e., 182.4 μM) was 19 times higher than that of etoposide (i.e., 9.17 μM). Based on the rational design, four novel 4 β-sulfur-substituted podophyllum derivatives with superior in vitro anti-tumor activity were obtained for the first time. The correctness of structure-function relationship and rational drug

  8. Synthesis and evaluation of fluorine-substituted phenyl acetate derivatives as ultra-short recovery sedative/hypnotic agents.

    Directory of Open Access Journals (Sweden)

    Heng Zhang

    Full Text Available BACKGROUND: Soft drugs are molecules that are purposefully designed to be rapidly metabolized (metabolically labile. In anesthesia, the soft drug is useful because it enables precise titration to effect and rapid recovery, which might allow swift and clear-headed recovery of consciousness and early home readiness. Propofol may cause delayed awakening after prolonged infusion. Propanidid and AZD3043 have a different metabolic pathway compared to propofol, resulting in a short-acting clinical profile. Fluorine imparts a variety of properties to certain medicines, including an enhanced absorption rate and improved drug transport across the blood-brain barrier. We hypothesized that the introduction of fluorine to the frame structure of propanidid and AZD3043 would further accelerate the swift and clear-headed recovery of consciousness. To test this hypothesis, we developed a series of fluorine-containing phenyl acetate derivatives. METHODOLOGY/PRINCIPAL FINDINGS: Fluorine-containing phenyl acetate derivatives were synthesized, and their hypnotic potencies and durations of LORR following bolus or infusion administration were determined in mice, rats and rabbits. The metabolic half-lives in the blood of various species were determined chromatographically. In vitro radioligand binding and γ-aminobutyric acidA (GABAA receptor electrophysiology studies were performed. Among the 12 synthesized fluorine-containing phenyl acetate derivatives, compound 5j induced comparable duration of LORR with AZD3043, but more rapid recovery than AZD3043, propanidid and propofol. The time of compound 5j to return to walk and behavioral recovery are approximately reduced by more than 50% compared to AZD3043 in mice and rats and rabbits. The HD50 of compound 5j decreased with increasing animal size. CONCLUSIONS/SIGNIFICANCE: The rapid recovery might make compound 5j suitable for precise titration and allow swift and clear-headed recovery of consciousness and early home

  9. 40 CFR Appendix D to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes

    Science.gov (United States)

    2010-07-01

    ... the following criteria, derived from Society of Automotive Engineers (SAE) standards and recommended... Substitutes] Application Substitute Decision Conditions Comments Electronics Cleaning w/CFC-113 and MCF HFC... Sector [Acceptable Subject to Narrowed Use Limits] Application Substitute Decision Comments Electronics...

  10. Novel Terthiophene-Substituted Fullerene Derivatives as Easily Accessible Acceptor Molecules for Bulk-Heterojunction Polymer Solar Cells

    Directory of Open Access Journals (Sweden)

    Filippo Nisic

    2014-01-01

    Full Text Available Five fulleropyrrolidines and methanofullerenes, bearing one or two terthiophene moieties, have been prepared in a convenient way and well characterized. These novel fullerene derivatives are characterized by good solubility and by better harvesting of the solar radiation with respect to traditional PCBM. In addition, they have a relatively high LUMO level and a low band gap that can be easily tuned by an adequate design of the link between the fullerene and the terthiophene. Preliminary results show that they are potential acceptors for the creation of efficient bulk-heterojunction solar cells based on donor polymers containing thiophene units.

  11. Increased Water Solubility of the Curcumin Derivatives via Substitution with an Acetoxy Group at the Central Methylene Moiety

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Mi Kyoung; Mok, Hyejung; Chong, Youhoon [Konkuk Univ., Seoul (Korea, Republic of)

    2012-09-15

    Curcumin (diferuloyl methane), a natural yellow pigment in the roots of turmeric, has been considered as one of the most promising chemopreventive agents against a variety of human cancers. Curcumin is known to exhibit its antiproliferative effect against various cancer cells through cell cycle arrest and induction of apoptosis. Although not as potent as many other cytotoxic agents, curcumin has been demonstrated to be safe in humans at relatively high doses (10 grams/day), making it an attractive target for chemotherapeutic drug discovery efforts. Two compounds with meta-methoxy substituents (2 and 3) maintained comparable antiproliferative activity with curcumin (1). In contrast, the acetoxy-curcuminoids (8-14) showed moderate to potent activity against all three cancer cell lines tested (Table 1). In particular, the colon cancer cell (HCT116) was most susceptible to the acetoxy-curcuminoids (8-12, Table 1) to show 2-2.5 times increase in EC{sub 50} values compared with that of curcumin (1, Table 1). In this series, like the simple curcuminoids (2-7), the aromatic meta-methoxy substituent turned out to be critical for the antiproliferative effect, and the corresponding acetoxy-curcuminoids 10 and 11 showed the most potent activity against HCT116 with EC{sub 50} values of 18.5 μM and 16.9 μM, respectively. Also noteworthy is the broad spectrum antiproliferative effect of the acetoxy-curcuminoid 11 with a free catechol moiety, which exhibited almost similar antiproliferative activity against all three cancer cell lines tested. Taken together, through evaluation of solubility as well as antiproliferative effect of the acetoxy-curcuminoids, we figured out that the acetoxy group substituted at the central methylene unit which served to enhance the solubility of the corresponding curcuminoids also played a key role in potentiating their antiproliferative effect. Thus, upon combination of the methylenyl acetoxy group and the aromatic meta-methoxy group on the curcumin

  12. Increased Water Solubility of the Curcumin Derivatives via Substitution with an Acetoxy Group at the Central Methylene Moiety

    International Nuclear Information System (INIS)

    Kim, Mi Kyoung; Mok, Hyejung; Chong, Youhoon

    2012-01-01

    Curcumin (diferuloyl methane), a natural yellow pigment in the roots of turmeric, has been considered as one of the most promising chemopreventive agents against a variety of human cancers. Curcumin is known to exhibit its antiproliferative effect against various cancer cells through cell cycle arrest and induction of apoptosis. Although not as potent as many other cytotoxic agents, curcumin has been demonstrated to be safe in humans at relatively high doses (10 grams/day), making it an attractive target for chemotherapeutic drug discovery efforts. Two compounds with meta-methoxy substituents (2 and 3) maintained comparable antiproliferative activity with curcumin (1). In contrast, the acetoxy-curcuminoids (8-14) showed moderate to potent activity against all three cancer cell lines tested (Table 1). In particular, the colon cancer cell (HCT116) was most susceptible to the acetoxy-curcuminoids (8-12, Table 1) to show 2-2.5 times increase in EC 50 values compared with that of curcumin (1, Table 1). In this series, like the simple curcuminoids (2-7), the aromatic meta-methoxy substituent turned out to be critical for the antiproliferative effect, and the corresponding acetoxy-curcuminoids 10 and 11 showed the most potent activity against HCT116 with EC 50 values of 18.5 μM and 16.9 μM, respectively. Also noteworthy is the broad spectrum antiproliferative effect of the acetoxy-curcuminoid 11 with a free catechol moiety, which exhibited almost similar antiproliferative activity against all three cancer cell lines tested. Taken together, through evaluation of solubility as well as antiproliferative effect of the acetoxy-curcuminoids, we figured out that the acetoxy group substituted at the central methylene unit which served to enhance the solubility of the corresponding curcuminoids also played a key role in potentiating their antiproliferative effect. Thus, upon combination of the methylenyl acetoxy group and the aromatic meta-methoxy group on the curcumin framework

  13. Synthesis, linear and nonlinear optical properties of phosphonato-substituted bithiophenes derived from 2,2'-biphenol.

    Science.gov (United States)

    Freeman, Jason L; Zhao, Qun; Zhang, Yuanli; Wang, Jianwei; Lawson, Christopher M; Gray, Gary M

    2013-10-21

    Two new series of phosphonato-substituted bithiophenes, BpP(X)(C4H2S)2H and BpP(X)(C4H2S)2P(X)Bp (Bp = 2,2'-C12H8O2, X = O, S, Se), have been synthesized and characterized using linear absorption and emission spectra, and third-order nonlinear absorption measurements at 430 nm with 27 ps laser pulses. The compounds were synthesized in three steps: (1) reacting lithiated bithiophene with (Et2N)2PCl; (2) reacting the product from the first step with biphenol; and (3) reacting the product from the second step with the appropriate chalcogen. The X-ray crystal structures of two of the compounds, BpP(O)(C4H2S)2P(O)Bp and BpP(Se)(C4H2S)2P(Se)Bp, are reported and show a number of intermolecular π-π interactions. The linear absorption spectra, emission spectra, and emission quantum yields show distinct trends with respect to the chalcogen and the number of phosphorus substituents attached to the 2,2'-bithiophene ring. The compounds show emission maxima at wavelengths ranging from 380-400 nm and, BpP(S)(C4H2S)2H shows a 23-fold increase in fluorescence quantum yield relative to that of 2,2'-bithiophene. Fluorescence lifetimes and radiative and non-radiative decay rate constants for the first singlet excited state have been extracted from the quantum yields using time-dependent DFT calculations. Nonlinear transmission measurements indicate that all of the compounds show nonlinear absorption at 430 nm with 27 ps laser pulses in spite of their low solubilities. Notably, the nonlinear absorption threshold of a 0.16 mol L(-1) CH2Cl2 solution of BpP(Se)(C4H2S)2H is 0.9 J cm(-2). The excellent emission quantum yields and good nonlinear absorptions make these compounds promising candidates for optical power limiting applications and as host materials for violet-blue organic light emitting diodes.

  14. Synthesis, Antiproliferative and Antifungal Activities of 1,2,3-Triazole-Substituted Carnosic Acid and Carnosol Derivatives

    Directory of Open Access Journals (Sweden)

    Mariano Walter Pertino

    2015-05-01

    Full Text Available Abietane diterpenes exhibit an array of interesting biological activities, which have generated significant interest among the pharmacological community. Starting from the abietane diterpenes carnosic acid and carnosol, twenty four new triazole derivatives were synthesized using click chemistry. The compounds differ in the length of the linker and the substituent on the triazole moiety. The compounds were assessed as antiproliferative and antifungal agents. The antiproliferative activity was determined on normal lung fibroblasts (MRC-5, gastric epithelial adenocarcinoma (AGS, lung cancer (SK-MES-1 and bladder carcinoma (J82 cells while the antifungal activity was assessed against Candida albicans ATCC 10231 and Cryptococcus neoformans ATCC 32264. The carnosic acid γ-lactone derivatives 1–3 were the most active antiproliferative compounds of the series, with IC50 values in the range of 43.4–46.9 μM and 39.2–48.9 μM for MRC-5 and AGS cells, respectively. Regarding antifungal activity, C. neoformans was the most sensitive fungus, with nine compounds inhibiting more than 50% of its fungal growth at concentrations ≤250 µg∙mL−1. Compound 22, possessing a p-Br-benzyl substituent on the triazole ring, showed the best activity (91% growth inhibition at 250 µg∙mL−1 In turn, six compounds inhibited 50% C. albicans growth at concentrations lower than 250 µg∙mL−1.

  15. Synthesis and Anti-Inflammatory Activity of New Alkyl-Substituted Phthalimide 1H-1,2,3-Triazole Derivatives

    Directory of Open Access Journals (Sweden)

    Shalom Pôrto de Oliveira Assis

    2012-01-01

    Full Text Available Four new 1,2,3-triazole phthalimide derivatives with a potent anti-inflammatory activity have been synthesized in the good yields by the 1,3-dipolar cycloaddition reaction from N-(azido-alkylphthalimides and terminal alkynes. The anti-inflammatory activity was determined by injecting carrageenan through the plantar tissue of the right hind paw of Swiss white mice to produce inflammation. All the compounds 3a–c and 5a–c exhibited an important anti-inflammatory activity; the best activity was found for the compounds 3b and 5c, which showed to be able to decrease by 69% and 56.2% carrageenan-induced edema in mice. These compounds may also offer a future promise as a new anti-inflammatory agent.

  16. Septipyridines as conformationally controlled substitutes for inaccessible bis(terpyridine-derived oligopyridines in two-dimensional self-assembly

    Directory of Open Access Journals (Sweden)

    Daniel Caterbow

    2011-07-01

    Full Text Available The position of the peripheral nitrogen atoms in bis(terpyridine-derived oligopyridines (BTPs has a strong impact on their self-assembly behavior at the liquid/HOPG (highly oriented pyrolytic graphite interface. The intermolecular hydrogen bonding interactions in these peripheral pyridine units show specific 2D structures for each BTP isomer. From nine possible constitutional isomers only four have been described in the literature. The synthesis and self-assembling behavior of an additional isomer is presented here, but the remaining four members of the series are synthetically inaccessible. The self-assembling properties of three of the missing four BTP isomers can be mimicked by making use of the energetically preferred N–C–C–N transoid conformation between 2,2'-bipyridine subunits in a new class of so-called septipyridines. The structures are investigated by scanning tunneling microscopy (STM and a combination of force-field and first-principles electronic structure calculations.

  17. Synthesis and Biological Activity of Substituted Urea and Thiourea Derivatives Containing 1,2,4-Triazole Moieties

    Directory of Open Access Journals (Sweden)

    David E. Wedge

    2013-03-01

    Full Text Available A series of novel thiourea and urea derivatives containing 1,2,4-triazole moieties were synthesized and evaluated for their antifungal and larvicidal activity. Triazole derivatives 3a–e and 4a–e were synthesized by reacting thiocarbohydrazide with thiourea and urea compounds 1a–e and 2a–e, respectively, in a 130–140 °C oil bath. The proposed structures of all the synthesized compounds were confirmed using elemental analysis, UV, IR, 1H-NMR and mass spectroscopy. All compounds were evaluated for antifungal activity against plant pathogens, larvicidal and biting deterrent activity against the mosquito Aedes aegypti L. and in vitro cytotoxicity and anti-inflammatory activity against some human cell lines. Phomopis species were the most sensitive fungi to these compounds. Compounds 1b, 1c, 3a and 4e demonstrated selectively good activity against Phomopis obscurans and only 1b and 4e showed a similar level of activity against P. viticola. Compound 3d, with a LD50 value of 67.9 ppm, followed by 1c (LD50 = 118.8 ppm and 3e (LD50 = 165.6 ppm, showed the highest toxicity against Aedes aegypti larvae. Four of these compounds showed biting deterrent activity greater than solvent control, with the highest activity being seen for 1c, with a proportion not biting (PNB value of 0.75, followed by 1e, 2b and 1a. No cytotoxicity was observed against the tested human cancer cell lines. No anti-inflammatory activity was observed against NF-kB dependent transcription induced by phorbol myristate acetate (PMA in human chondrosarcoma cells.

  18. Synthesis and in vitro cytotoxicity of novel C-12 substituted-14-deoxy-andrographolide derivatives as potent anti-cancer agents.

    Science.gov (United States)

    Kandanur, Sai Giridhar Sarma; Golakoti, Nageswara Rao; Nanduri, Srinivas

    2015-12-15

    Andrographolide, the major labdane diterpenoid from Andrographis paniculata has been reported to be cytotoxic against various cancer cells in vitro. Our research efforts led to the discovery of novel 12-phenyl thio and 12-aryl amino-14-deoxy-andrographolide derivatives (III q and III r) with potent cytotoxic activity, 12-benzyl amino-14-deoxy-andrographolide analogues showing broad range of cytotoxic activity against most of the cell lines and 12-alkyl amino-14-deoxy-andrographolide derivatives being selective to few cell lines (PC-3 and HOP-92), when the selected analogues were evaluated against 60 human cancer cell line panel at National Cancer Institute (N.C.I.), USA. The SAR (structure activity relationship) studies demonstrated potent activity for the compounds containing the following functionalities at C-12: substituted aryl amino/phenyl thio>benzylamine>alkyl amine. The significant cytotoxic activity observed for compounds III q and III r suggest that these could serve as templates for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Biological effects and repair of damage photoinduced by a derivative of psoralen substituted at the 3,4 reaction site

    International Nuclear Information System (INIS)

    Averbeck, D.; Moustacchi, E.; Bisagni, E.

    1978-01-01

    A newly-synthesized linear psoralen derivative, 3-carbethoxypsoralen is shown to bind to yeast nucleic acids after 365-nm light treatment. As compared to 8-methoxypsoralen, a well-known bifunctional furocoumarin, 3-carbethoxypsoralen exhibits a high photoaffinity for DNA in vivo. Both compounds bind and photoreact more efficiently in vivo than in vitro. In contrast to 8-methoxypsoralen, 3-carbethoxypsoralen does not form cross-links in yeast DNA as demonstrated by heat denaturation-reassociation studies at least in the ranges of doses used. Thus 3-carbethoxypsoralen reacts as a monofunctional compound. Wild-type cells of Saccharomyces cerevisiae are 6 times more resistant to 3-carbethoxypsoralen than to 8-methoxypsoralen plus 365 nm light treatment in terms of lethal effect. In comparison to angelicin, another monofunctional (but angular) furocoumarin, 3-carbethoxypsoralen is more photoreactive. When the photoaffinity for DNA of 8-methoxypsoralen and 3-carbethoxypsoralen are considered in relation to photoinduced cell killing, it is clear that monoadducts are very efficiently repaired in wild-type cells. In contrast to the additivity obtained with 8-methoxypsoralen, a synergistic interaction of the two different repair pathways blocked by the rad 2 and the rad 9 mutation is observed after 3-carbethoxypsoralen plus 365 nm light. Dark holding experiments show that the excision repair function which is present in wild-type and radsub(9-4) cells is important for dark recovery. (Auth.)

  20. Cysteine-based 3-substituted 1,5-benzoxathiepin derivatives: Two new classes of anti-proliferative agents

    Directory of Open Access Journals (Sweden)

    Nawal Mahfoudh

    2018-03-01

    Full Text Available Two distinct series of the 3-amino-1,5-benzoxathiepin scaffold, derived from L-cysteine, were synthesized and evaluated for their anti-proliferative activity in the breast cancer MDA-MB-231 and MCF-7 cells, and in the ovarian carcinoma SKOV-3 cell line. (3R-Amino-3,4-dihydro-2H-1,5-benzoxathiepin [(R-10] was diversified into two forms: (a by incorporating different amino acids at its position 3, through an amide bond; and (b by construction of the purine ring to give 6-chloro-9-[2-(3,4-dihydro-2H-1,5-benzoxathiepin-(3R-yl]-9H-purine [(R-28]. Nevertheless, when the introduction of iodine was tried at position 2 of the purine ring of (R-28, 2-{[2-(6-chloro-2-iodo-9H-purin-9-ylprop-2-en-1-yl]thio}phenol (34 was obtained. Compound 34 shows activity against cancer cells. Interestingly, 34 inhibits mammosphere formation at the micromolar range, demonstrating activity against cancer stem cells. Although further studies of its targets and mechanism of action are needed, these findings support the therapeutic potential of this compound in cancer.

  1. Syntheses of 7-Substituted α-Cyperone Derivatives for Selective Sigma-1 Receptor over Cannabinoid-1 Receptor Binding Affinities

    Energy Technology Data Exchange (ETDEWEB)

    Park, Juyoung; Shin, Younggyun; Yoon, Sunghwa [Ajou Univ., Suwon (Korea, Republic of); Kim, Keewon; Kwon, Youngbae [ChonBuk National Univ., Jeonju (Korea, Republic of)

    2013-11-15

    We have successfully synthesized seven α-cyperone derivatives and found that the presence of a hydrogen bond donor/acceptor groups at the C7 position of α-cyperone significantly affects specificity and potency of CB{sub 1} receptor binding affinity over sigma-1 receptor binding affinity. In particular, the presence of the amino moiety at the C7 position of α-cyperone is beneficial for binding to sigmia-1 receptor. The molecular mechanism of compound 8 involved in the high binding affinity to sigma-1 receptor is under investigation. We first synthesized α-cyperone 1 by following the previously reported synthetic routes.15-19 In brief, azeotropic imination of (+)-dihydrocarvone and (R)-(+)-1-phenylethylamine followed by alkylation with a slight excess of ethyl vinyl ketone (EVK) in THF at 40 .deg. C produced the Micheal adduct. The resulting adduct was hydrolyzed and then treated with sodium methoxide at room temperature to give an easily separable mixture of α-cyperone 1 and its side product. Flash chromatography resulted in pure α-cyperone 1 in a 30% yield from (+)-dihydrocarvone.

  2. Optimising the design of paramagnetic MRI contrast agents: influence of backbone substitution on the water exchange rate of Gd-DTPA derivatives.

    Science.gov (United States)

    Laurent, S; Botteman, F; Vander Elst, L; Muller, R N

    2004-04-01

    Among other factors influencing the residence time of the coordinated water (tauM) of paramagnetic contrast agents, the steric hindrance around the gadolinium ion seems to play a beneficial role. Such a crowding can be achieved by substituting the Gd-DTPA backbone on the C4 position. Several Gd-DTPA complexes carrying diverse groups at this position have thus been synthesised and characterised: GdS-C4-Me-DTPA, GdS-C4-n-Bu-DTPA, GdS-C4-iBu-DTPA, GdS-C4-iPr-DTPA, and Gd-C4-diMe-DTPA. TauM has been measured through the evolution of the water oxygen-17 transverse relaxation rate as a function of the temperature. The data show a reduction of tauM of GdS-C4-Me-DTPA, GdS-C4-n-Bu-DTPA, GdS-C4-iBu-DTPA, GdS-C4-iPr-DTPA, and Gd-C4-diMe-DTPA (tauM310 = 91,82, 108,98, and 57 ns respectively, as compared to Gd-DTPA (tauM310 = 143 ns)). At 310 K, the nuclear magnetic dispersion relaxation profiles of water protons are very similar for the five complexes which present longitudinal relaxivities slightly higher than those of Gd-DTPA. Regarding zinc transmetallation, C4-monosubstituted derivatives are more stable than Gd-DTPA. These results confirm that a judicious substitution of the DTPA skeleton allows for an acceleration of the coordinated water exchange rate. This observation can be useful for the design of vectorised contrast agents for molecular imaging. Copyright 2004 ESMRMB

  3. Enamel matrix protein derivative plus synthetic bone substitute for the treatment of mandibular Class II furcation defects: a case series.

    Science.gov (United States)

    Queiroz, Lucas Araujo; Santamaria, Mauro; Casati, Marcio; Silverio, Karina; Nociti-Junior, Francisco; Sallum, Enilson

    2015-03-01

    The aim of this study is to report on the treatment of mandibular Class II furcation defects with enamel matrix protein derivative (EMD) combined with a βTCP/HA (β-tricalcium phosphate/hydroxyapatite) alloplastic material. Thirteen patients were selected. All patients were nonsmokers, systemically healthy, and diagnosed with chronic periodontitis; had not taken medications known to interfere with periodontal tissue health and healing; presented one Class II mandibular furcation defect with horizontal probing equal to or greater than 4 mm at buccal site. The clinical parameters evaluated were probing depth (PD), relative gingival margin position (RGMP), relative vertical clinical attachment level (RVCAL), and relative horizontal clinical attachment level (RHCAL). A paired Student t test was used to detect differences between the baseline and 6-month measurements, with the level of significance of .05. After 6 months, the treatment produced a statistically significant reduction in PD and a significant gain in RVCAL and RHCAL, but no observable change in RGMP. RVCAL ranged from 13.77 (± 1.31) at baseline to 12.15 (± 1.29) after 6 months, with a mean change of -1.62 ± 1.00 mm (P < .05). RHCAL ranged from 5.54 (± 0.75) to 2.92 (± 0.92), with a mean change of -2.62 ± 0.63 mm (P < .05). After 6 months, 76.92% of the patients improved their diagnosis to Class I furcation defects while 23.08% remained as Class II. The present study has shown that positive clinical results may be expected from the combined treatment of Class II furcation defects with EMD and βTCP/HA, especially considering the gain of horizontal attachment level. Despite this result, controlled clinical studies are needed to confirm our outcomes.

  4. Molecular glues for manipulating enzymes: trypsin inhibition by benzamidine-conjugated molecular glues† †Electronic supplementary information (ESI) available: Synthesis of TEG–BA, Gluen–BA, mGluen–BA and Gluen–Ph; 1H NMR, 13C NMR, MALDI-TOF MS, electronic absorption, and CD spectra; zeta potential distributions; SLS plots; DLS histograms; and related experimental procedures. See DOI: 10.1039/c5sc00524h Click here for additional data file.

    Science.gov (United States)

    Mogaki, Rina

    2015-01-01

    Water-soluble bioadhesive polymers bearing multiple guanidinium ion (Gu+) pendants at their side-chain termini (Gluen–BA, n = 10 and 29) that were conjugated with benzamidine (BA) as a trypsin inhibitor were developed. The Gluen–BA molecules are supposed to adhere to oxyanionic regions of the trypsin surface, even in buffer, via a multivalent Gu+/oxyanion salt-bridge interaction, such that their BA group properly blocks the substrate-binding site. In fact, Glue10–BA and Glue29–BA exhibited 35- and 200-fold higher affinities for trypsin, respectively, than a BA derivative without the glue moiety (TEG–BA). Most importantly, Glue10–BA inhibited the protease activity of trypsin 13-fold more than TEG–BA. In sharp contrast, mGlue27–BA, which bears 27 Gu+ units along the main chain and has a 5-fold higher affinity than TEG–BA for trypsin, was inferior even to TEG–BA for trypsin inhibition. PMID:28706668

  5. The discovery of new potent non-peptide Angiotensin II AT1 receptor blockers: A concise synthesis, molecular docking studies and biological evaluation of N-substituted 5-butylimidazole derivatives

    Czech Academy of Sciences Publication Activity Database

    Agelis, G.; Resvani, A.; Durdagi, S.; Spyridaki, K.; Tůmová, Tereza; Slaninová, Jiřina; Giannopoulos, P.; Vlahakos, D.; Liapakis, G.; Mavromoustakos, T.; Matsoukas, J.

    2012-01-01

    Roč. 55, Sep (2012), s. 358-374 ISSN 0223-5234 Institutional research plan: CEZ:AV0Z40550506 Keywords : synthesis * angiotensin II receptor blockers * N-substituted 5-butylimidazole derivatives * antihypertensive activity * molecular docking Subject RIV: CC - Organic Chemistry Impact factor: 3.499, year: 2012

  6. Microwave Assisted Synthesis of 2,2'-Arylene-substituted Bis(4H-3,1-Benzoxazin-4-one Derivatives Using the Complex Cyanuric Chloride/N,N-Dimethylformamide

    Directory of Open Access Journals (Sweden)

    Mehdi Shariat

    2012-09-01

    Full Text Available A new and efficient method has been designed to prepare 2,2'-arylene-substituted bis(4H-3,1-benzoxazin-4-one derivatives by using the mixture of cyanuric chloride and N,N-dimethylformamide in a microwave-assisted reaction. The method used and presented here has good rate enhancement and excellent yields.

  7. Aryl substitution of pentacenes

    Directory of Open Access Journals (Sweden)

    Andreas R. Waterloo

    2014-07-01

    Full Text Available A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films, thermoanalytical methods (DSC and TGA, cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives. X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices.

  8. Aryl substitution of pentacenes

    Science.gov (United States)

    Waterloo, Andreas R; Sale, Anna-Chiara; Lehnherr, Dan; Hampel, Frank

    2014-01-01

    Summary A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films), thermoanalytical methods (DSC and TGA), cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives). X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices. PMID:25161729

  9. Synthesis and evaluation of a series of 2-substituted-5-thiopropylpiperazine (piperidine-1,3,4-oxadiazoles derivatives as atypical antipsychotics.

    Directory of Open Access Journals (Sweden)

    Yin Chen

    Full Text Available BACKGROUND: It is important to develop novel antipsychotics that can effectively treat schizophrenia with minor side-effects. The aim of our work is to develop novel antipsychotics that act on dopamine D(2 and D(3, serotonin 5-HT(1A and 5-HT(2A receptors with low affinity for the serotonin 5-HT(2C and H(1 receptors, which can effectively cure positive symptoms, negative symptoms and cognitive impairment without the weight gain side-effect. METHODOLOGY/PRINCIPAL FINDINGS: A series of 2-substituted-5-thiopropylpiperazine (piperidine -1,3,4-oxadiazoles derivatives have been synthesized and the target compounds were evaluated for binding affinities to D(2, 5-HT(1A and 5-HT(2A receptors. Preliminary results indicated that compounds 14, 16 and 22 exhibited high affinities to D(2, 5-HT(1A and 5-HT(2A receptors among these compounds. Further binding tests showed that compound 22 had high affinity for D(3 receptor, and low affinity for serotonin 5-HT(2C and H(1 receptors. In addition, compound 22 inhibited apomorphine-induced climbing behavior and MK-801-induced hyperactivity with no extrapyramidal symptoms liability in mice. Moreover, compound 22 exhibited acceptable pharmacokinetic properties. CONCLUSIONS/SIGNIFICANCE: Compound 22 showed an atypical antipsychotic activity without liability for extrapyramidal symptoms. We anticipate compound 22 to be useful for developing a novel class of drug for the treatment of schizophrenia.

  10. Synthesis and evaluation of a series of 2-substituted-5-thiopropylpiperazine (piperidine)-1,3,4-oxadiazoles derivatives as atypical antipsychotics.

    Science.gov (United States)

    Chen, Yin; Xu, Xiangqing; Liu, Xin; Yu, Minquan; Liu, Bi-Feng; Zhang, Guisen

    2012-01-01

    It is important to develop novel antipsychotics that can effectively treat schizophrenia with minor side-effects. The aim of our work is to develop novel antipsychotics that act on dopamine D(2) and D(3), serotonin 5-HT(1A) and 5-HT(2A) receptors with low affinity for the serotonin 5-HT(2C) and H(1) receptors, which can effectively cure positive symptoms, negative symptoms and cognitive impairment without the weight gain side-effect. A series of 2-substituted-5-thiopropylpiperazine (piperidine) -1,3,4-oxadiazoles derivatives have been synthesized and the target compounds were evaluated for binding affinities to D(2), 5-HT(1A) and 5-HT(2A) receptors. Preliminary results indicated that compounds 14, 16 and 22 exhibited high affinities to D(2), 5-HT(1A) and 5-HT(2A) receptors among these compounds. Further binding tests showed that compound 22 had high affinity for D(3) receptor, and low affinity for serotonin 5-HT(2C) and H(1) receptors. In addition, compound 22 inhibited apomorphine-induced climbing behavior and MK-801-induced hyperactivity with no extrapyramidal symptoms liability in mice. Moreover, compound 22 exhibited acceptable pharmacokinetic properties. Compound 22 showed an atypical antipsychotic activity without liability for extrapyramidal symptoms. We anticipate compound 22 to be useful for developing a novel class of drug for the treatment of schizophrenia.

  11. Synthesis and Electroluminescence Properties of 3-(Trifluoromethylphenyl-Substituted 9,10-Diarylanthracene Derivatives for Blue Organic Light-Emitting Diodes

    Directory of Open Access Journals (Sweden)

    Sang Woo Kwak

    2017-10-01

    Full Text Available Diaryl-substituted anthracene derivatives containing 3-(trifluoromethylphenyl groups, 9,10-diphenyl-2-(3-(trifluoromethylphenylanthracene (1, 9,10-di([1,1′-biphenyl]-4-yl-2-(3-(trifluoromethylphenylanthracene (2, and 9,10-di(naphthalen-2-yl-2-(3-(trifluoromethylphenylanthracene (3 were synthesized and characterized. The compounds 1–3 possessed high thermal stability and proper frontier-energy levels, which make them suitable as host materials for blue organic light-emitting diodes. The electroluminescent (EL emission maximum of the three N,N-diphenylamino phenyl vinyl biphenyl (DPAVBi-doped (8 wt % devices for compounds 1–3 was exhibited at 488 nm (for 1 and 512 nm (for 2 and 3. Among them, the 1-based device displayed the highest device performances in terms of brightness (Lmax = 2153.5 cd·m−2, current efficiency (2.1 cd·A−1, and external quantum efficiency (0.8%, compared to the 2- and 3-based devices.

  12. Syntheses of Novel 4-Substituted N-(5-amino-1H-1,2,4-triazol-3-ylpyridine-3-sulfonamide Derivatives with Potential Antifungal Activity

    Directory of Open Access Journals (Sweden)

    Krzysztof Szafrański

    2017-11-01

    Full Text Available Candidiasis represent a serious threat for patients with altered immune responses. Therefore, we have undertaken the synthesis of compounds comprising a pyridine-3-sulfonamide scaffold and known antifungally active 1,2,4-triazole substituents. Thus a series of novel 4-substituted N-(5-amino-1H-1,2,4-triazol-3-ylpyridine-3-sulfonamides have been synthesized by multistep reactions starting from 4-chloropyridine-3-sulfonamide via N′-cyano-N-[(4-substitutedpyridin-3-ylsulfonyl]carbamimidothioates which were further converted with hydrazine hydrate to the corresponding 1,2,4-triazole derivatives 26–36. The final compounds were evaluated for antifungal activity against strains of the genera Candida, Geotrichum, Rhodotorula, and Saccharomycess isolated from patients with mycosis. Many of them show greater efficacy than fluconazole, mostly towards Candida albicans and Rhodotorula mucilaginosa species, with MIC values ≤ 25 µg/mL. A docking study of the most active compounds 26, 34 and 35 was performed showing the potential mode of binding to Candida albicans lanosterol 14α-demethylase. Also in vitro cytotoxicity of selected compounds have been evaluated on the NCI-60 cell line panel.

  13. Development of a composite based on hydroxyapatite and magnesium and zinc‐containing sol–gel-derived bioactive glass for bone substitute applications

    International Nuclear Information System (INIS)

    Ashuri, Maziar; Moztarzadeh, Fathollah; Nezafati, Nader; Ansari Hamedani, Ali; Tahriri, Mohammadreza

    2012-01-01

    In the present study, a bioceramic-based composite was prepared by sintering compacts made up of mixtures of hydroxyapatite (HA) and sol–gel-derived bioactive glass (64SiO 2 -26CaO-5MgO-5ZnO) (based on mol%) powders. HA powder was mixed with different concentrations of the glass powders up to 30 wt.%. The effect of adding bioactive glass powder to HA matrix, on the mechanical properties of the composite was assessed by compression test. The specimen with the highest compressive strength was chosen to be immersed in simulated body fluid (SBF) to study apatite forming ability and dissolution behavior. It was found that compressive strength of the specimen was decreased 65% after maintaining in the SBF for 14 days. X-ray diffraction (XRD) showed prevalence of HA and β-TCP related peaks. Also, the surface morphology of the composite was observed using scanning electron microscopy (SEM). The study of degradation behavior revealed Si release capability of this composite. Biological evaluations in vitro confirmed the composite studied could induce osteoblast-like cells' activities. - Highlights: ► A novel composite based on HA/bioactive glass for bone substitutes was developed. ► Evaluations in vitro confirmed the composites induce bone-like cells' activities. ► A successful compromise of bioactivity and cytocompatibility was observed.

  14. Efficient Synthesis of Differentiated syn-1,2-Diol Derivatives by Asymmetric Transfer Hydrogenation-Dynamic Kinetic Resolution of α-Alkoxy-Substituted β-Ketoesters.

    Science.gov (United States)

    Monnereau, Laure; Cartigny, Damien; Scalone, Michelangelo; Ayad, Tahar; Ratovelomanana-Vidal, Virginie

    2015-08-10

    Asymmetric transfer hydrogenation was applied to a wide range of racemic aryl α-alkoxy-β-ketoesters in the presence of well-defined, commercially available, chiral catalyst Ru(II) -(N-p-toluenesulfonyl-1,2-diphenylethylenediamine) and a 5:2 mixture of formic acid and triethylamine as the hydrogen source. Under these conditions, dynamic kinetic resolution was efficiently promoted to provide the corresponding syn α-alkoxy-β-hydroxyesters derived from substituted aromatic and heteroaromatic aldehydes with a high level of diastereoselectivity (diastereomeric ratio (d.r.)>99:1) and an almost perfect enantioselectivity (enantiomeric excess (ee)>99 %). Additionally, after extensive screening of the reaction conditions, the use of Ru(II) - and Rh(III) -tethered precatalysts extended this process to more-challenging substrates that bore alkenyl-, alkynyl-, and alkyl substituents to provide the corresponding syn α-alkoxy-β-hydroxyesters with excellent enantiocontrol (up to 99 % ee) and good to perfect diastereocontrol (d.r.>99:1). Lastly, the synthetic utility of the present protocol was demonstrated by application to the asymmetric synthesis of chiral ester ethyl (2S)-2-ethoxy-3-(4-hydroxyphenyl)-propanoate, which is an important pharmacophore in a number of peroxisome proliferator-activated receptor α/γ dual agonist advanced drug candidates used for the treatment of type-II diabetes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Dual Inhibition of AChE and BChE with the C-5 Substituted Derivative of Meldrum’s Acid: Synthesis, Structure Elucidation, and Molecular Docking Studies

    Directory of Open Access Journals (Sweden)

    Haroon Mehfooz

    2017-07-01

    Full Text Available Alzheimer’s disease (AD lies in the category of those diseases which are still posing challenges to medicinal chemists, and the search for super-effective drugs for the treatment of AD is a work in progress. The inhibition of cholinesterase is considered a viable strategy to enhance the level of acetylcholine in the brain. The C-5 substituted derivative of Meldrum’s acid was synthesized and screened against acetylcholinesterase (AChE and butyrylcholinesterase (BChE enzyme inhibition activity. The simple and unique structure of synthesized derivative 3 was found to be good for the dual inhibition of both enzymes (AChE and BChE. 2,2-Dimethyl-5-(([2-(trifluoromethyl phenyl]aminomethylidene-1,3-dioxane-4,6-dione (3 showed significant inhibition against AChE, with an IC50 value of 1.13 ± 0.03 µ M (Standard Neostigmine 22.2 ± 3.2 µM, and moderate inhibition against BChE, with an IC50 value of 2.12 ± 1.22 µM (Standard Neostigmine 49.6 ± 6.11 µM. The structural insights reveal that compound 3 possesses intriguing reactive groups, which can potentially evoke the non-covalent interactions and possibly assist by binding in the active site of the target protein. Docking simulations revealed that the compound 3 showed binding inside the active site gorges of both AChE and BChE. An excellent agreement was obtained, as the best docked poses showed important binding features mostly based on interactions due to oxygen atoms and the aromatic moieties of the compound. The docking computations coupled with the experimental findings ascertained that the compound 3 can serve as a scaffold for the dual inhibitors of the human acetylcholine esterases.

  16. Photophysicochemical, calf thymus DNA binding and in vitro photocytotoxicity properties of tetra-morpholinoethoxy-substituted phthalocyanines and their water-soluble quaternized derivatives.

    Science.gov (United States)

    Koçan, Halit; Kaya, Kerem; Özçeşmeci, İbrahim; Sesalan, B Şebnem; Göksel, Meltem; Durmuş, Mahmut; Burat, Ayfer Kalkan

    2017-12-01

    In this study, morpholinoethoxy-substituted metal-free (3), zinc(II) (4) and indium(III) (5) phthalocyanines were synthesized. These phthalocyanines were converted to their water-soluble quaternized derivatives (3Q-5Q) using excess methyl iodide as a quaternization agent. All these phthalocyanines (Pcs) were characterized by elemental analysis and different spectroscopic methods such as FT-IR, 1 H NMR, UV-Vis and mass spectrometry. The photophysical and photochemical properties such as fluorescence and generation of singlet oxygen were investigated for determination of these phthalocyanines as photosensitizers in photodynamic therapy (PDT) applications. The binding properties of quaternized phthalocyanines (3Q-5Q) to calf thymus DNA (CT-DNA) were investigated by UV-Vis and fluorescence spectrophotometric methods. The quenching effect of all quaternized phthalocyanines on the fluorescence intensity of SYBR Green-DNA complex was determined. The mixtures of 3Q, 4Q or 5Q and DNA solutions were used to determine the change in T m of double helix DNA with thermal denaturation profile. In addition, thermodynamic parameters considering their aggregation in buffer solution, which shows the spontaneity of the reactions between DNA and quaternized Pcs were investigated. On the other hand, in vitro phototoxicity and cytotoxicity behavior of the quaternized water-soluble phthalocyanine photosensitizers (3Q-5Q) were tested against the cervical cancer cell line named HeLa for evaluation of their suitability for treatment of cancer by PDT method. Peripherally tetra-substituted neutral and quaternized metal-free and metallophthalocyanines (MPcs) (Zn, In) bearing morpholinoethoxy groups were prepared. The binding of quaternized compounds (3Q-5Q) to CT-DNA were examined using UV-Vis, fluorescence spectra, thermal denaturation profiles and K SV values. Besides, thermodynamic studies indicated that binding of 3Q-5Q to DNA was spontaneous. On the other hand, in vitro phototoxicity and

  17. /sup 13/C-/sup 13/C spin-spin coupling in structural investigations. VII. Substitution effects and direct carbon-carbon constants of the triple bond in acetyline derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Krivdin, L.B.; Proidakov, A.G.; Bazhenov, B.N.; Zinchenko, S.V.; Kalabin, G.A.

    1989-01-10

    The effects of substitution on the direct /sup 13/C-/sup 13/C spin-spin coupling constants of the triple bond were studied in 100 derivatives of acetylene. It was established that these parameters exhibit increased sensitivity to the effect of substituents compared with other types of compounds. The main factor which determines their variation is the electronegativity of the substituting groups, and in individual cases the /pi/-electronic effects are appreciable. The effect of the substituents with an element of the silicon subgroup at the /alpha/ position simultaneously at the triple bond or substituent of the above-mentioned type and a halogen atom.

  18. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

    Directory of Open Access Journals (Sweden)

    Nalin CW Goonesekere

    2009-06-01

    Full Text Available Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP database. We show that when incorporated into the homology search algorithms BLAST and PSI-blaST, the structure-based substitution matrices enhance the efficacy of detecting remote homologs. Keywords: computational biology, protein homology, amino acid substitution matrix, protein structure

  19. Novel CMS lines in pigeonpea [Cajanus cajan (L. Millspaugh] derived from cytoplasmic substitutions, and their effective restoration and deployment in hybrid breeding

    Directory of Open Access Journals (Sweden)

    Abhishek Bohra

    2017-02-01

    Full Text Available The availability of stable cytoplasmic male sterile (CMS or A lines coupled with a robust restoration system (R lines is an essential prerequisite for efficient hybrid breeding. CMS-enabled hybrid technology holds immense potential to enhance the long-stagnant productivity of pigeonpea. In the present investigation, cytoplasmic substitutions were made in the nuclear backgrounds of early-maturing pigeonpea varieties or lines. Three new CMS lines (ICPL 88039A, Pusa 992A, and DPP 3-2A resulted from genetic crosses involving cytoplasmic donors from A2 (GT 288A and A4 (ICPA 2089 categories. In addition to visual inspection of anthers, pollen-staining techniques and scanning electron microscopy (SEM analysis were used to confirm pollen sterility. Further, given the relevance of the plant mitochondrial genome to CMS manifestation, 25 mitochondrion-specific DNA markers were assayed on these newly developed A lines and isogenic maintainer (B lines. DNA polymorphism between Pusa 992A and Pusa 992B as revealed by the nad7a_del marker confirmed the successful combination of sterilizing cytoplasm (A4 and nonrestoring nuclear background (Pusa 992. Such cytoplasm-specific DNA markers are required for A2-CMS as well. Further, to assess restoration ability, potential restorers were crossed with these CMS lines, and as a consequence, promising A × R combinations exhibiting 100% pollen fertility could be identified. In parallel, we also analyzed the inheritance patterns underlying fertility restoration using ICPL 88039A-derived F2 and BC1F1 populations, and established a monogenic dominant model to explain the phenomenon of A2-CMS restoration. In summary, we report the successful development of new CMS lines and describe their effective deployment in hybrid breeding of pigeonpea.

  20. Insight into the structural requirement of substituted quinazolinone biphenyl acylsulfonamides derivatives as Angiotensin II AT1 receptor antagonist: 2D and 3D QSAR approach

    Directory of Open Access Journals (Sweden)

    Mukesh C. Sharma

    2014-01-01

    Full Text Available A series of 19 molecules substituted quinazolinone biphenyl acylsulfonamides derivatives displaying variable inhibition of Angiotensin II receptor AT1 activity were selected to develop models for establishing 2D and 3D QSAR. The compounds in the selected series were characterized by spatial, molecular and electro topological descriptors using QSAR module of Molecular Design Suite (VLife MDS™ 3.5. The best 2D QSAR model was selected, having correlation coefficient r2 (0.8056 and cross validated squared correlation coefficient q2 (0.6742 with external predictive ability of pred_r2 0.7583 coefficient of correlation of predicted data set (pred_r2se 0.2165. The results obtained from QSAR studies could be used in designing better Ang II activity among the congeners in future. The optimum QSAR model showed that the parameters SsssCHE index, SddCE-index, T_2_Cl_4, and SssNHE-index contributed in the model. 3D QSAR analysis by kNN-molecular field analysis approach developed based on principles of the k-nearest neighbor method combined with Genetic algorithms, stepwise forward variable selection approach; a leave-one-out cross-validated correlation coefficient (q2 of 0.6516 and a non-cross-validated correlation coefficient (r2 of 0.8316 and pred_r2 0.6954 were obtained. Contour maps using this approach showed that steric, electrostatic, and hydrophobic field effects dominantly determine binding affinities. The information rendered by 3D QSAR models may lead to a better understanding of structural requirements of Angiotensin II receptor and can help in the design of novel potent antihypertensive molecules.

  1. Design, syntheses, characterization, and evaluation of 2-substituted-1,3-bis(1-naphthylmethyl-imidazolidine derivatives in search of safer nonsteroidal anti-inflammatory drugs

    Directory of Open Access Journals (Sweden)

    Umesh Kumar

    2015-01-01

    Full Text Available Background: 1,2,3-trisubstituted imidazolidines are reported to have better anti-inflammatory activity than the reference drug indomethacin. Similarly, naphthalene nucleus plays a significant role in the drug design. Nabumetone and naproxen are naphthalene nucleus containing anti-inflammatory drugs available in the market. There are also reports that compounds having two naphthalene rings incorporated with a heterocyclic nucleus have good medicinal value. Based on these reports it was planned to synthesize hybrid compounds containing two naphthalene rings with imidazolidine nucleus. Aim: To obtain potent compounds having anti-inflammatory and analgesic activities with reduced gastrointestinal side effects. Materials and Methods: The reaction scheme includes the reaction between 1-naphthaldehyde with ethylenediamine to obtain diSchiff′s base (1 Reduction of this diSchiff′s base with NaBH 4 gave tetrahydrodiSchiff′s base (2 Further cyclization of 2 with appropriate aldehyde in the presence of ethanol formed 2-substituted-1,3-bis(1-naphthylmethyl-imidazolidine derivatives (3a-n. The structures of these compounds were established on the basis of spectral data. All these compounds were tested for their anti-inflammatory, analgesic, ulcerogenic, and lipid peroxidation activities. Results and Discussion: The tested compounds (3a-n showed anti-inflammatory activity ranging between 27.61% and 53.43%. The compound 3h showed the highest activity of 53.43% and 3n showed 53.02% inhibition at 20 mg/kg dose in rats compared with the standard drug indomethacin which showed 61.45% inhibition at the same dose. It was encouraging to note that both the compounds showed reduced ulcerogenic activity (less than half compared to the standard drug indomethacin.

  2. Synthesis of 3-(4, 5-dihydro-1-phenyl-5-substituted phenyl-1H-pyrazol-3-yl-2H-chromen-2-one derivatives and evaluation of their anticancer activity

    Directory of Open Access Journals (Sweden)

    Nitin Kumar

    2017-05-01

    Full Text Available A novel series of 3-(4, 5-dihydro-1-phenyl-5-substituted phenyl-1H-pyrazol-3-yl-2H-chromen-2-one derivatives were synthesized. In the first step salicylaldehyde was reacted with ethylacetoacetate at room temperature by stirring which gives compound (I. Compound (I when refluxed with substituted benzaldehyde and diethylamine in the presence of n-butanol for 4–5 h gives substituted derivatives (IIa–d. Compounds synthesized in step 2 when refluxed with phenyl hydrazine in the presence of pyridine for 6–7 h gives the title compounds (IIIa–d. All the synthesized compounds were sent to NCI for anticancer activity. Synthesized compounds were tested for anticancer activity against 60 different cell lines. From the data thus obtained it was observed that simple coumarin ring derivatives were more effective in inhibiting the growth of cancerous cell lines, than coumarin-pyrazoline derivatives. Among all the synthesized compounds, irrespective of compounds having simple coumarin ring and coumarin-pyrazoline combination, compounds IIa–c, IIIb and IIId were potent anticancer agents. Compounds were active for the single dose therapeutic program at the dose of 1.00E-5 molar concentration. The main anti cancer activity is assumed to be due to the presence of the lactone structure in coumarin moiety.

  3. Substitutional analysis

    CERN Document Server

    Rutherford, Daniel Edwin

    2013-01-01

    Classic monograph, suitable for advanced undergraduates and graduate students. Topics include calculus of permutations and tableaux, semi-normal representation, orthogonal and natural representations, group characters, and substitutional equations. 1968 edition.

  4. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST.

    Science.gov (United States)

    Goonesekere, Nalin Cw

    2009-01-01

    The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP) database. We show that when incorporated into the homology search algorithms BLAST and PSI-blast, the structure-based substitution matrices enhance the efficacy of detecting remote homologs.

  5. Substitution of matrices over rings

    NARCIS (Netherlands)

    Hautus, M.L.J.

    1995-01-01

    For a given commutative ring with an identity element, we define and study the substitution of a matrix with entries in into a matrix polynomial or rational function over . A Bezout-type remainder theorem and a "partial-substitution rule" are derived and used to obtain a number of results. The

  6. Synthesis and antitumoral activity of novel 3-(2-substituted-1,3,4-oxadiazol-5-yl) and 3-(5-substituted-1,2,4-triazol-3-yl) beta-carboline derivatives.

    Science.gov (United States)

    Formagio, Anelise S Nazari; Tonin, Lilian T Düsman; Foglio, Mary Ann; Madjarof, Christiana; de Carvalho, João Ernesto; da Costa, Willian Ferreira; Cardoso, Flávia P; Sarragiotto, Maria Helena

    2008-11-15

    Several novel 1-substituted-phenyl beta-carbolines bearing the 2-substituted-1,3,4-oxadiazol-5-yl and 5-substituted-1,2,4-triazol-3-yl groups at C-3 were synthesized and evaluated for their in vitro anticancer activity. The assay results pointed thirteen compounds with growth inhibition effect (GI(50)<100 microM) for all eight different types of human cancer cell lines tested. The beta-carbolines 7a and 7h, bearing the 3-(2-metylthio-1,3,4-oxadiazol-5-yl) group, displayed high selectivity and potent anticancer activity against ovarian cell line with GI(50) values lying in the nanomolar concentration range (GI(50)=10 nM for both compounds). The 1-(N,N-dimethylaminophenyl)-3-(5-thioxo-1,2,4-triazol-3-yl) beta-carboline (8g) was the most active compound, showing particular effectiveness on lung (GI(50)=0.06 microM), ovarian and renal cell lines. The potent anticancer activity presented for synthesized compounds 7a, 7h, and 8g, together with their easiness of synthesis, makes these compounds promising anticancer agents.

  7. Cu-catalyzed aerobic oxidative cyclizations of 3-N-hydroxyamino-1,2-propadienes with alcohols, thiols, and amines to form α-O-, S-, and N-substituted 4-methylquinoline derivatives.

    Science.gov (United States)

    Sharma, Pankaj; Liu, Rai-Shung

    2015-03-16

    A one-pot, two-step synthesis of α-O-, S-, and N-substituted 4-methylquinoline derivatives through Cu-catalyzed aerobic oxidations of N-hydroxyaminoallenes with alcohols, thiols, and amines is described. This reaction sequence involves an initial oxidation of N-hydroxyaminoallenes with NuH (Nu = OH, OR, NHR, and SR) to form 3-substituted 2-en-1-ones, followed by Brønsted acid catalyzed intramolecular cyclizations of the resulting products. Our mechanistic analysis suggests that the reactions proceed through a radical-type mechanism rather than a typical nitrone-intermediate route. The utility of this new Cu-catalyzed reaction is shown by its applicability to the synthesis of several 2-amino-4-methylquinoline derivatives, which are known to be key precursors to several bioactive molecules. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. N-substituted iminodiacetic acids

    International Nuclear Information System (INIS)

    Nunn, A.; Loberg, M.

    1982-01-01

    The chemical preparation of several new N-substituted iminodiacetic acid derivatives are described. These compounds when complexed with sup(99m)Tc provide useful radiopharmaceuticals for the external imaging of the hepatobiliary system. (U.K.)

  9. Synthesis, Characterization, and Antimicrobial Studies of Novel Series of 2,4-Bis(hydrazino-6-substituted-1,3,5-triazine and Their Schiff Base Derivatives

    Directory of Open Access Journals (Sweden)

    Hessa H. Al-Rasheed

    2018-01-01

    Full Text Available The present work represents the synthesis, characterization, and antimicrobial studies of novel series of 2,4-bis(hydrazino-6-substituted-1,3,5-triazine and their Schiff base derivatives. IR, NMR (H1 and C13, elemental analysis, and LC-MS characterized the prepared compounds. The biological activity of the target products was evaluated as well. Twenty-two of the prepared compounds were selected according to their solubility in aqueous DMSO. Only eight compounds showed good activity against the selected pathogenic bacteria and did not show antagonistic effect against fungus Candida albicans. Two compounds 4k and 5g have wide-range effect presently in Gram-positive and Gram-negative bacteria while other compounds (4f, 4i, 4m, 5d, 6i, and 6h showed specific effect against the Gram-negative or Gram-positive bacteria. The minimum inhibitory concentration (MIC, μg/mL of 4f, 4i, 4k, and 6h compounds against Streptococcus mutans was 62.5 μg/mL, 100 μg/mL, 31.25 μg/mL, and 31.25 μg/mL, respectively. The MIC of 4m, 4k, 5d, 5g, and 6h compounds against Staphylococcus aureus was 62.5 μg/mL, 31.25 μg/mL, 31.25 μg/mL, 100 μg/mL, and 62.5 μg/mL, respectively. The MIC of 4k, 5g, and 6i compounds against Salmonella typhimurium was 31.25 μg/mL, 100 μg/mL, and 62.5 μg/mL, respectively. The MIC of 6i compound against Escherichia coli was 62.5 μg/mL.

  10. Properties of concrete with tire derived aggregate and crumb rubber as a lighthweight substitute for mineral aggregates in the concrete mix

    Science.gov (United States)

    Siringi, Gideon Momanyi

    Scrap tires continue to be a nuisance to the environment and this research proposes one way of recycling them as a lightweight aggregate which can substitute for mineral aggregates in concrete. Aggregates derived from scrap tires are often referred to as Tire Derived Aggregate (TDA). First, the focus is how much mineral aggregate can be replaced by these waste tires and how the properties of concrete are affected with the introduction of rubber. This is being mindful of the fact that for a new material to be acceptable as an engineering material, its properties and behavior has to be well understood, the materials must perform properly and be acceptable to the regulating agencies. The role played by the quantity of TDA and Crumb Rubber replacing coarse aggregate and fine aggregate respectively as well as different treatment and additives in concrete on its properties are examined. Conventional concrete (without TDA) and concrete containing TDA are compared by examining their compressive strength based on ASTM C39, workability based on ASTM C143, Splitting Tensile Strength based on ASTM C496, Modulus of Rupture (flexural strength) based on ASTM C78 and Bond strength of concrete developed with reinforcing steel based on ASTM C234.Through stress-strain plots, the rubberized concrete is compared in terms of change in ductility, toughness and Elastic Modulus. Results indicate that while replacement of mineral aggregates with TDA results in reduction in compressive strength, this may be mitigated by addition of silica fume or using a smaller size of TDA to obtain the desired strength. The greatest benefit of using TDA is in the development of a higher ductile product with lower density while utilizing recycled TDA. From the results, it is observed that 7-10% of weight of mineral aggregates can be replaced by an equal volume of TDA to produce concrete with compressive strength of up to 4000 psi (27.5 MPa). Rubberized concrete would have higher ductility and toughness with

  11. Solvent substitution

    International Nuclear Information System (INIS)

    1990-01-01

    The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general ''Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated

  12. Tonemic Substitution

    African Journals Online (AJOL)

    Ezenwafor

    grammatical constructions. The choice of substitutable tonemes as observed from the analyzed data is highly. Ezenwafordependent on the intuitive judgement of the native speaker. This work shows with adequate data, that regular tonemic changes are not always meaningful in Ekwulobia lect. Such tonemic alternations are ...

  13. Solvent substitution

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated.

  14. Asymmetric allylation of α-ketoester-derived N-benzoylhydrazones promoted by chiral sulfoxides/N-oxides Lewis bases: highly enantioselective synthesis of quaternary α-substituted α-allyl-α-amino acids.

    Science.gov (United States)

    Reyes-Rangel, Gloria; Bandala, Yamir; García-Flores, Fred; Juaristi, Eusebio

    2013-09-01

    Chiral sulfoxides/N-oxides (R)-1 and (R,R)-2 are effective chiral promoters in the enantioselective allylation of α-keto ester N-benzoylhydrazone derivatives 3a-g to generate the corresponding N-benzoylhydrazine derivatives 4a-g, with enantiomeric excesses as high as 98%. Representative hydrazine derivatives 4a-b were subsequently treated with SmI2, and the resulting amino esters 5a-b with LiOH to obtain quaternary α-substituted α-allyl α-amino acids 6a-b, whose absolute configuration was assigned as (S), with fundament on chemical correlation and electronic circular dichroism (ECD) data. © 2013 Wiley Periodicals, Inc.

  15. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

    OpenAIRE

    Goonesekere, Nalin CW

    2009-01-01

    Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution ...

  16. In silico binding affinity studies of N-9 substituted 6-(4-(4-propoxyphenylpiperazin-1-yl-9H-purine derivatives-Target for P70-S6K1 & PI3K-δ kinases

    Directory of Open Access Journals (Sweden)

    Manjunath G. Sunagar

    2018-03-01

    Full Text Available P70-S6K1 & PI3K-δ kinases are identified to be involved in many physiological processes associated with cancer, therefore many of the inhibitors being designed to target these kinases are in clinical trials. In the current study we have exploited the N-9 substituted 6-(4-(4-propoxyphenyl piperazin-1-yl-9H-purine derivatives for their inhibitory properties with the above kinases. We have used an in silico docking study with seventeen purine derivatives for their binding affinity calculations. The binding affinities of these small molecules with P70-S6K1 & PI3K-δ were performed using AutoDock Vina. Among all the compounds, PP16 showed highest binding affinity of −14.7 kcal/mol with P70-S6K1 kinase & −17.2 kcal/mol with PI3K-δ kinases as compared to the molecules under clinical trials (PF-4708671 & IC-87114. Docking studies revealed that N-9 coumarine substituted purine derivative could be one of the potential ligands for the inhibition of P70-S6K1 & PI3K-δ kinases. Hence, this compound can be further investigated by in vitro and in vivo experiments for further validation.

  17. An Efficient Synthesis of 3,4-Dihydro-3-substituted-2H-naphtho[2,1-e][1,3]oxazine Derivatives Catalyzed by Zirconyl(IV) Chloride and Evaluation of its Biological Activities

    Energy Technology Data Exchange (ETDEWEB)

    Kategaonkar, Amol H.; Sonar, Swapnil S.; Pokalwar, Rajkumar U.; Shingate, Bapurao B.; Shingare, Murlidhar S. [Babasaheb Ambedkar Marathwada University, Maharashtra (India); Kategaonkar, Atul H. [Maharashtra Institute of Pharmacy, Maharashtra (India)

    2010-06-15

    An efficient and novel one-pot synthesis of new 3,4-dihydro-3-substituted-2H-naphtho[2,1-e][1,3]oxazine derivatives from 1-naphthol, various anilines and formalin at room temperature grinding is presented. The six-membered N,O-heterocyclic skeleton was constructed via zirconyl(IV) chloride promoted Mannich type reaction. In vitro antimicrobial activities of synthesized compounds have been investigated against Gram-positive Bacillus subtilis, Gram negative Escherichia coli and two fungi Candida albicans and Aspergillus niger in comparison with standard drugs. The results of preliminary bioassay indicate that some of title compounds possess significant antibacterial and antifungal activity.

  18. Anti-leishmanial and structure-activity relationship of ring substituted 3-phenyl-1-(1,4-di-N-oxide quinoxalin-2-yl-2-propen-1-one derivatives

    Directory of Open Access Journals (Sweden)

    Asunción Burguete

    2008-12-01

    Full Text Available A series of ring substituted 3-phenyl-1-(1,4-di-N-oxide quinoxalin-2-yl-2-propen-1-one derivatives were synthesized and tested for in vitro leishmanicidal activity against amastigotes of Leishmania amazonensis in axenical cultures and murine infected macrophages. Structure-activity relationships demonstrated the importance of a radical methoxy at position R3', R4' and R5'. (2E-3-(3,4,5-trimethoxy-phenyl-1-(3,6,7-trimethyl-1,4-dioxy-quinoxalin-2-yl-propenone was the most active. Cytotoxicity on macrophages revealed that this product was almost six times more active than toxic.

  19. Synthesis, spectral characterization and in vitro antifungal activity of Lanthanum(III) and Praseodymium(III) complexes with Schiff bases derived from 5-substituted-4-amino-5-hydrazino-1,2,4-triazoles and isatin

    International Nuclear Information System (INIS)

    Singh, Shweta; Tripathi, Priti; Pandey, Om P.; Sengupta, Soumitra K.

    2013-01-01

    The new lanthanum(III) and praseodymium(III) complexes of the general formula (LnCl(L)(H 2 O) 2 ) (Ln = La III or Pr III ; H 2 L = Schiff bases derived from 3-substituted-4-amino-5-hydrazino-1,2,4-triazoles and isatin) have been prepared. The complexes have been characterized by elemental analyses, molecular weight by FAB-mass, thermogravimetry, electrical conductance, magnetic moment and spectral (electronic, infrared, far-infrared, 1 H NMR and 13 C NMR) data. The ligands and all prepared complexes were assayed for antifungal (Aspergillus niger and Helminthosporium oryzae) activities. The activities have been correlated with the structures of the complexes. (author)

  20. Synthesis, antimicrobial, and anti-inflammatory activities of novel 2-[3-(1-adamantyl)-4-substituted-5-thioxo-1,2,4-triazolin-1-yl] acetic acids, 2-[3-(1-adamantyl)-4-substituted-5-thioxo-1,2,4-triazolin-1-yl]propionic acids and related derivatives.

    Science.gov (United States)

    Al-Deeb, Omar A; Al-Omar, Mohamed A; El-Brollosy, Nasser R; Habib, Elsayed E; Ibrahim, Tarek M; El-Emam, Ali A

    2006-01-01

    The reaction of 3-(1-adamantyl)-4-substituted-1,2,4-triazoline-5-thiones 3a-g with sodium chloroacetate, in ethanolic sodium hydroxide yielded the corresponding N1-acetic acid derivatives 4a-g. The interaction of 3a-g with ethyl 2-bromopropionate in acetone, in the presence of potassium carbonate, yielded the corresponding N1-ethyl propionate derivatives 5a-g, which upon hydrolysis with aqueous sodium hydroxide afforded the corresponding propionic acid derivatives 6a-g. Similarly, the reaction of 3-(1-adamantyl)-4-amino-1,2,4-triazoline-5-thione 7 with sodium chloroacetate in ethanolic sodium hydroxide yielded the corresponding N1-acetic acid derivative 8. On the other hand, the reaction of 2-(1-adamantyl)-1,3,4-oxadiazoline-5-thione 9 with sodium chloroacetate yielded the corresponding S-acetic acid derivative 10. Compounds 4a-g, 5b, 5c, 5g, 6a-g, 8 and 10 were tested for in vitro activities against a panel of Gram-positive and Gram-negative bacteria and the yeast-like pathogenic fungus Candida albicans. Several derivatives produced good or moderate activities particularly against Bacillus subtilis. In addition, the in vivo anti-inflammatory activities of these compounds were determined using the carrageenin-induced paw oedema method in rats. Compounds 4a, 4b, 4e, 4f, 6f, 6g and 10 produced good dose-dependent anti-inflammatory activities.

  1. Substituted benzylamino

    African Journals Online (AJOL)

    NJD

    history dating back to the end of the 19th century, when the first. pKa was measured. Since then a vast body of ... derivatives, have been reported.5–16 It is known that these deriva- tives have weak acidic properties. ... constants of these derivatives in different media,17–20 however, very little information on the protonation ...

  2. Experimental and theoretical studies of solvent effects on the hydrogen bonds in homoconjugated cations of substituted 4-halo (Cl, Br) pyridine N-oxide derivatives

    International Nuclear Information System (INIS)

    Gurzynski, Lukasz; Puszko, Aniela; Makowski, Mariusz; Chmurzynski, Lech

    2007-01-01

    Hydrogen bond OHO-type bridges formed between six substituted 4-halo (Cl, Br) pyridine N-oxide systems and their simple cations have been investigated by using the potentiometric titration method. The formation constants of these complexes (expressed as lgK BHB + ) have been determined in two non-aqueous aprotic solvents with different polarity, i.e., acetone (AC) and acetonitrile (AN). It has been observed that tri- and tetra-substituted pyridine N-oxides [B] and their cationic acids [BH + ] form stable homocomplexed cations [BHB + ] stabilized by O...H...O bridges in both solvents used. It has been found that the most stable homocomplexed system is formed by 3,5-dimethyl-4-chloropyridine N-oxide (3,5Me 2 4ClPyO). The lgK BHB + values for this compound in acetone and acetonitrile are 3.15 and 2.82, respectively. Furthermore, by using ab initio methods at the RHF and MP2 levels utilizing the Gaussian 6-31++G ** basis set, the energies of formation of the homocomplexed cations and Gibbs free energies have been determined in vacuo. The calculated energy parameters in vacuo have been compared with the cationic homoconjugation constants determined potentiometrically in acetone and acetonitrile to establish a correlation between these magnitudes. Additionally, the results of potentiometric measurements have been used to determine the acidity constants of the conjugate acids of N-oxides

  3. Synthesis and biological activity of novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives.

    Science.gov (United States)

    El-Sawy, Eslam R; Ebaid, Manal S; Abo-Salem, Heba M; El-Hallouty, Salwa; Kassem, Emad M; Mandour, Adel H

    2014-05-01

    A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a-g and 11a-g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a-g and 7a-g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a-g, and 11a-g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively.

  4. Synthesis and XRD, FT-IR vibrational, UV-vis, and nonlinear optical exploration of novel tetra substituted imidazole derivatives: A synergistic experimental-computational analysis

    Science.gov (United States)

    Ahmad, Muhammad Saeed; Khalid, Muhammad; Shaheen, Muhammad Ashraf; Tahir, Muhammad Nawaz; Khan, Muhammad Usman; Braga, Ataualpa Albert Carmo; Shad, Hazoor Ahmad

    2018-04-01

    Heterocyclic compounds have potential applications in many fields of life. We synthesized novel tetra substituted imidazoles by four-component condensation of benzil, substituted aldehydes, substituted anilines and ammonium acetate as a source of ammonia and acetic acid as the solvent. Their chemical structures were resolved through X-ray crystallographic and spectroscopic (Fourier transform IR and UV-vis) techniques. In addition to experimental analysis, density functional theory (DFT) calculations at the B3LYP/6-311 + G(d,p) level were performed on 4-bromo-2-(1-(4-methoxyphenyl)-4,5-diphenyl-1H-imidazole-2-yl)phenol (1), 4-bromo-2-(1-(1-naphthalen-yl)-4,5-diphenyl-1H-imidazole-2-yl)phenol (2), and 2-(1-(2-chlorophenyl)-4,5-diphenyl-1-H-imidazole-2-yl)-6-methoxyphenol (3) to obtain the optimized geometry and spectroscopic (Fourier transform IR and UV-vis) and non-linear optical properties. Frontier molecular orbital analysis was performed at the Hartee-Fock/6-311+g(d,p) and DFT/B3LYP/6-311+G(d,p) levels of theory. Natural bond orbital (NBO) and UV-vis spectral analyses were performed at the M06-2X/6-31+G(d,p) and time-dependent DFT/B3LYP/6-311+G(d,p) levels, respectively. Overall, the DFT findings show good agreement with the experimental data. The hyper conjugative interaction network, which is responsible for the stability of compounds 1, 2 and 3 was explored by the NBO approach. The global reactivity parameters were explored with use of the energy of the frontier molecular orbitals. DFT calculations predict the first-order hyperpolarizabilities of compounds 1, 2 and 3 are 294.89 × 10-30, 219.45 × 10-30 and 146.77 × 10-30 esu, respectively. A two-state model was used to describe the non-linear optical properties of the compounds investigated.

  5. The Photochemistry of Benzotriazole Derivatives. Part 2: Photolysis of 1-Substituted Benzotriazole Arylhydrazones: New Route to Phenanthridin-6-yl-2-phenyldiazines

    Directory of Open Access Journals (Sweden)

    Nouria A. Al-Awadi

    2011-12-01

    Full Text Available Irradiation of 1-substituted benzotriazole arylhydrazones 3a–c, 4a,b and 5a,b with a 16 W low pressure mercury arc-lamp (254 nm for 24 h gave phenanthridin-6-yl-2-phenyldiazines 9a–c, phenanthridin-6(5H-ones 10a–c, 1-anilinobenzimidazoles 11a–c, 2-aryl-1H-benzimidazoles 12a–c, 1-arylamino-1H-benzimidazol-2-carboxylic acid ethyl esters 14a,b, 1-aryl-1H, 9H-benzo [4,5][1,2,3] triazolo[1,2-a]tetrazole-3-carboxylic acid ethyl esters 16a,b, 1-arylamino-2-benzoylbenzimidazoles 18a,b and 2-benzoylbenzoxazole 21.

  6. Experimental and theoretical studies of solvent effects on the hydrogen bonds in homoconjugated cations of substituted 4-halo (Cl, Br) pyridine N-oxide derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Gurzynski, Lukasz [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Puszko, Aniela [Department of Organic Chemistry, School of Economics, Wroclaw (Poland); Makowski, Mariusz [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Chmurzynski, Lech [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland)], E-mail: lech@chem.univ.gda.pl

    2007-09-15

    Hydrogen bond OHO-type bridges formed between six substituted 4-halo (Cl, Br) pyridine N-oxide systems and their simple cations have been investigated by using the potentiometric titration method. The formation constants of these complexes (expressed as lgK{sub BHB{sup +}}) have been determined in two non-aqueous aprotic solvents with different polarity, i.e., acetone (AC) and acetonitrile (AN). It has been observed that tri- and tetra-substituted pyridine N-oxides [B] and their cationic acids [BH{sup +}] form stable homocomplexed cations [BHB{sup +}] stabilized by O...H...O bridges in both solvents used. It has been found that the most stable homocomplexed system is formed by 3,5-dimethyl-4-chloropyridine N-oxide (3,5Me{sub 2}4ClPyO). The lgK{sub BHB{sup +}} values for this compound in acetone and acetonitrile are 3.15 and 2.82, respectively. Furthermore, by using ab initio methods at the RHF and MP2 levels utilizing the Gaussian 6-31++G{sup **} basis set, the energies of formation of the homocomplexed cations and Gibbs free energies have been determined in vacuo. The calculated energy parameters in vacuo have been compared with the cationic homoconjugation constants determined potentiometrically in acetone and acetonitrile to establish a correlation between these magnitudes. Additionally, the results of potentiometric measurements have been used to determine the acidity constants of the conjugate acids of N-oxides.

  7. InIII GaIII complexes of sugar-substituted tripodal trisalicylidene imines: The first68Ga-labelled sugar derivative

    NARCIS (Netherlands)

    Gottschaldt, M.; Bohlender, C.; Pospiech, A.; Görls, H.; Walther, M.; Müller, Dirk; Klette, I.; Baum, R.P.; Schubert, U.S.

    2009-01-01

    Gallium and indium complexes derived from salicylaldimines of 1,1,1-tris(aminomethyl)ethane (TAME) with pendant xylose, glucose and galactose units have been synthesised as model compounds for potential, application as radiotracers, The formed neutral complexes have been characterised by NMR

  8. Efficient generation of smooth muscle cells from adipose-derived stromal cells by 3D mechanical stimulation can substitute the use of growth factors in vascular tissue engineering.

    Science.gov (United States)

    Parvizi, Mojtaba; Bolhuis-Versteeg, Lydia A M; Poot, André A; Harmsen, Martin C

    2016-07-01

    Occluding artery disease causes a high demand for bioartificial replacement vessels. We investigated the combined use of biodegradable and creep-free poly (1,3-trimethylene carbonate) (PTMC) with smooth muscle cells (SMC) derived by biochemical or mechanical stimulation of adipose tissue-derived stromal cells (ASC) to engineer bioartificial arteries. Biochemical induction of cultured ASC to SMC was done with TGF-β1 for 7d. Phenotype and function were assessed by qRT-PCR, immunodetection and collagen contraction assays. The influence of mechanical stimulation on non-differentiated and pre-differentiated ASC, loaded in porous tubular PTMC scaffolds, was assessed after culturing under pulsatile flow for 14d. Assays included qRT-PCR, production of extracellular matrix and scanning electron microscopy. ASC adhesion and TGF-β1-driven differentiation to contractile SMC on PTMC did not differ from tissue culture polystyrene controls. Mesenchymal and SMC markers were increased compared to controls. Interestingly, pre-differentiated ASC had only marginal higher contractility than controls. Moreover, in 3D PTMC scaffolds, mechanical stimulation yielded well-aligned ASC-derived SMC which deposited ECM. Under the same conditions, pre-differentiated ASC-derived SMC maintained their SMC phenotype. Our results show that mechanical stimulation can replace TGF-β1 pre-stimulation to generate SMC from ASC and that pre-differentiated ASC keep their SMC phenotype with increased expression of SMC markers. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Human platelet lysate as a fetal bovine serum substitute improves human adipose-derived stromal cell culture for future cardiac repair applications

    NARCIS (Netherlands)

    Naaijkens, B.A.; Niessen, H.W.M.; Prins, H.J.; Krijnen, P.A.J.; Kokhuis, T.J.A.; de Jong, N.; van Hinsbergh, V.W.M.; Kamp, O.; Helder, M.N.; Musters, R.J.P.; van Dijk, A.; Juffermans, L.J.M.

    2012-01-01

    Adipose-derived stromal cells (ASC) are promising candidates for cell therapy, for example to treat myocardial infarction. Commonly, fetal bovine serum (FBS) is used in ASC culturing. However, FBS has several disadvantages. Its effects differ between batches and, when applied clinically,

  10. Human platelet lysate as a fetal bovine serum substitute improves human adipose-derived stromal cell culture for future cardiac repair applications

    NARCIS (Netherlands)

    B. Naaijkens (Benno); H.W.M. Niessen (Hans ); H.-J. Prins (H.); P.A.J. Krijnen (Paul); T.J.A. Kokhuis (Tom); N. de Jong (Nico); V.W.M. van Hinsbergh (Victor); O. Kamp (Otto); K. Helder MScN (Onno); R.J.P. Musters (René); A. van Dijk (Annemieke); L.J.M. Juffermans (Lynda)

    2012-01-01

    textabstractAdipose-derived stromal cells (ASC) are promising candidates for cell therapy, for example to treat myocardial infarction. Commonly, fetal bovine serum (FBS) is used in ASC culturing. However, FBS has several disadvantages. Its effects differ between batches and, when applied clinically,

  11. Development of 2-(Substituted Benzylamino)-4-Methyl-1, 3-Thiazole-5-Carboxylic Acid Derivatives as Xanthine Oxidase Inhibitors and Free Radical Scavengers.

    Science.gov (United States)

    Ali, Md Rahmat; Kumar, Suresh; Afzal, Obaid; Shalmali, Nishtha; Sharma, Manju; Bawa, Sandhya

    2016-04-01

    A series of 2-(substituted benzylamino)-4-methylthiazole-5-carboxylic acid was designed and synthesized as structural analogue of febuxostat. A methylene amine spacer was incorporated between the phenyl ring and thiazole ring in contrast to febuxostat in which the phenyl ring was directly linked with the thiazole moiety. The purpose of incorporating methylene amine was to provide a heteroatom which is expected to favour hydrogen bonding within the active site residues of the enzyme xanthine oxidase. The structure of all the compounds was established by the combined use of FT-IR, NMR and MS spectral data. All the compounds were screened in vitro for their ability to inhibit the enzyme xanthine oxidase as per the reported procedure along with DPPH free radical scavenging assay. Compounds 5j, 5k and 5l demonstrated satisfactory potent xanthine oxidase inhibitory activities with IC50 values, 3.6, 8.1 and 9.9 μm, respectively, whereas compounds 5k, 5n and 5p demonstrated moderate antioxidant activities having IC50 15.3, 17.6 and 19.6 μm, respectively, along with xanthine oxidase inhibitory activity. Compound 5k showed moderate xanthine oxidase inhibitory activity as compared with febuxostat along with antioxidant activity. All the compounds were also studied for their binding affinity in active site of enzyme (PDB ID-1N5X). © 2015 John Wiley & Sons A/S.

  12. Evaluation of some selected blood parameters and histopathology of liver and kidney of rats fed protein-substituted mucuna flour and derived protein rich product.

    Science.gov (United States)

    Ngatchic, Josiane Therese Metsagang; Sokeng, Selestion Dongmo; Njintang, Nicolas Yanou; Maoundombaye, Theophile; Oben, Julius; Mbofung, Carl Moses F

    2013-07-01

    This comparative study reports the nutritional and toxicological characteristics of Mucuna pruriens flour and a protein-rich product developed from it. The protein-rich mucuna product (PRMP) was obtained by the three steps procedure: protein solubilization, heat-coagulation and sieving. Three weeks rats (n=6 per group) were fed for 28 days on standard protein-substituted rat feed with mucuna flour or PRMP. The experimental design was a factorial design with three mucuna accessions (Velvet, Black and White) and two treatments (flour and PRMP). The protein content ranged 27.2-31.5 g/100 g for flour and 58.8-61.1% for PRMP. Processing flour into PRMP led to a significant (pmucuna flour lost weight. The levels of total cholesterol, HDL-cholesterol and LDL-cholesterol observed in animals groups fed mucuna flour and PRMP were significantly lower (pmucuna flour were significantly (pmucuna flour. PRMP then represents a good alternative of using mucuna proteins for human nutrition. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  13. Design and synthesis of new of 3-(benzo[d]isoxazol-3-yl)-1-substituted pyrrolidine-2, 5-dione derivatives as anticonvulsants.

    Science.gov (United States)

    Malik, Sachin; Ahuja, Priya; Sahu, Kapendra; Khan, Suroor Ahmad

    2014-09-12

    A series of 3-(benzo[d]isoxazol-3-yl)-N-substituted pyrrolidine-2, 5-dione (7a-7d, 8a-8d, 9a-9c) have been prepared and evaluated for their anticonvulsant activities. Preliminary anticonvulsant activity was performed using maximal electroshock (MES) and subcutaneous pentylenetetrazole (scPTZ) tests after intraperitoneal (ip) injection into mice, which are the most widely employed models for early identification of anticonvulsant candidate. The acute neurological toxicity (NT) was determined applying rotorod test. The quantitative evaluation after oral administration in rats showed that the most active was 3-(benzo[d]isoxazol-3-yl)-1-(4-fluorophenyl) pyrrolidine-2, 5-dione (8a) with ED50 values of 14.90 mg/kg. Similarly the most potent in scPTZ was 3-(benzo[d]isoxazol-3-yl)-1-cyclohexylpyrrolidine-2, 5-dione (7d) with ED50 values of 42.30 mg/kg. These molecules were more potent and less neurotoxic than phenytoin and ethosuximide which were used as reference antiepileptic drugs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. Convergent synthesis of 6-substituted phenanthridines via anionic ring closure

    DEFF Research Database (Denmark)

    Lysén, M.; Kristensen, Jesper Langgaard; Vedsø, P.

    2002-01-01

    Chemical equation presented The addition of organometallic derivatives to the cyano group of 2-(2-fluorophenyl)benzonitrile followed by intramolecular nucleophilic substitution produces 6-substituted phenanthridines. Alkyllithiums, aryllithiums, and sterically nondemanding lithium amides reacted ...

  15. Normal-phase liquid chromatography retention behavior of polycyclic aromatic hydrocarbon and their methyl-substituted derivatives on an aminopropyl stationary phase.

    Science.gov (United States)

    Wilson, Walter B; Hayes, Hugh V; Sander, Lane C; Campiglia, Andres D; Wise, Stephen A

    2017-09-01

    Retention indices for 124 polycyclic aromatic hydrocarbons (PAHs) and 62 methyl-substituted (Me-) PAHs were determined using normal-phase liquid chromatography (NPLC) on a aminopropyl (NH 2 ) stationary phase. PAH retention behavior on the NH 2 phase is correlated to the total number of aromatic carbons in the PAH structure. Within an isomer group, non-planar isomers generally elute earlier than planar isomers. MePAHs generally elute slightly later but in the same region as the parent PAHs. Correlations between PAH retention behavior on the NH 2 phase and PAH thickness (T) values were investigated to determine the influence of non-planarity for isomeric PAHs with four to seven aromatic rings. Correlation coefficients ranged from r = 0.19 (five-ring peri-condensed molecular mass (MM) 252 Da) to r = -0.99 (five-ring cata-condensed MM 278 Da). In the case of the smaller PAHs (MM ≤ 252 Da), most of the PAHs had a planar structure and provided a low correlation. In the case of larger PAHs (MM ≥ 278 Da), nonplanarity had a significant influence on the retention behavior and good correlation between retention and T was obtained for the MM 278 Da, MM 302 Da, MM 328 Da, and MM 378 Da isomer sets. Graphical abstract NPLC separation of the three-, four-, five-, and six-ring PAH isomers with different number of aromatic carbon atoms and degrees of non-planarity (Thickness, T). The inserted figure plots the number of aromatic carbon atoms vs. the log I value for the 124 parent PAHs.

  16. Microwave-Assisted Facile Synthesis, Anticancer Evaluation and Docking Study of N-((5-(Substituted methylene amino-1,3,4-thiadiazol-2-ylmethyl Benzamide Derivatives

    Directory of Open Access Journals (Sweden)

    Shailee V. Tiwari

    2017-06-01

    Full Text Available In the present work, 12 novel Schiff’s bases containing a thiadiazole scaffold and benzamide groups coupled through appropriate pharmacophore were synthesized. These moieties are associated with important biological properties. A facile, solvent-free synthesis of a series of novel 7(a–l N-((5-(substituted methylene amino-1,3,4-thiadiazol-2-ylmethyl benzamide was carried out under microwave irradiation. Structures of the synthesized compounds were confirmed by IR, NMR, mass spectral study and elemental analysis. All the synthesized hybrids were evaluated for their in vitro anticancer activity against a panel of four human cancer cell lines, viz. SK-MEL-2 (melanoma, HL-60 (leukemia, HeLa (cervical cancer, MCF-7 (breast cancer and normal breast epithelial cell (MCF-10A using 3-(4,5-dimethythiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay method. Most of the synthesized compounds exhibited promising anticancer activity, showed comparable GI50 values comparable to that of the standard drug Adriamycin. The compounds 7k, 7l, 7b, and 7a were found to be the most promising anticancer agents in this study. A molecular docking study was performed to predict the probable mechanism of action and computational study of the synthesized compounds 7(a–l was performed to predict absorption, distribution, metabolism, excretion and toxicity (ADMET properties, by using QikProp v3.5 (Schrödinger LLC. The results showed the good oral drug-like behavior of the synthesized compounds 7(a–l.

  17. Correlations Between retention indices and molecular structure of aliphatic alcohols and of their benzoyl derivatives on phenyl substituted polysiloxane stationary phases

    International Nuclear Information System (INIS)

    Pias, J. B.; Gasco, L.

    1976-01-01

    The retention indices of aliphatic alcohols of carbon number up to C g , and of their benzoyl derivatives up to C 7 , were determined in columns packed with Chromo sorb G (AW-DMCS-HP) coated previously with 5% methyl, and methyl phenyl polysiloxanes with increasing polarity (SE-30, 0V-3, 0V-7, 0V-11, 0V-17 and OV-25). Correlations between retention indices and chain length for 1-alcohols, 2-alcohols, 3-alcohols, 1 , on -3-alcohols, 2-methyl-1-alcohols and for their corresponding benzoyl derivatives were calculated at 100, 120 and 140 degree centigree. In alcohols, a -CH 2 - group increases I approximately 100 units, and in their benzoyl derivatives from 80 to 100 units. Dispersion indices Δl , and positional and structural increments δI, were evaluated for -OH and benzoyl groups in terms of phase polarity and chain length. Effects of chain length, chain branching and double bond location on retention parameters were also studied. (Author) 23 refs

  18. Synthesis, characterization, MCD spectroscopy, and TD-DFT calculations of copper-metalated nonperipherally substituted octaoctyl derivatives of tetrabenzotriazaporphyrin, cis- and trans-tetrabenzodiazaporphyrin, tetrabenzomonoazaporphyrin, and tetrabenzoporphyrin.

    Science.gov (United States)

    Mack, John; Sosa-Vargas, Lydia; Coles, Simon J; Tizzard, Graham J; Chambrier, Isabelle; Cammidge, Andrew N; Cook, Michael J; Kobayashi, Nagao

    2012-12-03

    Synthesis of the title compounds has been achieved through refinement of a recently reported synthetic protocol whereby varying equivalents of MeMgBr are reacted with 1,4-dioctylphthalonitrile to produce mixtures favoring specific hybrid structures. The initially formed magnesium-metalated compounds are obtained as pure materials and include, for the first time, both isomers (cis and trans) of tetrabenzodiazaporphyrin. The compounds were demetalated to the metal-free analogues, which were then converted into the copper-metalated derivatives. The X-ray structure of the copper tetrabenzotriazaporphyrin derivative is reported. The metal-free and copper-metalated macrocycles exhibit columnar mesophase behavior, and it is found that the mesophase stability is unexpectedly reduced in the diazaporphyrin derivatives compared to the rest of the series. The results of time-dependent density functional theory calculations for the copper complexes are compared to the observed optical properties. Michl's perimeter model was used as a conceptual framework for analyzing the magnetic circular dichroism spectral data, which predicted and accounted for trends in the observed experimental spectra.

  19. Synthesis, antitumor and antimicrobial activity of novel 1-substituted phenyl-3-[3-alkylamino(methyl)-2-thioxo-1,3,4-oxadiazole-5-yl] beta-carboline derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Savariz, Franciele C.; Formagio, Anelise S. N.; Barbosa, Valeria A.; Sarragiotto, Maria Helena [Universidade Estadual de Maringa (UEM), PR (Brazil). Dept. de Quimica; Foglio, Mary Ann; Carvalho, Joao E. de; Duarte, Marta C.T. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Centro Pluridisciplinar de Pesquisas Quimicas, Biologicas e Agricolas; Dias Filho, Benedito P. [Universidade Estadual de Maringa (UEM), PR (Brazil). Dept. de Analises Clinicas

    2010-07-01

    With the purpose of activity enhancement of 1-substituted phenyl-3-(2-thioxo-1,3,4-oxadiazole-5-yl) beta-carbolines 1a-c, reported as potential antitumor agents in our previous study, herein we report the synthesis and antitumor activity evaluation of several novel Mannich bases 2-7(a-c), by the introduction of different alkylamino(methyl) groups in the 1,3,4-oxadiazole unity of 1a-c. The antimicrobial activities of 1a-c and of 2-7(a-c) were also evaluated. Additionally, an in silico study of the ADME properties of novel synthesized beta-carboline derivatives 2-7(a-c) was performed by evaluation of their Lipinski's parameters and topological polar surface area (TPSA) and percentage of absorption (% ABS) data. (author)

  20. Synthesis and in vitro anti-proliferative effects of 3-(hetero)aryl substituted 3-[(prop-2-ynyloxy)(thiophen-2-yl)methyl]pyridine derivatives on various cancer cell lines.

    Science.gov (United States)

    Reddy Chamakura, Upendar; Sailaja, E; Dulla, Balakrishna; Kalle, Arunasree M; Bhavani, S; Rambabu, D; Kapavarapu, Ravikumar; Rao, M V Basaveswara; Pal, Manojit

    2014-03-01

    A series of 3-(hetero)aryl substituted 3-[(prop-2-ynyloxy)(thiophen-2-yl)methyl]pyridine derivatives were designed as potential anticancer agents. These compounds were conveniently prepared by using Pd/C-Cu mediated Sonogashira type coupling as a key step. Many of these compounds were found to be promising when tested for their in vitro anti-proliferative properties against six cancer cell lines. All these compounds were found to be selective towards the growth inhibition of cancer cells with IC50 values in the range of 0.9-1.7 μM (against MDA-MB 231 and MCF7 cells), comparable to the known anticancer drug doxorubicin. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. α-Amino Acid Derived Benzimidazole-Linked Rhodamines: A Case of Substitution Effect at the Amino Acid Site toward Spiro Ring Opening for Selective Sensing of Al3+ Ions.

    Science.gov (United States)

    Majumdar, Anupam; Mondal, Subhendu; Daniliuc, Constantin G; Sahu, Debashis; Ganguly, Bishwajit; Ghosh, Sourav; Ghosh, Utpal; Ghosh, Kumaresh

    2017-08-07

    α-Amino acid derived benzimidazole-linked rhodamines have been synthesized, and their metal ion sensing properties have been evaluated. Experimentally, l-valine- and l-phenylglycine-derived benzimidazole-based rhodamines 1 and 2 selectively recognize Al 3+ ion in aqueous CH 3 CN (CH 3 CN/H 2 O 4/1 v/v, 10 mM tris HCl buffer, pH 7.0) over the other cations by exhibiting color and "turn-on" emission changes. In contrast, glycine-derived benzimidazole 3 remains silent in the recognition event and emphasizes the role of α-substitution of amino acid undertaken in the design. The fact has been addressed on the basis of the single-crystal X-ray structures and theoretical calculations. Moreover, pink 1·Al 3+ and 2·Al 3+ ensembles selectively sensed F - ions over other halides through a discharge of color. Importantly, compounds 1 and 2 are cell permeable and have been used as imaging reagents for the detection of Al 3+ uptake in human lung carcinoma cell line A549.

  2. Simple, heart-smart substitutions

    Science.gov (United States)

    Coronary artery disease - heart smart substitutions; Atherosclerosis - heart smart substitutions; Cholesterol - heart smart substitutions; Coronary heart disease - heart smart substitutions; Healthy diet - heart ...

  3. The formation of [M-H]+ ions in N-alkyl-substituted thieno[3,4-c]-pyrrole-4,6-dione derivatives during atmospheric pressure photoionization mass spectrometry

    KAUST Repository

    Sioud, Salim

    2014-10-09

    RESULTS [M-H]+ ions were observed under APPI conditions. The type of dopant and the length of the alkyl chain affected the formation of these ions. MS/MS fragmentation of [M-H]+ and [M + H]+ ions exhibited completely different patterns. Theoretical calculations revealed that the loss of hydrogen molecules from the [M + H]+ ions is the most favourable condition under which to form [M-H]+ ions.CONCLUSIONS [M-H]+ ions were detected in all the TPD derivatives studied here under the special experimental conditions during APPI, using a halogenated benzene dopant, and TPD containing substituted N-alkyl side chains with a minimum of four carbon atoms. Density functional theory calculations showed that for [M-H]+ ions to be formed under these conditions, the loss of hydrogen molecules from the [M + H]+ ions is proposed to be necessary.RATIONALE The formation of ions during atmospheric pressure photoionization (APPI) mass spectrometry in the positive mode usually provides radical cations and/or protonated species. Intriguingly, during the analysis of some N-alkyl-substituted thieno[3,4-c]pyrrole-4,6-dione (TPD) derivatives synthesized in our laboratory, unusual [M-H]+ ion peaks were observed. In this work we investigate the formation of [M-H]+ ions observed under APPI conditions.METHODS Multiple experimental parameters, including the type of ionization source, the composition of the solvent, the type of dopant, the infusion flow rate, and the length of the alkyl side chain were investigated to determine their effects on the formation of [M-H]+ ions. In addition, a comparison study of the gas-phase tandem mass spectrometric (MS/MS) fragmentation of [M + H]+ vs [M-H]+ ions and computational approaches were used.

  4. Effect of halogen substitution on the enthalpies of solvation and hydrogen bonding of organic solutes in chlorobenzene and 1,2-dichlorobenzene derived using multi-parameter correlations

    Energy Technology Data Exchange (ETDEWEB)

    Varfolomeev, Mikhail A.; Rakipov, Ilnaz T.; Khachatrian, Artashes A. [Department of Physical Chemistry, Kazan Federal University, Kremlevskaya 18, Kazan 420008 (Russian Federation); Acree, William E., E-mail: acree@unt.edu [Department of Chemistry, 1155 Union Circle # 305070, University of North Texas, Denton, TX 76203-5017 (United States); Brumfield, Michela [Department of Chemistry, 1155 Union Circle # 305070, University of North Texas, Denton, TX 76203-5017 (United States); Abraham, Michael H. [Department of Chemistry, University College London, 20 Gordon Street, London WC1H 0AJ (United Kingdom)

    2015-10-10

    Graphical abstract: - Highlights: • Enthalpies of solution measured for 43 solutes dissolved in chlorobenzene. • Enthalpies of solution measured for 72 solutes dissolved in 1,2-dichlorobenzene. • Mathematical expressions derived for predicting enthalpies of solvation of solutes in chlorobenzene. • Mathematical expressions derived for predicting enthalpies of solvation of solutes in 1,2-chlorobenzene. - Abstract: Enthalpies of solution at infinite dilution at 298 K, Δ{sub soln}H{sup A/Solvent}, have been measured by isothermal solution calorimetry for 43 and 72 organic solutes dissolved in chlorobenzene and 1,2-dichlorobenzene, respectively. The measured Δ{sub soln}H{sup A/Solvent} data, along with published Δ{sub soln}H{sup A/Solvent} values taken from the published literature for solutes dissolved in both chlorobenzene solvents, were converted to enthalpies of solvation, Δ{sub solv}H{sup A/Solvent}, using standard thermodynamic equations. Abraham model correlations were developed from the experimental Δ{sub solv}H{sup A/Solvent} data. The best derived correlations describe the experimental gas-to-chlorobenzene and gas-to-1,2-dichlorobenzene enthalpies of solvation to within standard deviations of 1.5 kJ mol{sup −1} and 1.9 kJ mol{sup −1}, respectively. Enthalpies of X−H…π (X – O, N, and C) hydrogen bond formation of proton donor solutes (alcohols, amines, chlorinated hydrocarbons, etc.) with chlorobenzene and 1,2-dichlorobenzene were calculated based on the Abraham solvation equation. Obtained values are in good agreement with the results determined using conventional methods.

  5. Docking studies on a new human immunodeficiency virus integrase-Mg-DNA complex: phenyl ring exploration and synthesis of 1H-benzylindole derivatives through fluorine substitutions.

    Science.gov (United States)

    Ferro, Stefania; De Luca, Laura; Barreca, Maria Letizia; Iraci, Nunzio; De Grazia, Sara; Christ, Frauke; Witvrouw, Myriam; Debyser, Zeger; Chimirri, Alba

    2009-01-22

    A new model of HIV-1 integrase-Mg-DNA complex that is useful for docking experiments has been built. It was used to study the binding mode of integrase strand transfer inhibitor 1 (CHI-1043) and other fluorine analogues. Molecular modeling results prompted us to synthesize the designed derivatives which showed potent enzymatic inhibition at nanomolar concentration, high antiviral activity, and low toxicity. Microwave assisted organic synthesis (MAOS) was employed in several steps of the synthetic pathway, thus reducing reaction times and improving yields.

  6. Calorimetric investigations of hydrogen bonding in binary mixtures containing pyridine and its methyl-substituted derivatives. II. The dilute solutions of methanol and 2-methyl-2-propanol

    International Nuclear Information System (INIS)

    Marczak, Wojciech; Heintz, Andreas; Bucek, Monika

    2004-01-01

    Enthalpies of solution of methanol and 2-methyl-2-propanol (tert-butanol) in pyridine and its methyl derivatives were investigated in the range of mole fractions of alcohol x≤0.02 at temperature 298.15 K by a titration calorimeter. Dissolution of methanol is an exothermic process, with heat effects very close to those for water reported in part I of this study. The negative enthalpy of solution increases in the following order: pyridine < 3-methylpyridine < 4-methylpyridine < 2-methylpyridine < 2,6-dimethylpyridine < 2,4,6-trimethylpyridine. Positive enthalpies of solution of 2-methyl-2-propanol increase as follows: 2-methylpyridine < 2,4,6-trimethylpyridine < 4-methylpyridine < 2,6-dimethylpyridine < 3-methylpyridine < pyridine. The propensity of pyridine derivatives to hydrogen bonding is enhanced by the ortho effect. Methyl groups are probably too small to prevent the nitrogen atom in the pyridine ring from hydrogen bonding. However, spacious hydrocarbon group in 2-methyl-2-propanol molecule makes the bonding difficult for 2,6-dimethylpyridine and 2,4,6-trimethylpyridine, thus the number of O-H···N bonds is smaller than that in the solutions of methanol or water. The two latter seem to be very close to each other

  7. Discovery of novel propargylamine-modified 4-aminoalkyl imidazole substituted pyrimidinylthiourea derivatives as multifunctional agents for the treatment of Alzheimer's disease.

    Science.gov (United States)

    Xu, Yi-Xiang; Wang, Huan; Li, Xiao-Kang; Dong, Sheng-Nan; Liu, Wen-Wen; Gong, Qi; Wang, Tian-Duan-Yi; Tang, Yun; Zhu, Jin; Li, Jian; Zhang, Hai-Yan; Mao, Fei

    2018-01-01

    A series of novel propargylamine-modified pyrimidinylthiourea derivatives (1-3) were designed and synthesized as multifunctional agents for Alzheimer's disease (AD) therapy, and their potential was evaluated through various biological experiments. Among these derivatives, compound 1b displayed good selective inhibitory activity against AChE (vs BuChE, IC 50  = 0.324 μM, SI > 123) and MAO-B (vs MAO-A, IC 50  = 1.427 μM, SI > 35). Molecular docking study showed that the pyrimidinylthiourea moiety of 1b could bind to the catalytic active site (CAS) of AChE, and the propargylamine moiety interacted directly with the flavin adenine dinucleotide (FAD) of MAO-B. Moreover, 1b demonstrated mild antioxidant ability, good copper chelating property, effective inhibitory activity against Cu 2+ -induced Aβ 1-42 aggregation, moderate neuroprotection, low cytotoxicity, and appropriate blood-brain barrier (BBB) permeability in vitro and was capable of ameliorating scopolamine-induced cognitive impairment in mice. These results indicated that 1b has the potential to be a multifunctional candidate for the treatment of Alzheimer's disease. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Patient-Derived Human Induced Pluripotent Stem Cells From Gingival Fibroblasts Composited With Defined Nanohydroxyapatite/Chitosan/Gelatin Porous Scaffolds as Potential Bone Graft Substitutes.

    Science.gov (United States)

    Ji, Jun; Tong, Xin; Huang, Xiaofeng; Zhang, Junfeng; Qin, Haiyan; Hu, Qingang

    2016-01-01

    Human embryonic stem cells and adult stem cells have always been the cell source for bone tissue engineering. However, their limitations are obvious, including ethical concerns and/or a short lifespan. The use of human induced pluripotent stem cells (hiPSCs) could avoid these problems. Nanohydroxyapatite (nHA) is an important component of natural bone and bone tissue engineering scaffolds. However, its regulation on osteogenic differentiation with hiPSCs from human gingival fibroblasts (hGFs) is unknown. The purpose of the present study was to investigate the osteogenic differentiation of hiPSCs from patient-derived hGFs regulated by nHA/chitosan/gelatin (HCG) scaffolds with different nHA ratios, such as HCG-111 (1 wt/vol% nHA) and HCG-311 (3 wt/vol% nHA). First, hGFs were reprogrammed into hiPSCs, which have enhanced osteogenic differentiation capability. Second, HCG-111 and HCG-311 scaffolds were successfully synthesized. Finally, hiPSC/HCG complexes were cultured in vitro or subcutaneously transplanted into immunocompromised mice in vivo. The osteogenic differentiation effects of two types of HCG scaffolds on hiPSCs were assessed for up to 12 weeks. The results showed that HCG-311 increased osteogenic-related gene expression of hiPSCs in vitro proved by quantitative real-time polymerase chain reaction, and hiPSC/HCG-311 complexes formed much bone-like tissue in vivo, indicated by cone-beam computed tomography imaging, H&E staining, Masson staining, and RUNX-2, OCN immunohistochemistry staining. In conclusion, our study has shown that osteogenic differentiation of hiPSCs from hGFs was improved by HCG-311. The mechanism might be that the nHA addition stimulates osteogenic marker expression of hiPSCs from hGFs. Our work has provided an innovative autologous cell-based bone tissue engineering approach with soft tissues such as clinically abundant gingiva. The present study focused on patient-personalized bone tissue engineering. Human induced pluripotent stem cells

  9. The Substitution Effect on Reaction Enthalpies of Antioxidant Mechanisms of Juglone and Its Derivatives in Gas and Solution Phase: DFT Study

    Directory of Open Access Journals (Sweden)

    Aymard Didier Tamafo Fouegue

    2018-01-01

    Full Text Available We examined the structure-reaction enthalpies-antioxidant activity relationship of the molecule library built around juglone and its derivatives at B3LYP/6-31+G(d,p level. Three major antioxidant mechanisms (hydrogen atom transfer (HAT, single electron transfer-proton transfer (SET-PT, and sequential proton loss electron transfer (SPLET have been investigated in five solvents and in the gas phase. The delocalization of the unpaired electrons in the radicals or cation radicals has been explored by the natural bond orbital analysis and the interpretation of spin density maps. The results obtained have proven that the HAT mechanism is the thermodynamically preferred mechanism in the gas phase. But, in the solution phase, the SPLET mechanism has been shown to be more predominant than HAT. The reactivity order of compounds towards selected reactive oxygen species has also been studied.

  10. Synthesis and electroluminescent properties of blue fluorescent materials based on 9,9-diethyl-N,N-diphenyl-9 H-fluoren-2-amine substituted anthracene derivatives for organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seul Bee; Kim, Chanwoo; Park, Soo Na; Kim, Young Seok [Department of Chemistry, Sungkyunkwan University, Suwon, 440-746 (Korea, Republic of); Lee, Ho Won [Department of Information Display, Hongik University, Seoul, 121-791 (Korea, Republic of); Kim, Young Kwan, E-mail: kimyk@hongik.ac.kr [Department of Information Display, Hongik University, Seoul, 121-791 (Korea, Republic of); Yoon, Seung Soo, E-mail: ssyoon@skku.edu [Department of Chemistry, Sungkyunkwan University, Suwon, 440-746 (Korea, Republic of)

    2015-11-30

    Four 9,9-diethyl-N,N-diphenyl-9 H-fluoren-2-amine substituted anthracene derivatives have been designed and synthesized by Suzuki cross coupling reactions. To explore the electroluminescent properties of these blue materials, multilayer blue organic light-emitting diodes were fabricated in the following device structure: indium tin oxide (180 nm)/N,N’-diphenyl-N,N’-(1-napthyl)-(1,1′-phenyl)-4,4′-diamine (50 nm)/blue emitting materials (1–4) (30 nm)/bathophenanthroline (30 nm)/lithium quinolate (2 nm)/Al (100 nm). All devices appeared excellent deep-blue emissions. Among them, a device exhibited a maximum luminance of 5686 cd/m{sup 2}, the luminous, power and external quantum efficiencies of 5.11 cd/A, 3.79 lm/W, and 4.06% with the Commission International de L'Eclairage coordinates of (0.15, 0.15) at 500 cd/m{sup 2}, respectively. - Highlights: • We synthesized blue fluorescent materials based on anthracene derivatives. • The EL efficiencies of these materials depend on the quantum yields in solid states. • These materials have great potential for applications as blue emitter in OLEDs.

  11. Synthesis, crystal structure determination, biological screening and docking studies of N1-substituted derivatives of 2,3-dihydroquinazolin-4(1H)-one as inhibitors of cholinesterases.

    Science.gov (United States)

    Sultana, Nargis; Sarfraz, Muhammad; Tanoli, Saba Tahir; Akram, Muhammad Safwan; Sadiq, Abdul; Rashid, Umer; Tariq, Muhammad Ilyas

    2017-06-01

    Pursuing the strategy of developing potent AChE inhibitors, we attempted to carry out the N 1 -substitution of 2,3-dihydroquinazolin-4(1H)-one core. A set of 32 N-alkylated/benzylated quinazoline derivatives were synthesized, characterized and evaluated for their inhibition against cholinesterases. N-alkylation of the series of the compounds reported previously (N-unsubstituted) resulted in improved activity. All the compounds showed inhibition of both enzymes in the micromolar to submicromolar range. Structure activity relationship (SAR) of the 32 derivatives showed that N-benzylated compounds possess good activity than N-alkylated compounds. N-benzylated compounds 2ad and 2af were found very active with their IC 50 values toward AChE in submicromolar range (0.8µM and 0.6µM respectively). Binding modes of the synthesized compounds were explored by using GOLD (Genetic Optimization for Ligand Docking) suit v5.4.1. Computational predictions of ADMET studies reveal that all the compounds have good pharmacokinetic properties with no AMES toxicity and carcinogenicity. Moreover, all the compounds are predicted to be absorbed in human intestine and also have the ability to cross blood brain barrier. Overall, the synthesized compounds have established a structural foundation for the design of new inhibitors of cholinesterase. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Synthesis and Antidepressant Activity of Some New 5-(1H-Indol-3-yl-3-(substituted aryl-4,5-dihydroisoxazoline Derivatives

    Directory of Open Access Journals (Sweden)

    Pravin O. Patil

    2013-01-01

    Full Text Available The present study refers to the synthesis of new antidepressant candidates using the indole scaffold. In an attempt to identify potential lead antidepressant agents, a number of indole molecules, incorporating isoxazoline, were synthesized by microwave-assisted synthesis. The antidepressant activity of the synthesized compounds (3a–3n was evaluated by forced swim test in mice and their locomotor activity was assessed using actophotometry. The present paper showed significant antidepressant activity for all compounds of the series and no significant change in locomotor activity of mice. Compounds 3d and 3j were found to be potent molecules of this series, when compared with the reference drugs imipramine and fluoxetine. It clearly demonstrated that replacement of aromatic core by appropriate heterocycles such as pyridine and pyrrole on the 5-(1H-Indol-3-yl-3-(Phenyl-4,5-dihydroisoxazoline (3a would generate more potent derivatives. Thus, these compounds can serve as potential leads for further antidepressant studies.

  13. Buthalital and methitural – 5,5-substituted derivatives of 2-thiobarbituric acid forming the same type of hydrogen-bonded chain

    Directory of Open Access Journals (Sweden)

    Thomas Gelbrich

    2017-12-01

    Full Text Available The molecule of buthalital, (I [systematic name: 5-(2-methylpropyl-5-(prop-2-en-1-yl-2-sulfanylidene-1,3-diazinane-4,6-dione], C11H16N2O2S, exhibits a planar pyrimidine ring, whereas the pyrimidine ring of methitural, (II [systematic name: 5-(1-methylbutyl-5-[2-(methylsulfanylethyl]-2-sulfanylidene-1,3-diazinane-4,6-dione], C12H20N2O2S2, is slightly puckered. (I and (II contain the same hydrogen-bonded chain structure in which each molecule is connected, via four N—H...O=C hydrogen bonds, to two other molecules, resulting in a hydrogen-bonded chain displaying a sequence of R22(8 rings. The same type of N—H...O=C hydrogen-bonded chain has previously been found in several 5,5-disubstituted derivatives of barbituric acid which are chemically closely related to (I and (II.

  14. Convenience versus Biological Significance: Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived Macrophages When Studying in Vitro Polarization?

    Science.gov (United States)

    Tedesco, Serena; De Majo, Federica; Kim, Jieun; Trenti, Annalisa; Trevisi, Lucia; Fadini, Gian Paolo; Bolego, Chiara; Zandstra, Peter W; Cignarella, Andrea; Vitiello, Libero

    2018-01-01

    Human peripheral-blood monocytes are used as an established in vitro system for generating macrophages. For several reasons, monocytic cell lines such as THP-1 have been considered as a possible alternative. In view of their distinct developmental origins and phenotypic attributes, we set out to assess the extent to which human monocyte-derived macrophages (MDMs) and phorbol-12-myristate-13-acetate (PMA)-differentiated THP-1 cells were overlapping across a variety of responses to activating stimuli. Resting (M0) macrophages were polarized toward M1 or M2 phenotypes by 48-h incubation with LPS (1 μg/ml) and IFN-γ (10 ng/ml) or with IL-4 (20 ng/ml) and IL-13 (5 ng/ml), respectively. At the end of stimulation, MDMs displayed more pronounced changes in marker gene expression than THP-1. Upon assaying an array of 41 cytokines, chemokines and growth factors in conditioned media (CM) using the Luminex technology, secretion of 29 out of the 41 proteins was affected by polarized activation. While in 12 of them THP-1 and MDM showed comparable trends, for the remaining 17 proteins their responses to activating stimuli did markedly differ. Quantitative comparison for selected analytes confirmed this pattern. In terms of phenotypic activation markers, measured by flow cytometry, M1 response was similar but the established MDM M2 marker CD163 was undetectable in THP-1 cells. In a beads-based assay, MDM activation did not induce significant changes, whereas M2 activation of THP-1 decreased phagocytic activity compared to M0 and M1. In further biological activity tests, both MDM and THP-1 CM failed to affect proliferation of mouse myogenic progenitors, whereas they both reduced adipogenic differentiation of mouse fibro-adipogenic progenitor cells (M2 to a lesser extent than M1 and M0). Finally, migration of human umbilical vein endothelial cells was enhanced by CM irrespective of cell type and activation state except for M0 CM from MDMs. In summary, PMA-differentiated THP-1

  15. Substitution determination of Fmoc‐substituted resins at different wavelengths

    Science.gov (United States)

    Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel

    2017-01-01

    In solid‐phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc‐substituted resins, substitution determination is often performed by suspending the Fmoc‐protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene–piperidine adduct that is quantified by ultraviolet–visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene–piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert–Beer's law, together with the substance‐specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol−1 cm−1 and 8100 l mol−1 cm−1 have been reported for the dibenzofulvene–piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. PMID:28635051

  16. Substitution determination of Fmoc-substituted resins at different wavelengths.

    Science.gov (United States)

    Eissler, Stefan; Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel

    2017-10-01

    In solid-phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc-substituted resins, substitution determination is often performed by suspending the Fmoc-protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene-piperidine adduct that is quantified by ultraviolet-visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene-piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert-Beer's law, together with the substance-specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol -1  cm -1 and 8100 l mol -1  cm -1 have been reported for the dibenzofulvene-piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd.

  17. The substitution bias of the consumer price index

    OpenAIRE

    Frenger, Petter

    2006-01-01

    Abstract: The paper uses elementary consumer theory to propose an inflation independent ratio definition of the substitution bias of the Laspeyres consumer price index, and derives an approximate substitution bias which depends on the size of the price change as measured by a norm in the Laspeyres plane and on the elasticity of substitution in the direction of the price change. This norm or distance measure can be interpreted as a price substitution index which yields useful in...

  18. Biological activities of substituted trichostatic acid derivatives

    Indian Academy of Sciences (India)

    Administrator

    reduced pressure to give the crude alcohol that was purified (flash ..... Briefly, 4 × 10. 3 cells/well were plated .... to give alcohol 8 that under Oppenhauer oxidation gave the key .... Minucci S and Pelicci G 2006 Nature Reviews Can- cer 6 38. 8.

  19. Medicineringsfejl ved generisk substitution

    DEFF Research Database (Denmark)

    Rölfing, Jan

    2012-01-01

    Generic substitution is a major cause of medical mistakes in the general population. Danish legislation obligates pharmacies to substitute prescribed medicine with the cheapest equivalent formulation, despite variations in product name, packaging, shape and colour. Consequently, medical mistakes...... occur. Scientific evidence on the consequences of generic substitution is sparse. Call upon fellow health workers to report medical mistakes to the national entities and scientific peers, in order to increase awareness and scientific evidence about the problem....

  20. Synthesis and serotonergic activity of substituted 2, N-benzylcarboxamido-5-(2-ethyl-1-dioxoimidazolidinyl)-N, N-dimethyltryptamine derivatives: novel antagonists for the vascular 5-HT(1B)-like receptor.

    Science.gov (United States)

    Moloney, G P; Martin, G R; Mathews, N; Milne, A; Hobbs, H; Dodsworth, S; Sang, P Y; Knight, C; Williams, M; Maxwell, M; Glen, R C

    1999-07-15

    The synthesis and vascular 5-HT(1B)-like receptor activity of a novel series of substituted 2, N-benzylcarboxamido-5-(2-ethyl-1-dioxoimidazolidinyl)-N, N-dimethyltryptamine derivatives are described. Modifications to the 5-ethylene-linked heterocycle and to substituents on the 2-benzylamide side chain have been explored. Several compounds were identified which exhibited affinity at the vascular 5-HT(1B)-like receptor of pK(B) > 7.0, up to 100-fold selectivity over alpha(1)-adrenoceptor affinity and 5-HT(2A) receptor affinity, and which exhibited a favorable pharmacokinetic profile. N-Benzyl-3-[2-(dimethylamino)ethyl]-5-[2-(4,4-dimethyl-2, 5-dioxo-1-imidazolidinyl)ethyl]-1H-indole-2-carboxamide (23) was identified as a highly potent, silent (as judged by the inability of angiotensin II to unmask 5-HT(1B)-like receptor-mediated agonist activity in the rabbit femoral artery), and competitive vascular 5-HT(1B)-like receptor antagonist with a plasma elimination half-life of approximately 4 h in dog plasma and with good oral bioavailability. The selectivity of compounds from this series for the vascular 5-HT(1B)-like receptors over other receptor subtypes is discussed as well as a proposed mode of binding to the receptor pharmacophore. It has been proposed that the aromatic ring of the 2, N-benzylcarboxamide group can occupy an aromatic binding site rather than the indole ring. The resulting conformation allows an amine-binding site to be occupied by the ethylamine nitrogen and a hydrogen-bonding site to be occupied by one of the hydantoin carbonyls. The electronic nature of the 2,N-benzylcarboxamide aromatic group as well as the size of substituents on this aromatic group is crucial for producing potent and selective antagonists. The structural requirement on the 3-ethylamine side chain incorporating the protonatable nitrogen is achieved by the bulky 2, N-benzylcarboxamide group and its close proximity to the 3-side chain.

  1. 40 CFR 721.981 - Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex.

    Science.gov (United States)

    2010-07-01

    ... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...

  2. Cation Radical Accelerated Nucleophilic Aromatic Substitution via Organic Photoredox Catalysis.

    Science.gov (United States)

    Tay, Nicholas E S; Nicewicz, David A

    2017-11-15

    Nucleophilic aromatic substitution (S N Ar) is a direct method for arene functionalization; however, it can be hampered by low reactivity of arene substrates and their availability. Herein we describe a cation radical-accelerated nucleophilic aromatic substitution using methoxy- and benzyloxy-groups as nucleofuges. In particular, lignin-derived aromatics containing guaiacol and veratrole motifs were competent substrates for functionalization. We also demonstrate an example of site-selective substitutive oxygenation with trifluoroethanol to afford the desired trifluoromethylaryl ether.

  3. Facile Synthesis of N -Substituted Benzimidazoles

    NARCIS (Netherlands)

    Kurhade, Santosh; Rossetti, Arianna; Dömling, Alexander

    2016-01-01

    A particularly mild and efficient one-pot synthesis of N-substituted benzimidazole derivatives was developed. 2-Fluoro-5-nitrophenylisocyanide reacts with a diverse set of primary amines to afford the respective products in moderate to very good yield (35-95%; 20 examples).

  4. Electricity/oil substitution

    International Nuclear Information System (INIS)

    Melvin, J.G.

    1980-09-01

    The extent to which electricity could substitute for imported oil in Canada is assessed and it is concluded that the bulk of projected oil imports could be displaced. This substitution of electricity for oil could be largely completed within two decades, with existing technology, using Canadian resources. The substitution of electricity for imported oil would result in relatively low energy costs and would stimulate economic growth. Energy self-sufficiency through the substitution of electricity for oil is uniquely a Canadian option; it is not open to other industrial countries. The option exists because of Canada's resources of oil sands for essential liquid fuels, hydraulic and nuclear electrical potential, and natural gas as an interim source of energy. While other countries face an energy crisis due to declining supplies of oil, Canada faces opportunities. The policies of Federal and Provincial governments, as perceived by individual decision makers, will have a major influence on Canada's ability to realize opportunities. (auth)

  5. Synthesis and properties of di- and trinitrobenzyl substituted pyridine derivates. The paper is supposed to be published in the special issue of the ESOR XII 2009 meeting in Haifa. Editor of the issue is Amnon Stanger

    OpenAIRE

    2010-01-01

    Abstract A new method to obtain di- and trinitrobenzyl substituted pyridines is presented. By systematic variation of reaction parameters the reaction conditions were optimized. The novel synthesis circumvents the commonly used nitration of benzyl pyridines, and thus avoids the nitration of the heterocycle which is a common side reaction. Furthermore, the starting materials for the synthesis of a variety of photochromic nitrobenzyl pyridines are easily accessible. The half-lifes of...

  6. Bone substitute biomaterials

    CERN Document Server

    Mallick, K

    2014-01-01

    Bone substitute biomaterials are fundamental to the biomedical sector, and have recently benefitted from extensive research and technological advances aimed at minimizing failure rates and reducing the need for further surgery. This book reviews these developments, with a particular focus on the desirable properties for bone substitute materials and their potential to encourage bone repair and regeneration. Part I covers the principles of bone substitute biomaterials for medical applications. One chapter reviews the quantification of bone mechanics at the whole-bone, micro-scale, and non-scale levels, while others discuss biomineralization, osteoductivization, materials to fill bone defects, and bioresorbable materials. Part II focuses on biomaterials as scaffolds and implants, including multi-functional scaffolds, bioceramics, and titanium-based foams. Finally, Part III reviews further materials with the potential to encourage bone repair and regeneration, including cartilage grafts, chitosan, inorganic poly...

  7. [Delegation yes, substitution no!].

    Science.gov (United States)

    Schroeder, A

    2014-08-01

    The aging of society leads on the one hand to increasing case numbers and on the other hand to a reduction in the number of physicians available for patient treatment. The delegation and substitution of medical duties as a tried and tested method is increasingly being recommended in order to compensate for the lack of physicians. The Berufsverband der Deutschen Urologen (BDU, Professional Association of German Urologists) supports the guiding principle of the Bundesärztekammer (Federal Medical Council) of "delegation yes, substitution no" and rejects a substitution of medical duties by non-medical academic health personnel. Against the background of the demographic changes, the increasing need for treatment and the current deficiency of junior physicians, a more extensive inclusion of well-qualified and experienced non-medical personnel by the delegation of medically responsible duties (medical scope of practice) can be an appropriate measure to maintain a good medical service in practices, hospitals and nursing homes.

  8. Muon substituted free radicals

    International Nuclear Information System (INIS)

    Burkhard, P.; Fischer, H.; Roduner, E.; Strub, W.; Gygax, F.N.; Brinkman, G.A.; Louwrier, P.W.F.; McKenna, D.; Ramos, M.; Webster, B.C.

    1984-01-01

    Spin polarized energetic positive muons are injected as magnetic probes into unsaturated organic liquids. They are implemented via fast chemical processes ( -10 s) in various molecules. Of particular interest among these are muonium substituted free radicals. The technique allows determination of accurate rate coefficients for fast chemical reactions of radicals. Furthermore, radiochemical processes occuring in picoseconds after injection of the muon are studied. Of fundamental interest are also the structural and dynamical implications of substituting a proton by a muon, or in other terms, a hydrogen atom by a muonium atom. Selected examples for each of these three types of experiments are given. (Auth.)

  9. Photo-rearrangements of some 3-allyloxy-2-phenyl-chromones: Synthesis of vinyl substituted benzopyronopyranes

    Directory of Open Access Journals (Sweden)

    Rupesh Kumar

    2008-10-01

    Full Text Available Photochemical reactions of some 3-allyloxy-2-phenylchromones have been studied. Photoreactions of the compounds afforded substituted pyronopyrane derivatives through the 1,4-biradicals.

  10. Hazardous solvent substitution

    International Nuclear Information System (INIS)

    Twitchell, K.E.

    1995-01-01

    This article is an overview of efforts at INEL to reduce the generation of hazardous wastes through the elimination of hazardous solvents. To aid in their efforts, a number of databases have been developed and will become a part of an Integrated Solvent Substitution Data System. This latter data system will be accessible through Internet

  11. Carbolanthanation of substituted alkynes

    International Nuclear Information System (INIS)

    Kalinin, V.N.; Kazimirchuk, E.I.; Vitt, S.V.; Khandozhko, V.N.; Beletskaya, I.P.

    1993-01-01

    Using the reaction between CH 3 YbI and substituted alkynes as an example, agents can enter into carbolanthanation reaction via transfer of a methyl group to carbon atom of acetylene bond with the production of a new olefin carbanion. 5 refs.; 1 fig.; 3 tabs

  12. Crystal structures and catalytic performance of three new methoxy substituted salen type nickel(II) Schiff base complexes derived from meso-1,2-diphenyl-1,2-ethylenediamine

    Science.gov (United States)

    Ghaffari, Abolfazl; Behzad, Mahdi; Pooyan, Mahsa; Amiri Rudbari, Hadi; Bruno, Giuseppe

    2014-04-01

    Three new nickel(II) complexes of a series of methoxy substituted salen type Schiff base ligands were synthesized and characterized by IR, UV-Vis and 1H NMR spectroscopy and elemental analysis. The ligands were synthesized from the condensation of meso-1,2-diphenyl-1,2-ethylenediamine with n-methoxysalicylaldehyde (n = 3, 4 and 5). Crystal structures of these complexes were determined. Electrochemical behavior of the complexes was studied by means of cyclic voltammetry in DMSO solutions. Catalytic performance of the complexes was studied in the epoxidation of cyclooctene using tert-butylhydroperoxide (TBHP) as oxidant under various conditions to find the optimum operating parameters. Low catalytic activity with moderate epoxide selectivity was observed in in-solvent conditions but in the solvent-free conditions, enhanced catalytic activity with high epoxide selectivity was achieved.

  13. Neutron scattering from a substitutional mass defect

    International Nuclear Information System (INIS)

    Williams, R.D.; Lovesey, S.W.

    1985-06-01

    The dynamic structure factor is calculated for a low concentration of light mass scatterers substituted in a cubic crystal matrix. A new numerical method for the exact calculation is demonstrated. A local density of states for the low momentum transfer limit, and the shifts and widths of the oscillator peaks in the high momentum transfer limit are derived. The limitations of an approximation which decouples the defect from the lattice is discussed. (author)

  14. [Currently available skin substitutes].

    Science.gov (United States)

    Oravcová, Darina; Koller, Ján

    2014-01-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. Autologous split or full-thickness skin graft are the best definitive burn wound coverage, but it is constrained by the limited available sources, especially in major burns. Donor site morbidities in term of additional wounds and scarring are also of concern of the autograft application. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. This paper reviews currently available skin substitutes, produced in not for-profit skin banks as well as commercially available. They are divided according to type of material included, as biological, biosynthetic and synthetic and named respectively.

  15. Synthesis and Evaluation of in Vitro Biological Activity of 4-Substituted Arylpiperazine Derivatives of 1,7,8,9-Tetrachloro-10,10-dimethoxy-4-azatricyclo[5.2.1.02,6]dec-8-ene-3,5-dione

    Directory of Open Access Journals (Sweden)

    David Collu

    2009-12-01

    Full Text Available A series of twenty arylpiperazine derivatives of 1,7,8,9-tetrachloro-10,10-dimethoxy-4-azatricyclo[5.2.1.02,6]dec-8-ene-3,5-dione have been prepared. These derivatives were tested in vitro with the aim of identifying novel lead compounds active against emergent and re-emergent human and cattle infectious diseases (AIDS, hepatitis B and C, tuberculosis, bovine viral diarrhea. In particular, these compounds were evaluated in vitro against representatives of different virus classes, such as a HIV-1 (Retrovirus, a HBV (Hepadnavirus and the single-stranded RNA+ viruses Yellow fever virus (YFV and Bovine viral diarrhea virus (BVDV, both belonging to the Flaviridae. Compounds 2c, 2g and 3d showed a modest activity against CVB-2. The molecular structures of the starting imide 1 and one of propyl-piperazine derivatives, 3b, have been determined by an X-ray crystallography study.

  16. Design, synthesis, and biological evaluation of novel 1,2-diaryl-4-substituted-benzylidene-5(4H)-imidazolone derivatives as cytotoxic agents and COX-2/LOX inhibitors

    Czech Academy of Sciences Publication Activity Database

    Lamie, P.F.; Philoppes, J.N.; Rárová, Lucie

    2018-01-01

    Roč. 351, 3-4 (2018), č. článku e1700311. ISSN 0365-6233 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : anti-inflammatory * cytotoxicity * diaryl imidazolone derivatives * molecular docking study Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemical research methods Impact factor: 1.994, year: 2016

  17. A multidisciplinary study of 3-(β-d-glucopyranosyl)-5-substituted-1,2,4-triazole derivatives as glycogen phosphorylase inhibitors: Computation, synthesis, crystallography and kinetics reveal new potent inhibitors.

    Science.gov (United States)

    Kun, Sándor; Begum, Jaida; Kyriakis, Efthimios; Stamati, Evgenia C V; Barkas, Thomas A; Szennyes, Eszter; Bokor, Éva; Szabó, Katalin E; Stravodimos, George A; Sipos, Ádám; Docsa, Tibor; Gergely, Pál; Moffatt, Colin; Patraskaki, Myrto S; Kokolaki, Maria C; Gkerdi, Alkistis; Skamnaki, Vassiliki T; Leonidas, Demetres D; Somsák, László; Hayes, Joseph M

    2018-03-10

    3-(β-d-Glucopyranosyl)-5-substituted-1,2,4-triazoles have been revealed as an effective scaffold for the development of potent glycogen phosphorylase (GP) inhibitors but with the potency very sensitive to the nature of the alkyl/aryl 5-substituent (Kun et al., Eur. J. Med. Chem. 2014, 76, 567). For a training set of these ligands, quantum mechanics-polarized ligand docking (QM-PLD) demonstrated good potential to identify larger differences in potencies (predictive index PI = 0.82) and potent inhibitors with K i 's synthesis. The compounds were prepared in O-perbenzoylated forms by either ring transformation of 5-β-d-glucopyranosyl tetrazole by N-benzyl-arenecarboximidoyl chlorides, ring closure of C-(β-d-glucopyranosyl)formamidrazone with aroyl chlorides, or that of N-(β-d-glucopyranosylcarbonyl)arenethiocarboxamides by hydrazine, followed by deprotections. Kinetics experiments against rabbit muscle GPb (rmGPb) and human liver GPa (hlGPa) revealed five compounds as potent low μM inhibitors with three of these on the submicromolar range for rmGPa. X-ray crystallographic analysis sourced the potency to a combination of favorable interactions from the 1,2,4-triazole and suitable aryl substituents in the GP catalytic site. The compounds also revealed promising calculated pharmacokinetic profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  18. Electronic and photophysical properties of 2-(2′-hydroxyphenyl)benzoxazole and its derivatives enhancing in the excited-state intramolecular proton transfer processes: A TD-DFT study on substitution effect

    Energy Technology Data Exchange (ETDEWEB)

    Daengngern, Rathawat; Kungwan, Nawee, E-mail: naweekung@gmail.com

    2015-11-15

    The effect of electron donating and withdrawing substituents on the enol absorption and keto emission spectra of 2-(2′-hydroxyphenyl)benzoxazole (HBO) and its derivatives has been systematically investigated by means of density functional theory (DFT) and time-dependent DFT (TD-DFT) methods. The enol absorption spectra of HBO were simulated by using five different DFTs with various exchange-correlation functions to validate a suitable functional prior to being further used as a method of choice to study the effect of substituents on the spectral characteristics of HBO derivatives. The popular B3LYP (Becke, three-parameter, Lee–Yang–Parr) exchange-correlation functional is found to provide the best desirable result in predicting the absorption spectrum close to experimental data. In the ground state, enol forms of HBO and its derivatives are more stable than those of keto forms, while in the first lowest excited state, keto forms are found to be more stable than their enol forms. Overall, simulated absorption and emission spectra of HBO and its derivatives from TD-B3LYP calculations are in good agreement with the experimental data. For enol, absorption maxima of HBO derivatives having electron-withdrawing groups are red-shift corresponding to their lower HOMO–LUMO energy gaps compared to that of HBO. For keto emission, HBO having electron donating groups (m-MeHBO and MHBO) and withdrawing group (CNHBO) at 4′-position on the phenol fragment as well as electron donating groups (HBOMe and HBOM) at 6-position on the benzoxazole fragment make the position of keto emission peak shift to shorter wavelength (blue-shift). However, HBO derivatives with electron withdrawing groups (HBOF, HBOCl, HBOA and HBOE) at 6-position give redshifted emission compared to the parent compound (HBO). The type of substituent on both 4′- and 6-positions certainly has a pronounced effect on the absorption and emission spectra of HBO derivatives. - Highlights: • Simulated spectra

  19. Electronic and photophysical properties of 2-(2′-hydroxyphenyl)benzoxazole and its derivatives enhancing in the excited-state intramolecular proton transfer processes: A TD-DFT study on substitution effect

    International Nuclear Information System (INIS)

    Daengngern, Rathawat; Kungwan, Nawee

    2015-01-01

    The effect of electron donating and withdrawing substituents on the enol absorption and keto emission spectra of 2-(2′-hydroxyphenyl)benzoxazole (HBO) and its derivatives has been systematically investigated by means of density functional theory (DFT) and time-dependent DFT (TD-DFT) methods. The enol absorption spectra of HBO were simulated by using five different DFTs with various exchange-correlation functions to validate a suitable functional prior to being further used as a method of choice to study the effect of substituents on the spectral characteristics of HBO derivatives. The popular B3LYP (Becke, three-parameter, Lee–Yang–Parr) exchange-correlation functional is found to provide the best desirable result in predicting the absorption spectrum close to experimental data. In the ground state, enol forms of HBO and its derivatives are more stable than those of keto forms, while in the first lowest excited state, keto forms are found to be more stable than their enol forms. Overall, simulated absorption and emission spectra of HBO and its derivatives from TD-B3LYP calculations are in good agreement with the experimental data. For enol, absorption maxima of HBO derivatives having electron-withdrawing groups are red-shift corresponding to their lower HOMO–LUMO energy gaps compared to that of HBO. For keto emission, HBO having electron donating groups (m-MeHBO and MHBO) and withdrawing group (CNHBO) at 4′-position on the phenol fragment as well as electron donating groups (HBOMe and HBOM) at 6-position on the benzoxazole fragment make the position of keto emission peak shift to shorter wavelength (blue-shift). However, HBO derivatives with electron withdrawing groups (HBOF, HBOCl, HBOA and HBOE) at 6-position give redshifted emission compared to the parent compound (HBO). The type of substituent on both 4′- and 6-positions certainly has a pronounced effect on the absorption and emission spectra of HBO derivatives. - Highlights: • Simulated spectra

  20. Hexavalent Chromium Substitution Projects

    Science.gov (United States)

    2011-05-12

    Hexavalent Chromium Substitution Projects Date (12 May 2011) Gene McKinley ASC/WNV (937) 255-3596 Gene.McKinley@wpafb.af.mil Aeronautical Systems...valid OMB control number. 1. REPORT DATE 12 MAY 2011 2. REPORT TYPE 3. DATES COVERED 00-00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Hexavalent ...A-10) – AETC (T-6, T-38 and T1A) • Both Cr Primers & Non-Cr primers as well as Cr Surface Treatment – F-22 8 Non- Chrome Tie-coat & touch-up

  1. Muonium substituted molecules

    International Nuclear Information System (INIS)

    Cox, S.F.J.

    1990-12-01

    The manner in which Muon Spin Rotation and Level Crossing Resonance are used to characterise muonium substituted organic radicals is described, and illustrated with spectra for the ethyl radical and related species. Comparison with electron spin resonance data for the unsubstituted radicals reveals significant structural and hyperfine isotope effects which can be traced to the effects of zero point motion. The first comparable results for a diamagnetic species, exhibiting a quadrupole isotope effect by comparison with conventional nuclear quadrupole resonance data, are presented and discussed. (author)

  2. Synthesis of carbasugars from aldonolactones, part III - A study on the allylic substitution of (1R,5R,8R)- and (1R,5R,8S)-8-hydroxy-2-oxabicyclo[3.3.0]oct-6-en-3-one derivatives - Preparation of (1S,2R,3R)-9-[2-hydroxy-3-(2-hydroxyethyl)cyclopent-4-en-1-yl]-9H-adenine

    DEFF Research Database (Denmark)

    Johansen, Steen Karsk; Lundt, Inge

    2001-01-01

    The palladium-catalyzed substitution of acylated (1R,5R,8R)- and (1R,SR,8S)-8-hydroxy-2-oxabicyclo[3.3.0] ones has been studied using a number of C- and N-nucleophiles, In all cases, the exo derivatives (8R) were found to be more reactive than the corresponding endo derivatives (8S). The reaction...... with these nucleophiles. Additionally, Mitsunobu substitution of (1R,5R,8R)-8-hydroxy-2-oxabicyclo[3.3.0]oct-B-en-3-one (3) with 6-chloropurine, followed by reduction of the lactone moiety and treatment with Liquid ammonia, gave the carbocyclic nucleoside (1S,2R,3R)-9-[2-hydroxy-3-(2-hydroxyethyl)cyclopent-4-en-1-yl]-9H...

  3. The elasticity of substitution of superlative price indices

    OpenAIRE

    Petter Frenger

    2005-01-01

    Abstract: The paper presents a method for computing the curvature implicit in the use of superlative price indices. It extends the quadratic lemma and allows us to compute the elasticity of substitution of the underlying preferences in the direction of the observed price change for the Törnqvist and the quadratic mean of order r indices. It derives the expressions for the directional shadow elasticity of substitution and applies the results to the Norwegian CPI data base. Ke...

  4. Resources, recycle, and substitution

    International Nuclear Information System (INIS)

    Wymer, R.G.

    A two-fold strategy appears necessary to ensure that the resource needs of the developed and developing nations are met. First, recycle and substitution must be encouraged in those instances where they do find application. Although these measures have limited applicability, they may be of vital importance in those instances where they do apply; in any event, they buy time. Second, practical and economical technologies must be developed to exploit the lower-grade and marginal ores and the oftentimes abundant but highly refractory ores, as well as to greatly increase the recovery of secondary elements present in the ores - elements whose form and amounts in the ores make them economically unrecoverable by themselves, but which are economically recoverable as by-products. It is often the case that if these elements are not recovered during the initial mining and milling operations, they are rendered unrecoverable, in a practical sense, forever. Furthermore, they may even become environmental pollutants. Specific examples of recovery from refractory ores, by-product recovery, and recycle are given. Also, some suggestions of substitutes for important resources are tabulated

  5. Synthesis and Antibacterial, Antimycobacterial Activity of 7-[4-{5-(2-Oxo-2-p-substituted-phenylethylthio-1,3,4-thiadiazol-2yl}-3′-methylpiperazinyl] Quinolone Derivatives

    Directory of Open Access Journals (Sweden)

    Kapil M. Agrawal

    2013-01-01

    Full Text Available Currently we screened 9 newer synthesized fluoroquinolone derivatives 5(a–i against two gram positive, two gram negative bacterial strains, and mycobacterium tuberculosis H37Rv. These analogues were confirmed by IR, 1H NMR, 13C NMR, and elemental analysis. Selected compounds were confirmed by mass spectral study. Compounds 5(b–d showed comparable biological activities and other analogues of the series showed moderate-to-weak activity, as compared to the reference marketed drugs.

  6. Correlations Between retention indices and molecular structure of aliphatic alcohols and of their benzoyl derivatives on phenyl substituted polysiloxane stationary phases; Cromatografia en fase gaseosa sobre metilfenilpolisiloxanos. Estructura molecular y parametros de retencion para alcoholes y sus derivados benzoilados

    Energy Technology Data Exchange (ETDEWEB)

    Pias, J B; Gasco, L

    1976-07-01

    The retention indices of aliphatic alcohols of carbon number up to C{sub g}, and of their benzoyl derivatives up to C{sub 7}, were determined in columns packed with Chromo sorb G (AW-DMCS-HP) coated previously with 5% methyl, and methyl phenyl polysiloxanes with increasing polarity (SE-30, 0V-3, 0V-7, 0V-11, 0V-17 and OV-25). Correlations between retention indices and chain length for 1-alcohols, 2-alcohols, 3-alcohols, 1 , on -3-alcohols, 2-methyl-1-alcohols and for their corresponding benzoyl derivatives were calculated at 100, 120 and 140 degree centigree. In alcohols, a -CH{sub 2}- group increases I approximately 100 units, and in their benzoyl derivatives from 80 to 100 units. Dispersion indices {delta}l , and positional and structural increments {delta}I, were evaluated for -OH and benzoyl groups in terms of phase polarity and chain length. Effects of chain length, chain branching and double bond location on retention parameters were also studied. (Author) 23 refs.

  7. LL-37-derived short antimicrobial peptide KR-12-a5 and its d-amino acid substituted analogs with cell selectivity, anti-biofilm activity, synergistic effect with conventional antibiotics, and anti-inflammatory activity.

    Science.gov (United States)

    Kim, Eun Young; Rajasekaran, Ganesan; Shin, Song Yub

    2017-08-18

    KR-12-a5 is a 12-meric α-helical antimicrobial peptide (AMP) with dual antimicrobial and anti-inflammatory activities designed from human cathelicidin LL-37. We designed and synthesized a series of d-amino acid-substituted analogs of KR-12-a5 with the aim of developing novel α-helical AMPs that possess higher cell selectivity than KR-12-a5, while maintaining the anti-inflammatory activity. d-amino acid incorporation into KR-12-a5 induced a significant improvement in the cell selectivity by 2.6- to 13.6-fold as compared to KR-12-a5, while maintaining the anti-inflammatory activity. Among the three analogs, KR-12-a5 (6- D L) with d-amino acid in the polar-nonpolar interface (Leu 6 ) showed the highest cell selectivity (therapeutic index: 61.2). Similar to LL-37, KR-12-a5 and its analogs significantly inhibited the expression and secretion of NO, TNF-α, IL-6 and MCP-1 from LPS-stimulated RAW264.7 cells. KR-12-a5 and its analogs showed a more potent antimicrobial activity against antibiotic-resistant bacteria, including clinically isolated MRSA, MDRPA, and VREF than LL-37 and melittin. Furthermore, compared to LL-37, KR-12-a5 and its analogs showed greater synergistic effects with conventional antibiotics, such as chloramphenicol, ciprofloxacin, and oxacillin against MDRPA; KR-12-a5 and its analogs had a FICI range between 0.25 and 0.5, and LL-37 had a range between 0.75 and 1.5. KR-12-a5 and its analogs were found to be more effective anti-biofilm agents against MDRPA than LL-37. In addition, KR-12-a5 and its analogs maintained antimicrobial activity in physiological salts and human serum. SYTOX Green uptake and membrane depolarization studies revealed that KR-12-a5 and its analogs kills microbial cells by permeabilizing the cell membrane and damaging membrane integrity. Taken together, our results suggest that KR-12-a5 and its analogs can be developed further as novel antimicrobial/anti-inflammatory agents to treat antibiotic-resistant infections. Copyright

  8. Metal borohydrides and derivatives

    DEFF Research Database (Denmark)

    Paskevicius, Mark; Haarh Jepsen, Lars; Schouwink, Pascal

    2017-01-01

    major classes of metal borohydride derivatives have also been discovered: anion-substituted compounds where the complex borohydride anion, BH4 -, is replaced by another anion, i.e. a halide or amide ion; and metal borohydrides modified with neutral molecules, such as NH3, NH3BH3, N2H4, etc. Here, we...

  9. Synthesis, Central Nervous System Activity and Structure-Activity Relationships of Novel 1-(1-Alkyl-4-aryl-4,5-dihydro-1H-imidazo-3-substituted Urea Derivatives

    Directory of Open Access Journals (Sweden)

    Elżbieta Szacoń

    2015-02-01

    Full Text Available A series of 10 novel urea derivatives has been synthesized and evaluated for their central nervous system activity. Compounds 3a–3h were prepared in the reaction between the respective 1-alkyl-4-aryl-4,5-dihydro-1H-imidazol-2-amines 1a and 1b and appropriate benzyl-, phenethyl-isocyanate or ethyl 4-isocyanatobenzoate and ethyl isocyanatoacetate 2 in dichloromethane. Derivatives 4c and 4g resulted from the conversion of 3c and 3g into the respective amides due to action of an aqueous ammonia solution. The results obtained in this study, based on literature data suggest a possible involvement of serotonin system and/or the opioid system in the effects of tested compounds, and especially in the effect of compound 3h. The best activity of compound 3h may be primarily attributed to its favourable ADMET properties, i.e., higher lipophilicity (related to lower polar surface area and greater molecular surface, volume and mass than for other compounds and good blood-brain permeation. This compound has also the greatest polarizability and ovality. The HOMO and LUMO energies do not seem to be directly related to activity.

  10. Design, synthesis, and biological evaluation of 2-substituted-2,3,4,9-tetrahydrospiro-β-carboline-3-carboxylic acid derivatives as first-in-class mast cell stabilizers.

    Science.gov (United States)

    Singh, Jatinder; Shah, Ramanpreet; Singh, Dhandeep; Jaggi, Amteshwar S; Singh, Nirmal

    2018-05-01

    Mast cell degranulation plays a momentous role in myriad diseases like asthma, eczema, allergic rhinitis, and conjunctivitis as well as anaphylactic shock; hence, there is an unmet need for developing new mast cells stabilizers. The reported mast cell stabilizers have a heterocyclic moiety and an acidic group. Furthermore, the role of tryptophan in suppression of mast cell activation is established. Hence, we prepared constrained analogs of tryptophan, which are derivatives of 2,3,4,9-tetrahydrospiro-β-carboline-3-carboxylic acid, and evaluated them for ex vivo inhibition of compound 48/80-induced mast degranulation activity. By comparing IC 50 (μM) values with that of the standard drug sodium cromoglycate (IC 50  = 0.489 ± 0.003 μM), compounds with bulky groups like heptyl (compound 9; IC 50  = 0.389 ± 0.015 μM) and octyl (compound 10; IC 50  = 0.354 ± 0.023 μM) were found to be of similar potency as sodium cromoglycate. Furthermore, the polar group-containing compounds like the chloropropyl (compound 16; IC 50  = 0.382 ± 0.083 μM) and benzoyl derivative (compound 14; IC 50  = 00.469 ± 0.032 μM) were also found to be of similar potency as sodium cromoglycate. This is a seminal study of spiro-β-carboline mast cell stabilization having a wider scope in mast cell research; yet, the mechanism of action remains elusive. © 2018 Deutsche Pharmazeutische Gesellschaft.

  11. Antimalarial Activity of C-10 Substituted Triazolyl Artemisinin.

    Science.gov (United States)

    Park, Gab-Man; Park, Hyun; Oh, Sangtae; Lee, Seokjoon

    2017-12-01

    We synthesized C-10 substituted triazolyl artemisinins by the Huisgen cycloaddition reaction between dihydroartemisinins (2) and variously substituted 1, 2, 3-triazoles (8a-8h). The antimalarial activities of 32 novel artemisinin derivatives were screened against a chloroquine-resistant parasite. Among them, triazolyl artemisinins with electron-withdrawing groups showed stronger antimalarial activities than those shown by the derivatives having electron-donating groups. In particularly, m-chlorotriazolyl artemisinin (9d-12d) showed antimalarial activity equivalent to that of artemisinin and could be a strong drug candidate.

  12. Si-substituted hydroxyapatite nanopowders: Synthesis, thermal stability and sinterability

    International Nuclear Information System (INIS)

    Bianco, Alessandra; Cacciotti, Ilaria; Lombardi, Mariangela; Montanaro, Laura

    2009-01-01

    Synthetic hydroxyapatites incorporating small amounts of Si have shown improved biological performances in terms of enhanced bone apposition, bone in-growth and cell-mediated degradation. This paper reports a systematic investigation on Si-substituted hydroxyapatite (Si 1.40 wt%) nanopowders produced following two different conventional wet methodologies: (a) precipitation of Ca(NO 3 ) 2 .4H 2 O and (b) titration of Ca(OH) 2 . The influence of the synthesis process on composition, thermal behaviour and sinterability of the resulting nanopowders is studied. Samples were characterised by electron microscopy, induced coupled plasma atomic emission spectroscopy, thermal analysis, infrared spectroscopy, N 2 adsorption measurements, X-ray diffraction and dilatometry. Semicrystalline Si-substituted hydroxyapatite powders made up of needle-like nanoparticles were obtained, the specific surface area ranged between 84 and 110 m 2 /g. Pure and Si-substituted hydroxyapatite nanopowders derived from Ca(NO 3 ) 2 .4H 2 O decomposed around 1000 deg. C. Si-substituted hydroxyapatite nanopowders obtained from Ca(OH) 2 were thermally stable up to 1200 deg. C and showed a distinct decreased thermal stability with respect to the homologous pure sample. Si-substituted hydroxyapatites exhibited higher sintering temperature and increased total shrinkage with respect to pure powders. Nanostructured dense ceramics were obtained by sintering at 1100 deg. C Si-substituted hydroxyapatites derived from Ca(OH) 2

  13. Eosin-sensitized photooxidation of substituted phenylalanines and tyrosines

    Energy Technology Data Exchange (ETDEWEB)

    Rizzuto, F.; Spikes, J.D.

    1977-01-01

    The cosin-sensitized photooxidation of tyrosine and a number of compounds related to tyrosine (substituted phenylalanines) was studied by steady-state kinetic and flash photolysis techniques. In particular, the role of the phenolic group and the amino and carboxyl groups of the alanyl side chain in the photooxidation mechanism was investigated in detail. Several relationships between substrate structure and susceptibility to photooxidation as well as effects of substrate structure on photooxidation mechanisms were found. For example, phenylalanine is not photooxidizable, but substitution of electron-donating (activating) groups such as -OH (as in tyrosine) or -NH/sub 2/ (as in p-aminophenylalanine) results in rapidly photooxidized derivatives. However, substituting deactivating groups such as -Cl (as in p-chlorophenylalanine) or weakly activating groups such as -OCH/sub 3/ (as in 4-methoxyphenylalanine) result in non-photooxidizable derivatives. Substitution of additional activating groups to the ring of hydroxy-substituted phenylalanines results in increased rates of photooxidation, whereas additional deactivating groups result in decreased photooxidation rates. The rate-determining step in the photooxidation mechanism is shown to be dependent on the presence and position of an electron-donating substituent on the benzenoid ring. Only minor involvement of the side chain amino and carboxyl groups was found. Both singlet oxygen and hydrogen abstraction mechanisms are involved in the eosin-sensitized photooxidation of hydroxy-substituted phenylalanines (e.g., tyrosine). The hydrogen abstraction mechanism probably predominates at both pH 8 and 11.

  14. Currency substitution in Eastern Europe

    NARCIS (Netherlands)

    van Aarle, B.; Budina, N.

    1995-01-01

    Monetary instability during the transition process from a command economy to a market economy has induced a considerable increase in currency substitution in Eastern Europe. Currency substitution itself affects monetary stability since it reduces the stability of velocity. This paper investigates

  15. Why Does Trigonometric Substitution Work?

    Science.gov (United States)

    Cunningham, Daniel W.

    2018-01-01

    Modern calculus textbooks carefully illustrate how to perform integration by trigonometric substitution. Unfortunately, most of these books do not adequately justify this powerful technique of integration. In this article, we present an accessible proof that establishes the validity of integration by trigonometric substitution. The proof offers…

  16. Substitution in recreation choice behavior

    Science.gov (United States)

    George L. Peterson; Daniel J. Stynes; Donald H. Rosenthal; John F. Dwyer

    1985-01-01

    This review discusses concepts and theories of substitution in recreation choice. It brings together the literature of recreation research, psychology, geography, economics, and transportation. Parallel and complementary developments need integration into an improved theory of substitution. Recreation decision behavior is characterized as a nested or sequential choice...

  17. Biological background of dermal substitutes

    NARCIS (Netherlands)

    van der Veen, V. C.; van der Wal, M.B.; van Leeuwen, M.C.; Ulrich, M.; Middelkoop, E.

    2010-01-01

    Dermal substitutes are of major importance in treating full thickness skin defects, both in acute and chronic wounds. In this review we will outline specific requirements of three classes of dermal substitutes:-natural biological materials, with a more or less intact extracellular matrix

  18. The improved syntheses of 5-substituted 2'-[18F]fluoro-2'-deoxy-arabinofuranosyluracil derivatives ([18F]FAU, [18F]FEAU, [18F]FFAU, [18F]FCAU, [18F]FBAU and [18F]FIAU) using a multistep one-pot strategy

    International Nuclear Information System (INIS)

    Cai Hancheng; Li Zibo; Conti, Peter S.

    2011-01-01

    Introduction: We and others have previously reported a four-step radiosynthesis of a series of 2'-deoxy-2'-[ 18 F]fluoro-5-substituted-1-β-D-arabinofuranosyluracil derivatives including [ 18 F]FAU, [ 18 F]FEAU, [ 18 F]FFAU, [ 18 F]FCAU, [ 18 F]FBAU and [ 18 F]FIAU as thymidine derivatives for tumor proliferation and/or reporter gene expression imaging with positron emission tomography (PET). Although the radiosynthesis has been proven to be reproducible and efficient, this complicated multistep reaction is difficult to incorporate into an automated cGMP-compliant radiosynthesis module for routine production. Recently, we have developed a simple and efficient one-pot method for routine production of [ 18 F]FMAU. In this study, we studied the feasibility of radiosynthesizing [ 18 F]FAU, [ 18 F]FEAU, [ 18 F]FFAU, [ 18 F]FCAU, [ 18 F]FBAU and [ 18 F]FIAU using this newly developed method. Methods: Similar to the radiosynthesis of [ 18 F]FMAU, 5-substituted 2'-[ 18 F]fluoro-2'-deoxy-arabinofuranosyluracil derivatives ([ 18 F]FAU, [ 18 F]FEAU, [ 18 F]FFAU, [ 18 F]FCAU, [ 18 F]FBAU and [ 18 F]FIAU) were synthesized in one-pot radiosynthesis module in the presence of Friedel-Crafts catalyst TMSOTf and HMDS. Results: This one-pot radiosynthesis method could be used to produce [ 18 F]FAU, [ 18 F]FEAU, [ 18 F]FFAU, [ 18 F]FCAU, [ 18 F]FBAU and [ 18 F]FIAU. The overall radiochemical yields of these tracers varied from 4.1%±0.8% to 10.1%±1.9% (decay-corrected, n=4). The overall reaction time was reduced from 210 min to 150 min from the end of bombardment, and the radiochemical purity was >99%. Conclusions: The improved radiosyntheses of [ 18 F]FAU, [ 18 F]FEAU, [ 18 F]FFAU, [ 18 F]FCAU, [ 18 F]FBAU and [ 18 F]FIAU have been achieved with reasonable yields and high purity using a multistep one-pot method. The synthetic time has been reduced, and the reaction procedures have been significantly simplified. The success of this approach may make PET tracers [ 18 F]FAU, [ 18 F

  19. Novel synthesis and antitumor evaluation of polyfunctionally substituted heterocyclic compounds derived from 2-cyano-N-(3-cyano-4,5,6,7-tetrahydrobenzo[b]thiophen-2-yl)-acetamide.

    Science.gov (United States)

    Shams, Hoda Z; Mohareb, Rafat M; Helal, Maher H; Mahmoud, Amira E

    2010-12-27

    The reaction of 2-amino-3-cyano-4,5,6,7-tetrahydrobenzo[b]thiophene with ethyl cyanoacetate gave 2-cyano-N-(3-cyano-4,5,6,7-tetrahydrobenzo[b]thiophen-2-yl)-acetamide. The latter was used to synthesize different heterocyclic derivatives comprising thiophene, thiazole, pyrazole, pyridine, pyrimidine, and coumarin rings. The mechanistic and synthetic pathways depended on regioselective attack and/or cyclization by the cyanoacetamido moiety in the key precursor on various chemical reagents. The competition of the reaction pathways including dipolar cyclization, dinucleophilic-bielectrophilic attack, β-attack, Gewald-type attack, and condensation reactions led to the diversity of the synthesized products. The antitumor activities of the synthesized products were studied and evaluated. Most of the compounds revealed high inhibitory effects when screened in vitro for their antiproliferative activity. Three human cancer cell lines, namely, breast adenocarcinoma (MCF-7), non-small cell lung cancer (NCI-H460) and CNS cancer (SF-268) were used in the screening tests. The simplicity of the synthetic procedures which mainly involved one-pot reactions under mild reaction conditions, the convenience of yield production and the diversity of the reactive sites in the produced systems play a valuable role for further heterocyclic transformations and further biological investigations.

  20. Synthesis of Randomly Substituted Anionic Cyclodextrins in Ball Milling

    Directory of Open Access Journals (Sweden)

    László Jicsinszky

    2017-03-01

    Full Text Available A number of influencing factors mean that the random substitution of cyclodextrins (CD in solution is difficult to reproduce. Reaction assembly in mechanochemistry reduces the number of these factors. However, lack of water can improve the reaction outcomes by minimizing the reagent’s hydrolysis. High-energy ball milling is an efficient, green and simple method for one-step reactions and usually reduces degradation and byproduct formation. Anionic CD derivatives have successfully been synthesized in the solid state, using a planetary ball mill. Comparison with solution reactions, the solvent-free conditions strongly reduced the reagent hydrolysis and resulted in products of higher degree of substitution (DS with more homogeneous DS distribution. The synthesis of anionic CD derivatives can be effectively performed under mechanochemical activation without significant changes to the substitution pattern but the DS distributions were considerably different from the products of solution syntheses.

  1. Packing and Disorder in Substituted Fullerenes

    KAUST Repository

    Tummala, Naga Rajesh

    2016-07-15

    Fullerenes are ubiquitous as electron-acceptor and electron-transport materials in organic solar cells. Recent synthetic strategies to improve the solubility and electronic characteristics of these molecules have translated into a tremendous increase in the variety of derivatives employed in these applications. Here, we use molecular dynamics (MD) simulations to examine the impact of going from mono-adducts to bis- and tris-adducts on the structural, cohesive, and packing characteristics of [6,6]-phenyl-C60-butyric acid methyl ester (PCBM) and indene-C60. The packing configurations obtained at the MD level then serve as input for density functional theory calculations that examine the solid-state energetic disorder (distribution of site energies) as a function of chemical substitution. The variations in structural and site-energy disorders reflect the fundamental materials differences among the derivatives and impact the performance of these materials in thin-film electronic devices.

  2. Synthesis, characterization of N-, S-, O-substituted naphtho- and ...

    Indian Academy of Sciences (India)

    obtained on a Thermo Finnigan LCQ Advantage MAX. LC/MS/MS spectrometer .... organic layer was washed with water (4 × 30 mL), and dried with Na2SO4. ..... mono(thio)-substituted compounds containing chlorine atom derivatives were.

  3. 1,3- and 1,4-Substituted tetrazolium salts

    International Nuclear Information System (INIS)

    Voitekhovich, Sergei V; Gaponik, Pavel N; Ivashkevich, Oleg A

    2002-01-01

    The published data on the synthesis, physicochemical properties, structures and reactions of 1,3-(1,3,5)- and 1,4-(1,4,5)-substituted tetrazolium salts are systematised and generalised. Their applications as starting compounds in the preparative chemistry of heterocyclic derivatives and some other branches of science and technology are reviewed. The bibliography includes 122 references.

  4. Preparation, characterization and biological activity of C8-substituted cytokinins

    Czech Academy of Sciences Publication Activity Database

    Zahajská, Lenka; Nisler, Jaroslav; Voller, Jiří; Gucký, Tomáš; Pospíšil, Tomáš; Spíchal, Lukáš; Strnad, Miroslav

    2017-01-01

    Roč. 135, MAR (2017), s. 115-127 ISSN 0031-9422 Institutional support: RVO:61389030 Keywords : potential purine antagonists * arabidopsis-thaliana * nucleosides * derivatives * thidiazuron * specificity * receptors * kinetin * Organic synthesis * Cytokinin bioassay * AHK3 and CRE1/AHK4 bacterial receptor assay * C8-substituted cytokinin Subject RIV: CE - Biochemistry OBOR OECD: Organic chemistry Impact factor: 3.205, year: 2016

  5. Synthesis and antibacterial activities of N-substituted maleopimarimide

    Directory of Open Access Journals (Sweden)

    LI Hui

    2016-02-01

    Full Text Available With Macrogol 600(PEG-600 as solvent and toluene as dehydrant,eight N-Substituted maleopimarimide compounds were synthesized from maleopimaric acid and aniline or its derivatives by one-step reaction;Their structures were confirmed and the antimicrobial activities of these compounds were also preliminarily investigated.

  6. preparation and nucleophilic substitution of the 2,4,6

    African Journals Online (AJOL)

    Mgina

    Three methods for preparation of D-amino acids by nucleophilic substitution on derivatives of ... bioactivity of the peptide (Wenger 1985, ... Acetic acid (0.29 mL, 5 mmol) was added, and the mixture was further stirred for 5 h at rt under ... methanol/dichloromethane) to yield a white ... temperature, diluted with water, extracted.

  7. Commercial formalin substitutes for histopathology

    DEFF Research Database (Denmark)

    Prentø, P; Lyon, H

    1997-01-01

    We compared the performance of six commercial fixatives proposed to be formalin substitutes with the performance of buffered formalin, Clarke's ethanol-acetic acid, and ethanol, using rat liver, small intestine, and kidney. We investigated the rate of penetration, mode of fixation, extent of prot...... was obtained by combining formalin fixation with antigen retrieval. We conclude that none of the proposed commercial substitutes for buffered formalin are adequate for critical histology or histopathology....

  8. Stores, Prices, and Currency Substitution

    OpenAIRE

    Gabriele, Camera; Winkler, Johannes

    1999-01-01

    We study endogenous currency substitution in a decentralized trade environment. Sellers maximize profits from sales of imperfectly substitutable goods by posting prices in either one of two currencies. A unique symmetric equilibrium exists where goods are priced only in the local currency. This occurs if foreign trade is sporadic, there is sufficient but not excessive liquidity, and discounting is low. Excess or scarcity of liquidity, however, induces sellers to extract all surplus from bu...

  9. Substitution reactions of technetium complexes

    International Nuclear Information System (INIS)

    Omori, T.

    1997-01-01

    Substitution reactions of a series of technetium complexes are considered in comparison with corresponding reactions of rhenium. Rhenium and technetium complexes are rather inert in substitution reactions, the latter are characterized by greater rate constants when they proceed according to dissociative mechanism. In rare cases when k Tc /k Re id little it is assumed that the reaction proceeds according to the associative mechanism. (author)

  10. Gold-catalyzed Alkyne Hydroxylation: Synthesis of 2-Substituted Benzo[b]furan Compounds

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yuan; XIN Zhi-Jun; XUE Ji-Jun; LI Ying

    2008-01-01

    A strategy concerning the synthesis of 2-substituted benzo[b]furan compounds from o-alkynyl phenols via a gold-catalyzed alkyne hydroxylation is described, which allows the rapid synthesis of various 2-substituted benzo[b]furan derivatives in excellent yields under mild conditions. The o-alkynyl phenol precursors were readily prepared with a Sonogashira coupling reaction.

  11. Synthesis of 2-substituted tryptophans via a C3- to C2-alkyl migration

    Directory of Open Access Journals (Sweden)

    Michele Mari

    2014-08-01

    Full Text Available The reaction of 3-substituted indoles with dehydroalanine (Dha derivatives under Lewis acid-mediated conditions has been investigated. The formation of 2-substituted tryptophans is proposed to occur through a selective alkylative dearomatization–cyclization followed by C3- to C2-alkyl migration and rearomatization.

  12. [Anti-arrhythmic action of some amidinohydrazone substituted benzophenones. 1. Synthesis of new amidinohydrazone and N-phenylamidinohydrazone substituted benzophenones].

    Science.gov (United States)

    Richter, P H; Kasbohm, K; Besch, A; Hagen, A

    1992-10-01

    The title compounds are synthesized as a rule by condensation of substituted benzophenones and derivatives of aminoguanidine in the presence of up to 2.5 moles of an anorganic acid. They can be obtained alternatively via corresponding hydrazones, thiosemicarbazones or methylthiothiocarbonylhydrazones.

  13. Primary amino acid derivatives: substitution of the 4'-N'-benzylamide site in (R)-N'-benzyl 2-amino-3-methylbutanamide, (R)-N'-benzyl 2-amino-3,3-dimethylbutanamide, and (R)-N'-benzyl 2-amino-3-methoxypropionamide provides potent anticonvulsants with pain-attenuating properties.

    Science.gov (United States)

    King, Amber M; Salomé, Christophe; Salomé-Grosjean, Elise; De Ryck, Marc; Kaminski, Rafal; Valade, Anne; Stables, James P; Kohn, Harold

    2011-10-13

    Recently, we reported that select N'-benzyl 2-substituted 2-amino acetamides (primary amino acid derivatives (PAADs)) exhibited pronounced activities in established whole animal anticonvulsant (i.e., maximal electroshock seizure (MES)) and neuropathic pain (i.e., formalin) models. The anticonvulsant activities of C(2)-hydrocarbon N'-benzyl 2-amino acetamides (MES ED(50) = 13-21 mg/kg) exceeded those of phenobarbital (ED(50) = 22 mg/kg). Two additional studies defining the structure-activity relationship of PAADs are presented in this issue of the journal. In this study, we demonstrated that the anticonvulsant activities of (R)-N'-benzyl 2-amino-3-methylbutanamide and (R)-N'-benzyl 2-amino-3,3-dimethylbutanamide were sensitive to substituents at the 4'-N'-benzylamide site; electron-withdrawing groups retained activity, electron-donating groups led to a loss of activity, and incorporating either a 3-fluorobenzyloxy or 3-fluorophenoxymethyl group using a rationally designed multiple ligand approach improved activity. Additionally, we showed that substituents at the 4'-N'-benzylamide site of (R)-N'-benzyl 2-amino-3-methoxypropionamide also improved anticonvulsant activity, with the 3-fluorophenoxymethyl group providing the largest (∼4-fold) increase in activity (ED(50) = 8.9 mg/kg), a value that surpassed phenytoin (ED(50) = 9.5 mg/kg). Collectively, the pharmacological findings provided new information that C(2)-hydrocarbon PAADs represent a novel class of anticonvulsants.

  14. Reduction of gaseous pollutants and particulate materials by using fuels derived from vegetable in substitution to diesel oil; Reducao de poluentes gasosos e de material particulado por meio do uso de combustiveis a base de oleos vegetais como substitutos ao oleo diesel

    Energy Technology Data Exchange (ETDEWEB)

    Yazaki, Carlos Kazuaki [General Motors do Brasil, Sao Caetano do Sul, SP (Brazil). Engenharia de Chassis e Integracao Powertrain]. E-mail: carlos.yazaki@gm.com; Trielli, Mauricio Assumpcao [Sao Paulo Univ., SP (Brazil). Escola Politecnica. Dept. de Engenharia Mecanica]. E-mail: trielli@ipt.br

    2006-07-01

    The aim of this article is to present the contribution allowed by fuels derived from vegetable oils in substitution for the diesel oil. It especially emphasizes the vegetable oil esters potential as gaseous exhaust pollutant and particulate matter reduction produced by ignition compression engines, such a conclusion has been achieved through systematization and analysis of results of experimental tests performed by several researchers that applied natural vegetable oils and their esters to this class of engines. Once the vegetable oils are the base of formation of these fuels, their direct application in these engines is also analyzed showing the advantages and disadvantages of this alternative route. This article also includes an analysis of their physical and chemical properties which help the understanding of their performance in the engines. Due to better results obtained from esters use, their industrial processing, the special characteristics of the engineering materials which they will have contact in engine, principally those used in injection systems, as well as aspects related to their storages are discussed too. (author)

  15. Synthesis of Substituted Titanocene Dichloride Derivatives by Hydrosilylation

    Czech Academy of Sciences Publication Activity Database

    Strašák, Tomáš; Karban, Jindřich; Červenková Šťastná, Lucie; Maixnerová, Lucie; Březinová, Anna; Bernard, Martin; Fajgar, Radek

    2014-01-01

    Roč. 768, OCT 1 (2014), s. 115-120 ISSN 0022-328X Institutional support: RVO:67985858 ; RVO:61388963 Keywords : titanocene dichloride * hydrosilylation * carbohydrates Subject RIV: CC - Organic Chemistry Impact factor: 2.173, year: 2014

  16. Competition Derived from Innovation as a Substitution Threat

    DEFF Research Database (Denmark)

    Howells, John

    2003-01-01

    is examined in three detailed cases; the reluctance of the nineteenth century alkali industry in England to switch to a superior continuous production process; IBM's succesful switch to computer technology; the inability of the electronic valve manufacturers of the 1950s to switch to the semiconductor...

  17. Banana-shaped molecules derived from substituted isophthalic acids

    Indian Academy of Sciences (India)

    Different precursors inducing the bending angle of the banana-shaped molecules. Figure 2. ... Pramana – J. Phys., Vol. 61, No. 2, August ... isotropic liquid; N: nematic; SmA: smectic A; SmC: smectic C. For other phase assign- ments, see text.

  18. Use of hyaluronic acid-derived dermal substitute for skin ...

    African Journals Online (AJOL)

    Figs 1–6). Second case. The case was a 32-week-old preterm male baby, delivered by lower segment cesarean section on 6 October 2010 due to breech presentation. The baby was a twin to a normal male baby. Omphalocele was diagnosed ...

  19. Synthesis of new biphenyl-substituted quinoline derivatives ...

    Indian Academy of Sciences (India)

    with 10 mL of water and dried in an oven under reduced pressure for 5 h at 50. ◦. C. .... Structures of the obtained products were confirmed by elemental analysis, IR, 1H ..... the active pockets of β-tubulin(PDB ID: 1OJ0). Molec- ular docking of ...

  20. Chlorine- and Sulphur-substituted Pyrrolo[3,4-b]quinolines and ...

    African Journals Online (AJOL)

    Chlorine- and Sulphur-substituted Pyrrolo[3,4-b]quinolines and Related Derivatives .... J. Chem., 2003, 56, 40–46,. . .... It is evident from the above that by judicious selection and application of reagents ...

  1. Approaches in Substitution of Organic Solvents

    DEFF Research Database (Denmark)

    Jacobsen, Thomas

    2000-01-01

    In substitution of harmful chemicals or products with less harmful or harmless ones, there are different approaches according to the different situations, the technical requirements to the substitutes, and the goals for the substitution. Three different cases are presented. The substitution process...

  2. Studies on Synthesis of Some Novel Heterocyclic Azlactone Derivatives and Imidazolinone Derivatives and their Antimicrobial Activity

    Directory of Open Access Journals (Sweden)

    Rakesh N. Mistry

    2005-01-01

    Full Text Available p - Methyl benzoic acid on reaction with phosphorus pentachloride gives p - methyl benzoyl chloride derivative which on condensation with glycine gives p - methyl benzoyl glycine derivative. Now, this p - methyl benzoyl glycine derivative on condensation with various substituted aldehydes gives corresponding substituted 4 - [aryl methylidine] - 2 - [p - methyl phenyl] - oxazole - 5 - one derivatives [1(a-j]. Further, these derivatives [1(a-j] on condensation with 4 , 4’ - diamino diphenyl sulphone gives corresponding substituted imidazolinone - dibenzsulphone derivatives [2(a-j], on condensation with 4 , 4’ - diamino diphenyl methane gives corresponding substituted imidazolinone - dibenzmethane derivatives [3(a-j], on condensation with 4,4’- diamino benzanilide gives corresponding substituted imidazolinone - benzanilide derivatives [4(a-j] and on condensation with 2 - amino pyridine gives corresponding substituted imidazolinone - pyridine derivatives [5(a-j] respectively. Structure elucidation of synthesised compounds has been made on the basis of elemental analysis, I.R. spectral studies and 1H N.M.R. spectral studies. The antimicrobial activity of the synthesised compounds has been studied against the cultures “Staphylococcus aureus”, “Escherichia coli” and “Candela albicans”.

  3. Synthesis of Novel Benzimidazolyl-substituted Acrylonitriles and Amidino-substituted Benzimidazo[1,2-a]Quinolines

    Directory of Open Access Journals (Sweden)

    Grace Karminski-Zamola

    2006-08-01

    Full Text Available A series of novel benzimidazole derivatives 3-10 were synthesized. Benzimidazolyl-substituted acrylonitriles 3 and 4 underwent a photochemical dehydrocyclization reaction to give the corresponding mono- and dicyano-substituted benzimidazo[1,2-a] quinolines 5 and 6. Pinner reaction of these compounds did not give the expected mono- and diamidines, but rather only compounds 7-10, with amido groups at 6-position were isolated. A mechanism for the reaction is proposed. Acyclic compounds 3 and 4, as well as cyclic benzimidazo[1,2-a]quinolines 5-8, exhibit interesting spectroscopic properties and are potential biologically active compounds.

  4. 40 CFR 721.2577 - Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted phenyl...

  5. Substituted decision making: elder guardianship.

    Science.gov (United States)

    Leatherman, Martha E; Goethe, Katherine E

    2009-11-01

    The goal of this column is to help experienced clinicians navigate the judicial system when they are confronted with requests for capacity evaluations that involve guardianship (conservatorship). The interface between the growing elderly medical population and increasing requests for substituted decision making is becoming more complex. This column will help practicing psychiatrists understand the medical, legal, and societal factors involved in adult guardianship. Such understanding is necessary in order to effectively perform guardianship evaluations and adequately inform courts, patients, and families about the psychiatric diagnoses central to substituted decision making.

  6. Tissue reaction and material characteristics of four bone substitutes

    DEFF Research Database (Denmark)

    Jensen, S S; Aaboe, M; Pinholt, E M

    1996-01-01

    and Interpore 500 HA/CC) were implanted into 5-mm bur holes in rabbit tibiae. There was no difference in the amount of newly formed bone around the four biomaterials. Interpore 500 HA/CC resorbed completely, whereas the other three biomaterials did not undergo any detectable biodegradation. Bio......The aim of the present study was to qualitatively and quantitatively compare the tissue reactions around four different bone substitutes used in orthopedic and craniofacial surgery. Cylinders of two bovine bone substitutes (Endobon and Bio-Oss) and two coral-derived bone substitutes (Pro Osteon 500......-Oss was osseointegrated to a higher degree than the other biomaterials. Material characteristics obtained by diffuse reflectance infrared Fourier transform spectrometry analysis and energy-dispersive spectrometry did not explain the differences in biologic behavior....

  7. Synthesis and application of trifluoroethoxy-substituted phthalocyanines and subphthalocyanines

    Directory of Open Access Journals (Sweden)

    Satoru Mori

    2017-10-01

    Full Text Available Phthalocyanines and subphthalocyanines are attracting attention as functional dyes that are applicable to organic solar cells, photodynamic therapy, organic electronic devices, and other applications. However, phthalocyanines are generally difficult to handle due to their strong ability to aggregate, so this property must be controlled for further applications of phthalocyanines. On the other hand, trifluoroethoxy-substituted phthalocyanines are known to suppress aggregation due to repulsion of the trifluoroethoxy group. Furthermore, the electronic characteristics of phthalocyanines are significantly changed by the strong electronegativity of fluorine. Therefore, it is expected that trifluoroethoxy-substituted phthalocyanines can be applied to new industrial fields. This review summarizes the synthesis and application of trifluoroethoxy-substituted phthalocyanine and subphthalocyanine derivatives.

  8. Challenges in drug discovery for thiazolidinedione substitute

    Directory of Open Access Journals (Sweden)

    Jian-ping Ye

    2011-10-01

    Full Text Available Thiazolidinedione (TZD is a powerful insulin sensitizer in the treatment of type 2 diabetes. It acts as a ligand to the nuclear receptor PPARγ (peroxisome proliferator-activated receptor-gamma and induces transcription of PPARγ-responsive genes. TZD controls lipid synthesis and storage in adipose tissue, liver and many other tissues through PPARγ. Derivatives of TZD, such as rosiglitazone (Avandia and pioglitazone (Actos, are more powerful than metformin or berberine in insulin sensitization. Although they have common side effects such as weight gain and edema, these did not influence their clinical application in general. However, recent findings of risk for congestive heart failure and bladder cancer have significantly impaired their future in many countries. European countries have prohibited those drugs, and US will terminate application of rosiglitazone in clinics and hospitals. The multiple country actions may mark the end of TZD era. As a result, there is a strong demand for identification of TZD substitute in the treatment of type 2 diabetes. In this regard, literature about PPARγ ligands and potential TZD substitute are reviewed in this article. Histone deacetylase (HDAC inhibitor is emphasized as a new class of insulin sensitizer here. Regulators of SIRT1, CREB, NO, p38, ERK and Cdk5 are discussed in the activation of PPARγ.

  9. Behavioral service substitution (Chapter 9)

    NARCIS (Netherlands)

    Stahl, C.; Aalst, van der W.M.P.; Bouguettaya, A.; Sheng, Q.Z.; Daniel, F.

    2014-01-01

    Service-oriented design supports system evolution and encourages reuse and modularization. A key ingredient of service orientation is the ability to substitute one service by another without reconfiguring the overall system. This chapter aims to give an overview of the state of the art and open

  10. prismane structure by silicon substitution

    Indian Academy of Sciences (India)

    Using the second-order Møller–Plesset perturbation (MP2) theoretic method and the cc-pVDZ basis set, it is shown that with an increase in the number of carbon atoms substituted by silicon, the [6]-prismane structure becomes increasingly more stable, relative to the two isolated benzene (like) structures. A similar trend is ...

  11. Story of skeletally substituted benzenes

    Indian Academy of Sciences (India)

    Unknown

    values are extensively used to define aromaticity quantitatively.3 In a recent study on ... studies were directed to unravel the subtle ways in which the stability, reactivity, and ..... The singlet–triplet gaps of all the skeletally substituted benzenes ...

  12. Radiolabeled derivatives of folic acid

    International Nuclear Information System (INIS)

    1980-01-01

    Derivatives of folic acid are described, in which the α-carboxyl group is substituted with an amino compound having an aromatic or heterocyclic ring substituent which is capable of being radiolabelled. Particularly mentioned as a radiolabel is 125 I. (author)

  13. Synthesis and Characterization of 5-Substituted 1 H -Tetrazoles in ...

    African Journals Online (AJOL)

    Nano-TiCl4.SiO2 was found to be an extremely efficient catalyst for the preparation of 5-substituted 1H-tetrazole derivatives. Nano-TiCl4.SiO2 is a solid Lewis-acid was synthesized by the reaction of nano-SiO2 and TiCl4. The structure characterization of this acid was achieved with X-ray diffraction, thermogravimetric ...

  14. Dihydroxylation of 4-substituted 1,2-dioxines

    DEFF Research Database (Denmark)

    Robinson, Tony V; Pedersen, Daniel Sejer; Taylor, Dennis K

    2009-01-01

    The synthesis of 2-C-branched erythritol derivatives, including the plant sugar (+/-)-2-C-methylerythritol 2, was achieved through a dihydroxylation/reduction sequence on a series of 4-substituted 1,2-dioxines 3. The asymmetric dihydroxylation of 1,2-dioxines was examined, providing access...... to optically enriched dihydroxy 1,2-dioxanes 4. The synthesized 1,2-dioxanes were converted to other erythro sugar analogues and tetrahydrofurans through controlled cleavage of the endoperoxide linkage....

  15. Smart Phones and their Substitutes

    DEFF Research Database (Denmark)

    Bødker, Mads; Gimpel, Gregory; Hedman, Jonas

    2009-01-01

    Drawing on data from a longitudinal field study, this paper investigates the influence of existing, better and stand-alone technology substitutes on the use of smart phones. By applying prospect theory, media richness theory, and business model literature, the purpose of this paper is to improve...... our understanding of the role of substitutes, device content fit issues, and implications for business models by asking the question: What is an effective business model to address the relationship between user preference and the fit of the smart phone and everyday task? The field study data suggest...... the need for business models to recognize that adoption decisions are reference-dependent and strongly influenced by the fit between task and smart phone....

  16. Bone healing and bone substitutes.

    Science.gov (United States)

    Costantino, Peter D; Hiltzik, David; Govindaraj, Satish; Moche, Jason

    2002-02-01

    With the advent of new biomaterials and surgical techniques, the reconstructive surgeon has a wider range of treatment modalities for the rehabilitation and reconstruction of craniofacial skeletal deformities than ever before. These innovative substances act as true bone graft substitutes, thereby allowing the surgeon to avoid the use of autogenous bone grafts and their associated donor site morbidity. Surgeons have long been interested in producing a composite graft that can heal faster by induction, incorporate with surrounding tissues, and be remodeled to resemble native bone. Currently, there are a host of bone graft substitutes available that vary in both their composition and properties. Craniomaxillofacial surgeons must therefore become comfortable with numerous biomaterials to best tailor the treatment for each patient individually. Ongoing investigations into the next phase of tissue engineering will continue to bring us closer to the ability to regenerate or replace bone.

  17. Substituting oil by electric power

    International Nuclear Information System (INIS)

    Lichtenberg, H.

    1981-01-01

    Parting from the development of primary energy use the author refers to the latest investigations and results presented on the 1980 World Energy Conference and with special regard to oil points out the threatening exhaustion of fossil energy resources. Maintaining the economic structure of the Federal Republic of Germany implies an orientation away from oil. Due to its flexible application technology and quasi-inexhaustible energy resources electric power may substantially contribute to oil substitution which as a matter of fact is of particular interest in connection with the heat market. Coal alone cannot substitute both oil and nuclear energy. Thus, the above postulates the use of the latter. Leaving nuclear energy inactive today will effect an increase in the demand for oil the negative consequences of which would weight heavily upon the anyhow unbalanced import/export ratio of the Federal Republic of Germany. (orig.) [de

  18. 40 CFR 721.4420 - Substituted hydroxylamine.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted hydroxylamine. 721.4420... Substances § 721.4420 Substituted hydroxylamine. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as substituted hydroxylamine (PMN P-84-492) is...

  19. Substituted Indoleacetic Acids Tested in Tissue Cultures

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1978-01-01

    Monochloro substituted IAA inhibited shoot induction in tobacco tissue cultures about as much as IAA. Dichloro substituted IAA inhibited shoot formation less. Other substituted IAA except 5-fluoro- and 5-bromoindole-3-acetic acid were less active than IAA. Callus growth was quite variable...

  20. Substitutes for School Nurses in Illinois

    Science.gov (United States)

    Vollinger, Linda Jeno; Bergren, Martha Dewey; Belmonte-Mann, Frances

    2011-01-01

    The purpose of this descriptive study was to explore utilization of nurse substitutes in the school setting in Illinois. The literature described personnel who staff the school health office in the absence of the school nurse and the barriers to obtaining nurse substitutes. There were no empirical studies conducted on school nurse substitutes in…

  1. Synthesis and Antimicrobial Activity of Some Novel Substituted Piperazinyl-quinazolin-3(4H-ones

    Directory of Open Access Journals (Sweden)

    N. M. Raghavendra

    2008-01-01

    Full Text Available Several substituted-quinazolin-3(4H-ones were synthesized by condensation of 2-chloro-N-(4-oxo-substituted-quinazolin-3(4H-yl-acetamides with various substituted piperazines through single step reaction. Elemental analysis, IR, 1HNMR and mass spectral data confirmed the structure of the newly synthesized compounds. Synthesized quinazolin-4-one derivatives were investigated for their antibacterial and antifungal activities.

  2. Narrowing the gap: from semiconductor to semimetal in the homologous series of rare-earth zinc arsenides RE(2-y)Zn4As4·n(REAs) and Mn-substituted derivatives RE(2-y)Mn(x)Zn(4-x)As4·n(REAs) (RE = La-Nd, Sm, Gd).

    Science.gov (United States)

    Lin, Xinsong; Tabassum, Danisa; Mar, Arthur

    2015-12-14

    A homologous series of ternary rare-earth zinc arsenides, prepared by reactions of the elements at 750 °C, has been identified with the formula RE(2-y)Zn4As4·n(REAs) (n = 2, 3, 4) for various RE members. They adopt trigonal structures: RE(4-y)Zn4As6 (RE = La-Nd), space group R3̄m1, Z = 3; RE(5-y)Zn4As7 (RE = Pr, Nd, Sm, Gd), space group P3̄m1, Z = 1; RE(6-y)Zn4As8 (RE = La-Nd, Sm, Gd), space group R3̄m1, Z = 3. The Zn atoms can be partially substituted by Mn atoms, resulting in quaternary derivatives RE(2-y)Mn(x)Zn(4-x)As4·n(REAs). Single-crystal structures were determined for nine ternary and quaternary arsenides RE(2-y)M4As4·n(REAs) (M = Mn, Zn) as representative examples of these series. The structures are built by stacking close-packed nets of As atoms, sometimes in very long sequences, with RE atoms occupying octahedral sites and M atoms occupying tetrahedral sites, resulting in an intergrowth of [REAs] and [M2As2] slabs. The recurring feature of all members of the homologous series is a sandwich of [M2As2]-[REAs]-[M2As2] slabs, while rocksalt-type blocks of [REAs] increase in thickness between these sandwiches with higher n. Similar to the previously known related homologous series REM(2-x)As2·n(REAs) which is deficient in M, this new series RE(2-y)M4As4·n(REAs) exhibits deficiencies in RE to reduce the electron excess that would be present in the fully stoichiometric formulas. Enthalpic and entropic factors are considered to account for the differences in site deficiencies in these two homologous series. Band structure calculations indicate that the semiconducting behaviour of the parent n = 0 member (with CaAl2Si2-type structure) gradually evolves, through a narrowing of the gap between valence and conduction bands, to semimetallic behaviour as the number of [REAs] blocks increases, to the limit of n = ∞ for rocksalt-type REAs.

  3. Substituted Pyrazinecarboxamides: Synthesis and Biological Evaluation

    Directory of Open Access Journals (Sweden)

    Katarina Kralova

    2006-03-01

    Full Text Available Condensation of the corresponding chlorides of some substituted pyrazine-2-carboxylic acids (pyrazine-2-carboxylic acid, 6-chloropyrazine-2-carboxylic acid, 5-tert-butylpyrazine-2-carboxylic acid or 5-tert-butyl-6-chloropyrazine-2-carboxylic acid withvarious ring-substituted aminothiazoles or anilines yielded a series of amides. Thesyntheses, analytical and spectroscopic data of thirty newly prepared compounds arepresented. Structure-activity relationships between the chemical structures and the anti-mycobacterial, antifungal and photosynthesis-inhibiting activity of the evaluatedcompounds are discussed. 3,5-Bromo-4-hydroxyphenyl derivatives of substitutedpyrazinecarboxylic acid, 16-18, have shown the highest activity against Mycobacteriumtuberculosis H37Rv (54-72% inhibition. The highest antifungal effect againstTrichophyton mentagrophytes, the most susceptible fungal strain tested, was found for5-tert-butyl-6-chloro-N-(4-methyl-1,3-thiazol-2-ylpyrazine-2-carboxamide (8, MIC =31.25 μmol·mL-1. The most active inhibitors of oxygen evolution rate in spinachMolecules 2006, 11 243 chloroplasts were the compounds 5-tert-butyl-6-chloro-N-(5-bromo-2-hydroxyphenyl- pyrazine-2-carboxamide (27, IC50 = 41.9 μmol·L-1 and 5-tert-butyl-6-chloro-N-(1,3- thiazol-2-yl-pyrazine-2-carboxamide (4, IC50 = 49.5 μmol·L-1.

  4. Successive substitution one-leg hybrid P-stable LMM for initial value ...

    African Journals Online (AJOL)

    This paper derives P-stable successive substitution one-leg hybrid linear multistep methods for the numerical solution of second order initial value problems in ordinary differential equations without explicit first order derivative. The methods are demonstrated by a numerical example also considered by Fatunla, et al (1997) ...

  5. Synthesis and Cytotoxicity of Novel Hexahydrothienocycloheptapyridazinone Derivatives

    Directory of Open Access Journals (Sweden)

    Irene Marchesi

    2009-09-01

    Full Text Available Designed as a new group of tricyclic molecules containing the thienocycloheptapyridazinone ring system, a number of 2N-substituted-hexahydrothienocycloheptapyridazinone derivatives were synthesized and their biological activity evaluated. Among the synthesized compounds, derivatives 7d and 7h were found to possess cytotoxic activity against non-small cell lung cancer and central nervous system cancer cell lines, respectively.

  6. Biologic and clinical aspects of integration of different bone substitutes in oral surgery: a literature review.

    Science.gov (United States)

    Zizzari, Vincenzo Luca; Zara, Susi; Tetè, Giulia; Vinci, Raffaele; Gherlone, Enrico; Cataldi, Amelia

    2016-10-01

    Many bone substitutes have been proposed for bone regeneration, and researchers have focused on the interactions occurring between grafts and host tissue, as the biologic response of host tissue is related to the origin of the biomaterial. Bone substitutes used in oral and maxillofacial surgery could be categorized according to their biologic origin and source as autologous bone graft when obtained from the same individual receiving the graft; homologous bone graft, or allograft, when harvested from an individual other than the one receiving the graft; animal-derived heterologous bone graft, or xenograft, when derived from a species other than human; and alloplastic graft, made of bone substitute of synthetic origin. The aim of this review is to describe the most commonly used bone substitutes, according to their origin, and to focus on the biologic events that ultimately lead to the integration of a biomaterial with the host tissue. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Global chaos synchronization of electro-mechanical gyrostat systems via variable substitution control

    International Nuclear Information System (INIS)

    Chen Yun; Wu Xiaofeng; Liu Zhong

    2009-01-01

    This paper studies global synchronization of non-autonomous chaotic electro-mechanical gyrostat systems via variable substitution control. A master-slave non-autonomous synchronization scheme with variable substitution control is mathematically presented. Based on the scheme, some sufficient algebraic criteria for global chaos synchronization of master and slave electro-mechanical gyrostat systems via various single-variable coupling are derived. The effectiveness of the obtained criteria is numerically illustrated by the examples.

  8. Impacts of Vehicle Weight Reduction via Material Substitution on Life-Cycle Greenhouse Gas Emissions.

    Science.gov (United States)

    Kelly, Jarod C; Sullivan, John L; Burnham, Andrew; Elgowainy, Amgad

    2015-10-20

    This study examines the vehicle-cycle and vehicle total life-cycle impacts of substituting lightweight materials into vehicles. We determine part-based greenhouse gas (GHG) emission ratios by collecting material substitution data and evaluating that alongside known mass-based GHG ratios (using and updating Argonne National Laboratory's GREET model) associated with material pair substitutions. Several vehicle parts are lightweighted via material substitution, using substitution ratios from a U.S. Department of Energy report, to determine GHG emissions. We then examine fuel-cycle GHG reductions from lightweighting. The fuel reduction value methodology is applied using FRV estimates of 0.15-0.25, and 0.25-0.5 L/(100km·100 kg), with and without powertrain adjustments, respectively. GHG breakeven values are derived for both driving distance and material substitution ratio. While material substitution can reduce vehicle weight, it often increases vehicle-cycle GHGs. It is likely that replacing steel (the dominant vehicle material) with wrought aluminum, carbon fiber reinforced plastic (CRFP), or magnesium will increase vehicle-cycle GHGs. However, lifetime fuel economy benefits often outweigh the vehicle-cycle, resulting in a net total life-cycle GHG benefit. This is the case for steel replaced by wrought aluminum in all assumed cases, and for CFRP and magnesium except for high substitution ratio and low FRV.

  9. Substitution Effects and Linear Free Energy Relationships During Reduction of 4- Benzoyl-n-(4-substituted Benzyl)pyridinium Cations

    Science.gov (United States)

    Leventis, Nicholas; Zhang, Guo-Hui; Rawashdeh, Abdel-Monem M.; Sotiriou-Leventis, Chariklia; Gray, Hugh R. (Technical Monitor)

    2003-01-01

    In analogy to 4-(para-substituted benzoyl)-N-methylpyridinium cations (1-X's), the title species (2-X's, -X = -OCH3, -CH3, -H, -Br, -COCH3, -NO2) undergo two reversible, well-separated (E(sub 1/2) greater than or equal to 650 mV) one-electron reductions. The effect of substitution on the reduction potentials of 2-X's is much weaker than the effect of the same substituents on 1-X's: the Hammett rho-values are 0.80 and 0.93 for the 1st- and 2nd-e reduction of 2-X's vs. 2.3 and 3.3 for the same reductions of 1-X's, respectively. Importantly, the nitro group of 2-NO2 undergoes reduction before the 2nd-e reduction of the 4-benzoylpyridinium system. These results suggest that the redox potentials of the 4-benzoylpyridinium system can be course-tuned via p-benzoyl substitution and fine-tuned via para-benzyl substitution. Introducing the recently derived substituent constant of the -NO2(sup)- group (sigma para-NO2(sup)- = -0.97) yields an excellent correlation for the 3rd-e reduction of 2- NO2 (corresponding to the reduction of the carbonyl group) with the 2nd-e reduction of the other 2-X's, and confirms the electron donating properties of -NO2(sup)-.

  10. Biologic and synthetic skin substitutes: An overview.

    Science.gov (United States)

    Halim, Ahmad Sukari; Khoo, Teng Lye; Mohd Yussof, Shah Jumaat

    2010-09-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substitutes can be divided into two main classes, namely, biological and synthetic substitutes. The biological skin substitutes have a more intact extracellular matrix structure, while the synthetic skin substitutes can be synthesised on demand and can be modulated for specific purposes. Each class has its advantages and disadvantages. The biological skin substitutes may allow the construction of a more natural new dermis and allow excellent re-epithelialisation characteristics due to the presence of a basement membrane. Synthetic skin substitutes demonstrate the advantages of increase control over scaffold composition. The ultimate goal is to achieve an ideal skin substitute that provides an effective and scar-free wound healing.

  11. Biologic and synthetic skin substitutes: An overview

    Directory of Open Access Journals (Sweden)

    Halim Ahmad

    2010-10-01

    Full Text Available The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substitutes can be divided into two main classes, namely, biological and synthetic substitutes. The biological skin substitutes have a more intact extracellular matrix structure, while the synthetic skin substitutes can be synthesised on demand and can be modulated for specific purposes. Each class has its advantages and disadvantages. The biological skin substitutes may allow the construction of a more natural new dermis and allow excellent re-epithelialisation characteristics due to the presence of a basement membrane. Synthetic skin substitutes demonstrate the advantages of increase control over scaffold composition. The ultimate goal is to achieve an ideal skin substitute that provides an effective and scar-free wound healing.

  12. Computational study of cation substitutions in apatites

    International Nuclear Information System (INIS)

    Tamm, Toomas; Peld, Merike

    2006-01-01

    Density-functional theory plane-wave modeling of fluor- and hydroxyapatites has been performed, where one or two calcium ions per unit cell were replaced with cadmium or zinc cations. It was found that cadmium ions favor Ca(1) positions in fluorapatites and Ca(2) positions in hydroxyapatites, in agreement with experiment. A similar pattern is predicted for zinc substitutions. In the doubly substituted cases, where only hydroxyapatites were modeled, a preference for the substituting ions to be located in Ca(2) position was also observed. Displacement of the hydroxide ions from their symmetrical positions on the hexagonal axis can be used to explain the preferred configurations of substituting ions around the axis. -- Deformation of the hydroxide ion chain due to substitutions around the ion channel in substituted hydroxyapatites

  13. Evaluation of substitution monopole models for tire noise sound synthesis

    Science.gov (United States)

    Berckmans, D.; Kindt, P.; Sas, P.; Desmet, W.

    2010-01-01

    Due to the considerable efforts in engine noise reduction, tire noise has become one of the major sources of passenger car noise nowadays and the demand for accurate prediction models is high. A rolling tire is therefore experimentally characterized by means of the substitution monopole technique, suiting a general sound synthesis approach with a focus on perceived sound quality. The running tire is substituted by a monopole distribution covering the static tire. All monopoles have mutual phase relationships and a well-defined volume velocity distribution which is derived by means of the airborne source quantification technique; i.e. by combining static transfer function measurements with operating indicator pressure measurements close to the rolling tire. Models with varying numbers/locations of monopoles are discussed and the application of different regularization techniques is evaluated.

  14. Modeling charge transport properties of cyano-substituted PPV

    International Nuclear Information System (INIS)

    Correia, Helena M.G.; Ramos, Marta M.D.

    2003-01-01

    In recent years, poly (p-phenylenevinylene) (PPV) and its derivatives have attracted much interest due to their applications in light-emitting diodes (LEDs). One of the issues that determine device performance is the transport of charge carriers along the polymer strands. For that reason, we investigate the influence of cyano substitution on geometry and electronic behaviour of PPV chains using self-consistent quantum molecular dynamics simulations. Our results suggest that substitution by cyano groups induce distortion in the PPV chains and a charge rearrangement among the polymer atoms. Specifically addressed is the issue concerning estimates of charge (electron and hole) mobility by computer experiments. Significant differences have been found both in the strength of the electric field needed to move positive and negative charge carriers along the polymer chain as well as in charge mobility

  15. The Morishima Gross elasticity of substitution

    OpenAIRE

    Blackorby, Charles; Primont, Daniel; Russell, R. Robert

    2007-01-01

    We show that the Hotelling-Lau elasticity of substitution, an extension of the Allen-Uzawa elasticity to allow for optimal output-quantity (or utility) responses to changes in factor prices, inherits all of the failings of the Allen-Uzawa elasticity identified by Blackorby and Russell [1989 AER]. An analogous extension of the Morishima elasticity of substitution to allow for output quantity changes preserves the salient properties of the original Hicksian notion of elasticity of substitution.

  16. Statistical Physics of Complex Substitutive Systems

    Science.gov (United States)

    Jin, Qing

    Diffusion processes are central to human interactions. Despite extensive studies that span multiple disciplines, our knowledge is limited to spreading processes in non-substitutive systems. Yet, a considerable number of ideas, products, and behaviors spread by substitution; to adopt a new one, agents must give up an existing one. This captures the spread of scientific constructs--forcing scientists to choose, for example, a deterministic or probabilistic worldview, as well as the adoption of durable items, such as mobile phones, cars, or homes. In this dissertation, I develop a statistical physics framework to describe, quantify, and understand substitutive systems. By empirically exploring three collected high-resolution datasets pertaining to such systems, I build a mechanistic model describing substitutions, which not only analytically predicts the universal macroscopic phenomenon discovered in the collected datasets, but also accurately captures the trajectories of individual items in a complex substitutive system, demonstrating a high degree of regularity and universality in substitutive systems. I also discuss the origins and insights of the parameters in the substitution model and possible generalization form of the mathematical framework. The systematical study of substitutive systems presented in this dissertation could potentially guide the understanding and prediction of all spreading phenomena driven by substitutions, from electric cars to scientific paradigms, and from renewable energy to new healthy habits.

  17. Substitution dynamical systems spectral analysis

    CERN Document Server

    Queffélec, Martine

    2010-01-01

    This volume mainly deals with the dynamics of finitely valued sequences, and more specifically, of sequences generated by substitutions and automata. Those sequences demonstrate fairly simple combinatorical and arithmetical properties and naturally appear in various domains. As the title suggests, the aim of the initial version of this book was the spectral study of the associated dynamical systems: the first chapters consisted in a detailed introduction to the mathematical notions involved, and the description of the spectral invariants followed in the closing chapters. This approach, combined with new material added to the new edition, results in a nearly self-contained book on the subject. New tools - which have also proven helpful in other contexts - had to be developed for this study. Moreover, its findings can be concretely applied, the method providing an algorithm to exhibit the spectral measures and the spectral multiplicity, as is demonstrated in several examples. Beyond this advanced analysis, many...

  18. Controversial issues of maternity substitution

    Directory of Open Access Journals (Sweden)

    Andy Pușcă

    2009-06-01

    Full Text Available Substitute maternity consists in a woman carrying a pregnancy (the implant of an embryo, at therequest of a sterile couple, most of the times in exchange of a sum of money, with her commitment tounconditionally give away the newborn after birth to the couple she concluded the agreement with. Manycontroversies emerged in what concerns the contract between the sterile couple and the carrying mother,especially when this contract is by onerous title, which happens in most of the cases. In that a civil contract? Is ita sales contract for the child? Is it a contract to provide services? Is it body marketing? Between total prohibitionand excessive liberalism, the middle way, which is the regulation according to ethical religious, cultural andsocial norms of each community, represents a realistic solution.

  19. Photoelectron Spectroscopy of Substituted Phenylnitrenes

    Science.gov (United States)

    Wijeratne, Neloni R.; Da Fonte, Maria; Wenthold, Paul G.

    2009-06-01

    Nitrenes are unusual molecular structures with unfilled electronic valences that are isoelectronic with carbenes. Although, both can be generated by either thermal or photochemical decomposition of appropriate precursors they usually exhibit different reactivities. In this work, we carry out spectroscopic studies of substituted phenylnitrene to determine how the introduction of substituents will affect the reactivity and its thermochemical properties. All studies were carried out by using the newly constructed time-of-flight negative ion photoelectron spectrometer (NIPES) at Purdue University. The 355 nm photoelectron spectra of the o-, m-, and p-chlorophenyl nitrene anions are fairly similar to that measured for phenylnitrene anion. All spectra show low energy triplet state and a high energy singlet state. The singlet state for the meta isomer is well-resolved, with a well defined origin and observable vibrational structure. Whereas the singlet states for the ortho and para isomers have lower energy onsets and no resolved structure. The isomeric dependence suggests that the geometry differences result from the resonance interaction between the nitrogen and the substituent. Quinoidal resonance structures are possible for the open-shell singlet states of the o- and p-chlorinated phenyl nitrenes. The advantages of this type of electronic structures for the open-shell singlet states is that the unpaired electrons can be more localized on separate atoms in the molecules, minimizing the repulsion between. Because the meta position is not in resonance with the nitrenes, substitution at that position should not affect the structure of the open-shell singlet state. The measured electron affinities (EA) of the triplet phenylnitrenes are in excellent agreement with the values predicted by electronic structure calculations. The largest EA, 1.82 eV is found for the meta isomer, with para being the smallest, 1.70 eV.

  20. Bis-aryl substituted dioxaborines as electron-transport materials: a comparative density functional theory investigation with oxadiazoles and siloles

    International Nuclear Information System (INIS)

    Risko, C.; Zojer, E.; Brocorens, P.; Marder, S.R.; Bredas, J.L.

    2005-01-01

    We report on a detailed quantum-chemical comparison of the electronic structures, vertical electron affinities, and intramolecular reorganization energies for bis-aryl substituted dioxaborine, oxadiazole, and silole derivatives. The results indicate that the HOMO and LUMO energies of the substituted compounds can be tuned on the order of 2-3 eV via minor changes in the substitution patterns, with the HOMO and LUMO levels for the dioxaborine derivatives consistently the most energy stabilized. Additionally, large vertical electron affinities and comparable intramolecular reorganization energies confirm that dioxaborine systems are interesting candidates for electron transport materials

  1. Synthesis and characterization of novel substituted N-benzothiazole-2-yl-acetamides

    Directory of Open Access Journals (Sweden)

    H.C. Sakarya

    2016-11-01

    Full Text Available Schiff base derivatives of benzothiazole 2a–e have been synthesized by reacting with substituted 2-aminobenzothiazole 1a–e and different substituted benzaldehydes 5a–e. The obtained Schiff bases reaction with NaBH4 has afforded the corresponding some novel amines 3a–e. The condensation of amines with chloroacetylchloride leads to novel amide derivatives 4a–e. The structures of the synthesized compounds are characterized by elemental analysis, IR, MS, 1H NMR and 13C NMR.

  2. Accessing 2-substituted piperidine iminosugars by organometallic addition/intramolecular reductive amination: aldehyde vs. nitrone route.

    Science.gov (United States)

    Mirabella, S; Fibbi, G; Matassini, C; Faggi, C; Goti, A; Cardona, F

    2017-11-07

    A dual synthetic strategy to afford 2-substituted trihydroxypiperidines is disclosed. The procedure involved Grignard addition either to a carbohydrate-derived aldehyde or to a nitrone derived thereof, and took advantage of an efficient ring-closure reductive amination strategy in the final cyclization step. An opposite diastereofacial preference was demonstrated in the nucleophilic attack to the two electrophiles, which would finally produce the same piperidine diastereoisomer as the major product. However, use of a suitable Lewis acid in the Grignard addition to the nitrone allowed reversing the selectivity, giving access to 2-substituted piperidines with the opposite configuration at C-2.

  3. Diagnostic radio labelled polysaccharide derivatives

    International Nuclear Information System (INIS)

    Milbrath, D.S.; Ferber, R.H.; Barnett, W.E.

    1982-01-01

    A radiopharmaceutical compound for diagnosing blood clots is claimed. It is the reaction product of a compound characterized by a water-soluble polysaccharide moiety having an average of at least 0.25 anionic group per monosaccharide unit, and at least one chelating group derived from the group consisting of amino acids, substituted cyclic acid anhydrides, and carbon disulfide; and a radioactive tracer metal compound selected from In-111, Tc-99m, Cr-51, Ga-68, and a reduced pertechnetate compound

  4. Type Substitution for Object-Oriented Programming

    DEFF Research Database (Denmark)

    Schwartzbach, Michael Ignatieff; Palsberg, Jens

    1990-01-01

    Genericity allows the substitution of types in a class. This is usually obtained through parameterized classes, although they are inflexible since any class can be inherited but is not in itself parameterized. We suggest a new genericity mechanism, type substitution, which is a subclassing concep...

  5. Multisensory integration, sensory substitution and visual rehabilitation

    DEFF Research Database (Denmark)

    Proulx, Michael J; Ptito, Maurice; Amedi, Amir

    2014-01-01

    Sensory substitution has advanced remarkably over the past 35 years since first introduced to the scientific literature by Paul Bach-y-Rita. In this issue dedicated to his memory, we describe a collection of reviews that assess the current state of neuroscience research on sensory substitution...

  6. Educators Take Another Look at Substitutes

    Science.gov (United States)

    Zubrzycki, Jaclyn

    2012-01-01

    The mythology surrounding the substitute teacher is not a pretty one: Paper airplanes, lost learning, bullying. But as schools collect more information about teacher absenteeism and its consequences, districts and schools are exploring ways to professionalize substitute teaching--or experiment with alternative ways of coping with teacher absences.…

  7. Synthesis and Antimicrobial Activity of Some New Formazan Derivatives

    Directory of Open Access Journals (Sweden)

    S. I. Marjadi

    2009-01-01

    Full Text Available A series of new substituted formazan derivatives has been synthesized from corresponding aryl diazonium chloride and Schiff base in pyridine. The synthesized compounds were identified by spectral studies and screened for their antimicrobial activities.

  8. Highly fluorescent benzofuran derivatives of the GFP chromophore

    DEFF Research Database (Denmark)

    Christensen, Mikkel Andreas; Jennum, Karsten Stein; Abrahamsen, Peter Bæch

    2012-01-01

    Intramolecular cyclization reactions of Green Fluorescent Protein chromophores (GFPc) containing an arylethynyl ortho-substituent at the phenol ring provide new aryl-substituted benzofuran derivatives of the GFPc. Some of these heteroaromatic compounds exhibit significantly enhanced fluorescence...

  9. Substitution between cars within the household

    DEFF Research Database (Denmark)

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    2016-01-01

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars of different fuel efficiency in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate – for each car owned by the household...... – own and cross-price effects of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, the basic model yielded fuel price elasticities of 0.......98 and 1.41 for the primary and secondary cars, respectively. Accounting for substitution effects, these figures reduce to, respectively, 0.32 and 0.45. Consistent with substitution behaviour, we find that the fuel price elasticity of fuel demand exceeds the elasticity of kilometre demands with respect...

  10. Elasticity of Substitution and Antidumping Measures

    DEFF Research Database (Denmark)

    Drud Hansen, Jørgen; Meinen, Philipp; Nielsen, Jørgen Ulff-Møller

    Abstract This paper analyzes the role of the elasticity of substitution for anti-dumping decisions across countries. In monopolistic competition models with cost heterogeneous firms across countries, price differences vary inversely with the elasticity of substitution. Anti-dumping duties should...... therefore also vary inversely with the elasticity of substitution at least for countries which have a strong focus on prices in the determination of their anti-dumping measures. We test this for ten countries from 1990 to 2009 using data on anti-dumping from Chad Bown (2010) and US-data at 8-digit level...... in our empirical investigation support the predicted role of the elasticity of substitution as we find a significant negative relation between the elasticity of substitution and the final anti-dumping duties for the ‘lesser duty rule’ group of countries. The countries which do not follow the ‘lesser duty...

  11. Investigating the Activity Spectrum for Ring-Substituted 8-Hydroxyquinolines

    Directory of Open Access Journals (Sweden)

    Aidan Coffey

    2010-01-01

    Full Text Available In this study, a series of fourteen ring-substituted 8-hydroxyquinoline derivatives were prepared. The synthesis procedures are presented. The compounds were analyzed using RP-HPLC to determine lipophilicity. They were tested for their activity related to inhibition of photosynthetic electron transport (PET in spinach (Spinacia oleracea L. chloroplasts. Primary in vitro screening of the synthesized compounds was also performed against four mycobacterial strains and against eight fungal strains. Several compounds showed biological activity comparable with or higher than the standards isoniazid or fluconazole. For all the compounds, the relationships between the lipophilicity and the chemical structure of the studied compounds are discussed.

  12. Substituted sodium phenylanthranylates as inhibitors of corrosion in chloride solutions

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, Yu.I.; Fialkov, Yu.A.; Popova, L.I.; Ehndel' man, E.S.; Kuznetsova, I.G. (AN SSSR, Moscow. Inst. Fizicheskoj Khimii)

    The efficiency of corrosion protection of armco iron, zinc (Ts-O) aluminium (AB 000) and its alloys (.D16 and AMG6) with sodium phenylanthranylate derivatives in chloride buffer solutions (pH 7.4-8.08) are investigated. It has been ascertained that the introduction of sodium phenylanthranylate into phenyl radical in m- and p-position relative to the amino group of electron-seeking substitutes improves protective properties of an inhibitor. The inhibiting effect of phenylanthranylates and its dependence on electron structure enchances in zinc-aluminium-iron series and decreases in case of transition from pure aluminium to its alloys.

  13. Substituted sodium phenylanthranylates as inhibitors of corrosion in chloride solutions

    International Nuclear Information System (INIS)

    Kuznetsov, Yu.I.; Fialkov, Yu.A.; Popova, L.I.; Ehndel'man, E.S.; Kuznetsova, I.G.

    1982-01-01

    The efficiency of corrosion protoction of armco iron, zinc (Ts-O) aluminium (AB 000) and its alloys (.D16 and AMG6) with sodium phenylanthranylate derivatives in clloride buffer solutions (pH 7.4-8.08) are investigated. It has been ascertained that the introduction of sodium phenylantiranylate into phenyl radical in m- and p-position relative to the amino group of electron-seeking substitutes improves protective properties of an inhibitor. The inhibiting effect of phenylanthranylates and its dependence on electron structure enchances in zinc-aluminium-iron series and decreases in case of transition from pure aluminium to its alloys

  14. Substituted Hydroxyapatites with Antibacterial Properties

    Directory of Open Access Journals (Sweden)

    Joanna Kolmas

    2014-01-01

    Full Text Available Reconstructive surgery is presently struggling with the problem of infections located within implantation biomaterials. Of course, the best antibacterial protection is antibiotic therapy. However, oral antibiotic therapy is sometimes ineffective, while administering an antibiotic at the location of infection is often associated with an unfavourable ratio of dosage efficiency and toxic effect. Thus, the present study aims to find a new factor which may improve antibacterial activity while also presenting low toxicity to the human cells. Such factors are usually implemented along with the implant itself and may be an integral part of it. Many recent studies have focused on inorganic factors, such as metal nanoparticles, salts, and metal oxides. The advantages of inorganic factors include the ease with which they can be combined with ceramic and polymeric biomaterials. The following review focuses on hydroxyapatites substituted with ions with antibacterial properties. It considers materials that have already been applied in regenerative medicine (e.g., hydroxyapatites with silver ions and those that are only at the preliminary stage of research and which could potentially be used in implantology or dentistry. We present methods for the synthesis of modified apatites and the antibacterial mechanisms of various ions as well as their antibacterial efficiency.

  15. Substituted Hydroxyapatites with Antibacterial Properties

    Science.gov (United States)

    Kolmas, Joanna; Groszyk, Ewa; Kwiatkowska-Różycka, Dagmara

    2014-01-01

    Reconstructive surgery is presently struggling with the problem of infections located within implantation biomaterials. Of course, the best antibacterial protection is antibiotic therapy. However, oral antibiotic therapy is sometimes ineffective, while administering an antibiotic at the location of infection is often associated with an unfavourable ratio of dosage efficiency and toxic effect. Thus, the present study aims to find a new factor which may improve antibacterial activity while also presenting low toxicity to the human cells. Such factors are usually implemented along with the implant itself and may be an integral part of it. Many recent studies have focused on inorganic factors, such as metal nanoparticles, salts, and metal oxides. The advantages of inorganic factors include the ease with which they can be combined with ceramic and polymeric biomaterials. The following review focuses on hydroxyapatites substituted with ions with antibacterial properties. It considers materials that have already been applied in regenerative medicine (e.g., hydroxyapatites with silver ions) and those that are only at the preliminary stage of research and which could potentially be used in implantology or dentistry. We present methods for the synthesis of modified apatites and the antibacterial mechanisms of various ions as well as their antibacterial efficiency. PMID:24949423

  16. Global Derivatives

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    approaches to dealing in the global business environment." - Sharon Brown-Hruska, Commissioner, Commodity Futures Trading Commission, USA. "This comprehensive survey of modern risk management using derivative securities is a fine demonstration of the practical relevance of modern derivatives theory to risk......" provides comprehensive coverage of different types of derivatives, including exchange traded contracts and over-the-counter instruments as well as real options. There is an equal emphasis on the practical application of derivatives and their actual uses in business transactions and corporate risk...... management situations. Its key features include: derivatives are introduced in a global market perspective; describes major derivative pricing models for practical use, extending these principles to valuation of real options; practical applications of derivative instruments are richly illustrated...

  17. Syntheses and biological activities of 13-substituted avermectin aglycons.

    Science.gov (United States)

    Mrozik, H; Linn, B O; Eskola, P; Lusi, A; Matzuk, A; Preiser, F A; Ostlind, D A; Schaeffer, J M; Fisher, M H

    1989-02-01

    The reactions of sulfonate esters of the allylic/homoallylic 13-alcohol of 5-O-(tert-butyldimethylsilyl)-22,23-dihydroavermectin B1a aglycon (1a) were investigated. Nucleophilic substitution gave 13 beta-chloro and 13 beta-iodo derivatives, while solvolytic reaction conditions yielded 13 alpha-methoxy, 13 alpha-fluoro, and 13 alpha-chloro products. A mixture of 13 alpha- and 13 beta-fluorides was obtained upon reaction with DAST. The 13 beta-iodide gave, upon elimination with lutidine, the 8(9),10(11),12(13),14(15)-tetraene. The 13 beta-alcohol and the rearranged 15-ol 13(14)-ene and 15-amino 13(14)-ene derivatives were obtained by substitution via the allylic carbonium ion. MEM ethers 11 and 12 of the two epimeric 13-ols were prepared by alkylation with MEM chloride. In contrast, methylation of 1a with MeI and Ag2O in CH2Cl2 occurred exclusively at the tertiary 7-hydroxy group and not at the secondary 13 alpha-ol. Oxidation of the allylic alcohol 1a proceeded under Swern conditions but not with MnO2 to the 13-oxo aglycon, which was reduced by NaBH4 exclusively to the natural 13 alpha-ol, while reductive amination with NaCNBH3-NH4OAc gave the 13 alpha-amine. The methoxime derivative was obtained in the form of the two geometric isomers. Anthelmintic activities against the sheep nematode Trichostrongylus colubriformis, miticidal activities against the two-spotted spider mite (Tetranychus urticae), and insecticidal activities against the southern armyworm (Spodoptera eridania) as well as the binding constants to a free living nematode (Caenorhabditis elegans) derived receptor assay were obtained and compared to avermectin B1a, 22,23-dihydroavermectin B1a, and the 13-deoxy-22,23-dihydroavermectin B1 aglycon related to the milbemycins. None of the newly prepared derivatives exceeded the potency of the three reference compounds. Lipophilic 13-substituents such as halogen, alkoxy, and methoxime retained high biological activities in all assays, while the more polar

  18. Crystal and molecular structure of the coordination compounds of Er3+ with 1-(methoxydiphenylphosphoryl)-2-diphenylphosphorylbenzene [ErL21(NO3)2]2[Er(NO3)2(H2O)5]0.333(NO3)2.333 · 2.833H2O and its ethyl substituted derivative [ErL22(NO3)2][Er(NO3)5]0.5 · 0.5H2O

    International Nuclear Information System (INIS)

    Polyakova, I. N.; Baulin, V. E.; Ivanova, I. S.; Pyatova, E. N.; Sergienko, V. S.; Tsivadze, A. Yu.

    2015-01-01

    The coordination compounds of Er 3+ with 1-(methoxydiphenylphosphoryl)-2-diphenylphosphorylbenzene [ErL 2 1 (NO 3 ) 2 ] 2 [Er(NO 3 ) 2 (H 2 O) 5 ] 0.333 (NO 3 ) 2.333 · 2.833H 2 O (I) and its ethyl substituted derivative [ErL 2 2 (NO 3 ) 2 ][Er(NO 3 ) 5 ] 0.5 · 0.5H 2 O (II) are synthesized and their crystal structures are studied. I and II contain [ErL 2 (NO 3 ) 2 ] + complex cations of identical composition and close structure. The eight-vertex polyhedron of the Er atom in the shape of a distorted octahedron with two split trans vertices is formed by the O atoms of the phosphoryl groups of L ligands and nitrate anions. L ligands close nine-membered metallocycles. The structures contain spacious channels which are populated differently, namely, by disordered [Er(NO 3 ) 2 (H 2 O) 5 ] + complex cations, NO 3 − anions, and crystallization water molecules in I and disordered [Er(NO 3 ) 5 ] 2− complex anions and crystallization water molecules in II. The IR spectra of I and II are studied

  19. Modeling competitive substitution in a polyelectrolyte complex

    International Nuclear Information System (INIS)

    Peng, B.; Muthukumar, M.

    2015-01-01

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longer than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution

  20. Determinants of generic drug substitution in Switzerland

    Directory of Open Access Journals (Sweden)

    Lufkin Thomas M

    2011-01-01

    Full Text Available Abstract Background Since generic drugs have the same therapeutic effect as the original formulation but at generally lower costs, their use should be more heavily promoted. However, a considerable number of barriers to their wider use have been observed in many countries. The present study examines the influence of patients, physicians and certain characteristics of the generics' market on generic substitution in Switzerland. Methods We used reimbursement claims' data submitted to a large health insurer by insured individuals living in one of Switzerland's three linguistic regions during 2003. All dispensed drugs studied here were substitutable. The outcome (use of a generic or not was modelled by logistic regression, adjusted for patients' characteristics (gender, age, treatment complexity, substitution groups and with several variables describing reimbursement incentives (deductible, co-payments and the generics' market (prices, packaging, co-branded original, number of available generics, etc.. Results The overall generics' substitution rate for 173,212 dispensed prescriptions was 31%, though this varied considerably across cantons. Poor health status (older patients, complex treatments was associated with lower generic use. Higher rates were associated with higher out-of-pocket costs, greater price differences between the original and the generic, and with the number of generics on the market, while reformulation and repackaging were associated with lower rates. The substitution rate was 13% lower among hospital physicians. The adoption of the prescribing practices of the canton with the highest substitution rate would increase substitution in other cantons to as much as 26%. Conclusions Patient health status explained a part of the reluctance to substitute an original formulation by a generic. Economic incentives were efficient, but with a moderate global effect. The huge interregional differences indicated that prescribing behaviours and

  1. Sensory Substitution and Multimodal Mental Imagery.

    Science.gov (United States)

    Nanay, Bence

    2017-09-01

    Many philosophers use findings about sensory substitution devices in the grand debate about how we should individuate the senses. The big question is this: Is "vision" assisted by (tactile) sensory substitution really vision? Or is it tactile perception? Or some sui generis novel form of perception? My claim is that sensory substitution assisted "vision" is neither vision nor tactile perception, because it is not perception at all. It is mental imagery: visual mental imagery triggered by tactile sensory stimulation. But it is a special form of mental imagery that is triggered by corresponding sensory stimulation in a different sense modality, which I call "multimodal mental imagery."

  2. Biologic and synthetic skin substitutes: An overview

    OpenAIRE

    Halim, Ahmad Sukari; Khoo, Teng Lye; Mohd. Yussof, Shah Jumaat

    2010-01-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substit...

  3. Financial Derivatives

    DEFF Research Database (Denmark)

    Wigan, Duncan

    2013-01-01

    Contemporary derivatives mark the development of capital and constitute a novel form of ownership. By reconfiguring the temporal, spatial and legal character of ownership derivatives present a substantive challenge to the tax collecting state. While fiscal systems are nationally bounded...... and inherently static, capital itself is unprecedentedly mobile, fluid and fungible. As such derivatives raise the specter of ‘financial weapons of mass destruction’....

  4. Financial Derivatives

    OpenAIRE

    Janečková, Alena

    2011-01-01

    1 Abstract/ Financial derivatives The purpose of this thesis is to provide an introduction to financial derivatives which has been, from the legal perspective, described in a not satisfactory manner as quite little literature that can be found about this topic. The main objectives of this thesis are to define the term "financial derivatives" and its particular types and to analyse legal nature of these financial instruments. The last objective is to try to draft future law regulation of finan...

  5. Sequential Au(I-catalyzed reaction of water with o-acetylenyl-substituted phenyldiazoacetates

    Directory of Open Access Journals (Sweden)

    Jianbo Wang

    2011-05-01

    Full Text Available The gold(I-catalyzed reaction of water with o-acetylenyl-substituted phenyldiazoacetates provides 1H-isochromene derivatives in good yields. The reaction follows a catalytic sequence of gold carbene formation/water O–H insertion/alcohol-alkyne cyclization. The gold(I complex is the only catalyst in each of these steps.

  6. One Leg hybrid P-stable substitution LMM for oscilatory IVPs in ODEs.

    African Journals Online (AJOL)

    This presents P-stable successive substitution one-leg hybrid LMM for the numerical solution of oscillatory second order IVPs in ODEs without explicitly defined first order derivative. These problems occurs amongst others, in orbital mechanics where the methods to be presented finds ready applications and need not any a ...

  7. Copper-Catalyzed Heteroarylboration of 1,3-Dienes with 3-Bromopyridines: A cine Substitution.

    Science.gov (United States)

    Smith, Kevin B; Huang, Yuan; Brown, M Kevin

    2018-04-26

    A method for the heteroarylboration of 1,3-dienes is presented. The process involves an unusual cine substitution of 3-bromopyridine derivatives to deliver highly functionalized heterocyclic products. Mechanistic studies are included that clarify the details of this unusual process. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Substituted Phthalic Anhydrides from Biobased Furanics : A New Approach to Renewable Aromatics

    NARCIS (Netherlands)

    Thiyagarajan, Shanmugam; Genuino, Homer C.|info:eu-repo/dai/nl/371571685; Sliwa, Michal; van der Waal, Jan C.; de Jong, Ed; van Haveren, Jacco; Weckhuysen, Bert M.|info:eu-repo/dai/nl/285484397; Bruijnincx, Pieter C. A.|info:eu-repo/dai/nl/33799529X; van Es, Daan S.

    2015-01-01

    A novel route for the production of renewable aromatic chemicals, particularly substituted phthalic acid anhydrides, is presented. The classical two-step approach to furanics-derived aromatics via Diels-Alder (DA) aromatization has been modified into a three-step procedure to address the general

  9. One-pot, three-component synthesis of highly substituted pyridines ...

    Indian Academy of Sciences (India)

    Administrator

    trile in the presence of nanocrystalline magnesium oxide provides the highly substituted pyridine derivatives in moderate to ..... NAP–MgO (0⋅1 g), ethanol (5 mL) at reflux temperature b ... difference in the electronic and steric properties of.

  10. Substitution within the Danish printing industry

    DEFF Research Database (Denmark)

    Larsen, Henrik Fred; Bøg, Carsten

    2009-01-01

    are running a substitution project. A major part of the work has been mapping the presence of chemicals which are potential candidates for substitution (e.g. PBT, CMR, vPvB, EDS) within the Danish printing industry and this work was recently finished. The mapping comprises a combination of a literature study......The implementation of the EU REACH regulation will most probably promote substitution within sectors handling a lot of different chemicals like the printing industry. With the aim of being at the cutting edge of this development the Danish EPA together with the Danish printing industry and IPU...... total 15 substances) were found in the Danish printing industry. This paper presents the results of the mapping of chemical candidates and the first results on preparing for actual substitutions....

  11. Substituted hydroxyapatites for biomedical applications: A review

    Czech Academy of Sciences Publication Activity Database

    Šupová, Monika

    2015-01-01

    Roč. 41, č. 8 (2015), s. 9203-9231 ISSN 0272-8842 Institutional support: RVO:67985891 Keywords : bioapatite * calcium phosphate * hydroxyapatite * substitution Subject RIV: JJ - Other Materials Impact factor: 2.758, year: 2015

  12. Dodecatungstocobaltate and Sn (IV)-Substituted Polyoxometalate ...

    African Journals Online (AJOL)

    NICO

    work metals, or substituting different cations for the protons to make their acidic or neutral ... corrosive materials in comparison with traditional Lewis acids. The importance of .... salt by treatment with potassium chloride. Finally, the cobalt (II).

  13. Questioning nuclear waste substitution: a case study.

    Science.gov (United States)

    Marshall, Alan

    2007-03-01

    This article looks at the ethical quandaries, and their social and political context, which emerge as a result of international nuclear waste substitution. In particular it addresses the dilemmas inherent within the proposed return of nuclear waste owned by Japanese nuclear companies and currently stored in the United Kingdom. The UK company responsible for this waste, British Nuclear Fuels Limited (BNFL), wish to substitute this high volume intermediate-level Japanese-owned radioactive waste for a much lower volume of much more highly radioactive waste. Special focus is given to ethical problems that they, and the UK government, have not wished to address as they move forward with waste substitution. The conclusion is that waste substitution can only be considered an ethical practice if a set of moderating conditions are observed by all parties. These conditions are listed and, as of yet, they are not being observed.

  14. DOES CURRENCY SUBSTITUTION AFFECT EXCHANGE RATE VOLATILITY?

    Directory of Open Access Journals (Sweden)

    Hisao Kumamoto

    2014-10-01

    Full Text Available This study investigates the impacts of the degree of currency substitution on nominal exchange rate volatility in seven countries (Indonesia, the Philippines, the Czech Republic, Hungary, Poland, Argentina, and Peru. We use the Threshold ARCH model to consider the ratchet effect of currency substitution and sample periods in the 2000s, during which time the economies of the sample countries stabilized, while the U.S. dollar and euro depreciated against other major currencies following the recent global financial crisis. The presented empirical analyses show that the degree of currency substitution has significant positive effects on the conditional variance of the depreciation rate of the nominal exchange rate in most sample countries. Moreover, a shock to the depreciation rate of the nominal exchange rate has asymmetric effects on the conditional variance, depending on the sign. One possible explanation for these differential effects is the existence of the ratchet effect of currency substitution.

  15. Development of a diesel substitute fuel

    Energy Technology Data Exchange (ETDEWEB)

    Reiter, Anton; Mair-Zelenka, Philipp [Graz Univ. of Technology (Austria). Inst. of Chemical Engineering and Environmental Technology; Zeymer, Marc [OMV Refining and Marketing GmbH, Vienna (Austria). MRDI-D Product Development and Innovation

    2013-06-01

    Substitute fuels composed of few real chemical compounds are an alternative characterisation approach for conventional fuels as opposed to the traditional pseudo-component method. With the algorithm proposed in this paper the generation of such substitutes will be facilitated and well-established thermodynamic methods can be applied for physical property-data prediction. Based on some quality criteria like true boiling-point curve, liquid density, C/H ratio, or cloud point of a target fuel a surrogate which meets these properties is determined by fitting its composition. The application and capabilities of the algorithm developed are demonstrated by means of an exemplary diesel substitute fuel. The substitute mixture obtained can be generated and used for evaluation of property-prediction methods. Furthermore this approach can help to understand the effects of mixing fossil fuels with biogenic compounds. (orig.)

  16. Econometric analysis and energy substitution

    International Nuclear Information System (INIS)

    Phillips, G.J.

    1981-09-01

    As part of its long-term assessment of new applications for nuclear energy, AECL is becoming acquainted with the techniques of mathematical modelling as used in the areas of energy and economics. Early in 1980, a contract was arranged with DataMetrics Limited of Calgary to prepare an econometric model of the manufacturing sector for Ontario, and to provide AECL with all the information necessary to understand the theory, derivation, and use of the model. This report summarizes the results of this exercise

  17. Alkynyl substituted carboranes as precursors to boron carbide thin films, fibers and composites

    International Nuclear Information System (INIS)

    Johnson, S.E.; Yang, X.; Hawthorne, M.F.; Mackenzie, J.D.; Thorne, K.J.; Zheng, H.

    1992-01-01

    In this paper the use of alkynyl substituted derivatives of o-carborane as precursors to boron containing ceramics is described. These compounds undergo a thermally or photochemically induced polymerization to afford cross linked polyakynyl-o-carborane derivatives. The increase in molecular weight should allow for increased Tg's and the retention of modelled polymer preforms. In this report, these modification reactions are described. In addition, the retention of molded polymer preforms were analyzed after UV exposure and inert atmosphere pyrolysis

  18. Synthesis and Anti-HIV-1 Activity of New MKC-442 Analogues with an Alkynyl-Substituted 6-Benzyl Group

    DEFF Research Database (Denmark)

    Aly, Youssef L.; Pedersen, Erik Bjerreg.; La Colla, Paolo

    2007-01-01

    Synthesis and antiviral activities are reported of a series of 6-(3-alkynyl benzyl)-substituted analogues of MKC-442 (6-benzyl-1-(ethoxymethyl)-5-isopropyluracil), a highly potent agent against HIV. The 3-alkynyl group is assumed to give a better stacking of the substituted benzyl group to reverse...... transcriptase (RT) and this was believed to improve antiviral activity against HIV-1. The bromo derivatives, 5-alkyl-6-(3-bromo-benzyl)-1-ethoxymethyl derivatives 7a, b and 5-alkyl-6-(3-bromobenzyl)-1-allyloxymethyl derivatives 9a, b, showed activity against HIV on the same level as their corresponding...

  19. Hyperfine magnetic fields in substituted Finemet alloys

    Energy Technology Data Exchange (ETDEWEB)

    Brzózka, K., E-mail: k.brzozka@uthrad.pl [University of Technology and Humanities in Radom, Department of Physics (Poland); Sovák, P. [P.J. Šafárik University, Institute of Physics (Slovakia); Szumiata, T.; Gawroński, M.; Górka, B. [University of Technology and Humanities in Radom, Department of Physics (Poland)

    2016-12-15

    Transmission Mössbauer spectroscopy was used to determine the hyperfine fields of Finemet-type alloys in form of ribbons, substituted alternatively by Mn, Ni, Co, Al, Zn, V or Ge of various concentration. The comparative analysis of magnetic hyperfine fields was carried out which enabled to understand the role of added elements in as-quenched as well as annealed samples. Moreover, the influence of the substitution on the mean direction of the local hyperfine magnetic field was examined.

  20. Trace maps of general substitutional sequences

    International Nuclear Information System (INIS)

    Kolar, M.; Nori, F.

    1990-01-01

    It is shown that for arbitrary n, there exists a trace map for any n-letter substitutional sequence. Trace maps are explicitly obtained for the well-known circle and Rudin-Shapiro sequences which can be defined by means of substitution rules on three and four letters, respectively. The properties of the two trace maps and their consequences for various spectral properties are briefly discussed

  1. Product portfolio optimization based on substitution

    DEFF Research Database (Denmark)

    Myrodia, Anna; Moseley, A.; Hvam, Lars

    2017-01-01

    The development of production capabilities has led to proliferation of the product variety offered to the customer. Yet this fact does not directly imply increase of manufacturers' profitability, nor customers' satisfaction. Consequently, recent research focuses on portfolio optimization through...... substitution and standardization techniques. However when re-defining the strategic market decisions are characterized by uncertainty due to several parameters. In this study, by using a GAMS optimization model we present a method for supporting strategic decisions on substitution, by quantifying the impact...

  2. Currency Substitution and Inflation in Peru

    OpenAIRE

    Liliana Rojas-Suárez

    1992-01-01

    This paper shows that there is a long-run relationship between the expected rate of depreciation in the black-market-exchange rate and the ratio of domestic to foreign money in Peru; that is, the hypothesis of currency substitution can explain the behavior of real holdings of money in Peru. The paper also shows that, while the importance of currency substitution as a transmission mechanism through which domestic policies affected the dynamics of inflation was relatively small during a period ...

  3. Isotope-labelled folic acid derivatives

    International Nuclear Information System (INIS)

    Lewin, N.; Wong, E.T.

    1976-01-01

    The suggestion deals with the production of folic acid derivatives suitable as indicators or tracers for analyses of serum folates. These folic acid derivatives contain folic acid which is bound by one or both carboxyl groups to the amino nitrogen of compounds such as, e.g., tyramine, glycyl tyrosine, tyrosine, or the methyl ester of tyrosine. The derivative obtained can be substituted by a gamma emitter, e.g. the iodine isotope I 125. The radioactive derivative is used in the method for the competitive protein bonding to determine endogenic folates in the serum. (UWI) [de

  4. Structural Studies of Some Binaphthyl Derivatives

    DEFF Research Database (Denmark)

    Thorup, Niels; Bjørnholm, T.; Bechgaard, K.

    1996-01-01

    Crystal structures of several 1,1'-binaphthyl derivatives have been determined. In particular compounds which at the 2,2' positions have either identical ethoxy groups or a closed bridged ether and furthermore have identical substitution at the 6,6' positions. The latter groups may be Br, CHO, CN...

  5. Derivation of the Ideal Gas Law

    Science.gov (United States)

    Laugier, Alexander; Garai, Jozsef

    2007-01-01

    Undergraduate and graduate physics and chemistry books usually state that combining the gas laws results in the ideal gas law. Leaving the derivation to the students implies that this should be a simple task, most likely a substitution. Boyle's law, Charles's law, and the Avogadro's principle are given under certain conditions; therefore, direct…

  6. INVESTIGATION OF ANTIFUNGAL ACTIVITY OF QUINOLINIUM DERIVATIVES

    Directory of Open Access Journals (Sweden)

    G. A. Alexandrova

    2013-01-01

    Full Text Available Abstract. Antifungal activity (Candida albicans, Candida krusei of some substituted quinolinium derivatives has been investigated. It was established that the most perspective compound for detail investigation of antifungal activity by labeled biomarkers method was N-phenylbenzoquinaldinium tetrafluoroborate.

  7. Substituting missing data in compositional analysis

    Energy Technology Data Exchange (ETDEWEB)

    Real, Carlos, E-mail: carlos.real@usc.es [Area de Ecologia, Departamento de Biologia Celular y Ecologia, Escuela Politecnica Superior, Universidad de Santiago de Compostela, 27002 Lugo (Spain); Angel Fernandez, J.; Aboal, Jesus R.; Carballeira, Alejo [Area de Ecologia, Departamento de Biologia Celular y Ecologia, Facultad de Biologia, Universidad de Santiago de Compostela, 15782 Santiago de Compostela (Spain)

    2011-10-15

    Multivariate analysis of environmental data sets requires the absence of missing values or their substitution by small values. However, if the data is transformed logarithmically prior to the analysis, this solution cannot be applied because the logarithm of a small value might become an outlier. Several methods for substituting the missing values can be found in the literature although none of them guarantees that no distortion of the structure of the data set is produced. We propose a method for the assessment of these distortions which can be used for deciding whether to retain or not the samples or variables containing missing values and for the investigation of the performance of different substitution techniques. The method analyzes the structure of the distances among samples using Mantel tests. We present an application of the method to PCDD/F data measured in samples of terrestrial moss as part of a biomonitoring study. - Highlights: > Missing values in multivariate data sets must be substituted prior to analysis. > The substituted values can modify the structure of the data set. > We developed a method to estimate the magnitude of the alterations. > The method is simple and based on the Mantel test. > The method allowed the identification of problematic variables in a sample data set. - A method is presented for the assessment of the possible distortions in multivariate analysis caused by the substitution of missing values.

  8. Substituting missing data in compositional analysis

    International Nuclear Information System (INIS)

    Real, Carlos; Angel Fernandez, J.; Aboal, Jesus R.; Carballeira, Alejo

    2011-01-01

    Multivariate analysis of environmental data sets requires the absence of missing values or their substitution by small values. However, if the data is transformed logarithmically prior to the analysis, this solution cannot be applied because the logarithm of a small value might become an outlier. Several methods for substituting the missing values can be found in the literature although none of them guarantees that no distortion of the structure of the data set is produced. We propose a method for the assessment of these distortions which can be used for deciding whether to retain or not the samples or variables containing missing values and for the investigation of the performance of different substitution techniques. The method analyzes the structure of the distances among samples using Mantel tests. We present an application of the method to PCDD/F data measured in samples of terrestrial moss as part of a biomonitoring study. - Highlights: → Missing values in multivariate data sets must be substituted prior to analysis. → The substituted values can modify the structure of the data set. → We developed a method to estimate the magnitude of the alterations. → The method is simple and based on the Mantel test. → The method allowed the identification of problematic variables in a sample data set. - A method is presented for the assessment of the possible distortions in multivariate analysis caused by the substitution of missing values.

  9. Complexes of salicylic acid and its derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Tel' zhenskaya, P N; Shvarts, E M [AN Latvijskoj SSR, Riga. Inst. Neorganicheskoj Khimii

    1977-01-01

    A generalization and systematization have been made of literature data on complexing of various elements, including beryllium, cadmium, boron, indium, rare-earth elements, actinides, and transition elements with salicylic acid and it derivatives (amino-, nitro- and halosalicylic acids). The effect of the position and nature of the substitute, in the case of salicylic acid derivatives, on the complexing process is discussed. Certain physicochemical properties of the complexes under consideration are described along with data indicative of their stability.

  10. THE SPECIFICITY OF KERATEINE DERIVATIVES.

    Science.gov (United States)

    Pillemer, L; Ecker, E E; Martiensen, E W

    1939-09-30

    Carboxymethyl, alpha-carboxyethyl-, alpha-carboxy-n-propyl-, alpha-carboxyisopropyl-, alpha-carboxy-n-butyl, alpha-carboxyisobutyl, alpha-carboxyamyl-, benzyl-, and beta-phenylethylkeratemes were prepared from the parent protein, reduced keratin or kerateine. Chemical analysis disclosed that the various compounds differed in their isoelectric points and solubilities depending on the nature of the substituent group introduced. In general, it was found that in so far as could be determined, nearly all of the available sulfhydryl groups were substituted, while no detectable substitution of the free amino groups of the proteins occurred. The results of the serologic studies revealed that the kerateine derivatives acquired a new immunologie character dependent on the nature of the introduced determinant group. Inhibition tests confirmed the results obtained. Evidence was also produced to show that the grouping See PDF for structure may play a rôle in some of the reactions observed.

  11. Emerging drugs of abuse: current perspectives on substituted cathinones

    Directory of Open Access Journals (Sweden)

    Paillet-Loilier M

    2014-05-01

    Full Text Available Magalie Paillet-Loilier,1 Alexandre Cesbron,1 Reynald Le Boisselier,2 Joanna Bourgine,1 Danièle Debruyne1,2 1Toxicology and Pharmacology Laboratory, 2Centre d'Evaluation et d'Information sur la Pharmacodépendance – Addictovigilance (CEIP-A, Department of Pharmacology, University Hospital Centre, Caen, France Abstract: Substituted cathinones are synthetic analogs of cathinone that can be considered as derivatives of phenethylamines with a beta-keto group on the side chain. They appeared in the recreational drug market in the mid-2000s and now represent a large class of new popular drugs of abuse. Initially considered as legal highs, their legal status is variable by country and is rapidly changing, with government institutions encouraging their control. Some cathinones (such as diethylpropion or pyrovalerone have been used in a medical setting and bupropion is actually indicated for smoking cessation. Substituted cathinones are widely available from internet websites, retail shops, and street dealers. They can be sold under chemical, evocative or generic names, making their identification difficult. Fortunately, analytical methods have been developed in recent years to solve this problem. Available as powders, substituted cathinones are self-administered by snorting, oral injestion, or intravenous injection. They act as central nervous system stimulants by causing the release of catecholamines (dopamine, noradrenaline, and serotonin and blocking their reuptake in the central and peripheral nervous system. They may also decrease dopamine and serotonin transporter function as nonselective substrates or potent blockers and may inhibit monoamine oxidase effects. Nevertheless, considerable differences have been found in the potencies of the different substituted cathinones in vitro. Desired effects reported by users include increased energy, empathy, and improved libido. Cardiovascular (tachycardia, hypertension and psychiatric

  12. [Synthesis and biological activity of 1,4-benzoquinone-guanylhydrazone-thiosemicarbazone analogs. 1. Substitution at the S atom].

    Science.gov (United States)

    Schulze, W; Gutsche, W; Wohlrabe, K; Fleck, W; Tresselt, D

    1985-08-01

    The synthesis of S-substituted derivatives of 1,4-benzoquinone-guanylhydrazone-thiosemicarbazone is described. The obtained 1,4-benzoquinone-guanylhydrazone-S-alkyl (resp. aralkyl)-isothiosemicarbazones, in comparison with the unsubstituted standard compound, showed a significantly decreased biological activity against the murine leukemias L 1210 and P 388 as well as against the growth of several kinds of bacteria. Therefore the S-substitution seems not to be useful for reaching a maximum activity.

  13. Elucidation of the substitution pattern of 9,10-anthraquinones through the chemical shifts of peri-hydroxyl protons

    DEFF Research Database (Denmark)

    Schripsema, Jan; Danigno, Denise

    1996-01-01

    In 9,10-anthraquinones the chemical shift of a peri-hydroxyl proton is affected by the substituents in the other benzenoid ring. These effects are additive. They are useful for the determination of substitution patterns and have been used to revise the structures of six previously reported...... anthraquinones containing methoxyl, hydroxyl, methylenedioxy and beta-methyl substituents. Because the chemical shifts of the other protons are hardly affected by substitutions in the other ring, the characteristic chemical shifts for a wide variety of substitution patterns could be derived....

  14. [Guidelines for substitution treatments in prison populations].

    Science.gov (United States)

    Michel, L; Maguet, O

    2005-01-01

    Care access for the drug addict patients in prison (in particular for the treatments of substitution) in France is very unequal from one establishment to another. This reflects the great variability of the practices of substitution and especially the absence of consensus on the methods of adaptation of these practices to the prison environment. Because of difficulties expressed by prisoners and medical staff on this subject and of stakes (let us recall that approximately 30% of the prisoners are dependent or abusers of one or more psychoactive substances), the formulation of recommendations or of a good practices guide of substitution in prison appeared necessary. Work that we detail here answers a ordering of the Advisory Commission of the Treatments of Substitution (September 2001) whose authors are members. It was presented at the session April 2003. It results from the confrontation of a review of the literature (including legal texts and official reports concerning substitution, the organization of the care in prison environment and the lawful framework), with a vast investigation. The latter was carried out near medical staff (22 prisons), penitentiary staff (3 prisons, 27 people met including directors of these establishments) and prisoners (7 establishments, 28 prisoners met) in the form of individual talks (semi-directing interviews with evaluation of the type of existing device and its knowledge by the penitentiary staff and the prisoners; statement of the suggestions, needs and requests of the medical, penitentiary staffs and of the prisoners). In the whole visited prisons, 7.8% (870) of the prisoners received substitution treatments (6.35% by buprenorphine, 1.44% by methadone), representing a proportion of substituted drug addicts (870 substituted for an evaluation of 3,350 prisoners drug addicts among the 11,168 prisoners of the 22 visited prisons) notably lower than that in free environment (56%, ie 96,000 substituted for an evaluated population of

  15. Synthesis and Antibacterial Activity of Some New Phenothiazine Derivatives

    Directory of Open Access Journals (Sweden)

    Pawan Kumar Swarnkar

    2007-01-01

    Full Text Available A series of some new phenothiazine derivatives were synthesized with the objective for evaluation as antimicrobials. The title compounds were prepared by a five step synthesis scheme. 2-Amino-6-substituted benzothiazoles (1 on diazotization afford 6-substituted benzothiazolyl-2-diazonium chlorides (2. Reaction of 2 with cold solution of β-naphthol in dilute NaOH furnishes α-(2-diazo-6-substituted benzothiazolyl- β-sodionaphthoxides (3 which on acidification with concentrated HCl gives α-(2-diazo-6-substituted benzothiazolyl-β-naphthols (4. Reaction of 4 with p-substituted anilines gives α-(2-diazo-6-substituted benzothiazolyl-β-(p-substituted anilino naphthalenes (5. This synthesis besides by using conventional methods was also attempted using microwave. Fusion of 5 with sulphur in presence of iodine results in α-(2-diazo-6-substituted benzothiazolyl-6- substituted [2, 3-b] benzophenothiazines(6. The structures of all these compounds have been supported by elemental analysis and their spectral studies. All synthesized compounds were tested for their antibacterial activity using standard drugs.

  16. Effect of ortho-substituted aniline on the corrosion protection of aluminum in 2 mol/L H2SO4 solution

    KAUST Repository

    El-Deeb, Mohamed M.; Alshammari, Hamed M.; Abdel-Azeim, Safwat

    2017-01-01

    Corrosion protection of aluminum in 2 mol/L HSO solution is examined in the presence of ortho-substituted aniline derivatives using potentiodynamic polarization and electrochemical impedance spectroscopy measurements. Density function theory (DFT

  17. A microwave-catalyzed rapid, efficient and ecofriendly synthesis of substituted pyrazol-5-ones

    Directory of Open Access Journals (Sweden)

    RAHUL P. GAVANDE

    2003-10-01

    Full Text Available A series of 1-(3,4-dihydro-3-oxo-2H-1,4-benzoxazine-2-carbonyl-3-methyl-4-(substituted phenylhydrazono-2-pyrazolin-5-ones have been synthesized by the reaction of 2H-3,4-dihydro-3-oxo-1,4-benzoxazine-2-carboxylic acid hydrazide with substituted acetoacetic ester derivatives using acetic acid as solvent under microwave irradiation (MWI, as well as by conventional methods. The reaction rate is enhanced tremendously and the yields are improved under MWI as compared to conventional methods.

  18. 40 CFR Appendix B to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes

    Science.gov (United States)

    2010-07-01

    ... demonstrate it can be used safely in this end-use. CFC-12 Motor Vehicle Air Conditioners (Retrofit and New... Conditions Application Substitute Decision Conditions Comments CFC-12 Automobile Motor Vehicle Air... refrigerant. CFC-12 Automobile Motor Vehicle Air Conditioning (New equipment only) R-152a as a substitute for...

  19. Optimal ordering quantities for substitutable deteriorating items under joint replenishment with cost of substitution

    Science.gov (United States)

    Mishra, Vinod Kumar

    2017-09-01

    In this paper we develop an inventory model, to determine the optimal ordering quantities, for a set of two substitutable deteriorating items. In this inventory model the inventory level of both items depleted due to demands and deterioration and when an item is out of stock, its demands are partially fulfilled by the other item and all unsatisfied demand is lost. Each substituted item incurs a cost of substitution and the demands and deterioration is considered to be deterministic and constant. Items are order jointly in each ordering cycle, to take the advantages of joint replenishment. The problem is formulated and a solution procedure is developed to determine the optimal ordering quantities that minimize the total inventory cost. We provide an extensive numerical and sensitivity analysis to illustrate the effect of different parameter on the model. The key observation on the basis of numerical analysis, there is substantial improvement in the optimal total cost of the inventory model with substitution over without substitution.

  20. Derivative chameleons

    International Nuclear Information System (INIS)

    Noller, Johannes

    2012-01-01

    We consider generalized chameleon models where the conformal coupling between matter and gravitational geometries is not only a function of the chameleon field φ, but also of its derivatives via higher order co-ordinate invariants (such as ∂ μ φ∂ μ φ,□φ,...). Specifically we consider the first such non-trivial conformal factor A(φ,∂ μ φ∂ μ φ). The associated phenomenology is investigated and we show that such theories have a new generic mass-altering mechanism, potentially assisting the generation of a sufficiently large chameleon mass in dense environments. The most general effective potential is derived for such derivative chameleon setups and explicit examples are given. Interestingly this points us to the existence of a purely derivative chameleon protected by a shift symmetry for φ → φ+c. We also discuss potential ghost-like instabilities associated with mass-lifting mechanisms and find another, mass-lowering and instability-free, branch of solutions. This suggests that, barring fine-tuning, stable derivative models are in fact typically anti-chameleons that suppress the field's mass in dense environments. Furthermore we investigate modifications to the thin-shell regime and prove a no-go theorem for chameleon effects in non-conformal geometries of the disformal type

  1. Derivative chameleons

    Energy Technology Data Exchange (ETDEWEB)

    Noller, Johannes, E-mail: johannes.noller08@imperial.ac.uk [Theoretical Physics, Blackett Laboratory, Imperial College London, Prince Consort Road, London, SW7 2BZ (United Kingdom)

    2012-07-01

    We consider generalized chameleon models where the conformal coupling between matter and gravitational geometries is not only a function of the chameleon field φ, but also of its derivatives via higher order co-ordinate invariants (such as ∂{sub μ}φ∂{sup μ}φ,□φ,...). Specifically we consider the first such non-trivial conformal factor A(φ,∂{sub μ}φ∂{sup μ}φ). The associated phenomenology is investigated and we show that such theories have a new generic mass-altering mechanism, potentially assisting the generation of a sufficiently large chameleon mass in dense environments. The most general effective potential is derived for such derivative chameleon setups and explicit examples are given. Interestingly this points us to the existence of a purely derivative chameleon protected by a shift symmetry for φ → φ+c. We also discuss potential ghost-like instabilities associated with mass-lifting mechanisms and find another, mass-lowering and instability-free, branch of solutions. This suggests that, barring fine-tuning, stable derivative models are in fact typically anti-chameleons that suppress the field's mass in dense environments. Furthermore we investigate modifications to the thin-shell regime and prove a no-go theorem for chameleon effects in non-conformal geometries of the disformal type.

  2. [Contingency management in opioid substitution treatment].

    Science.gov (United States)

    Specka, M; Böning, A; Scherbaum, N

    2011-07-01

    The majority of opiate-dependent patients in substitution treatment show additional substance-related disorders. Concomitant use of heroin, alcohol, benzodiazepines or cocaine compromises treatment success. Concomitant drug use may be treated by using contingency management (CM) which is based on learning theory. In CM, abstinence from drugs, as verified by drug screenings, is reinforced directly and contingently. Reinforcers used in CM studies with substituted patients were, amongst others, vouchers and take-home privileges. Studies in the USA show a medium average effect of CM on drug consumption rates and abstinence. The effects decrease markedly after the end of the intervention. We discuss whether CM is applicable within the German substitution treatment system and how it can be combined with other interventions such as selective detoxification treatments or cognitive-behavioural programmes. © Georg Thieme Verlag KG Stuttgart · New York.

  3. Biomaterials in search of a meniscus substitute.

    Science.gov (United States)

    Rongen, Jan J; van Tienen, Tony G; van Bochove, Bas; Grijpma, Dirk W; Buma, Pieter

    2014-04-01

    The menisci fulfill key biomechanical functions in the tibiofemoral (knee) joint. Unfortunately meniscal injuries are quite common and most often treated by (partial) meniscectomy. However, some patients experience enduring symptoms, and, more importantly, it leads to an increased risk for symptomatic osteoarthritis. Over the past decades, researchers have put effort in developing a meniscal substitute able to prevent osteoarthritis and treat enduring clinical symptoms. Grossly, two categories of substitutes are observed: First, a resorbable scaffold mimicking biomechanical function which slowly degrades while tissue regeneration and organization is promoted. Second, a non resorbable, permanent implant which mimics the biomechanical function of the native meniscus. Numerous biomaterials with different (material) properties have been used in order to provide such a substitute. Nevertheless, a clinically applicable cartilage protecting material is not yet emerged. In the current review we provide an overview, and discuss, these different materials and extract recommendations regarding material properties for future developmental research. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Substitution between Cars within the Household

    DEFF Research Database (Denmark)

    de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects...... of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices...

  5. Substitute energy resource policy in Japan

    International Nuclear Information System (INIS)

    Umehara, Katsuhiko

    1980-01-01

    Japan depends 88% of energy resources and 99.8% of petroleum on imports. The solution of energy problems is now made internationally. As the means for Japan, there are the substitution of other resources for petroleum and its promotion. However, this involves the considerable funds for the development and utilization, which must be borne by the people in the form of tax. For governmental financing, a special account must be set up for the particular purpose. In the research and development of new energy resources, new institution is required. The following matters are described: petroleum shortage coming even in 1980s, the international need of substitute energy development, the need for establishing measures for substitute energy resources, acquisition of the funds, special-account governmental financing, and an institute of new energy development. (author)

  6. Substituting telecommunications for travel - Feasible or desirable

    Science.gov (United States)

    Van Vleck, E. M.

    1974-01-01

    This paper reviews recent advances in telecommunications and examines the detailed structure of travel to estimate the feasibility of substituting telecommunications for various travel objectives. The impact of travel is analyzed from a social, economic, energy, and pollution standpoint to assess the desirability of substitution. Perhaps 35-50% of the nation's travel could, in theory, be replaced by very advanced telecommunications (such as a much improved large-screen teleconferencing network), but public resistance would be massive. Much economic dislocation would result since, for example, over 25% of retail sales are travel-related. The energy savings would be modest since only 25% of the nation's energy is consumed by transportation. However, all pollution would be reduced substantially since transportation accounts for 75% of the carbon monoxide, 60% of the hydrocarbon, and 55% of the nitrogen oxide pollution in the nation. Problems related to the implementation of large-scale substitution are discussed.

  7. Electricity derivatives

    CERN Document Server

    Aïd, René

    2015-01-01

    Offering a concise but complete survey of the common features of the microstructure of electricity markets, this book describes the state of the art in the different proposed electricity price models for pricing derivatives and in the numerical methods used to price and hedge the most prominent derivatives in electricity markets, namely power plants and swings. The mathematical content of the book has intentionally been made light in order to concentrate on the main subject matter, avoiding fastidious computations. Wherever possible, the models are illustrated by diagrams. The book should allow prospective researchers in the field of electricity derivatives to focus on the actual difficulties associated with the subject. It should also offer a brief but exhaustive overview of the latest techniques used by financial engineers in energy utilities and energy trading desks.

  8. A New Substitution Cipher - Random-X

    Directory of Open Access Journals (Sweden)

    Falguni Patel

    2015-08-01

    Full Text Available Ciphers are the encryption methods to prepare the algorithm for encryption and decryption. The currently known ciphers are not strong enough to protect the data. A new substitution cipher Random-X that we introduce in this paper can be used for password encryption and data encryption. Random-X cipher is a unique substitution cipher which replaces the units of plaintext with triplets of letters. The beauty of this cipher is that the encrypted string of the same plain text is not always same. This makes it strong and difficult to crack. This paper covers the principle the implementation ideas and testing of Random-X cipher.

  9. Hydrophosphorylation of substituted alkynes by phosphonic acids

    International Nuclear Information System (INIS)

    Nifant'ev, E.F.; Solovetskaya, L.A.; Maslennikova, V.I.; Sergeev, N.M.

    1987-01-01

    Hydrophosphorylation of functionally substituted alkynes by phosphonic acids can be a convenient method for synthesis of functionally substituted mono- and diphosphine oxides. The ease of hydrophosphorylation is determined by the strength of the negative inductive effect of the substituents on the triple bond and the steric factor. The structure of the bis-adducts was confirmed by elementary analysis and the 31 P and 13 C NMR spectra. The 31 P NMR spectrum is an AB two-spin system. The values of the chemical shifts and spin-spin interaction constants 3 J/sub PP/ are in agreement with the data in the literature for similar compounds

  10. Substitution between cars within the household

    DEFF Research Database (Denmark)

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    The purpose of this paper is to study to what extent two-car households substitute the use of their less fuel efficient car by the use of their more fuel efficient car after an increase in fuel prices. Based on a simple theoretical framework we use a large sample of detailed Danish data on two-car...... households to estimate, for each car owned by the household, own and cross-price effects of increases in fuel costs per kilometer. The empirical results point at important substitution effects, so that models that estimate responses to fuel prices on the implicit or explicit assumption of one car per...

  11. Characterization and Antimicrobial Studies of Five Substituted Bis-Thioureas

    International Nuclear Information System (INIS)

    Nurulain Kamalulazmy; Sahilah Abd Mutalib; Fatin Ilyani Nasir; Nurul Izzaty Hassan

    2016-01-01

    Thioureas play an important role in medicinal chemistry and agricultures due to their biological activity such as antibacterial, antifungal, antiviral, herbicides, rodenticides, phenoloxidase enzymatic inhibitors, anti-HIV and anti-tumor agents. In this study, five substituted bis-thioureas have been synthesized. The isophthaloyl chloride and 2,6- pyridine dicarbonyl dichloride were easily converted to bis-isothiocyanate compound via the reaction with ammonium thiocyanate by solid-liquid phase transfer catalysis of polyethylene glycol-400 (PEG-400). Bis-isothiocyanate compound was reacted with aniline derivatives to produce substituted bis-thioureas in good yield at room temperature. All the novel compounds were obtained as yellow solid after recrystallization using DMF/EtOH/H_2O. Their chemical structures were confirmed by Infrared spectroscopy (IR), Nuclear Magnetic Resonance (NMR) "1H and "1"3C and mass spectrometry. The five synthesized compounds were screened for antimicrobial activities using disc diffusion method for antimicrobial activity against Gram-positive bacteria (Bacillus Subtilis and Staphylococcus Aureus), Gram-negative bacteria (Escherichia Coli and Salmonella Typhi) and a mold (Aspergillus Niger). All tested compounds showed low antimicrobial activity since the diameter of inhibition zone (IZ) measure was less than positive control inhibition zone. (author)

  12. Femtosecond transient photoluminescence of the substituted poly(diphenylacetulene)s.

    Science.gov (United States)

    Piskun, N. V.; Wang, D. K.; Lim, H.; Epstein, A. J.; Vanwoerkom, L. D.; Gustafson, T. L.

    2000-03-01

    We present the results of a femtosecond transient photoluminescence (PL) study of solutions of two derivatives of substituted poly(diphenylacetylene) using an up-conversion technique. n-Butyl (nBu) and p-carbazole (Cz) substituted poly(diphenylacetylene), PDPA-nBu and PDPA-Cz respectively, have band gaps determined by maxima in the slope of absorption vs. energy of 2.75 eV and 2.63 eV. The steady state emission peaks are at 2.4 eV for PDPA-nBu and at 2.3 eV for PDPA-Cz respectively. The PL peak for PDPA-Cz is red shifted in comparison to the PL peak for PDPA-nBu. Roles of phenyl groups, electron donating effect of the carbazole side units and planarity of the backbone are discussed. Exciting at 3.1 eV, the fs PL shows a faster decay for PDPA-Cz than that for PDPA-nBu, in accord with the decrease of PL quantum efficiency of PDPA-Cz. The 200 fs - 80 ps PL(t) agrees with ~1 ns lifetime. The PDPA-Cz has larger red shift in the 0.2-20 ps time frame. The origin of that shift will be discussed. This work is supported in part by ONR.

  13. Substituting freshwater: Can ocean desalination and water recycling capacities substitute for groundwater depletion in California?

    Science.gov (United States)

    Badiuzzaman, Pierre; McLaughlin, Eoin; McCauley, Darren

    2017-12-01

    While the sustainability of resource depletion is a longstanding environmental concern, wider attention has recently been given to growing water scarcity and groundwater depletion. This study seeks to test the substitutability assumption embedded in weak sustainability indicators using a case study of Californian water supply. The volume of groundwater depletion is used as a proxy for unsustainable water consumption, and defined by synthesising existing research estimates into low, medium and high depletion baselines. These are compared against projected water supply increases from ocean desalination and water recycling by 2035, to determine whether new, drought-proof water sources can substitute for currently unsustainable groundwater consumption. Results show that the maximum projected supply of new water, 2.47 million acre-feet per year (MAF/yr), is sufficient to meet low depletion estimates of 2.02 MAF/yr, but fails to come near the high depletion estimate of 3.44 MAF/yr. This does not necessarily indicate physical limitations of substitutability, but more so socio-economic limitations influenced by high comparative costs. By including capacities in demand-substitutability via urban water conservation, maximum predicted capacities reach 5.57 MAF/yr, indicating wide room for substitution. Based on these results, investment in social and institutional capital is an important factor to enhance demand-side substitutability of water and other natural resources, which has been somewhat neglected by the literature on the substitutability of natural resources. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. P. Electricity demand, substitution and resources

    International Nuclear Information System (INIS)

    1976-01-01

    This report discusses the demand for electricity in New Zealand, the accuracy of demand predictions, and whether some other form of energy could be substituted for electricity. It then discusses past and possible future electricity generation in New Zealand by geothermal steam and hydro power and the resources of gas and coal that could be made available for electricity generation

  15. Endogenous cueing attenuates object substitution masking.

    Science.gov (United States)

    Germeys, Filip; Pomianowska, I; De Graef, P; Zaenen, P; Verfaillie, K

    2010-07-01

    Object substitution masking (OSM) is a form of visual masking in which a briefly presented target surrounded by four small dots is masked by the continuing presence of the four dots after target offset. A major parameter in the prediction of OSM is the time required for attention to be directed to the target following its onset. Object substitution theory (Di Lollo et al. in J Exp Psychol Gen 129:481-507, 2000) predicts that the sooner attention can be focused at the target's location, the less masking will ensue. However, recently Luiga and Bachmann (Psychol Res 71:634-640, 2007) presented evidence that precueing of attention to the target location prior to target-plus-mask onset by means of a central (endogenous) arrow cue does not reduce OSM. When attention was cued exogenously, OSM was attenuated. Based on these results, Luiga and Bachmann argued that object substitution theory should be adapted by differentiating the ways of directing attention to the target location. The goal of the present study was to further examine the dissociation between the effects of endogenous and exogenous precueing on OSM. Contrary to Luiga and Bachmann, our results show that prior shifts of attention to the target location initiated by both exogenous and endogenous cues reduce OSM as predicted by object substitution theory and its computational model CMOS.

  16. Substitute fluid examinations for liquid manure

    Directory of Open Access Journals (Sweden)

    Schrader Kevin

    2017-01-01

    Full Text Available For the farming industry it is essential to use liquid manure as natural fertilizer. Through new agricultural regulation 2015 in Germany the industry must develop new liquid manure spreader systems because the ammonia and methane emission are limited. In a research project the University of Applied Sciences Zwickau and some other industry partners will develop such a new innovative liquid manure spreader. The new liquid manure spreader should use pulsating air to distribute the liquid manure exactly. The pulsating air, which flows through the pipelines, should be analysed at a test station. For examinations at this test station it is important to find another substitute fluid because liquid manure smells strong, is not transparent and is also not homogeneous enough for scientific investigations. Furthermore it is important to ensure that the substitute fluid is, like liquid manure, a non-Newtonian fluid. The substitute fluid must be a shear-thinning substance - this means the viscosity decrease at higher shear rate. Many different samples like soap-water-farragoes, jelly-water-farragoes, agar-water-farragoes, soap-ethanol-farragoes and more are, for the project, examined in regard of their physical properties to find the best substitute fluid. The samples are examined at the rotational viscometer for viscosity at various shear rates and then compared with the viscosity values of liquid manure.

  17. Substitute fluid examinations for liquid manure

    Science.gov (United States)

    Schrader, Kevin; Riedel, Marco; Eichert, Helmut

    For the farming industry it is essential to use liquid manure as natural fertilizer. Through new agricultural regulation 2015 in Germany the industry must develop new liquid manure spreader systems because the ammonia and methane emission are limited. In a research project the University of Applied Sciences Zwickau and some other industry partners will develop such a new innovative liquid manure spreader. The new liquid manure spreader should use pulsating air to distribute the liquid manure exactly. The pulsating air, which flows through the pipelines, should be analysed at a test station. For examinations at this test station it is important to find another substitute fluid because liquid manure smells strong, is not transparent and is also not homogeneous enough for scientific investigations. Furthermore it is important to ensure that the substitute fluid is, like liquid manure, a non-Newtonian fluid. The substitute fluid must be a shear-thinning substance - this means the viscosity decrease at higher shear rate. Many different samples like soap-water-farragoes, jelly-water-farragoes, agar-water-farragoes, soap-ethanol-farragoes and more are, for the project, examined in regard of their physical properties to find the best substitute fluid. The samples are examined at the rotational viscometer for viscosity at various shear rates and then compared with the viscosity values of liquid manure.

  18. Trace maps for arbitrary substitution sequences

    International Nuclear Information System (INIS)

    Avishai, Y.

    1993-01-01

    The discovery of quasi-crystals and their 1-dimensional modeling have led to a deep mathematical study of Schroedinger operators with an arbitrary deterministic potential sequence. In this work we address this problem and find trace maps for an arbitrary substitution sequence. our trace maps have lower dimensionality than those of Kolar and Nori, which make them quite attractive for actual applications. (authors)

  19. Fossil Fuels, Backstop Technologies, and Imperfect Substitution

    NARCIS (Netherlands)

    van der Meijden, G.C.; Pittel, Karen; van der Ploeg, Frederick; Withagen, Cees

    2014-01-01

    This chapter studies the transition from fossil fuels to backstop technologies in a general equilibrium model in which growth is driven by research and development. The analysis generalizes the existing literature by allowing for imperfect substitution between fossil fuels and the new energy

  20. 3-Substituted 2-phenyl-indoles

    DEFF Research Database (Denmark)

    Johansson, Karl Henrik; Jørgensen, T.B.; Gloriam, D.E.

    2013-01-01

    -indoles with a variety of substituents at the indole 3-position. Herein we describe the development of optimised and efficient synthetic routes to a series of new 2-phenyl-indole building blocks 3 to 9 and show that these can be used to generate a broad variety of 3-substituted 2-phenyl-indoles of interest to medicinal...

  1. Law of substitution for mixed arrays

    International Nuclear Information System (INIS)

    Koudelka, A.J.

    1987-01-01

    The nuclear safety justification of a mixed array of dissimilar fissile units of metal units and dilute solution units, according to Clayton, has been a persistent and nagging problem. Dissimilar uranium metal or dissimilar uranium solution units in a mixed array can also create a modeling nightmare for the nuclear criticality safety engineer. Now, a calculational method known as the Law of Substitution has been developed to ensure that the k/sub eff/ of an array of uranium metal and uranium solution units will satisfy any k/sub eff/ limit set by the nuclear safety engineer. The nuclear criticality safety engineer can utilize the Law of Substitution to safely mix or substitute different uranium metal units, different uranium solution units, and more importantly, uranium metal and dilute UO 2 solution units in an array. The Law of Substitution is as follows: (1) calculate the k/sub eff/ of each unit type in its own infinite planar array. (2) Determine the edge-to-edge spacing of the infinite planar array of each type of unit to satisfy a desired k/sub eff/. (3) Select the largest edge-to-edge spacing from among the similar units in their infinite planar arrays and use that spacing for the finite or infinite planar array of mixed units

  2. Thermal stability of 4-substituted benzenediazonium tetrafluoroborates

    International Nuclear Information System (INIS)

    Bruner, V.Ya.

    1990-01-01

    Heating of tetraborates of 4-methyl-, 4-phenyl- and 4-dimethylaminobenzenediazonium at 95, 120 and 148 deg, correspondingly, causes their autocatalytic destruction, two moles of gas (nitrogen, boron fluoride) being liberated. The thermal stability of 4-substituted benzenediazonium tetrafluoroborates increases with the increase of the electron-donor activity of the substituent at benzene ring

  3. complexes based on meso-substituted dipyrrins

    Indian Academy of Sciences (India)

    Keywords. Coordination polymers; meso-substituted dipyrrins; heteroleptic; acetylacetonato; ... Room temperature magnetic susceptibility measurements were ... After cooling to ambient tem- perature it ... crystals of 1 were obtained from CH2Cl2/ hexane (1. : 1) solution. .... are air-stable, crystalline solids, soluble in common.

  4. Symptomatic hemorrhagic complications associated with dural substitutes

    Directory of Open Access Journals (Sweden)

    Po-Yuan Chen

    2018-01-01

    Conclusion: The increased risk of hemorrhagic complications associated with craniotomy is modified by choice of dural replacement. Our results could assist clinicians in their decision-making with respect to the optimal timing for synthetic dural substitutes in patients with tumor infiltration of the patient's dura, severe brain swelling in traumatic brain injury, or a result of shrinkage from exposure and electrocautery.

  5. Stochastic diffusion models for substitutable technological innovations

    NARCIS (Netherlands)

    Wang, L.; Hu, B.; Yu, X.

    2004-01-01

    Based on the analysis of firms' stochastic adoption behaviour, this paper first points out the necessity to build more practical stochastic models. And then, stochastic evolutionary models are built for substitutable innovation diffusion system. Finally, through the computer simulation of the

  6. Ultrasound Promoted Synthesis of Bis(substituted pyrazol-4-ylcarbonyl-Substituted Thioureas

    Directory of Open Access Journals (Sweden)

    Li Xiao

    2009-03-01

    Full Text Available A series of novel bis(substituted pyrazol-4-ylcarbonyl-substituted thioureas have been synthesized by the reactions of substituted pyrazol-4-ylcarbonyl isothiocyanates with different diamines under ultrasound irradiation and classical heating method at 20-25 °C. In general, substantial improvement in rates and modest yields increases were observed when reactions were carried out under sonication, compared with the classical heating method. The structures of these compounds have been elucidated by elemental and spectral (IR, 1H-NMR analysis.

  7. Generation time, life history and the substitution rate of neutral mutations.

    Science.gov (United States)

    Lehtonen, Jussi; Lanfear, Robert

    2014-11-01

    Our understanding of molecular evolution is hampered by a lack of quantitative predictions about how life-history (LH) traits should correlate with substitution rates. Comparative studies have shown that neutral substitution rates vary substantially between species, and evidence shows that much of this diversity is associated with variation in LH traits. However, while these studies often agree, some unexplained and contradictory results have emerged. Explaining these results is difficult without a clear theoretical understanding of the problem. In this study, we derive predictions for the relationships between LH traits and substitution rates in iteroparous species by using demographic theory to relate commonly measured life-history traits to genetic generation time, and by implication to neutral substitution rates. This provides some surprisingly simple explanations for otherwise confusing patterns, such as the association between fecundity and substitution rates. The same framework can be applied to more complex life histories if full life-tables are available. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  8. Tuning the NLO properties of polymethineimine chains by chemical substitution

    International Nuclear Information System (INIS)

    Medved’, Miroslav; Jacquemin, Denis

    2013-01-01

    Highlights: ► Properties of the most stable isomers of polymethineimine (PMI) are investigated. ► 2nd order NLO properties of experimentally known PMI derivatives are determined. ► Structure-property relationships are unraveled for several series of oligomers. ► Performance of long-range corrected DFT methods is assessed. - Abstract: Structure and molecular electronic properties including dipole moment, polarizability and first hyperpolarizability of polymethineimine (PMI) oligomers (up to hexadecamers) and its experimentally known amino-, methyl-, and cyano-derivatives are investigated using several ab initio methods (HF, MP2 and DFT). It is shown that side-chain substitutions have significant effects both on the structure and molecular properties of PMI chains. Depending on the substitution, two types of structures have been identified. The first is characterized by a bent skeleton and encompasses PMI, polyacetonitrile (PAcN), and polycyanonitrile (PCN). The second, represented by polyaminonitrile (PAN), remains quasi-linear with the plane of the unit cell (UC) only slightly rotating around the longitudinal molecular axis. These structural differences are also reflected in molecular properties; while in case of PMI, PAcN, and PCN the longitudinal component of properties (reduced per UC) reaches its maximum value for medium-size oligomers and then decreases for longer chains, the linear and nonlinear properties of PAN steadily increase towards the polymeric limit. In addition, we have assessed the performances of long-range corrected DFT functionals (LR-DFT), namely LC-BLYP, CAM-B3LYP, and ωB97X within the present framework: they provide results in qualitative agreement with MP2, a success not reached with B3LYP

  9. Association of Dietary Proportions of Macronutrients with Visceral Adiposity Index: Non-Substitution and Iso-Energetic Substitution Models in a Prospective Study.

    Science.gov (United States)

    Moslehi, Nazanin; Ehsani, Behnaz; Mirmiran, Parvin; Hojjat, Parvane; Azizi, Fereidoun

    2015-10-26

    We aimed to investigate associations between dietary macronutrient proportions and prospective visceral adiposity index changes (ΔVAI). The study included 1254 adults (18-74 years), from the Tehran Lipid and Glucose Study (TLGS), who were followed for three years. Dietary intakes were assessed twice using food frequency questionnaires. Associations of dietary macronutrient with ΔVAI and risk of visceral adiposity dysfunction (VAD) after three years were investigated. The percentage of energy intake from protein in the total population, and from fat in women, were associated with higher increases in VAI. A 5% higher energy intake from protein substituted for carbohydrate, monounsaturated fatty acids (MUFAs), and polyunsaturated fatty acids (PUFAs) was associated with higher ΔVAI. Higher energy intake from animal protein substituted for PUFAs was positively associated with ΔVAI. Substituting protein and PUFAs with MUFAs were related to higher ΔVAI. The associations were similar in men and women, but reached significance mostly among women. Risk of VAD was increased when 1% of energy from protein was replaced with MUFAs. Substituting protein for carbohydrate and fat, and fat for carbohydrate, resulted in increased risk of VAD in women. Higher dietary proportions of protein and animal-derived MUFA may be positively associated with ΔVAI and risk of VAD.

  10. Meso-ester and carboxylic acid substituted BODIPYs with far-red and near-infrared emission for bioimaging applications

    KAUST Repository

    Ni, Yong

    2014-01-21

    A series of meso-ester-substituted BODIPY derivatives 1-6 are synthesized and characterized. In particular, dyes functionalized with oligo(ethylene glycol) ether styryl or naphthalene vinylene groups at the α positions of the BODIPY core (3-6) become partially soluble in water, and their absorptions and emissions are located in the far-red or near-infrared region. Three synthetic approaches are attempted to access the meso-carboxylic acid (COOH)-substituted BODIPYs 7 and 8 from the meso-ester-substituted BODIPYs. Two feasible synthetic routes are developed successfully, including one short route with only three steps. The meso-COOH-substituted BODIPY 7 is completely soluble in pure water, and its fluorescence maximum reaches around 650 nm with a fluorescence quantum yield of up to 15 %. Time-dependent density functional theory calculations are conducted to understand the structure-optical properties relationship, and it is revealed that the Stokes shift is dependent mainly on the geometric change from the ground state to the first excited singlet state. Furthermore, cell staining tests demonstrate that the meso-ester-substituted BODIPYs (1 and 3-6) and one of the meso-COOH-substituted BODIPYs (8) are very membrane-permeable. These features make these meso-ester- and meso-COOH-substituted BODIPY dyes attractive for bioimaging and biolabeling applications in living cells. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Synthesis, antimicrobial, and antiproliferative activities of substituted phenylfuranylnicotinamidines

    Directory of Open Access Journals (Sweden)

    Youssef MM

    2016-03-01

    Full Text Available Magdy M Youssef,1,2 Reem K Arafa,3,4 Mohamed A Ismail1,21Department of Chemistry, College of Science, King Faisal University, Hofuf, Saudi Arabia; 2Department of Chemistry, Faculty of Science, Mansoura University, Mansoura, 3Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University, Cairo, 4Biomedical Sciences Program, University of Science and Technology, Zewail City of Science and Technology, Cairo, EgyptAbstract: This research work deals with the design and synthesis of a series of substituted phenylfuranylnicotinamidines 4a–i. Facile preparation of the target compounds was achieved by Suzuki coupling-based synthesis of the nitrile precursors 3a–i, followed by their conversion to the corresponding nicotinamidines 4a–i utilizing LiN(TMS2. The antimicrobial activities of the newly synthesized nicotinamidine derivatives were evaluated against the Gram-negative bacterial strains Escherichia coli and Pseudomonas aeruginosa as well as the Gram-positive bacterial strains Staphylococcus aureus and Bacillus megaterium. The minimum inhibitory concentration values of nicotinamidines against all tested microorganisms were in the range of 10–20 µM. In specific, compounds 4a and 4b showed excellent minimum inhibitory concentration values of 10 µM against Staphylococcus aureus bacterial strain and were similar to ampicillin as an antibacterial reference. On the other hand, selected nicotinamidine derivatives were biologically screened for their cytotoxic activities against a panel of 60 cell lines representing nine types of human cancer at a single high dose at National Cancer Institute, Bethesda, MD, USA. Nicotinamidines showing promising activities were further assessed in a five-dose screening assay to determine their compound concentration causing 50% growth inhibition of tested cell (GI50, compound concentration causing 100% growth inhibition of tested cell (TGI, and compound concentration causing 50% lethality of tested

  12. Substitution of wastes for fuels and raw materials in high-temperature processes; Substitution von Brennstoffen und Rohstoffen durch Abfaelle in Hochtemperaturprozessen

    Energy Technology Data Exchange (ETDEWEB)

    Scholz, R. [Technische Univ. Clausthal, Clausthal-Zellerfeld (Germany). Inst. fuer Energieverfahrenstechnik; Beckmann, M. [Clausthaler Umwelttechnik-Institut GmbH (CUTEC), Clausthal-Zellerfeld (Germany)

    1998-09-01

    The physical recycling and energy conversion of wastes has for a long time been a topic of discussion. Some of the most interesting questions in this connection concern specific applications such as the co-combustion of sewage sludge in power plants, substitution of plastic wastes for primary fuels in burning processes in the cement industry etc. This paper also undertakes a comparative study of different applications, giving additional consideration to the state of the art in thermal waste treatment. Different processes can of course only be compared by taking the entirety of expenditures on additives and auxiliary energy into account and assuming equal side constraints for all processes. A further requirement is that the waste materials` specific properties that are relevant to the application in question have to be taken into account. This concerns in particular the effects of the substitution of waste-derived fuels (secondary fuels) for primary fuels on, for example, heat transfer conditions during the combustion process, flow conditions, and the resultant temperature distribution, transport of feedstock, and specific energy expenditure. Secondary fuels must be suited for substitution in various respects, e.g. in their material properties, and their combustion and thermal behaviour. The present paper deals in particular with the requirements on wastes as substitutes for primary fuels with regard to combustion and thermal behaviour. For this purpose it briefly discusses some important aspects of heat transfer in firing plants and industrial furnaces. An important criterion in assessing fuel substitution is the energy exchange ratio, which expresses value of the substitute fuel relative to that of the primary fuel and should be duly considered when making comparative studies. Focussing on aspects of process engineering the paper also deals exemplarily with the influence of fuel substitution on, e.g. furnace temperature, exhaust gas quantities etc. in clinker

  13. Currency Substitution and Inflation in Peru Currency Substitution and Inflation in Peru

    OpenAIRE

    Liliana Rojas-Suarez

    1992-01-01

    This paper shows that there is a long-run relationship between the expected rate of depreciation in the black-market-exchange rate and the ratio of domestic to foreign money in Peru: that is, the hypothesis of currency substitution can explain the behavior of real holdings of money in Peru. The paper also shows that, while, the importance of currency substitution as a transmission mechanism through which domestic policies affected the dynamics of inflation was relatively small during a period...

  14. Substitution treatment for opioid addicts in Germany

    Directory of Open Access Journals (Sweden)

    Gerlach Ralf

    2007-02-01

    Full Text Available Abstract Background After a long and controversial debate methadone maintenance treatment (MMT was first introduced in Germany in 1987. The number of patients in MMT – first low because of strict admission criteria – increased considerably since the 1990s up to some 65,000 at the end of 2006. In Germany each general practitioner (GP, who has completed an additional training in addiction medicine, is allowed to prescribe substitution drugs to opioid dependent patients. Currently 2,700 GPs prescribe substitution drugs. Psychosocial care should be made available to all MMT patients. Results The results of research studies and practical experiences clearly indicate that patients benefit substantially from MMT with improvements in physical and psychological health. MMT proves successful in attaining high retention rates (65 % to 85 % in the first years, up to 50 % after more than seven years and plays a major role in accessing and maintaining ongoing medical treatment for HIV and hepatitis. MMT is also seen as a vital factor in the process of social re-integration and it contributes to the reduction of drug related harms such as mortality and morbidity and to the prevention of infectious diseases. Some 10 % of MMT patients become drug-free in the long run. Methadone is the most commonly prescribed substitution medication in Germany, although buprenorphine is attaining rising importance. Access to MMT in rural areas is very patchy and still constitutes a problem. There are only few employment opportunities for patients participating in MMT, although regular employment is considered unanimously as a positive factor of treatment success. Substitution treatment in German prisons is heterogeneous in access and treatment modalities. Access is very patchy and the number of inmates in treatment is limited. Nevertheless, substitution treatment plays a substantial part in the health care system provided to drug users in Germany. Conclusion In Germany, a

  15. Substitution treatment for opioid addicts in Germany.

    Science.gov (United States)

    Michels, Ingo Ilja; Stöver, Heino; Gerlach, Ralf

    2007-02-02

    After a long and controversial debate methadone maintenance treatment (MMT) was first introduced in Germany in 1987. The number of patients in MMT--first low because of strict admission criteria--increased considerably since the 1990s up to some 65,000 at the end of 2006. In Germany each general practitioner (GP), who has completed an additional training in addiction medicine, is allowed to prescribe substitution drugs to opioid dependent patients. Currently 2,700 GPs prescribe substitution drugs. Psychosocial care should be made available to all MMT patients. The results of research studies and practical experiences clearly indicate that patients benefit substantially from MMT with improvements in physical and psychological health. MMT proves successful in attaining high retention rates (65% to 85% in the first years, up to 50% after more than seven years) and plays a major role in accessing and maintaining ongoing medical treatment for HIV and hepatitis. MMT is also seen as a vital factor in the process of social re-integration and it contributes to the reduction of drug related harms such as mortality and morbidity and to the prevention of infectious diseases. Some 10% of MMT patients become drug-free in the long run. Methadone is the most commonly prescribed substitution medication in Germany, although buprenorphine is attaining rising importance. Access to MMT in rural areas is very patchy and still constitutes a problem. There are only few employment opportunities for patients participating in MMT, although regular employment is considered unanimously as a positive factor of treatment success. Substitution treatment in German prisons is heterogeneous in access and treatment modalities. Access is very patchy and the number of inmates in treatment is limited. Nevertheless, substitution treatment plays a substantial part in the health care system provided to drug users in Germany. In Germany, a history of substitution treatment spanning 20 years has meanwhile

  16. [The substitution effect of leadership substitutes for transformational leadership in nursing organization].

    Science.gov (United States)

    Kim, Jeong-Hee

    2006-04-01

    This paper was conducted to examine the effects of transformational leadership behaviors, within the substitutes for leadership model (Kerr & Jermier, 1978). Data was collected from 181 staff nurses in 3 general hospitals, with self-reporting questionnaires (MLQ developed by Bass, rd-SLS developed by Podsakoff, et al., and MSQ developed by Weiss, et al.). Descriptive statistics, factor analysis, Cronbach's alpha and moderated regression analysis were used. 1) The transformational leader behaviors and substitutes for leadership each had correlations with job satisfaction. 2) The total amount of variance accounted for by the substitutes for leadership was substantially greater than by the transformational leadership behaviors. 3) Few of the substitutes variables moderated the relationships between the transformational leader behaviors and job satisfaction in a manner consistent with that specified by Howell, Dorfman, and Kerr (1986). The finding of this study suggest that leaders need to have a better understanding of those contextual variables that influence job satisfaction. Thus future research should focus attention on the moderating effects of substitutes, as well as the things that leaders can do to influence them. In addition, it may be good to examine the effects of substitutes on other criterion variables.

  17. A DFT study of solvation effects and NBO analysis on the tautomerism of 1-substituted hydantoin

    Directory of Open Access Journals (Sweden)

    Meisam Shabanian

    2016-09-01

    Full Text Available 1-Substituted hydantoins (1-SH have been known as a benefit intermediate for producing agricultural and pharmaceuticals. The effect of solvent polarity on the tautomeric equilibria of 1-substituted hydantoin ring is studied by the density functional theory calculation (B3LYP/6–31++G(d,p level for predominant tautomeric forms of hydantoin derivatives (1-NO2, 1-CF3, 1-Br, 1-H, 1-CHCH2, 1-OH, 1-CH3 in the gas phase and selected solvents (benzene (non-polar solvent, tetrahydrofuran (THF (polar aprotic solvent and water (protic solvent. For electron withdrawing and releasing derivatives in the gas phase and solution Hy1 forms is more stable and dominant form. In addition variation of dipole moments and charges on atoms in the solvents are studied.

  18. Synthesis, Characterization, Antimicrobial Screening and Free-Radical Scavenging Activity of Some Novel Substituted Pyrazoles

    Directory of Open Access Journals (Sweden)

    Nagwa Mohamed Mahrous Hamada

    2015-06-01

    Full Text Available The present work deals with the synthesis of acetoxysulfonamide pyrazole derivatives, substituted 4,5-dihydropyrazole-1-carbothioamide and 4,5-dihydropyrazole-1-isonicotinoyl derivatives starting from substituted vanillin chalcones. Acetoxysulfonamide pyrazole derivatives were prepared from the reaction of chalcones with p-sulfamylphenylhydrazine followed by treatment with acetic anhydride. At the same time 4,5-dihydropyrazole-1-carbothioamide and 4,5-dihydropyrazole-1-isonicotinoyl derivatives were prepared from the reaction of chalcones with either thiosemicarbazide or isonicotinic acid hydrazide, respectively. The synthesized compounds were structurally characterized on the basis of IR, 1H-NMR, 13C-NMR spectral data and microanalyses. All of the newly isolated compounds were tested for their antimicrobial activities. The antimicrobial screening using the agar well-diffusion method revealed that the chloro derivatives are the most active ones. Moreover, the antioxidant and anti-inflammatory activity of these chloro derivatives are also studied using the DPPH radical scavenging and NO radical scavenging methods, respectively.

  19. SUBSTITUTION OF CADMIUM CYANIDE ELECTROPLATING WITH ZINC CHLORIDE ELECTROPLATING

    Science.gov (United States)

    The study evaluated the zinc chloride electroplating process as a substitute for cadmium cyanide electroplating in the manufacture of industrial connectors and fittings at Aeroquip Corporation. The process substitution eliminates certain wastes, specifically cadmium and cyanide, ...

  20. One-pot sequential synthesis of O-(halo-substituted benzyl hydroxylammonium salts

    Directory of Open Access Journals (Sweden)

    Saeed Emami

    2017-02-01

    Full Text Available In this study, we described a simple one-pot preparation of O-(halo-substituted benzyl hydroxylamine derivatives by O-benzylation of N-hydroxyurethane, followed by basic N-deprotection. The advantages of the method were the chemo- and regio-selectivity in obtaining the desired O-benzyl hydroxylammonium salts in a high yield as well as the simplicity of the purification process.

  1. Highly enantio- and diastereoselective reactions of γ-substituted butenolides through direct vinylogous conjugate additions

    KAUST Repository

    Zhang, Wen; Tan, Davin; Lee, Richmond; Tong, Guanghu; Chen, Wenchao; Qi, Baojian; Huang, Kuo-Wei; Tan, Choonhong; Jiang, Zhiyong

    2012-01-01

    The strength of the weak: An L-tert-leucine-derived amine-thiourea catalyst (see scheme, green box) promotes the asymmetric vinylogous conjugate addition reaction between γ-aryl- and alkyl-substituted butenolides with the butenamides and enoates shown. Computational studies show the preference for the observed stereochemistry is a result of favourable weak non-bonding interactions, which stabilize the transition state. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Acid catalyzed solvent free synthesis of new 1-acyl-4-benzhydryl substituted pyrazoles

    International Nuclear Information System (INIS)

    Sher, M.; Kausar, T.; Riaz, N.; Sharif, A.

    2016-01-01

    A convenient, cost effective and environmentally benign methodology has been developed, which delivered fourteen new 1-acyl-4-benzhyrdyl substituted pyrazole derivatives under solvent free conditions. Target compounds were synthesized in good to excellent yields simply by grinding reactants in a pestle and mortar with catalytic amount of conc. H/sub 2/SO/sub 4/. All the newly formed compounds were fully characterized with the help of detailed spectroscopic techniques including FTIR, NMR and GC-MS. (author)

  3. Highly enantio- and diastereoselective reactions of γ-substituted butenolides through direct vinylogous conjugate additions

    KAUST Repository

    Zhang, Wen

    2012-09-05

    The strength of the weak: An L-tert-leucine-derived amine-thiourea catalyst (see scheme, green box) promotes the asymmetric vinylogous conjugate addition reaction between γ-aryl- and alkyl-substituted butenolides with the butenamides and enoates shown. Computational studies show the preference for the observed stereochemistry is a result of favourable weak non-bonding interactions, which stabilize the transition state. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Consequence of patient substitution of nattokinase for warfarin after aortic valve replacement with a mechanical prosthesis

    OpenAIRE

    Elahi, Maqsood M.; Choi, Charles H.; Konda, Subbareddy; Shake, Jay G.

    2015-01-01

    This report describes a patient's self-substitution of nattokinase for the vitamin K antagonist warfarin after aortic valve replacement with a mechanical prosthesis. Nattokinase is an enzyme derived from a popular fermented soybean preparation in Japan (natto), which has fibrinolytic properties and is gaining popularity in nontraditional health journals and nonmedical health websites as an over-the-counter thrombolytic. After nearly a year of use of nattokinase without warfarin, the patient d...

  5. 4-Substituted-2-Methoxyphenol: Suitable Building Block to Prepare New Bioactive Natural-like Hydroxylated Biphenyls.

    Science.gov (United States)

    Dettori, Maria Antonietta; Fabbri, Davide; Pisano, Marina; Rozzo, Carla; Palmieri, Giuseppe; Dess, Alessandro; Dallocchio, Roberto; Delogu, Giovanna

    2015-02-01

    A small collection of eugenol- and curcumin-analog hydroxylated biphenyls was prepared by straightforward methods starting from natural 4-substituted-2-methoxyphenols and their antitumoral activity was evaluated in vitro . Two curcumin-biphenyl derivatives showed interesting growth inhibitory activities on different malignant melanoma cell lines with IC 50 ranging from 13 to 1 µM. Preliminary molecular modeling studies were carried out to evaluate conformations and dihedral angles suitable for antiproliferative activity in hydroxylated biphenyls bearing a side aliphatic chain.

  6. "Customizable" units in di- and tripeptides: selective conversion into substituted dehydroamino acids.

    Science.gov (United States)

    Saavedra, Carlos J; Boto, Alicia; Hernández, Rosendo

    2012-07-20

    The selective conversion of serine or threonine units of di- and tripeptides into substituted dehydroamino acids is reported. Thus, these common α-amino acids undergo a scission-phosphorylation process to give α-amino phosphonate residues. A Horner-Wadsworth-Emmons reaction with aldehydes or ketones follows to afford the final products with excellent Z-stereoselectivity (Z:E > 98:2). In this way, a single peptide precursor can selectively be transformed into a variety of derivatives.

  7. Synthesis, Reactivity and Stability of Aryl Halide Protecting Groups towards Di-Substituted Pyridines

    Directory of Open Access Journals (Sweden)

    Ptoton Mnangat Brian

    2016-03-01

    Full Text Available This paper reports the synthesis and reactivity of different Benzyl derivative protecting groups. The synthesis and stability of Benzyl halides, 4-methoxybenzyl halides, 3,5-dimethoxybenzyl halides, 3,4-dimethoxybenzyl halides, 3,4,5-trimethoxybenzyl halide protecting groups and their reactivity towards nitrogen atom of a di-substituted pyridine ring in formation of pyridinium salts is also reported.

  8. Characterization of hydroxyapatite substituted with silicon

    International Nuclear Information System (INIS)

    Silva, H.M. da; Soares, G.A.; Mateescu, M.; Anselme, K.; Palard, M.; Champion, E.

    2009-01-01

    Incorporation of silicon (Si) ions into hydroxyapatite structure (HA) influences on physical, chemical and physiological properties. Some studies reported the improved bioactivity Si substitution, and it also accelerates the biomineralization process. The main objective of this work is to characterize stoichiometric hydroxyapatite and hydroxyapatite substituted with 1.13% in weight of Si (SiHA) using a wet precipitation method followed by a heat treatment. SEM/EDS, AFM, DRX and FTIR analyses were used to characterize the samples. EDS and FTIR results confirmed the presence of Si. Silicon induces small changes on crystal structure of HA, not detected on X-ray diffraction patterns of sintered tablets of SiHA and HA. No secondary phases were observed, that indicates the Si had entered the HA lattice. (author)

  9. Unemployment, Factor Substitution, and Capital Formation

    OpenAIRE

    Leo Kaas; Leopold von Thadden

    2001-01-01

    We incorporate a wage bargaining structure in a dynamic general equilibrium model and show how this feature changes short and long-run properties of equilibria compared with a perfectly competitive setting. We discuss how employment, capital, and income shares respond to wage setting shocks and show that adjustment dynamics depend decisively on the magnitude of the elasticity of substitution between labour and capital. Values of the elasticity below unity add persistence, tend to preserve sta...

  10. Mindfulness as substitute for transformational leadership

    OpenAIRE

    Kroon, B.; van Woerkom, M.; Menting, Charlotte

    2017-01-01

    Purpose Transformational leaders spark the intrinsic motivation of employees, thereby stimulating their extra-role performance. However, not all employees are lucky enough to have a transformational leader. The purpose of this paper is to investigate to what extent mindfulness can function as a substitute for transformational leadership. By being attentive to and aware of what is taking place in the present, mindfulness provides employees with a source of intrinsic motivation that lies within...

  11. Substitution biases in price indices during transition

    Czech Academy of Sciences Publication Activity Database

    Hanousek, Jan; Filer, Randall K.

    2004-01-01

    Roč. 21, č. 2 (2004), s. 167-177 ISSN 0167-8000 R&D Projects: GA MŠk ME 595 Institutional research plan: CEZ:AV0Z7085904 Keywords : price liberalization * substitution bias * transition economies Subject RIV: AH - Economics http://search. ebscohost .com/login.aspx?direct=true&db=a9h&AN=17109091&site=ehost-live

  12. Interfuel substitution in the United States

    Energy Technology Data Exchange (ETDEWEB)

    Serletis, Apostolos; Vasetsky, Olexandr [Department of Economics, University of Calgary, Calgary, Alberta (Canada); Timilsina, Govinda R. [Development Research Group, The World Bank, 1818 H Street N.W., Washington, DC 20433 (United States)

    2010-05-15

    In this paper, we use the locally flexible translog functional form to investigate the demand for energy and interfuel substitution in the United States and to provide a comparison of our results with most of the existing empirical energy demand literature. Motivated by the widespread practice of ignoring theoretical regularity, we follow Barnett's (2002) suggestions and estimate the model subject to theoretical regularity, using methods developed by Diewert and Wales (1987) and Ryan and Wales (2000), in an attempt to produce inference consistent with neoclassical microeconomic theory. Moreover, we use the most recent data, published by the U.S. Energy Information Administration (EIA), and in addition to investigating interfuel substitution possibilities in total U.S. energy demand, we follow Serletis et al. (2009) and also examine interfuel substitution possibilities in energy demand by sector. Moreover, we test for weak separability, with the objective of discovering the structure of the functional form in total energy demand as well as energy demand by sector. (author)

  13. 40 CFR 721.4596 - Diazo substituted carbomonocyclic metal complex.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Diazo substituted carbomonocyclic... Specific Chemical Substances § 721.4596 Diazo substituted carbomonocyclic metal complex. (a) Chemical... as a diazo substituted carbomonocyclic metal complex (PMN P-94-1039) is subject to reporting under...

  14. 40 CFR 721.5350 - Substituted nitrile (generic name).

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted nitrile (generic name... Substances § 721.5350 Substituted nitrile (generic name). (a) Chemical substances and significant new uses subject to reporting. (1) The chemical substance identified generically as a substituted nitrile (PMN P-83...

  15. 40 CFR 721.10043 - Dineopentyl-4-substituted phthalate (generic).

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Dineopentyl-4-substituted phthalate... Specific Chemical Substances § 721.10043 Dineopentyl-4-substituted phthalate (generic). (a) Chemical... as dineopentyl-4-substituted phthalate (PMN P-02-697) is subject to reporting under this section for...

  16. Arylazoindazole Photoswitches : Facile Synthesis and Functionalization via SNAr Substitution

    NARCIS (Netherlands)

    Travieso-Puente, Raquel; Budzak, Simon; Chen, Juan; Stacko, Peter; Jastrzebski, Johann T B H; Jacquemin, Denis; Otten, Edwin

    2017-01-01

    A straightforward synthetic route to arylazoindazoles via nucleophilic aromatic substitution is presented. Upon deprotonation of the NH group, a C6F5-substituted formazan undergoes facile cyclization as a result of intermolecular nucleophilic substitution (SNAr). This new class of azo photoswitches

  17. Genotoxicity risk assessment of diversely substituted quinolines using the SOS chromotest.

    Science.gov (United States)

    Duran, Leidy Tatiana Díaz; Rincón, Nathalia Olivar; Galvis, Carlos Eduardo Puerto; Kouznetsov, Vladimir V; Lorenzo, Jorge Luis Fuentes

    2015-03-01

    Quinolines are aromatic nitrogen compounds with wide therapeutic potential to treat parasitic and microbial diseases. In this study, the genotoxicity of quinoline, 4-methylquinoline, 4-nitroquinoline-1-oxide (4-NQO), and diversely functionalized quinoline derivatives and the influence of the substituents (functional groups and/or atoms) on their genotoxicity were tested using the SOS chromotest. Quinoline derivatives that induce genotoxicity by the formation of an enamine epoxide structure did not induce the SOS response in Escherichia coli PQ37 cells, with the exception of 4-methylquinoline that was weakly genotoxic. The chemical nature of the substitution (C-5 to C-8: hydroxyl, nitro, methyl, isopropyl, chlorine, fluorine, and iodine atoms; C-2: phenyl and 3,4-methylenedioxyphenyl rings) of quinoline skeleton did not significantly modify compound genotoxicities; however, C-2 substitution with α-, β-, or γ-pyridinyl groups removed 4-methylquinoline genotoxicity. On the other hand, 4-NQO derivatives whose genotoxic mechanism involves reduction of the C-4 nitro group were strong inducers of the SOS response. Methyl and nitrophenyl substituents at C-2 of 4-NQO core affected the genotoxic potency of this molecule. The relevance of these results is discussed in relation to the potential use of the substituted quinolines. The work showed the sensitivity of SOS chromotest for studying structure-genotoxicity relationships and bioassay-guided quinoline synthesis. © 2013 Wiley Periodicals, Inc.

  18. Molecular-weight-enlarged multiple-pincer ligands: synthesis and application in palladium-catalyzed allylic substitution reactions

    NARCIS (Netherlands)

    Ronde, N.J.; Totev, D.; Müller, Christian; Lutz, M.; Spek, A.L.; Vogt, D.

    2009-01-01

    Three different pincer ligand systems are synthesized via nucleophilic substitution reactions of polyaromatic benzyl bromides as support molecules and phenol derivatives as ligand precursors. Retention tests using a polymeric nanofiltration membrane show moderate to good retention in THF and CH2Cl2.

  19. Nitrogen-Containing Coronenes: Theoretical Evaluation of the Influence of Aza-substitution on their Aromaticity

    Science.gov (United States)

    Pop, Raluca; van Staden, Jacobus; Diudea, Mircea

    2015-03-01

    The aromaticity of coronene derivatives where two C atoms of each outer six-membered ring are replaced by N have been investigated. Three types of substitution, namely 1,2-, 1,3-, and 1,4- are proposed. Computations of the geometric (HOMA index), energetic (HOMO-LUMO gap), and magnetic indices (NICS(0) and NICS(1)) were performed, and the results compared to the ones obtained for the all-carbon species. The results outline that the aza-derivatives have aromatic character comparable to the all-carbon species and an enlarged HOMO-LUMO gap.

  20. Synthesis of substituted 1,4-diazepines and 1,5-benzodiazepines using an efficient heteropolyacid-catalyzed procedure.

    Science.gov (United States)

    Kaoua, Rachedine; Bennamane, Norah; Bakhta, Saliha; Benadji, Sihame; Rabia, Cherifa; Nedjar-Kolli, Bellara

    2010-12-28

    An efficient and improved procedure for the synthesis of 1,4-diazepine and 1,5-benzodiazepine derivatives via the reaction of ketimine intermediates with aldehydes in the presence of Keggin-type heteropolyacids (HPAs) was developed. High yields and short reaction times were obtained for both electron-releasing and electron-withdrawing substituted 1,4-diazepine  and 1,5-benzodiazepines derivatives.

  1. Synthesis of Substituted 1,4-Diazepines and 1,5-Benzodiazepines Using an Efficient Heteropolyacid-Catalyzed Procedure

    Directory of Open Access Journals (Sweden)

    Sihame Benadji

    2010-12-01

    Full Text Available An efficient and improved procedure for the synthesis of 1,4-diazepine and 1,5-benzodiazepine derivatives via the reaction of ketimine intermediates with aldehydes in the presence of Keggin-type heteropolyacids (HPAs was developed. High yields and short reaction times were obtained for both electron-releasing and electron-withdrawing substituted 1,4-diazepine  and 1,5-benzodiazepines derivatives.

  2. On the substitution of energy sources: Prospective of the natural gas market share in the Brazilian urban transportation and dwelling sectors

    International Nuclear Information System (INIS)

    Kamimura, A.; Guerra, S.M.G.; Sauer, I.L.

    2006-01-01

    The substitution process resultant of the competition between two opponents fighting for the same resource or market is pointed out through a dynamic model derived from biomathematics. A brief description of the origin of the method based on coupled non-linear differential equations (NLDE) is presented. Numerical adherence of the proposed model to explain several substitution phenomena which have occurred in the past is examined. The proposed method is particularly suitable for prospective analysis and scenarios assessment. In this sense, two applications of the model to prospect the dynamic substitution process in the Brazilian case are done: firstly, the development of the urban gas pipeline system in substituting for the bottled LPG in the dwelling sector and, secondly, the substitution of the urban Diesel transportation fleet by compressed natural gas (CNG) buses

  3. On the effect of heterovalent substitutions in ruthenocuprates

    Energy Technology Data Exchange (ETDEWEB)

    Klamut, P.W.; Dabrowski, B.; Mini, S.M.; Maxwell, M.; Mais, J.; Felner, I.; Asaf, U.; Ritter, F.; Shengelaya, A.; Khasanov, R.; Savic, I.M.; Keller, H.; Wisniewski, A.; Puzniak, R.; Fita, I.M.; Sulkowski, C.; Matusiak, M

    2003-05-01

    We discuss the properties of superconducting derivatives of the RuSr{sub 2}GdCu{sub 2}O{sub 8} (1212-type) ruthenocuprate, for which heterovalent doping has been achieved through partial substitution of Cu ions into the RuO{sub 2} planes (Ru{sub 1-x}Sr{sub 2}GdCu{sub 2+x}O{sub 8-{delta}}, 0{<=}x{<=}0.75, T{sub c}{sup max}=72 K for x=0.3-0.4) and Ce ions into the Gd sites (RuSr{sub 2}Gd{sub 1-y}Ce{sub y}Cu{sub 2}O{sub 8}, 0{<=}y{<=}0.1). The measurements of XANES, thermopower, and magnetization under external pressure reveal an underdoped character of all compounds. Muon spin rotation experiments indicate the presence of magnetic order at low temperatures (T{sub m}=14-2 K for x=0.1-0.4). Properties of these two series lead us to the qualitative phase diagram for differently doped 1212-type ruthenocuprates. The difference in temperature of magnetic ordering found for superconducting and non-superconducting RuSr{sub 2}GdCu{sub 2}O{sub 8} is discussed in the context of the properties of substituted compounds. The high pressure oxygen conditions required for synthesis of Ru{sub 1-x}Sr{sub 2}RECu{sub 2+x}O{sub 8-{delta}}, have been extended to synthesis of a Ru{sub 1-x}Sr{sub 2}Eu{sub 2-y}Ce{sub y}Cu{sub 2+x}O{sub 10-{delta}} series. The Cu {yields} Ru doping achieved in these phases is found to decrease the temperature for magnetic ordering as well the volume fraction of the magnetic phase.

  4. Annonaceae substitution rates: a codon model perspective

    Directory of Open Access Journals (Sweden)

    Lars Willem Chatrou

    2014-01-01

    Full Text Available The Annonaceae includes cultivated species of economic interest and represents an important source of information for better understanding the evolution of tropical rainforests. In phylogenetic analyses of DNA sequence data that are used to address evolutionary questions, it is imperative to use appropriate statistical models. Annonaceae are cases in point: Two sister clades, the subfamilies Annonoideae and Malmeoideae, contain the majority of Annonaceae species diversity. The Annonoideae generally show a greater degree of sequence divergence compared to the Malmeoideae, resulting in stark differences in branch lengths in phylogenetic trees. Uncertainty in how to interpret and analyse these differences has led to inconsistent results when estimating the ages of clades in Annonaceae using molecular dating techniques. We ask whether these differences may be attributed to inappropriate modelling assumptions in the phylogenetic analyses. Specifically, we test for (clade-specific differences in rates of non-synonymous and synonymous substitutions. A high ratio of nonsynonymous to synonymous substitutions may lead to similarity of DNA sequences due to convergence instead of common ancestry, and as a result confound phylogenetic analyses. We use a dataset of three chloroplast genes (rbcL, matK, ndhF for 129 species representative of the family. We find that differences in branch lengths between major clades are not attributable to different rates of non-synonymous and synonymous substitutions. The differences in evolutionary rate between the major clades of Annonaceae pose a challenge for current molecular dating techniques that should be seen as a warning for the interpretation of such results in other organisms.

  5. Variation in heterozygosity predicts variation in human substitution rates between populations, individuals and genomic regions.

    Directory of Open Access Journals (Sweden)

    William Amos

    Full Text Available The "heterozygote instability" (HI hypothesis suggests that gene conversion events focused on heterozygous sites during meiosis locally increase the mutation rate, but this hypothesis remains largely untested. As humans left Africa they lost variability, which, if HI operates, should have reduced the mutation rate in non-Africans. Relative substitution rates were quantified in diverse humans using aligned whole genome sequences from the 1,000 genomes project. Substitution rate is consistently greater in Africans than in non-Africans, but only in diploid regions of the genome, consistent with a role for heterozygosity. Analysing the same data partitioned into a series of non-overlapping 2 Mb windows reveals a strong, non-linear correlation between the amount of heterozygosity lost "out of Africa" and the difference in substitution rate between Africans and non-Africans. Putative recent mutations, derived variants that occur only once among the 80 human chromosomes sampled, occur preferentially at the centre of 2 Kb windows that have elevated heterozygosity compared both with the same region in a closely related population and with an immediately adjacent region in the same population. More than half of all substitutions appear attributable to variation in heterozygosity. This observation provides strong support for HI with implications for many branches of evolutionary biology.

  6. Mechanistic study of manganese-substituted glycerol dehydrogenase using a kinetic and thermodynamic analysis.

    Science.gov (United States)

    Fang, Baishan; Niu, Jin; Ren, Hong; Guo, Yingxia; Wang, Shizhen

    2014-01-01

    Mechanistic insights regarding the activity enhancement of dehydrogenase by metal ion substitution were investigated by a simple method using a kinetic and thermodynamic analysis. By profiling the binding energy of both the substrate and product, the metal ion's role in catalysis enhancement was revealed. Glycerol dehydrogenase (GDH) from Klebsiella pneumoniae sp., which demonstrated an improvement in activity by the substitution of a zinc ion with a manganese ion, was used as a model for the mechanistic study of metal ion substitution. A kinetic model based on an ordered Bi-Bi mechanism was proposed considering the noncompetitive product inhibition of dihydroxyacetone (DHA) and the competitive product inhibition of NADH. By obtaining preliminary kinetic parameters of substrate and product inhibition, the number of estimated parameters was reduced from 10 to 4 for a nonlinear regression-based kinetic parameter estimation. The simulated values of time-concentration curves fit the experimental values well, with an average relative error of 11.5% and 12.7% for Mn-GDH and GDH, respectively. A comparison of the binding energy of enzyme ternary complex for Mn-GDH and GDH derived from kinetic parameters indicated that metal ion substitution accelerated the release of dioxyacetone. The metal ion's role in catalysis enhancement was explicated.

  7. Mechanistic study of manganese-substituted glycerol dehydrogenase using a kinetic and thermodynamic analysis.

    Directory of Open Access Journals (Sweden)

    Baishan Fang

    Full Text Available Mechanistic insights regarding the activity enhancement of dehydrogenase by metal ion substitution were investigated by a simple method using a kinetic and thermodynamic analysis. By profiling the binding energy of both the substrate and product, the metal ion's role in catalysis enhancement was revealed. Glycerol dehydrogenase (GDH from Klebsiella pneumoniae sp., which demonstrated an improvement in activity by the substitution of a zinc ion with a manganese ion, was used as a model for the mechanistic study of metal ion substitution. A kinetic model based on an ordered Bi-Bi mechanism was proposed considering the noncompetitive product inhibition of dihydroxyacetone (DHA and the competitive product inhibition of NADH. By obtaining preliminary kinetic parameters of substrate and product inhibition, the number of estimated parameters was reduced from 10 to 4 for a nonlinear regression-based kinetic parameter estimation. The simulated values of time-concentration curves fit the experimental values well, with an average relative error of 11.5% and 12.7% for Mn-GDH and GDH, respectively. A comparison of the binding energy of enzyme ternary complex for Mn-GDH and GDH derived from kinetic parameters indicated that metal ion substitution accelerated the release of dioxyacetone. The metal ion's role in catalysis enhancement was explicated.

  8. Theoretical study of substitution effects on molecular reorganization energy in organic semiconductors.

    Science.gov (United States)

    Geng, Hua; Niu, Yingli; Peng, Qian; Shuai, Zhigang; Coropceanu, Veaceslav; Brédas, Jean-Luc

    2011-09-14

    Chemical substitutions are powerful molecular design tools to enhance the performance of organic semiconductors, for instance, to improve solubility, intermolecular stacking, or film quality. However, at the microscopic level, substitutions in general tend to increase the molecular reorganization energy and thus decrease the intrinsic charge-carrier mobility. Through density functional theory calculations, we elucidate strategies that could be followed to reduce the reorganization energy upon chemical substitution. Specific examples are given here for hole-transport materials including indolo-carbazoles and several triarylamine derivatives. Through decomposition of the total reorganization energy into the internal coordinate space, we are able to identify the molecular segment that provides the most important contributions to the reorganization energy. It is found that when substitution reduces (enhances) the amplitude of the relevant frontier molecular orbital in that segment, the total reorganization energy decreases (increases). In particular, chlorination at appropriate positions can significantly reduce the reorganization energy. Several other substituents are shown to play a similar role, to a greater or lesser extent. © 2011 American Institute of Physics

  9. Rheological and structural studies of carboxymethyl derivatives of chitosan

    Science.gov (United States)

    Winstead, Cherese; Katagumpola, Pushpika

    2014-05-01

    The degrees of substitution of chitosan derivatives were varied and the viscoelastic behavior of these biopolymer solutions was studied using rheology. Chitosan is a cationic copolymer of glucosamine and N-acetylglucosamine obtained by alkaline deacetylation of chitin. Due to its inherent non-toxicity, biocompatibility, and biodegradability, chitosan has gained much interest. However, the poor solubility of the biopolymer in water and most common organic solvents limits its applications. Therefore, the focus of this work is the chemical modification of chitosan via carboxymethylation as well as studying the viscoelastic behavior of these polymer solutions. Varying degrees of substitution (DS) of carboxymethyl chitosan derivatives were synthesized by treating chitosan with monochloroacetic acid under alkylated medium varying the reaction time and temperature. The effect of degree of substitution on the rheology of these polymer solutions was studied as a function of concentration. The viscosity of chitosan derivatives sharply increased with increase in degree of substitution. G' and G" dependence on strain and angular frequency were studied and were found to exhibit predominantly viscous behavior. Additional characterization of the derivatized products were further studied using Fourier transform infrared (FT-IR), 1H Nuclear Magnetic Resonance (1H NMR) spectroscopy, X-ray diffraction (XRD), and thermal gravimetric analysis as well as differential scanning calorimetry (DSC). Degree of substitution (DS) was calculated by titrimetric method.

  10. Rheological and structural studies of carboxymethyl derivatives of chitosan

    International Nuclear Information System (INIS)

    Winstead, Cherese; Katagumpola, Pushpika

    2014-01-01

    The degrees of substitution of chitosan derivatives were varied and the viscoelastic behavior of these biopolymer solutions was studied using rheology. Chitosan is a cationic copolymer of glucosamine and N-acetylglucosamine obtained by alkaline deacetylation of chitin. Due to its inherent non-toxicity, biocompatibility, and biodegradability, chitosan has gained much interest. However, the poor solubility of the biopolymer in water and most common organic solvents limits its applications. Therefore, the focus of this work is the chemical modification of chitosan via carboxymethylation as well as studying the viscoelastic behavior of these polymer solutions. Varying degrees of substitution (DS) of carboxymethyl chitosan derivatives were synthesized by treating chitosan with monochloroacetic acid under alkylated medium varying the reaction time and temperature. The effect of degree of substitution on the rheology of these polymer solutions was studied as a function of concentration. The viscosity of chitosan derivatives sharply increased with increase in degree of substitution. G' and G' dependence on strain and angular frequency were studied and were found to exhibit predominantly viscous behavior. Additional characterization of the derivatized products were further studied using Fourier transform infrared (FT-IR), 1 H Nuclear Magnetic Resonance ( 1 H NMR) spectroscopy, X-ray diffraction (XRD), and thermal gravimetric analysis as well as differential scanning calorimetry (DSC). Degree of substitution (DS) was calculated by titrimetric method

  11. Interactions of a didomain fragment of the Drosophila Sex-lethal protein with single-stranded uridine-rich oligoribonucleotides derived from the transformer and Sex-lethal messenger RNA precursors: NMR with residue-selective [5-2H]uridine substitutions

    International Nuclear Information System (INIS)

    Kim, Insil; Muto, Yutaka; Watanabe, Satoru; Kitamura, Aya; Futamura, Yasuhiro; Yokoyama, Shigeyuki; Hosono, Kazumi; Kawai, Gota; Takaku, Hiroshi; Dohmae, Naoshi; Takio, Koji; Sakamoto, Hiroshi; Shimura, Yoshiro

    2000-01-01

    Proteins that contain two or more copies of the RNA-binding domain [ribonucleoprotein (RNP) domain or RNA recognition motif (RRM)] are considered to be involved in the recognition of single-stranded RNA, but the mechanisms of this recognition are poorly understood at the molecular level. For an NMR analysis of a single-stranded RNA complexed with a multi-RBD protein, residue-selective stable-isotope labeling techniques are necessary, rather than common assignment methods based on the secondary structure of RNA. In the present study, we analyzed the interaction of a Drosophila Sex-lethal (Sxl) protein fragment, consisting of two RBDs (RBD1-RBD2), with two distinct target RNAs derived from the tra and Sxl mRNA precursors with guanosine and adenosine, respectively, in a position near the 5'-terminus of a uridine stretch. First, we prepared a [5- 2 H]uridine phosphoramidite, and synthesized a series of 2 H-labeled RNAs, in which all of the uridine residues except one were replaced by [5- 2 H]uridine in the target sequence, GU 8 C. By observing the H5-H6 TOCSY cross peaks of the series of 2 H-labeled RNAs complexed with the Sxl RBD1-RBD2, all of the base H5-H6 proton resonances of the target RNA were unambiguously assigned. Then, the H5-H6 cross peaks of other target RNAs, GU 2 GU 8 , AU 8 , and UAU 8 , were assigned by comparison with those of GU 8 C. We found that the uridine residue prior to the G or A residue is essential for proper interaction with the protein, and that the interaction is tighter for A than for G. Moreover, the H1' resonance assignments were achieved from the H5-H6 assignments. The results revealed that all of the protein-bound nucleotide residues, except for only two, are in the unusual C2'-endo ribose conformation in the complex

  12. Interactions of a didomain fragment of the Drosophila Sex-lethal protein with single-stranded uridine-rich oligoribonucleotides derived from the transformer and Sex-lethal messenger RNA precursors: NMR with residue-selective [5-2H]uridine substitutions

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Insil; Muto, Yutaka; Watanabe, Satoru; Kitamura, Aya; Futamura, Yasuhiro; Yokoyama, Shigeyuki [University of Tokyo, Department of Biophysics and Biochemistry, Graduate School of Science (Japan); Hosono, Kazumi; Kawai, Gota; Takaku, Hiroshi [Chiba Institute of Technology, Department of Industrial Chemistry (Japan); Dohmae, Naoshi; Takio, Koji [Institute of Physical and Chemical Research (RIKEN) (Japan); Sakamoto, Hiroshi [Kobe University, Department of Biology, Faculty of Science (Japan); Shimura, Yoshiro [Biomolecular Engineering Research Institute (Japan)

    2000-06-15

    Proteins that contain two or more copies of the RNA-binding domain [ribonucleoprotein (RNP) domain or RNA recognition motif (RRM)] are considered to be involved in the recognition of single-stranded RNA, but the mechanisms of this recognition are poorly understood at the molecular level. For an NMR analysis of a single-stranded RNA complexed with a multi-RBD protein, residue-selective stable-isotope labeling techniques are necessary, rather than common assignment methods based on the secondary structure of RNA. In the present study, we analyzed the interaction of a Drosophila Sex-lethal (Sxl) protein fragment, consisting of two RBDs (RBD1-RBD2), with two distinct target RNAs derived from the tra and Sxl mRNA precursors with guanosine and adenosine, respectively, in a position near the 5'-terminus of a uridine stretch. First, we prepared a [5-{sup 2}H]uridine phosphoramidite, and synthesized a series of {sup 2}H-labeled RNAs, in which all of the uridine residues except one were replaced by [5-{sup 2}H]uridine in the target sequence, GU{sub 8}C. By observing the H5-H6 TOCSY cross peaks of the series of {sup 2}H-labeled RNAs complexed with the Sxl RBD1-RBD2, all of the base H5-H6 proton resonances of the target RNA were unambiguously assigned. Then, the H5-H6 cross peaks of other target RNAs, GU{sub 2}GU{sub 8}, AU{sub 8}, and UAU{sub 8}, were assigned by comparison with those of GU{sub 8}C. We found that the uridine residue prior to the G or A residue is essential for proper interaction with the protein, and that the interaction is tighter for A than for G. Moreover, the H1' resonance assignments were achieved from the H5-H6 assignments. The results revealed that all of the protein-bound nucleotide residues, except for only two, are in the unusual C2'-endo ribose conformation in the complex.

  13. Alkylation of N-substituted 2-phenylacetamides

    Directory of Open Access Journals (Sweden)

    SLOBODAN D. PETROVIC

    2004-10-01

    Full Text Available Various N-substituted phenylacetamides were alkylated using different alkylating agents under neutral and basic conditions. Reactions were performed at different reaction temperatures and in various solvents. Also, a number of various catalysts were used including phase-transfer catalysts. Reactions were followed using GC or GC-MS technique and the presence as well as the yields of the alkylation products were established. Generally, the best yield and high selectivity in the studied reactions were achieved under basic conditions where in the certain cases some products, mostly N-product, were obtained solely in quantitative yields.

  14. Comparison of Porcine and Bovine Collagen Dural Substitutes in Posterior Fossa Decompression for Chiari I Malformation in Adults.

    Science.gov (United States)

    Lee, Christine K; Mokhtari, Tara; Connolly, Ian D; Li, Gordon; Shuer, Lawrence M; Chang, Steven D; Steinberg, Gary K; Hayden Gephart, Melanie

    2017-12-01

    Posterior fossa decompression surgeries for Chiari malformations are susceptible to postoperative complications such as pseudomeningocele, external cerebrospinal fluid (CSF) leak, and meningitis. Various dural substitutes have been used to improve surgical outcomes. This study examined whether the collagen matrix dural substitute type correlated with the incidence of postoperative complications after posterior fossa decompression in adult patients with Chiari I malformations. A retrospective cohort study was conducted of 81 adult patients who underwent an elective decompressive surgery for treatment of symptomatic Chiari I malformations, with duraplasty involving a dural substitute derived from either bovine or porcine collagen matrix. Demographics and treatment characteristics were correlated with surgical outcomes. A total of 81 patients were included in the study. Compared with bovine dural substitute, porcine dural substitute was associated with a significantly higher risk of pseudomeningocele occurrence (odds ratio, 5.78; 95% confidence interval, 1.65-27.15; P = 0.01) and a higher overall complication rate (odds ratio, 3.70; 95% confidence interval, 1.23-12.71; P = 0.03) by univariate analysis. There was no significant difference in the rate of meningitis, repeat operations, or overall complication rate between the 2 dural substitutes. In addition, estimated blood loss was a significant risk factor for meningitis (P = 0.03). Multivariate analyses again showed that porcine dural substitute was associated with pseudomeningocele occurrence, although the association with higher overall complication rate did not reach significance. Dural substitutes generated from porcine collagen, compared with those from bovine collagen, were associated with a higher likelihood of pseudomeningocele development in adult patients undergoing Chiari I malformation decompression and duraplasty. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Advances in Osteobiologic Materials for Bone Substitutes.

    Science.gov (United States)

    Hasan, Anwarul; Byambaa, Batzaya; Morshed, Mahboob; Cheikh, Mohammad Ibrahim; Shakoor, Rana Abdul; Mustafy, Tanvir; Marei, Hany

    2018-04-27

    A significant challenge in the current orthopedics is the development of suitable osteobiologic materials that can replace the conventional allografts, autografts and xenografts, and thereby serve as implant materials as bone substitutes for bone repair or remodeling. The complex biology behind the nano-microstructure of bones and their repair mechanisms, which involve various types of chemical and biomechanical signaling amongst different cells, has set strong requirements for biomaterials to be used in bone tissue engineering. This review presents an overview of various types of osteobiologic materials to facilitate the formation of the functional bone tissue and healing of the bone, covering metallic, ceramic, polymeric and cell-based graft substitutes, as well as some biomolecular strategies including stem cells, extracellular matrices, growth factors and gene therapies. Advantages and disadvantages of each type, particularly from the perspective of osteoinductive and osteoconductive capabilities, are discussed. Although the numerous challenges of bone regeneration in tissue engineering and regenerative medicine are yet to be entirely addressed, further advancements in osteobiologic materials will pave the way towards engineering fully functional bone replacement grafts. This article is protected by copyright. All rights reserved.

  16. Pressure-induced polymerization in substituted acetylenes

    Energy Technology Data Exchange (ETDEWEB)

    Chellappa, Raja S.; Dattelbaum, Dana M.; Sheffield, Stephen; Robbins, David (LANL)

    2012-04-10

    A fundamental understanding of shock-induced chemical reactions in organics is still lacking and there are limited studies devoted to determining reaction mechanisms, evolution of bonding, and effect of functional group substitutions. The fast timescale of reactions occurring during shock compression create significant experimental challenges (diagnostics) to fully quantify the mechanisms involved. Static compression combined with temperature provides a complementary route to investigate the equilibrium phase space and metastable intermediates under extreme P-T conditions. In this study, we present our results from our ongoing high pressure in situ synchrotron x-ray diffraction experiments on substituted acetylenes: tert-butyl acetylene [TBA: (CH{sub 3}){sub 3}-C=CH] and ethynyl trimethylsilane [ETMS: (CH{sub 3}){sub 3}-SiC=CH]. We observed that the onset pressure of chemical reactions (at room temperature) in these compounds is higher under static compression (TBA: 12 GPa and ETMS: 17.6 GPa) when compared to shock input pressures (TBA: 6.1 GPa and ETMS: 6.6 GPa). At elevated temperatures, reactivity was observed to occur at pressures comparable to shock conditions. The products were polymeric in nature, recovered to ambient conditions with little degradation.

  17. Substitution of thoriated tungsten electrodes in Switzerland

    International Nuclear Information System (INIS)

    Kunz, H.; Piller, G.

    2006-01-01

    Thoriated tungsten electrodes are frequently used for inert gas welding (TIG/WIG). The use of these electrodes can lead to doses which are well above the limit for the general population (1mSv/year). This has been shown by different investigations, for example from the ''Berufsgenossenschaft''. With these findings in mind, the regulatory authorities (Swiss Federal Office of Public Health (SFOPH) and Swiss National Accident Insurance Association (Suva)) started in 1999 to examine the justification of thoriated tungsten electrodes and a possible substitution with products containing no radioactive material. Up to this time, the use of thoriated tungsten electrodes could be justified since no thorium-free products leading to comparable results were available on the market. This was also the reason why the SFOPH approved several types of these electrodes. Discussions with formation centers for welding and inquiries made at welding shops, trading companies and producers showed that in the mean-time thorium-free products with comparable welding specifications and results became available on the market. Since the 1 January 2004, thoriated tungsten electrodes can only be used if the user has obtained the corresponding license from the SFOPH. The use of thoriated tungsten electrodes is thus not completely forbidden, but very strict conditions have to be fulfilled. Up to now and due to the involvement of the relevant partners, the substitution process has not met any problem. Neither trading companies nor users made any opposition and no request for obtaining a license for thoriated tungsten electrodes was made. (orig.)

  18. Computational Electrochemistry Study of Derivatives of Anthraquinone and Phenanthraquinone Analogues

    DEFF Research Database (Denmark)

    Wang, Zhen; Li, Anyang; Gou, Lei

    2016-01-01

    The substituent effect on fused heteroaromatic anthraquinone and phenanthraquinone are investigated by density functional calculations to determine some guidelines for designing potential cathode materials for rechargeable Li-ion batteries. The calculated redox potentials of the quinone derivatives...... change monotonically with increasing number of substitutions. Full substitution with electron-withdrawing groups brings the highest redox potential; however, mono-substitution results in the largest mass energy density. Carbonyl groups are the most favorable active Li-binding sites; moreover......, intramolecular lithium bonds can be formed between Li atoms and electronegative atoms from the substituent groups. The lithium bonds increase the redox potential by improving the thermodynamic stabilization of the lithiation derivatives. Furthermore, the calculation of nucleus-independent chemical shift...

  19. A tandem Mannich addition–palladium catalyzed ring-closing route toward 4-substituted-3(2H-furanones

    Directory of Open Access Journals (Sweden)

    Jubi John

    2014-06-01

    Full Text Available A facile route towards highly functionalized 3(2H-furanones via a sequential Mannich addition–palladium catalyzed ring closing has been elaborated. The reaction of 4-chloroacetoacetate esters with imines derived from aliphatic and aromatic aldehydes under palladium catalysis afforded 4-substituted furanones in good to excellent yields. 4-Hydrazino-3(2H-furanones could also be synthesized from diazo esters in excellent yields by utilising the developed strategy. We could also efficiently transform the substituted furanones to aza-prostaglandin analogues.

  20. Flow perfusion culture of human mesenchymal stem cells on silicate-substituted tricalcium phosphate scaffolds

    DEFF Research Database (Denmark)

    Bjerre, Lea; Bünger, Cody E; Kassem, Moustapha

    2008-01-01

    Autologous bone grafts are currently the gold standard for treatment of large bone defects, but their availability is limited due to donor site morbidity. Different substitutes have been suggested to replace these grafts, and this study presents a bone tissue engineered alternative using silicate......-substituted tricalcium phosphate (Si-TCP) scaffolds seeded with human bone marrow-derived mesenchymal stem cells (hMSC). The cells were seeded onto the scaffolds and cultured either statically or in a perfusion bioreactor for up to 21 days and assessed for osteogenic differentiation by alkaline phosphatase activity...... assays and by quantitative real-time RT-PCR on bone markers. During culture, cells from the flow cultured constructs demonstrated improved proliferation and osteogenic differentiation verified by a more pronounced expression of several bone markers, e.g. alkaline phosphatase, osteopontin, Runx2, bone...

  1. Singlet Fission and Excimer Formation in Disordered Solids of Alkyl-Substituted 1,3-Diphenylisobenzofurans.

    Science.gov (United States)

    Dron, Paul I; Michl, Josef; Johnson, Justin C

    2017-11-16

    We describe the preparation and excited state dynamics of three alkyl derivatives of 1,3-diphenylisobenzofuran (1) in both solutions and thin films. The substitutions are intended to disrupt the slip-stacked packing observed in crystals of 1 while maintaining the favorable energies of singlet and triplet for singlet fission (SF). All substitutions result in films that are largely amorphous as judged by the absence of strong X-ray diffraction peaks. The films of 1 carrying a methyl in the para position of one phenyl ring undergo SF relatively efficiently (≥75% triplet yield, Φ T ) but more slowly than thin films of 1. When the methyl is replaced with a t-butyl, kinetic competition in the excited state favors excimer formation rather than SF (Φ T = 55%). When t-Bu groups are placed in both meta positions of the phenyl substituent, SF is slowed further and Φ T = 35%.

  2. Kinetic response study in chemiresistive gas sensor based on carbon nanotube surface functionalized with substituted phthalocyanines

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Anshul Kumar; Saini, Rajan; Bedi, R. K.; Mahajan, Aman, E-mail: dramanmahajan@yahoo.co.in, E-mail: anshulsharma.phy@gmail.com [Material Science Laboratory, Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Kumar, Pankaj [Department of Applied Sciences, I.K. Gujral Punjab Technical University, Kapurthala 144601 (India)

    2016-05-06

    A kind of hybrid material is prepared by functionalizing multi-wall carbon nanotubes (MWCNTs-COOH) with substituted copper phthalocyanine and the formation of CuPcOC{sub 8}/MWCNTs-COOH hybrid is confirmed by scanning electron microscopy and transmission electron microscopy. The results indicated that on the surface of nanotubes substituted CuPcOC{sub 8} derivatives has been successfully anchored through π-π stacking interaction. The gas sensing application of the fabricated hybrid material is tested upon exposure to different hazardous species, specifically NO{sub 2}, NO, Cl{sub 2} and NH{sub 3} at operating temperature of 150°C. It has been demonstrated that for Cl{sub 2} minimum detection limit of CuPcOC{sub 8}/MWCNTs-COOH hybrid is 100 ppb. The response of hybrid sensor is found to be increased with increase in the concentration of Cl{sub 2}.

  3. Acid-base and coordination properties of Meso-substituted porphyrins in nonaqueous solutions

    Science.gov (United States)

    Pukhovskaya, S. G.; Nam, Dao Tkhe; Fien, Chan Ding; Domanina, E. N.; Ivanova, Yu. B.; Semeikin, A. S.

    2017-09-01

    Acid-base and coordination properties of alkyl and aryl meso-substituted porphyrins are studied spectrophotometrically in nonaqueous solutions. It is found that the nature of the substituent greatly affects the basicity of ligands for porphyrins characterized by a flat structure of macrocycle. The electronic effects of substituents have a much weaker influence on the kinetics of complexing. These effects could be due to the opposite orientation of some factors: an increase in the basicity and stability of the N-H bonds of porphyrin reaction centers. Dissociation constants p K b of the cationic forms of meso-substituted derivatives of porphyrin are measured. The values of p K b are in good agreement with classic concepts of the nature of substituents, particularly those indirectly included in the macrocycle through phenyl buffer rings.

  4. Consequence of patient substitution of nattokinase for warfarin after aortic valve replacement with a mechanical prosthesis.

    Science.gov (United States)

    Elahi, Maqsood M; Choi, Charles H; Konda, Subbareddy; Shake, Jay G

    2015-01-01

    This report describes a patient's self-substitution of nattokinase for the vitamin K antagonist warfarin after aortic valve replacement with a mechanical prosthesis. Nattokinase is an enzyme derived from a popular fermented soybean preparation in Japan (natto), which has fibrinolytic properties and is gaining popularity in nontraditional health journals and nonmedical health websites as an over-the-counter thrombolytic. After nearly a year of use of nattokinase without warfarin, the patient developed thrombus on the mechanical valve and underwent successful repeat valve replacement. We believe this is the first documented case of nattokinase being used as a substitute for warfarin after valve replacement, and we strongly discourage its use for this purpose.

  5. Chiral 2-Aminobenzimidazole as Bifunctional Catalyst in the Asymmetric Electrophilic Amination of Unprotected 3-Substituted Oxindoles

    Directory of Open Access Journals (Sweden)

    Llorenç Benavent

    2018-06-01

    Full Text Available The use of readily available chiral trans-cyclohexanediamine-benzimidazole derivatives as bifunctional organocatalysts in the asymmetric electrophilic amination of unprotected 3-substituted oxindoles is presented. Different organocatalysts were evaluated; the most successful one contained a dimethylamino moiety (5. With this catalyst under optimized conditions, different oxindoles containing a wide variety of substituents at the 3-position were aminated in good yields and with good to excellent enantioselectivities using di-tert-butylazodicarboxylate as the aminating agent. The procedure proved to be also efficient for the amination of 3-substituted benzofuranones, although with moderate results. A bifunctional role of the catalyst, acting as Brønsted base and hydrogen bond donor, is proposed according to the experimental results observed.

  6. Kinetic response study in chemiresistive gas sensor based on carbon nanotube surface functionalized with substituted phthalocyanines

    Science.gov (United States)

    Sharma, Anshul Kumar; Kumar, Pankaj; Saini, Rajan; Bedi, R. K.; Mahajan, Aman

    2016-05-01

    A kind of hybrid material is prepared by functionalizing multi-wall carbon nanotubes (MWCNTs-COOH) with substituted copper phthalocyanine and the formation of CuPcOC8/MWCNTs-COOH hybrid is confirmed by scanning electron microscopy and transmission electron microscopy. The results indicated that on the surface of nanotubes substituted CuPcOC8 derivatives has been successfully anchored through π-π stacking interaction. The gas sensing application of the fabricated hybrid material is tested upon exposure to different hazardous species, specifically NO2, NO, Cl2 and NH3 at operating temperature of 150˚C. It has been demonstrated that for Cl2 minimum detection limit of CuPcOC8/MWCNTs-COOH hybrid is 100 ppb. The response of hybrid sensor is found to be increased with increase in the concentration of Cl2.

  7. Perron-Frobenius theory and frequency convergence for reducible substitutions

    OpenAIRE

    Lustig, Martin; Uyanik, Caglar

    2016-01-01

    We prove a general version of the classical Perron-Frobenius convergence property for reducible matrices. We then apply this result to reducible substitutions and use it to produce limit frequencies for factors and hence invariant measures on the associated subshift. The analogous results are well known for primitive substitutions and have found many applications, but for reducible substitutions the tools provided here were so far missing from the theory.

  8. Goods-Time Elasticity of Substitution in Health Production.

    Science.gov (United States)

    Du, Juan; Yagihashi, Takeshi

    2017-11-01

    We examine how inputs for health production, in particular, medical care and health-enhancing time, are combined to improve health. The estimated elasticity of substitution from a constant elasticity of substitution production function is significantly less than one for the working-age population, rejecting the unit elasticity of substitution used in previous studies. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  9. Effect of rare earth substitution in cobalt ferrite bulk materials

    International Nuclear Information System (INIS)

    Bulai, G.; Diamandescu, L.; Dumitru, I.; Gurlui, S.; Feder, M.; Caltun, O.F.

    2015-01-01

    The study was focused on the influence of small amounts of rare earth (RE=La, Ce, Sm, Gd, Dy, Ho, Er, Yb) addition on the microstructure, phase content and magnetic properties of cobalt ferrite bulk materials. The X-Ray diffraction measurements confirmed the formation of the spinel structure but also the presence of secondary phases of RE oxides or orthoferrite in small percentages (up to 3%). Density measurements obtained by Archimedes method revealed a ~1 g cm −3 decrease for the RE doped cobalt ferrite samples compared with stoichiometric one. Both the Mössbauer and Fourier Transform Infrared Spectrocopy analysis results confirmed the formation of the spinel phase. The saturation magnetization and coercive field values of the doped samples obtained by Vibrating Sample Magnetometry were close to those of the pure cobalt ferrite. For magnetostrictive property studies the samples were analyzed using the strain gauge method. Higher maximum magnetostriction coefficients were found for the Ho, Ce, Sm and Yb doped cobalt ferrite bulk materials as related to the stoichiometric CoFe 2 O 4 sample. Moreover, improved strain derivative was observed for these samples but at higher magnetic fields due to the low increase of the coercive field values for doped samples. - Highlights: • Substitution by a large number of rare earth elements was investigated. • First reported results on magnetostriction measurements of RE doped cobalt ferrite. • The doped samples presented an increased porosity and a decreased grain size. • Increased magnetostrctive response was observed for several doped samples

  10. Polymerization of an acetoxyvinyl substituted chlorocyclophosphazene

    NARCIS (Netherlands)

    Bosscher, G; Jekel, AP; vandeGrampel, JC

    The vinyl acetate derivative, gem-isopropyl-2-(alpha-acetoxyvinyl)tetrachlorocyclotriphosphazene (1), has been used in radical homopolymerization and copolymerization reactions with methyl methacrylate, (MMA) and styrene. The 1,1-disubstituted olefin did not undergo radical homopolymerization.

  11. Compounded laxative formulations for substituting phenolphthalein ...

    African Journals Online (AJOL)

    Dr Patrick O Erah

    acid, PEG, and sugar derivatives such as lactose, glucose and sorbitol when granulated with water. ... because when stored at increased temperature and relative humidity, disintegration times ...... suited for treating patients that have difficulty.

  12. Import Substitution in Regional Industrial Production: Theoretical and Practical Aspects

    Directory of Open Access Journals (Sweden)

    Yevgeniy Georgievich Animitsa

    2015-09-01

    Full Text Available The article proves the important role of import substitution in the economic security protection of state and its regions, especially in times of crisis, geopolitical and economical instability. The authors argue that the problem of import substitution is not modern, trendy scientific stream. The issue of displacement of import goods by domestic ones was brought up in famous classic theories of mercantilists. The particular emphasis is placed on the analysis and systematization of different scientific approaches, which are utilized by native and foreign scientists to bring out the matter of “import substitution,” to determine its essential characteristics. The authors suggest their own interpretation of the import substitution notion. In the article, the most significant pro and contra arguments in import substitution policy are defined. The regional aspects in the import substitution are approved: case study — organization of industrial import substitution in the Sverdlovsk region. In the article, the authors analyze the subject matter of the Program “Development of Intraregional Industrial Cooperation and Implementation of an Import Substitution in Branches of Industry in the Sverdlovsk Region.” It is resumed, that active policy of import substitution in the industry may become the driver of regional economic development.

  13. Zinc and Carbonate Co-Substituted Nano-Hydroxyapatite

    Science.gov (United States)

    Girija, E. K.; Kumar, G. Suresh; Thamizhavel, A.

    2011-07-01

    Synthesis of Zn or CO32- substituted nano-hydroxyapatite (HA) and its physico-chemical properties have been well documented. However, the effects of the simultaneous substitution of Zn and CO32- in nano-HA have not been reported. In the present study, Zn and CO32- substitutions in nano HA independently and concurrently have been done by wet precipitation method and characterized by XRD and FT-IR for its phase purity and chemical homogeneity. Further modulations of the bioactivity and thermal stability of HA due to the substitutions have been studied.

  14. Technological substitution options for controlling greenhouse gas emissions

    International Nuclear Information System (INIS)

    Barbier, E.B.; Burgess, J.C.; Pearce, D.W.

    1991-01-01

    This chapter is concerned with technological options for greenhouse gas substitution. The authors interpret the term substitution to exclude energy conservation/efficiency measures, investments in afforestation (sinks), and greenhouse gas removal or abatement technologies. Their working definition of greenhouse gas substitution includes (1) replacement technologies, for example, substituting a greenhouse gas technology with a nongreenhouse gas technology; and (2) reduction technologies, for example, substituting a greenhouse gas technology with an alternative technology that reduces greenhouse gas emissions. Essentially, replacement technologies involve 100 percent reduction in CO 2 ; reduction technologies involve a partial reduction in CO 2 . Of the man-made sources of greenhouse gases, energy is the most important and is expected to contribute to at least half of the global warming effect in the near future. The majority of this impact is from fossil fuel combustion as a source of carbon dioxide (CO 2 ), although fossil fuels also contribute significantly to methane (CH 4 ), to nitrous oxide (N 2 O), and to low-level ozone (O 3 ) through production of various nitrogen gases (NO x ) and carbon monoxide (CO). This study analyzes the available greenhouse gas substitutions and their costs. The authors concentrate particularly on substitutions for fossil-fuel combustion and CFC production and consumption. They conclude by summarizing the potential for greenhouse gas substitution, the cost-effectiveness of the various options and the design of incentives for substitution

  15. Risk management with substitution options: Valuing flexibility in small-scale energy systems

    Science.gov (United States)

    Knapp, Karl Eric

    Several features of small-scale energy systems make them more easily adapted to a changing operating environment than large centralized designs. This flexibility is often manifested as the ability to substitute inputs. This research explores the value of this substitution flexibility and the marginal value of becoming a "little more flexible" in the context of real project investment in developing countries. The elasticity of substitution is proposed as a stylized measure of flexibility and a choice variable. A flexible alternative (elasticity > 0) can be thought of as holding a fixed-proportions "nflexible" asset plus a sequence of exchange options---the option to move to another feasible "recipe" each period. Substitutability derives value from following a contour of anticipated variations and from responding to new information. Substitutability value, a "cost savings option", increases with elasticity and price risk. However, the required premium to incrementally increase flexibility can in some cases decrease with an increase in risk. Variance is not always a measure of risk. Tools from stochastic dominance are newly applied to real options with convex payoffs to correct some misperceptions and clarify many common modeling situations that meet the criteria for increased variance to imply increased risk. The behavior of the cost savings option is explored subject to a stochastic input price process. At the point where costs are identical for all alternatives, the stochastic process for cost savings becomes deterministic, with savings directly proportional to elasticity of substitution and price variance. The option is also formulated as a derivative security via dynamic programming. The partial differential equation is solved for the special case of Cobb-Douglas (elasticity = 1) (also shown are linear (infinite elasticity), Leontief (elasticity = 0)). Risk aversion is insufficient to prefer a more flexible alternative with the same expected value. Intertemporal

  16. Time and Money - Are they Substitutes?

    DEFF Research Database (Denmark)

    Bonke, Jens; Deding, Mette; Lausten, Mette

    In this paper, we analyse the distribution of time and money for Danish wage earner couples, where time is defined as leisure time and money as extended income, i.e. the sum of disposable income and the value of housework. The hypothesis is that individuals being rich in one dimension are more...... likely to be poor in the other dimension, such that individuals can be classified as either money-poor/time-rich or money-rich/time-poor. We analyse two different distributions of income, where the first assumes no sharing and the second complete sharing of income between spouses. The data are from...... the Danish Time-Use Survey 2001, merged with register data. Results show that the substitution of money for time is more prominent for women than for men, because they have a larger income share of time-intensive value of housework, while men have the larger share of disposable income. Furthermore, when...

  17. SYNTHESIS OF SUBSTITUTED QUINOLINE-3-CARBALDEHYDES

    Directory of Open Access Journals (Sweden)

    L. G. Klad'ko

    2015-12-01

    Full Text Available Dehalogenation of а series substituted 2-chloroquinoline-3-carbaldehydes was investigated. It was found that zinc dust in alkali ethanol practically do not react with 2-chloro-3-(1,3-dioxolan-2-yl-7-methylquinolines for a 5 day at ambient temperature. Increase temperature to boiling point of reaction mixture lead to increase yield 7-methylquinoline-3-carbaldehyde to 12.5%. This reaction with 2-chloro-3-dimetoxymetyl-7-methylquinoline give 26.5 above aldehyde. Replacement of ethanol to methanol give only traces of desired aldehyde. Neither 2-chloro-7-methylquinoline-3-carbaldehyde, nor his acetals do not react with sodium dithionite. Furthermore for activation of halogen we replaced chloraldehydes to iodoaldehydes by Finkelstein reaction, then protect aldehyde function by formation of dimethylacetals and treatment his by sodium dithionite in mixture pyridine-water. Desired aldehydes was obtained with poor to moderate yields. Increasing yields of this reaction is goal our further investigations.

  18. Porous bioresorbable magnesium as bone substitute

    Energy Technology Data Exchange (ETDEWEB)

    Wen, C.E.; Yamada, Y.; Shimojima, K.; Chino, Y.; Hosokawa, H.; Mabuchi, M. [Inst. for Structural and Engineering Materials, National Inst. of Advanced Industrial Science and Technology, Nagoya (Japan)

    2003-07-01

    Recently magnesium has been recognized as a very promising biomaterial for bone substitutes because of its excellent properties of biocompatibility, biodegradability and bioresorbability. In the present study, magnesium foams were fabricated by using a powder metallurgical process. Scanning electron microscopy equipped with energy dispersive X-ray spectrometer (EDS) and compressive tester were used to characterize the porous magnesium. Results show that the Young's modulus and the peak stress of the porous magnesium increase with decreasing porosity and pore size. This study suggests that the mechanical properties of the porous magnesium with the low porosity of 35% and/or with the small pore size of about 70 {mu}m are close to those of human cancellous bones. (orig.)

  19. Substitution reactions of carbon nanotube template

    Science.gov (United States)

    Li, Chi Pui; Chen, Ying; Gerald, John Fitz

    2006-05-01

    Substitution reactions between carbon nanotube (CNT) template and SiO with the formation of carbon rich silicon oxide nanowires (SiO-C-NWs) have been investigated using transmission electron microscopy and x-ray energy dispersive spectroscopy. The reaction was carried out by thermal annealing at 1200°C for 1h of a mixture of silicon monoxide (SiO) and iron (II) phthalocyanine, FeC32N8H16 (FePc) powders. Multiwalled CNTs were produced first via pyrolysis of FePc at a lower temperature (1000°C ). SiO vapors reacted with the CNTs at higher temperatures to produce amorphous SiO-C-NWs with a uniform diameter and a length in tens of micrometers. The special bamboolike structure of the CNTs allows the reaction to start from the external surface of the tubes and transform each CNT into a solid nanowire section by section.

  20. Crossmodal Perceptual Learning and Sensory Substitution

    Directory of Open Access Journals (Sweden)

    Michael J Proulx

    2011-10-01

    Full Text Available A sensory substitution device for blind persons aims to provide the missing visual input by converting images into a form that another modality can perceive, such as sound. Here I will discuss the perceptual learning and attentional mechanisms necessary for interpreting sounds produced by a device (The vOICe in a visuospatial manner. Although some aspects of the conversion, such as relating vertical location to pitch, rely on natural crossmodal mappings, the extensive training required suggests that synthetic mappings are required to generalize perceptual learning to new objects and environments, and ultimately to experience visual qualia. Here I will discuss the effects of the conversion and training on perception and attention that demonstrate the synthetic nature of learning the crossmodal mapping. Sensorimotor experience may be required to facilitate learning, develop expertise, and to develop a form of synthetic synaesthesia.