Crystallographic characterization of single-ortho, N-substituted acetanilide derivatives

International Nuclear Information System (INIS)

Boeyens, J.C.A.; Denner, L.; Painter, S.; Staskun, B.

1987-01-01

The crystal and molecular structures of the three single-ortho, N-substituted amide derivatives, acet-2'-bromo-N-(p-nitrobenzyl)anilide, 3',5'-dimethyl-N-ethyl-2,2,2',4'-tetrachlorobenzoylacetanilide, and difluoro[(1-phenyl-2-(o-ethylphenyl-N-benzylcarbamoyl)vinyl)oxy]borane, have been determined by X-ray diffraction analysis. In each case, the amide carbonyl group was found in the exo-conformation, independent of the nature of the acyl group. The observed conformations correlate well with solution structures, inferred from n.m.r. data

Subpicosecond pulse radiolysis in liquid methyl-substituted benzene derivatives

International Nuclear Information System (INIS)

Okamoto, Kazumasa; Kozawa, Takahiro; Saeki, Akinori; Yoshida, Yoichi; Tagawa, Seiichi

2007-01-01

The early processes of radiation chemistry in the picosecond time region in methyl-substituted benzene derivatives have been investigated using subpicosecond pulse radiolysis. In o-xylene, a fairly slow geminate ion recombination was observed within 50 ps after the electron beam irradiation; this is due to the smaller electron mobility. The kinetic traces were analyzed using the Smoluchowski equation with exponential and modified-Gaussian (YGP) functions as the distribution of thermalized electrons. Only exponential functions well reproduced the experimental data within 50 ps after the electron pulse

"CH"/N substituted mer-Gaq3 and mer-Alq3 derivatives: an effective approach for the tuning of emitting color.

Science.gov (United States)

Gahungu, Godefroid; Zhang, Jingping

2005-09-22

Equilibrium geometry configurations of the "CH"/N substituted Alq3 and Gaq3 derivatives are calculated by density functional theory (B3LYP/6-31G). The frontier molecular orbital and gap energy calculations for all complexes have been performed at the HF/6-31G level. It was shown that, compared to the pristine molecules, the HOMO and LUMO are stabilized, the net effect being however an increasing/decreasing of the gap (Eg) depending on the position of the substituted group. On the basis of the equilibrium geometries, the effect of the substitution on the absorption and emission spectra was evaluated using TDB3LYP/3-21G. It was shown that the change of "CH"/N substituted position on 8-hydroxyquinoline ligand is a powerful approach for the tuning of emitting color. An important blue shift was predicted for 5-substituted 8-hydroxyquinoline derivatives, an important red one being observed for 4-substituted ones. Interestingly, relatively significant blue and red shifts were also predicted for the 7- and 2-substituted derivatives. In this work, the correlation between the spectrum shifts and the metal-ligand bonding is also discussed.

Synthesis of selected 5-thio-substituted tetrazole derivatives and evaluation of their antibacterial and antifungal activities

Directory of Open Access Journals (Sweden)

NALILU SUCHETHA KUMARI

2011-02-01

Full Text Available Several 5-thio-substituted tetrazole derivatives were efficiently synthesized by a three-step process. The substituted tetrazol-5-thiol, namely, 1-benzyl-1H-tetrazole-5-thiol (2 was prepared by refluxing commercially available benzyl isothiocyanate (1 with sodium azide in water. The second step was the synthesis of 1-benzyl-5-[(3-bromopropylthio]-1H-tetrazole (3 by thioalkylation of tetrazole-5-thiol 2 with 1,3-dibromopropane in tetrahydrofuran. Finally, the 5-thio-substituted tetrazole derivatives 4a–i were prepared by condensation of 3 with the corresponding amine or thiol. The structures of the newly synthesized compounds were characterized by NMR, LC/MS/MS, IR spectral data and elemental analysis. All the synthesized compounds were screened for their antibacterial and antifungal activities.

Copper-catalyzed aerobic oxidative C-H functionalization of substituted pyridines: synthesis of imidazopyridine derivatives.

Science.gov (United States)

Yu, Jipan; Jin, Yunhe; Zhang, Hao; Yang, Xiaobo; Fu, Hua

2013-12-02

A novel, efficient, and practical method for the synthesis of imidazopyridine derivatives has been developed through the copper-catalyzed aerobic oxidative C-H functionalization of substituted pyridines with N-(alkylidene)-4H-1,2,4-triazol-4-amines. The procedure occurs by cleavage of the N-N bond in the N-(alkylidene)-4H-1,2,4-triazol-4-amines and activation of an aryl C-H bond in the substituted pyridines. This is the first example of the preparation of imidazopyridine derivatives by using pyridines as the substrates by transition-metal-catalyzed C-H functionalization. This method should provide a novel and efficient strategy for the synthesis of other nitrogen heterocycles. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

SYNTHESIS AND EVALUATION OF NEW PHTHALAZINE SUBSTITUTED β-LACTAM DERIVATIVES AS CARBONIC ANHYDRASE INHIBITORS.

Science.gov (United States)

Berber, Nurcan; Arslan, Mustafa; Bilen, Çiğdem; Sackes, Zübeyde; Gençer, Nahit; Arslan, Oktay

2015-01-01

A new series of phthalazine substituted β-lactam derivatives were synthesized and their inhibitory effects on the activity of purified human carbonic anhydrase (hCA I and II) were evaluated. 2H-Indazolo[2,1-b]phthala- zine-trione derivative was prepared with 4-nitrobenzaldehyde, dimedone, and phthalhydrazide in the presence of TFA in DMF, and the nitro group was reduced to 13-(4-aminophenyl)-3,3-dimethyl-3,4-dihydro- 2H-indazolo[1,2-b]phthalazine-1,6,11(13H)-trione with SnCl2 · 2H2O. The reduced compound was re- acted with different aromatic aldehydes, and phthalazine substituted imines were synthesized. The imine compounds undergo (2+2) cycloaddition reactions with ketenes to produce 2H-indazolo[2,1-b]phthala-zine-trione substituted β-lactam derivatives. The β-lactam compounds were tested as inhibitors of the CA isoenzyme activity. The results showed that all the synthesized compounds inhibited the CA isoenzyme activity. 1-(4-(3,3-dimethyl- 1,6,1 1-trioxo-2,3,4,6,11,13-hexahydro-1H-indazolo[1,2-b]phthalazin-13- yl)phenyl)-2-oxo-4-p-tolylazetidin-3-yl acetate (IC50 = 6.97 µM for hCA I and 8.48 µM for hCA II) had the most inhibitory effect.

Synthesis and Fungicidal activity of some sulphide derivatives of O-Ethyl-N-substituted phenylcarbamates

International Nuclear Information System (INIS)

Imeokparia, F.A.

2006-01-01

Monosulphides of O-ethyl-N-substituted phenylcarbamates were prepared by the reaction between O-ethyl-N-substituted phenylcarbamates and sulphur dichloride, while the corresponding disulphides were prepared by the reaction between O-ethyl-N-substituted phenylcarbamates and sulphur monochloride. The synthesized compounds were characterized by elemental analysis, thin layer chromatography (TLC), Fourier-transform infrared, and /sup 1/H and /sup 13/C nuclear magnetic resonance spectroscopic techniques. In vitro fungicidal assay of these sulphides against Fusarium oxysporum, Aspergillus niger, Aspergillus flavus and Rhizopus stolonifer showed that they had Greater fungicidal activity than their parent carbamates. The synthesized sulphides were more active towards A. Niger and A. flavus. Unlike the parent carbamates, the type of substituents attached to the aromatic nucleus of these sulphides had little or no effect on their fungicidal activity as there was insignificant variation in the fungicidal activity of the monosulphide and the disulphide derivatives of O-ethyl-N-substituted phenylcarbamates. (author)

Chemical Synthesis and Biological Activities of Novel Pleuromutilin Derivatives with Substituted Amino Moiety

Science.gov (United States)

Shang, Ruofeng; Wang, Shengyu; Xu, Ximing; Yi, Yunpeng; Guo, Wenzhu; YuLiu; Liang, Jianping

2013-01-01

Novel pleuromutilin derivatives designed based on the structure of valnemulin were synthesized and evaluated for their in vitro antibacterial activities. These pleuromutilin derivatives with substituted amino moiety exhibited excellent activities against methicillin-resistant Staphylococcus aureus, methicillin-resistant Staphylococcus epidermidis, Escherichia coli, and Streptococcus agalactiae. Compound 5b showed the highest antibacterial activities and even exceeded tiamulin. Moreover, the docking experiments provided information about the binding model between the synthesized compounds and peptidyl transferase center (PTC) of 23S rRNA. PMID:24376551

Chemical synthesis and biological activities of novel pleuromutilin derivatives with substituted amino moiety.

Directory of Open Access Journals (Sweden)

Ruofeng Shang

Full Text Available Novel pleuromutilin derivatives designed based on the structure of valnemulin were synthesized and evaluated for their in vitro antibacterial activities. These pleuromutilin derivatives with substituted amino moiety exhibited excellent activities against methicillin-resistant Staphylococcus aureus, methicillin-resistant Staphylococcus epidermidis, Escherichia coli, and Streptococcus agalactiae. Compound 5b showed the highest antibacterial activities and even exceeded tiamulin. Moreover, the docking experiments provided information about the binding model between the synthesized compounds and peptidyl transferase center (PTC of 23S rRNA.

Substitution pattern elucidation of hydroxypropyl Pinus pinaster (Ait.) bark polyflavonoid derivatives by ESI(-)-MS/MS.

Science.gov (United States)

García Marrero, Danny E; Glasser, Wolfgang G; Pizzi, Antonio; Paczkowski, Sebastian; Laborie, Marie-Pierre G

2014-10-01

The structure of condensed tannins (CTs) from Pinus pinaster bark extract and their hydroxypropylated derivatives with four degrees of substitution (DS 1, 2, 3 and 4) has been characterized for the first time using negative-ion mode electrospray ionization tandem mass spectrometry (ESI(-)-MS/MS). The results showed that P. pinaster bark CTs possess structural homogeneity in terms of monomeric units (C(15), catechin). The oligomer sizes were detected to be dimers to heptamers. The derivatives showed typical phenyl-propyl ether mass fragmentation by substituent elimination (58 amu) and inherent C(15) flavonoid fissions. The relative abundance of the product ions revealed a preferential triple, tetra-/penta- and octa- hydroxypropylation substitution pattern in the monomer, dimer and trimer derivatives, respectively. A defined order of -OH reactivity towards propylene oxide was established by means of multistage experiments (A-ring ≥ B-ring > C-ring). A high structural heterogeneity of the modified oligomers was detected. Copyright © 2014 John Wiley & Sons, Ltd.

Synthesis and Analgesic Activity of Novel Derivatives of 1,2-Substituted Benzimidazoles

Directory of Open Access Journals (Sweden)

Shobhit Srivastava

2013-01-01

Full Text Available A series of novel 2-phenylhydrazinomethyl and 2-(2-hydroxyphenyl-benzimidazole derivatives substituted at the N1-position of benzimidazole nucleus were synthesized as well as screened for analgesic activity. Some of these compounds showed promising analgesic activity when compared with the standard drug diclofenac sodium. The incorporation of a phenylhydrazinomethyl nucleus at 2-position of benzimidazole compound gave a biologically active pharmacophore.

UV action spectroscopy of protonated PAH derivatives. Methyl substituted quinolines

DEFF Research Database (Denmark)

Klærke, Benedikte; Holm, Anne; Andersen, Lars Henrik

2011-01-01

using the electrostatic storage ring ELISA, an electrospray ion source and 3 ns UV laser pulses. Results. It is shown that the absorption profile is both redshifted and broadened when moving the methyl group from the heterocycle containing nitrogen to the homoatomic ring. The absorption profiles......Aims. We investigate the production of molecular photofragments upon UV excitation of PAH derivatives, relevant for the interstellar medium. Methods. The action absorption spectra of protonated gas-phase methyl-substituted quinolines (CH3−C9H7NH+) have been recorded in the 215–338 nm spectral range...

Photophysical investigation of cyano-substituted terrylenediimide derivatives.

Science.gov (United States)

Kennes, Koen; Baeten, Yannick; Vosch, Tom; Sempels, Wouter; Yordanov, Stoyan; Stappert, Sebastian; Chen, Long; Müllen, Klaus; Hofkens, Johan; Van der Auweraer, Mark; Fron, Eduard

2014-12-18

Two new terrylenediimide (TDI) chromophores with cyano substituents in the bay and core area (BCN-TDI and OCN-TDI, respectively) have been characterized by a wide range of techniques, and their applicability for stimulated emission depletion (STED) microscopy has been tested. By cyano substitution an increase of the fluorescence quantum yield and a decrease of the nonradiative rate constant is achieved and attributed to a reduced charge-transfer character of the excited state due to a lower electron density of the TDI core. For BCN-TDI, the substitution in the bay area induces a strong torsional twist in the molecule which, similar to phenoxy bay-perylenediimide (PDI), has a strong effect on the fluorescence lifetime but appears to prevent the aggregation that is observed for OCN-TDI. The single-molecule photobleaching stability of BCN- and OCN-TDI is lower than that of a reference TDI without cyano substitution (C7-TDI), although less so for OCN-TDI. The photophysical properties of the excited singlet state are only slightly influenced by the cyano groups. The observed intense stimulated emission, the pump-dump-probe experiments, and STED single-molecule imaging indicate that STED experiments with the cyano-substituted TDIs are possible. However, because of aggregation and more efficient photobleaching, the performance of BCN- and OCN-TDI is worse than that of the reference compound without cyano groups (C7-TDI). Bay-substituted TDIs are less suitable for STED microscopy.

Synthesis of Various Polyaniline / Clay Nanocomposites Derived from Aniline and Substituted Aniline Derivatives by Mechanochemical Intercalation Method

Directory of Open Access Journals (Sweden)

N. Kalaivasan

2010-01-01

Full Text Available Polyaniline clay nanocomposite can be prepared by mechano-chemical method in which intercalation of anilinium ion into the clay lattices accomplished by mechanical grinding of sodium montmorillonite (Na+MMT in presence of anilinium hydrochloride at room temperature using mortar & pestle for about 30 min and subsequent grinding with oxidizing agent, ammonium peroxysulfate. The appearance of green colour indicates the formation of polyaniline/clay nanocomposite (PANI/Clay. Similarly aniline derivatives like o-toludine and o-anisidine in the form of HCl salt can form intercalation into the clay lattices. The intercalated aniline derivatives were ground mechanically in presence of oxidizing agent ammonium peroxysulfate lead to formation of substituted polyaniline/ clay nanocomposites. The characteristics of various polyaniline-clay nanocomposites were investigated using UV-Visible, FT-IR, cyclic voltammetry studies.

Synthetic Methods and Exploring Biological Potential of Various Substituted Quinoxalin-2-one Derivatives

OpenAIRE

Mohammad Asif

2016-01-01

Substituted quinoxaline have considerable interest in chemistry, biology and pharmacology. Quinoxaline derivatives are capable with variety of biological activities and possess different biological activities, of which the most potent are anti-microbial, analgesic and anti-inflammatory activities. It facilitated the researchers to develop various methods for their synthesis and their applications. In this review represented different methods of synthesis, reactivity and various biological act...

Correction: Synthesis of pyrrolidine-3-carboxylic acid derivatives via asymmetric Michael addition reactions of carboxylate-substituted enones.

Science.gov (United States)

Yin, Feng; Garifullina, Ainash; Tanaka, Fujie

2018-04-25

Correction for 'Synthesis of pyrrolidine-3-carboxylic acid derivatives via asymmetric Michael addition reactions of carboxylate-substituted enones' by Feng Yin et al., Org. Biomol. Chem., 2017, 15, 6089-6092.

Activated carbon modified with 4-(8-hydroxyquinoline-azo)benzamidine for selective solid-phase extraction and preconcentration of trace lead from environmental samples

International Nuclear Information System (INIS)

Tian, H.; Chang, X.; Hu, Z.; Yang, K.; He, Q.; Zhang, L.; Tu, Z.

2010-01-01

Activated carbon was chemically modified with 4-(8-hydroxyquinoline-azo)benzamidine and used for separation and preconcentration of trace amounts of Pb(II) in environmental samples by solid-phase extraction prior to the measurement by inductively coupled plasma atomic emission spectrometry. The effects of pH, shaking time, eluent concentration and volume, sample flow rate and potential interfering ions were studied. Under the optimum conditions, the enrichment factor was 100, the detection limits is 0. 43 ng mL -1 , and the relative standard deviations are <2. 1% (n = 8). The adsorption capacity of the sorbent is 53. 58 mg of lead(II) per gram of the material. The sorbent was successfully applied to the preconcentration of trace Pb(II) in the reference materials GBW 08301 (river sediment) and GBW 08302 (Tibet soil). The recovery of lead(II) from Yellow river water, Huangshui water, and tap water is in range of 99. 3-101. 6%. (author)

Design, synthesis and inhibitory activities of 8-(substituted styrol-formamido)phenyl-xanthine derivatives on monoamine oxidase B.

Science.gov (United States)

Hu, Suwen; Nian, Siyun; Qin, Kuiyou; Xiao, Tong; Li, Lingna; Qi, Xiaolu; Ye, Faqing; Liang, Guang; Hu, Guoxin; He, Jincai; Yu, Yinfei; Song, Bo

2012-01-01

The design and synthesis of two series of 8-(substituted styrol-formamido)phenyl-xanthine derivatives are described. Their in vitro monoamine oxidase B (MAO-B) inhibition were tested and the effect of substituents on the N-7, phenyl and the substituted positions are discussed. It was observed that compound 9b displayed significant MAO-B inhibition activity and selectivity, fluorine substitution plays a key role in the selectivity of MAO-B inhibition, and the styrol-formamido group at position-3' may enhance the activity and selectivity of 8-phenyl-xanthine analogues. These results suggest that such compounds may be utilized for the development of new candidate MAO-B inhibitors for treatment of Parkinson's disease.

Aryl substitution of pentacenes

Directory of Open Access Journals (Sweden)

Andreas R. Waterloo

2014-07-01

Full Text Available A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films, thermoanalytical methods (DSC and TGA, cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives. X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices.

Aryl substitution of pentacenes

Science.gov (United States)

Waterloo, Andreas R; Sale, Anna-Chiara; Lehnherr, Dan; Hampel, Frank

2014-01-01

Summary A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films), thermoanalytical methods (DSC and TGA), cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives). X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices. PMID:25161729

Design, Synthesis and Optoelectronic Properties of Unsymmetrical Oxadiazole Based Indene Substituted Derivatives as Deep Blue Fluoroscent Materials.

Science.gov (United States)

Belavagi, Ningaraddi S; Deshapande, Narahari; Pujar, G H; Wari, M N; Inamdar, S R; Khazi, Imtiyaz Ahmed M

2015-09-01

A series of novel unsymmetrically substituted indene-oxadiazole derivatives (3a-f) have been designed and synthesized by employing palladium catalysed Suzuki cross coupling reaction in high yields. The structural integrity of all the novel compounds was established by (1)H, (13)C NMR and LC/MS analysis. These compounds are amorphous in nature and are remarkably stable to long term storage under ambient conditions. The optoelectronic properties have been studied in detail using UV-Vis absorption and Fluorescence spectroscopy. All compounds emit intense blue to green-blue fluoroscence with high quantum yields. Time resolved measurments have shown life times in the range of 1.28 to 4.51 ns. The density functional theory (DFT) calculations were carried out for all the molecules to understand their structure-property relationships. Effect of concentration studies has been carried out in different concentrations for both absorption and emission properties and from this we have identified the optimized fluoroscence concentrations for all these compounds. The indene substituted anthracene-oxadiazole derivative (3f) showed significant red shift (λmax (emi) = 490 nm) and emits intense green-blue fluoroscence with largest stokes shift of 145 nm. This compound also exhibited highest fluoroscence life time (τ) of 4.51 ns, which is very close to the standard dye coumarin-540A (4.63 ns) and better than fluorescein-548 (4.10 ns). The results demonstrated that the novel unsymmetrical indene-substituted oxadiazole derivatives could play important role in organic optoelectronic applications, such as organic light-emitting diodes (OLEDs) or as models for investigating the fluorescent structure-property relationship of the indene-functionalized oxadiazole derivatives.

Effect of a bulky lateral substitution by chlorine atom and methoxy group on self-assembling properties of lactic acid derivatives

Czech Academy of Sciences Publication Activity Database

Stojanović, M.; Bubnov, Alexej; Obadović, D.Ž.; Hamplová, Věra; Cvetinov, M.; Kašpar, Miroslav

2014-01-01

Roč. 146, 1-2 (2014), s. 18-25 ISSN 0254-0584 R&D Projects: GA ČR GA13-14133S Grant - others:AVČR(CZ) M100101204 Institutional support: RVO:68378271 Keywords : ferroelectric liquid crystal * lactic acid derivative * lateral substitution * methoxy group * chlorine substitution * dielectric spectroscopy Subject RIV: JJ - Other Materials Impact factor: 2.259, year: 2014

Substituted group and side chain effects for the porphyrin and zinc(II)–porphyrin derivatives: A DFT and TD-DFT study

International Nuclear Information System (INIS)

Tai, Chin-Kuen; Chuang, Wen-Hua; Wang, Bo-Cheng

2013-01-01

The DFT/B3LYP/LANL2DZ and TD-DFT calculations have been performed to generate the optimized structures, electronic and photo-physical properties for the porphyrin and zinc(II)–porphyrin (metalloporphyrin) derivatives. The substituted group and side chain effects for these derivatives are discussed in this study. According to the calculation results, the side chain moiety extends the π-delocalization length from the porphyrin core to the side chain moiety. The substituted group with a stronger electron-donating ability increases the energy level of highest occupied molecular orbital (E HOMO ). The side chain moiety with a lower resonance energy decreases E HOMO , the energy level of the lowest unoccupied molecular orbital (E LUMO ), and the energy gap (E g ) between HOMO and LUMO in the porphyrin and zinc(II)–porphyrin derivatives. The natural bonding orbital (NBO) analysis determines the possible electron transfer mechanism from the electron-donating to -withdrawing groups (the side chain moiety) in these porphyrin derivatives. The projected density of state (PDOS) analysis shows that the electron-donating group affects the electron density distribution in both HOMO and LUMO, and the side chain moiety influence the electron density distribution in LUMO. The calculated photo-physical properties (absorption wavelengths and the related oscillator strength, f) in dichloromethane environment for porphyrin and zinc(II)–porphyrin derivatives have been simulated by using the TD-DFT method within the Polarizable Continuum Model (PCM). The present of both of the substituted group and the side chain moiety in these derivatives results in a red shift and broadening of the range of the absorption peaks of the Q/Soret band as compared to porphin. -- Highlights: • Side chain moiety extends the π-delocalization for the porphyrins. • Substituted group increases the energy of highest occupied molecular orbital. • Side chain moiety influences the Q/Soret band of

40 CFR Appendix D to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes

Science.gov (United States)

2010-07-01

... the following criteria, derived from Society of Automotive Engineers (SAE) standards and recommended... Substitutes] Application Substitute Decision Conditions Comments Electronics Cleaning w/CFC-113 and MCF HFC... Sector [Acceptable Subject to Narrowed Use Limits] Application Substitute Decision Comments Electronics...

265 nm laser flash photolysis of some ortho-substituted anilides and related N-formylkynurenine derivatives

Energy Technology Data Exchange (ETDEWEB)

Pileni, M P; Santus, R [Museum National d' Histoire Naturelle, 75 - Paris (France); Land, E J

1978-06-01

The physical and chemical properties of the triplet state of eight ortho-substituted anilides including N-formylkynurenine(FK), the major trp UV-photooxidation product and a remarkable photodynamic agent, have been investigated using both pulse radiolysis and 265 nm laser flash photolysis techniques. The molar extinction coefficient, the inter-system-crossing quantum yield and the oscillator strength of the T/sub 1/..-->..Tsub(n) absorption band (lambdasub(max)approximately equal 450nm) have been determined. It is shown that anilides having n..pi..* triplets readily react with most solvents whereas those having ..pi..,..pi..* triplets slowly react with alcohols. In both cases, the semi-reduced species are formed. In water, the formation of the semi-reduced species most probably involves the first excited singlet state. The triplet state properties of the FK derivatives (i.e. ortho-substituted anilides having a side chain bearing charged groups such as carboxylic or amino groups) are strongly modified by the ionization state of the charged side chain. In the case of the FK derivatives possessing an uncharged amino group, quenching of the triplet state occurs via a fast reversible electron transfer reaction from the NH/sub 2/ to the triplet anilide.

The inhibition performance of long-chain alkyl-substituted benzimidazole derivatives for corrosion of mild steel in HCl

International Nuclear Information System (INIS)

Zhang, Dongqin; Tang, Yongming; Qi, Sijun; Dong, Dawei; Cang, Hui; Lu, Gang

2016-01-01

Highlights: • Inhibition performance of long-chain alkyl-substituted benzimidazole. • Benzimidazole segment donating electrons to metal surface. • Non-polar long chain enhancing inhibition by the barrier effect. • Molecular form of DBI more tightly adsorbs on the steel than its protonated form. - Abstract: The corrosion inhibition of a new benzimidazole derivative, 6-(dodecyloxy)-1H-benzo[d]imidazole (DBI), for mild steel in 1 M HCl was investigated in this paper. Computational chemistry was performed to explore the adsorption of DBI on metal surface. Inhibition performance of DBI is attributed to both the direct interaction of benzimidazole segment with iron surface and the barrier effect of the non-polar long chain against aggressive solution. Compared to the protonated form, the molecular form of DBI could more tightly interact with iron surface. These results show that the long-chain alkyl-substituted benzimidazole derivative is of great potential application as corrosion inhibitor.

Synthesis of substituted 1-metallyl derivatives of o- and m-carboranes and some their transformations

International Nuclear Information System (INIS)

Kovredov, A.I.; Shemyakin, N.F.; Zakharkin, L.I.

1985-01-01

Synthesis of 1-metallyl substituted o- and m- carbonates is carried out, and alkylation of benzene by them is investigated. Synthesis with 30-95% yield has been carried out by the reaction of lithium derivatives with metallylchloride in the ester-benzene solution. The reaction of benzene alkylation is studied in the presence of aluminium chloride and H 2 SO 4 . Reaction mechanisms are considered

Paracetamol, 3-monoalkyl- and 3,5-dialkyl-substituted derivatives. Antioxidant activity and relationship between lipid peroxidation and cytotoxicity

NARCIS (Netherlands)

Van de Straat, R; Bijloo, G.J.; Vermeulen, N P

1988-01-01

The analgesic drug paracetamol is known to cause lipid peroxidation and hepatotoxicity after overdosage. In this paper, the relationship between lipid peroxidation and toxicity in freshly isolated hepatocytes was studied using paracetamol and three 3-monoalkyl-substituted derivatives of paracetamol.

Effect of a bulky lateral substitution by chlorine atom and methoxy group on self-assembling properties of lactic acid derivatives

International Nuclear Information System (INIS)

Stojanović, Maja; Bubnov, Alexej; Obadović, Dušanka Ž.; Hamplová, Věra; Cvetinov, Miroslav; Kašpar, Miroslav

2014-01-01

Several chiral liquid crystalline materials derived from the lactic acid have been studied with the aim to establish the effect of bulky lateral substituents on their self-assembling properties. A chlorine atom and methoxy group have been used as lateral substituents in ortho position to ether group position on phenyl ring far from the chiral centre. All the studied materials possess tilted ferroelectric smectic C* phase in a broad temperature range. In dependence on the molecular structure namely type of lateral substituent and length of the chiral chain, the cholesteric mesophase, orthogonal paraelectric smectic A* and crystal mesophases have been detected. Lateral chlorine substitution results in decrease of both the clearing point and crystallisation temperature as well as in a distinct increase of spontaneous polarization. Bulky methoxy substitution slightly suppresses the spontaneous polarisation but strongly increases the melting point that results in monotropic peculiarity of the SmC* phase. Mesomorphic, spontaneous, structural and dielectric properties of the substituted compounds were established and compared to those of the non-substituted ones in order to contribute to better understanding of the structure–property relationship for such chiral self-assembling materials. - Highlights: • Chiral liquid crystalline materials derived from the lactic acid have been studied. • Effect of bulky lateral substituents on self-assembling properties has been established. • Bulky methoxy substitution suppresses spontaneous polarisation but increases the melting point. • The compounds might have a strong potential for many advanced electro-optic applications

Noval 1-substituted-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazole derivatives: Synthesis and pharmacological activity

Directory of Open Access Journals (Sweden)

Sabir Hussain

2015-05-01

Full Text Available Several-1-carbothioamide-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazoles 2a–d, 1-(pyridine-4-ylcarbonyl-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazoles 3a–d, 1-(5-chloro-6-fluoro-1,3-benzothiazole-2-ylthiocarbamoyl-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazoles 4a–d and 1-[(1,2,4-triazole-4-yl carbothioamide]-3,5-dimethyl-4-[(substituted phenyl diazenyl] pyrazoles 5a–d were synthesized. The structures of the newly synthesized compounds were supported by IR, 1H NMR and mass spectral data. These compounds were investigated for their, anti-inflammatory, analgesic, ulcerogenic, lipid peroxidation, antibacterial and antifungal activities. Some of the synthesized compounds showed potent anti-inflammatory activity along with minimal ulcerogenic effect and lipid peroxidation, compared to ibuprofen and flurbiprofen. Some of the tested compounds also showed moderate antimicrobial activity against tested bacterial and fungal strains.

Novel fluoroquinolone derivatives bearing N-thiomide linkage with 6-substituted-2-aminobenzothiazoles: Synthesis and antibacterial evaluation

Directory of Open Access Journals (Sweden)

Prabodh Chander Sharma

2017-02-01

Full Text Available A series of novel fluoroquinolone derivatives bearing N-thiomide linkage with 6-substituted-2-aminobenzothiazole substituents at the C-7 position were synthesized to obtain potent analogs active against bacterial strains. Some compounds exhibited excellent antibacterial activity against Staphylococcus auerus, Escherichia coli, Bacillus subtilis, Pseudomonas aeruginosa bacterial strains. Among all the synthesized compounds 6-nitro substituted benzothiazole along with norfloxacin (4b and gatifloxacin (4l showed MIC 05 μg/ml when tested against S. auerus. Moreover, compounds 4d, 4f and 4l showed superior MIC (15, 10, and 15 μg/ml respectively against B. subtilis. The results of the present study reveal that the compounds have significant antibacterial potential and are suitable candidates for further exploration.

Identification of ortho-Substituted Benzoic Acid/Ester Derivatives via the Gas-Phase Neighboring Group Participation Effect in (+)-ESI High Resolution Mass Spectrometry.

Science.gov (United States)

Blincoe, William D; Rodriguez-Granillo, Agustina; Saurí, Josep; Pierson, Nicholas A; Joyce, Leo A; Mangion, Ian; Sheng, Huaming

2018-04-01

Benzoic acid/ester/amide derivatives are common moieties in pharmaceutical compounds and present a challenge in positional isomer identification by traditional tandem mass spectrometric analysis. A method is presented for exploiting the gas-phase neighboring group participation (NGP) effect to differentiate ortho-substituted benzoic acid/ester derivatives with high resolution mass spectrometry (HRMS 1 ). Significant water/alcohol loss (>30% abundance in MS 1 spectra) was observed for ortho-substituted nucleophilic groups; these fragment peaks are not observable for the corresponding para and meta-substituted analogs. Experiments were also extended to the analysis of two intermediates in the synthesis of suvorexant (Belsomra) with additional analysis conducted with nuclear magnetic resonance (NMR), density functional theory (DFT), and ion mobility spectrometry-mass spectrometry (IMS-MS) studies. Significant water/alcohol loss was also observed for 1-substituted 1, 2, 3-triazoles but not for the isomeric 2-substituted 1, 2, 3-triazole analogs. IMS-MS, NMR, and DFT studies were conducted to show that the preferred orientation of the 2-substituted triazole rotamer was away from the electrophilic center of the reaction, whereas the 1-subtituted triazole was oriented in close proximity to the center. Abundance of NGP product was determined to be a product of three factors: (1) proton affinity of the nucleophilic group; (2) steric impact of the nucleophile; and (3) proximity of the nucleophile to carboxylic acid/ester functional groups. Graphical Abstract ᅟ.

Substitution determination of Fmoc‐substituted resins at different wavelengths

Science.gov (United States)

Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel

2017-01-01

In solid‐phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc‐substituted resins, substitution determination is often performed by suspending the Fmoc‐protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene–piperidine adduct that is quantified by ultraviolet–visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene–piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert–Beer's law, together with the substance‐specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol−1 cm−1 and 8100 l mol−1 cm−1 have been reported for the dibenzofulvene–piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. PMID:28635051

Novel Substituted Heteroaromatic Piperazine and Piperidine Derivatives as Inhibitors of Human Enterovirus 71 and Coxsackievirus A16

Directory of Open Access Journals (Sweden)

Xian Zhang

2013-04-01

Full Text Available A series of substituted heteroaromatic piperazine and piperidine derivatives were found through virtual screening based on the structure of human enterovirus 71 capsid protein VP1. The preliminary biological evaluation revealed that compounds 8e and 9e have potent activity against EV71 and Coxsackievirus A16 with low cytotoxicity.

Synthesis and antiproliferative activity of novel limonene derivatives with a substituted thiourea moiety

International Nuclear Information System (INIS)

Figueiredo, Isis M.; Santos, Luciane V. dos; Costa, Willian F. da; Silva, Cleuza C. da; Sarragiotto, Maria H.; Carvalho, Joao E. de; Sacoman, Juliana L.; Kohn, Luciana K.

2006-01-01

A series of R-(+)-limonene derivatives bearing a substituted thiourea moiety (3-13) and five S-methyl analogs (14-18) were synthesized and evaluated for their in vitro antiproliferative activity against human cancer cell lines. Compounds bearing aromatic substituents (3-6) exhibit cytostatic activity in the full panel of cell lines tested, with GI 50 values in the range of 2.5 to 24 μmol L -1 . Compounds 3, 10, 12 and 16 were the most active with GI 5 )0 values in the range of 0.41 to 3.0 μmol L -1 , against different cell lines. (author)

Silica-Supported Polyphosphoric Acid in the Synthesis of 4-Substituted Tetrahydroisoquinoline Derivatives

Directory of Open Access Journals (Sweden)

Iliyan Ivanov

2013-02-01

Full Text Available We report herein an application of an α-amidoalkylation reaction, as an alternative efficient synthesis of 4-aryl- and 4-methyl-1,2,3,4-tetrahydroisoquinoline derivatives. The amides required for this purpose would result from reaction of aminoacetaldehyde dimethylacetal with different substituted benzenes in polyphosphoric acid, followed by acylation of the obtained amines with different acid chlorides or sulfochlorides. We compared the cyclisation step using conventional (milieu of acetic-trifluoracetic acid = 4:1 and solid supported reagents (SiO2/PPA, as recovered, regenerated and reused without loss of its activity catalyst. We found that in comparison to conventional methods, the yields of the reaction are greater and the reaction time is shorter.

Synthesis and Structural Characterization of 1- and 2-Substituted Indazoles: Ester and Carboxylic Acid Derivatives

Directory of Open Access Journals (Sweden)

Isabel Bento

2006-11-01

Full Text Available A series of indazoles substituted at the N-1 and N-2 positions with ester-containing side chains -(CH2nCO2R of different lengths (n = 0-6, 9, 10 are described.Nucleophilic substitution reactions on halo esters (X(CH2nCO2R by 1H-indazole inalkaline solution lead to mixtures of N-1 and N-2 isomers, in which the N-1 isomerpredominates. Basic hydrolysis of the ester derivatives allowed the synthesis of thecorresponding indazole carboxylic acids. All compounds were fully characterised bymultinuclear NMR and IR spectroscopies, MS spectrometry and elemental analysis; theNMR spectroscopic data were used for structural assignment of the N-1 and N-2 isomers.The molecular structure of indazol-2-yl-acetic acid (5b was determined by X-raydiffraction, which shows a supramolecular architecture involving O2-H...N1intermolecular hydrogen bonds.

Diamidines versus Monoamidines as Anti-Pneumocystis Agents: An in Vivo Study

Directory of Open Access Journals (Sweden)

El-Moukhtar Aliouat

2013-07-01

Full Text Available Some compounds articulated around a piperazine or an ethylenediamine linker have been evaluated in vitro to determine their activity in the presence of a 3T6 fibroblast cell line and an axenic culture of Pneumocystis carinii, respectively. The most efficient antifungal derivatives, namely N,N′-bis(benzamidine-4-ylethane-1,2-diamine (compound 6, a diamidine and N-(benzamidine-4-yl-N′-phenylethane-1,2-diamine (compound 7, a monoamidine, exhibited no cytotoxicity and were evaluated in vivo in a rat model. Only the diamidine 6 emerged as a promising hit for further studies.

Substitution determination of Fmoc-substituted resins at different wavelengths.

Science.gov (United States)

Eissler, Stefan; Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel

2017-10-01

In solid-phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc-substituted resins, substitution determination is often performed by suspending the Fmoc-protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene-piperidine adduct that is quantified by ultraviolet-visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene-piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert-Beer's law, together with the substance-specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol -1  cm -1 and 8100 l mol -1  cm -1 have been reported for the dibenzofulvene-piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd.

Synthesis and in vitro antibacterial activity of N-methylnitrone and nitrovinyl derivatives of some N-substituted 2-chloroindol-3-carboxaldehydes

Energy Technology Data Exchange (ETDEWEB)

Gatti, R.; Cavrini, V.; Roveri, P.; Bianucci, F.; Legnani, P.

1981-02-01

N-methylnitrones and nitrovinyl derivatives from 1-substituted-2-chloroindol-3-carboxaldehydes were synthesized and evaluated for their in vitro antibacterial activity. Some nitrovinyl derivatives displayed good in vitro activity against Gram-positive bacteria; the compound (II e), 1-(o-chlorobenzyl)-2-chloro-3-(2-nitroethenyl)indole, was more active than nitrofurantoin against Staphylococcus aureus and Streptococcus pyogenes. Some structure-activity relationships are discussed.

Synthesis and Biological Activity of Some 3, 5-Diarylisoxazoline Derivatives: Reaction of Substituted Chalcones with Hydroxylamine Hydrochloride

Directory of Open Access Journals (Sweden)

Vandana Sharma

2010-01-01

Full Text Available A series of 3-aryl-5-styrylisoxazoline/ 3,5-diarylisoxazoline derivatives were synthesized by the reaction of appropriately substituted chalcones and hydroxylamine hydrochloride in presence of alkali in ethanol. The synthesized heterocycles have been characterized on the basis of their chemical properties and spectroscopic data. These compounds were tested for biological activity against a variety of test organisms

Substitution of matrices over rings

NARCIS (Netherlands)

Hautus, M.L.J.

1995-01-01

For a given commutative ring with an identity element, we define and study the substitution of a matrix with entries in into a matrix polynomial or rational function over . A Bezout-type remainder theorem and a "partial-substitution rule" are derived and used to obtain a number of results. The

Studies on Synthesis of Some Novel Heterocyclic Azlactone Derivatives and Imidazolinone Derivatives and their Antimicrobial Activity

Directory of Open Access Journals (Sweden)

Rakesh N. Mistry

2005-01-01

Full Text Available p - Methyl benzoic acid on reaction with phosphorus pentachloride gives p - methyl benzoyl chloride derivative which on condensation with glycine gives p - methyl benzoyl glycine derivative. Now, this p - methyl benzoyl glycine derivative on condensation with various substituted aldehydes gives corresponding substituted 4 - [aryl methylidine] - 2 - [p - methyl phenyl] - oxazole - 5 - one derivatives [1(a-j]. Further, these derivatives [1(a-j] on condensation with 4 , 4’ - diamino diphenyl sulphone gives corresponding substituted imidazolinone - dibenzsulphone derivatives [2(a-j], on condensation with 4 , 4’ - diamino diphenyl methane gives corresponding substituted imidazolinone - dibenzmethane derivatives [3(a-j], on condensation with 4,4’- diamino benzanilide gives corresponding substituted imidazolinone - benzanilide derivatives [4(a-j] and on condensation with 2 - amino pyridine gives corresponding substituted imidazolinone - pyridine derivatives [5(a-j] respectively. Structure elucidation of synthesised compounds has been made on the basis of elemental analysis, I.R. spectral studies and 1H N.M.R. spectral studies. The antimicrobial activity of the synthesised compounds has been studied against the cultures “Staphylococcus aureus”, “Escherichia coli” and “Candela albicans”.

Synthesis of novel 4,6-di(substituted)amino-1,2-dihydro-1,3,5-triazine derivatives as topical antiseptic agents.

Science.gov (United States)

Maeda, Shirou; Kita, Toshiko; Meguro, Kanji

2009-02-12

A series of novel 4,6-di(substituted)amino-1,2-dihydro-1,3,5-triazine derivatives designed to have ClogP of 5.1-7.5 was synthesized and evaluated for their antiseptic properties by MIC and MBC tests against Gram-positive and Gram-negative bacteria, including MRSA, VRE, and P. aeruginosa. Among these compounds, 4-alkyl-6-aralkyl derivatives having ClogP of 6.6-7.1 and 4-alkyl-6-aryl or 4,6-dialkyl derivatives with ClogP of 6.0-6.4 showed pronounced antibacterial activities in both tests.

Effect of five-membered ring and heteroatom substitution on charge transport properties of perylene discotic derivatives: A theoretical approach

Energy Technology Data Exchange (ETDEWEB)

Navarro, Amparo, E-mail: anavarro@ujaen.es; Fernández-Liencres, M. Paz; Peña-Ruiz, Tomás; Granadino-Roldán, José M.; Fernández-Gómez, Manuel [Departamento de Química Física y Analítica, Universidad de Jaén, Campus Las Lagunillas, E23071 Jaén (Spain); García, Gregorio [Instituto de Energía Solar and Departamento TFB, E.T.S.I. Telecomunicación, Universidad Politécnica de Madrid, Ciudad Universitaria, Madrid 28040 (Spain)

2016-08-07

Density functional theory calculations were carried out to investigate the evolvement of charge transport properties of a set of new discotic systems as a function of ring and heteroatom (B, Si, S, and Se) substitution on the basic structure of perylene. The replacement of six-membered rings by five-membered rings in the reference compound has shown a prominent effect on the electron reorganization energy that decreases ∼0.2 eV from perylene to the new carbon five-membered ring derivative. Heteroatom substitution with boron also revealed to lower the LUMO energy level and increase the electron affinity, therefore lowering the electron injection barrier compared to perylene. Since the rate of the charge transfer between two molecules in columnar discotic systems is strongly dependent on the orientation of the stacked cores, the total energy and transfer integral of a dimer as a disc is rotated with respect to the other along the stacking axis have been predicted. Aimed at obtaining a more realistic approach to the bulk structure, the molecular geometry of clusters made up of five discs was fully optimized, and charge transfer rate and mobilities were estimated for charge transport along a one dimensional pathway. Heteroatom substitution with selenium yields electron transfer integral values ∼0.3 eV with a relative disc orientation of 25°, which is the preferred angle according to the dimer energy profile. All the results indicate that the tetraselenium-substituted derivative, not synthetized so far, could be a promising candidate among those studied in this work for the fabrication of n-type semiconductors based on columnar discotic liquid crystals materials.

N9-Substituted N(6)-[(3-methylbut-2-en-1-yl)amino]purine derivatives and their biological activity in selected cytokinin bioassays

Czech Academy of Sciences Publication Activity Database

Mik, V.; Szüčová, Lucie; Spíchal, Lukáš; Plíhal, O.; Nisler, Jaroslav; Zahajská, L.; Doležal, Karel; Strnad, Miroslav

2011-01-01

Roč. 19, č. 23 (2011), s. 7244-7251 ISSN 0968-0896 R&D Projects: GA MŠk ED0007/01/01; GA ČR GA522/09/1576 Keywords : N6-[(3-Methylbut-2-en-1-yl)amino]purine * Isopentenyladenine derivatives * N9-Substituted derivatives * Cytokinins * Cytokinin receptors Subject RIV: EF - Botanics Impact factor: 2.921, year: 2011

2D QSAR studies of the inhibitory activity of a series of substituted purine derivatives against c-Src tyrosine kinase

OpenAIRE

Mukesh C. Sharma

2016-01-01

A series of 34 substituted purine analogues derivatives were subjected to quantitative structure-activity relationship analyses as inhibitors of c-Src tyrosine kinase. Partial least squares regression was applied to derive QSAR models, which were further validated for statistical significance by internal and external validation. The best QSAR model developed had a good predictive correlation coefficient (r2) of 0.8319, a significant cross-validated correlation coefficient (q2) of 0.7550, and ...

Srtucture and properties of intracomplexes of 2-substituted 8-mercaptoquinoline derivatives

International Nuclear Information System (INIS)

Sturis, A.P.; Bankovskij, Yu.A.; Pech, L.Ya.

1990-01-01

The results of investigation of the molecular and crystal structure of 2-substituted 8-mercaptoquinoline internal complexes (in particular complexes of cadmium and indium) have been reviewed. Substitution of hydrogen atom in o-position in relation to the nitrogen atom in the ligand molecule causes the steric hindrance in the molecules of complexes. Due to it the changes in structure of the central atom coordination center in the MR 2 complexes from the planar (8-mercaptoquinolinates) to the distored tetrahedral (2-substituted 8-mercaptoquinolinates) occur. The ascertainment of such effect allows to explain the changes in physicochemical properties of 2-substituted 8-mercaptoquinolinates (hypsochromic shift of absorption maxima, decrease of the amount of ligands connected to the central atom, decrease of stability, increase of solubility in organic solvents) in comparison with 8-mercaptoquinolinates

Synthesis of 2-azetidinones substituted quinoline derivative

Directory of Open Access Journals (Sweden)

Mashelkar Uday C.

2013-01-01

Full Text Available Acetanilide is converted into 2-chloro-3-formyl quinoline by reacting with DMF-POCl3 at 80-90ºC and then condensed with aromatic primary amines to give Schiff bases (3a-3c. These Schiff bases are then reacted with acid chlorides in the presence of base in toluene to give 1, 3, 4-substituted 2-azetidinones.

Emitting materials based on phenylanthracene-substituted naphthalene derivatives for organic light-emitting diodes

Energy Technology Data Exchange (ETDEWEB)

Lee, Hyun Woo; Kim, Hye Jeong; Kim, Young Seok; Kim, Jwajin [Department of Chemistry, Sungkyunkwan University, Suwon 440‐746 (Korea, Republic of); Lee, Song Eun; Lee, Ho Won [Department of Information Display, Hongik University, Seoul 121-791 (Korea, Republic of); Kim, Young Kwan, E-mail: kimyk@wow.hongik.ac.kr [Department of Information Display, Hongik University, Seoul 121-791 (Korea, Republic of); Yoon, Seung Soo, E-mail: ssyoon@skku.edu [Department of Chemistry, Sungkyunkwan University, Suwon 440‐746 (Korea, Republic of)

2015-09-15

This study reports the emitting materials based on phenylanthracene-substituted naphthalene derivatives to achieve efficient electroluminescent properties for OLED applications. An OLED device using 4,4′-bis(10-phenylanthracen-9-yl)-1,1′-binaphthalene exhibited the blue emission with the CIE coordinates of (0.19, 0.16) and efficient electroluminescent properties with the luminance, power and external quantum efficiency of 1.70 cd/A, 0.79 lm/W and 1.26% at 20 mA/cm{sup 2}, respectively. Also, the other device using 1,4-bis(10-phenylanthracene-9-yl)naphthalene exhibited white emission with the CIE coordinates of (0.34, 0.43) at 7V, respectively. This device exhibits the luminance, power and external quantum efficiency of 2.22 cd/A, 1.13 lm/W and 0.86% at 20 mA/cm{sup 2}, respectively. - Highlights: • We synthesized fluorescent materials based on phenylanthracene derivatives. • Electroluminescence properties of these materials depend on the molecular structures. • These blue and white materials have great potential for application in OLEDs.

Emitting materials based on phenylanthracene-substituted naphthalene derivatives for organic light-emitting diodes

International Nuclear Information System (INIS)

Lee, Hyun Woo; Kim, Hye Jeong; Kim, Young Seok; Kim, Jwajin; Lee, Song Eun; Lee, Ho Won; Kim, Young Kwan; Yoon, Seung Soo

2015-01-01

This study reports the emitting materials based on phenylanthracene-substituted naphthalene derivatives to achieve efficient electroluminescent properties for OLED applications. An OLED device using 4,4′-bis(10-phenylanthracen-9-yl)-1,1′-binaphthalene exhibited the blue emission with the CIE coordinates of (0.19, 0.16) and efficient electroluminescent properties with the luminance, power and external quantum efficiency of 1.70 cd/A, 0.79 lm/W and 1.26% at 20 mA/cm 2 , respectively. Also, the other device using 1,4-bis(10-phenylanthracene-9-yl)naphthalene exhibited white emission with the CIE coordinates of (0.34, 0.43) at 7V, respectively. This device exhibits the luminance, power and external quantum efficiency of 2.22 cd/A, 1.13 lm/W and 0.86% at 20 mA/cm 2 , respectively. - Highlights: • We synthesized fluorescent materials based on phenylanthracene derivatives. • Electroluminescence properties of these materials depend on the molecular structures. • These blue and white materials have great potential for application in OLEDs

Operator substitution

NARCIS (Netherlands)

Hautus, M.L.J.

1994-01-01

Substitution of an operator into an operator-valued map is defined and studied. A Bezout-type remainder theorem is used to derive a number of results. The tensor map is used to formulate solvability conditions for linear matrix equations. Some applications to system theory are given, in particular

Determination of Structural Requirements of N-Substituted Tetrahydro-β-Carboline Imidazolium Salt Derivatives Using in Silico Approaches for Designing MEK-1 Inhibitors

Directory of Open Access Journals (Sweden)

Jingwei Liang

2017-06-01

Full Text Available Novel N-substituted tetrahydro-β-carboline imidazolium salt derivatives proved to have potent antitumor activity in past research. The Topomer CoMFA and CoMSIA function in Sybyl-X 2.0 software was applied for the identification of important features of N-substituted tetrahydro-β-carboline-imidazolium salt derivative moieties. In the case of Topomer CoMFA, all the compounds were split into two fragments which were used to generate a 3D invariant representation, the statistical results of the Topomer CoMFA model: q2 value of 0.700; r2 value of 0.954; with 5 optimum components. The database alignment was utilized for building the CoMSIA model, and the CoMSIA model had q2 and r2 values of 0.615 and 0.897, with 4 optimum components. Target fishing of the PharmMapper platform was utilised for finding potential targets, the human mitogen-activated protein kinase 1 (MEK-1 was found to be the primary potential target for the three compounds with the fit scores of 6.288, 5.741, and 6.721. The molecular docking technique of MOE 2015 was carried out to identify the interactions of amino acids surrounding the ligand, and correlating QASR contour maps were used to identify structural requirements of N-substituted tetrahydro-β-carboline imidazolium salt moieties. Molecular dynamics and simulation studies proved that the target protein was stable for 0.8–5 ns. The pivotal moieties of N-substituted tetrahydro-β-carboline imidazolium salt derivatives and its potential targets were verified by the QASR study, PharmMapper, and the molecular docking study which would be helpful to design novel MEK-1 inhibitors for anticancer drugs.

Basicity comparison for di-substituted 4-nitropyridine derivatives in polar non-aqueous media

International Nuclear Information System (INIS)

Gurzynski, Lukasz; Puszko, Aniela; Chmurzynski, Lech

2007-01-01

Acid dissociation, as well as cationic homoconjugation equilibria have been studied potentiometrically in systems involving four di-substituted 4-nitropyridines and conjugate cationic acids in the polar non-aqueous solvents - aprotic protophobic acetonitrile (AN) and propylene carbonate (PC), the amphiprotic methanol (MeOH), and in the aprotic protophilic dimethyl sulfoxide (DMSO). The influence of solvent effect on the obtained acidity constants has been discussed. The acidity constants (expressed as pK a values) were compared with those previously determined in another polar protophobic aprotic solvent - acetone (AC), and obtained for the unsubstituted pyridine (Py). A comparison of the acid dissociation constants determined in all media studied has proved that the strength of the cationic acids increases on going from acetonitrile through propylene carbonate, acetone, and methanol to dimethyl sulfoxide. Furthermore, the values of acidity constants in the non-aqueous media have shown that in all the solvents studied they change according to the substituent effects. It has been also found that substituted 4-nitropyridine derivatives studied exhibit no tendency towards cationic homoconjugation in acetonitrile, propylene carbonate, and methanol and dimethyl sulfoxide. Moreover, it has been demonstrated that the acid dissociation constants determined by potentiometric titration method in all the solutions investigated correlate well with the calculated energy parameters of the protonation reactions in the gaseous phase

Basicity comparison for di-substituted 4-nitropyridine derivatives in polar non-aqueous media

Energy Technology Data Exchange (ETDEWEB)

Gurzynski, Lukasz [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Puszko, Aniela [Department of Organic Chemistry, School of Economics, Wroclaw (Poland); Chmurzynski, Lech [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland)], E-mail: lech@chemik.chem.univ.gda.pl

2007-12-15

Acid dissociation, as well as cationic homoconjugation equilibria have been studied potentiometrically in systems involving four di-substituted 4-nitropyridines and conjugate cationic acids in the polar non-aqueous solvents - aprotic protophobic acetonitrile (AN) and propylene carbonate (PC), the amphiprotic methanol (MeOH), and in the aprotic protophilic dimethyl sulfoxide (DMSO). The influence of solvent effect on the obtained acidity constants has been discussed. The acidity constants (expressed as pK{sub a} values) were compared with those previously determined in another polar protophobic aprotic solvent - acetone (AC), and obtained for the unsubstituted pyridine (Py). A comparison of the acid dissociation constants determined in all media studied has proved that the strength of the cationic acids increases on going from acetonitrile through propylene carbonate, acetone, and methanol to dimethyl sulfoxide. Furthermore, the values of acidity constants in the non-aqueous media have shown that in all the solvents studied they change according to the substituent effects. It has been also found that substituted 4-nitropyridine derivatives studied exhibit no tendency towards cationic homoconjugation in acetonitrile, propylene carbonate, and methanol and dimethyl sulfoxide. Moreover, it has been demonstrated that the acid dissociation constants determined by potentiometric titration method in all the solutions investigated correlate well with the calculated energy parameters of the protonation reactions in the gaseous phase.

Asymmetric syntheses of 3,4-disubstituted tetrahydroquinoline derivatives using (+)- sparteine-mediated electrophilic substitution

International Nuclear Information System (INIS)

Choi, Yun Soo; Kang, Kyoung Hee; Park, Yong Sun

2015-01-01

Tetrahydroquinolines bearing substituents are frequently found as a substructure in a number of alkaloids and natural products. Since their individual stereoisomers displays different biological activities, it is desirable to develop a highly stereoselective synthetic method for tetrahydroquinolines. While some progress has recently been made toward the development of asymmetric synthetic methods for tetrahydroquinolines, it is still a challenging topic in organic synthesis. In order to investigate the source of diastereoselection attained in the substitution reaction with a racemic epoxide, we examined the substitution of 2 with an excess amount of racemic p-chlorophenyl-substituted oxirane. We have developed a novel method for the asymmetric synthesis of trans-3,4-diaryl-substituted tetrahy- droquinolines from ortho-substituted N-pivaloyl anilines. The enantioselective process includes (+)-sparteine-mediated stereoselective lithiati on, kinetic resolution of epoxides in substitution, and stereospecific Mitsu nobu cyclization as the key reactions. The simple protocol can provide highly functionalized tetrahydroqu inoline rings and would allow their further functionalization to access more complex target molecules

Asymmetric syntheses of 3,4-disubstituted tetrahydroquinoline derivatives using (+)- sparteine-mediated electrophilic substitution

Energy Technology Data Exchange (ETDEWEB)

Choi, Yun Soo; Kang, Kyoung Hee; Park, Yong Sun [Dept. of Chemistry, Konkuk University, Seoul (Korea, Republic of)

2015-05-15

Tetrahydroquinolines bearing substituents are frequently found as a substructure in a number of alkaloids and natural products. Since their individual stereoisomers displays different biological activities, it is desirable to develop a highly stereoselective synthetic method for tetrahydroquinolines. While some progress has recently been made toward the development of asymmetric synthetic methods for tetrahydroquinolines, it is still a challenging topic in organic synthesis. In order to investigate the source of diastereoselection attained in the substitution reaction with a racemic epoxide, we examined the substitution of 2 with an excess amount of racemic p-chlorophenyl-substituted oxirane. We have developed a novel method for the asymmetric synthesis of trans-3,4-diaryl-substituted tetrahy- droquinolines from ortho-substituted N-pivaloyl anilines. The enantioselective process includes (+)-sparteine-mediated stereoselective lithiati on, kinetic resolution of epoxides in substitution, and stereospecific Mitsu nobu cyclization as the key reactions. The simple protocol can provide highly functionalized tetrahydroqu inoline rings and would allow their further functionalization to access more complex target molecules.

Synthesis and Bioactivity of N-Benzoyl-N'-[5-(2'-substituted phenyl-2-furoyl] Semicarbazide Derivatives

Directory of Open Access Journals (Sweden)

Zining Cui

2010-06-01

Full Text Available In order to find novel chitin synthesis inhibitors (CSIs with good activity, benzoylphenylurea, a typical kind of CSIs, was chosen as the lead compound and 15 novel derivatives containing furan moieties were designed by converting the urea linkage of benzoylphenylureas into a semicarbazide and changing the aniline part into furoyl groups. The title compounds were synthesized by the reaction of substituted benzoyl isocyanates with 5-(substituted phenyl-2-furoyl hydrazine, and the structures were confirmed by IR, 1H-NMR, elemental analysis and single crystal X-ray diffraction analyses (compound E2. The bioassay results indicated that the title compounds exhibit good insecticidal activity, especially towards Plutella xylostella L., but had lower fungicidal activity. Inspiringly, the title compounds possessed obvious anticancer activity against human promyelocytic leukemic cell line (HL-60, and some of the title compounds also had activity against human hepatocellular carcinoma cell line (Bel-7402, human gastric carcinoma cell line (BGC-823, and human nasopharyngeal carcinoma cell line (KB. The results indicated that the linkage in the lead compounds was important to the bioactivity and spectra. The modification on the urea linkage is an effective strategy to discover new pesticide and drug candidates.

N-substituted iminodiacetic acids

International Nuclear Information System (INIS)

Nunn, A.; Loberg, M.

1982-01-01

The chemical preparation of several new N-substituted iminodiacetic acid derivatives are described. These compounds when complexed with sup(99m)Tc provide useful radiopharmaceuticals for the external imaging of the hepatobiliary system. (U.K.)

Preparation of 7-substituted ginkgolide derivatives

DEFF Research Database (Denmark)

Vogensen, Stine Byskov; Strømgaard, Kristian; Shindou, Hideo

2003-01-01

alpha-fluoro ginkgolide B was equipotent to ginkgolide B underlining the critical importance of the 7-position of ginkgolides for PAF receptor activity. Herein we describe the synthesis of a series of ginkgolide B derivatives with modifications at the 7-position and the pharmacological evaluation...... of these derivatives as assayed by cloned PAF receptors. In two cases nucleophilic attack on a 7beta-O-triflate ginkgolide B did not lead to the expected products, but gave rise to two unprecedented ginkgolide derivatives, one with a novel rearranged skeleton. Furthermore, standard reduction of 7alpha-azido ginkgolide......-chloro ginkgolide B, the most potent nonaromatic ginkgolide derivative described to date with a K(i) value of 110 nM....

The substitution bias of the consumer price index

OpenAIRE

Frenger, Petter

2006-01-01

Abstract: The paper uses elementary consumer theory to propose an inflation independent ratio definition of the substitution bias of the Laspeyres consumer price index, and derives an approximate substitution bias which depends on the size of the price change as measured by a norm in the Laspeyres plane and on the elasticity of substitution in the direction of the price change. This norm or distance measure can be interpreted as a price substitution index which yields useful in...

Design, Synthesis and Evaluation of N13-Substituted Evodiamine Derivatives against Human Cancer Cell Lines

Directory of Open Access Journals (Sweden)

Senchuan Song

2013-12-01

Full Text Available Attempting to improve the anticancer activity and solubility of evodiamine in simulated gastric fluid (SGF and simulated intestinal fluid (SIF solutions, thirty-eight N13-substituted evodiamine derivatives were designed, synthesized and tested for antitumor activities against six kinds of human cancer cell lines, namely prostate cancer (DU-145 and PC-3, lung cancer (H460, breast cancer (MCF-7, colon cancer (HCT-5 and glioblastoma (SF-268. The solubility of these compounds in SGF and SIF solutions was evaluated, and apoptosis induced by 2-2, 2-3, 2-16 and 3-2 was determined. The results showed: (1 among all compounds examined, 2-16 showed the highest antitumor activity and a broader spectrum of activity, with IC50 values ranging from 1–2 µM; (2 their solubility was obviously improved; (3 2-3, 2-16 and 3-2 had a significant impact inducing apoptosis in some cancer cell lines. The preliminary structure-activity relationships of these derivatives were discussed.

Efficient continuous-flow synthesis of novel 1,2,3-triazole-substituted β-aminocyclohexanecarboxylic acid derivatives with gram-scale production

Directory of Open Access Journals (Sweden)

Sándor B. Ötvös

2013-07-01

Full Text Available The preparation of novel multi-substituted 1,2,3-triazole-modified β-aminocyclohexanecarboxylic acid derivatives in a simple and efficient continuous-flow procedure is reported. The 1,3-dipolar cycloaddition reactions were performed with copper powder as a readily accessible Cu(I source. Initially, high reaction rates were achieved under high-pressure/high-temperature conditions. Subsequently, the reaction temperature was lowered to room temperature by the joint use of both basic and acidic additives to improve the safety of the synthesis, as azides were to be handled as unstable reactants. Scale-up experiments were also performed, which led to the achievement of gram-scale production in a safe and straightforward way. The obtained 1,2,3-triazole-substituted β-aminocyclohexanecarboxylates can be regarded as interesting precursors for drugs with possible biological effects.

Ultrasound-Promoted Greener Synthesis of Novel Trifurcate 3-Substituted-chroman-2,4-dione Derivatives and Their Drug-Likeness Evaluation

Directory of Open Access Journals (Sweden)

Yu Xue

2012-11-01

Full Text Available An efficient and convenient approach for one-pot synthesis of 3-substituted chroman-2,4-diones via a three-component reaction of aromatic aldehydes, 4-hydroxy- coumarins and diverse pyrazolone derivatives was described. The combinatorial synthesis for this methodology was achieved by applying ultrasound irradiation in the absence of activator while making use of water as green solvent. Additionally, novel chroman-2,4-dione derivatives attached to an edaravone moiety represent an exploitable source of brand new anticancer agents. In comparison with conventional methods, experimental simplicity, good functional group tolerance, excellent yields, short routine, and atom efficiency are prominent features of this sonocatalyzed procedure.

Synthesis and Biological Evaluation of Novel 2-Methoxypyridylamino-Substituted Riminophenazine Derivatives as Antituberculosis Agents

Directory of Open Access Journals (Sweden)

Dongfeng Zhang

2014-04-01

Full Text Available Clofazimine, a member of the riminophenazine class, is one of the few antibiotics that are still active against multidrug-resistant Mycobacterium tuberculosis (M. tuberculosis. However, the clinical utility of this agent is limited by its undesirable physicochemical properties and skin pigmentation potential. With the goal of maintaining potent antituberculosis activity while improving physicochemical properties and lowering skin pigmentation potential, a series of novel riminophenazine derivatives containing a 2-methoxypyridylamino substituent at the C-2 position of the phenazine nucleus were designed and synthesized. These compounds were evaluated for antituberculosis activity against M. tuberculosis H37Rv and screened for cytotoxicity. Riminophenazines bearing a 3-halogen- or 3,4-dihalogen-substituted phenyl group at the N-5 position exhibited potent antituberculosis activity, with MICs ranging from 0.25~0.01 μg/mL. The 3,4-dihalogen- substituted compounds displayed low cytotoxicity, with IC50 values greater than 64 μg/mL. Among these riminophenazines, compound 15 exhibited equivalent in vivo efficacy against M. tuberculosis infection and reduced skin discoloration potential in an experimental mouse infection model as compared to clofazimine. Compound 15, as compared to clofazimine, also demonstrated improved physicochemical properties and pharmacokinetic profiles with a short half-life and less drug tissue accumulation. This compound is being evaluated as a potential drug candidate for the treatment of multidrug resistant tuberculosis.

Biological relevance and synthesis of C-substituted morpholine derivatives

NARCIS (Netherlands)

Wijtmans, R.; Vink, M.K.S.; Schoemaker, H.E.; Delft, F.L. van; Blaauw, R.H.; Rutjes, F.P.J.T.

2004-01-01

C-Functionalized morpholines are found in a variety of natural products and biologically active compounds, but have also for other reasons been applied in organic synthesis. This review deals with the biological relevance of C-substituted morpholines, their synthesis and important applications in

Pyridine substituted spirofluorene derivative as an electron transport material for high efficiency in blue organic light-emitting diodes

Energy Technology Data Exchange (ETDEWEB)

Jeon, Soon Ok; Yook, Kyoung Soo; Lee, Jun Yeob, E-mail: leej17@dankook.ac.k

2010-11-01

The quantum efficiency of blue fluorescent organic light-emitting diodes was enhanced by 20% using a pyridine substituted spirofluorene-benzofluorene derivative as an electron transport material. 2',7'-Di(pyridin-3-yl)spiro[benzofluorene-7,9'-fluorene] (SPBP) was synthesized and it was used as the electron transport material to block the hole leakage from the emitting layer. The improvement of the quantum efficiency and power efficiency of the blue fluorescent organic light-emitting diodes using the SPBP was investigated.

Nonpeptidic angiotensin II AT₁ receptor antagonists derived from 6-substituted aminocarbonyl and acylamino benzimidazoles.

Science.gov (United States)

Zhang, Jun; Wang, Jin-Liang; Yu, Wei-Fa; Zhou, Zhi-Ming; Tao, Wen-Chang; Wang, Yi-Cheng; Xue, Wei-Zhe; Xu, Di; Hao, Li-Ping; Han, Xiao-Feng; Fei, Fan; Liu, Ting; Liang, Ai-Hua

2013-11-01

Both 6-substituted aminocarbonyl and acylamino benzimidazole derivatives were designed and synthesized as nonpeptidic angiotensin II AT₁ receptor antagonists. Compounds 6f, 6g, 11e, 11f, 11g, and 12 showed nanomolar AT₁ receptor binding affinity and high AT₁ receptor selectivity over AT₂ receptor in a preliminary pharmacological evaluation. Among them, the two most active compounds 6f (AT₁ IC₅₀ = 3 nM, AT₂ IC₅₀ > 10,000 nM, PA₂ = 8.51) and 11g (AT₁ IC₅₀ = 0.1 nM, AT₂ IC₅₀ = 149 nM, PA₂ = 8.43) exhibited good antagonistic activity in isolated rabbit aortic strip functional assay. In addition, they were orally active AT₁ receptor antagonists in spontaneous hypertensive rats. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Antimalarial Activity of C-10 Substituted Triazolyl Artemisinin.

Science.gov (United States)

Park, Gab-Man; Park, Hyun; Oh, Sangtae; Lee, Seokjoon

2017-12-01

We synthesized C-10 substituted triazolyl artemisinins by the Huisgen cycloaddition reaction between dihydroartemisinins (2) and variously substituted 1, 2, 3-triazoles (8a-8h). The antimalarial activities of 32 novel artemisinin derivatives were screened against a chloroquine-resistant parasite. Among them, triazolyl artemisinins with electron-withdrawing groups showed stronger antimalarial activities than those shown by the derivatives having electron-donating groups. In particularly, m-chlorotriazolyl artemisinin (9d-12d) showed antimalarial activity equivalent to that of artemisinin and could be a strong drug candidate.

Synthesis of Substituted α-Trifluoromethyl Piperidinic Derivatives

Directory of Open Access Journals (Sweden)

Sarah Rioton

2017-03-01

Full Text Available A comprehensive survey of pathways leading to the generation of α-trifluoromethyl monocyclic piperidinic derivatives is provided (65 references. These compounds have been synthesized either from 6-membered rings e.g., pipecolic acid or lactam derivatives by introduction a trifluoromethyl group, from pyridine or pyridinone derivatives by reduction, and from 5-membered rings e.g., prolinol derivatives by ring expansion, from linear amines by cyclization or from dienes/dienophiles by [4 + 2]-cycloaddition.

Synthesis of 3-(4, 5-dihydro-1-phenyl-5-substituted phenyl-1H-pyrazol-3-yl-2H-chromen-2-one derivatives and evaluation of their anticancer activity

Directory of Open Access Journals (Sweden)

Nitin Kumar

2017-05-01

Full Text Available A novel series of 3-(4, 5-dihydro-1-phenyl-5-substituted phenyl-1H-pyrazol-3-yl-2H-chromen-2-one derivatives were synthesized. In the first step salicylaldehyde was reacted with ethylacetoacetate at room temperature by stirring which gives compound (I. Compound (I when refluxed with substituted benzaldehyde and diethylamine in the presence of n-butanol for 4–5 h gives substituted derivatives (IIa–d. Compounds synthesized in step 2 when refluxed with phenyl hydrazine in the presence of pyridine for 6–7 h gives the title compounds (IIIa–d. All the synthesized compounds were sent to NCI for anticancer activity. Synthesized compounds were tested for anticancer activity against 60 different cell lines. From the data thus obtained it was observed that simple coumarin ring derivatives were more effective in inhibiting the growth of cancerous cell lines, than coumarin-pyrazoline derivatives. Among all the synthesized compounds, irrespective of compounds having simple coumarin ring and coumarin-pyrazoline combination, compounds IIa–c, IIIb and IIId were potent anticancer agents. Compounds were active for the single dose therapeutic program at the dose of 1.00E-5 molar concentration. The main anti cancer activity is assumed to be due to the presence of the lactone structure in coumarin moiety.

Synthesis, crystal structure, and transport properties of Fe substituted rhombohedral skutterudite derivatives Co4−xFexGe6Se6

KAUST Repository

Wei, Kaya

2014-11-01

We report on the synthesis and low temperature transport properties of rhombohedral derivatives of the cubic skutterudite CoSb3, namely Co4-xFexGe6Se6 with x = 0, 1, 1.5. Rietveld refinement and elemental analyses were used to identify the structure and stoichiometry of the compositions. The thermal conductivity was investigated by employing the Debye model with different phonon-scattering parameters. This investigation demonstrates that Fe substitution is feasible in these skutterudite derivatives and can significantly affect the transport properties as compared with Co4Ge6Se6. © 2014 Elsevier B.V. All rights reserved.

Synthesis, crystal structure, and transport properties of Fe substituted rhombohedral skutterudite derivatives Co4−xFexGe6Se6

KAUST Repository

Wei, Kaya; Dong, Yongkwan; Puneet, Pooja; Tritt, Terry M.; Nolas, George S.

2014-01-01

We report on the synthesis and low temperature transport properties of rhombohedral derivatives of the cubic skutterudite CoSb3, namely Co4-xFexGe6Se6 with x = 0, 1, 1.5. Rietveld refinement and elemental analyses were used to identify the structure and stoichiometry of the compositions. The thermal conductivity was investigated by employing the Debye model with different phonon-scattering parameters. This investigation demonstrates that Fe substitution is feasible in these skutterudite derivatives and can significantly affect the transport properties as compared with Co4Ge6Se6. © 2014 Elsevier B.V. All rights reserved.

Convergent synthesis of 6-substituted phenanthridines via anionic ring closure

DEFF Research Database (Denmark)

Lysén, M.; Kristensen, Jesper Langgaard; Vedsø, P.

2002-01-01

Chemical equation presented The addition of organometallic derivatives to the cyano group of 2-(2-fluorophenyl)benzonitrile followed by intramolecular nucleophilic substitution produces 6-substituted phenanthridines. Alkyllithiums, aryllithiums, and sterically nondemanding lithium amides reacted ...

Pyridine-substituted thiazolylphenol derivatives: Synthesis, modeling studies, aromatase inhibition, and antiproliferative activity evaluation.

Science.gov (United States)

Ertas, Merve; Sahin, Zafer; Berk, Barkin; Yurttas, Leyla; Biltekin, Sevde N; Demirayak, Seref

2018-04-01

Drugs used in breast cancer treatments target the suppression of estrogen biosynthesis. During this suppression, the main goal is to inhibit the aromatase enzyme that is responsible for the cyclization and structuring of estrogens either with steroid or non-steroidal-type inhibitors. Non-steroidal derivatives generally have a planar aromatic structure attached to the triazole ring system in their structures, which inhibits hydroxylation reactions during aromatization by coordinating the heme group. Bioisosteric replacement of the triazole ring system and development of aromatic/cyclic structures of the side chain can increase the selectivity for aromatase enzyme inhibition. In this study, pyridine-substituted thiazolylphenol derivatives, which are non-steroidal triazole bioisosteres, were synthesized using the Hantzsch method, and physical analysis and structural determination studies were performed. The IC 50 values of the compounds were determined by a fluorescence-based aromatase inhibition assay. Then, their antiproliferative activities on the MCF7 and HEK 293 cell lines were evaluated with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Furthermore, the crystal structure of human placental aromatase was subjected to a series of docking experiments to identify the possible interactions between the most active structure and the active site. Lastly, an in silico technique was performed to analyze and predict the drug-likeness, molecular and ADME properties of the synthesized molecules. © 2018 Deutsche Pharmazeutische Gesellschaft.

Exploring the potential of high resolution mass spectrometry for the investigation of lignin-derived phenol substitutes in phenolic resin syntheses.

Science.gov (United States)

Dier, Tobias K F; Fleckenstein, Marco; Militz, Holger; Volmer, Dietrich A

2017-05-01

Chemical degradation is an efficient method to obtain bio-oils and other compounds from lignin. Lignin bio-oils are potential substitutes for the phenol component of phenol formaldehyde (PF) resins. Here, we developed an analytical method based on high resolution mass spectrometry that provided structural information for the synthesized lignin-derived resins and supported the prediction of their properties. Different model resins based on typical lignin degradation products were analyzed by electrospray ionization in negative ionization mode. Utilizing enhanced mass defect filter techniques provided detailed structural information of the lignin-based model resins and readily complemented the analytical data from differential scanning calorimetry and thermogravimetric analysis. Relative reactivity and chemical diversity of the phenol substitutes were significant determinants of the outcome of the PF resin synthesis and thus controlled the areas of application of the resulting polymers. Graphical abstract ᅟ.

Molecular glues for manipulating enzymes: trypsin inhibition by benzamidine-conjugated molecular glues† †Electronic supplementary information (ESI) available: Synthesis of TEG–BA, Gluen–BA, mGluen–BA and Gluen–Ph; 1H NMR, 13C NMR, MALDI-TOF MS, electronic absorption, and CD spectra; zeta potential distributions; SLS plots; DLS histograms; and related experimental procedures. See DOI: 10.1039/c5sc00524h Click here for additional data file.

Science.gov (United States)

Mogaki, Rina

2015-01-01

Water-soluble bioadhesive polymers bearing multiple guanidinium ion (Gu+) pendants at their side-chain termini (Gluen–BA, n = 10 and 29) that were conjugated with benzamidine (BA) as a trypsin inhibitor were developed. The Gluen–BA molecules are supposed to adhere to oxyanionic regions of the trypsin surface, even in buffer, via a multivalent Gu+/oxyanion salt-bridge interaction, such that their BA group properly blocks the substrate-binding site. In fact, Glue10–BA and Glue29–BA exhibited 35- and 200-fold higher affinities for trypsin, respectively, than a BA derivative without the glue moiety (TEG–BA). Most importantly, Glue10–BA inhibited the protease activity of trypsin 13-fold more than TEG–BA. In sharp contrast, mGlue27–BA, which bears 27 Gu+ units along the main chain and has a 5-fold higher affinity than TEG–BA for trypsin, was inferior even to TEG–BA for trypsin inhibition. PMID:28706668

Structure-Activity Relationships of Truncated C2- or C8-Substituted Adenosine Derivatives as Dual Acting A2A and A3 Adenosine Receptor Ligands

Science.gov (United States)

Hou, Xiyan; Majik, Mahesh S.; Kim, Kyunglim; Pyee, Yuna; Lee, Yoonji; Alexander, Varughese; Chung, Hwa-Jin; Lee, Hyuk Woo; Chandra, Girish; Lee, Jin Hee; Park, Seul-gi; Choi, Won Jun; Kim, Hea Ok; Phan, Khai; Gao, Zhan-Guo; Jacobson, Kenneth A.; Choi, Sun; Lee, Sang Kook; Jeong, Lak Shin

2011-01-01

Truncated N6-substituted-4′-oxo- and 4′-thioadenosine derivatives with C2 or C8 substitution were studied as dual acting A2A and A3 adenosine receptor (AR) ligands. The lithiation-mediated stannyl transfer and palladium-catalyzed cross coupling reactions were utilized for functionalization of the C2 position of 6-chloropurine nucleosides. An unsubstituted 6-amino group and a hydrophobic C2 substituent were required for high affinity at the hA2AAR, but hydrophobic C8 substitution abolished binding at the hA2AAR. However, most of synthesized compounds displayed medium to high binding affinity at the hA3AR, regardless of C2 or C8 substitution, and low efficacy in a functional cAMP assay. Several compounds tended to be full hA2AAR agonists. C2 substitution probed geometrically through hA2AAR-docking, was important for binding in order of hexynyl > hexenyl > hexanyl. Compound 4g was the most potent ligand acting dually as hA2AAR agonist and hA3AR antagonist, which might be useful for treatment of asthma or other inflammatory diseases. PMID:22142423

Synthesis of Novel Benzimidazolyl-substituted Acrylonitriles and Amidino-substituted Benzimidazo[1,2-a]Quinolines

Directory of Open Access Journals (Sweden)

Grace Karminski-Zamola

2006-08-01

Full Text Available A series of novel benzimidazole derivatives 3-10 were synthesized. Benzimidazolyl-substituted acrylonitriles 3 and 4 underwent a photochemical dehydrocyclization reaction to give the corresponding mono- and dicyano-substituted benzimidazo[1,2-a] quinolines 5 and 6. Pinner reaction of these compounds did not give the expected mono- and diamidines, but rather only compounds 7-10, with amido groups at 6-position were isolated. A mechanism for the reaction is proposed. Acyclic compounds 3 and 4, as well as cyclic benzimidazo[1,2-a]quinolines 5-8, exhibit interesting spectroscopic properties and are potential biologically active compounds.

Eosin-sensitized photooxidation of substituted phenylalanines and tyrosines

Energy Technology Data Exchange (ETDEWEB)

Rizzuto, F.; Spikes, J.D.

1977-01-01

The cosin-sensitized photooxidation of tyrosine and a number of compounds related to tyrosine (substituted phenylalanines) was studied by steady-state kinetic and flash photolysis techniques. In particular, the role of the phenolic group and the amino and carboxyl groups of the alanyl side chain in the photooxidation mechanism was investigated in detail. Several relationships between substrate structure and susceptibility to photooxidation as well as effects of substrate structure on photooxidation mechanisms were found. For example, phenylalanine is not photooxidizable, but substitution of electron-donating (activating) groups such as -OH (as in tyrosine) or -NH/sub 2/ (as in p-aminophenylalanine) results in rapidly photooxidized derivatives. However, substituting deactivating groups such as -Cl (as in p-chlorophenylalanine) or weakly activating groups such as -OCH/sub 3/ (as in 4-methoxyphenylalanine) result in non-photooxidizable derivatives. Substitution of additional activating groups to the ring of hydroxy-substituted phenylalanines results in increased rates of photooxidation, whereas additional deactivating groups result in decreased photooxidation rates. The rate-determining step in the photooxidation mechanism is shown to be dependent on the presence and position of an electron-donating substituent on the benzenoid ring. Only minor involvement of the side chain amino and carboxyl groups was found. Both singlet oxygen and hydrogen abstraction mechanisms are involved in the eosin-sensitized photooxidation of hydroxy-substituted phenylalanines (e.g., tyrosine). The hydrogen abstraction mechanism probably predominates at both pH 8 and 11.

Si-substituted hydroxyapatite nanopowders: Synthesis, thermal stability and sinterability

International Nuclear Information System (INIS)

Bianco, Alessandra; Cacciotti, Ilaria; Lombardi, Mariangela; Montanaro, Laura

2009-01-01

Synthetic hydroxyapatites incorporating small amounts of Si have shown improved biological performances in terms of enhanced bone apposition, bone in-growth and cell-mediated degradation. This paper reports a systematic investigation on Si-substituted hydroxyapatite (Si 1.40 wt%) nanopowders produced following two different conventional wet methodologies: (a) precipitation of Ca(NO 3 ) 2 .4H 2 O and (b) titration of Ca(OH) 2 . The influence of the synthesis process on composition, thermal behaviour and sinterability of the resulting nanopowders is studied. Samples were characterised by electron microscopy, induced coupled plasma atomic emission spectroscopy, thermal analysis, infrared spectroscopy, N 2 adsorption measurements, X-ray diffraction and dilatometry. Semicrystalline Si-substituted hydroxyapatite powders made up of needle-like nanoparticles were obtained, the specific surface area ranged between 84 and 110 m 2 /g. Pure and Si-substituted hydroxyapatite nanopowders derived from Ca(NO 3 ) 2 .4H 2 O decomposed around 1000 deg. C. Si-substituted hydroxyapatite nanopowders obtained from Ca(OH) 2 were thermally stable up to 1200 deg. C and showed a distinct decreased thermal stability with respect to the homologous pure sample. Si-substituted hydroxyapatites exhibited higher sintering temperature and increased total shrinkage with respect to pure powders. Nanostructured dense ceramics were obtained by sintering at 1100 deg. C Si-substituted hydroxyapatites derived from Ca(OH) 2

40 CFR 721.981 - Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex.

Science.gov (United States)

2010-07-01

... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...

Progesterone radioimmunoassay with the use of progesterone derivative substituted at 12α position

International Nuclear Information System (INIS)

Kula, E.; Stupnicka, R.

1981-01-01

A direct (non-extraction) radioimmunoassay method for progesterone determination in blood plasma has been presented. A new progesterone derivative substituted at 12α position was used as antigen for production of antibody. Cheap and easily accessible substrate -deoxycholic acid - was used as starting material for 9 step degradation procedure yielding 12α-hydroxy-progesterone. The latter compound was subsequently esterified with succinic anhydrine and conjugated with bovine serum albumin. The conjugate was then used for the immunization of rabbits to obtain immune antisera. After the detailed characterization, the obtained antibodies have been used for the determination of progesterone in human and cattle blood plasma. Transcortin present in samples used for the determinations was saturated with the excess of cortisol. The sensitivity of the method was found to be 5 pg in a sample, which corresponds to the concentration of about 0.25 ng/ml in blood plasma, in as much as the volume of plasma used for analysis was 20 ml. The within-series error was 7% when progesterone concentration in plasma samples was higher than 2.5 ng/ml. (author)

Cation Radical Accelerated Nucleophilic Aromatic Substitution via Organic Photoredox Catalysis.

Science.gov (United States)

Tay, Nicholas E S; Nicewicz, David A

2017-11-15

Nucleophilic aromatic substitution (S N Ar) is a direct method for arene functionalization; however, it can be hampered by low reactivity of arene substrates and their availability. Herein we describe a cation radical-accelerated nucleophilic aromatic substitution using methoxy- and benzyloxy-groups as nucleofuges. In particular, lignin-derived aromatics containing guaiacol and veratrole motifs were competent substrates for functionalization. We also demonstrate an example of site-selective substitutive oxygenation with trifluoroethanol to afford the desired trifluoromethylaryl ether.

Facile Synthesis of N -Substituted Benzimidazoles

NARCIS (Netherlands)

Kurhade, Santosh; Rossetti, Arianna; Dömling, Alexander

2016-01-01

A particularly mild and efficient one-pot synthesis of N-substituted benzimidazole derivatives was developed. 2-Fluoro-5-nitrophenylisocyanide reacts with a diverse set of primary amines to afford the respective products in moderate to very good yield (35-95%; 20 examples).

Synthesis of Randomly Substituted Anionic Cyclodextrins in Ball Milling

Directory of Open Access Journals (Sweden)

László Jicsinszky

2017-03-01

Full Text Available A number of influencing factors mean that the random substitution of cyclodextrins (CD in solution is difficult to reproduce. Reaction assembly in mechanochemistry reduces the number of these factors. However, lack of water can improve the reaction outcomes by minimizing the reagent’s hydrolysis. High-energy ball milling is an efficient, green and simple method for one-step reactions and usually reduces degradation and byproduct formation. Anionic CD derivatives have successfully been synthesized in the solid state, using a planetary ball mill. Comparison with solution reactions, the solvent-free conditions strongly reduced the reagent hydrolysis and resulted in products of higher degree of substitution (DS with more homogeneous DS distribution. The synthesis of anionic CD derivatives can be effectively performed under mechanochemical activation without significant changes to the substitution pattern but the DS distributions were considerably different from the products of solution syntheses.

Synthesis and characterization of novel substituted N-benzothiazole-2-yl-acetamides

Directory of Open Access Journals (Sweden)

H.C. Sakarya

2016-11-01

Full Text Available Schiff base derivatives of benzothiazole 2a–e have been synthesized by reacting with substituted 2-aminobenzothiazole 1a–e and different substituted benzaldehydes 5a–e. The obtained Schiff bases reaction with NaBH4 has afforded the corresponding some novel amines 3a–e. The condensation of amines with chloroacetylchloride leads to novel amide derivatives 4a–e. The structures of the synthesized compounds are characterized by elemental analysis, IR, MS, 1H NMR and 13C NMR.

Microwave Assisted Synthesis of N-Arylheterocyclic Substituted-4-aminoquinazoline Derivatives

Directory of Open Access Journals (Sweden)

Ping Lu

2006-04-01

Full Text Available A simple, efficient, and general method has been developed for the synthesis of various N-aryl heterocylic substituted-4-aminoquinazoline compounds from 4-chloro- quinazoline and aryl heterocyclic amines under microwave irradiation using 2-propanol as solvent. The advantages of the use of microwave irradiation in relation to the classical method were demonstrated.

Thermochemical studies on two alkyl-bulky substituted xanthene derivatives: 9,9-dimethylxanthene and 2,7-di-tert-butyl-9,9-dimethylxanthene

International Nuclear Information System (INIS)

Freitas, Vera L.S.; Gomes, José R.B.; Ribeiro da Silva, Maria D.M.C.

2017-01-01

Highlights: • Energetic characterization of two alkyl-bulky substituted xanthene derivatives. • Massic energies of combustion of xanthene derivatives. • Enthalpies of sublimation determined by vacuum drop microcalorimetry technique. • Temperature-vapour pressure dependence by mass-loss Knudsen effusion method. • Gas-phase enthalpies of formation of alkyl xanthene derivatives. - Abstract: Thermodynamic properties of 9,9-dimethylxanthene and 2,7-di-tert-butyl-9,9-dimethylxanthene for the condensed and gas states were derived from experimental and computational studies. Static-bomb combustion calorimetry, vacuum drop microcalorimetry and the Knudsen effusion techniques were used. Computational calculations of the enthalpies of hypothetical reactions in the gaseous phase, using the G3(MP2)//B3LYP composite method, were performed for the two xanthene derivatives. Natural bond orbital (NBO) calculations were also performed to ascertain the structure and reactivity of these compounds. The energetic effects caused by replacing hydrogen atoms in the xanthene moiety by methyl and tert-butyl groups yielding 9,9-dimethylxanthene and 2,7-di-tert-butyl-9,9-dimethylxanthene species were determined from direct comparison of their standard (p o = 0.1 MPa) molar enthalpies of formation in the gaseous phase, at T = 298.15 K.

Cu-catalyzed aerobic oxidative cyclizations of 3-N-hydroxyamino-1,2-propadienes with alcohols, thiols, and amines to form α-O-, S-, and N-substituted 4-methylquinoline derivatives.

Science.gov (United States)

Sharma, Pankaj; Liu, Rai-Shung

2015-03-16

A one-pot, two-step synthesis of α-O-, S-, and N-substituted 4-methylquinoline derivatives through Cu-catalyzed aerobic oxidations of N-hydroxyaminoallenes with alcohols, thiols, and amines is described. This reaction sequence involves an initial oxidation of N-hydroxyaminoallenes with NuH (Nu = OH, OR, NHR, and SR) to form 3-substituted 2-en-1-ones, followed by Brønsted acid catalyzed intramolecular cyclizations of the resulting products. Our mechanistic analysis suggests that the reactions proceed through a radical-type mechanism rather than a typical nitrone-intermediate route. The utility of this new Cu-catalyzed reaction is shown by its applicability to the synthesis of several 2-amino-4-methylquinoline derivatives, which are known to be key precursors to several bioactive molecules. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

SYNTHESIS OF SUBSTITUTED FLAVONE DERIVATIVES AS ...

African Journals Online (AJOL)

Preferred Customer

Flavone (2-phenylchromone) derivatives are naturally occurring heterocyclic compound belongs to the flavanoid group. It showed significant role in pharmaceutical effects [1] including leishmanicidal activity, oviposter stimulant phytoalexins, anti-HIV, vasodilator, antiviral, anti- oxidants, bactericidal, DNA cleavage, ...

Microwave Assisted Synthesis of 2,2'-Arylene-substituted Bis(4H-3,1-Benzoxazin-4-one Derivatives Using the Complex Cyanuric Chloride/N,N-Dimethylformamide

Directory of Open Access Journals (Sweden)

Mehdi Shariat

2012-09-01

Full Text Available A new and efficient method has been designed to prepare 2,2'-arylene-substituted bis(4H-3,1-benzoxazin-4-one derivatives by using the mixture of cyanuric chloride and N,N-dimethylformamide in a microwave-assisted reaction. The method used and presented here has good rate enhancement and excellent yields.

[Anti-arrhythmic action of some amidinohydrazone substituted benzophenones. 1. Synthesis of new amidinohydrazone and N-phenylamidinohydrazone substituted benzophenones].

Science.gov (United States)

Richter, P H; Kasbohm, K; Besch, A; Hagen, A

1992-10-01

The title compounds are synthesized as a rule by condensation of substituted benzophenones and derivatives of aminoguanidine in the presence of up to 2.5 moles of an anorganic acid. They can be obtained alternatively via corresponding hydrazones, thiosemicarbazones or methylthiothiocarbonylhydrazones.

2D QSAR studies of the inhibitory activity of a series of substituted purine derivatives against c-Src tyrosine kinase

Directory of Open Access Journals (Sweden)

Mukesh C. Sharma

2016-07-01

Full Text Available A series of 34 substituted purine analogues derivatives were subjected to quantitative structure-activity relationship analyses as inhibitors of c-Src tyrosine kinase. Partial least squares regression was applied to derive QSAR models, which were further validated for statistical significance by internal and external validation. The best QSAR model developed had a good predictive correlation coefficient (r2 of 0.8319, a significant cross-validated correlation coefficient (q2 of 0.7550, and an r2 for the external test set (pred_r2 of 0.7983. It was developed from the PLS method with descriptors including the SsCH3E-index, H-Donor Count, T_2_Cl_3, and negative correlation with SsOHcount. The current study provides better insight into the future design of more potent c-Src tyrosine kinase inhibitors prior to synthesis.

The elasticity of substitution of superlative price indices

OpenAIRE

Petter Frenger

2005-01-01

Abstract: The paper presents a method for computing the curvature implicit in the use of superlative price indices. It extends the quadratic lemma and allows us to compute the elasticity of substitution of the underlying preferences in the direction of the observed price change for the Törnqvist and the quadratic mean of order r indices. It derives the expressions for the directional shadow elasticity of substitution and applies the results to the Norwegian CPI data base. Ke...

Novel 5-Fluorouracil Derivatives: Synthesis and Cytotoxic Activity of 2-Butoxy-4-Substituted 5-Fluoropyrimidines

International Nuclear Information System (INIS)

Sun, Jian; Zhou, Wei; Hu, Weixiao; Shan, Shang; Zhang, Shijie; Li, Haibo

2013-01-01

Twenty two new 5-fluorouracil (5-FU) derivatives, 2-butoxy-4-substituted 5-fluoropyrimidines, were synthesized and characterized by IR, 1 H NMR, MS, HRMS. All compounds were preliminarily evaluated by MTT assay on human liver BEL-7402 cancer cell line in vitro. Ten compounds were selected to test their cytotoxic activity against A549, HL-60 and MCF-7 cancer cell lines in vitro. These compounds were more sensitive to BEL-7402 than other cell lines, particularly, cytotoxic activity of compounds 6b, 6d-f, 6p, 6s-u were in sub-micromolar scale. The highest cytotoxic potency against A549, HL-60 and MCF-7 was shown by 2-butoxy-4-chloro-5-fluoropyrimidine (5) with IC 50 values of 0.10, 1.66 and 0.59 μM, respectively. Compounds 6d and 6e were effective against MCF-7 with IC 50 9.73 μM and HL-60 with IC 50 8.83 μM, respectively

Halogeno-substituted 2-aminobenzoic acid derivatives for negative ion fragmentation studies of N-linked carbohydrates.

Science.gov (United States)

Harvey, David J

2005-01-01

Negative ion electrospray mass spectra of high-mannose N-linked glycans derivatised with 2-aminobenzoic acids and ionised from solutions containing ammonium hydroxide gave prominent [M-H](-) ions accompanied by weaker [M-2H](2-) ions. Fragmentation of both types of ions gave prominent singly charged glycosidic cleavage ions containing the derivatised reducing terminus and ions from the non-reducing terminus that appeared to be products of cross-ring cleavages. Differentiation of these two groups of ions was conveniently achieved in a single spectrum by use of chloro- or bromo-substituted benzoic acids in order to label ions containing the derivative with an atom with a distinctive isotope pattern. Fragmentation of the doubly charged ions gave more abundant fragments, both singly and doubly charged, than did fragmentation of the singly charged ions, but information of chain branching was masked by the appearance of prominent ions produced by internal cleavages. Copyright (c) 2005 John Wiley & Sons, Ltd.

Structure-activity relationships for novel drug precursor N-substituted-6-acylbenzothiazolon derivatives: A theoretical approach

Science.gov (United States)

Sıdır, Yadigar Gülseven; Sıdır, İsa

2013-08-01

In this study, the twelve new modeled N-substituted-6-acylbenzothiazolon derivatives having analgesic analog structure have been investigated by quantum chemical methods using a lot of electronic parameters and structure-activity properties; such as molecular polarizability (α), dipole moment (μ), EHOMO, ELUMO, q-, qH+, molecular volume (Vm), ionization potential (IP), electron affinity (EA), electronegativity (χ), molecular hardness (η), molecular softness (S), electrophilic index (ω), heat of formation (HOF), molar refractivity (MR), octanol-water partition coefficient (log P), thermochemical properties (entropy (S), capacity of heat (Cv)); as to investigate activity relationships with molecular structure. The correlations of log P with Vm, MR, ω, EA, EHOMO - ELUMO (ΔE), HOF in aqueous phase, χ, μ, S, η parameters, respectively are obtained, while the linear relation of log P with IP, Cv, HOF in gas phase are not observed. The log P parameter is obtained to be depending on different properties of compounds due to their complexity.

Synthesis and in vitro cytotoxicity of novel C-12 substituted-14-deoxy-andrographolide derivatives as potent anti-cancer agents.

Science.gov (United States)

Kandanur, Sai Giridhar Sarma; Golakoti, Nageswara Rao; Nanduri, Srinivas

2015-12-15

Andrographolide, the major labdane diterpenoid from Andrographis paniculata has been reported to be cytotoxic against various cancer cells in vitro. Our research efforts led to the discovery of novel 12-phenyl thio and 12-aryl amino-14-deoxy-andrographolide derivatives (III q and III r) with potent cytotoxic activity, 12-benzyl amino-14-deoxy-andrographolide analogues showing broad range of cytotoxic activity against most of the cell lines and 12-alkyl amino-14-deoxy-andrographolide derivatives being selective to few cell lines (PC-3 and HOP-92), when the selected analogues were evaluated against 60 human cancer cell line panel at National Cancer Institute (N.C.I.), USA. The SAR (structure activity relationship) studies demonstrated potent activity for the compounds containing the following functionalities at C-12: substituted aryl amino/phenyl thio>benzylamine>alkyl amine. The significant cytotoxic activity observed for compounds III q and III r suggest that these could serve as templates for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.

The discovery of new potent non-peptide Angiotensin II AT1 receptor blockers: A concise synthesis, molecular docking studies and biological evaluation of N-substituted 5-butylimidazole derivatives

Czech Academy of Sciences Publication Activity Database

Agelis, G.; Resvani, A.; Durdagi, S.; Spyridaki, K.; Tůmová, Tereza; Slaninová, Jiřina; Giannopoulos, P.; Vlahakos, D.; Liapakis, G.; Mavromoustakos, T.; Matsoukas, J.

2012-01-01

Roč. 55, Sep (2012), s. 358-374 ISSN 0223-5234 Institutional research plan: CEZ:AV0Z40550506 Keywords : synthesis * angiotensin II receptor blockers * N-substituted 5-butylimidazole derivatives * antihypertensive activity * molecular docking Subject RIV: CC - Organic Chemistry Impact factor: 3.499, year: 2012

/sup 13/C-/sup 13/C spin-spin coupling in structural investigations. VII. Substitution effects and direct carbon-carbon constants of the triple bond in acetyline derivatives

Energy Technology Data Exchange (ETDEWEB)

Krivdin, L.B.; Proidakov, A.G.; Bazhenov, B.N.; Zinchenko, S.V.; Kalabin, G.A.

1989-01-10

The effects of substitution on the direct /sup 13/C-/sup 13/C spin-spin coupling constants of the triple bond were studied in 100 derivatives of acetylene. It was established that these parameters exhibit increased sensitivity to the effect of substituents compared with other types of compounds. The main factor which determines their variation is the electronegativity of the substituting groups, and in individual cases the /pi/-electronic effects are appreciable. The effect of the substituents with an element of the silicon subgroup at the /alpha/ position simultaneously at the triple bond or substituent of the above-mentioned type and a halogen atom.

Induction of discrete apoptotic pathways by bromo-substituted indirubin derivatives in invasive breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Nicolaou, Katerina A. [Department of Biological Sciences, University of Cyprus, Nicosia (Cyprus); Liapis, Vasilis; Evdokiou, Andreas [Department of Surgery, Basil Hetzel Institute, Adelaide University, Adelaide (Australia); Constantinou, Constantina [St. George' s University of London Medical School at the University of Nicosia, Nicosia (Cyprus); Magiatis, Prokopios; Skaltsounis, Alex L. [Faculty of Pharmacy, University of Athens, Athens (Greece); Koumas, Laura; Costeas, Paul A. [Center for Study of Hematological Malignancies, Nicosia (Cyprus); Constantinou, Andreas I., E-mail: andreasc@ucy.ac.cy [Department of Biological Sciences, University of Cyprus, Nicosia (Cyprus)

2012-08-17

Highlights: Black-Right-Pointing-Pointer The effects of 6BIO and 7BIO are evaluated against five breast cancer cell lines. Black-Right-Pointing-Pointer 6BIO induces a caspase dependent apoptotic effect via the intrinsic pathway. Black-Right-Pointing-Pointer 7BIO promotes G{sub 2}/M cells cycle arrest. Black-Right-Pointing-Pointer 7BIO triggers a caspase-8 mediated apoptotic pathway. Black-Right-Pointing-Pointer 7BIO triggers and a caspase independent pathway. -- Abstract: Indirubin derivatives gained interest in recent years for their anticancer and antimetastatic properties. The objective of the present study was to evaluate and compare the anticancer properties of the two novel bromo-substituted derivatives 6-bromoindirubin-3 Prime -oxime (6BIO) and 7-bromoindirubin-3 Prime -oxime (7BIO) in five different breast cancer cell lines. Cell viability assays identified that 6BIO and 7BIO are most effective in preventing the proliferation of the MDA-MB-231-TXSA breast cancer cell line from a total of five breast cancer cell lined examined. In addition it was found that the two compounds induce apoptosis via different mechanisms. 6BIO induces caspase-dependent programmed cell death through the intrinsic (mitochondrial) caspase-9 pathway. 7BIO up-regulates p21 and promotes G{sub 2}/M cell cycle arrest which is subsequently followed by the activation of two different apoptotic pathways: (a) a pathway that involves the upregulation of DR4/DR5 and activation of caspase-8 and (b) a caspase independent pathway. In conclusion, this study provides important insights regarding the molecular pathways leading to cell cycle arrest and apoptosis by two indirubin derivatives that can find clinical applications in targeted cancer therapeutics.

Design, synthesis, and herbicidal activity of novel substituted 3-(pyridin-2-yl)benzenesulfonamide derivatives.

Science.gov (United States)

Xie, Yong; Chi, Hui-Wei; Guan, Ai-Ying; Liu, Chang-Ling; Ma, Hong-Juan; Cui, Dong-Liang

2014-12-31

A series of novel substituted 3-(pyridin-2-yl)benzenesulfonamide derivatives were designed and synthesized using 2-phenylpridines as the lead compound by intermediate derivatization methods in an attempt to obtain novel compound candidates for weed control. The herbicidal activity assay in glasshouse tests showed several compounds (II6, II7, II8, II9, II10, II11, III2, III3, III4, and III5) could efficiently control velvet leaf, youth-and-old age, barnyard grass, and foxtail at the 37.5 g/ha active substance. Especially, the activities of II6, II7, III2, and III4 were proved roughly equivalent to the saflufenacil and better than 95% sulcotrione at the same concentration. The result of the herbicidal activity assay in field tests demonstrated that II7 at 60 g/ha active substance could give the same effect as bentazon at 1440 g/ha active substance to control dayflower and nightshade, meanwhile II7 showed better activity than oxyfluorfen to control arrowhead and security to rice. The present work indicates that II7 may be a novel compound candidate for potential herbicide.

Synthesis and application of trifluoroethoxy-substituted phthalocyanines and subphthalocyanines

Directory of Open Access Journals (Sweden)

Satoru Mori

2017-10-01

Full Text Available Phthalocyanines and subphthalocyanines are attracting attention as functional dyes that are applicable to organic solar cells, photodynamic therapy, organic electronic devices, and other applications. However, phthalocyanines are generally difficult to handle due to their strong ability to aggregate, so this property must be controlled for further applications of phthalocyanines. On the other hand, trifluoroethoxy-substituted phthalocyanines are known to suppress aggregation due to repulsion of the trifluoroethoxy group. Furthermore, the electronic characteristics of phthalocyanines are significantly changed by the strong electronegativity of fluorine. Therefore, it is expected that trifluoroethoxy-substituted phthalocyanines can be applied to new industrial fields. This review summarizes the synthesis and application of trifluoroethoxy-substituted phthalocyanine and subphthalocyanine derivatives.

Asymmetric allylation of α-ketoester-derived N-benzoylhydrazones promoted by chiral sulfoxides/N-oxides Lewis bases: highly enantioselective synthesis of quaternary α-substituted α-allyl-α-amino acids.

Science.gov (United States)

Reyes-Rangel, Gloria; Bandala, Yamir; García-Flores, Fred; Juaristi, Eusebio

2013-09-01

Chiral sulfoxides/N-oxides (R)-1 and (R,R)-2 are effective chiral promoters in the enantioselective allylation of α-keto ester N-benzoylhydrazone derivatives 3a-g to generate the corresponding N-benzoylhydrazine derivatives 4a-g, with enantiomeric excesses as high as 98%. Representative hydrazine derivatives 4a-b were subsequently treated with SmI2, and the resulting amino esters 5a-b with LiOH to obtain quaternary α-substituted α-allyl α-amino acids 6a-b, whose absolute configuration was assigned as (S), with fundament on chemical correlation and electronic circular dichroism (ECD) data. © 2013 Wiley Periodicals, Inc.

Synthesis and Antimicrobial Activity of Some Novel Substituted Piperazinyl-quinazolin-3(4H-ones

Directory of Open Access Journals (Sweden)

N. M. Raghavendra

2008-01-01

Full Text Available Several substituted-quinazolin-3(4H-ones were synthesized by condensation of 2-chloro-N-(4-oxo-substituted-quinazolin-3(4H-yl-acetamides with various substituted piperazines through single step reaction. Elemental analysis, IR, 1HNMR and mass spectral data confirmed the structure of the newly synthesized compounds. Synthesized quinazolin-4-one derivatives were investigated for their antibacterial and antifungal activities.

Removal potential of toxic 2378-substituted PCDD/F from incinerator flue gases by waste-derived activated carbons.

Science.gov (United States)

Hajizadeh, Yaghoub; Onwudili, Jude A; Williams, Paul T

2011-06-01

The application of activated carbons has become a commonly used emission control protocol for the removal or adsorption of persistent organic pollutants from the flue gas streams of waste incinerators. In this study, the 2378-substituted PCDD/F removal efficiency of three types of activated carbons derived from the pyrolysis of refuse derived fuel, textile waste and scrap tyre was investigated and compared with that of a commercial carbon. Experiments were carried out in a laboratory scale fixed-bed reactor under a simulated flue gas at 275°C with a reaction period of four days. The PCDD/F in the solid matrices and exhaust gas, were analyzed using gas chromatography coupled with a triple quadrupole mass spectrometer. In the absence of activated carbon adsorbent, there was a significant increase in the concentration of toxic PCDD/F produced in the reacted flyash, reaching up to 6.6 times higher than in the raw flyash. In addition, there was a substantial release of PCDD/F into the gas phase, which was found in the flue gas trapping system. By application of the different commercial, refuse derived fuel, textile and tyre activated carbons the total PCDD/F toxic equivalent removal efficiencies in the exhaust gas stream were 58%, 57%, 64% and 52%, respectively. In general, the removal of the PCDDs was much higher with an average of 85% compared to PCDFs at 41%. Analysis of the reacted activated carbons showed that there was some formation of PCDD/F, for instance, a total of 60.6 μg I-TEQ kg(-1) toxic PCDD/F was formed in the refuse derived fuel activated carbon compared to 34 μg I-TEQ kg(-1) in the commercial activated carbon. The activated carbons derived from the pyrolysis of waste, therefore, showed good potential as a control material for PCDD/F emissions in waste incinerator flue gases. Copyright © 2011 Elsevier Ltd. All rights reserved.

Gold-catalyzed Alkyne Hydroxylation: Synthesis of 2-Substituted Benzo[b]furan Compounds

Institute of Scientific and Technical Information of China (English)

ZHANG Yuan; XIN Zhi-Jun; XUE Ji-Jun; LI Ying

2008-01-01

A strategy concerning the synthesis of 2-substituted benzo[b]furan compounds from o-alkynyl phenols via a gold-catalyzed alkyne hydroxylation is described, which allows the rapid synthesis of various 2-substituted benzo[b]furan derivatives in excellent yields under mild conditions. The o-alkynyl phenol precursors were readily prepared with a Sonogashira coupling reaction.

Tautomerization and Dimerization of 6,13-Disubstituted Derivatives of Pentacene.

Science.gov (United States)

Garcia-Borràs, Marc; Konishi, Akihito; Waterloo, Andreas; Liang, Yong; Cao, Yang; Hetzer, Constantin; Lehnherr, Dan; Hampel, Frank; Houk, Kendall N; Tykwinski, Rik R

2017-05-02

Two new 6,13-disubstituted pentacene derivatives, 1 c and 1 d, with alkyl and triisopropylsilylethynyl substitution have been synthesized and characterized experimentally and computationally. The alkyl substituted 1 c and 1 d represent the first 6-alkyl-substituted pentacene derivative where the fully aromatic species dominates over the corresponding tautomer. Indeed, no tautomerization product is found for either 1 c or 1 d upon heating or in the presence of catalytic amounts of acid. On the other hand, an unexpected dimer (3 c) is formed from 1 c. A plausible mechanism for this new dimerization process of the 6-methyl-substituted pentacene derivative 1 c is proposed, which involves first a bimolecular hydrogen atom transfer followed by an intramolecular [4+2] Diels-Alder cycloaddition. In the case of 6-butyl substitution, neither tautomerization nor dimerization is observed. Computations support the proposed 1 c dehydrodimerization pathway, explain why 1 d does not dimerize, and show the importance of the nature of the group at C-13 in controlling the relative stability of 6-alkyl-substituted pentacene tautomers. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Successive substitution one-leg hybrid P-stable LMM for initial value ...

African Journals Online (AJOL)

This paper derives P-stable successive substitution one-leg hybrid linear multistep methods for the numerical solution of second order initial value problems in ordinary differential equations without explicit first order derivative. The methods are demonstrated by a numerical example also considered by Fatunla, et al (1997) ...

Synthesis and In Vitro Antiproliferative Activity of Novel Phenyl Ring-Substituted 5-Alkyl-12(H-quino[3,4-b][1,4]benzothiazine Derivatives

Directory of Open Access Journals (Sweden)

Andrzej Zięba

2016-11-01

Full Text Available A novel series of tetracyclic quinobenzothiazine derivatives was synthetized. Compounds containing a substituent (hydroxyl, methyl, phenyl, piperidyl, or piperazinyl in positions 9 and 11 were obtained by cyclization of suitable 4-aminoquinolinium-3-thiolates. Quinobenzothiazine 10-O-substituted derivatives were obtained by alkylating the hydroxyl group in position 10 of the parent (quinobenzothiazine system. Antiproliferative activity of the synthesized compounds was studied using cultured neoplastic cells (MDA-MB-231, SNB-19, and C-32 cell lines. Four selected compounds were investigated in more detail for cytotoxicity and antiproliferative effect. Transcriptional activity of genes regulating cell cycle (TP53, apoptosis (BAX, BCL-2, as well as proliferation (H3 were assessed. Finally, the ability of the selected compounds to bind DNA was checked in the presence of ethidium bromide.

A zeta potential value determines the aggregate's size of penta-substituted [60]fullerene derivatives in aqueous suspension whereas positive charge is required for toxicity against bacterial cells.

Science.gov (United States)

Deryabin, Dmitry G; Efremova, Ludmila V; Vasilchenko, Alexey S; Saidakova, Evgeniya V; Sizova, Elena A; Troshin, Pavel A; Zhilenkov, Alexander V; Khakina, Ekaterina A; Khakina, Ekaterina E

2015-08-08

The cause-effect relationships between physicochemical properties of amphiphilic [60]fullerene derivatives and their toxicity against bacterial cells have not yet been clarified. In this study, we report how the differences in the chemical structure of organic addends in 10 originally synthesized penta-substituted [60]fullerene derivatives modulate their zeta potential and aggregate's size in salt-free and salt-added aqueous suspensions as well as how these physicochemical characteristics affect the bioenergetics of freshwater Escherichia coli and marine Photobacterium phosphoreum bacteria. Dynamic light scattering, laser Doppler micro-electrophoresis, agarose gel electrophoresis, atomic force microscopy, and bioluminescence inhibition assay were used to characterize the fullerene aggregation behavior in aqueous solution and their interaction with the bacterial cell surface, following zeta potential changes and toxic effects. Dynamic light scattering results indicated the formation of self-assembled [60]fullerene aggregates in aqueous suspensions. The measurement of the zeta potential of the particles revealed that they have different surface charges. The relationship between these physicochemical characteristics was presented as an exponential regression that correctly described the dependence of the aggregate's size of penta-substituted [60]fullerene derivatives in salt-free aqueous suspension from zeta potential value. The prevalence of DLVO-related effects was shown in salt-added aqueous suspension that decreased zeta potential values and affected the aggregation of [60]fullerene derivatives expressed differently for individual compounds. A bioluminescence inhibition assay demonstrated that the toxic effect of [60]fullerene derivatives against E. coli cells was strictly determined by their positive zeta potential charge value being weakened against P. phosphoreum cells in an aquatic system of high salinity. Atomic force microscopy data suggested that the

Tissue reaction and material characteristics of four bone substitutes

DEFF Research Database (Denmark)

Jensen, S S; Aaboe, M; Pinholt, E M

1996-01-01

and Interpore 500 HA/CC) were implanted into 5-mm bur holes in rabbit tibiae. There was no difference in the amount of newly formed bone around the four biomaterials. Interpore 500 HA/CC resorbed completely, whereas the other three biomaterials did not undergo any detectable biodegradation. Bio......The aim of the present study was to qualitatively and quantitatively compare the tissue reactions around four different bone substitutes used in orthopedic and craniofacial surgery. Cylinders of two bovine bone substitutes (Endobon and Bio-Oss) and two coral-derived bone substitutes (Pro Osteon 500......-Oss was osseointegrated to a higher degree than the other biomaterials. Material characteristics obtained by diffuse reflectance infrared Fourier transform spectrometry analysis and energy-dispersive spectrometry did not explain the differences in biologic behavior....

Synthesis and Positive Inotropic Activity of [1,2,4]Triazolo[4,3-a] Quinoxaline Derivatives Bearing Substituted Benzylpiperazine and Benzoylpiperazine Moieties

Directory of Open Access Journals (Sweden)

Xue-Kun Liu

2017-02-01

Full Text Available In an attempt to search for more potent positive inotropic agents, two series of [1,2,4]triazolo[4,3-a] quinoxaline derivatives bearing substituted benzylpiperazine and benzoylpiperazine moieties were synthesized and their positive inotropic activities evaluated by measuring left atrial stroke volume in isolated rabbit heart preparations. Several compounds showed favorable activities compared with the standard drug, milrinone. Compound 6c was the most potent agent, with an increased stroke volume of 12.53% ± 0.30% (milrinone: 2.46% ± 0.07% at 3 × 10−5 M. The chronotropic effects of compounds having considerable inotropic effects were also evaluated.

Synthesis and antitumor evaluation of some new N4 substituted sulfa pyridine derivatives with studying the synergistic effect of γ-irradiation

International Nuclear Information System (INIS)

Elsaid Agha, H.M.S.

2011-01-01

The aim of the present investigation is to synthesize a new class of N 4 substituted sulfa pyridine derivatives with anticipated cytotoxic activity. All the newly synthesized compounds were screened for their in-vitro cytotoxic activity against breast cancer cell line (MCF-7) compared to the reference drug Doxorubicin. Also the synergism of the most potent synthesized compounds with γ- radiation was studied. Moreover, a molecular docking study was carried out by docking the most active synthesized compounds in the active site of Cyclin Dependent Kinase 2 receptor to assess their inhibitory effect upon this enzyme as this may have a role in their anticancer activity.

Synthesis, characterization of N-, S-, O-substituted naphtho- and ...

Indian Academy of Sciences (India)

obtained on a Thermo Finnigan LCQ Advantage MAX. LC/MS/MS spectrometer .... organic layer was washed with water (4 × 30 mL), and dried with Na2SO4. ..... mono(thio)-substituted compounds containing chlorine atom derivatives were.

Design and synthesis of dimethylaminomethyl-substituted curcumin derivatives/analogues: potent antitumor and antioxidant activity, improved stability and aqueous solubility compared with curcumin.

Science.gov (United States)

Fang, Xubin; Fang, Lei; Gou, Shaohua; Cheng, Lin

2013-03-01

A series of dimethylaminomethyl-substituted curcumin derivatives/analogues were designed and synthesized. All compounds effectively inhibited HepG2, SGC-7901, A549 and HCT-116 tumor cell lines proliferation in MTT assay. Particularly, compounds 2a and 3d showed much better activity than curcumin against all of the four tumor cell lines. Antioxidant test revealed that these compounds had higher free radical scavenging activity than curcumin towards both DPPH and galvinoxyl radicals. Furthermore, the aqueous solubility and stability of the target compounds were also significantly improved compared with curcumin. Copyright © 2013 Elsevier Ltd. All rights reserved.

Bis-aryl substituted dioxaborines as electron-transport materials: a comparative density functional theory investigation with oxadiazoles and siloles

International Nuclear Information System (INIS)

Risko, C.; Zojer, E.; Brocorens, P.; Marder, S.R.; Bredas, J.L.

2005-01-01

We report on a detailed quantum-chemical comparison of the electronic structures, vertical electron affinities, and intramolecular reorganization energies for bis-aryl substituted dioxaborine, oxadiazole, and silole derivatives. The results indicate that the HOMO and LUMO energies of the substituted compounds can be tuned on the order of 2-3 eV via minor changes in the substitution patterns, with the HOMO and LUMO levels for the dioxaborine derivatives consistently the most energy stabilized. Additionally, large vertical electron affinities and comparable intramolecular reorganization energies confirm that dioxaborine systems are interesting candidates for electron transport materials

Synthesis of 2-substituted tryptophans via a C3- to C2-alkyl migration

Directory of Open Access Journals (Sweden)

Michele Mari

2014-08-01

Full Text Available The reaction of 3-substituted indoles with dehydroalanine (Dha derivatives under Lewis acid-mediated conditions has been investigated. The formation of 2-substituted tryptophans is proposed to occur through a selective alkylative dearomatization–cyclization followed by C3- to C2-alkyl migration and rearomatization.

One-pot, three-component synthesis of highly substituted pyridines ...

Indian Academy of Sciences (India)

Administrator

trile in the presence of nanocrystalline magnesium oxide provides the highly substituted pyridine derivatives in moderate to ..... NAP–MgO (0⋅1 g), ethanol (5 mL) at reflux temperature b ... difference in the electronic and steric properties of.

Chlorine- and Sulphur-substituted Pyrrolo[3,4-b]quinolines and ...

African Journals Online (AJOL)

Chlorine- and Sulphur-substituted Pyrrolo[3,4-b]quinolines and Related Derivatives .... J. Chem., 2003, 56, 40–46,. . .... It is evident from the above that by judicious selection and application of reagents ...

Synthesis, Characterization, Antimicrobial Screening and Free-Radical Scavenging Activity of Some Novel Substituted Pyrazoles

Directory of Open Access Journals (Sweden)

Nagwa Mohamed Mahrous Hamada

2015-06-01

Full Text Available The present work deals with the synthesis of acetoxysulfonamide pyrazole derivatives, substituted 4,5-dihydropyrazole-1-carbothioamide and 4,5-dihydropyrazole-1-isonicotinoyl derivatives starting from substituted vanillin chalcones. Acetoxysulfonamide pyrazole derivatives were prepared from the reaction of chalcones with p-sulfamylphenylhydrazine followed by treatment with acetic anhydride. At the same time 4,5-dihydropyrazole-1-carbothioamide and 4,5-dihydropyrazole-1-isonicotinoyl derivatives were prepared from the reaction of chalcones with either thiosemicarbazide or isonicotinic acid hydrazide, respectively. The synthesized compounds were structurally characterized on the basis of IR, 1H-NMR, 13C-NMR spectral data and microanalyses. All of the newly isolated compounds were tested for their antimicrobial activities. The antimicrobial screening using the agar well-diffusion method revealed that the chloro derivatives are the most active ones. Moreover, the antioxidant and anti-inflammatory activity of these chloro derivatives are also studied using the DPPH radical scavenging and NO radical scavenging methods, respectively.

Synthesis and antibacterial activities of N-substituted maleopimarimide

Directory of Open Access Journals (Sweden)

LI Hui

2016-02-01

Full Text Available With Macrogol 600(PEG-600 as solvent and toluene as dehydrant,eight N-Substituted maleopimarimide compounds were synthesized from maleopimaric acid and aniline or its derivatives by one-step reaction;Their structures were confirmed and the antimicrobial activities of these compounds were also preliminarily investigated.

Novel biotransformation process of podophyllotoxin to 4 β-sulfur-substituted podophyllum derivates with anti-tumor activity by Penicillium purpurogenum Y.J. Tang.

Science.gov (United States)

Bai, J-K; Zhao, W; Li, H-M; Tang, Y-J

2012-01-01

According to the structure-function relationship of podophyllotoxin (PTOX) and its analogue of 4'- demethylepipodophyllotoxin (DMEP), the 4 β-substitution of sulfur-containing heterocyclic compounds with a carbon-sulfur bond at 4 position of PTOX or DMEP is an essential modification direction for improving the anti-tumor activity. So, four novel 4 β-sulfursubstituted podophyllum derivatives (i.e., 4β -(1,2,4-triazole-3-yl)sulfanyl-4-deoxy-podophyllotoxin (4-MT-PTOX), 4β-(1,3,4- thiadiazole-2-yl)sulfanyl-4-deoxy-podophyllotoxin (4-MTD-PTOX), 4β-(1,2,4-triazole-3-yl)sulfanyl-4-deoxy-4' -demethylepipodophyllotoxin (4-MT-DMEP), and 4β-(1,3,4-thiadiazole-2-yl)sulfanyl-4-deoxy-4'-demethylepipodophyllotoxin (4-MTD-DMEP)) were designed and then successfully biosynthesized in this work. In the novel sulfur-substituted biotransformation processes, PTOX and DMEP was linked with sulfur-containing compounds (i.e., 3-mercapto-1,2,4-triazole (MT) and 2-mercapto-1,3,4-thiadiazole (MTD)) at 4 position of cycloparaffin to produce 4-MT-PTOX (1), 4-MTD-PTOX (2), 4-MT-DMEP (3), and 4-MTD-DMEP (4) by Penicillium purpurogenum Y.J. Tang, respectively, which was screened out from Diphylleia sinensis Li (Hubei, China). All the novel compounds exhibited promising in vitro bioactivity, especially 4-MT-PTOX (1). Compared with etoposide (i.e., a 50 % effective concentration [EC(50)] of 25.72, 167.97, and 1.15 M), the EC(50) values of 4-MT-PTOX (1) against tumor cell line BGC-823, A549 and HepG2 (i.e., 0.28, 0.76, and 0.42 M) were significantly improved by 91, 221 and 2.73 times, respectively. Moreover, the EC(50) value of 4-MT-PTOX (1) against the normal human cell line HK-2 (i.e., 182.4 μM) was 19 times higher than that of etoposide (i.e., 9.17 μM). Based on the rational design, four novel 4 β-sulfur-substituted podophyllum derivatives with superior in vitro anti-tumor activity were obtained for the first time. The correctness of structure-function relationship and rational drug

Synthesis and biological activity of novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives.

Science.gov (United States)

El-Sawy, Eslam R; Ebaid, Manal S; Abo-Salem, Heba M; El-Hallouty, Salwa; Kassem, Emad M; Mandour, Adel H

2014-05-01

A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a-g and 11a-g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a-g and 7a-g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a-g, and 11a-g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively.

Synthesis of N-substituted acetamide derivatives of azinane-bearing ...

African Journals Online (AJOL)

The search for new drug candidates with more bioactivity potential is a key research interest in synthetic organic chemistry [1]. The derivatives of heterocyclic compounds have been found to be bioactive, including naturally occurring and synthetically prepared ones [2]. Among these compounds, 1,3,4-oxadiazole derivatives ...

Generation time, life history and the substitution rate of neutral mutations.

Science.gov (United States)

Lehtonen, Jussi; Lanfear, Robert

2014-11-01

Our understanding of molecular evolution is hampered by a lack of quantitative predictions about how life-history (LH) traits should correlate with substitution rates. Comparative studies have shown that neutral substitution rates vary substantially between species, and evidence shows that much of this diversity is associated with variation in LH traits. However, while these studies often agree, some unexplained and contradictory results have emerged. Explaining these results is difficult without a clear theoretical understanding of the problem. In this study, we derive predictions for the relationships between LH traits and substitution rates in iteroparous species by using demographic theory to relate commonly measured life-history traits to genetic generation time, and by implication to neutral substitution rates. This provides some surprisingly simple explanations for otherwise confusing patterns, such as the association between fecundity and substitution rates. The same framework can be applied to more complex life histories if full life-tables are available. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Regioselective 1-N-Alkylation and Rearrangement of Adenosine Derivatives.

Science.gov (United States)

Oslovsky, Vladimir E; Drenichev, Mikhail S; Mikhailov, Sergey N

2015-01-01

Several methods for the preparation of some N(6)-substituted adenosines based on selective 1-N-alkylation with subsequent Dimroth rearrangement were developed. The proposed methods seem to be effective for the preparation of natural N(6)-isopentenyl- and N(6)-benzyladenosines, which are known to possess pronounced biological activities. Direct 1-N-alkylation of 2',3',5'-tri-O-acetyladenosine and 3',5'-di-O-acetyl-2'-deoxyadenosine with alkyl halides in N,N-dimethylformamide (DMF) in the presence of BaCO3 and KI gave 1-N-substituted derivatives with quantitative yields, whereas 1-N-alkylation of adenosine was accompanied by significant O-alkylation. Moreover, the reaction of trimethylsilyl derivatives of N(6)-acetyl-2',3',5'-tri-O-acetyladenosine and N(6)-acetyl-3',5'-di-O-acetyl-2'-deoxyadenosine with alkyl halides leads to the formation of the stable 1-N-substituted adenosines. Dimroth rearrangement of 1-N-substituted adenosines in aqueous ammonia yields pure N(6)-substituted adenosines.

Azomethines, isoxazole, N-substituted pyrazoles and pyrimidine containing curcumin derivatives: Urease inhibition and molecular modeling studies.

Science.gov (United States)

Ahmed, Mahmood; Qadir, Muhammad Abdul; Hameed, Abdul; Arshad, Muhammad Nadeem; Asiri, Abdullah M; Muddassar, Muhammad

2017-08-19

Curcumin has shown large number of pharmacological properties against different phenotypes of various disease models. Different synthetic routes have been employed to develop its various derivatives for diverse biological functions. In this study, curcumin derived azomethine, isoxazole, pyrimidines and N-substituted pyrazoles were synthesized to investigate their urease enzyme inhibition. The structures of newly synthesized compounds were described by IR, MS, 1 H NMR and 13 C NMR spectral data. Urease enzyme inhibition was evaluated through in vitro assays in which compound 8b was found to be the most potent (IC 50  = 2.44 ± 0.07 μM) among the tested compounds. The compounds with diazine ring system except the 4d showed better urease inhibition (IC 50  = 11.43 ± 0.21-19.63 ± 0.28 μM) than the standard urease inhibitor thiourea (IC 50  = 22.61 ± 0.23 μM). Similarly enzyme kinetics data revealed that compounds 3c-3e and 8b were competitive inhibitors with Ki values of 20.0, 19.87, 20.23 and 19.11 μM respectively while the compounds 4b, 4c and 4e were mixed type of inhibitors with Ki values 6.72, 19.69 and 6.72 μM respectively. Molecular docking studies were also performed to identify the plausible binding modes of the most active compounds. Copyright © 2017 Elsevier Inc. All rights reserved.

Trypanocidal 1,3-arylene diketone bis(guanylhydrazone)s. Structure-activity relationships among substituted and heterocyclic analogues.

Science.gov (United States)

Ulrich, P; Cerami, A

1984-01-01

Based on the antitrypanosomal activity of 1,3-diacetylbenzene bis(guanylhydrazone) (4) and 2,6-diacetylpyridine bis(guanylhydrazone) (17), a number of substituted and heterocyclic 1,3-arylene diketone bis(guanylhydrazone)s were prepared and tested against Trypanosoma brucei infections in mice. A wide range of ED50 values was observed among 5-substituted derivatives of 4. The 5-amino analogue 5 and 5-acetamido analogue 6 were about twice as active as 4. 1,3,5-Triacetylbenzene tris(guanylhydrazone) (12) was about 9 times as active as 4 and was approximately one-half as active as the currently used trypanocide diminazene aceturate in this test system. Other 5-derivatives had activity equivalent to or less than that of the parent compound 4. Three new heterocyclic analogues were all less active than 2,6-diacetylpyridine derivative 17 and benzene derivative 4. Ring substitution ortho to the guanylhydrazone side chains was invariably detrimental to activity. Side-chain homologues 1,3-dipentanoylbenzene bis(guanylhydrazone) and 1,3-diacetylbenzene bis(2-imidazolin-2-ylhydrazone) were essentially inactive.

Global chaos synchronization of electro-mechanical gyrostat systems via variable substitution control

International Nuclear Information System (INIS)

Chen Yun; Wu Xiaofeng; Liu Zhong

2009-01-01

This paper studies global synchronization of non-autonomous chaotic electro-mechanical gyrostat systems via variable substitution control. A master-slave non-autonomous synchronization scheme with variable substitution control is mathematically presented. Based on the scheme, some sufficient algebraic criteria for global chaos synchronization of master and slave electro-mechanical gyrostat systems via various single-variable coupling are derived. The effectiveness of the obtained criteria is numerically illustrated by the examples.

Genotoxicity risk assessment of diversely substituted quinolines using the SOS chromotest.

Science.gov (United States)

Duran, Leidy Tatiana Díaz; Rincón, Nathalia Olivar; Galvis, Carlos Eduardo Puerto; Kouznetsov, Vladimir V; Lorenzo, Jorge Luis Fuentes

2015-03-01

Quinolines are aromatic nitrogen compounds with wide therapeutic potential to treat parasitic and microbial diseases. In this study, the genotoxicity of quinoline, 4-methylquinoline, 4-nitroquinoline-1-oxide (4-NQO), and diversely functionalized quinoline derivatives and the influence of the substituents (functional groups and/or atoms) on their genotoxicity were tested using the SOS chromotest. Quinoline derivatives that induce genotoxicity by the formation of an enamine epoxide structure did not induce the SOS response in Escherichia coli PQ37 cells, with the exception of 4-methylquinoline that was weakly genotoxic. The chemical nature of the substitution (C-5 to C-8: hydroxyl, nitro, methyl, isopropyl, chlorine, fluorine, and iodine atoms; C-2: phenyl and 3,4-methylenedioxyphenyl rings) of quinoline skeleton did not significantly modify compound genotoxicities; however, C-2 substitution with α-, β-, or γ-pyridinyl groups removed 4-methylquinoline genotoxicity. On the other hand, 4-NQO derivatives whose genotoxic mechanism involves reduction of the C-4 nitro group were strong inducers of the SOS response. Methyl and nitrophenyl substituents at C-2 of 4-NQO core affected the genotoxic potency of this molecule. The relevance of these results is discussed in relation to the potential use of the substituted quinolines. The work showed the sensitivity of SOS chromotest for studying structure-genotoxicity relationships and bioassay-guided quinoline synthesis. © 2013 Wiley Periodicals, Inc.

Substitution Effects and Linear Free Energy Relationships During Reduction of 4- Benzoyl-n-(4-substituted Benzyl)pyridinium Cations

Science.gov (United States)

Leventis, Nicholas; Zhang, Guo-Hui; Rawashdeh, Abdel-Monem M.; Sotiriou-Leventis, Chariklia; Gray, Hugh R. (Technical Monitor)

2003-01-01

In analogy to 4-(para-substituted benzoyl)-N-methylpyridinium cations (1-X's), the title species (2-X's, -X = -OCH3, -CH3, -H, -Br, -COCH3, -NO2) undergo two reversible, well-separated (E(sub 1/2) greater than or equal to 650 mV) one-electron reductions. The effect of substitution on the reduction potentials of 2-X's is much weaker than the effect of the same substituents on 1-X's: the Hammett rho-values are 0.80 and 0.93 for the 1st- and 2nd-e reduction of 2-X's vs. 2.3 and 3.3 for the same reductions of 1-X's, respectively. Importantly, the nitro group of 2-NO2 undergoes reduction before the 2nd-e reduction of the 4-benzoylpyridinium system. These results suggest that the redox potentials of the 4-benzoylpyridinium system can be course-tuned via p-benzoyl substitution and fine-tuned via para-benzyl substitution. Introducing the recently derived substituent constant of the -NO2(sup)- group (sigma para-NO2(sup)- = -0.97) yields an excellent correlation for the 3rd-e reduction of 2- NO2 (corresponding to the reduction of the carbonyl group) with the 2nd-e reduction of the other 2-X's, and confirms the electron donating properties of -NO2(sup)-.

Synthesis and Electroluminescence Properties of 3-(Trifluoromethylphenyl-Substituted 9,10-Diarylanthracene Derivatives for Blue Organic Light-Emitting Diodes

Directory of Open Access Journals (Sweden)

Sang Woo Kwak

2017-10-01

Full Text Available Diaryl-substituted anthracene derivatives containing 3-(trifluoromethylphenyl groups, 9,10-diphenyl-2-(3-(trifluoromethylphenylanthracene (1, 9,10-di([1,1′-biphenyl]-4-yl-2-(3-(trifluoromethylphenylanthracene (2, and 9,10-di(naphthalen-2-yl-2-(3-(trifluoromethylphenylanthracene (3 were synthesized and characterized. The compounds 1–3 possessed high thermal stability and proper frontier-energy levels, which make them suitable as host materials for blue organic light-emitting diodes. The electroluminescent (EL emission maximum of the three N,N-diphenylamino phenyl vinyl biphenyl (DPAVBi-doped (8 wt % devices for compounds 1–3 was exhibited at 488 nm (for 1 and 512 nm (for 2 and 3. Among them, the 1-based device displayed the highest device performances in terms of brightness (Lmax = 2153.5 cd·m−2, current efficiency (2.1 cd·A−1, and external quantum efficiency (0.8%, compared to the 2- and 3-based devices.

Biologic and clinical aspects of integration of different bone substitutes in oral surgery: a literature review.

Science.gov (United States)

Zizzari, Vincenzo Luca; Zara, Susi; Tetè, Giulia; Vinci, Raffaele; Gherlone, Enrico; Cataldi, Amelia

2016-10-01

Many bone substitutes have been proposed for bone regeneration, and researchers have focused on the interactions occurring between grafts and host tissue, as the biologic response of host tissue is related to the origin of the biomaterial. Bone substitutes used in oral and maxillofacial surgery could be categorized according to their biologic origin and source as autologous bone graft when obtained from the same individual receiving the graft; homologous bone graft, or allograft, when harvested from an individual other than the one receiving the graft; animal-derived heterologous bone graft, or xenograft, when derived from a species other than human; and alloplastic graft, made of bone substitute of synthetic origin. The aim of this review is to describe the most commonly used bone substitutes, according to their origin, and to focus on the biologic events that ultimately lead to the integration of a biomaterial with the host tissue. Copyright © 2016 Elsevier Inc. All rights reserved.

One-step synthesis of an {sup 18}F-labeled boron-derived methionine analog. A substitute for {sup 11}C-methionine?

Energy Technology Data Exchange (ETDEWEB)

Liu, Zhen; Lan, Xiaoli [Huazhong University of Science and Technology, Department of Nuclear Medicine, Union Hospital, Tongji Medical College, Wuhan (China); Huazhong University of Science and Technology, Hubei Key Laboratory of Molecular Imaging, Union Hospital, Tongji Medical College, Wuhan (China); Ehlerding, Emily B. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Cai, Weibo [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Carbone Cancer Center, Madison, WI (United States)

2018-04-15

Amino acid-based tracers have been extensively investigated for positron emission tomography (PET) imaging of brain tumors, and {sup 11}C-methionine ({sup 11}C-MET) is one of the most extensively investigated. However, widespread clinical use of {sup 11}C-MET is challenging due to the short half-life of {sup 11}C and low radiolabeling yield. In this issue of the European Journal of Nuclear Medicine and Molecular Imaging, Yang and colleagues report an {sup 18}F-labeled boron-derived methionine analog, {sup 18}F-B-MET, as a potential substitute for {sup 11}C-MET in PET imaging of glioma. The push-button synthesis, highly efficient radiolabeling, and good imaging performance in glioma models make this tracer a promising candidate for future clinical translation. (orig.)

1,3- and 1,4-Substituted tetrazolium salts

International Nuclear Information System (INIS)

Voitekhovich, Sergei V; Gaponik, Pavel N; Ivashkevich, Oleg A

2002-01-01

The published data on the synthesis, physicochemical properties, structures and reactions of 1,3-(1,3,5)- and 1,4-(1,4,5)-substituted tetrazolium salts are systematised and generalised. Their applications as starting compounds in the preparative chemistry of heterocyclic derivatives and some other branches of science and technology are reviewed. The bibliography includes 122 references.

Rheological and structural studies of carboxymethyl derivatives of chitosan

Science.gov (United States)

Winstead, Cherese; Katagumpola, Pushpika

2014-05-01

The degrees of substitution of chitosan derivatives were varied and the viscoelastic behavior of these biopolymer solutions was studied using rheology. Chitosan is a cationic copolymer of glucosamine and N-acetylglucosamine obtained by alkaline deacetylation of chitin. Due to its inherent non-toxicity, biocompatibility, and biodegradability, chitosan has gained much interest. However, the poor solubility of the biopolymer in water and most common organic solvents limits its applications. Therefore, the focus of this work is the chemical modification of chitosan via carboxymethylation as well as studying the viscoelastic behavior of these polymer solutions. Varying degrees of substitution (DS) of carboxymethyl chitosan derivatives were synthesized by treating chitosan with monochloroacetic acid under alkylated medium varying the reaction time and temperature. The effect of degree of substitution on the rheology of these polymer solutions was studied as a function of concentration. The viscosity of chitosan derivatives sharply increased with increase in degree of substitution. G' and G" dependence on strain and angular frequency were studied and were found to exhibit predominantly viscous behavior. Additional characterization of the derivatized products were further studied using Fourier transform infrared (FT-IR), 1H Nuclear Magnetic Resonance (1H NMR) spectroscopy, X-ray diffraction (XRD), and thermal gravimetric analysis as well as differential scanning calorimetry (DSC). Degree of substitution (DS) was calculated by titrimetric method.

Rheological and structural studies of carboxymethyl derivatives of chitosan

International Nuclear Information System (INIS)

Winstead, Cherese; Katagumpola, Pushpika

2014-01-01

The degrees of substitution of chitosan derivatives were varied and the viscoelastic behavior of these biopolymer solutions was studied using rheology. Chitosan is a cationic copolymer of glucosamine and N-acetylglucosamine obtained by alkaline deacetylation of chitin. Due to its inherent non-toxicity, biocompatibility, and biodegradability, chitosan has gained much interest. However, the poor solubility of the biopolymer in water and most common organic solvents limits its applications. Therefore, the focus of this work is the chemical modification of chitosan via carboxymethylation as well as studying the viscoelastic behavior of these polymer solutions. Varying degrees of substitution (DS) of carboxymethyl chitosan derivatives were synthesized by treating chitosan with monochloroacetic acid under alkylated medium varying the reaction time and temperature. The effect of degree of substitution on the rheology of these polymer solutions was studied as a function of concentration. The viscosity of chitosan derivatives sharply increased with increase in degree of substitution. G' and G' dependence on strain and angular frequency were studied and were found to exhibit predominantly viscous behavior. Additional characterization of the derivatized products were further studied using Fourier transform infrared (FT-IR), 1 H Nuclear Magnetic Resonance ( 1 H NMR) spectroscopy, X-ray diffraction (XRD), and thermal gravimetric analysis as well as differential scanning calorimetry (DSC). Degree of substitution (DS) was calculated by titrimetric method

Design, synthesis and anticonvulsant activity evaluation of 7-substituted-4H-[1,2,4]triazino[3,4-alpha]phthalazin-4-one derivatives

Energy Technology Data Exchange (ETDEWEB)

Sun, Xian-Yu; Quan, Zhe-Shan [Yanbian Univ., Yanji, Jilin (China). Key Lab. of Organism Functional Factors of the Changbai Mountain; Yanbian Univ., Yanji, Jilin (China). Coll. of Pharmacy; Guan, Li-Ping; Zhang, Lei; Wei, Cheng-Xi; Piao, Hu-Ri [Yanbian Univ., Yanji, Jilin (China). Key Lab. of Organism Functional Factors of the Changbai Mountain

2009-07-01

In this study, a novel series of 7-substituted-4H-[1,2,4]triazino[3,4-a]phthalazin-4-one derivatives was synthesized as potential anticonvulsant agents. Their anticonvulsant activities were evaluated by the maximal electroshock (MES) test, and their neurotoxicities were evaluated by the rotarod neurotoxicity test. The pharmacological results showed that 7-hexyloxy-4H-[1,2,4]triazino[3,4-alpha]phthalazin-4-one 4e was the most potent with median effective dose (ED{sub 50}) value of 6.6 mg kg-1, median toxicity dose (TD{sub 50}) of 39.4 mg kg{sup -1}, providing a protective index (PI=TD{sub 50} /ED{sub 50}) value of 6.0. (author)

Synthesis and Anti-HIV-1 Activity of New MKC-442 Analogues with an Alkynyl-Substituted 6-Benzyl Group

DEFF Research Database (Denmark)

Aly, Youssef L.; Pedersen, Erik Bjerreg.; La Colla, Paolo

2007-01-01

Synthesis and antiviral activities are reported of a series of 6-(3-alkynyl benzyl)-substituted analogues of MKC-442 (6-benzyl-1-(ethoxymethyl)-5-isopropyluracil), a highly potent agent against HIV. The 3-alkynyl group is assumed to give a better stacking of the substituted benzyl group to reverse...... transcriptase (RT) and this was believed to improve antiviral activity against HIV-1. The bromo derivatives, 5-alkyl-6-(3-bromo-benzyl)-1-ethoxymethyl derivatives 7a, b and 5-alkyl-6-(3-bromobenzyl)-1-allyloxymethyl derivatives 9a, b, showed activity against HIV on the same level as their corresponding...

Accessing 2-substituted piperidine iminosugars by organometallic addition/intramolecular reductive amination: aldehyde vs. nitrone route.

Science.gov (United States)

Mirabella, S; Fibbi, G; Matassini, C; Faggi, C; Goti, A; Cardona, F

2017-11-07

A dual synthetic strategy to afford 2-substituted trihydroxypiperidines is disclosed. The procedure involved Grignard addition either to a carbohydrate-derived aldehyde or to a nitrone derived thereof, and took advantage of an efficient ring-closure reductive amination strategy in the final cyclization step. An opposite diastereofacial preference was demonstrated in the nucleophilic attack to the two electrophiles, which would finally produce the same piperidine diastereoisomer as the major product. However, use of a suitable Lewis acid in the Grignard addition to the nitrone allowed reversing the selectivity, giving access to 2-substituted piperidines with the opposite configuration at C-2.

In silico binding affinity studies of N-9 substituted 6-(4-(4-propoxyphenylpiperazin-1-yl-9H-purine derivatives-Target for P70-S6K1 & PI3K-δ kinases

Directory of Open Access Journals (Sweden)

Manjunath G. Sunagar

2018-03-01

Full Text Available P70-S6K1 & PI3K-δ kinases are identified to be involved in many physiological processes associated with cancer, therefore many of the inhibitors being designed to target these kinases are in clinical trials. In the current study we have exploited the N-9 substituted 6-(4-(4-propoxyphenyl piperazin-1-yl-9H-purine derivatives for their inhibitory properties with the above kinases. We have used an in silico docking study with seventeen purine derivatives for their binding affinity calculations. The binding affinities of these small molecules with P70-S6K1 & PI3K-δ were performed using AutoDock Vina. Among all the compounds, PP16 showed highest binding affinity of −14.7 kcal/mol with P70-S6K1 kinase & −17.2 kcal/mol with PI3K-δ kinases as compared to the molecules under clinical trials (PF-4708671 & IC-87114. Docking studies revealed that N-9 coumarine substituted purine derivative could be one of the potential ligands for the inhibition of P70-S6K1 & PI3K-δ kinases. Hence, this compound can be further investigated by in vitro and in vivo experiments for further validation.

Simple, heart-smart substitutions

Science.gov (United States)

Coronary artery disease - heart smart substitutions; Atherosclerosis - heart smart substitutions; Cholesterol - heart smart substitutions; Coronary heart disease - heart smart substitutions; Healthy diet - heart ...

Association of Dietary Proportions of Macronutrients with Visceral Adiposity Index: Non-Substitution and Iso-Energetic Substitution Models in a Prospective Study.

Science.gov (United States)

Moslehi, Nazanin; Ehsani, Behnaz; Mirmiran, Parvin; Hojjat, Parvane; Azizi, Fereidoun

2015-10-26

We aimed to investigate associations between dietary macronutrient proportions and prospective visceral adiposity index changes (ΔVAI). The study included 1254 adults (18-74 years), from the Tehran Lipid and Glucose Study (TLGS), who were followed for three years. Dietary intakes were assessed twice using food frequency questionnaires. Associations of dietary macronutrient with ΔVAI and risk of visceral adiposity dysfunction (VAD) after three years were investigated. The percentage of energy intake from protein in the total population, and from fat in women, were associated with higher increases in VAI. A 5% higher energy intake from protein substituted for carbohydrate, monounsaturated fatty acids (MUFAs), and polyunsaturated fatty acids (PUFAs) was associated with higher ΔVAI. Higher energy intake from animal protein substituted for PUFAs was positively associated with ΔVAI. Substituting protein and PUFAs with MUFAs were related to higher ΔVAI. The associations were similar in men and women, but reached significance mostly among women. Risk of VAD was increased when 1% of energy from protein was replaced with MUFAs. Substituting protein for carbohydrate and fat, and fat for carbohydrate, resulted in increased risk of VAD in women. Higher dietary proportions of protein and animal-derived MUFA may be positively associated with ΔVAI and risk of VAD.

Micro-, to nano-structural relationships in natural serpentines, derived from cationic substitutions.

Science.gov (United States)

Munoz, M.; Farges, F.; Andreani, M.; Ulrich, M.; Marcaillou, C.; Mathon, O.

2014-12-01

The understanding of the crystal chemistry of serpentine minerals (incl. antigorite, lizardite and chrysotile) is fundamental since serpentinization processes concern very large scientific domains: e.g., natural abiotic hydrogen production (Marcaillou et al., 2011), origins of life (Russell et al., 2010), fluid properties and mobility of metals in subduction zones (Kelley and Cottrell, 2009). This study aims at characterizing relations between the micro-, and nano-structures of the most abundant serpentine polytypes in the oceanic crust. Serpentine theoretical formula is Mg3Si2O5(OH)4 but several natural substitutions are possible and the formula may be written such as: (Mg,Fe2+,Fe3+,Al)3(Si,Al,Fe3+)2O5(OH)4; showing that Fe and Al may play an important role in the crystallization of serpentines. Preliminary crystal chemistry studies, suggest that, 1) the Al content alone cannot be directly correlated to serpentine polytypes (Andreani et al., 2008), 2) the amounts of tetrahedral iron can be significant in the presence of ferric iron (Marcaillou et al., 2011). Because magnetite is usually associated to serpentine, the Fe-speciation characterization of serpentine is delicate. Here, we provide the study of 33 magnetite-free serpentines containing various amounts of Fe and Al. The samples were characterized by SEM, Raman, XRF, as well as XANES, pre-edge, and EXAFS spectroscopy at the Fe K-edge. XANES experimental data were crosschecked and interpreted thanks to ab initio calculations and EXAFS shell-fitting. Also, preliminary 27Al-RMN data is presented. Results suggest relationships between the type and amount of substitution of trivalent cations in minerals, and the microstructures observed. Chrysotile incorporates less trivalent cations than other varieties, which tends to preserve the so-called misfit between the TO layers, and therefore the tubular structure of the mineral. Lizardites mainly involve Fe/Al Tschermak-type substitutions, while M-site vacancy charge

preparation and nucleophilic substitution of the 2,4,6

African Journals Online (AJOL)

Mgina

Three methods for preparation of D-amino acids by nucleophilic substitution on derivatives of ... bioactivity of the peptide (Wenger 1985, ... Acetic acid (0.29 mL, 5 mmol) was added, and the mixture was further stirred for 5 h at rt under ... methanol/dichloromethane) to yield a white ... temperature, diluted with water, extracted.

[Glycosilated derivatives of substituted hydroxylamine. II. Phase transfer synthesis and investigation of glycosyl transfer reaction of glucosaminides of substituted hydroxylavine].

Science.gov (United States)

Kur'ianov, V O; Lushchik, A A; Chupakhina, T A

2013-01-01

1-(2-Acetamido-3,4,6,-tri-O-acetyl-2-deoxy-beta-D-glucopyranosyloxy)-benzotriazole reacted in boiling dichloromethane, in the presence of Luis acids as a promotors with primary and secondary aliphatic and cycloaliphatic alcohols and diisopropilidene galactose with alkyl-O-1,2-trans-glucosaminides formation. It was shown that the other glucosaminides of substituted hydroxylamine are not participated in this reaction. Structures of glucosaminides were identify by 1H-NMR-spectroscopy and comparison with known compounds.

Isotope-labelled folic acid derivatives

International Nuclear Information System (INIS)

Lewin, N.; Wong, E.T.

1976-01-01

The suggestion deals with the production of folic acid derivatives suitable as indicators or tracers for analyses of serum folates. These folic acid derivatives contain folic acid which is bound by one or both carboxyl groups to the amino nitrogen of compounds such as, e.g., tyramine, glycyl tyrosine, tyrosine, or the methyl ester of tyrosine. The derivative obtained can be substituted by a gamma emitter, e.g. the iodine isotope I 125. The radioactive derivative is used in the method for the competitive protein bonding to determine endogenic folates in the serum. (UWI) [de

Evaluation of substituted ebselen derivatives as potential trypanocidal agents.

Science.gov (United States)

Gordhan, Heeren M; Patrick, Stephen L; Swasy, Maria I; Hackler, Amber L; Anayee, Mark; Golden, Jennifer E; Morris, James C; Whitehead, Daniel C

2017-02-01

Human African trypanosomiasis is a disease of sub-Saharan Africa, where millions are at risk for the illness. The disease, commonly referred to as African sleeping sickness, is caused by an infection by the eukaryotic pathogen, Trypanosoma brucei. Previously, a target-based high throughput screen revealed ebselen (EbSe), and its sulfur analog, EbS, to be potent in vitro inhibitors of the T. brucei hexokinase 1 (TbHK1). These molecules also exhibited potent trypanocidal activity in vivo. In this manuscript, we synthesized a series of sixteen EbSe and EbS derivatives bearing electron-withdrawing carboxylic acid and methyl ester functional groups, and evaluated the influence of these substituents on the biological efficacy of the parent scaffold. With the exception of one methyl ester derivative, these modifications ablated or blunted the potent TbHK1 inhibition of the parent scaffold. Nonetheless, a few of the methyl ester derivatives still exhibited trypanocidal effects with single-digit micromolar or high nanomolar EC 50 values. Copyright © 2016 Elsevier Ltd. All rights reserved.

Syntheses and biological activities of 13-substituted avermectin aglycons.

Science.gov (United States)

Mrozik, H; Linn, B O; Eskola, P; Lusi, A; Matzuk, A; Preiser, F A; Ostlind, D A; Schaeffer, J M; Fisher, M H

1989-02-01

The reactions of sulfonate esters of the allylic/homoallylic 13-alcohol of 5-O-(tert-butyldimethylsilyl)-22,23-dihydroavermectin B1a aglycon (1a) were investigated. Nucleophilic substitution gave 13 beta-chloro and 13 beta-iodo derivatives, while solvolytic reaction conditions yielded 13 alpha-methoxy, 13 alpha-fluoro, and 13 alpha-chloro products. A mixture of 13 alpha- and 13 beta-fluorides was obtained upon reaction with DAST. The 13 beta-iodide gave, upon elimination with lutidine, the 8(9),10(11),12(13),14(15)-tetraene. The 13 beta-alcohol and the rearranged 15-ol 13(14)-ene and 15-amino 13(14)-ene derivatives were obtained by substitution via the allylic carbonium ion. MEM ethers 11 and 12 of the two epimeric 13-ols were prepared by alkylation with MEM chloride. In contrast, methylation of 1a with MeI and Ag2O in CH2Cl2 occurred exclusively at the tertiary 7-hydroxy group and not at the secondary 13 alpha-ol. Oxidation of the allylic alcohol 1a proceeded under Swern conditions but not with MnO2 to the 13-oxo aglycon, which was reduced by NaBH4 exclusively to the natural 13 alpha-ol, while reductive amination with NaCNBH3-NH4OAc gave the 13 alpha-amine. The methoxime derivative was obtained in the form of the two geometric isomers. Anthelmintic activities against the sheep nematode Trichostrongylus colubriformis, miticidal activities against the two-spotted spider mite (Tetranychus urticae), and insecticidal activities against the southern armyworm (Spodoptera eridania) as well as the binding constants to a free living nematode (Caenorhabditis elegans) derived receptor assay were obtained and compared to avermectin B1a, 22,23-dihydroavermectin B1a, and the 13-deoxy-22,23-dihydroavermectin B1 aglycon related to the milbemycins. None of the newly prepared derivatives exceeded the potency of the three reference compounds. Lipophilic 13-substituents such as halogen, alkoxy, and methoxime retained high biological activities in all assays, while the more polar

Synthesis of Some O-Substituted Derivatives of Natural 6-hydroxymethyl-4-methoxy-2H-pyran-2-one (opuntiol)

International Nuclear Information System (INIS)

Shahzadi, T.; Akhtar, M.; Rehman, A.; Riaz, T.; Ashraf, M.

2013-01-01

This manuscript reports the synthesis of a series of new O-substituted derivatives of opuntiol (1) which is a naturally occurring compound isolated from a plant Opuntia dillenii Haw belonging to family Cactaceae. These derivatives 3a-t, were characterized by FAB-MS, IR, and 1H-NMR and then screened against acetylcholinesterase, butyrylcholinesterase, lipoxygenase and H-chymotrypsin enzymes. The screening results revealed that 6-(acetyloxy) methyl- 4-methoxy-2H-pyran-2-one (3b) and N-(2,5-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl) methoxy)acetamide (3p) were found to be the inhibitor of butyrylcholinesterase while 6-(acetyloxy) methyl- 4-methoxy-2H-pyran-2-one (3b), 6-(ethoxymethyl)-4-methoxy-2H-pyran-2-one (3c), 4-methoxy-6-((phenylmethoxy)methyl)-2H-pyran-2-one (3g), 6-((2-bromoethyloxy)methyl)-4-methoxy-2H-pyran-2-one (3j), N-(5-chloro-2-ethoxyphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy) acetamide (3r), N-(3,4-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy)acetamide (3s) N-(3,5-dimethylphenyl)-2-((4-methoxy-6-oxo-2H-pyran-2-yl)methoxy)acetamide (3t) were found to be active against H-chymotrypsin and among these 3s was the good inhibitor of this enzyme having IC50 value of 142.71 +- 0.22 micro moles/L. (author)

Stereocomplementary Construction of Optically Active Bicyclo[4.3.0]nonenone Derivatives.

Science.gov (United States)

Mukai, Chisato; Kim, Jin Sung; Sonobe, Hiroshi; Hanaoka, Miyoji

1999-09-03

Treatment of (5S,6S)-5,6-bis(tert-butyldimethylsiloxy)-8-(substituted)oct-1-en-7-yne derivatives, prepared from diethyl L-tartrate, with Co(2)(CO)(8) afforded the corresponding cobalt-complexed enynes, which were subsequently exposed to the typical Pauson-Khand conditions to furnish highly stereoselectively or exclusively (2S,3S,6S)-2,3-bis(tert-butyldimethylsiloxy)-9-(substituted)bicyclo[4.3.0]non-1(9)-en-8-ones. On the other hand, (3S,4S)-1-(substituted)oct-7-en-1-yne-3,4-diol congeners produced, on exposure to the Pauson-Khand conditions, (2S,3S,6R)-2,3-dihydroxy-9-(substituted)bicyclo[4.3.0]-non-1(9)-en-8-one derivatives in a highly stereoselective manner. The newly developed procedure has been shown to be useful for construction of the 2,3-bis(oxygenated)-7-(substituted)bicyclo[4.3.0]non-6-en-8-one framework in a stereocomplementary as well as stereoselective fashion.

Computational Electrochemistry Study of Derivatives of Anthraquinone and Phenanthraquinone Analogues

DEFF Research Database (Denmark)

Wang, Zhen; Li, Anyang; Gou, Lei

2016-01-01

The substituent effect on fused heteroaromatic anthraquinone and phenanthraquinone are investigated by density functional calculations to determine some guidelines for designing potential cathode materials for rechargeable Li-ion batteries. The calculated redox potentials of the quinone derivatives...... change monotonically with increasing number of substitutions. Full substitution with electron-withdrawing groups brings the highest redox potential; however, mono-substitution results in the largest mass energy density. Carbonyl groups are the most favorable active Li-binding sites; moreover......, intramolecular lithium bonds can be formed between Li atoms and electronegative atoms from the substituent groups. The lithium bonds increase the redox potential by improving the thermodynamic stabilization of the lithiation derivatives. Furthermore, the calculation of nucleus-independent chemical shift...

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

Directory of Open Access Journals (Sweden)

Nalin CW Goonesekere

2009-06-01

Full Text Available Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP database. We show that when incorporated into the homology search algorithms BLAST and PSI-blaST, the structure-based substitution matrices enhance the efficacy of detecting remote homologs. Keywords: computational biology, protein homology, amino acid substitution matrix, protein structure

Neutron scattering from a substitutional mass defect

International Nuclear Information System (INIS)

Williams, R.D.; Lovesey, S.W.

1985-06-01

The dynamic structure factor is calculated for a low concentration of light mass scatterers substituted in a cubic crystal matrix. A new numerical method for the exact calculation is demonstrated. A local density of states for the low momentum transfer limit, and the shifts and widths of the oscillator peaks in the high momentum transfer limit are derived. The limitations of an approximation which decouples the defect from the lattice is discussed. (author)

Dihydroxylation of 4-substituted 1,2-dioxines

DEFF Research Database (Denmark)

Robinson, Tony V; Pedersen, Daniel Sejer; Taylor, Dennis K

2009-01-01

The synthesis of 2-C-branched erythritol derivatives, including the plant sugar (+/-)-2-C-methylerythritol 2, was achieved through a dihydroxylation/reduction sequence on a series of 4-substituted 1,2-dioxines 3. The asymmetric dihydroxylation of 1,2-dioxines was examined, providing access...... to optically enriched dihydroxy 1,2-dioxanes 4. The synthesized 1,2-dioxanes were converted to other erythro sugar analogues and tetrahydrofurans through controlled cleavage of the endoperoxide linkage....

Biologically stable [18F]-labeled benzylfluoride derivatives

International Nuclear Information System (INIS)

Magata, Yasuhiro; Lang, Lixin; Kiesewetter, Dale O.; Jagoda, Elaine M.; Channing, Michael A.; Eckelman, William C.

2000-01-01

Use of the [ 18 F]-fluoromethyl phenyl group is an attractive alternative to direct fluorination of phenyl groups because the fluorination of the methyl group takes place under milder reaction conditions. However, we have found that 4-FMeBWAY showed femur uptake equal to that of fluoride up to 30 min in rat whereas 4-FMeQNB had a significantly lower percent injected dose per gram in femur up to 120 min. For these and other benzylfluoride derivatives, there was no clear in vivo structure-defluorination relationship. Because benzylchlorides (BzCls) are known alkylating agents, benzylfluorides may be alkylating agents as well, which may be the mechanism of defluorination. On this basis, the effects of substitution on chemical stability were evaluated by the 4-(4-nitro-benzyl)-pyridine (NBP) test, which is used to estimate alkylating activity with NBP. The effect of substitution on the alkylating activity was evaluated for nine BzCl derivatives: BzCl; 3- or 4-methoxy (electron donation) substituted BzCl; 2-, 3-, or 4-nitro (electron withdrawing) substituted BzCl; and 2-, 3-, or 4-chloro (electron withdrawing) substituted BzCl. Taken together, the alkylating reactivity of 3-chloro-BzCl was the weakest. This result was then applied to [ 18 F]-benzylfluoride derivatives and in vivo and in vitro stability were evaluated. Consequently, 3-chloro-[ 18 F]-benzylfluoride showed a 70-80% decrease of defluorination in both experiments in comparison with [ 18 F]-benzylfluoride, as expected. Moreover, a good linear relationship between in vivo femur uptake and in vitro hepatocyte metabolism was observed with seven 18 F-labeled radiopharmaceuticals, which were benzylfluorides, alkylfluorides, and arylfluorides. Apparently, the [ 18 F]-fluoride ion is released by metabolism in the liver in vivo. In conclusion, 3-chloro substituted BzCls are the most stable, which suggests that 3-chloro benzylfluorides will be the most chemically stable compound. This result should be important in

Photo-rearrangements of some 3-allyloxy-2-phenyl-chromones: Synthesis of vinyl substituted benzopyronopyranes

Directory of Open Access Journals (Sweden)

Rupesh Kumar

2008-10-01

Full Text Available Photochemical reactions of some 3-allyloxy-2-phenylchromones have been studied. Photoreactions of the compounds afforded substituted pyronopyrane derivatives through the 1,4-biradicals.

Anti-leishmanial and structure-activity relationship of ring substituted 3-phenyl-1-(1,4-di-N-oxide quinoxalin-2-yl-2-propen-1-one derivatives

Directory of Open Access Journals (Sweden)

Asunción Burguete

2008-12-01

Full Text Available A series of ring substituted 3-phenyl-1-(1,4-di-N-oxide quinoxalin-2-yl-2-propen-1-one derivatives were synthesized and tested for in vitro leishmanicidal activity against amastigotes of Leishmania amazonensis in axenical cultures and murine infected macrophages. Structure-activity relationships demonstrated the importance of a radical methoxy at position R3', R4' and R5'. (2E-3-(3,4,5-trimethoxy-phenyl-1-(3,6,7-trimethyl-1,4-dioxy-quinoxalin-2-yl-propenone was the most active. Cytotoxicity on macrophages revealed that this product was almost six times more active than toxic.

Banana-shaped molecules derived from substituted isophthalic acids

Indian Academy of Sciences (India)

In this paper we present a review of five-rings banana-shaped molecules derived from isophthalic acids. This study deals with about a hundred compounds and most of them have not been published. By a combination of several linking groups and different selected substituents either on the outer rings or on the central core ...

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST.

Science.gov (United States)

Goonesekere, Nalin Cw

2009-01-01

The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP) database. We show that when incorporated into the homology search algorithms BLAST and PSI-blast, the structure-based substitution matrices enhance the efficacy of detecting remote homologs.

Modeling charge transport properties of cyano-substituted PPV

International Nuclear Information System (INIS)

Correia, Helena M.G.; Ramos, Marta M.D.

2003-01-01

In recent years, poly (p-phenylenevinylene) (PPV) and its derivatives have attracted much interest due to their applications in light-emitting diodes (LEDs). One of the issues that determine device performance is the transport of charge carriers along the polymer strands. For that reason, we investigate the influence of cyano substitution on geometry and electronic behaviour of PPV chains using self-consistent quantum molecular dynamics simulations. Our results suggest that substitution by cyano groups induce distortion in the PPV chains and a charge rearrangement among the polymer atoms. Specifically addressed is the issue concerning estimates of charge (electron and hole) mobility by computer experiments. Significant differences have been found both in the strength of the electric field needed to move positive and negative charge carriers along the polymer chain as well as in charge mobility

Preparation of new boron compounds with potential for application in 10B NCT: Derivatives of monocarbon carboranes

International Nuclear Information System (INIS)

Morris, J.H.; Khan, S.A.; Mair, F.; Peters, G.

1992-01-01

In order to extend the range and versatility of boron clusters appropriate to NCT the authors have studied routes to derivatives of the anions 1-carba-closo-dodecahydrododecaborate-1, [CB 11 H 12 ] - , (1), and its synthetic precursor, 7-carba-nido-tridecahydroundecaborate-1, [CB 10 H 13 ] - , (2). Substitution chemistry of closo-[CB 11 H 12 ] - and its derivatives had been examined previously primarily with respect to substituents at the C-atom. The different isomeric sites of boron substitution, which have been much less studied, offer potential scope for subtle modification of properties of the substituted species. They have sought to prepare thiol substituted derivatives analogous to the widely studied species [B 12 H 11 SH] 2- . The preliminary experiments to introduce the thiol substituent by routes analogous to those for the preparation of [B 12 H 11 SH] 2- or 1- and 2-[B 10 H 9 SH] 2- were unsuccessful. Therefore they considered routes involving prior substitution of either the precursor nido-[CB 10 H 13 ] - and its derivatives, or the monoboron species used for boron insertion

Syntheses and anti-microbial evaluation of new quinoline scaffold derived pyrimidine derivatives

Directory of Open Access Journals (Sweden)

Shikha S. Dave

2016-09-01

Full Text Available A series of diversely substituted chalcones derived from a quinoline scaffold, e.g. (E-3-(2-chloroquinolin-3-yl-1-(2-hydroxyphenyl prop-2-en-1-one and its pyrimidine analogues e.g. 2-[2-amino-6-(2-chloroquinolin-3-yl-5,6-dihydropyrimidin-4-yl]phenols have been prepared by condensation of 2-chloro-3-formyl quinoline with differently substituted 2-hydroxy acetophenones and further treatment with guanidine carbonate. All the newly synthesized compounds have been evaluated for their in vitro growth inhibitory activity against Escherichia coli, Pseudomonas vulgaris, Bacillus subtilis, Staphylococcus aureus, Staphylococcus typhi, Candida albicans, Aspergillus niger and Pseudomonas chrysogenum.

Impacts of Vehicle Weight Reduction via Material Substitution on Life-Cycle Greenhouse Gas Emissions.

Science.gov (United States)

Kelly, Jarod C; Sullivan, John L; Burnham, Andrew; Elgowainy, Amgad

2015-10-20

This study examines the vehicle-cycle and vehicle total life-cycle impacts of substituting lightweight materials into vehicles. We determine part-based greenhouse gas (GHG) emission ratios by collecting material substitution data and evaluating that alongside known mass-based GHG ratios (using and updating Argonne National Laboratory's GREET model) associated with material pair substitutions. Several vehicle parts are lightweighted via material substitution, using substitution ratios from a U.S. Department of Energy report, to determine GHG emissions. We then examine fuel-cycle GHG reductions from lightweighting. The fuel reduction value methodology is applied using FRV estimates of 0.15-0.25, and 0.25-0.5 L/(100km·100 kg), with and without powertrain adjustments, respectively. GHG breakeven values are derived for both driving distance and material substitution ratio. While material substitution can reduce vehicle weight, it often increases vehicle-cycle GHGs. It is likely that replacing steel (the dominant vehicle material) with wrought aluminum, carbon fiber reinforced plastic (CRFP), or magnesium will increase vehicle-cycle GHGs. However, lifetime fuel economy benefits often outweigh the vehicle-cycle, resulting in a net total life-cycle GHG benefit. This is the case for steel replaced by wrought aluminum in all assumed cases, and for CFRP and magnesium except for high substitution ratio and low FRV.

Radiolabeled derivatives of folic acid

International Nuclear Information System (INIS)

1980-01-01

Derivatives of folic acid are described, in which the α-carboxyl group is substituted with an amino compound having an aromatic or heterocyclic ring substituent which is capable of being radiolabelled. Particularly mentioned as a radiolabel is 125 I. (author)

Synthesis and Antibacterial Activity of Some New Phenothiazine Derivatives

Directory of Open Access Journals (Sweden)

Pawan Kumar Swarnkar

2007-01-01

Full Text Available A series of some new phenothiazine derivatives were synthesized with the objective for evaluation as antimicrobials. The title compounds were prepared by a five step synthesis scheme. 2-Amino-6-substituted benzothiazoles (1 on diazotization afford 6-substituted benzothiazolyl-2-diazonium chlorides (2. Reaction of 2 with cold solution of β-naphthol in dilute NaOH furnishes α-(2-diazo-6-substituted benzothiazolyl- β-sodionaphthoxides (3 which on acidification with concentrated HCl gives α-(2-diazo-6-substituted benzothiazolyl-β-naphthols (4. Reaction of 4 with p-substituted anilines gives α-(2-diazo-6-substituted benzothiazolyl-β-(p-substituted anilino naphthalenes (5. This synthesis besides by using conventional methods was also attempted using microwave. Fusion of 5 with sulphur in presence of iodine results in α-(2-diazo-6-substituted benzothiazolyl-6- substituted [2, 3-b] benzophenothiazines(6. The structures of all these compounds have been supported by elemental analysis and their spectral studies. All synthesized compounds were tested for their antibacterial activity using standard drugs.

The formation of [M-H]+ ions in N-alkyl-substituted thieno[3,4-c]-pyrrole-4,6-dione derivatives during atmospheric pressure photoionization mass spectrometry

KAUST Repository

Sioud, Salim

2014-10-09

RESULTS [M-H]+ ions were observed under APPI conditions. The type of dopant and the length of the alkyl chain affected the formation of these ions. MS/MS fragmentation of [M-H]+ and [M + H]+ ions exhibited completely different patterns. Theoretical calculations revealed that the loss of hydrogen molecules from the [M + H]+ ions is the most favourable condition under which to form [M-H]+ ions.CONCLUSIONS [M-H]+ ions were detected in all the TPD derivatives studied here under the special experimental conditions during APPI, using a halogenated benzene dopant, and TPD containing substituted N-alkyl side chains with a minimum of four carbon atoms. Density functional theory calculations showed that for [M-H]+ ions to be formed under these conditions, the loss of hydrogen molecules from the [M + H]+ ions is proposed to be necessary.RATIONALE The formation of ions during atmospheric pressure photoionization (APPI) mass spectrometry in the positive mode usually provides radical cations and/or protonated species. Intriguingly, during the analysis of some N-alkyl-substituted thieno[3,4-c]pyrrole-4,6-dione (TPD) derivatives synthesized in our laboratory, unusual [M-H]+ ion peaks were observed. In this work we investigate the formation of [M-H]+ ions observed under APPI conditions.METHODS Multiple experimental parameters, including the type of ionization source, the composition of the solvent, the type of dopant, the infusion flow rate, and the length of the alkyl side chain were investigated to determine their effects on the formation of [M-H]+ ions. In addition, a comparison study of the gas-phase tandem mass spectrometric (MS/MS) fragmentation of [M + H]+ vs [M-H]+ ions and computational approaches were used.

Elucidation of the substitution pattern of 9,10-anthraquinones through the chemical shifts of peri-hydroxyl protons

DEFF Research Database (Denmark)

Schripsema, Jan; Danigno, Denise

1996-01-01

In 9,10-anthraquinones the chemical shift of a peri-hydroxyl proton is affected by the substituents in the other benzenoid ring. These effects are additive. They are useful for the determination of substitution patterns and have been used to revise the structures of six previously reported...... anthraquinones containing methoxyl, hydroxyl, methylenedioxy and beta-methyl substituents. Because the chemical shifts of the other protons are hardly affected by substitutions in the other ring, the characteristic chemical shifts for a wide variety of substitution patterns could be derived....

Substituted Phthalic Anhydrides from Biobased Furanics : A New Approach to Renewable Aromatics

NARCIS (Netherlands)

Thiyagarajan, Shanmugam; Genuino, Homer C.|info:eu-repo/dai/nl/371571685; Sliwa, Michal; van der Waal, Jan C.; de Jong, Ed; van Haveren, Jacco; Weckhuysen, Bert M.|info:eu-repo/dai/nl/285484397; Bruijnincx, Pieter C. A.|info:eu-repo/dai/nl/33799529X; van Es, Daan S.

2015-01-01

A novel route for the production of renewable aromatic chemicals, particularly substituted phthalic acid anhydrides, is presented. The classical two-step approach to furanics-derived aromatics via Diels-Alder (DA) aromatization has been modified into a three-step procedure to address the general

A microwave-catalyzed rapid, efficient and ecofriendly synthesis of substituted pyrazol-5-ones

Directory of Open Access Journals (Sweden)

RAHUL P. GAVANDE

2003-10-01

Full Text Available A series of 1-(3,4-dihydro-3-oxo-2H-1,4-benzoxazine-2-carbonyl-3-methyl-4-(substituted phenylhydrazono-2-pyrazolin-5-ones have been synthesized by the reaction of 2H-3,4-dihydro-3-oxo-1,4-benzoxazine-2-carboxylic acid hydrazide with substituted acetoacetic ester derivatives using acetic acid as solvent under microwave irradiation (MWI, as well as by conventional methods. The reaction rate is enhanced tremendously and the yields are improved under MWI as compared to conventional methods.

40 CFR 721.2577 - Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine...

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted phenyl...

Synthesis, antimicrobial, and anti-inflammatory activities of novel 2-[3-(1-adamantyl)-4-substituted-5-thioxo-1,2,4-triazolin-1-yl] acetic acids, 2-[3-(1-adamantyl)-4-substituted-5-thioxo-1,2,4-triazolin-1-yl]propionic acids and related derivatives.

Science.gov (United States)

Al-Deeb, Omar A; Al-Omar, Mohamed A; El-Brollosy, Nasser R; Habib, Elsayed E; Ibrahim, Tarek M; El-Emam, Ali A

2006-01-01

The reaction of 3-(1-adamantyl)-4-substituted-1,2,4-triazoline-5-thiones 3a-g with sodium chloroacetate, in ethanolic sodium hydroxide yielded the corresponding N1-acetic acid derivatives 4a-g. The interaction of 3a-g with ethyl 2-bromopropionate in acetone, in the presence of potassium carbonate, yielded the corresponding N1-ethyl propionate derivatives 5a-g, which upon hydrolysis with aqueous sodium hydroxide afforded the corresponding propionic acid derivatives 6a-g. Similarly, the reaction of 3-(1-adamantyl)-4-amino-1,2,4-triazoline-5-thione 7 with sodium chloroacetate in ethanolic sodium hydroxide yielded the corresponding N1-acetic acid derivative 8. On the other hand, the reaction of 2-(1-adamantyl)-1,3,4-oxadiazoline-5-thione 9 with sodium chloroacetate yielded the corresponding S-acetic acid derivative 10. Compounds 4a-g, 5b, 5c, 5g, 6a-g, 8 and 10 were tested for in vitro activities against a panel of Gram-positive and Gram-negative bacteria and the yeast-like pathogenic fungus Candida albicans. Several derivatives produced good or moderate activities particularly against Bacillus subtilis. In addition, the in vivo anti-inflammatory activities of these compounds were determined using the carrageenin-induced paw oedema method in rats. Compounds 4a, 4b, 4e, 4f, 6f, 6g and 10 produced good dose-dependent anti-inflammatory activities.

D-amino acid substitution enhances the stability of antimicrobial peptide polybia-CP.

Science.gov (United States)

Jia, Fengjing; Wang, Jiayi; Peng, Jinxiu; Zhao, Ping; Kong, Ziqing; Wang, Kairong; Yan, Wenjin; Wang, Rui

2017-10-01

With the increasing emergence of resistant microbes toward conventional antimicrobial agents, there is an urgent need for the development of antimicrobial agents with novel action mode. Antimicrobial peptides (AMPs) are believed to be one kind of ideal alternatives. However, AMPs can be easily degraded by protease, which limited their therapeutic use. In the present study, D-amino acid substitution strategy was employed to enhance the stability of polybia-CP. We investigated the stability of peptides against the degradation of trypsin and chymotrypsin by determining the antimicrobial activity or determining the HPLC profile of peptides after incubation with proteases. Our results showed that both the all D-amino acid derivative (D-CP) and partial D-lysine substitution derivative (D-lys-CP) have an improved stability against trypsin and chymotrypsin. Although D-CP takes left-hand α-helical conformation and D-lys-CP loses some α-helical content, both of the D-amino acid-substituted derivatives maintain their parental peptides' membrane active action mode. In addition, D-lys-CP showed a slight weaker antimicrobial activity than polybia-CP, but the hemolytic activity decreased greatly. These results suggest that D-CP and D-lys-CP can offer strategy to improve the property of AMPs and may be leading compounds for the development of novel antimicrobial agents. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Preparation, characterization and biological activity of C8-substituted cytokinins

Czech Academy of Sciences Publication Activity Database

Zahajská, Lenka; Nisler, Jaroslav; Voller, Jiří; Gucký, Tomáš; Pospíšil, Tomáš; Spíchal, Lukáš; Strnad, Miroslav

2017-01-01

Roč. 135, MAR (2017), s. 115-127 ISSN 0031-9422 Institutional support: RVO:61389030 Keywords : potential purine antagonists * arabidopsis-thaliana * nucleosides * derivatives * thidiazuron * specificity * receptors * kinetin * Organic synthesis * Cytokinin bioassay * AHK3 and CRE1/AHK4 bacterial receptor assay * C8-substituted cytokinin Subject RIV: CE - Biochemistry OBOR OECD: Organic chemistry Impact factor: 3.205, year: 2016

Synthesis and antitumoral activity of novel 3-(2-substituted-1,3,4-oxadiazol-5-yl) and 3-(5-substituted-1,2,4-triazol-3-yl) beta-carboline derivatives.

Science.gov (United States)

Formagio, Anelise S Nazari; Tonin, Lilian T Düsman; Foglio, Mary Ann; Madjarof, Christiana; de Carvalho, João Ernesto; da Costa, Willian Ferreira; Cardoso, Flávia P; Sarragiotto, Maria Helena

2008-11-15

Several novel 1-substituted-phenyl beta-carbolines bearing the 2-substituted-1,3,4-oxadiazol-5-yl and 5-substituted-1,2,4-triazol-3-yl groups at C-3 were synthesized and evaluated for their in vitro anticancer activity. The assay results pointed thirteen compounds with growth inhibition effect (GI(50)<100 microM) for all eight different types of human cancer cell lines tested. The beta-carbolines 7a and 7h, bearing the 3-(2-metylthio-1,3,4-oxadiazol-5-yl) group, displayed high selectivity and potent anticancer activity against ovarian cell line with GI(50) values lying in the nanomolar concentration range (GI(50)=10 nM for both compounds). The 1-(N,N-dimethylaminophenyl)-3-(5-thioxo-1,2,4-triazol-3-yl) beta-carboline (8g) was the most active compound, showing particular effectiveness on lung (GI(50)=0.06 microM), ovarian and renal cell lines. The potent anticancer activity presented for synthesized compounds 7a, 7h, and 8g, together with their easiness of synthesis, makes these compounds promising anticancer agents.

Theoretical study of substitution effects on molecular reorganization energy in organic semiconductors.

Science.gov (United States)

Geng, Hua; Niu, Yingli; Peng, Qian; Shuai, Zhigang; Coropceanu, Veaceslav; Brédas, Jean-Luc

2011-09-14

Chemical substitutions are powerful molecular design tools to enhance the performance of organic semiconductors, for instance, to improve solubility, intermolecular stacking, or film quality. However, at the microscopic level, substitutions in general tend to increase the molecular reorganization energy and thus decrease the intrinsic charge-carrier mobility. Through density functional theory calculations, we elucidate strategies that could be followed to reduce the reorganization energy upon chemical substitution. Specific examples are given here for hole-transport materials including indolo-carbazoles and several triarylamine derivatives. Through decomposition of the total reorganization energy into the internal coordinate space, we are able to identify the molecular segment that provides the most important contributions to the reorganization energy. It is found that when substitution reduces (enhances) the amplitude of the relevant frontier molecular orbital in that segment, the total reorganization energy decreases (increases). In particular, chlorination at appropriate positions can significantly reduce the reorganization energy. Several other substituents are shown to play a similar role, to a greater or lesser extent. © 2011 American Institute of Physics

Metal borohydrides and derivatives

DEFF Research Database (Denmark)

Paskevicius, Mark; Haarh Jepsen, Lars; Schouwink, Pascal

2017-01-01

major classes of metal borohydride derivatives have also been discovered: anion-substituted compounds where the complex borohydride anion, BH4 -, is replaced by another anion, i.e. a halide or amide ion; and metal borohydrides modified with neutral molecules, such as NH3, NH3BH3, N2H4, etc. Here, we...

Synthesis and Cytotoxicity of Novel Hexahydrothienocycloheptapyridazinone Derivatives

Directory of Open Access Journals (Sweden)

Irene Marchesi

2009-09-01

Full Text Available Designed as a new group of tricyclic molecules containing the thienocycloheptapyridazinone ring system, a number of 2N-substituted-hexahydrothienocycloheptapyridazinone derivatives were synthesized and their biological activity evaluated. Among the synthesized compounds, derivatives 7d and 7h were found to possess cytotoxic activity against non-small cell lung cancer and central nervous system cancer cell lines, respectively.

Packing and Disorder in Substituted Fullerenes

KAUST Repository

Tummala, Naga Rajesh

2016-07-15

Fullerenes are ubiquitous as electron-acceptor and electron-transport materials in organic solar cells. Recent synthetic strategies to improve the solubility and electronic characteristics of these molecules have translated into a tremendous increase in the variety of derivatives employed in these applications. Here, we use molecular dynamics (MD) simulations to examine the impact of going from mono-adducts to bis- and tris-adducts on the structural, cohesive, and packing characteristics of [6,6]-phenyl-C60-butyric acid methyl ester (PCBM) and indene-C60. The packing configurations obtained at the MD level then serve as input for density functional theory calculations that examine the solid-state energetic disorder (distribution of site energies) as a function of chemical substitution. The variations in structural and site-energy disorders reflect the fundamental materials differences among the derivatives and impact the performance of these materials in thin-film electronic devices.

Risk management with substitution options: Valuing flexibility in small-scale energy systems

Science.gov (United States)

Knapp, Karl Eric

Several features of small-scale energy systems make them more easily adapted to a changing operating environment than large centralized designs. This flexibility is often manifested as the ability to substitute inputs. This research explores the value of this substitution flexibility and the marginal value of becoming a "little more flexible" in the context of real project investment in developing countries. The elasticity of substitution is proposed as a stylized measure of flexibility and a choice variable. A flexible alternative (elasticity > 0) can be thought of as holding a fixed-proportions "nflexible" asset plus a sequence of exchange options---the option to move to another feasible "recipe" each period. Substitutability derives value from following a contour of anticipated variations and from responding to new information. Substitutability value, a "cost savings option", increases with elasticity and price risk. However, the required premium to incrementally increase flexibility can in some cases decrease with an increase in risk. Variance is not always a measure of risk. Tools from stochastic dominance are newly applied to real options with convex payoffs to correct some misperceptions and clarify many common modeling situations that meet the criteria for increased variance to imply increased risk. The behavior of the cost savings option is explored subject to a stochastic input price process. At the point where costs are identical for all alternatives, the stochastic process for cost savings becomes deterministic, with savings directly proportional to elasticity of substitution and price variance. The option is also formulated as a derivative security via dynamic programming. The partial differential equation is solved for the special case of Cobb-Douglas (elasticity = 1) (also shown are linear (infinite elasticity), Leontief (elasticity = 0)). Risk aversion is insufficient to prefer a more flexible alternative with the same expected value. Intertemporal

α-Amino Acid Derived Benzimidazole-Linked Rhodamines: A Case of Substitution Effect at the Amino Acid Site toward Spiro Ring Opening for Selective Sensing of Al3+ Ions.

Science.gov (United States)

Majumdar, Anupam; Mondal, Subhendu; Daniliuc, Constantin G; Sahu, Debashis; Ganguly, Bishwajit; Ghosh, Sourav; Ghosh, Utpal; Ghosh, Kumaresh

2017-08-07

α-Amino acid derived benzimidazole-linked rhodamines have been synthesized, and their metal ion sensing properties have been evaluated. Experimentally, l-valine- and l-phenylglycine-derived benzimidazole-based rhodamines 1 and 2 selectively recognize Al 3+ ion in aqueous CH 3 CN (CH 3 CN/H 2 O 4/1 v/v, 10 mM tris HCl buffer, pH 7.0) over the other cations by exhibiting color and "turn-on" emission changes. In contrast, glycine-derived benzimidazole 3 remains silent in the recognition event and emphasizes the role of α-substitution of amino acid undertaken in the design. The fact has been addressed on the basis of the single-crystal X-ray structures and theoretical calculations. Moreover, pink 1·Al 3+ and 2·Al 3+ ensembles selectively sensed F - ions over other halides through a discharge of color. Importantly, compounds 1 and 2 are cell permeable and have been used as imaging reagents for the detection of Al 3+ uptake in human lung carcinoma cell line A549.

Optimising the design of paramagnetic MRI contrast agents: influence of backbone substitution on the water exchange rate of Gd-DTPA derivatives.

Science.gov (United States)

Laurent, S; Botteman, F; Vander Elst, L; Muller, R N

2004-04-01

Among other factors influencing the residence time of the coordinated water (tauM) of paramagnetic contrast agents, the steric hindrance around the gadolinium ion seems to play a beneficial role. Such a crowding can be achieved by substituting the Gd-DTPA backbone on the C4 position. Several Gd-DTPA complexes carrying diverse groups at this position have thus been synthesised and characterised: GdS-C4-Me-DTPA, GdS-C4-n-Bu-DTPA, GdS-C4-iBu-DTPA, GdS-C4-iPr-DTPA, and Gd-C4-diMe-DTPA. TauM has been measured through the evolution of the water oxygen-17 transverse relaxation rate as a function of the temperature. The data show a reduction of tauM of GdS-C4-Me-DTPA, GdS-C4-n-Bu-DTPA, GdS-C4-iBu-DTPA, GdS-C4-iPr-DTPA, and Gd-C4-diMe-DTPA (tauM310 = 91,82, 108,98, and 57 ns respectively, as compared to Gd-DTPA (tauM310 = 143 ns)). At 310 K, the nuclear magnetic dispersion relaxation profiles of water protons are very similar for the five complexes which present longitudinal relaxivities slightly higher than those of Gd-DTPA. Regarding zinc transmetallation, C4-monosubstituted derivatives are more stable than Gd-DTPA. These results confirm that a judicious substitution of the DTPA skeleton allows for an acceleration of the coordinated water exchange rate. This observation can be useful for the design of vectorised contrast agents for molecular imaging. Copyright 2004 ESMRMB

[The substitution effect of leadership substitutes for transformational leadership in nursing organization].

Science.gov (United States)

Kim, Jeong-Hee

2006-04-01

This paper was conducted to examine the effects of transformational leadership behaviors, within the substitutes for leadership model (Kerr & Jermier, 1978). Data was collected from 181 staff nurses in 3 general hospitals, with self-reporting questionnaires (MLQ developed by Bass, rd-SLS developed by Podsakoff, et al., and MSQ developed by Weiss, et al.). Descriptive statistics, factor analysis, Cronbach's alpha and moderated regression analysis were used. 1) The transformational leader behaviors and substitutes for leadership each had correlations with job satisfaction. 2) The total amount of variance accounted for by the substitutes for leadership was substantially greater than by the transformational leadership behaviors. 3) Few of the substitutes variables moderated the relationships between the transformational leader behaviors and job satisfaction in a manner consistent with that specified by Howell, Dorfman, and Kerr (1986). The finding of this study suggest that leaders need to have a better understanding of those contextual variables that influence job satisfaction. Thus future research should focus attention on the moderating effects of substitutes, as well as the things that leaders can do to influence them. In addition, it may be good to examine the effects of substitutes on other criterion variables.

Ultrasound Promoted Synthesis of Bis(substituted pyrazol-4-ylcarbonyl-Substituted Thioureas

Directory of Open Access Journals (Sweden)

Li Xiao

2009-03-01

Full Text Available A series of novel bis(substituted pyrazol-4-ylcarbonyl-substituted thioureas have been synthesized by the reactions of substituted pyrazol-4-ylcarbonyl isothiocyanates with different diamines under ultrasound irradiation and classical heating method at 20-25 °C. In general, substantial improvement in rates and modest yields increases were observed when reactions were carried out under sonication, compared with the classical heating method. The structures of these compounds have been elucidated by elemental and spectral (IR, 1H-NMR analysis.

One Leg hybrid P-stable substitution LMM for oscilatory IVPs in ODEs.

African Journals Online (AJOL)

This presents P-stable successive substitution one-leg hybrid LMM for the numerical solution of oscillatory second order IVPs in ODEs without explicitly defined first order derivative. These problems occurs amongst others, in orbital mechanics where the methods to be presented finds ready applications and need not any a ...

3-(2-Benzofuranyl)quinuclidin-2-ene derivatives: novel muscarinic antagonists.

Science.gov (United States)

Nordvall, G; Sundquist, S; Johansson, G; Glas, G; Nilvebrant, L; Hacksell, U

1996-08-16

A series of 26 derivatives of the novel muscarinic antagonist 3-(2-benzofuranyl)quinuclidin-2-ene (1) has been synthesized and evaluated for muscarinic and antimuscarinic properties. The affinity of the compounds was determined by competition experiments in homogenates of cerebral cortex, heart, parotid gland, and urinary bladder from guinea pigs using (-)-[3H]-3-quinuclidinyl benzilate as the radioligand, and the antimuscarinic-potency was determined in a functional assay on isolated guinea pig urinary bladder using carbachol as the agonist. The 5-fluorobenzofuranyl derivative was slightly more potent than 1. The 7-bromo-substituted 8 displayed a 14-fold tissue selectivity ratio for muscarinic receptors in the cortex versus the parotid gland. Comparative molecular field analysis and quantitative structure-activity relationship models were developed for this series of substituted benzofuranyl derivatives.

Synthesis and Characterization of 5-Substituted 1 H -Tetrazoles in ...

African Journals Online (AJOL)

Nano-TiCl4.SiO2 was found to be an extremely efficient catalyst for the preparation of 5-substituted 1H-tetrazole derivatives. Nano-TiCl4.SiO2 is a solid Lewis-acid was synthesized by the reaction of nano-SiO2 and TiCl4. The structure characterization of this acid was achieved with X-ray diffraction, thermogravimetric ...

Alkynyl substituted carboranes as precursors to boron carbide thin films, fibers and composites

International Nuclear Information System (INIS)

Johnson, S.E.; Yang, X.; Hawthorne, M.F.; Mackenzie, J.D.; Thorne, K.J.; Zheng, H.

1992-01-01

In this paper the use of alkynyl substituted derivatives of o-carborane as precursors to boron containing ceramics is described. These compounds undergo a thermally or photochemically induced polymerization to afford cross linked polyakynyl-o-carborane derivatives. The increase in molecular weight should allow for increased Tg's and the retention of modelled polymer preforms. In this report, these modification reactions are described. In addition, the retention of molded polymer preforms were analyzed after UV exposure and inert atmosphere pyrolysis

Evaluation of substitution monopole models for tire noise sound synthesis

Science.gov (United States)

Berckmans, D.; Kindt, P.; Sas, P.; Desmet, W.

2010-01-01

Due to the considerable efforts in engine noise reduction, tire noise has become one of the major sources of passenger car noise nowadays and the demand for accurate prediction models is high. A rolling tire is therefore experimentally characterized by means of the substitution monopole technique, suiting a general sound synthesis approach with a focus on perceived sound quality. The running tire is substituted by a monopole distribution covering the static tire. All monopoles have mutual phase relationships and a well-defined volume velocity distribution which is derived by means of the airborne source quantification technique; i.e. by combining static transfer function measurements with operating indicator pressure measurements close to the rolling tire. Models with varying numbers/locations of monopoles are discussed and the application of different regularization techniques is evaluated.

Structural investigations of substituted indolizine derivatives by NMR studies

International Nuclear Information System (INIS)

Furdui, Bianca; Dinica, Rodica; Demeunynck, Martine; Druta, Ioan

2008-01-01

Owing to the increasing importance of indolizine heterocycles in the field of biology and pharmacology we have synthesized and investigated the obtained heterocycles by NMR techniques. In order to investigate the substituent effects on the spectroscopic properties, a series of indolizine derivatives were studied by 1 H-NMR, 13 C-NMR and 2D NMR (GCOSY, GHMBC and GHMQC spectra). (authors)

Studies on Synthesis of Some Novel Heterocyclic Chalcone, Pyrazoline, Pyrimidine - 2 - One, Pyrimidine - 2 - Thione, para-Acetanilide Sulphonyl and Benzoyl Derivatives and their Antimicrobial Activity

Directory of Open Access Journals (Sweden)

Rakesh N. Mistry

2005-01-01

Full Text Available 1, 2 - Dichloro benzene on chlorosulphonation by chlorosulphonic acid gives 1, 2 - [dichloro] - benzene sulphonyl chloride which on condensation with p –amino acetophenone gives 1-[acetyl] - 1’ , 2’ - [dichloro] - dibenz sulphonamide derivative. This derivative undergo condensation with 2,4- dichloro benzaldehyde gives 1- [3” - (sub. phenyl - 2” - propene - 1” - one] - 1’ , 2’ - [dichloro] - dibenz sulphonamide derivative which on reaction with 99% hydrazine hydrate and glacial acetic acid gives 1-[acetyl]-3- [1’ , 2’ - (dichloro - dibenz sulphonamide] -5 - [2” , 4” - dichloro phenyl] - 2 - pyrazoline derivative. This derivative reacts with various substituted aldehydes to give corresponding substituted chalcone derivatives [1(a-j]. Now, these chalcone derivatives [1(a-j] on condensation with urea gives corresponding substituted pyrimidine - 2 - one derivatives [2(a-j] and on condensation with thio-urea gives corresponding substituted pyrimidine- 2 -thione derivatives [3(a-j]. Further, these chalcone derivatives [1(a-j] on reaction with 99% hydrazine hydrate gives 1 - [1’ - (H - 5’ - (sub. phenyl - 2’ - pyrazoline]- 3 - [1” , 2” - (dichloro - dibenz sulphonamide] - 5 - [2’’’ , 4’’’ - dichloro phenyl]-2- pyrazoline derivatives [4(a-j] as an intermediate compounds, which on condensation with p-acetanilide sulphonyl chloride gives corresponding substituted p - acetanilide sulphonyl derivatives [5(a-j] and on condensation with benzoyl chloride gives corresponding substituted benzoyl derivatives [6(a-j]. Structure elucidation of synthesised compounds has been made on the basis of elemental analysis, I.R. spectral studies and 1H N.M.R. spectral studies. The antimicrobial activity of the synthesised compounds has been studied against the cultures “Staphylococcus aureus”, “Escherichia coli” and “Candela albicans”.

Sequential Au(I-catalyzed reaction of water with o-acetylenyl-substituted phenyldiazoacetates

Directory of Open Access Journals (Sweden)

Jianbo Wang

2011-05-01

Full Text Available The gold(I-catalyzed reaction of water with o-acetylenyl-substituted phenyldiazoacetates provides 1H-isochromene derivatives in good yields. The reaction follows a catalytic sequence of gold carbene formation/water O–H insertion/alcohol-alkyne cyclization. The gold(I complex is the only catalyst in each of these steps.

Synthesis, kinetic mechanism and docking studies of vanillin derivatives as inhibitors of mushroom tyrosinase.

Science.gov (United States)

Ashraf, Zaman; Rafiq, Muhammad; Seo, Sung-Yum; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf

2015-09-01

The purpose of the present study was to discover the extent of contribution to antityrosinase activity by adding hydroxy substituted benzoic acid, cinnamic acid and piperazine residues to vanillin. The study showed the transformation of vanillin into esters as shown in (4a-4d), (6a-6b), and (8a-8b). In addition, the relationship between structures of these esters and their mushroom tyrosinase inhibitory activity was explored. The kinetics of inhibition on mushroom tyrosinase by these esters was also investigated. It was found that hydroxyl substituted benzoic acid derivatives were weak inhibitors; however hydroxy or chloro substituted cinnamic acid and piperazine substituted derivatives were able to induce significant tyrosinase inhibition. The mushroom tyrosinase (PDBID 2ZWE) was docked with synthesized vanillin derivatives and their calculated binding energies were compared with experimental IC50 values which provided positive correlation. The most potent derivative 2-(4-formyl-2-methoxyphenoxy)-2-oxoethyl (2E)-3-(4-hydroxyphenyl)prop-2-enoate (6a) possesses hydroxy substituted cinnamic acid scaffold having IC50 value 16.13 μM with binding energy of -7.2 kcal/mol. The tyrosinase inhibitory activity of (6a) is comparable with standard kojic acid. Kinetic analysis indicated that compound 6a was mixed-type tyrosinase inhibitor with inhibition constant values Ki (13 μM) and Ki' (53 μM) and formed reversible enzyme inhibitor complex. The active vanillin analog (6a) was devoid of toxic effects as shown in cytotoxic studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Synthesis, characterization and biological behavior of some Schiff's and Mannich base derivatives of Lamotrigine

Directory of Open Access Journals (Sweden)

A.A. Kulkarni

2017-02-01

Full Text Available A series of various Schiff's and Mannich base derivatives (N1–2 & ND1–6 of Lamotrigine with isatin and substituted isatin were synthesized to get more potent anticonvulsant agents. The starting material for the synthesis of various new Schiff's and Mannich base derivatives was isatin (1H-indole- 2, 3-dione which in turn was prepared from substituted isonitrosoacetanilide using aniline. Lamotrigine reacts with isatin & substituted isatin gave Schiff's bases (N1–2 which on reaction with various secondary amines (dimethylamine, diethylamine, morpholine produced Mannich bases (ND1–6. The structures of newly synthesized compounds were characterized by using TLC, UV, FT-IR, 1HNMR and studied for their anticonvulsant activity. Anticonvulsant activity of all the derivatives was evaluated by MES method using phenobarbitone sodium & Lamotrigine as standard drugs and % reduction of time spent by animals in extension, flexion, clonus, and stupor phase were noted. Compounds ND-4 and ND-6 showed significant anticonvulsant activity when compared with that of standard drugs. The remaining all compounds show moderate activity. Biological activity data of the synthesized derivatives revealed that, the synthesized derivatives are good anticonvulsant agents as compared to Lamotrigine.

Electron Acceptors Based on α-Substituted Perylene Diimide (PDI) for Organic Solar Cells

Energy Technology Data Exchange (ETDEWEB)

Zhao, Donglin [Department; Wu, Qinghe [Department; Cai, Zhengxu [Department; Zheng, Tianyue [Department; Chen, Wei [Materials; Institute; Lu, Jessica [Department; Yu, Luping [Department

2016-02-02

Perylene diimide (PDI) derivatives functionalized at the ortho-position (αPPID, αPBDT) were synthesized and used as electron acceptors in non-fullerene organic photovoltaic cells. Because of the good planarity and strong π-stacking of ortho-functionalized PDI, the αPPID and αPBDT exhibit a strong tendency to form aggregates, which endow the materials with high electron mobility. The inverted OPVs employing αPDI-based compounds as the acceptors and PBT7-Th as the donor give the highest power conversion efficiency (PCE) values: 4.92% for αPBDT-based devices and 3.61% for αPPID-based devices, which are, respectively, 39% and 4% higher than that of their β-substituted counterparts βPBDT and βPPID. Charge separation studies show more efficient exciton dissociation at interfaces between αPDI-based compounds and PTB7-Th. The results suggest that α-substituted PDI derivatives are more promising electron acceptors for organic photovoltaic (OPV) components than β-isomers.

[Synthesis and biological activity of 1,4-benzoquinone-guanylhydrazone-thiosemicarbazone analogs. 1. Substitution at the S atom].

Science.gov (United States)

Schulze, W; Gutsche, W; Wohlrabe, K; Fleck, W; Tresselt, D

1985-08-01

The synthesis of S-substituted derivatives of 1,4-benzoquinone-guanylhydrazone-thiosemicarbazone is described. The obtained 1,4-benzoquinone-guanylhydrazone-S-alkyl (resp. aralkyl)-isothiosemicarbazones, in comparison with the unsubstituted standard compound, showed a significantly decreased biological activity against the murine leukemias L 1210 and P 388 as well as against the growth of several kinds of bacteria. Therefore the S-substitution seems not to be useful for reaching a maximum activity.

One-pot sequential synthesis of O-(halo-substituted benzyl hydroxylammonium salts

Directory of Open Access Journals (Sweden)

Saeed Emami

2017-02-01

Full Text Available In this study, we described a simple one-pot preparation of O-(halo-substituted benzyl hydroxylamine derivatives by O-benzylation of N-hydroxyurethane, followed by basic N-deprotection. The advantages of the method were the chemo- and regio-selectivity in obtaining the desired O-benzyl hydroxylammonium salts in a high yield as well as the simplicity of the purification process.

INVESTIGATION OF ANTIFUNGAL ACTIVITY OF QUINOLINIUM DERIVATIVES

Directory of Open Access Journals (Sweden)

G. A. Alexandrova

2013-01-01

Full Text Available Abstract. Antifungal activity (Candida albicans, Candida krusei of some substituted quinolinium derivatives has been investigated. It was established that the most perspective compound for detail investigation of antifungal activity by labeled biomarkers method was N-phenylbenzoquinaldinium tetrafluoroborate.

Synthesis of substituted 1,4-diazepines and 1,5-benzodiazepines using an efficient heteropolyacid-catalyzed procedure.

Science.gov (United States)

Kaoua, Rachedine; Bennamane, Norah; Bakhta, Saliha; Benadji, Sihame; Rabia, Cherifa; Nedjar-Kolli, Bellara

2010-12-28

An efficient and improved procedure for the synthesis of 1,4-diazepine and 1,5-benzodiazepine derivatives via the reaction of ketimine intermediates with aldehydes in the presence of Keggin-type heteropolyacids (HPAs) was developed. High yields and short reaction times were obtained for both electron-releasing and electron-withdrawing substituted 1,4-diazepine  and 1,5-benzodiazepines derivatives.

Synthesis of Substituted 1,4-Diazepines and 1,5-Benzodiazepines Using an Efficient Heteropolyacid-Catalyzed Procedure

Directory of Open Access Journals (Sweden)

Sihame Benadji

2010-12-01

Full Text Available An efficient and improved procedure for the synthesis of 1,4-diazepine and 1,5-benzodiazepine derivatives via the reaction of ketimine intermediates with aldehydes in the presence of Keggin-type heteropolyacids (HPAs was developed. High yields and short reaction times were obtained for both electron-releasing and electron-withdrawing substituted 1,4-diazepine  and 1,5-benzodiazepines derivatives.

Smoke reduction from pool fires using ferrocene and derivatives

International Nuclear Information System (INIS)

Mitchell, J.B.A.; Moir, M.E.

1992-01-01

A series of acyl and alkyl substituted ferrocene derivatives were tested as smoke control agents in laboratory-scale burn tests. In the tests, the soot produced by a given volume was collected on a filter and its weight measured to determine the relative smoke reducing effectiveness of the various derivatives. As the molecular weight of the derivative increases, the effectiveness decreases when added at a fixed weight concentration. The heavier derivatives were much less effective on a per-weight basis than ferrocene, while the multiply substituted compounds appeared to be more effective. In field tests conducted to evaluate the effectiveness of ferrocene in reducing smoke during combustion of other hydrocarbon fuels, it was found that there was a very large soot yield from gasoline fuel, higher than for crude oil even when ferrocene was used. In meso-scale tests, a drastic reduction in smoke yield was obtained when using a new liquid smoke-control additive during combustion of dilbit (bitumen diluted by gas condensate) floating on water. 3 refs., 5 figs., 1 tab

Electricity/oil substitution

International Nuclear Information System (INIS)

Melvin, J.G.

1980-09-01

The extent to which electricity could substitute for imported oil in Canada is assessed and it is concluded that the bulk of projected oil imports could be displaced. This substitution of electricity for oil could be largely completed within two decades, with existing technology, using Canadian resources. The substitution of electricity for imported oil would result in relatively low energy costs and would stimulate economic growth. Energy self-sufficiency through the substitution of electricity for oil is uniquely a Canadian option; it is not open to other industrial countries. The option exists because of Canada's resources of oil sands for essential liquid fuels, hydraulic and nuclear electrical potential, and natural gas as an interim source of energy. While other countries face an energy crisis due to declining supplies of oil, Canada faces opportunities. The policies of Federal and Provincial governments, as perceived by individual decision makers, will have a major influence on Canada's ability to realize opportunities. (auth)

Synthesis, antiviral evaluation and molecular docking studies of N4-aryl substituted/unsubstituted thiosemicarbazones derived from 1-indanones as potent anti-bovine viral diarrhea virus agents.

Science.gov (United States)

Soraires Santacruz, María C; Fabiani, Matías; Castro, Eliana F; Cavallaro, Lucía V; Finkielsztein, Liliana M

2017-08-01

A series of N 4 -arylsubstituted thiosemicarbazones derived from 1-indanones and a set of compounds lacking such substitution in the N 4 position of the thiosemicarbazone moiety were synthesized and evaluated for their anti-bovine viral diarrhea virus (BVDV) activity. Among these, derivatives 2 and 15 displayed high activity (EC 50 =2.7±0.4 and 0.7±0.1µM, respectively) as inhibitors of BVDV replication. Novel key structural features related to the anti-BVDV activity were identified by structure-activity relationship (SAR) analysis. In a previous study, the thiosemicarbazone of 5,6-dimethoxy-1-indanone (5,6-TSC) was characterized as a non-nucleoside inhibitor (NNI) of the BVDV RNA-dependent RNA polymerase. In the present work, cross-resistance assays were performed with the most active compounds. Such studies were carried out on 5,6-TSC resistant BVDV (BVDV-TSC r T1) carrying mutations in the viral polymerase. This BVDV mutant was also resistant to compound 15. Molecular docking studies and MM/PBSA calculations were performed to assess the most active derivatives at the 5,6-TSC viral polymerase binding site. The differences in the interaction pattern and the binding affinity of derivative 15 either to the wild type or BVDV-TSC r T1 polymerase were key factors to define the mode of action of this compound. Copyright © 2017 Elsevier Ltd. All rights reserved.

A DFT study of solvation effects and NBO analysis on the tautomerism of 1-substituted hydantoin

Directory of Open Access Journals (Sweden)

Meisam Shabanian

2016-09-01

Full Text Available 1-Substituted hydantoins (1-SH have been known as a benefit intermediate for producing agricultural and pharmaceuticals. The effect of solvent polarity on the tautomeric equilibria of 1-substituted hydantoin ring is studied by the density functional theory calculation (B3LYP/6–31++G(d,p level for predominant tautomeric forms of hydantoin derivatives (1-NO2, 1-CF3, 1-Br, 1-H, 1-CHCH2, 1-OH, 1-CH3 in the gas phase and selected solvents (benzene (non-polar solvent, tetrahydrofuran (THF (polar aprotic solvent and water (protic solvent. For electron withdrawing and releasing derivatives in the gas phase and solution Hy1 forms is more stable and dominant form. In addition variation of dipole moments and charges on atoms in the solvents are studied.

Structural Studies of Some Binaphthyl Derivatives

DEFF Research Database (Denmark)

Thorup, Niels; Bjørnholm, T.; Bechgaard, K.

1996-01-01

Crystal structures of several 1,1'-binaphthyl derivatives have been determined. In particular compounds which at the 2,2' positions have either identical ethoxy groups or a closed bridged ether and furthermore have identical substitution at the 6,6' positions. The latter groups may be Br, CHO, CN...

Novel N-substituted aminobenzamide scaffold derivatives targeting the dipeptidyl peptidase-IV enzyme

Directory of Open Access Journals (Sweden)

Al-Balas QA

2014-01-01

Full Text Available Qosay A Al-Balas,1 Munia F Sowaileh,1 Mohammad A Hassan,1 Amjad M Qandil,1,2 Karem H Alzoubi,3 Nizar M Mhaidat,3 Ammar M Almaaytah,4 Omar F Khabour51Department of Medicinal Chemistry and Pharmacognosy, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid, Jordan; 2Pharmaceutical Sciences Department, College of Pharmacy, King Saud bin Abdulaziz University for Health Sciences, Riyadh, Saudi Arabia; 3Department of Clinical Pharmacy, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid, Jordan; 4Department of Pharmaceutical Technology, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid, Jordan; 5Department of Medical Laboratory Sciences, Faculty of Applied Medical Sciences, Jordan University of Science and Technology, Irbid, JordanBackground: The dipeptidyl peptidase-IV (DPP-IV enzyme is considered a pivotal target for controlling normal blood sugar levels in the body. Incretins secreted in response to ingestion of meals enhance insulin release to the blood, and DPP-IV inactivates these incretins within a short period and stops their action. Inhibition of this enzyme escalates the action of incretins and induces more insulin to achieve better glucose control in diabetic patients. Thus, inhibition of this enzyme will lead to better control of blood sugar levels.Methods: In this study, computer-aided drug design was used to help establish a novel N-substituted aminobenzamide scaffold as a potential inhibitor of DPP-IV. CDOCKER software available from Discovery Studio 3.5 was used to evaluate a series of designed compounds and assess their mode of binding to the active site of the DPP-IV enzyme. The designed compounds were synthesized and tested against a DPP-IV enzyme kit provided by Enzo Life Sciences. The synthesized compounds were characterized using proton and carbon nuclear magnetic resonance, mass spectrometry, infrared spectroscopy, and determination of melting point.Results: Sixty

Highly fluorescent benzofuran derivatives of the GFP chromophore

DEFF Research Database (Denmark)

Christensen, Mikkel Andreas; Jennum, Karsten Stein; Abrahamsen, Peter Bæch

2012-01-01

Intramolecular cyclization reactions of Green Fluorescent Protein chromophores (GFPc) containing an arylethynyl ortho-substituent at the phenol ring provide new aryl-substituted benzofuran derivatives of the GFPc. Some of these heteroaromatic compounds exhibit significantly enhanced fluorescence...

Copper-Catalyzed Heteroarylboration of 1,3-Dienes with 3-Bromopyridines: A cine Substitution.

Science.gov (United States)

Smith, Kevin B; Huang, Yuan; Brown, M Kevin

2018-04-26

A method for the heteroarylboration of 1,3-dienes is presented. The process involves an unusual cine substitution of 3-bromopyridine derivatives to deliver highly functionalized heterocyclic products. Mechanistic studies are included that clarify the details of this unusual process. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Suitability of various plant derived gelling agents as agar substitute ...

African Journals Online (AJOL)

USER

2012-06-05

Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

Approaches in Substitution of Organic Solvents

DEFF Research Database (Denmark)

Jacobsen, Thomas

2000-01-01

In substitution of harmful chemicals or products with less harmful or harmless ones, there are different approaches according to the different situations, the technical requirements to the substitutes, and the goals for the substitution. Three different cases are presented. The substitution process...

A tandem Mannich addition–palladium catalyzed ring-closing route toward 4-substituted-3(2H-furanones

Directory of Open Access Journals (Sweden)

Jubi John

2014-06-01

Full Text Available A facile route towards highly functionalized 3(2H-furanones via a sequential Mannich addition–palladium catalyzed ring closing has been elaborated. The reaction of 4-chloroacetoacetate esters with imines derived from aliphatic and aromatic aldehydes under palladium catalysis afforded 4-substituted furanones in good to excellent yields. 4-Hydrazino-3(2H-furanones could also be synthesized from diazo esters in excellent yields by utilising the developed strategy. We could also efficiently transform the substituted furanones to aza-prostaglandin analogues.

Effect of ortho-substituted aniline on the corrosion protection of aluminum in 2 mol/L H2SO4 solution

KAUST Repository

El-Deeb, Mohamed M.

2017-02-13

Corrosion protection of aluminum in 2 mol/L HSO solution is examined in the presence of ortho-substituted aniline derivatives using potentiodynamic polarization and electrochemical impedance spectroscopy measurements. Density function theory (DFT) calculations are performed to investigate the aluminum-electrolyte interface relationship in the absence and presence of both ortho-substituted aniline derivatives and sulphate anions, as well as their roles in the protection efficiency at the atomic level. Our results show that ortho-aniline derivatives are good inhibitors and that their efficiencies improved as the concentration increased. SEM-EDX analysis is used to confirm the adsorption thermodynamics of the studied compounds on the aluminum surface. The best inhibitory effect is exhibits in the presence of the methyl group in ortho-position followed by ortho-carboxilic compared to aniline. The adsorption of these compounds on the aluminum surface is well described by Langmuir adsorption isotherm as well as the experimental and the theoretical adosrption energies are in a good agreement. DFT calculations also show that the interaction between the inhibitors and the aluminum surface is mainly electrostatic and depends on the type of the ortho-substituted group in addition to the sulphate anions.

Synthesis and Insecticidal Activities of New Ester-Derivatives of Celangulin-V

Directory of Open Access Journals (Sweden)

Wenjun Wu

2011-12-01

Full Text Available In order to develop new biorational pesticides, ten new 6-substituted ester derivatives of Celangulin-V were designed and synthesized. The structures of the new derivatives were confirmed by IR, 1H-NMR, 13C-NMR and ESI-MS spectral analysis. Insecticidal activities of these compounds were tested against the third-instar larvae of Mythimna separata. Two derivatives (1.1, 1.2 showed higher insecticidal activities than Celangulin-V, with mortality of 75.0% and 83.3%, respectively. While four compounds (1.3, 1.4, 1.7, 1.8 denoted lower insecticidal activities, the others (1.5, 1.6, 1.9, 1.10 revealed no activities at a concentration of 10 mg.mL−1. The results suggest that C-6 substitutions of Celangulin-V are very important in determining the insecticidal activities of its ester-derivatives. That the acetyl (1.1 and propionyl (1.2 derivatives possessed much higher insecticidal activities than Celangulin-V itself supported the view that Celangulin-V has the potential to be a lead structure of semi-synthetic green insecticides.

Differences in substrate specificity of C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides by DNA polymerases from thermophilic bacteria, archaea, and phages.

Science.gov (United States)

Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo

2007-09-01

The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.

Medicineringsfejl ved generisk substitution

DEFF Research Database (Denmark)

Rölfing, Jan

2012-01-01

Generic substitution is a major cause of medical mistakes in the general population. Danish legislation obligates pharmacies to substitute prescribed medicine with the cheapest equivalent formulation, despite variations in product name, packaging, shape and colour. Consequently, medical mistakes...... occur. Scientific evidence on the consequences of generic substitution is sparse. Call upon fellow health workers to report medical mistakes to the national entities and scientific peers, in order to increase awareness and scientific evidence about the problem....

Molecular-weight-enlarged multiple-pincer ligands: synthesis and application in palladium-catalyzed allylic substitution reactions

NARCIS (Netherlands)

Ronde, N.J.; Totev, D.; Müller, Christian; Lutz, M.; Spek, A.L.; Vogt, D.

2009-01-01

Three different pincer ligand systems are synthesized via nucleophilic substitution reactions of polyaromatic benzyl bromides as support molecules and phenol derivatives as ligand precursors. Retention tests using a polymeric nanofiltration membrane show moderate to good retention in THF and CH2Cl2.

Synthesis and in vitro anti-proliferative effects of 3-(hetero)aryl substituted 3-[(prop-2-ynyloxy)(thiophen-2-yl)methyl]pyridine derivatives on various cancer cell lines.

Science.gov (United States)

Reddy Chamakura, Upendar; Sailaja, E; Dulla, Balakrishna; Kalle, Arunasree M; Bhavani, S; Rambabu, D; Kapavarapu, Ravikumar; Rao, M V Basaveswara; Pal, Manojit

2014-03-01

A series of 3-(hetero)aryl substituted 3-[(prop-2-ynyloxy)(thiophen-2-yl)methyl]pyridine derivatives were designed as potential anticancer agents. These compounds were conveniently prepared by using Pd/C-Cu mediated Sonogashira type coupling as a key step. Many of these compounds were found to be promising when tested for their in vitro anti-proliferative properties against six cancer cell lines. All these compounds were found to be selective towards the growth inhibition of cancer cells with IC50 values in the range of 0.9-1.7 μM (against MDA-MB 231 and MCF7 cells), comparable to the known anticancer drug doxorubicin. Copyright © 2014 Elsevier Ltd. All rights reserved.

Synthesis, antitumor and antimicrobial activity of novel 1-substituted phenyl-3-[3-alkylamino(methyl)-2-thioxo-1,3,4-oxadiazole-5-yl] beta-carboline derivatives

Energy Technology Data Exchange (ETDEWEB)

Savariz, Franciele C.; Formagio, Anelise S. N.; Barbosa, Valeria A.; Sarragiotto, Maria Helena [Universidade Estadual de Maringa (UEM), PR (Brazil). Dept. de Quimica; Foglio, Mary Ann; Carvalho, Joao E. de; Duarte, Marta C.T. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Centro Pluridisciplinar de Pesquisas Quimicas, Biologicas e Agricolas; Dias Filho, Benedito P. [Universidade Estadual de Maringa (UEM), PR (Brazil). Dept. de Analises Clinicas

2010-07-01

With the purpose of activity enhancement of 1-substituted phenyl-3-(2-thioxo-1,3,4-oxadiazole-5-yl) beta-carbolines 1a-c, reported as potential antitumor agents in our previous study, herein we report the synthesis and antitumor activity evaluation of several novel Mannich bases 2-7(a-c), by the introduction of different alkylamino(methyl) groups in the 1,3,4-oxadiazole unity of 1a-c. The antimicrobial activities of 1a-c and of 2-7(a-c) were also evaluated. Additionally, an in silico study of the ADME properties of novel synthesized beta-carboline derivatives 2-7(a-c) was performed by evaluation of their Lipinski's parameters and topological polar surface area (TPSA) and percentage of absorption (% ABS) data. (author)

Optical, thermal and electrical properties of polybenzimidazoles derived from substituted benzimidazoles

Science.gov (United States)

Anand, Siddeswaran; Muthusamy, Athianna

2017-11-01

Three benzimidazole monomers synthesized by condensing various substituted phenolic aldehydes with 4-methylphenylenediamine were converted in to polymers by oxidative polycondensation. The structure of the monomers and polymers were confirmed by various spectroscopic techniques. Electronic distribution of molecular frontier orbitals and optimized geometries of monomers were calculated by Gaussian 09 package. The spectral results showed that the repeating units are connected through both Csbnd C and Csbnd Osbnd C linkages. Both polymers and monomers are showing good fluorescence emission in blue region. The electrical conductivity of I2 doped PBIs was measured using two point probe technique. The conductivities of PBIs were compared on the basis of the charge densities obtained from Huckel method on imidazole nitrogen which is involved in iodine coordination. The conductivity of polymers increases with increase in iodine vapour contact time. The dielectric properties of the synthesized polymers have been investigated at different temperature and frequency. Among the PBIs, PBIOP is having greater thermal stability and is shown by high carbines residues of around 50% at 500 °C in thermogravimetric analysis.

Derivation of the Ideal Gas Law

Science.gov (United States)

Laugier, Alexander; Garai, Jozsef

2007-01-01

Undergraduate and graduate physics and chemistry books usually state that combining the gas laws results in the ideal gas law. Leaving the derivation to the students implies that this should be a simple task, most likely a substitution. Boyle's law, Charles's law, and the Avogadro's principle are given under certain conditions; therefore, direct…

Inter-deriving Semantic Artifacts for Object-Oriented Programming

DEFF Research Database (Denmark)

Danvy, Olivier; Johannsen, Jacob

2008-01-01

We present a new abstract machine for Abadi and Cardelli's untyped calculus of objects. What is special about this semantic artifact (i.e., man-made construct) is that is mechanically corresponds to both the reduction semantics (i.e., small-step operational semantics) and the natural semantics (i...... actual substitutions, we then represent object methods as closures and in the same inter-derivational spirit, we present three new semantic artifacts: a reduction semantics for a version of Abadi and Cardelli's untyped calculus of objects with explicit substitutions, an environment-based abstract machine...

Solvent substitution

International Nuclear Information System (INIS)

1990-01-01

The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general ''Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated

Complexes of salicylic acid and its derivatives

Energy Technology Data Exchange (ETDEWEB)

Tel' zhenskaya, P N; Shvarts, E M [AN Latvijskoj SSR, Riga. Inst. Neorganicheskoj Khimii

1977-01-01

A generalization and systematization have been made of literature data on complexing of various elements, including beryllium, cadmium, boron, indium, rare-earth elements, actinides, and transition elements with salicylic acid and it derivatives (amino-, nitro- and halosalicylic acids). The effect of the position and nature of the substitute, in the case of salicylic acid derivatives, on the complexing process is discussed. Certain physicochemical properties of the complexes under consideration are described along with data indicative of their stability.

On the substitution of energy sources: Prospective of the natural gas market share in the Brazilian urban transportation and dwelling sectors

International Nuclear Information System (INIS)

Kamimura, A.; Guerra, S.M.G.; Sauer, I.L.

2006-01-01

The substitution process resultant of the competition between two opponents fighting for the same resource or market is pointed out through a dynamic model derived from biomathematics. A brief description of the origin of the method based on coupled non-linear differential equations (NLDE) is presented. Numerical adherence of the proposed model to explain several substitution phenomena which have occurred in the past is examined. The proposed method is particularly suitable for prospective analysis and scenarios assessment. In this sense, two applications of the model to prospect the dynamic substitution process in the Brazilian case are done: firstly, the development of the urban gas pipeline system in substituting for the bottled LPG in the dwelling sector and, secondly, the substitution of the urban Diesel transportation fleet by compressed natural gas (CNG) buses

Synthesis, Characterization and Antimicrobial Activity of New Thiadiazole Derivatives

Energy Technology Data Exchange (ETDEWEB)

Mullick, Pooja; Khan, Suroor A.; Verma, Surajpal; Alam, Ozair [Hamdard University, New Delhi (India)

2010-08-15

A series of thiadiazole derivatives were synthesized with differently substituted benzoic acids which were cyclized to give differently substituted thiazolidin-4-one. Elemental analysis, IR, {sup 1}H NMR, {sup 13}C NMR and mass spectral data confirmed the structure of the newly synthesized compounds. The derivatives of these moieties were evaluated for antimicrobial activity. Most of the synthesized compounds showed good antimicrobial activity at 200 and 100 μg/mL. Compounds showed most significant antibacterial activity against gram negative test organism Escherichia coli and most significant antifungal activity against test organisms Aspergillus niger and Candida albicans. It was observed that compounds with OCH{sub 3} at 3, 4 position of phenyl ring [5(a-l)] were more potent against microbes as compared to compounds having unsubstituted phenyl ring [4(a-l)].

Novel cytokinin derivatives do not show negative effects on root growth and proliferation in submicromolar range.

Directory of Open Access Journals (Sweden)

Kateřina Podlešáková

Full Text Available BACKGROUND: When applied to a nutrition solution or agar media, the non-substituted aromatic cytokinins caused thickening and shortening of the primary root, had an inhibitory effect on lateral root branching, and even showed some negative effects on development of the aerial part at as low as a 10 nanomolar concentration. Novel analogues of aromatic cytokinins ranking among topolins substituted on N9-atom of adenine by tetrahydropyranyl or 4-chlorobutyl group have been prepared and tested in standardized cytokinin bioassays [1]. Those showing comparable activities with N(6-benzylaminopurine were further tested in planta. METHODOLOGY/PRINCIPAL FINDINGS: The main aim of the study was to explain molecular mechanism of function of novel cytokinin derivatives on plant development. Precise quantification of cytokinin content and profiling of genes involved in cytokinin metabolism and perception in treated plants revealed several aspects of different action of m-methoxytopolin base and its substituted derivative on plant development. In contrast to standard cytokinins, N9- tetrahydropyranyl derivative of m-topolin and its methoxy-counterpart showed the negative effects on root development only at three orders of magnitude higher concentrations. Moreover, the methoxy-derivative demonstrates a positive effect on lateral root branching and leaf emerging in a nanomolar range of concentrations, in comparison with untreated plants. CONCLUSIONS/SIGNIFICANCE: Tetrahydropyranyl substitution at N9-position of cytokinin purine ring significantly enhances acropetal transport of a given cytokinins. Together with the methoxy-substitution, impedes accumulation of non-active cytokinin glucoside forms in roots, allows gradual release of the active base, and has a significant effect on the distribution and amount of endogenous isoprenoid cytokinins in different plant tissues. The utilization of novel aromatic cytokinin derivatives can distinctively improve expected

An Efficient Synthesis of 3,4-Dihydro-3-substituted-2H-naphtho[2,1-e][1,3]oxazine Derivatives Catalyzed by Zirconyl(IV) Chloride and Evaluation of its Biological Activities

Energy Technology Data Exchange (ETDEWEB)

Kategaonkar, Amol H.; Sonar, Swapnil S.; Pokalwar, Rajkumar U.; Shingate, Bapurao B.; Shingare, Murlidhar S. [Babasaheb Ambedkar Marathwada University, Maharashtra (India); Kategaonkar, Atul H. [Maharashtra Institute of Pharmacy, Maharashtra (India)

2010-06-15

An efficient and novel one-pot synthesis of new 3,4-dihydro-3-substituted-2H-naphtho[2,1-e][1,3]oxazine derivatives from 1-naphthol, various anilines and formalin at room temperature grinding is presented. The six-membered N,O-heterocyclic skeleton was constructed via zirconyl(IV) chloride promoted Mannich type reaction. In vitro antimicrobial activities of synthesized compounds have been investigated against Gram-positive Bacillus subtilis, Gram negative Escherichia coli and two fungi Candida albicans and Aspergillus niger in comparison with standard drugs. The results of preliminary bioassay indicate that some of title compounds possess significant antibacterial and antifungal activity.

Substitution of wastes for fuels and raw materials in high-temperature processes; Substitution von Brennstoffen und Rohstoffen durch Abfaelle in Hochtemperaturprozessen

Energy Technology Data Exchange (ETDEWEB)

Scholz, R. [Technische Univ. Clausthal, Clausthal-Zellerfeld (Germany). Inst. fuer Energieverfahrenstechnik; Beckmann, M. [Clausthaler Umwelttechnik-Institut GmbH (CUTEC), Clausthal-Zellerfeld (Germany)

1998-09-01

The physical recycling and energy conversion of wastes has for a long time been a topic of discussion. Some of the most interesting questions in this connection concern specific applications such as the co-combustion of sewage sludge in power plants, substitution of plastic wastes for primary fuels in burning processes in the cement industry etc. This paper also undertakes a comparative study of different applications, giving additional consideration to the state of the art in thermal waste treatment. Different processes can of course only be compared by taking the entirety of expenditures on additives and auxiliary energy into account and assuming equal side constraints for all processes. A further requirement is that the waste materials` specific properties that are relevant to the application in question have to be taken into account. This concerns in particular the effects of the substitution of waste-derived fuels (secondary fuels) for primary fuels on, for example, heat transfer conditions during the combustion process, flow conditions, and the resultant temperature distribution, transport of feedstock, and specific energy expenditure. Secondary fuels must be suited for substitution in various respects, e.g. in their material properties, and their combustion and thermal behaviour. The present paper deals in particular with the requirements on wastes as substitutes for primary fuels with regard to combustion and thermal behaviour. For this purpose it briefly discusses some important aspects of heat transfer in firing plants and industrial furnaces. An important criterion in assessing fuel substitution is the energy exchange ratio, which expresses value of the substitute fuel relative to that of the primary fuel and should be duly considered when making comparative studies. Focussing on aspects of process engineering the paper also deals exemplarily with the influence of fuel substitution on, e.g. furnace temperature, exhaust gas quantities etc. in clinker

Theoretical study of GC+/GC base pair derivatives

International Nuclear Information System (INIS)

Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

2005-01-01

The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

Synthesis and Spectroscopic Characterization of Some New Biological Active Azo–Pyrazoline Derivatives

Directory of Open Access Journals (Sweden)

Farouq E. Hawaiz

2012-01-01

Full Text Available A number of 3-[4-(benzyloxy-3-(2-Chlorophenylazo-phenyl]-5-(substituted-phenyl-1-substituted-2-pyrazolines( 4a-j and (5a-j have been synthesized by diazotization of 2-chloroaniline and its coupling reaction with 4-hydroxy acetophenone, followed by benzyloxation of the hydroxyl group to give the substrate [4-benzyloxy-3-(2-chlorophenylazo-acetophenone (1].The prepared starting material (1 has been reacted with different substituted benzaldehydes to give a new series of chalcone derivatives 1-[(4-benzyloxy-3-(2-chloro-phenylazo-phenyl]-3-(substituted phenyl-2-propen-1-one (3a-j, in high yields and in a few minutes, and the later compounds were treated with hydrazine hydrate according to Michael addition reaction to afford a new biolological active target compounds (4a-j and (5a-j. Furthermore, The structures of the newly synthesized compounds were confirmed by FT-IR, 13C-NMR,13C-DEPT & 1H-NMR spectral data. The chalcone and pyrazoline derivatives were evaluated for their anti bacterial activity against Escherichia coli as gram negative and Staphylococcus aureus as gram positive, the results showed significant activity against both types of bacteria.

Optimal ordering quantities for substitutable deteriorating items under joint replenishment with cost of substitution

Science.gov (United States)

Mishra, Vinod Kumar

2017-09-01

In this paper we develop an inventory model, to determine the optimal ordering quantities, for a set of two substitutable deteriorating items. In this inventory model the inventory level of both items depleted due to demands and deterioration and when an item is out of stock, its demands are partially fulfilled by the other item and all unsatisfied demand is lost. Each substituted item incurs a cost of substitution and the demands and deterioration is considered to be deterministic and constant. Items are order jointly in each ordering cycle, to take the advantages of joint replenishment. The problem is formulated and a solution procedure is developed to determine the optimal ordering quantities that minimize the total inventory cost. We provide an extensive numerical and sensitivity analysis to illustrate the effect of different parameter on the model. The key observation on the basis of numerical analysis, there is substantial improvement in the optimal total cost of the inventory model with substitution over without substitution.

Estimation of parameters of constant elasticity of substitution production functional model

Science.gov (United States)

Mahaboob, B.; Venkateswarlu, B.; Sankar, J. Ravi

2017-11-01

Nonlinear model building has become an increasing important powerful tool in mathematical economics. In recent years the popularity of applications of nonlinear models has dramatically been rising up. Several researchers in econometrics are very often interested in the inferential aspects of nonlinear regression models [6]. The present research study gives a distinct method of estimation of more complicated and highly nonlinear model viz Constant Elasticity of Substitution (CES) production functional model. Henningen et.al [5] proposed three solutions to avoid serious problems when estimating CES functions in 2012 and they are i) removing discontinuities by using the limits of the CES function and its derivative. ii) Circumventing large rounding errors by local linear approximations iii) Handling ill-behaved objective functions by a multi-dimensional grid search. Joel Chongeh et.al [7] discussed the estimation of the impact of capital and labour inputs to the gris output agri-food products using constant elasticity of substitution production function in Tanzanian context. Pol Antras [8] presented new estimates of the elasticity of substitution between capital and labour using data from the private sector of the U.S. economy for the period 1948-1998.

Solvent substitution

Energy Technology Data Exchange (ETDEWEB)

1990-01-01

The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated.

Statistical Physics of Complex Substitutive Systems

Science.gov (United States)

Jin, Qing

Diffusion processes are central to human interactions. Despite extensive studies that span multiple disciplines, our knowledge is limited to spreading processes in non-substitutive systems. Yet, a considerable number of ideas, products, and behaviors spread by substitution; to adopt a new one, agents must give up an existing one. This captures the spread of scientific constructs--forcing scientists to choose, for example, a deterministic or probabilistic worldview, as well as the adoption of durable items, such as mobile phones, cars, or homes. In this dissertation, I develop a statistical physics framework to describe, quantify, and understand substitutive systems. By empirically exploring three collected high-resolution datasets pertaining to such systems, I build a mechanistic model describing substitutions, which not only analytically predicts the universal macroscopic phenomenon discovered in the collected datasets, but also accurately captures the trajectories of individual items in a complex substitutive system, demonstrating a high degree of regularity and universality in substitutive systems. I also discuss the origins and insights of the parameters in the substitution model and possible generalization form of the mathematical framework. The systematical study of substitutive systems presented in this dissertation could potentially guide the understanding and prediction of all spreading phenomena driven by substitutions, from electric cars to scientific paradigms, and from renewable energy to new healthy habits.

Synthesis and Antimicrobial Activity of Some New Formazan Derivatives

Directory of Open Access Journals (Sweden)

S. I. Marjadi

2009-01-01

Full Text Available A series of new substituted formazan derivatives has been synthesized from corresponding aryl diazonium chloride and Schiff base in pyridine. The synthesized compounds were identified by spectral studies and screened for their antimicrobial activities.

Meso-ester and carboxylic acid substituted BODIPYs with far-red and near-infrared emission for bioimaging applications

KAUST Repository

Ni, Yong

2014-01-21

A series of meso-ester-substituted BODIPY derivatives 1-6 are synthesized and characterized. In particular, dyes functionalized with oligo(ethylene glycol) ether styryl or naphthalene vinylene groups at the α positions of the BODIPY core (3-6) become partially soluble in water, and their absorptions and emissions are located in the far-red or near-infrared region. Three synthetic approaches are attempted to access the meso-carboxylic acid (COOH)-substituted BODIPYs 7 and 8 from the meso-ester-substituted BODIPYs. Two feasible synthetic routes are developed successfully, including one short route with only three steps. The meso-COOH-substituted BODIPY 7 is completely soluble in pure water, and its fluorescence maximum reaches around 650 nm with a fluorescence quantum yield of up to 15 %. Time-dependent density functional theory calculations are conducted to understand the structure-optical properties relationship, and it is revealed that the Stokes shift is dependent mainly on the geometric change from the ground state to the first excited singlet state. Furthermore, cell staining tests demonstrate that the meso-ester-substituted BODIPYs (1 and 3-6) and one of the meso-COOH-substituted BODIPYs (8) are very membrane-permeable. These features make these meso-ester- and meso-COOH-substituted BODIPY dyes attractive for bioimaging and biolabeling applications in living cells. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Facile Method for Detection of Substituted Salicylic Acids Using Pyrenesulfonamide-Terminated Self-Assembled Monolayers on Silicon Oxide Surfaces

Energy Technology Data Exchange (ETDEWEB)

Han, Gyeongyeop; Choi, Jaehyuck; Lee, Jungkyu; Kumar, Ashwani; Lee, Ju-Young; Kim, Hong-Seok [Kyungpook Nation al University, Daegu (Korea, Republic of)

2016-05-15

We have developed a method for sensing substituted salicylic acids on silicon oxide surfaces. The receptor molecule was successfully immobilized onto the surface by self-assembly, and, as a demonstration, micropatterns of substituted salicylic acids were generated by soft lithography techniques. We believe that this approach used herein will not only widen the understanding of the specific interactions between salicylic acids and pyrenesulfonamide derivatives, but also be applicable to practical devices such as chemo/bio analytical sensors. We have successfully demonstrated the molecular recognition between salicylic acids and pyrene derivatives in solution by fluorescence measurement. Briefly, selective recognition was achieved using intermolecular interactions, including π-π interactions and multi-hydrogen bonds, and intramolecular hydrogen bonding between the phenolic O-H group and the adjacent C=O group.

A Facile Method for Detection of Substituted Salicylic Acids Using Pyrenesulfonamide-Terminated Self-Assembled Monolayers on Silicon Oxide Surfaces

International Nuclear Information System (INIS)

Han, Gyeongyeop; Choi, Jaehyuck; Lee, Jungkyu; Kumar, Ashwani; Lee, Ju-Young; Kim, Hong-Seok

2016-01-01

We have developed a method for sensing substituted salicylic acids on silicon oxide surfaces. The receptor molecule was successfully immobilized onto the surface by self-assembly, and, as a demonstration, micropatterns of substituted salicylic acids were generated by soft lithography techniques. We believe that this approach used herein will not only widen the understanding of the specific interactions between salicylic acids and pyrenesulfonamide derivatives, but also be applicable to practical devices such as chemo/bio analytical sensors. We have successfully demonstrated the molecular recognition between salicylic acids and pyrene derivatives in solution by fluorescence measurement. Briefly, selective recognition was achieved using intermolecular interactions, including π-π interactions and multi-hydrogen bonds, and intramolecular hydrogen bonding between the phenolic O-H group and the adjacent C=O group

Syntheses and spectral studies of novel ciprofloxacin derivatives

Directory of Open Access Journals (Sweden)

Pradeep Yadav

2008-12-01

Full Text Available Reaction of 1-cyclopropyl-6-fluoro-4-oxo-7-(piperazin-1-yl-1,4-dihydroquinoline-3-carboxylic acid (ciprofloxacin with thiazole/benzothiazole diazonium chloride afforded piperazine substituted ciprofloxacin derivative. The acid part of these derivatives was further condensed with various β-diketones to get 1-cyclopropyl-6-fluoro-4-oxo-7-(4-(thiazol-2-yldiazenylpiperazin-1-yl-1,4-dihydroquinoline-3-carboxylic acid derivatives (5a-e and 7-(4-(benzo[d]thiazol-2-yldiazenylpiperazin-1-yl-1-cyclopropyl-6-fluoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid derivatives (5f-j. Structures of these compounds were established on the basis of spectral studies.

Mechanistic study of manganese-substituted glycerol dehydrogenase using a kinetic and thermodynamic analysis.

Science.gov (United States)

Fang, Baishan; Niu, Jin; Ren, Hong; Guo, Yingxia; Wang, Shizhen

2014-01-01

Mechanistic insights regarding the activity enhancement of dehydrogenase by metal ion substitution were investigated by a simple method using a kinetic and thermodynamic analysis. By profiling the binding energy of both the substrate and product, the metal ion's role in catalysis enhancement was revealed. Glycerol dehydrogenase (GDH) from Klebsiella pneumoniae sp., which demonstrated an improvement in activity by the substitution of a zinc ion with a manganese ion, was used as a model for the mechanistic study of metal ion substitution. A kinetic model based on an ordered Bi-Bi mechanism was proposed considering the noncompetitive product inhibition of dihydroxyacetone (DHA) and the competitive product inhibition of NADH. By obtaining preliminary kinetic parameters of substrate and product inhibition, the number of estimated parameters was reduced from 10 to 4 for a nonlinear regression-based kinetic parameter estimation. The simulated values of time-concentration curves fit the experimental values well, with an average relative error of 11.5% and 12.7% for Mn-GDH and GDH, respectively. A comparison of the binding energy of enzyme ternary complex for Mn-GDH and GDH derived from kinetic parameters indicated that metal ion substitution accelerated the release of dioxyacetone. The metal ion's role in catalysis enhancement was explicated.

Mechanistic study of manganese-substituted glycerol dehydrogenase using a kinetic and thermodynamic analysis.

Directory of Open Access Journals (Sweden)

Baishan Fang

Full Text Available Mechanistic insights regarding the activity enhancement of dehydrogenase by metal ion substitution were investigated by a simple method using a kinetic and thermodynamic analysis. By profiling the binding energy of both the substrate and product, the metal ion's role in catalysis enhancement was revealed. Glycerol dehydrogenase (GDH from Klebsiella pneumoniae sp., which demonstrated an improvement in activity by the substitution of a zinc ion with a manganese ion, was used as a model for the mechanistic study of metal ion substitution. A kinetic model based on an ordered Bi-Bi mechanism was proposed considering the noncompetitive product inhibition of dihydroxyacetone (DHA and the competitive product inhibition of NADH. By obtaining preliminary kinetic parameters of substrate and product inhibition, the number of estimated parameters was reduced from 10 to 4 for a nonlinear regression-based kinetic parameter estimation. The simulated values of time-concentration curves fit the experimental values well, with an average relative error of 11.5% and 12.7% for Mn-GDH and GDH, respectively. A comparison of the binding energy of enzyme ternary complex for Mn-GDH and GDH derived from kinetic parameters indicated that metal ion substitution accelerated the release of dioxyacetone. The metal ion's role in catalysis enhancement was explicated.

Biologic and synthetic skin substitutes: An overview.

Science.gov (United States)

Halim, Ahmad Sukari; Khoo, Teng Lye; Mohd Yussof, Shah Jumaat

2010-09-01

The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substitutes can be divided into two main classes, namely, biological and synthetic substitutes. The biological skin substitutes have a more intact extracellular matrix structure, while the synthetic skin substitutes can be synthesised on demand and can be modulated for specific purposes. Each class has its advantages and disadvantages. The biological skin substitutes may allow the construction of a more natural new dermis and allow excellent re-epithelialisation characteristics due to the presence of a basement membrane. Synthetic skin substitutes demonstrate the advantages of increase control over scaffold composition. The ultimate goal is to achieve an ideal skin substitute that provides an effective and scar-free wound healing.

Biologic and synthetic skin substitutes: An overview

Directory of Open Access Journals (Sweden)

Halim Ahmad

2010-10-01

Full Text Available The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substitutes can be divided into two main classes, namely, biological and synthetic substitutes. The biological skin substitutes have a more intact extracellular matrix structure, while the synthetic skin substitutes can be synthesised on demand and can be modulated for specific purposes. Each class has its advantages and disadvantages. The biological skin substitutes may allow the construction of a more natural new dermis and allow excellent re-epithelialisation characteristics due to the presence of a basement membrane. Synthetic skin substitutes demonstrate the advantages of increase control over scaffold composition. The ultimate goal is to achieve an ideal skin substitute that provides an effective and scar-free wound healing.

Substituted Pyrazinecarboxamides: Synthesis and Biological Evaluation

Directory of Open Access Journals (Sweden)

Katarina Kralova

2006-03-01

Full Text Available Condensation of the corresponding chlorides of some substituted pyrazine-2-carboxylic acids (pyrazine-2-carboxylic acid, 6-chloropyrazine-2-carboxylic acid, 5-tert-butylpyrazine-2-carboxylic acid or 5-tert-butyl-6-chloropyrazine-2-carboxylic acid withvarious ring-substituted aminothiazoles or anilines yielded a series of amides. Thesyntheses, analytical and spectroscopic data of thirty newly prepared compounds arepresented. Structure-activity relationships between the chemical structures and the anti-mycobacterial, antifungal and photosynthesis-inhibiting activity of the evaluatedcompounds are discussed. 3,5-Bromo-4-hydroxyphenyl derivatives of substitutedpyrazinecarboxylic acid, 16-18, have shown the highest activity against Mycobacteriumtuberculosis H37Rv (54-72% inhibition. The highest antifungal effect againstTrichophyton mentagrophytes, the most susceptible fungal strain tested, was found for5-tert-butyl-6-chloro-N-(4-methyl-1,3-thiazol-2-ylpyrazine-2-carboxamide (8, MIC =31.25 μmol·mL-1. The most active inhibitors of oxygen evolution rate in spinachMolecules 2006, 11 243 chloroplasts were the compounds 5-tert-butyl-6-chloro-N-(5-bromo-2-hydroxyphenyl- pyrazine-2-carboxamide (27, IC50 = 41.9 μmol·L-1 and 5-tert-butyl-6-chloro-N-(1,3- thiazol-2-yl-pyrazine-2-carboxamide (4, IC50 = 49.5 μmol·L-1.

Transient negative ions in benzene. Some N-heterocyclic and mono-substituted derivatives

International Nuclear Information System (INIS)

Nenner, Irene

1975-01-01

Electron transmission spectroscopy is used to study transient negative ions or shape resonances in various benzene derivatives. Because of the long lifetime of these ions (τ > 10 -14 S) the vibrational structure of their first two electronic states is observed superposed on the total electron cross section curves in the energy range 0-6 eV and the corresponding adiabatic electron affinities are determined. The comparison of the first electron affinity with the first ionization potential and the energy on the first excited state of each of the derivatives is used to characterize the 'donor' substituents on the benzene ring. As a complementary study, these derivatives are studied in the liquid phase using polarography (cyclic voltametry). The linear correlation established between polarographic potentials measured in dimethyl formamide and the electron affinities was used to deduce electron affinities for several molecules which are difficult to measure in the gas phase. (author) [fr

Reactions of Fischer carbene complexes with Electron-deficient olefins: Scope and limitations of this route to donor-acceptor-substituted cyclopropanes

Energy Technology Data Exchange (ETDEWEB)

Wienand, A.; Reissig, H.U. (Inst. fuer Organische Chemie der Technischen Hochschule Darmstadt (West Germany))

1990-12-01

The Fischer carbene complex ((CO){sub 5}Cr{double bond}C(OMe)Ph) (1) is able to transfer its carbene ligand to a variety of electron-deficient olefins and provides donor-acceptor-substituted cyclopropanes in good yields. Apt activating groups with respect to the alkene are ester, amide, nitrile, sulfone, and dialkyl phosphonate functions. Methyl vinyl ketone (19) affords products in low yield that may arise from an intermediate cyclopropane derivative. Phenyl vinyl sulfoxide (24) mainly acts as an oxidizing agent, transforming 1 into methyl benzoate. for olefin 24 and {alpha}-(N-methylanilino)acrylonitrile the authors found products that should be formed on an olefin metathesis pathway. The methyl-substituted carbene complex 48 also affords the expected donor-acceptor-substituted cyclopropanes; however, acyclic isomers are formed in higher amounts. The molybdenum and tungsten complexes 55 and 56, respectively, also furnish cyclopropane derivatives, but the yields are lower than with the chromium compound 1. Disubstituted olefins and complex 1 still give the cyclopropanes in moderate yields, while all trisubstituted and most of the difunctionalized alkenes do not react with this Fischer carbene complex. The cyclopropanes synthesized can be deprotonated and alkylated or transformed into ring-opened products. These model reactions demonstrate the synthetic potentials of donor-acceptor-substituted cyclopropanes prepared via Fischer carbene complexes.

Acid-base and coordination properties of Meso-substituted porphyrins in nonaqueous solutions

Science.gov (United States)

Pukhovskaya, S. G.; Nam, Dao Tkhe; Fien, Chan Ding; Domanina, E. N.; Ivanova, Yu. B.; Semeikin, A. S.

2017-09-01

Acid-base and coordination properties of alkyl and aryl meso-substituted porphyrins are studied spectrophotometrically in nonaqueous solutions. It is found that the nature of the substituent greatly affects the basicity of ligands for porphyrins characterized by a flat structure of macrocycle. The electronic effects of substituents have a much weaker influence on the kinetics of complexing. These effects could be due to the opposite orientation of some factors: an increase in the basicity and stability of the N-H bonds of porphyrin reaction centers. Dissociation constants p K b of the cationic forms of meso-substituted derivatives of porphyrin are measured. The values of p K b are in good agreement with classic concepts of the nature of substituents, particularly those indirectly included in the macrocycle through phenyl buffer rings.

The substituent and solvent effects on the antioxidant activity of the ferulic acid derivations

International Nuclear Information System (INIS)

Najafi, M.; Bukhari, S.A.

2014-01-01

The antioxidant activity of ortho and meta substituted ferulic acid derivatives have been investigated in the gas phase and water. The reaction enthalpies of antioxidant activity of studied derivatives have been calculated and compared with corresponding values of ferulic acid. Results show that EWG substituents increase the BDE, IP, while EDG ones cause a rise in the PA. The ferulic acid derivatives with lowest BDE, IP and PA values were identified as the compounds with high antioxidant activity. Results show that the substituents at ortho position have high potential for synthesis of novel ferulic acid derivatives. Results show that ferulic acid derivatives can process their protective role via HAT and SPLET mechanism in gas phase and solvent, respectively. The calculated reaction enthalpies of the substituted ferulic acids have linear dependences with Hammett constants and EHOMO that can be utilized in the selection of suitable substituents for the synthesis of novel antioxidants based on ferulic acid. (author)

Bone substitute biomaterials

CERN Document Server

Mallick, K

2014-01-01

Bone substitute biomaterials are fundamental to the biomedical sector, and have recently benefitted from extensive research and technological advances aimed at minimizing failure rates and reducing the need for further surgery. This book reviews these developments, with a particular focus on the desirable properties for bone substitute materials and their potential to encourage bone repair and regeneration. Part I covers the principles of bone substitute biomaterials for medical applications. One chapter reviews the quantification of bone mechanics at the whole-bone, micro-scale, and non-scale levels, while others discuss biomineralization, osteoductivization, materials to fill bone defects, and bioresorbable materials. Part II focuses on biomaterials as scaffolds and implants, including multi-functional scaffolds, bioceramics, and titanium-based foams. Finally, Part III reviews further materials with the potential to encourage bone repair and regeneration, including cartilage grafts, chitosan, inorganic poly...

Photophysicochemical, calf thymus DNA binding and in vitro photocytotoxicity properties of tetra-morpholinoethoxy-substituted phthalocyanines and their water-soluble quaternized derivatives.

Science.gov (United States)

Koçan, Halit; Kaya, Kerem; Özçeşmeci, İbrahim; Sesalan, B Şebnem; Göksel, Meltem; Durmuş, Mahmut; Burat, Ayfer Kalkan

2017-12-01

In this study, morpholinoethoxy-substituted metal-free (3), zinc(II) (4) and indium(III) (5) phthalocyanines were synthesized. These phthalocyanines were converted to their water-soluble quaternized derivatives (3Q-5Q) using excess methyl iodide as a quaternization agent. All these phthalocyanines (Pcs) were characterized by elemental analysis and different spectroscopic methods such as FT-IR, 1 H NMR, UV-Vis and mass spectrometry. The photophysical and photochemical properties such as fluorescence and generation of singlet oxygen were investigated for determination of these phthalocyanines as photosensitizers in photodynamic therapy (PDT) applications. The binding properties of quaternized phthalocyanines (3Q-5Q) to calf thymus DNA (CT-DNA) were investigated by UV-Vis and fluorescence spectrophotometric methods. The quenching effect of all quaternized phthalocyanines on the fluorescence intensity of SYBR Green-DNA complex was determined. The mixtures of 3Q, 4Q or 5Q and DNA solutions were used to determine the change in T m of double helix DNA with thermal denaturation profile. In addition, thermodynamic parameters considering their aggregation in buffer solution, which shows the spontaneity of the reactions between DNA and quaternized Pcs were investigated. On the other hand, in vitro phototoxicity and cytotoxicity behavior of the quaternized water-soluble phthalocyanine photosensitizers (3Q-5Q) were tested against the cervical cancer cell line named HeLa for evaluation of their suitability for treatment of cancer by PDT method. Peripherally tetra-substituted neutral and quaternized metal-free and metallophthalocyanines (MPcs) (Zn, In) bearing morpholinoethoxy groups were prepared. The binding of quaternized compounds (3Q-5Q) to CT-DNA were examined using UV-Vis, fluorescence spectra, thermal denaturation profiles and K SV values. Besides, thermodynamic studies indicated that binding of 3Q-5Q to DNA was spontaneous. On the other hand, in vitro phototoxicity and

Synthesis and Analgesic Properties of Lidocaine Derivatives with Substituted Aminobenzothiazoles.

Science.gov (United States)

Ahmadi, Abbas; Khalili, Mohsen; Mohammadinoude, Mohammad Kazem; Nahri-Niknafs, Babak

2016-01-01

Local anesthetics are the most widely consumed drugs in the practice of medicine which provide a loss of sensation in a certain body part without loss of consciousness or impairment of central control of essential functions. Lidocaine (I) is the most commonly local anaesthetic drug which is widely used in all species due to its fabulous diffusing and penetrating properties as well as prompt onset of surgical analgesia. In this study, new aminobenzothiazole (with many useful biological and pharmacological properties) analogues were synthesized by changing of amine moiety of I. Both acute and chronic pain properties of new compounds (II-VI) were studied by using the tail immersion and formalin tests on mice and the outcomes were compared with control and lidocaine groups. According to the results, aminobenzothiazole derivatives are better candidates than diethylamine group for replacement on amine moiety of I. Also, derivatives with electron-withdrawing groups on this amine (V and VI) could decrease pain better than electron-donating ones (II and III) (specially on position 6 of this amine, II and V) which may be of concern for blockade of specific sodium channels by these new compounds.

Synthesis, Reactivity and Stability of Aryl Halide Protecting Groups towards Di-Substituted Pyridines

Directory of Open Access Journals (Sweden)

Ptoton Mnangat Brian

2016-03-01

Full Text Available This paper reports the synthesis and reactivity of different Benzyl derivative protecting groups. The synthesis and stability of Benzyl halides, 4-methoxybenzyl halides, 3,5-dimethoxybenzyl halides, 3,4-dimethoxybenzyl halides, 3,4,5-trimethoxybenzyl halide protecting groups and their reactivity towards nitrogen atom of a di-substituted pyridine ring in formation of pyridinium salts is also reported.

Nitrogen-Containing Coronenes: Theoretical Evaluation of the Influence of Aza-substitution on their Aromaticity

Science.gov (United States)

Pop, Raluca; van Staden, Jacobus; Diudea, Mircea

2015-03-01

The aromaticity of coronene derivatives where two C atoms of each outer six-membered ring are replaced by N have been investigated. Three types of substitution, namely 1,2-, 1,3-, and 1,4- are proposed. Computations of the geometric (HOMA index), energetic (HOMO-LUMO gap), and magnetic indices (NICS(0) and NICS(1)) were performed, and the results compared to the ones obtained for the all-carbon species. The results outline that the aza-derivatives have aromatic character comparable to the all-carbon species and an enlarged HOMO-LUMO gap.

Challenges in drug discovery for thiazolidinedione substitute

Directory of Open Access Journals (Sweden)

Jian-ping Ye

2011-10-01

Full Text Available Thiazolidinedione (TZD is a powerful insulin sensitizer in the treatment of type 2 diabetes. It acts as a ligand to the nuclear receptor PPARγ (peroxisome proliferator-activated receptor-gamma and induces transcription of PPARγ-responsive genes. TZD controls lipid synthesis and storage in adipose tissue, liver and many other tissues through PPARγ. Derivatives of TZD, such as rosiglitazone (Avandia and pioglitazone (Actos, are more powerful than metformin or berberine in insulin sensitization. Although they have common side effects such as weight gain and edema, these did not influence their clinical application in general. However, recent findings of risk for congestive heart failure and bladder cancer have significantly impaired their future in many countries. European countries have prohibited those drugs, and US will terminate application of rosiglitazone in clinics and hospitals. The multiple country actions may mark the end of TZD era. As a result, there is a strong demand for identification of TZD substitute in the treatment of type 2 diabetes. In this regard, literature about PPARγ ligands and potential TZD substitute are reviewed in this article. Histone deacetylase (HDAC inhibitor is emphasized as a new class of insulin sensitizer here. Regulators of SIRT1, CREB, NO, p38, ERK and Cdk5 are discussed in the activation of PPARγ.

Substituting freshwater: Can ocean desalination and water recycling capacities substitute for groundwater depletion in California?

Science.gov (United States)

Badiuzzaman, Pierre; McLaughlin, Eoin; McCauley, Darren

2017-12-01

While the sustainability of resource depletion is a longstanding environmental concern, wider attention has recently been given to growing water scarcity and groundwater depletion. This study seeks to test the substitutability assumption embedded in weak sustainability indicators using a case study of Californian water supply. The volume of groundwater depletion is used as a proxy for unsustainable water consumption, and defined by synthesising existing research estimates into low, medium and high depletion baselines. These are compared against projected water supply increases from ocean desalination and water recycling by 2035, to determine whether new, drought-proof water sources can substitute for currently unsustainable groundwater consumption. Results show that the maximum projected supply of new water, 2.47 million acre-feet per year (MAF/yr), is sufficient to meet low depletion estimates of 2.02 MAF/yr, but fails to come near the high depletion estimate of 3.44 MAF/yr. This does not necessarily indicate physical limitations of substitutability, but more so socio-economic limitations influenced by high comparative costs. By including capacities in demand-substitutability via urban water conservation, maximum predicted capacities reach 5.57 MAF/yr, indicating wide room for substitution. Based on these results, investment in social and institutional capital is an important factor to enhance demand-side substitutability of water and other natural resources, which has been somewhat neglected by the literature on the substitutability of natural resources. Copyright © 2017 Elsevier Ltd. All rights reserved.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Science.gov (United States)

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Preparation and physiological activities of carboxymethylated derivative purified from corn bran

Science.gov (United States)

Zhu, Linghui; Fang, Miaoli; Ma, Jianjun; Mo, Qing

2017-06-01

Two water-soluble polysaccharides extracted from corn bran were chemically modified to obtain their carboxymethylated derivatives (C-CBP1, C-CBP2). Theresults of degree of substitution and FT-IR analysis showed the carboxymethylation of polysaccharides were successful. The average molecular weight (Mw) of C-CBP1 and C-CBP2 were 368 and 263kDa, respectively. The degree of substitution (DS) of C-CBP1 and C-CBP2 were determined to be 0.44 and 0.46. The results showed that derivatives were effective in antioxidant and bile acidbinding activityin a dose dependent way. And C-CBP2 had the higher activity for hydroxyl radical, superoxide anion scavenging activities and bile acid capacity, as lower molecular weight plays a critical role in antioxidant activities and bile acid capacity. The results suggest that the carboxymethylated derivatives are potential natural antioxidant and blood fat reduce agent that can be used as drugs or functional food ingredients.

40 CFR 721.4420 - Substituted hydroxylamine.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted hydroxylamine. 721.4420... Substances § 721.4420 Substituted hydroxylamine. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as substituted hydroxylamine (PMN P-84-492) is...

Synthesis of Some New 1,3,4-Thiadiazole, Thiazole and Pyridine Derivatives Containing 1,2,3-Triazole Moiety

Directory of Open Access Journals (Sweden)

Nadia A. Abdelriheem

2017-02-01

Full Text Available In this study, 1-(5-Methyl-1-(p-tolyl-1H-1,2,3-triazol-4-ylethan-1-one, was reacted with Thiosemicarbazide, alkyl carbodithioate and benzaldehyde to give thiosemicarbazone, alkylidenehydrazinecarbodithioate and 3-phenylprop-2-en-1-one-1,2,3-triazole derivatives. The 1,3,4-thiadiazole derivatives containing the 1,2,3-triazole moiety were obtained via reaction of alkylidenecarbodithioate with hydrazonoyl halides. Also, hydrazonoyl halides were reacted with thiosemicarbazone and pyrazolylthioamide to give 1,3-thiazoles derivatives. Subsequently, 3-phenyl2-en-1-one was used to synthesize substituted pyridines and substituted nicotinic acid ester. The latter was converted to its azide compound which was reacted with aromatic amines and phenol to give substituted urea and phenylcarbamate containing 1,2,3-triazole moiety. The newly synthesized compounds were established by elemental analysis, spectral data and alternative synthesis whenever possible.

Investigation of the Redox Chemistry of Anthraquinone Derivatives Using Density Functional Theory

Energy Technology Data Exchange (ETDEWEB)

Bachman, Jonathan E.; Curtiss, Larry A.; Assary, Rajeev S.

2014-09-25

Application of density functional calculations to compute electrochemical properties such as redox windows, effect of substitution by electron donating and electron withdrawing groups on redox windows, and solvation free energies for ~50 anthraquinone (AQ) derivatives are presented because of their potential as anolytes in all-organic redox flow batteries. Computations suggest that lithium ions can increase (by ~0.4 V) the reduction potential of anthraquinone due to the lithium ion pairing by forming a Lewis base-Lewis acid complex. To design new redox active species, the substitution by electron donating groups are essential to improve the reduction window of AQ with adequate oxidative stability. For instance, a complete methylation of AQ can improve its reduction window by ~0.4 V. The quantum chemical studies of the ~50 AQ derivatives are used to derive a relationship that connects the computed LUMO energy and the reduction potential that can be applied as a descriptor for screening thousands of AQ derivatives. Our computations also suggest that incorporating oxy-methyl dioxolane substituents in the AQ framework can increase its interaction with non-aqueous solvent and improve its solubility. Thermochemical calculations for likely bond breaking decomposition reactions of un-substituted AQ anions suggest that the dianions are relatively stable in the solution. These studies provide ideal platform to perform further combined experimental and theoretical studies to understand the electrochemical reversibility and solubility of new quinone molecules as energy storage materials.

The beneficial effects of mixing spiro-OMeTAD with n-butyl-substituted copper phthalocyanine for perovskite solar cells

International Nuclear Information System (INIS)

Nouri, Esmaiel; Wang, Yu-Long; Chen, Qian; Xu, Jia-Ju; Dracopoulos, Vassilios; Sygellou, Lamprini; Xu, Zong-Xiang; Mohammadi, Mohammad Reza; Lianos, Panagiotis

2016-01-01

Highlights: • Soluble n-butyl substituted copper phthalocyanine. • Mixture with spiro-OMeTAD and employment in perovskite solar cells. • Impressive improvement of perovskite solar cell efficiency. • n-Butyl derivative gives better results than tert-butyl derivative - Abstract: Perovskite solar cells have been constructed under ambient conditions by using 2,2',7,7'-Tetrakis-(N,N-di-4-methoxyphenylamino)-9,9'-spirobifluorene (spiro-OMeTAD) mixed with a small quantity of soluble tetra-n-butyl substituted copper phthalocyanine as hole transporting material. The introduction of the phthalocyanine derivative resulted in an impressive increase of cell efficiency, which changed from 10.4% in the absence to 15.4% in the presence of phthalocyanine. This effect is related to the creation of deep traps in the hole transporting phase which block back-travelling electrons as well as to the improvement of the structural quality of the spiro-OMeTAD film in the presence of phthalocyanine. Both functionalities decrease shunt paths within the hole transporting phase resulting in increasing the fill factor and the open-circuit voltage of the cell.

Effect of ortho-substituted aniline on the corrosion protection of aluminum in 2 mol/L H2SO4 solution

KAUST Repository

El-Deeb, Mohamed M.; Alshammari, Hamed M.; Abdel-Azeim, Safwat

2017-01-01

Corrosion protection of aluminum in 2 mol/L HSO solution is examined in the presence of ortho-substituted aniline derivatives using potentiodynamic polarization and electrochemical impedance spectroscopy measurements. Density function theory (DFT

Regioselective aromatic substitution reactions of cyclometalated Ir(III) complexes: synthesis and photochemical properties of substituted Ir(III) complexes that exhibit blue, green, and red color luminescence emission.

Science.gov (United States)

Aoki, Shin; Matsuo, Yasuki; Ogura, Shiori; Ohwada, Hiroki; Hisamatsu, Yosuke; Moromizato, Shinsuke; Shiro, Motoo; Kitamura, Masanori

2011-02-07

In this manuscript, the regioselective halogenation, nitration, formylation, and acylation of Ir(tpy)(3) and Ir(ppy)(3) (tpy = 2-(4'-tolyl)pyridine and ppy = 2-phenylpyridine) and the subsequent conversions are described. During attempted bromination of the three methyl groups in fac-Ir(tpy)(3) using N-bromosuccinimide (NBS) and benzoyl peroxide (BPO), three protons at the 5'-position (p-position with respect to the C-Ir bond) of phenyl rings in tpy units were substituted by Br, as confirmed by (1)H NMR spectra, mass spectra, and X-ray crystal structure analysis. It is suggested that such substitution reactions of Ir complexes proceed via an ionic mechanism rather than a radical mechanism. UV-vis and luminescence spectra of the substituted Ir(III) complexes are reported. The introduction of electron-withdrawing groups such as CN and CHO groups at the 5'-position of tpy induces a blue shift of luminescence emission to about 480 nm, and the introduction of electron-donating groups such as an amino group results in a red shift to about 600 nm. A reversible change of emission for the 5'-amino derivative of Ir(tpy)(3), Ir(atpy)(3), between red and green occurs upon protonation and deprotonation.

Novel substituted and fused pyrrolizine derivatives: synthesis, anti-inflammatory and ulcerogenecity studies.

Science.gov (United States)

Abbas, Safinaz E; Awadallah, Fadi M; Ibrahim, Nashwa A; Gouda, Ahmed M

2010-02-01

Synthesis of several substituted pyrrolizines 10a-f, 11a-f, 13a-c, pyrimidopyrrolizines 14a-c, 15a-c, and pyrrolizinopyrimidoisoindoles 12a-c was discussed. The starting compounds 6-amino-7-cyano-N-(4-(un)substitutedphenyl)-2,3-dihydro-1H-pyrrolizine-5-carboxamides 9a-c were reacted with different aldehydes, acid chlorides, and acid anhydrides to give the target compounds. The structures of the new compounds were characterized by spectral and elemental analyses. All compounds were tested for their anti-inflammatory activity using the carrageenan-induced rat paw oedema model and exhibited weak to good activities compared to ketorolac as the reference drug. Also, analgesic activity of selected compounds, which are the most active in the anti-inflammatory screening, was measured using the acetic acid-induced writhing model; revealing activities comparable to or higher than ketorolac. Ulcer indices for the most active compounds were calculated and some compounds showed no or minimal ulcerogenic effect compared to ketorolac. Copyright 2009 Elsevier Masson SAS. All rights reserved.

Substitutes for School Nurses in Illinois

Science.gov (United States)

Vollinger, Linda Jeno; Bergren, Martha Dewey; Belmonte-Mann, Frances

2011-01-01

The purpose of this descriptive study was to explore utilization of nurse substitutes in the school setting in Illinois. The literature described personnel who staff the school health office in the absence of the school nurse and the barriers to obtaining nurse substitutes. There were no empirical studies conducted on school nurse substitutes in…

"Customizable" units in di- and tripeptides: selective conversion into substituted dehydroamino acids.

Science.gov (United States)

Saavedra, Carlos J; Boto, Alicia; Hernández, Rosendo

2012-07-20

The selective conversion of serine or threonine units of di- and tripeptides into substituted dehydroamino acids is reported. Thus, these common α-amino acids undergo a scission-phosphorylation process to give α-amino phosphonate residues. A Horner-Wadsworth-Emmons reaction with aldehydes or ketones follows to afford the final products with excellent Z-stereoselectivity (Z:E > 98:2). In this way, a single peptide precursor can selectively be transformed into a variety of derivatives.

Modeling competitive substitution in a polyelectrolyte complex

International Nuclear Information System (INIS)

Peng, B.; Muthukumar, M.

2015-01-01

We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longer than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution

Synthesis and Utilization of Trialkylammonium-Substituted Cyclodextrins as Water-Soluble Chiral NMR Solvating Agents for Anionic Compounds.

Science.gov (United States)

Dowey, Alison E; Puentes, Cira Mollings; Carey-Hatch, Mira; Sandridge, Keyana L; Krishna, Nikhil B; Wenzel, Thomas J

2016-04-01

Cationic trialkylammonium-substituted α-, β-, and γ-cyclodextrins containing trimethyl-, triethyl-, and tri-n-propylammonium substituent groups were synthesized and analyzed for utility as water-soluble chiral nuclear magnetic resonance (NMR) solvating agents. Racemic and enantiomerically pure (3-chloro-2-hydroxypropyl)trimethyl-, triethyl-, and tri-n-propyl ammonium chloride were synthesized from the corresponding trialkyl amine hydrochloride and either racemic or enantiomerically pure epichlorohydrin. The ammonium salts were then reacted with α-, β-, and γ-cyclodextrins at basic pH to provide the corresponding randomly substituted cationic cyclodextrins. The (1) H NMR spectra of a range of anionic, aromatic compounds was recorded with the cationic cyclodextrins. Cyclodextrins with a single stereochemistry at the hydroxy group on the (2-hydroxypropyl)trialkylammonium chloride substituent were often but not always more effective than the corresponding cyclodextrin in which the C-2 position was racemic. In several cases, the larger triethyl or tri-n-propyl derivatives were more effective than the corresponding trimethyl derivative at causing enantiomeric differentiation. None of the cyclodextrin derivatives were consistently the most effective for all of the anionic compounds studied. © 2016 Wiley Periodicals, Inc.

Substitutional analysis

CERN Document Server

Rutherford, Daniel Edwin

2013-01-01

Classic monograph, suitable for advanced undergraduates and graduate students. Topics include calculus of permutations and tableaux, semi-normal representation, orthogonal and natural representations, group characters, and substitutional equations. 1968 edition.

Computational study of cation substitutions in apatites

International Nuclear Information System (INIS)

Tamm, Toomas; Peld, Merike

2006-01-01

Density-functional theory plane-wave modeling of fluor- and hydroxyapatites has been performed, where one or two calcium ions per unit cell were replaced with cadmium or zinc cations. It was found that cadmium ions favor Ca(1) positions in fluorapatites and Ca(2) positions in hydroxyapatites, in agreement with experiment. A similar pattern is predicted for zinc substitutions. In the doubly substituted cases, where only hydroxyapatites were modeled, a preference for the substituting ions to be located in Ca(2) position was also observed. Displacement of the hydroxide ions from their symmetrical positions on the hexagonal axis can be used to explain the preferred configurations of substituting ions around the axis. -- Deformation of the hydroxide ion chain due to substitutions around the ion channel in substituted hydroxyapatites

Photochemistry and photopolymerisation activity of novel thioxanthone derivatives

International Nuclear Information System (INIS)

Nik Ghazali Salleh; Allen, N.S.; Edge, M.; Shah, M.; Green, A.

1999-01-01

In this paper, we aim to examine the influence of a range of 4-oxy substituted groups on the photochemical and photopolymerization of 1-chloro- and 1-phenylthio-thioxanhone. Here we have examined the effect of a number of acyloxy groups attached to the ring 4-position. The study includes a spectroscopic and photoinitiated polymerization evaluation using real time infrared and photocalorimetry. The photoactivities of the initiators are compared with those of the standard industrial system such as the 4-n-propoxy derivative and the basic compound like the 1-chloro-4-hydroxyl derivative which was used to synthesise all the derivatives examined here

Substituted N-Phenylpyrazine-2-carboxamides, Their Synthesis and Evaluation as Herbicides and Abiotic Elicitors

Directory of Open Access Journals (Sweden)

Katarína Kráľová

2007-12-01

Full Text Available The condensation of substituted pyrazine-2-carboxylic acid chlorides with ring-substituted anilines yielded five substituted pyrazine-2-carboxylic acid amides. Thesynthesis, and analytical, lipophilicity and biological data of the newly synthesizedcompounds are presented in this paper. The photosynthesis inhibition, antialgal activityand the effect of a series of pyrazine derivatives as abiotic elicitors on the accumulation offlavonoids in a callus culture of Ononis arvensis (L. were investigated. The most activeinhibitor of the oxygen evolution rate in spinach chloroplasts was 6-chloro-pyrazine-2-carboxylic acid (3-iodo-4-methylphenyl-amide (2, IC50 = 51.0 μmol·L-1. The highestreduction of chlorophyll content in Chlorella vulgaris was found for 5-tert-butyl-N-(4-chloro-3-methylphenyl-pyrazine-2-carboxamide (3, IC50 = 44.0 μmol·L-1. The maximalflavonoid production (about 900% was reached after a twelve-hour elicitation processwith 6-chloropyrazine-2-carboxylic acid (3-iodo-4-methylphenyl-amide (2.

Optoelectronic properties of higher acenes, their BN analogue and substituted derivatives

International Nuclear Information System (INIS)

Armaković, Stevan; Armaković, Sanja J.; Holodkov, Vladimir; Pelemiš, Svetlana

2016-01-01

We have investigated optoelectronic properties of higher acenes: pentacene, hexacene, heptacene, octacene, nonacene, decacene and their boron-nitride (BN) analogues, within the framework of density functional theory (DFT). We have also investigated the optoelectronic properties of acenes modified by BN substitution. Calculated optoelectronic properties encompasses: oxidation and reduction potentials, electron and hole reorganization energies and energy difference between excited first singlet and triplet states ΔE(S_1−T_1). Oxidation and reduction potentials indicate significantly better stability of BN analogues, comparing with their all-carbon relatives. Although higher acenes possess lower electron and hole reorganization energies, with both best values much lower than 0.1 eV, their BN analogues also have competitive values of reorganization energies, especially for holes for which reorganization energy is also lower than 0.1 eV. On the other hand ΔE(S_1−T_1) is much better for BN analogues, having values that indicate that BN analogues are possible applicable for thermally activated delayed fluorescence. - Highlights: • Optoelectronic properties of structures based on higher acenes have been investigated. • Oxidation and reduction potentials together with reorganization energies are calculated. • TADF is analyzed through calculation of ΔE(S_1−T_1), which is much better for BN analogues. • Reorganization energies of acenes improve with the increase of number of benzene rings.

Currency substitution in Eastern Europe

NARCIS (Netherlands)

van Aarle, B.; Budina, N.

1995-01-01

Monetary instability during the transition process from a command economy to a market economy has induced a considerable increase in currency substitution in Eastern Europe. Currency substitution itself affects monetary stability since it reduces the stability of velocity. This paper investigates

Tissue-Engineered Skin Substitute Enhances Wound Healing after Radiation Therapy.

Science.gov (United States)

Busra, Mohd Fauzi bin Mh; Chowdhury, Shiplu Roy; bin Ismail, Fuad; bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

2016-03-01

When given in conjunction with surgery for treating cancer, radiation therapy may result in impaired wound healing, which, in turn, could cause skin ulcers. In this study, bilayer and monolayer autologous skin substitutes were used to treat an irradiated wound. A single dose of 30 Gy of linear electron beam radiation was applied to the hind limb of nude mice before creating the skin lesion (area of 78.6 mm). Monolayer tissue-engineered skin substitutes (MTESSs) were prepared by entrapping cultured keratinocytes in fibrin matrix, and bilayer tissue-engineered skin substitutes (BTESSs) were prepared by entrapping keratinocytes and fibroblasts in separate layers. Bilayer tissue-engineered skin substitute and MTESS were implanted to the wound area. Gross appearance and wound area were analyzed to evaluate wound healing efficiency. Skin regeneration and morphological appearance were observed via histological and electron microscopy. Protein expressions of transforming growth factor β1 (TGF-β1), platelet-derived growth factor BB (PDGF-BB), and vascular endothelial growth factor (VEGF) in skin regeneration were evaluated by immunohistochemistry (IHC). Macroscopic observation revealed that at day 13, treatments with BTESS completely healed the irradiated wound, whereas wound sizes of 1.1 ± 0.05 and 6.8 ± 0.14 mm were measured in the MTESS-treated and untreated control groups, respectively. Hematoxylin-eosin (H&E) analysis showed formation of compact and organized epidermal and dermal layers in the BTESS-treated group, as compared with MTESS-treated and untreated control groups. Ultrastructural analysis indicates maturation of skin in BTESS-treated wound evidenced by formation of intermediate filament bundles in the dermal layer and low intercellular space in the epidermal layer. Expressions of TGF-β1, PDGF-BB, and VEGF were also higher in BTESS-treated wounds, compared with MTESS-treated wounds. These results indicate that BTESS is the preferred treatment for

Chitosan Dermal Substitute and Chitosan Skin Substitute Contribute to Accelerated Full-Thickness Wound Healing in Irradiated Rats

Directory of Open Access Journals (Sweden)

Abu Bakar Mohd Hilmi

2013-01-01

Full Text Available Wounds with full-thickness skin loss are commonly managed by skin grafting. In the absence of a graft, reepithelialization is imperfect and leads to increased scar formation. Biomaterials can alter wound healing so that it produces more regenerative tissue and fewer scars. This current study use the new chitosan based biomaterial in full-thickness wound with impaired healing on rat model. Wounds were evaluated after being treated with a chitosan dermal substitute, a chitosan skin substitute, or duoderm CGF. Wounds treated with the chitosan skin substitute showed the most re-epithelialization (33.2 ± 2.8%, longest epithelial tongue (1.62 ± 0.13 mm, and shortest migratory tongue distance (7.11 ± 0.25 mm. The scar size of wounds treated with the chitosan dermal substitute (0.13 ± 0.02 cm and chitosan skin substitute (0.16 ± 0.05 cm were significantly decreased (P<0.05 compared with duoderm (0.45 ± 0.11 cm. Human leukocyte antigen (HLA expression on days 7, 14, and 21 revealed the presence of human hair follicle stem cells and fibroblasts that were incorporated into and surviving in the irradiated wound. We have proven that a chitosan dermal substitute and chitosan skin substitute are suitable for wound healing in full-thickness wounds that are impaired due to radiation.

Substitution between cars within the household

DEFF Research Database (Denmark)

De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

2016-01-01

In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars of different fuel efficiency in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate – for each car owned by the household...... – own and cross-price effects of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, the basic model yielded fuel price elasticities of 0.......98 and 1.41 for the primary and secondary cars, respectively. Accounting for substitution effects, these figures reduce to, respectively, 0.32 and 0.45. Consistent with substitution behaviour, we find that the fuel price elasticity of fuel demand exceeds the elasticity of kilometre demands with respect...

Elasticity of Substitution and Antidumping Measures

DEFF Research Database (Denmark)

Drud Hansen, Jørgen; Meinen, Philipp; Nielsen, Jørgen Ulff-Møller

Abstract This paper analyzes the role of the elasticity of substitution for anti-dumping decisions across countries. In monopolistic competition models with cost heterogeneous firms across countries, price differences vary inversely with the elasticity of substitution. Anti-dumping duties should...... therefore also vary inversely with the elasticity of substitution at least for countries which have a strong focus on prices in the determination of their anti-dumping measures. We test this for ten countries from 1990 to 2009 using data on anti-dumping from Chad Bown (2010) and US-data at 8-digit level...... in our empirical investigation support the predicted role of the elasticity of substitution as we find a significant negative relation between the elasticity of substitution and the final anti-dumping duties for the ‘lesser duty rule’ group of countries. The countries which do not follow the ‘lesser duty...

S-Substituted cysteine derivatives and thiosulfinate formation in Petiveria alliacea-part II.

Science.gov (United States)

Kubec, Roman; Kim, Seokwon; Musah, Rabi A

2002-11-01

Three cysteine derivatives, (R)-S-(2-hydroxyethyl)cysteine, together with (R(S)R(C))- and (S(S)R(C))-S-(2-hydroxyethyl)cysteine sulfoxides, have been isolated from the roots of Petiveria alliacea. Furthermore, three additional amino acids, S-methyl-, S-ethyl-, and S-propylcysteine derivatives, were detected. They were present only in trace amounts (<3 microg g(-1) fr. wt), precluding determination of their absolute configurations and oxidation states. In addition, four thiosulfinates, S-(2-hydroxyethyl) (2-hydroxyethane)-, S-(2-hydroxyethyl) phenylmethane-, S-benzyl (2-hydroxyethane)- and S-benzyl phenylmethanethiosulfinates, have been found in a homogenate of the roots. The formation pathways of various benzyl/phenyl-containing compounds previously found in the plant were also discussed.

Biological background of dermal substitutes

NARCIS (Netherlands)

van der Veen, V. C.; van der Wal, M.B.; van Leeuwen, M.C.; Ulrich, M.; Middelkoop, E.

2010-01-01

Dermal substitutes are of major importance in treating full thickness skin defects, both in acute and chronic wounds. In this review we will outline specific requirements of three classes of dermal substitutes:-natural biological materials, with a more or less intact extracellular matrix

THE SPECIFICITY OF KERATEINE DERIVATIVES.

Science.gov (United States)

Pillemer, L; Ecker, E E; Martiensen, E W

1939-09-30

Carboxymethyl, alpha-carboxyethyl-, alpha-carboxy-n-propyl-, alpha-carboxyisopropyl-, alpha-carboxy-n-butyl, alpha-carboxyisobutyl, alpha-carboxyamyl-, benzyl-, and beta-phenylethylkeratemes were prepared from the parent protein, reduced keratin or kerateine. Chemical analysis disclosed that the various compounds differed in their isoelectric points and solubilities depending on the nature of the substituent group introduced. In general, it was found that in so far as could be determined, nearly all of the available sulfhydryl groups were substituted, while no detectable substitution of the free amino groups of the proteins occurred. The results of the serologic studies revealed that the kerateine derivatives acquired a new immunologie character dependent on the nature of the introduced determinant group. Inhibition tests confirmed the results obtained. Evidence was also produced to show that the grouping See PDF for structure may play a rôle in some of the reactions observed.

Synthesis and evaluation of a series of 2-substituted-5-thiopropylpiperazine (piperidine)-1,3,4-oxadiazoles derivatives as atypical antipsychotics.

Science.gov (United States)

Chen, Yin; Xu, Xiangqing; Liu, Xin; Yu, Minquan; Liu, Bi-Feng; Zhang, Guisen

2012-01-01

It is important to develop novel antipsychotics that can effectively treat schizophrenia with minor side-effects. The aim of our work is to develop novel antipsychotics that act on dopamine D(2) and D(3), serotonin 5-HT(1A) and 5-HT(2A) receptors with low affinity for the serotonin 5-HT(2C) and H(1) receptors, which can effectively cure positive symptoms, negative symptoms and cognitive impairment without the weight gain side-effect. A series of 2-substituted-5-thiopropylpiperazine (piperidine) -1,3,4-oxadiazoles derivatives have been synthesized and the target compounds were evaluated for binding affinities to D(2), 5-HT(1A) and 5-HT(2A) receptors. Preliminary results indicated that compounds 14, 16 and 22 exhibited high affinities to D(2), 5-HT(1A) and 5-HT(2A) receptors among these compounds. Further binding tests showed that compound 22 had high affinity for D(3) receptor, and low affinity for serotonin 5-HT(2C) and H(1) receptors. In addition, compound 22 inhibited apomorphine-induced climbing behavior and MK-801-induced hyperactivity with no extrapyramidal symptoms liability in mice. Moreover, compound 22 exhibited acceptable pharmacokinetic properties. Compound 22 showed an atypical antipsychotic activity without liability for extrapyramidal symptoms. We anticipate compound 22 to be useful for developing a novel class of drug for the treatment of schizophrenia.

Characterization and Antimicrobial Studies of Five Substituted Bis-Thioureas

International Nuclear Information System (INIS)

Nurulain Kamalulazmy; Sahilah Abd Mutalib; Fatin Ilyani Nasir; Nurul Izzaty Hassan

2016-01-01

Thioureas play an important role in medicinal chemistry and agricultures due to their biological activity such as antibacterial, antifungal, antiviral, herbicides, rodenticides, phenoloxidase enzymatic inhibitors, anti-HIV and anti-tumor agents. In this study, five substituted bis-thioureas have been synthesized. The isophthaloyl chloride and 2,6- pyridine dicarbonyl dichloride were easily converted to bis-isothiocyanate compound via the reaction with ammonium thiocyanate by solid-liquid phase transfer catalysis of polyethylene glycol-400 (PEG-400). Bis-isothiocyanate compound was reacted with aniline derivatives to produce substituted bis-thioureas in good yield at room temperature. All the novel compounds were obtained as yellow solid after recrystallization using DMF/EtOH/H_2O. Their chemical structures were confirmed by Infrared spectroscopy (IR), Nuclear Magnetic Resonance (NMR) "1H and "1"3C and mass spectrometry. The five synthesized compounds were screened for antimicrobial activities using disc diffusion method for antimicrobial activity against Gram-positive bacteria (Bacillus Subtilis and Staphylococcus Aureus), Gram-negative bacteria (Escherichia Coli and Salmonella Typhi) and a mold (Aspergillus Niger). All tested compounds showed low antimicrobial activity since the diameter of inhibition zone (IZ) measure was less than positive control inhibition zone. (author)

Study on the thermal stability of nitrobenzene derivatives; Chikan nitorobenzen rui no netsu anteisei ni kansuru kenkyu

Energy Technology Data Exchange (ETDEWEB)

Sasaki, Tatsuya; Akutsu, Yoshiaki; Arai, Mitsuru; Tamura, Masamitsu [The University of Tokyo, Tokyo (Japan). Department of Chemical System Engineering School of Engineering

1999-10-31

In order to clarify the thermal decomposition behavior of nitrobenzene derivatives, the influences of interaction between nitro group and other substituents on thermal decomposition of nitrobenzene derivatives have been studied using sealed cell DSC and PM3 MO calculations. As a result, the mixtures of nitrobenzene and mono substituted benzenes having substituents containing hydrogen such as {sup -}CH{sub 3}, {sup -}COOH, {sup -}NH{sub 2}, and {sup -}OH showed 30-100 degree C lower T{sub DSC} value than nitrobenzene. Mono-substituted nitrobenzene having substituents containing hydrogen also showed lower T{sub DSC} value. On the other hand, PM3 MO calculations of hydrogen-bonded complexes of nitrobenzene and mono substituted benzene show that the hydrogen bonding of a nitro group and hydrogen of substituents may make the N-O bond length longer to induce the thermal decomposition. From These results, it can be said that the thermal decomposition of nitrobenzene derivatives would be unstabilized by the hydrogen bonding of a nitro group and a substituent containing hydrogen. (author)

Variation in heterozygosity predicts variation in human substitution rates between populations, individuals and genomic regions.

Directory of Open Access Journals (Sweden)

William Amos

Full Text Available The "heterozygote instability" (HI hypothesis suggests that gene conversion events focused on heterozygous sites during meiosis locally increase the mutation rate, but this hypothesis remains largely untested. As humans left Africa they lost variability, which, if HI operates, should have reduced the mutation rate in non-Africans. Relative substitution rates were quantified in diverse humans using aligned whole genome sequences from the 1,000 genomes project. Substitution rate is consistently greater in Africans than in non-Africans, but only in diploid regions of the genome, consistent with a role for heterozygosity. Analysing the same data partitioned into a series of non-overlapping 2 Mb windows reveals a strong, non-linear correlation between the amount of heterozygosity lost "out of Africa" and the difference in substitution rate between Africans and non-Africans. Putative recent mutations, derived variants that occur only once among the 80 human chromosomes sampled, occur preferentially at the centre of 2 Kb windows that have elevated heterozygosity compared both with the same region in a closely related population and with an immediately adjacent region in the same population. More than half of all substitutions appear attributable to variation in heterozygosity. This observation provides strong support for HI with implications for many branches of evolutionary biology.

Synthesis of 4-(2-substituted hydrazinyl)benzenesulfonamides and their carbonic anhydrase inhibitory effects.

Science.gov (United States)

Gul, Halise Inci; Kucukoglu, Kaan; Yamali, Cem; Bilginer, Sinan; Yuca, Hafize; Ozturk, Iknur; Taslimi, Parham; Gulcin, Ilhami; Supuran, Claudiu T

2016-08-01

In this study, 4-(2-substituted hydrazinyl)benzenesulfonamides were synthesized by microwave irradiation and their chemical structures were confirmed by (1)H NMR, (13)CNMR, and HRMS. Ketones used were: Acetophenone (S1), 4-methylacetophenone (S2), 4-chloroacetophenone (S3), 4-fluoroacetophenone (S4), 4-bromoacetophenone (S5), 4-methoxyacetophenone (S6), 4-nitroacetophenone (S7), 2-acetylthiophene (S8), 2-acetylfuran (S9), 1-indanone (S10), 2-indanone (S11). The compounds S9, S10 and S11 were reported for the first time, while S1-S8 was synthesized by different method than literature reported using microwave irradiation method instead of conventional heating in this study. The inhibitory effects of 4-(2-substituted hydrazinyl)benzenesulfonamide derivatives (S1-S11) against hCA I and II were studied. Cytosolic hCA I and II isoenzymes were potently inhibited by new synthesized sulphonamide derivatives with Kis in the range of 1.79 ± 0.22-2.73 ± 0.08 nM against hCA I and in the range of 1.72 ± 0.58-11.64 ± 5.21 nM against hCA II, respectively.

Alteration of terminal heterochromatin and chromosome rearrangements in derivatives of wheat-rye hybrids.

Science.gov (United States)

Fu, Shulan; Lv, Zhenling; Guo, Xiang; Zhang, Xiangqi; Han, Fangpu

2013-08-20

Wheat-rye addition and substitution lines and their self progenies revealed variations in telomeric heterochromatin and centromeres. Furthermore, a mitotically unstable dicentric chromosome and stable multicentric chromosomes were observed in the progeny of a Chinese Spring-Imperial rye 3R addition line. An unstable multicentric chromosome was found in the progeny of a 6R/6D substitution line. Drastic variation of terminal heterochromatin including movement and disappearance of terminal heterochromatin occurred in the progeny of wheat-rye addition line 3R, and the 5RS ditelosomic addition line. Highly stable minichromosomes were observed in the progeny of a monosomic 4R addition line, a ditelosomic 5RS addition line and a 6R/6D substitution line. Minichromosomes, with and without the FISH signals for telomeric DNA (TTTAGGG)n, derived from a monosomic 4R addition line are stable and transmissible to the next generation. The results indicated that centromeres and terminal heterochromatin can be profoundly altered in wheat-rye hybrid derivatives. Copyright © 2013. Published by Elsevier Ltd.

Substitution in recreation choice behavior

Science.gov (United States)

George L. Peterson; Daniel J. Stynes; Donald H. Rosenthal; John F. Dwyer

1985-01-01

This review discusses concepts and theories of substitution in recreation choice. It brings together the literature of recreation research, psychology, geography, economics, and transportation. Parallel and complementary developments need integration into an improved theory of substitution. Recreation decision behavior is characterized as a nested or sequential choice...

Why Does Trigonometric Substitution Work?

Science.gov (United States)

Cunningham, Daniel W.

2018-01-01

Modern calculus textbooks carefully illustrate how to perform integration by trigonometric substitution. Unfortunately, most of these books do not adequately justify this powerful technique of integration. In this article, we present an accessible proof that establishes the validity of integration by trigonometric substitution. The proof offers…

Substituted Indoleacetic Acids Tested in Tissue Cultures

DEFF Research Database (Denmark)

Engvild, Kjeld Christensen

1978-01-01

Monochloro substituted IAA inhibited shoot induction in tobacco tissue cultures about as much as IAA. Dichloro substituted IAA inhibited shoot formation less. Other substituted IAA except 5-fluoro- and 5-bromoindole-3-acetic acid were less active than IAA. Callus growth was quite variable...

Synthesis, spectral characterization and in vitro antifungal activity of Lanthanum(III) and Praseodymium(III) complexes with Schiff bases derived from 5-substituted-4-amino-5-hydrazino-1,2,4-triazoles and isatin

International Nuclear Information System (INIS)

Singh, Shweta; Tripathi, Priti; Pandey, Om P.; Sengupta, Soumitra K.

2013-01-01

The new lanthanum(III) and praseodymium(III) complexes of the general formula (LnCl(L)(H 2 O) 2 ) (Ln = La III or Pr III ; H 2 L = Schiff bases derived from 3-substituted-4-amino-5-hydrazino-1,2,4-triazoles and isatin) have been prepared. The complexes have been characterized by elemental analyses, molecular weight by FAB-mass, thermogravimetry, electrical conductance, magnetic moment and spectral (electronic, infrared, far-infrared, 1 H NMR and 13 C NMR) data. The ligands and all prepared complexes were assayed for antifungal (Aspergillus niger and Helminthosporium oryzae) activities. The activities have been correlated with the structures of the complexes. (author)

Density-independent population projection trajectories of chromosome-substituted lines resistant and susceptible to organophosphate insecticides in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Miyo Takahiro

2004-11-01

Full Text Available Abstract Background Seasonal fluctuations in susceptibility to organophosphate insecticides were observed in the Katsunuma population of Drosophila melanogaster for two consecutive years; susceptibility to three organophosphates tended to increase in the fall. To examine the hypothesis that variation in fitness among resistant and susceptible genotypes could trigger the change of genetic constitution within the fall population, we investigated density-independent population projection trajectories starting from single adult females with characteristics of chromosome-substituted lines resistant and susceptible to the three organophosphates. Results Density-independent population projection trajectories, expressed as the ratios of the number of each chromosome-substituted line to that of line SSS, for which all chromosomes were derived from the susceptible line, showed significant declines in numbers with time for all the resistant chromosome-substituted lines. Conclusion The declining tendency in the density-independent population projection trajectories of the resistant chromosome-substituted lines could explain the simultaneous decline in the levels of resistance to the three organophosphates, observed in the Katsunuma population in the fall.

Currency Substitution and Inflation in Peru Currency Substitution and Inflation in Peru

OpenAIRE

Liliana Rojas-Suarez

1992-01-01

This paper shows that there is a long-run relationship between the expected rate of depreciation in the black-market-exchange rate and the ratio of domestic to foreign money in Peru: that is, the hypothesis of currency substitution can explain the behavior of real holdings of money in Peru. The paper also shows that, while, the importance of currency substitution as a transmission mechanism through which domestic policies affected the dynamics of inflation was relatively small during a period...

Flow perfusion culture of human mesenchymal stem cells on silicate-substituted tricalcium phosphate scaffolds

DEFF Research Database (Denmark)

Bjerre, Lea; Bünger, Cody E; Kassem, Moustapha

2008-01-01

Autologous bone grafts are currently the gold standard for treatment of large bone defects, but their availability is limited due to donor site morbidity. Different substitutes have been suggested to replace these grafts, and this study presents a bone tissue engineered alternative using silicate......-substituted tricalcium phosphate (Si-TCP) scaffolds seeded with human bone marrow-derived mesenchymal stem cells (hMSC). The cells were seeded onto the scaffolds and cultured either statically or in a perfusion bioreactor for up to 21 days and assessed for osteogenic differentiation by alkaline phosphatase activity...... assays and by quantitative real-time RT-PCR on bone markers. During culture, cells from the flow cultured constructs demonstrated improved proliferation and osteogenic differentiation verified by a more pronounced expression of several bone markers, e.g. alkaline phosphatase, osteopontin, Runx2, bone...

New arylsparteine derivatives as positive inotropic drugs.

Science.gov (United States)

Boido, Vito; Ercoli, Marcella; Tonelli, Michele; Novelli, Federica; Tasso, Bruno; Sparatore, Fabio; Cichero, Elena; Fossa, Paola; Dorigo, Paola; Froldi, Guglielmina

2017-12-01

Positive inotropic agents are fundamental in the treatment of heart failure; however, their arrhythmogenic liability and the increased myocardial oxygen demand strongly limit their therapeutic utility. Pursuing our study on cardiovascular activities of lupin alkaloid derivatives, several 2-(4-substituted-phenyl)-2-dehydrosparteines and 2-(4-substituted-phenyl)sparteines were prepared and tested for inotropic and chronotropic activities on isolated guinea pig atria. Four compounds (6b, 6e, 7b, and 7f) exhibited significant inotropism that, at the higher concentrations, was followed by negative inotropism or toxicity. Compound 7e (2-(4-tolyl)sparteine) exhibited a steep dose-depending inotropic activity up to the highest concentration tested (300 µM) with an E max of 116.5 ± 3.4% of basal force, proving less potent but much more active in comparison to the highest concentrations tested of digoxin and milrinone having E max of 87.5 ± 3.1% and 52.2 ± 1.1%, respectively. Finally, docking studies suggested that the relevant sparteine derivatives could target the sigma-1 receptor, whose involvement in cardiac activity is well documented.

Comparison of Porcine and Bovine Collagen Dural Substitutes in Posterior Fossa Decompression for Chiari I Malformation in Adults.

Science.gov (United States)

Lee, Christine K; Mokhtari, Tara; Connolly, Ian D; Li, Gordon; Shuer, Lawrence M; Chang, Steven D; Steinberg, Gary K; Hayden Gephart, Melanie

2017-12-01

Posterior fossa decompression surgeries for Chiari malformations are susceptible to postoperative complications such as pseudomeningocele, external cerebrospinal fluid (CSF) leak, and meningitis. Various dural substitutes have been used to improve surgical outcomes. This study examined whether the collagen matrix dural substitute type correlated with the incidence of postoperative complications after posterior fossa decompression in adult patients with Chiari I malformations. A retrospective cohort study was conducted of 81 adult patients who underwent an elective decompressive surgery for treatment of symptomatic Chiari I malformations, with duraplasty involving a dural substitute derived from either bovine or porcine collagen matrix. Demographics and treatment characteristics were correlated with surgical outcomes. A total of 81 patients were included in the study. Compared with bovine dural substitute, porcine dural substitute was associated with a significantly higher risk of pseudomeningocele occurrence (odds ratio, 5.78; 95% confidence interval, 1.65-27.15; P = 0.01) and a higher overall complication rate (odds ratio, 3.70; 95% confidence interval, 1.23-12.71; P = 0.03) by univariate analysis. There was no significant difference in the rate of meningitis, repeat operations, or overall complication rate between the 2 dural substitutes. In addition, estimated blood loss was a significant risk factor for meningitis (P = 0.03). Multivariate analyses again showed that porcine dural substitute was associated with pseudomeningocele occurrence, although the association with higher overall complication rate did not reach significance. Dural substitutes generated from porcine collagen, compared with those from bovine collagen, were associated with a higher likelihood of pseudomeningocele development in adult patients undergoing Chiari I malformation decompression and duraplasty. Copyright © 2017 Elsevier Inc. All rights reserved.

Consequence of patient substitution of nattokinase for warfarin after aortic valve replacement with a mechanical prosthesis.

Science.gov (United States)

Elahi, Maqsood M; Choi, Charles H; Konda, Subbareddy; Shake, Jay G

2015-01-01

This report describes a patient's self-substitution of nattokinase for the vitamin K antagonist warfarin after aortic valve replacement with a mechanical prosthesis. Nattokinase is an enzyme derived from a popular fermented soybean preparation in Japan (natto), which has fibrinolytic properties and is gaining popularity in nontraditional health journals and nonmedical health websites as an over-the-counter thrombolytic. After nearly a year of use of nattokinase without warfarin, the patient developed thrombus on the mechanical valve and underwent successful repeat valve replacement. We believe this is the first documented case of nattokinase being used as a substitute for warfarin after valve replacement, and we strongly discourage its use for this purpose.

Influence of Bridgehead Substitution and Ring Annelation on the Photophysical Properties of Polycyclic DBO-Type Azoalkanes.

Science.gov (United States)

Adam, Waldemar; Nikolaus, Achim; Sauer, Jürgen

1999-05-14

The photophysical data for the polycyclic, bridgehead-substituted derivatives 1-10 of the photoreluctant diazabicyclo[2.2.2]oct-2-ene (DBO) are presented. Substitution on the bridgehead positions with radical-stabilizing substituents enhances the photoreactivity (Phi(r)) and decreases the fluorescence quantum yields (Phi(f)) and lifetimes (tau) compared to the parent DBO. The annelated rings have no influence on the photoreactivity, except when steric interactions with an alpha substituent hinder the optimal radical-stabilizing conformation. The fused rings and some of the bridgehead substituents reduce the solvent-induced quenching of the singlet-excited azo chromophore by steric shielding of the azo group and, thus, increase the fluorescence quantum yields and lifetimes.

Investigating the Activity Spectrum for Ring-Substituted 8-Hydroxyquinolines

Directory of Open Access Journals (Sweden)

Aidan Coffey

2010-01-01

Full Text Available In this study, a series of fourteen ring-substituted 8-hydroxyquinoline derivatives were prepared. The synthesis procedures are presented. The compounds were analyzed using RP-HPLC to determine lipophilicity. They were tested for their activity related to inhibition of photosynthetic electron transport (PET in spinach (Spinacia oleracea L. chloroplasts. Primary in vitro screening of the synthesized compounds was also performed against four mycobacterial strains and against eight fungal strains. Several compounds showed biological activity comparable with or higher than the standards isoniazid or fluconazole. For all the compounds, the relationships between the lipophilicity and the chemical structure of the studied compounds are discussed.

The Morishima Gross elasticity of substitution

OpenAIRE

Blackorby, Charles; Primont, Daniel; Russell, R. Robert

2007-01-01

We show that the Hotelling-Lau elasticity of substitution, an extension of the Allen-Uzawa elasticity to allow for optimal output-quantity (or utility) responses to changes in factor prices, inherits all of the failings of the Allen-Uzawa elasticity identified by Blackorby and Russell [1989 AER]. An analogous extension of the Morishima elasticity of substitution to allow for output quantity changes preserves the salient properties of the original Hicksian notion of elasticity of substitution.

Optoelectronic properties of higher acenes, their BN analogue and substituted derivatives

Energy Technology Data Exchange (ETDEWEB)

Armaković, Stevan, E-mail: stevan.armakovic@df.uns.ac.rs [University of Novi Sad, Faculty of Sciences, Department of Physics, Trg Dositeja Obradovića 4, 21000, Novi Sad (Serbia); Armaković, Sanja J. [University of Novi Sad, Faculty of Sciences, Department of Chemistry, Biochemistry and Environmental Protection, Trg Dositeja Obradovića 3, 21000, Novi Sad (Serbia); Holodkov, Vladimir [Educons University, Faculty of Sport and Tourism - TIMS, Radnička 30a, 21000, Novi Sad (Serbia); Pelemiš, Svetlana [University of East Sarajevo, Faculty of Technology, Karakaj bb, 75400, Zvornik, Republic of Srpska, Bosnia and Herzegovina (Bosnia and Herzegovina)

2016-02-15

We have investigated optoelectronic properties of higher acenes: pentacene, hexacene, heptacene, octacene, nonacene, decacene and their boron-nitride (BN) analogues, within the framework of density functional theory (DFT). We have also investigated the optoelectronic properties of acenes modified by BN substitution. Calculated optoelectronic properties encompasses: oxidation and reduction potentials, electron and hole reorganization energies and energy difference between excited first singlet and triplet states ΔE(S{sub 1}−T{sub 1}). Oxidation and reduction potentials indicate significantly better stability of BN analogues, comparing with their all-carbon relatives. Although higher acenes possess lower electron and hole reorganization energies, with both best values much lower than 0.1 eV, their BN analogues also have competitive values of reorganization energies, especially for holes for which reorganization energy is also lower than 0.1 eV. On the other hand ΔE(S{sub 1}−T{sub 1}) is much better for BN analogues, having values that indicate that BN analogues are possible applicable for thermally activated delayed fluorescence. - Highlights: • Optoelectronic properties of structures based on higher acenes have been investigated. • Oxidation and reduction potentials together with reorganization energies are calculated. • TADF is analyzed through calculation of ΔE(S{sub 1}−T{sub 1}), which is much better for BN analogues. • Reorganization energies of acenes improve with the increase of number of benzene rings.

Prediction of the enthalpies of vaporization for room-temperature ionic liquids: Correlations and a substitution-based additive scheme

International Nuclear Information System (INIS)

Kabo, Gennady J.; Paulechka, Yauheni U.; Zaitsau, Dzmitry H.; Firaha, Alena S.

2015-01-01

Highlights: • The available literature data on Δ l g H for ionic liquids were analyzed. • Correlation equations for Δ l g H were derived using symbolic regression. • A substitution-based incremental scheme for Δ l g H was developed. • The proposed scheme has an advantage over the existing predictive procedures. - Abstract: The literature data on the enthalpies of vaporization for aprotic ionic liquids (ILs) published by the end of May 2014 were analyzed and the most reliable Δ l g H m values were derived for 68 ILs. The selected enthalpies of vaporization were correlated with density and surface tension using symbolic regression and a number of effective correlation equations were proposed. The substitution-based incremental scheme for prediction of the enthalpies of vaporization of imidazolium, pyridinium and pyrrolidinium ILs was developed. The standard error of the regression for the developed scheme is significantly lower than that for the atom-based group-contribution schemes proposed earlier

Synthesis and Spectral Study of Novel Norfloxacin Derivatives

Directory of Open Access Journals (Sweden)

Pradeep Yadav

2008-01-01

Full Text Available Reaction of [1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(1-piperazinyl-quinolone-3-carboxylic acid (norfloxacin with thiazole / benzothiazole diazonium chloride to get new piperazine substituted norfloxacin derivative. These norfloxacin derivatives were further condensed with various β-diketone to get novel acid derivatives of 1-Ethyl-6-fluoro-4-oxo-7- [4 (thiazol-2-yldiazenyl-piperzin-1-yl]-1,4-dihydro-quinoline-3-carboxylic acid (6a-e and 7-(4-(benzo[d]thiazol-2-yldiazenylpiperazin-1-yl-1-ethyl-6-fluoro-4-oxo-1, 4-dihydroquinoline-3-carboxylic acid (6 f-j. Structures of these compounds were established on the basis of spectral studies viz. IR, 1H NMR etc.

Diagnostic radio labelled polysaccharide derivatives

International Nuclear Information System (INIS)

Milbrath, D.S.; Ferber, R.H.; Barnett, W.E.

1982-01-01

A radiopharmaceutical compound for diagnosing blood clots is claimed. It is the reaction product of a compound characterized by a water-soluble polysaccharide moiety having an average of at least 0.25 anionic group per monosaccharide unit, and at least one chelating group derived from the group consisting of amino acids, substituted cyclic acid anhydrides, and carbon disulfide; and a radioactive tracer metal compound selected from In-111, Tc-99m, Cr-51, Ga-68, and a reduced pertechnetate compound

Synthesis, crystal structure determination, biological screening and docking studies of N1-substituted derivatives of 2,3-dihydroquinazolin-4(1H)-one as inhibitors of cholinesterases.

Science.gov (United States)

Sultana, Nargis; Sarfraz, Muhammad; Tanoli, Saba Tahir; Akram, Muhammad Safwan; Sadiq, Abdul; Rashid, Umer; Tariq, Muhammad Ilyas

2017-06-01

Pursuing the strategy of developing potent AChE inhibitors, we attempted to carry out the N 1 -substitution of 2,3-dihydroquinazolin-4(1H)-one core. A set of 32 N-alkylated/benzylated quinazoline derivatives were synthesized, characterized and evaluated for their inhibition against cholinesterases. N-alkylation of the series of the compounds reported previously (N-unsubstituted) resulted in improved activity. All the compounds showed inhibition of both enzymes in the micromolar to submicromolar range. Structure activity relationship (SAR) of the 32 derivatives showed that N-benzylated compounds possess good activity than N-alkylated compounds. N-benzylated compounds 2ad and 2af were found very active with their IC 50 values toward AChE in submicromolar range (0.8µM and 0.6µM respectively). Binding modes of the synthesized compounds were explored by using GOLD (Genetic Optimization for Ligand Docking) suit v5.4.1. Computational predictions of ADMET studies reveal that all the compounds have good pharmacokinetic properties with no AMES toxicity and carcinogenicity. Moreover, all the compounds are predicted to be absorbed in human intestine and also have the ability to cross blood brain barrier. Overall, the synthesized compounds have established a structural foundation for the design of new inhibitors of cholinesterase. Copyright © 2017 Elsevier Inc. All rights reserved.

Substituted sodium phenylanthranylates as inhibitors of corrosion in chloride solutions

Energy Technology Data Exchange (ETDEWEB)

Kuznetsov, Yu.I.; Fialkov, Yu.A.; Popova, L.I.; Ehndel' man, E.S.; Kuznetsova, I.G. (AN SSSR, Moscow. Inst. Fizicheskoj Khimii)

The efficiency of corrosion protection of armco iron, zinc (Ts-O) aluminium (AB 000) and its alloys (.D16 and AMG6) with sodium phenylanthranylate derivatives in chloride buffer solutions (pH 7.4-8.08) are investigated. It has been ascertained that the introduction of sodium phenylanthranylate into phenyl radical in m- and p-position relative to the amino group of electron-seeking substitutes improves protective properties of an inhibitor. The inhibiting effect of phenylanthranylates and its dependence on electron structure enchances in zinc-aluminium-iron series and decreases in case of transition from pure aluminium to its alloys.

Substituted sodium phenylanthranylates as inhibitors of corrosion in chloride solutions

International Nuclear Information System (INIS)

Kuznetsov, Yu.I.; Fialkov, Yu.A.; Popova, L.I.; Ehndel'man, E.S.; Kuznetsova, I.G.

1982-01-01

The efficiency of corrosion protoction of armco iron, zinc (Ts-O) aluminium (AB 000) and its alloys (.D16 and AMG6) with sodium phenylanthranylate derivatives in clloride buffer solutions (pH 7.4-8.08) are investigated. It has been ascertained that the introduction of sodium phenylantiranylate into phenyl radical in m- and p-position relative to the amino group of electron-seeking substitutes improves protective properties of an inhibitor. The inhibiting effect of phenylanthranylates and its dependence on electron structure enchances in zinc-aluminium-iron series and decreases in case of transition from pure aluminium to its alloys

Structure activity relationships of quinoxalin-2-one derivatives as platelet-derived growth factor-beta receptor (PDGFbeta R) inhibitors, derived from molecular modeling.

Science.gov (United States)

Mori, Yoshikazu; Hirokawa, Takatsugu; Aoki, Katsuyuki; Satomi, Hisanori; Takeda, Shuichi; Aburada, Masaki; Miyamoto, Ken-ichi

2008-05-01

We previously reported a quinoxalin-2-one compound (Compound 1) that had inhibitory activity equivalent to existing platelet-derived growth factor-beta receptor (PDGFbeta R) inhibitors. Lead optimization of Compound 1 to increase its activity and selectivity, using structural information regarding PDGFbeta R-ligand interactions, is urgently needed. Here we present models of the PDGFbeta R kinase domain complexed with quinoxalin-2-one derivatives. The models were constructed using comparative modeling, molecular dynamics (MD) and ligand docking. In particular, conformations derived from MD, and ligand binding site information presented by alpha-spheres in the pre-docking processing, allowed us to identify optimal protein structures for docking of target ligands. By carrying out molecular modeling and MD of PDGFbeta R in its inactive state, we obtained two structural models having good Compound 1 binding potentials. In order to distinguish the optimal candidate, we evaluated the structural activity relationships (SAR) between the ligand-binding free energies and inhibitory activity values (IC50 values) for available quinoxalin-2-one derivatives. Consequently, a final model with a high SAR was identified. This model included a molecular interaction between the hydrophobic pocket behind the ATP binding site and the substitution region of the quinoxalin-2-one derivatives. These findings should prove useful in lead optimization of quinoxalin-2-one derivatives as PDGFb R inhibitors.

Synthesis and electroluminescent properties of blue fluorescent materials based on 9,9-diethyl-N,N-diphenyl-9 H-fluoren-2-amine substituted anthracene derivatives for organic light-emitting diodes

Energy Technology Data Exchange (ETDEWEB)

Lee, Seul Bee; Kim, Chanwoo; Park, Soo Na; Kim, Young Seok [Department of Chemistry, Sungkyunkwan University, Suwon, 440-746 (Korea, Republic of); Lee, Ho Won [Department of Information Display, Hongik University, Seoul, 121-791 (Korea, Republic of); Kim, Young Kwan, E-mail: kimyk@hongik.ac.kr [Department of Information Display, Hongik University, Seoul, 121-791 (Korea, Republic of); Yoon, Seung Soo, E-mail: ssyoon@skku.edu [Department of Chemistry, Sungkyunkwan University, Suwon, 440-746 (Korea, Republic of)

2015-11-30

Four 9,9-diethyl-N,N-diphenyl-9 H-fluoren-2-amine substituted anthracene derivatives have been designed and synthesized by Suzuki cross coupling reactions. To explore the electroluminescent properties of these blue materials, multilayer blue organic light-emitting diodes were fabricated in the following device structure: indium tin oxide (180 nm)/N,N’-diphenyl-N,N’-(1-napthyl)-(1,1′-phenyl)-4,4′-diamine (50 nm)/blue emitting materials (1–4) (30 nm)/bathophenanthroline (30 nm)/lithium quinolate (2 nm)/Al (100 nm). All devices appeared excellent deep-blue emissions. Among them, a device exhibited a maximum luminance of 5686 cd/m{sup 2}, the luminous, power and external quantum efficiencies of 5.11 cd/A, 3.79 lm/W, and 4.06% with the Commission International de L'Eclairage coordinates of (0.15, 0.15) at 500 cd/m{sup 2}, respectively. - Highlights: • We synthesized blue fluorescent materials based on anthracene derivatives. • The EL efficiencies of these materials depend on the quantum yields in solid states. • These materials have great potential for applications as blue emitter in OLEDs.

Synthesis and antimalarial evaluation of some 4-quinazolinone derivatives based on febrifugine

Directory of Open Access Journals (Sweden)

Debanjan Sen

2010-01-01

Full Text Available A series of 2-substituted and 2,3-substituted quinazolin -4(3H-one derivatives were designed and synthesized based on the structure of febrifugine. The structures of the new compounds were confirmed by spectral analysis. The in vivo biological activity test results indicated that those compounds exhibited antimalarial activities against Plasmodium berghei in mice, at a dose of 5 mg/kg. Compared to Chloroquine and Artemisinin, these compounds have the advantages of shorter synthetic routes and consequently are highly cost effective in nature.

Zinc and Carbonate Co-Substituted Nano-Hydroxyapatite

Science.gov (United States)

Girija, E. K.; Kumar, G. Suresh; Thamizhavel, A.

2011-07-01

Synthesis of Zn or CO32- substituted nano-hydroxyapatite (HA) and its physico-chemical properties have been well documented. However, the effects of the simultaneous substitution of Zn and CO32- in nano-HA have not been reported. In the present study, Zn and CO32- substitutions in nano HA independently and concurrently have been done by wet precipitation method and characterized by XRD and FT-IR for its phase purity and chemical homogeneity. Further modulations of the bioactivity and thermal stability of HA due to the substitutions have been studied.

One-group Perturbation Theory Applied to Substitution Measurements with Void

Energy Technology Data Exchange (ETDEWEB)

Persson, R

1962-06-15

Formulas suitable for evaluating substitution measurements or single-rod experiments by means of one-group perturbation theory are derived. The diffusion coefficient may depend on direction and position. By using the buckling concept the expressions derived are quite simple and the perturbed flux can be taken into account in a comparatively simple way. By using an unconventional definition of cells a transition region is introduced quite logically. Experiments with voids around metal rods, diam. 3.05 cm, have been analysed. The agreement between extrapolated and directly measured buckling values is excellent, the buckling difference between lattices with water-filled and voided shrouds being 0.263 {+-} 0.015/m{sup 2} and 0.274 {+-} 0.005 /m{sup 2} resp. The differences between diffusion coefficients are also determined, {delta}D{sub r}/D = 0.083 {+-} 0.004 and {delta}D{sub z}/D = 0.120 {+-} 0.018.

Emerging drugs of abuse: current perspectives on substituted cathinones

Directory of Open Access Journals (Sweden)

Paillet-Loilier M

2014-05-01

Full Text Available Magalie Paillet-Loilier,1 Alexandre Cesbron,1 Reynald Le Boisselier,2 Joanna Bourgine,1 Danièle Debruyne1,2 1Toxicology and Pharmacology Laboratory, 2Centre d'Evaluation et d'Information sur la Pharmacodépendance – Addictovigilance (CEIP-A, Department of Pharmacology, University Hospital Centre, Caen, France Abstract: Substituted cathinones are synthetic analogs of cathinone that can be considered as derivatives of phenethylamines with a beta-keto group on the side chain. They appeared in the recreational drug market in the mid-2000s and now represent a large class of new popular drugs of abuse. Initially considered as legal highs, their legal status is variable by country and is rapidly changing, with government institutions encouraging their control. Some cathinones (such as diethylpropion or pyrovalerone have been used in a medical setting and bupropion is actually indicated for smoking cessation. Substituted cathinones are widely available from internet websites, retail shops, and street dealers. They can be sold under chemical, evocative or generic names, making their identification difficult. Fortunately, analytical methods have been developed in recent years to solve this problem. Available as powders, substituted cathinones are self-administered by snorting, oral injestion, or intravenous injection. They act as central nervous system stimulants by causing the release of catecholamines (dopamine, noradrenaline, and serotonin and blocking their reuptake in the central and peripheral nervous system. They may also decrease dopamine and serotonin transporter function as nonselective substrates or potent blockers and may inhibit monoamine oxidase effects. Nevertheless, considerable differences have been found in the potencies of the different substituted cathinones in vitro. Desired effects reported by users include increased energy, empathy, and improved libido. Cardiovascular (tachycardia, hypertension and psychiatric

Syntheses of Novel 4-Substituted N-(5-amino-1H-1,2,4-triazol-3-ylpyridine-3-sulfonamide Derivatives with Potential Antifungal Activity

Directory of Open Access Journals (Sweden)

Krzysztof Szafrański

2017-11-01

Full Text Available Candidiasis represent a serious threat for patients with altered immune responses. Therefore, we have undertaken the synthesis of compounds comprising a pyridine-3-sulfonamide scaffold and known antifungally active 1,2,4-triazole substituents. Thus a series of novel 4-substituted N-(5-amino-1H-1,2,4-triazol-3-ylpyridine-3-sulfonamides have been synthesized by multistep reactions starting from 4-chloropyridine-3-sulfonamide via N′-cyano-N-[(4-substitutedpyridin-3-ylsulfonyl]carbamimidothioates which were further converted with hydrazine hydrate to the corresponding 1,2,4-triazole derivatives 26–36. The final compounds were evaluated for antifungal activity against strains of the genera Candida, Geotrichum, Rhodotorula, and Saccharomycess isolated from patients with mycosis. Many of them show greater efficacy than fluconazole, mostly towards Candida albicans and Rhodotorula mucilaginosa species, with MIC values ≤ 25 µg/mL. A docking study of the most active compounds 26, 34 and 35 was performed showing the potential mode of binding to Candida albicans lanosterol 14α-demethylase. Also in vitro cytotoxicity of selected compounds have been evaluated on the NCI-60 cell line panel.

Substituting missing data in compositional analysis

Energy Technology Data Exchange (ETDEWEB)

Real, Carlos, E-mail: carlos.real@usc.es [Area de Ecologia, Departamento de Biologia Celular y Ecologia, Escuela Politecnica Superior, Universidad de Santiago de Compostela, 27002 Lugo (Spain); Angel Fernandez, J.; Aboal, Jesus R.; Carballeira, Alejo [Area de Ecologia, Departamento de Biologia Celular y Ecologia, Facultad de Biologia, Universidad de Santiago de Compostela, 15782 Santiago de Compostela (Spain)

2011-10-15

Multivariate analysis of environmental data sets requires the absence of missing values or their substitution by small values. However, if the data is transformed logarithmically prior to the analysis, this solution cannot be applied because the logarithm of a small value might become an outlier. Several methods for substituting the missing values can be found in the literature although none of them guarantees that no distortion of the structure of the data set is produced. We propose a method for the assessment of these distortions which can be used for deciding whether to retain or not the samples or variables containing missing values and for the investigation of the performance of different substitution techniques. The method analyzes the structure of the distances among samples using Mantel tests. We present an application of the method to PCDD/F data measured in samples of terrestrial moss as part of a biomonitoring study. - Highlights: > Missing values in multivariate data sets must be substituted prior to analysis. > The substituted values can modify the structure of the data set. > We developed a method to estimate the magnitude of the alterations. > The method is simple and based on the Mantel test. > The method allowed the identification of problematic variables in a sample data set. - A method is presented for the assessment of the possible distortions in multivariate analysis caused by the substitution of missing values.

Determinants of generic drug substitution in Switzerland

Directory of Open Access Journals (Sweden)

Lufkin Thomas M

2011-01-01

Full Text Available Abstract Background Since generic drugs have the same therapeutic effect as the original formulation but at generally lower costs, their use should be more heavily promoted. However, a considerable number of barriers to their wider use have been observed in many countries. The present study examines the influence of patients, physicians and certain characteristics of the generics' market on generic substitution in Switzerland. Methods We used reimbursement claims' data submitted to a large health insurer by insured individuals living in one of Switzerland's three linguistic regions during 2003. All dispensed drugs studied here were substitutable. The outcome (use of a generic or not was modelled by logistic regression, adjusted for patients' characteristics (gender, age, treatment complexity, substitution groups and with several variables describing reimbursement incentives (deductible, co-payments and the generics' market (prices, packaging, co-branded original, number of available generics, etc.. Results The overall generics' substitution rate for 173,212 dispensed prescriptions was 31%, though this varied considerably across cantons. Poor health status (older patients, complex treatments was associated with lower generic use. Higher rates were associated with higher out-of-pocket costs, greater price differences between the original and the generic, and with the number of generics on the market, while reformulation and repackaging were associated with lower rates. The substitution rate was 13% lower among hospital physicians. The adoption of the prescribing practices of the canton with the highest substitution rate would increase substitution in other cantons to as much as 26%. Conclusions Patient health status explained a part of the reluctance to substitute an original formulation by a generic. Economic incentives were efficient, but with a moderate global effect. The huge interregional differences indicated that prescribing behaviours and

Photooxidative cleavage of 4(1H)-quinolinones to 2-acylaminobenzoic acids and derivatives

Energy Technology Data Exchange (ETDEWEB)

Staskun, B. (University of the Witwatersrand, Johannesburg (South Africa). Dept. of Chemistry); Foote, C.S. (California Univ., Los Angeles (USA). Dept. of Chemistry)

1984-12-01

4(1H)-Quinolinones undergo oxidative cleavage to afford the corresponding 2-acylaminobenzoic acids when subjected to dye-sensitized photooxygenation in methanol-aqueous sodium hydroxide solution. The derived 2-aminobenzoic acid was the predominant product in certain instances. The reaction, with singlet oxygen suggested as the active species, provides an alternative methodology for access to nuclear- substituted anthranilic acids and derivatives.

Substitution within the Danish printing industry

DEFF Research Database (Denmark)

Larsen, Henrik Fred; Bøg, Carsten

2009-01-01

are running a substitution project. A major part of the work has been mapping the presence of chemicals which are potential candidates for substitution (e.g. PBT, CMR, vPvB, EDS) within the Danish printing industry and this work was recently finished. The mapping comprises a combination of a literature study......The implementation of the EU REACH regulation will most probably promote substitution within sectors handling a lot of different chemicals like the printing industry. With the aim of being at the cutting edge of this development the Danish EPA together with the Danish printing industry and IPU...... total 15 substances) were found in the Danish printing industry. This paper presents the results of the mapping of chemical candidates and the first results on preparing for actual substitutions....

Technological substitution options for controlling greenhouse gas emissions

International Nuclear Information System (INIS)

Barbier, E.B.; Burgess, J.C.; Pearce, D.W.

1991-01-01

This chapter is concerned with technological options for greenhouse gas substitution. The authors interpret the term substitution to exclude energy conservation/efficiency measures, investments in afforestation (sinks), and greenhouse gas removal or abatement technologies. Their working definition of greenhouse gas substitution includes (1) replacement technologies, for example, substituting a greenhouse gas technology with a nongreenhouse gas technology; and (2) reduction technologies, for example, substituting a greenhouse gas technology with an alternative technology that reduces greenhouse gas emissions. Essentially, replacement technologies involve 100 percent reduction in CO 2 ; reduction technologies involve a partial reduction in CO 2 . Of the man-made sources of greenhouse gases, energy is the most important and is expected to contribute to at least half of the global warming effect in the near future. The majority of this impact is from fossil fuel combustion as a source of carbon dioxide (CO 2 ), although fossil fuels also contribute significantly to methane (CH 4 ), to nitrous oxide (N 2 O), and to low-level ozone (O 3 ) through production of various nitrogen gases (NO x ) and carbon monoxide (CO). This study analyzes the available greenhouse gas substitutions and their costs. The authors concentrate particularly on substitutions for fossil-fuel combustion and CFC production and consumption. They conclude by summarizing the potential for greenhouse gas substitution, the cost-effectiveness of the various options and the design of incentives for substitution

Acid catalyzed solvent free synthesis of new 1-acyl-4-benzhydryl substituted pyrazoles

International Nuclear Information System (INIS)

Sher, M.; Kausar, T.; Riaz, N.; Sharif, A.

2016-01-01

A convenient, cost effective and environmentally benign methodology has been developed, which delivered fourteen new 1-acyl-4-benzhyrdyl substituted pyrazole derivatives under solvent free conditions. Target compounds were synthesized in good to excellent yields simply by grinding reactants in a pestle and mortar with catalytic amount of conc. H/sub 2/SO/sub 4/. All the newly formed compounds were fully characterized with the help of detailed spectroscopic techniques including FTIR, NMR and GC-MS. (author)

Synthesis and evaluation of a series of 2-substituted-5-thiopropylpiperazine (piperidine-1,3,4-oxadiazoles derivatives as atypical antipsychotics.

Directory of Open Access Journals (Sweden)

Yin Chen

Full Text Available BACKGROUND: It is important to develop novel antipsychotics that can effectively treat schizophrenia with minor side-effects. The aim of our work is to develop novel antipsychotics that act on dopamine D(2 and D(3, serotonin 5-HT(1A and 5-HT(2A receptors with low affinity for the serotonin 5-HT(2C and H(1 receptors, which can effectively cure positive symptoms, negative symptoms and cognitive impairment without the weight gain side-effect. METHODOLOGY/PRINCIPAL FINDINGS: A series of 2-substituted-5-thiopropylpiperazine (piperidine -1,3,4-oxadiazoles derivatives have been synthesized and the target compounds were evaluated for binding affinities to D(2, 5-HT(1A and 5-HT(2A receptors. Preliminary results indicated that compounds 14, 16 and 22 exhibited high affinities to D(2, 5-HT(1A and 5-HT(2A receptors among these compounds. Further binding tests showed that compound 22 had high affinity for D(3 receptor, and low affinity for serotonin 5-HT(2C and H(1 receptors. In addition, compound 22 inhibited apomorphine-induced climbing behavior and MK-801-induced hyperactivity with no extrapyramidal symptoms liability in mice. Moreover, compound 22 exhibited acceptable pharmacokinetic properties. CONCLUSIONS/SIGNIFICANCE: Compound 22 showed an atypical antipsychotic activity without liability for extrapyramidal symptoms. We anticipate compound 22 to be useful for developing a novel class of drug for the treatment of schizophrenia.

Antimony substitution in SmFeAsO

Energy Technology Data Exchange (ETDEWEB)

Schmidt, Daniel; Braun, Hans F. [Universitaet Bayreuth (Germany)

2015-07-01

In the iron based compounds structural and magnetic phase transitions can be suppressed by applying external hydrostatic pressure and superconductivity emerges. Beside hydrostatic pressure, it is possible to apply chemical pressure by the substitution of atoms in the compounds with smaller ones. Such a substitution was successful for example in LaFeAs{sub 1-x}P{sub x}O, where the parent compound shows a structural and a spin-density-wave transition and the P doped samples become superconducting. We are interested in the opposite way and substitute the As by the bigger Sb. In literature, the substitution in the La-1111 compounds was possible up to a substitution level of 40 %. With Sm, instead of La, we used a smaller rare-earth metal. We present the results obtained on polycrystalline samples characterized by Xray powder diffraction and resistivity measurements.

Synthesis, antifungal activity, and QSAR studies of 1,6-dihydropyrimidine derivatives

Directory of Open Access Journals (Sweden)

Chirag Rami

2013-01-01

Full Text Available Introduction: A practical synthesis of pyrimidinone would be very helpful for chemists because pyrimidinone is found in many bioactive natural products and exhibits a wide range of biological properties. The biological significance of pyrimidine derivatives has led us to the synthesis of substituted pyrimidine. Materials and Methods: With the aim of developing potential antimicrobials, new series of 5-cyano-6-oxo-1,6-dihydro-pyrimidine derivatives namely 2-(5-cyano-6-oxo-4-substituted (aryl-1,6-dihydropyrimidin-2-ylthio-N-substituted (phenyl acetamide (C1-C41 were synthesized and characterized by Fourier transform infrared spectroscopy (FTIR, mass analysis, and proton nuclear magnetic resonance ( 1 H NMR. All the compounds were screened for their antifungal activity against Candida albicans (MTCC, 227. Results and Discussion: Quantitative structure activity relationship (QSAR studies of a series of 1,6-dihydro-pyrimidine were carried out to study various structural requirements for fungal inhibition. Various lipophilic, electronic, geometric, and spatial descriptors were correlated with antifungal activity using genetic function approximation. Developed models were found predictive as indicated by their square of predictive regression values (r 2pred and their internal and external cross-validation. Study reveals that CHI_3_C, Molecular_SurfaceArea, and Jurs_DPSA_1 contributed significantly to the activity along with some electronic, geometric, and quantum mechanical descriptors. Conclusion: A careful analysis of the antifungal activity data of synthesized compounds revealed that electron withdrawing substitution on N-phenyl acetamide ring of 1,6-dihydropyrimidine moiety possess good activity.

Development of a composite based on hydroxyapatite and magnesium and zinc‐containing sol–gel-derived bioactive glass for bone substitute applications

International Nuclear Information System (INIS)

Ashuri, Maziar; Moztarzadeh, Fathollah; Nezafati, Nader; Ansari Hamedani, Ali; Tahriri, Mohammadreza

2012-01-01

In the present study, a bioceramic-based composite was prepared by sintering compacts made up of mixtures of hydroxyapatite (HA) and sol–gel-derived bioactive glass (64SiO 2 -26CaO-5MgO-5ZnO) (based on mol%) powders. HA powder was mixed with different concentrations of the glass powders up to 30 wt.%. The effect of adding bioactive glass powder to HA matrix, on the mechanical properties of the composite was assessed by compression test. The specimen with the highest compressive strength was chosen to be immersed in simulated body fluid (SBF) to study apatite forming ability and dissolution behavior. It was found that compressive strength of the specimen was decreased 65% after maintaining in the SBF for 14 days. X-ray diffraction (XRD) showed prevalence of HA and β-TCP related peaks. Also, the surface morphology of the composite was observed using scanning electron microscopy (SEM). The study of degradation behavior revealed Si release capability of this composite. Biological evaluations in vitro confirmed the composite studied could induce osteoblast-like cells' activities. - Highlights: ► A novel composite based on HA/bioactive glass for bone substitutes was developed. ► Evaluations in vitro confirmed the composites induce bone-like cells' activities. ► A successful compromise of bioactivity and cytocompatibility was observed.

[Delegation yes, substitution no!].

Science.gov (United States)

Schroeder, A

2014-08-01

The aging of society leads on the one hand to increasing case numbers and on the other hand to a reduction in the number of physicians available for patient treatment. The delegation and substitution of medical duties as a tried and tested method is increasingly being recommended in order to compensate for the lack of physicians. The Berufsverband der Deutschen Urologen (BDU, Professional Association of German Urologists) supports the guiding principle of the Bundesärztekammer (Federal Medical Council) of "delegation yes, substitution no" and rejects a substitution of medical duties by non-medical academic health personnel. Against the background of the demographic changes, the increasing need for treatment and the current deficiency of junior physicians, a more extensive inclusion of well-qualified and experienced non-medical personnel by the delegation of medically responsible duties (medical scope of practice) can be an appropriate measure to maintain a good medical service in practices, hospitals and nursing homes.

Synthesis and antimalarial evaluation of novel isocryptolepine derivatives.

Science.gov (United States)

Whittell, Louise R; Batty, Kevin T; Wong, Rina P M; Bolitho, Erin M; Fox, Simon A; Davis, Timothy M E; Murray, Paul E

2011-12-15

A series of mono- and di-substituted analogues of isocryptolepine have been synthesized and evaluated for in vitro antimalarial activity against chloroquine sensitive (3D7) and resistant (W2mef) Plasmodium falciparum and for cytotoxicity (3T3 cells). Di-halogenated compounds were the most potent derivatives and 8-bromo-2-chloroisocryptolepine displayed the highest selectivity index (106; the ratio of cytotoxicity (IC(50)=9005 nM) to antimalarial activity (IC(50)=85 nM)). Our evaluation of novel isocryptolepine compounds has demonstrated that di-halogenated derivatives are promising antimalarial lead compounds. Copyright © 2011 Elsevier Ltd. All rights reserved.

Substituting missing data in compositional analysis

International Nuclear Information System (INIS)

Real, Carlos; Angel Fernandez, J.; Aboal, Jesus R.; Carballeira, Alejo

2011-01-01

Multivariate analysis of environmental data sets requires the absence of missing values or their substitution by small values. However, if the data is transformed logarithmically prior to the analysis, this solution cannot be applied because the logarithm of a small value might become an outlier. Several methods for substituting the missing values can be found in the literature although none of them guarantees that no distortion of the structure of the data set is produced. We propose a method for the assessment of these distortions which can be used for deciding whether to retain or not the samples or variables containing missing values and for the investigation of the performance of different substitution techniques. The method analyzes the structure of the distances among samples using Mantel tests. We present an application of the method to PCDD/F data measured in samples of terrestrial moss as part of a biomonitoring study. - Highlights: → Missing values in multivariate data sets must be substituted prior to analysis. → The substituted values can modify the structure of the data set. → We developed a method to estimate the magnitude of the alterations. → The method is simple and based on the Mantel test. → The method allowed the identification of problematic variables in a sample data set. - A method is presented for the assessment of the possible distortions in multivariate analysis caused by the substitution of missing values.

Syntheses and characterization of novel oxoisoaporphine derivatives as dual inhibitors for cholinesterases and amyloid beta aggregation.

Science.gov (United States)

Li, Yan-Ping; Ning, Fang-Xian; Yang, Meng-Bi; Li, Yong-Cheng; Nie, Min-Hua; Ou, Tian-Miao; Tan, Jia-Heng; Huang, Shi-Liang; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu

2011-05-01

A series of 3-substituted (5c-5f, 6c-6f) and 4-substituted (10a-10g) oxoisoaporphine derivatives were synthesized. It was found that all these synthetic compounds had IC50 values at micro or nano molar range for cholinesterase inhibition, and most of them could inhibit amyloid β (Aβ) self-induced aggregation with inhibition ratio from 31.8% to 57.6%. The structure-activity relationship studies revealed that the derivatives with higher selectivity on AChE also showed better inhibition on Aβ self-induced aggregation. The results from cell toxicity study indicated that most quaternary methiodide salts had higher IC50 values than the corresponding non-quaternary compounds. This study provided potentially important information for further development of oxoisoaporphine derivatives as lead compounds for the treatment of Alzheimer's disease. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Chiral 2-Aminobenzimidazole as Bifunctional Catalyst in the Asymmetric Electrophilic Amination of Unprotected 3-Substituted Oxindoles

Directory of Open Access Journals (Sweden)

Llorenç Benavent

2018-06-01

Full Text Available The use of readily available chiral trans-cyclohexanediamine-benzimidazole derivatives as bifunctional organocatalysts in the asymmetric electrophilic amination of unprotected 3-substituted oxindoles is presented. Different organocatalysts were evaluated; the most successful one contained a dimethylamino moiety (5. With this catalyst under optimized conditions, different oxindoles containing a wide variety of substituents at the 3-position were aminated in good yields and with good to excellent enantioselectivities using di-tert-butylazodicarboxylate as the aminating agent. The procedure proved to be also efficient for the amination of 3-substituted benzofuranones, although with moderate results. A bifunctional role of the catalyst, acting as Brønsted base and hydrogen bond donor, is proposed according to the experimental results observed.

Development of a diesel substitute fuel

Energy Technology Data Exchange (ETDEWEB)

Reiter, Anton; Mair-Zelenka, Philipp [Graz Univ. of Technology (Austria). Inst. of Chemical Engineering and Environmental Technology; Zeymer, Marc [OMV Refining and Marketing GmbH, Vienna (Austria). MRDI-D Product Development and Innovation

2013-06-01

Substitute fuels composed of few real chemical compounds are an alternative characterisation approach for conventional fuels as opposed to the traditional pseudo-component method. With the algorithm proposed in this paper the generation of such substitutes will be facilitated and well-established thermodynamic methods can be applied for physical property-data prediction. Based on some quality criteria like true boiling-point curve, liquid density, C/H ratio, or cloud point of a target fuel a surrogate which meets these properties is determined by fitting its composition. The application and capabilities of the algorithm developed are demonstrated by means of an exemplary diesel substitute fuel. The substitute mixture obtained can be generated and used for evaluation of property-prediction methods. Furthermore this approach can help to understand the effects of mixing fossil fuels with biogenic compounds. (orig.)

Structure-function relationship of substituted bromomethylcoumarins in nucleoside specificity of RNA alkylation.

Science.gov (United States)

Kellner, Stefanie; Kollar, Laura Bettina; Ochel, Antonia; Ghate, Manjunath; Helm, Mark

2013-01-01

Selective alkylation of RNA nucleotides is an important field of RNA biochemistry, e.g. in applications of fluorescent labeling or in structural probing experiments, yet detailed structure-function studies of labeling agents are rare. Here, bromomethylcoumarins as reactive compounds for fluorescent labeling of RNA are developed as an attractive scaffold on which electronic properties can be modulated by varying the substituents. Six different 4-bromomethyl-coumarins of various substitution patterns were tested for nucleotide specificity of RNA alkylation using tRNA from Escherichia coli as substrate. Using semi-quantitative LC-MS/MS analysis, reactions at mildly acidic and slightly alkaline pH were compared. For all tested compounds, coumarin conjugates with 4-thiouridine, pseudouridine, guanosine, and uridine were identified, with the latter largely dominating. This data set shows that selectivity of ribonucleotide alkylation depends on the substitution pattern of the reactive dye, and even more strongly on the modulation of the reaction conditions. The latter should be therefore carefully optimized when striving to achieve selectivity. Interestingly, the highest selectivity for labeling of a modified nucleoside, namely of 4-thiouridine, was achieved with a compound whose selectivity was somewhat less dependent on reaction conditions than the other compounds. In summary, bromomethylcoumarin derivatives are a highly interesting class of compounds, since their selectivity for 4-thiouridine can be efficiently tuned by variation of substitution pattern and reaction conditions.

Femtosecond transient photoluminescence of the substituted poly(diphenylacetulene)s.

Science.gov (United States)

Piskun, N. V.; Wang, D. K.; Lim, H.; Epstein, A. J.; Vanwoerkom, L. D.; Gustafson, T. L.

2000-03-01

We present the results of a femtosecond transient photoluminescence (PL) study of solutions of two derivatives of substituted poly(diphenylacetylene) using an up-conversion technique. n-Butyl (nBu) and p-carbazole (Cz) substituted poly(diphenylacetylene), PDPA-nBu and PDPA-Cz respectively, have band gaps determined by maxima in the slope of absorption vs. energy of 2.75 eV and 2.63 eV. The steady state emission peaks are at 2.4 eV for PDPA-nBu and at 2.3 eV for PDPA-Cz respectively. The PL peak for PDPA-Cz is red shifted in comparison to the PL peak for PDPA-nBu. Roles of phenyl groups, electron donating effect of the carbazole side units and planarity of the backbone are discussed. Exciting at 3.1 eV, the fs PL shows a faster decay for PDPA-Cz than that for PDPA-nBu, in accord with the decrease of PL quantum efficiency of PDPA-Cz. The 200 fs - 80 ps PL(t) agrees with ~1 ns lifetime. The PDPA-Cz has larger red shift in the 0.2-20 ps time frame. The origin of that shift will be discussed. This work is supported in part by ONR.

Antitumour activity of N 6 -substituted PMEDAP derivatives against T-cell lymphoma

Czech Academy of Sciences Publication Activity Database

Valeriánová, M.; Votruba, Ivan; Holý, Antonín; Mandys, Václav; Otová, B.

2001-01-01

Roč. 21, - (2001), s. 2057-2064 ISSN 0250-7005 R&D Projects: GA ČR GV203/96/K128; GA MZd NL5423 Institutional research plan: CEZ:AV0Z4055905 Keywords : PMEDAP derivatives Subject RIV: CC - Organic Chemistry Impact factor: 1.416, year: 2001

Highly enantio- and diastereoselective reactions of γ-substituted butenolides through direct vinylogous conjugate additions

KAUST Repository

Zhang, Wen; Tan, Davin; Lee, Richmond; Tong, Guanghu; Chen, Wenchao; Qi, Baojian; Huang, Kuo-Wei; Tan, Choonhong; Jiang, Zhiyong

2012-01-01

The strength of the weak: An L-tert-leucine-derived amine-thiourea catalyst (see scheme, green box) promotes the asymmetric vinylogous conjugate addition reaction between γ-aryl- and alkyl-substituted butenolides with the butenamides and enoates shown. Computational studies show the preference for the observed stereochemistry is a result of favourable weak non-bonding interactions, which stabilize the transition state. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Highly enantio- and diastereoselective reactions of γ-substituted butenolides through direct vinylogous conjugate additions

KAUST Repository

Zhang, Wen

2012-09-05

The strength of the weak: An L-tert-leucine-derived amine-thiourea catalyst (see scheme, green box) promotes the asymmetric vinylogous conjugate addition reaction between γ-aryl- and alkyl-substituted butenolides with the butenamides and enoates shown. Computational studies show the preference for the observed stereochemistry is a result of favourable weak non-bonding interactions, which stabilize the transition state. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tonemic Substitution

African Journals Online (AJOL)

Ezenwafor

grammatical constructions. The choice of substitutable tonemes as observed from the analyzed data is highly. Ezenwafordependent on the intuitive judgement of the native speaker. This work shows with adequate data, that regular tonemic changes are not always meaningful in Ekwulobia lect. Such tonemic alternations are ...

Tuning the NLO properties of polymethineimine chains by chemical substitution

International Nuclear Information System (INIS)

Medved’, Miroslav; Jacquemin, Denis

2013-01-01

Highlights: ► Properties of the most stable isomers of polymethineimine (PMI) are investigated. ► 2nd order NLO properties of experimentally known PMI derivatives are determined. ► Structure-property relationships are unraveled for several series of oligomers. ► Performance of long-range corrected DFT methods is assessed. - Abstract: Structure and molecular electronic properties including dipole moment, polarizability and first hyperpolarizability of polymethineimine (PMI) oligomers (up to hexadecamers) and its experimentally known amino-, methyl-, and cyano-derivatives are investigated using several ab initio methods (HF, MP2 and DFT). It is shown that side-chain substitutions have significant effects both on the structure and molecular properties of PMI chains. Depending on the substitution, two types of structures have been identified. The first is characterized by a bent skeleton and encompasses PMI, polyacetonitrile (PAcN), and polycyanonitrile (PCN). The second, represented by polyaminonitrile (PAN), remains quasi-linear with the plane of the unit cell (UC) only slightly rotating around the longitudinal molecular axis. These structural differences are also reflected in molecular properties; while in case of PMI, PAcN, and PCN the longitudinal component of properties (reduced per UC) reaches its maximum value for medium-size oligomers and then decreases for longer chains, the linear and nonlinear properties of PAN steadily increase towards the polymeric limit. In addition, we have assessed the performances of long-range corrected DFT functionals (LR-DFT), namely LC-BLYP, CAM-B3LYP, and ωB97X within the present framework: they provide results in qualitative agreement with MP2, a success not reached with B3LYP

Synthesis, antimicrobial, and antiproliferative activities of substituted phenylfuranylnicotinamidines

Directory of Open Access Journals (Sweden)

Youssef MM

2016-03-01

Full Text Available Magdy M Youssef,1,2 Reem K Arafa,3,4 Mohamed A Ismail1,21Department of Chemistry, College of Science, King Faisal University, Hofuf, Saudi Arabia; 2Department of Chemistry, Faculty of Science, Mansoura University, Mansoura, 3Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University, Cairo, 4Biomedical Sciences Program, University of Science and Technology, Zewail City of Science and Technology, Cairo, EgyptAbstract: This research work deals with the design and synthesis of a series of substituted phenylfuranylnicotinamidines 4a–i. Facile preparation of the target compounds was achieved by Suzuki coupling-based synthesis of the nitrile precursors 3a–i, followed by their conversion to the corresponding nicotinamidines 4a–i utilizing LiN(TMS2. The antimicrobial activities of the newly synthesized nicotinamidine derivatives were evaluated against the Gram-negative bacterial strains Escherichia coli and Pseudomonas aeruginosa as well as the Gram-positive bacterial strains Staphylococcus aureus and Bacillus megaterium. The minimum inhibitory concentration values of nicotinamidines against all tested microorganisms were in the range of 10–20 µM. In specific, compounds 4a and 4b showed excellent minimum inhibitory concentration values of 10 µM against Staphylococcus aureus bacterial strain and were similar to ampicillin as an antibacterial reference. On the other hand, selected nicotinamidine derivatives were biologically screened for their cytotoxic activities against a panel of 60 cell lines representing nine types of human cancer at a single high dose at National Cancer Institute, Bethesda, MD, USA. Nicotinamidines showing promising activities were further assessed in a five-dose screening assay to determine their compound concentration causing 50% growth inhibition of tested cell (GI50, compound concentration causing 100% growth inhibition of tested cell (TGI, and compound concentration causing 50% lethality of tested

40 CFR Appendix B to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes

Science.gov (United States)

2010-07-01

... demonstrate it can be used safely in this end-use. CFC-12 Motor Vehicle Air Conditioners (Retrofit and New... Conditions Application Substitute Decision Conditions Comments CFC-12 Automobile Motor Vehicle Air... refrigerant. CFC-12 Automobile Motor Vehicle Air Conditioning (New equipment only) R-152a as a substitute for...

Income smoothing and use of derivatives instruments in non-financial companies listed on BM&FBovespa

Directory of Open Access Journals (Sweden)

Henrique Portulhak

2014-09-01

Full Text Available This paper aims to investigate whether income smoothing and use of derivative financial instruments are related as substitute or complementary practices regarding organizational policies to reduce the volatility of corporate earnings. In order to reach this goal, 214 non-financial companies listed on BM&FBOVESPA stock exchange between 2005 and 2011were analyzed and Eckel (1981 model was applied in order to gather which companies present income smoothing evidences during this period, besides qualitative analysis on explanatory notes to investigate which companies used derivatives in the final year. Chi-square test with Yates correction was employed in order to verify the existence of correlations between income smoothing and derivative instruments. Results indicated, considering the impossibility of rejecting the null hypothesis of the chi-square test with Yates correction, evidence for an inverse relationship between the aforementioned variables. Through the results of this test, it is suggested that organizational policies for use of income smoothing and derivatives can be acting as resource substitutes for non-financial enterprises stock dealers on BM&FBOVESPA, thus meeting individual findings in other international researches.

Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

Science.gov (United States)

Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

2012-04-01

For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

Substitution reactions of technetium complexes

International Nuclear Information System (INIS)

Omori, T.

1997-01-01

Substitution reactions of a series of technetium complexes are considered in comparison with corresponding reactions of rhenium. Rhenium and technetium complexes are rather inert in substitution reactions, the latter are characterized by greater rate constants when they proceed according to dissociative mechanism. In rare cases when k Tc /k Re id little it is assumed that the reaction proceeds according to the associative mechanism. (author)

Synthesis of carbasugars from aldonolactones, part III - A study on the allylic substitution of (1R,5R,8R)- and (1R,5R,8S)-8-hydroxy-2-oxabicyclo[3.3.0]oct-6-en-3-one derivatives - Preparation of (1S,2R,3R)-9-[2-hydroxy-3-(2-hydroxyethyl)cyclopent-4-en-1-yl]-9H-adenine

DEFF Research Database (Denmark)

Johansen, Steen Karsk; Lundt, Inge

2001-01-01

The palladium-catalyzed substitution of acylated (1R,5R,8R)- and (1R,SR,8S)-8-hydroxy-2-oxabicyclo[3.3.0] ones has been studied using a number of C- and N-nucleophiles, In all cases, the exo derivatives (8R) were found to be more reactive than the corresponding endo derivatives (8S). The reaction...... with these nucleophiles. Additionally, Mitsunobu substitution of (1R,5R,8R)-8-hydroxy-2-oxabicyclo[3.3.0]oct-B-en-3-one (3) with 6-chloropurine, followed by reduction of the lactone moiety and treatment with Liquid ammonia, gave the carbocyclic nucleoside (1S,2R,3R)-9-[2-hydroxy-3-(2-hydroxyethyl)cyclopent-4-en-1-yl]-9H...

Porcine cholecyst–derived scaffold promotes full-thickness wound healing in rabbit

Directory of Open Access Journals (Sweden)

Deepa Revi

2013-12-01

Full Text Available Graft-assisted healing is an important strategy for treating full-thickness skin wounds. This study evaluated the properties of porcine cholecyst–derived scaffold and its use for treating full-thickness skin wound in rabbit. The physical properties of cholecyst-derived scaffold were congenial for skin-graft application. Compared to a commercially available skin-graft substitute made of porcine small intestinal submucosa, the cholecyst-derived scaffold was rich in natural biomolecules like elastin and glycosaminoglycans. When used as a xenograft, it promoted healing with excess cell proliferation at early phases and acceptable collagen deposition in the later remodelling phases.

Maximum parsimony, substitution model, and probability phylogenetic trees.

Science.gov (United States)

Weng, J F; Thomas, D A; Mareels, I

2011-01-01

The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.

Microstructure and Electrical Properties of Fe,Cu Substituted (Co,Mn)3O4 Thin Films

DEFF Research Database (Denmark)

Szymczewska, Dagmara; Molin, Sebastian; Hendriksen, Peter Vang

2017-01-01

In this work, thin films (~1000 nm) of a pure MnCo2O4 spinel together with its partially substituted derivatives (MnCo1.6Cu0.2Fe0.2O4, MnCo1.6Cu0.4O4, MnCo1.6Fe0.4O4) were prepared by spray pyrolysis and were evaluated for electrical conductivity. Doping by Cu increases the electrical conductivit...

Type Substitution for Object-Oriented Programming

DEFF Research Database (Denmark)

Schwartzbach, Michael Ignatieff; Palsberg, Jens

1990-01-01

Genericity allows the substitution of types in a class. This is usually obtained through parameterized classes, although they are inflexible since any class can be inherited but is not in itself parameterized. We suggest a new genericity mechanism, type substitution, which is a subclassing concep...

Synthesis of modified pyridine and bipyridine substituted coumarins as potent antimicrobial agents

Directory of Open Access Journals (Sweden)

Lad Hemali B.

2015-01-01

Full Text Available In search for new antimicrobial agents a series of new modified pyridine and bipyridine substituted coumarins 5a-y was designed and synthesized by adopting molecular hybridization strategy. All the synthesized compounds were evaluated for their in vitro antimicrobial activity using broth dilution method against selected bacterial (Gram-positive and Gram-negative and fungal strains. Compounds 5a, 5f, 5g, 5n, 5r, 5t, 5w, 5x and 5y demonstrated promising antibacterial activity while other derivatives showed comparable activity to standard drugs used as reference.

Synthesis and Antibacterial Evaluation of Novel 3-Substituted Ocotillol-Type Derivatives as Leads

Directory of Open Access Journals (Sweden)

Yi Bi

2017-04-01

Full Text Available Due to the rapidly growing bacterial antibiotic-resistance and the scarcity of novel agents in development, bacterial infection is still a global problem. Therefore, new types of antibacterial agents, which are effective both alone and in combination with traditional antibiotics, are urgently needed. In this paper, a series of antibacterial ocotillol-type C-24 epimers modified from natural 20(S-protopanaxadiol were synthesized and evaluated for their antibacterial activity. According to the screening results of Gram-positive bacteria (B. subtilis 168 and MRSA USA300 and Gram-negative bacteria (P. aer PAO1 and A. baum ATCC19606 in vitro, the derivatives exhibited good antibacterial activity, particularly against Gram-positive bacteria with an minimum inhibitory concentrations (MIC value of 2–16 µg/mL. The subsequent synergistic antibacterial assay showed that derivatives 5c and 6c enhanced the susceptibility of B. subtilis 168 and MRSA USA300 to chloramphenicol (CHL and kanamycin (KAN (FICI < 0.5. Our data showed that ocotillol-type derivatives with long-chain amino acid substituents at C-3 were good leads against antibiotic-resistant pathogens MRSA USA300, which could improve the ability of KAN and CHL to exhibit antibacterial activity at much lower concentrations with reduced toxicity.

40 CFR 721.5350 - Substituted nitrile (generic name).

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted nitrile (generic name... Substances § 721.5350 Substituted nitrile (generic name). (a) Chemical substances and significant new uses subject to reporting. (1) The chemical substance identified generically as a substituted nitrile (PMN P-83...

Synthesis and Biological Activity of 2,5-Bisubstituted Derivatives of 1,3,4-Thiadiazol-2,5-dithiol

Directory of Open Access Journals (Sweden)

T. S. Zhivotova

2013-01-01

Full Text Available By reaction of 1,3,4-thiadiazol-2,5-dithiol with different organohalogens, chlorides of carboxylic acids, acrylic acid derivatives, alkaloids, and secondary amines, various derivatives of 2,5-bi-substituted 1,3,4-thiadiazole were synthesized, and biological properties of some of them were studied.

Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

Science.gov (United States)

Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

2013-02-01

Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

Immunomodulatory and Anti-Inflammatory Activities of Chicken Cathelicidin-2 Derived Peptides

Science.gov (United States)

van Dijk, Albert; van Eldik, Mandy; Veldhuizen, Edwin J. A.; Tjeerdsma-van Bokhoven, Hanne L. M.; de Zoete, Marcel R.; Bikker, Floris J.; Haagsman, Henk P.

2016-01-01

Host Defence Peptides and derived peptides are promising classes of antimicrobial and immunomodulatory lead compounds. For this purpose we examined whether chicken cathelicidin-2 (CATH-2)-derived peptides modulate the function and inflammatory response of avian immune cells. Using a chicken macrophage cell line (HD11) we found that full-length CATH-2 dose-dependently induced transcription of chemokines CXCLi2/IL-8, MCP-3 and CCLi4/RANTES, but not of pro-inflammatory cytokine IL-1β. In addition, CATH-2 efficiently inhibited IL-1β and nitric oxide production by HD11 cells induced by different sources of lipopolysaccharides (LPS). N-terminal truncated CATH-2 derived peptides maintained the capacity to selectively induce chemokine transcription, but despite their high LPS affinity several analogs lacked LPS-neutralizing capacity. Substitution of phenylalanine residues by tryptophan introduced endotoxin neutralization capacity in inactive truncated CATH-2 derived peptides. In contrast, amino acid substitution of phenylalanine by tyrosine abrogated endotoxin neutralization activity of CATH-2 analogs. These findings support a pivotal role for aromatic residues in peptide-mediated endotoxin neutralization by CATH-2 analogs and were shown to be independent of LPS affinity. The capacity to modulate chemokine production and dampen endotoxin-induced pro-inflammatory responses in chicken immune cells implicates that small CATH-2 based peptides could serve as leads for the design of CATH-2 based immunomodulatory anti-infectives. PMID:26848845

Immunomodulatory and Anti-Inflammatory Activities of Chicken Cathelicidin-2 Derived Peptides.

Directory of Open Access Journals (Sweden)

Albert van Dijk

Full Text Available Host Defence Peptides and derived peptides are promising classes of antimicrobial and immunomodulatory lead compounds. For this purpose we examined whether chicken cathelicidin-2 (CATH-2-derived peptides modulate the function and inflammatory response of avian immune cells. Using a chicken macrophage cell line (HD11 we found that full-length CATH-2 dose-dependently induced transcription of chemokines CXCLi2/IL-8, MCP-3 and CCLi4/RANTES, but not of pro-inflammatory cytokine IL-1β. In addition, CATH-2 efficiently inhibited IL-1β and nitric oxide production by HD11 cells induced by different sources of lipopolysaccharides (LPS. N-terminal truncated CATH-2 derived peptides maintained the capacity to selectively induce chemokine transcription, but despite their high LPS affinity several analogs lacked LPS-neutralizing capacity. Substitution of phenylalanine residues by tryptophan introduced endotoxin neutralization capacity in inactive truncated CATH-2 derived peptides. In contrast, amino acid substitution of phenylalanine by tyrosine abrogated endotoxin neutralization activity of CATH-2 analogs. These findings support a pivotal role for aromatic residues in peptide-mediated endotoxin neutralization by CATH-2 analogs and were shown to be independent of LPS affinity. The capacity to modulate chemokine production and dampen endotoxin-induced pro-inflammatory responses in chicken immune cells implicates that small CATH-2 based peptides could serve as leads for the design of CATH-2 based immunomodulatory anti-infectives.

Sodium-carbonate co-substituted hydroxyapatite ceramics

Directory of Open Access Journals (Sweden)

Zoltan Z. Zyman

2013-12-01

Full Text Available Powders of sodium-carbonate co-substituted hydroxyapatite, having sodium content in the range of 0.25–1.5 wt.% with a 0.25 wt.% step, were prepared by a precipitation-solid state reaction route. Compacts of the powders were sintered in a CO2 flow (4 mL/min at 1100 °C for 2 h. The sintered ceramics contained sodium and carbonate ions in the ranges of 0–1.5 wt.% and 1.3–6 wt.%, respectively, which are typical impurity concentrations in biological apatite. A relationship between sodium and carbonate contents and the type of carbonate substitution was found. The total carbonate content progressively increased with the sodium content. The obtained ceramics showed an AB-type carbonate substitution. However, the substitution became more B-type as the sodium content increased. As a result, the carbonation was almost B-type (94 % for the highest sodium content (1.5 wt.%.

A triphenylamine substituted quinacridone derivative for solution processed organic light emitting diodes

NARCIS (Netherlands)

Pilz da Cunha, M.; Do, T.T.; Yambem, S.D.; Pham, H.D.; Chang, S.; Manzhos, S.; Katoh, R.; Sonar, P.

2018-01-01

We report on a novel quinacridone derivative design, namely, 2,9-bis(4-(bis(4-methoxyphenyl)amino)phenyl)-5,12-bis(2-ethylhexyl)-5,12-dihydroquinolino[2,3-b]acridine-7,14-dione (TPA-QA-TPA) for possible use as a solution processable emissive layer in organic light emitting diodes (OLEDs). TPA-QA-TPA

Inter-deriving Semantic Artifacts for Object-Oriented Programming

DEFF Research Database (Denmark)

Danvy, Olivier; Johannsen, Jacob

2008-01-01

.e., big-step operational semantics) specified in Abadi and Cardelli's monograph. This abstract machine therefore embodies the soundness of Abadi and Cardelli's reduction semantics and natural semantics relative to each other. To move closer to actual implementations, which use environments rather than......We present a new abstract machine for Abadi and Cardelli's untyped calculus of objects. What is special about this semantic artifact (i.e., man-made construct) is that is mechanically corresponds to both the reduction semantics (i.e., small-step operational semantics) and the natural semantics (i...... actual substitutions, we then represent object methods as closures and in the same inter-derivational spirit, we present three new semantic artifacts: a reduction semantics for a version of Abadi and Cardelli's untyped calculus of objects with explicit substitutions, an environment-based abstract machine...

Singlet Fission and Excimer Formation in Disordered Solids of Alkyl-Substituted 1,3-Diphenylisobenzofurans.

Science.gov (United States)

Dron, Paul I; Michl, Josef; Johnson, Justin C

2017-11-16

We describe the preparation and excited state dynamics of three alkyl derivatives of 1,3-diphenylisobenzofuran (1) in both solutions and thin films. The substitutions are intended to disrupt the slip-stacked packing observed in crystals of 1 while maintaining the favorable energies of singlet and triplet for singlet fission (SF). All substitutions result in films that are largely amorphous as judged by the absence of strong X-ray diffraction peaks. The films of 1 carrying a methyl in the para position of one phenyl ring undergo SF relatively efficiently (≥75% triplet yield, Φ T ) but more slowly than thin films of 1. When the methyl is replaced with a t-butyl, kinetic competition in the excited state favors excimer formation rather than SF (Φ T = 55%). When t-Bu groups are placed in both meta positions of the phenyl substituent, SF is slowed further and Φ T = 35%.

Educators Take Another Look at Substitutes

Science.gov (United States)

Zubrzycki, Jaclyn

2012-01-01

The mythology surrounding the substitute teacher is not a pretty one: Paper airplanes, lost learning, bullying. But as schools collect more information about teacher absenteeism and its consequences, districts and schools are exploring ways to professionalize substitute teaching--or experiment with alternative ways of coping with teacher absences.…

13C NMR and stereochestry of 1-β-phenylethylcyclohexanol derivatives obtained by synthesis

International Nuclear Information System (INIS)

Antunes, O.A.C.; Braz Filho, R.

1986-01-01

1-β-Phenylethylcyclohexanol derivatives substituted in position 2 have been synthesized and analysed by 13 C-NMR spectroscopy. Their stereochemistry have been considered as cis (hydroxyl in C-1 and substituent in C-2) which is in agreement with the pertinent literature. Derivatives obtained were 2-β-phenylethyl-2-allycyclohexanol, 1-β-phenylethyl-2-methylcyclohexanol, 7a-β-phenylethylperhy-drobenzo (b) furan, and 1-β-phenylethyl-2-β-hydroxyethylcyclohexanol. (author) [pt

Chemically Modified Starch; Allyl- and Epoxy-Starch Derivatives: Their Synthesis and Characterization

NARCIS (Netherlands)

Franssen, M.C.R.; Boeriu, C.

2014-01-01

Both native and modified starches, such as starch that is pregelatinized, extruded, acid-converted, cross-linked, and substituted, are widely used in industry. This chapter describes a mild two-step process for the synthesis of novel, highly reactive granular epoxy-starch derivatives. Via this

Synthesis and anti-depressant evaluation of novel pyrazolone derivatives

Directory of Open Access Journals (Sweden)

Vijay Kumar Merugumolu

2016-06-01

Full Text Available Diazotization of substituted anilines with NaNO2 and concentrated hydrochloric acid at 0ºC gave the diazonium chlorides. Coupling of substituted aryl diazonium chlorides with ethyl acetoacetate in methanol gave ethyl-2-aryl-hydrazono-3-oxobutyrates (2a-h. Reaction of (2a-h with naphthoic carbohydrazide (3 gave the title compounds pyrazolone derivatives (4a-h. The newly synthesized compounds were screened for their in vivo anti-depressant activity by tail suspension test and forced swimming test. Some of the tested compounds 4f, 4g showed very good activity when compared to the standard drug imipramine. The newly synthesized compounds were characterized by physical parameters and the structures were elucidated by spectral data.

Sensory Substitution and Multimodal Mental Imagery.

Science.gov (United States)

Nanay, Bence

2017-09-01

Many philosophers use findings about sensory substitution devices in the grand debate about how we should individuate the senses. The big question is this: Is "vision" assisted by (tactile) sensory substitution really vision? Or is it tactile perception? Or some sui generis novel form of perception? My claim is that sensory substitution assisted "vision" is neither vision nor tactile perception, because it is not perception at all. It is mental imagery: visual mental imagery triggered by tactile sensory stimulation. But it is a special form of mental imagery that is triggered by corresponding sensory stimulation in a different sense modality, which I call "multimodal mental imagery."

Stores, Prices, and Currency Substitution

OpenAIRE

Gabriele, Camera; Winkler, Johannes

1999-01-01

We study endogenous currency substitution in a decentralized trade environment. Sellers maximize profits from sales of imperfectly substitutable goods by posting prices in either one of two currencies. A unique symmetric equilibrium exists where goods are priced only in the local currency. This occurs if foreign trade is sporadic, there is sufficient but not excessive liquidity, and discounting is low. Excess or scarcity of liquidity, however, induces sellers to extract all surplus from bu...

Commercial formalin substitutes for histopathology

DEFF Research Database (Denmark)

Prentø, P; Lyon, H

1997-01-01

We compared the performance of six commercial fixatives proposed to be formalin substitutes with the performance of buffered formalin, Clarke's ethanol-acetic acid, and ethanol, using rat liver, small intestine, and kidney. We investigated the rate of penetration, mode of fixation, extent of prot...... was obtained by combining formalin fixation with antigen retrieval. We conclude that none of the proposed commercial substitutes for buffered formalin are adequate for critical histology or histopathology....

Efficient Synthesis of Differentiated syn-1,2-Diol Derivatives by Asymmetric Transfer Hydrogenation-Dynamic Kinetic Resolution of α-Alkoxy-Substituted β-Ketoesters.

Science.gov (United States)

Monnereau, Laure; Cartigny, Damien; Scalone, Michelangelo; Ayad, Tahar; Ratovelomanana-Vidal, Virginie

2015-08-10

Asymmetric transfer hydrogenation was applied to a wide range of racemic aryl α-alkoxy-β-ketoesters in the presence of well-defined, commercially available, chiral catalyst Ru(II) -(N-p-toluenesulfonyl-1,2-diphenylethylenediamine) and a 5:2 mixture of formic acid and triethylamine as the hydrogen source. Under these conditions, dynamic kinetic resolution was efficiently promoted to provide the corresponding syn α-alkoxy-β-hydroxyesters derived from substituted aromatic and heteroaromatic aldehydes with a high level of diastereoselectivity (diastereomeric ratio (d.r.)>99:1) and an almost perfect enantioselectivity (enantiomeric excess (ee)>99 %). Additionally, after extensive screening of the reaction conditions, the use of Ru(II) - and Rh(III) -tethered precatalysts extended this process to more-challenging substrates that bore alkenyl-, alkynyl-, and alkyl substituents to provide the corresponding syn α-alkoxy-β-hydroxyesters with excellent enantiocontrol (up to 99 % ee) and good to perfect diastereocontrol (d.r.>99:1). Lastly, the synthetic utility of the present protocol was demonstrated by application to the asymmetric synthesis of chiral ester ethyl (2S)-2-ethoxy-3-(4-hydroxyphenyl)-propanoate, which is an important pharmacophore in a number of peroxisome proliferator-activated receptor α/γ dual agonist advanced drug candidates used for the treatment of type-II diabetes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biologic and synthetic skin substitutes: An overview

OpenAIRE

Halim, Ahmad Sukari; Khoo, Teng Lye; Mohd. Yussof, Shah Jumaat

2010-01-01

The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substit...

Structure-activity relationships of amide-phosphonate derivatives as inhibitors of the human soluble epoxide hydrolase.

Science.gov (United States)

Kim, In-Hae; Park, Yong-Kyu; Nishiwaki, Hisashi; Hammock, Bruce D; Nishi, Kosuke

2015-11-15

Structure-activity relationships of amide-phosphonate derivatives as inhibitors of the human soluble epoxide hydrolase (sEH) were investigated. First, a series of alkyl or aryl groups were substituted on the carbon alpha to the phosphonate function in amide compounds to see whether substituted phosphonates can act as a secondary pharmacophore. A tert-butyl group (16) on the alpha carbon was found to yield most potent inhibition on the target enzyme. A 4-50-fold drop in inhibition was induced by other substituents such as aryls, substituted aryls, cycloalkyls, and alkyls. Then, the modification of the O-substituents on the phosphonate function revealed that diethyl groups (16 and 23) were preferable for inhibition to other longer alkyls or substituted alkyls. In amide compounds with the optimized diethylphosphonate moiety and an alkyl substitution such as adamantane (16), tetrahydronaphthalene (31), or adamantanemethane (36), highly potent inhibitions were gained. In addition, the resulting potent amide-phosphonate compounds had reasonable water solubility, suggesting that substituted phosphonates in amide inhibitors are effective for both inhibition potency on the human sEH and water solubility as a secondary pharmacophore. Copyright © 2015 Elsevier Ltd. All rights reserved.

Selection on start codons in prokaryotes and potential compensatory nucleotide substitutions.

Science.gov (United States)

Belinky, Frida; Rogozin, Igor B; Koonin, Eugene V

2017-09-29

Reconstruction of the evolution of start codons in 36 groups of closely related bacterial and archaeal genomes reveals purifying selection affecting AUG codons. The AUG starts are replaced by GUG and especially UUG significantly less frequently than expected under the neutral expectation derived from the frequencies of the respective nucleotide triplet substitutions in non-coding regions and in 4-fold degenerate sites. Thus, AUG is the optimal start codon that is actively maintained by purifying selection. However, purifying selection on start codons is significantly weaker than the selection on the same codons in coding sequences, although the switches between the codons result in conservative amino acid substitutions. The only exception is the AUG to UUG switch that is strongly selected against among start codons. Selection on start codons is most pronounced in evolutionarily conserved, highly expressed genes. Mutation of the start codon to a sub-optimal form (GUG or UUG) tends to be compensated by mutations in the Shine-Dalgarno sequence towards a stronger translation initiation signal. Together, all these findings indicate that in prokaryotes, translation start signals are subject to weak but significant selection for maximization of initiation rate and, consequently, protein production.

Can solar energy substitute for oil? A natural capital accounting approach

International Nuclear Information System (INIS)

Slesser, M.

1993-01-01

Humans have managed to exploit the Earth's natural capital to create a vast human-made physical capital stock, whereby we provide food, fuel, clothing and shelter for the great majority of the planet's inhabitants. In doing so, we have damaged the environment and dissipated much that we inherited. Since the stock of natural capital is finite, for how long can this depletion and erosion continue? With what do we replace it in order to maintain our economic systems? This paper explores in a quantitative manner the potential to substitute solar energy for natural capital. In order to proceed, we need to distinguish between different types of natural capital, understand the nature of human-made capital and see what it is that determines the viability of solar energy systems. A macroeconomic model, GlobEcco, has been used to assess the potential for economic development at the global level in the context of the consequent rate of depletion of the Earth's depletable natural capital and/or its substitution by solar energy. Nine policies for the introduction of solar electricity, as derived from hydro-power, wind energy and photovoltaics, have been tested. (7 figures, 3 tables). (Author)

Novel One-Pot Access to 3,3-bis(3-hydroxy-5-substituted-1H-pyrazol-4-yl) indolin-2-ones

International Nuclear Information System (INIS)

Lin, Y.; Fu, Z.; Song, Q.; Shen, T.

2016-01-01

Sodium bicarbonate was applied as catalyst for the synthesis of 3,3-bis(3-hydroxy-5-substituted-1H-pyrazol-4-yl)indolin-2-ones via the reaction of isatins, hydrazine hydrate and ethyl acetoacetate or ethyl benzoylacetate. This reaction was performed in ethanol at 78 degree C, giving 3,3-bis(3-hydroxy-5-substituted-1H-pyrazol-4-yl)indolin-2-one derivatives in good to excellent yields. The structure of 5-bromo-3,3-bis(3-hydroxy-5-methyl-1H-pyrazol-4-yl) indolin-2-one was unambiguously confirmed by X-ray single crystal structure analysis and a plausible reaction mechanism is also proposed. (author)

SYNTHESIS OF SOME PROLINE DERIVATIVES BY MEANS OF MICHAEL ADDITIONS OF GLYCINE ESTERS

NARCIS (Netherlands)

VANDERWERF, A; KELLOGG, RM

1991-01-01

Addition of the Schiff bases derived from reaction of glycine alkyl esters with benzophenoneimine to alpha,beta-unsaturated ketones, followed by hydrogenation of the addition products, leads to 5- or 3,5-substituted prolines. Hydrolysis of the Michael adducts rather than hydrogenation allows

[Guidelines for substitution treatments in prison populations].

Science.gov (United States)

Michel, L; Maguet, O

2005-01-01

Care access for the drug addict patients in prison (in particular for the treatments of substitution) in France is very unequal from one establishment to another. This reflects the great variability of the practices of substitution and especially the absence of consensus on the methods of adaptation of these practices to the prison environment. Because of difficulties expressed by prisoners and medical staff on this subject and of stakes (let us recall that approximately 30% of the prisoners are dependent or abusers of one or more psychoactive substances), the formulation of recommendations or of a good practices guide of substitution in prison appeared necessary. Work that we detail here answers a ordering of the Advisory Commission of the Treatments of Substitution (September 2001) whose authors are members. It was presented at the session April 2003. It results from the confrontation of a review of the literature (including legal texts and official reports concerning substitution, the organization of the care in prison environment and the lawful framework), with a vast investigation. The latter was carried out near medical staff (22 prisons), penitentiary staff (3 prisons, 27 people met including directors of these establishments) and prisoners (7 establishments, 28 prisoners met) in the form of individual talks (semi-directing interviews with evaluation of the type of existing device and its knowledge by the penitentiary staff and the prisoners; statement of the suggestions, needs and requests of the medical, penitentiary staffs and of the prisoners). In the whole visited prisons, 7.8% (870) of the prisoners received substitution treatments (6.35% by buprenorphine, 1.44% by methadone), representing a proportion of substituted drug addicts (870 substituted for an evaluation of 3,350 prisoners drug addicts among the 11,168 prisoners of the 22 visited prisons) notably lower than that in free environment (56%, ie 96,000 substituted for an evaluated population of

Reaction of urea thiourea and their derivatives with tertiary phosphine transition metal halides

International Nuclear Information System (INIS)

Adam, Eltayeb Mahala

2000-03-01

This thesis describes preparation characterization and some properties of a number of new compounds such as (ph 3 p)2 ML where M= cobalt (11), nickel (11), and copper (11), and L= urea, thiourea, phenylthiourea, sym diphenylurea and sym diphenylthiourea.These compounds have been prepared according according to the reaction of dichloro bis (triphenylphosphine) transition metal with urea, thiourea or some of their derivative ligands in 1:1 molar ratio.The work in this thesis is divided into three section firstly:- In the introduction chapter part one includes general definitions of coordination chemistry and related compounds and abroad definition of transition elements.Part two includes the theoretical back ground about transition metal complexes having urea, thiourea or some of their substituted derivative ligands.Part two also discusses the type of bonding between these ligands and the transition metal atom.Secondly: Chapter two describes the general techniques followed in this work such as purification of solvents recrystallization, preparation of starting materials and also gives full detailed procedures of the preparation of a number of new compounds.Thirdly: Discussion with detailed in chapter three, the results of the research are presented the preparation and characterization of a number of new compounds isolated from reaction between urea, thiourea or some of their substituted derivatives and dichloro bis (triphenyl phosphine) transition metal complex giving a general formula (ph 3 )2ML where M=cobalt, nickel, and copper, and urea, thiourea or some of their substituted derivatives ligands. The products of these experiments have been identified using infrared spectra, melting points and molar conductance. The results obtained indicated that all the compounds forming the nitrogen to metal bonds leading to the formation of a four- membered chelate ring, they are relatively thermally stable compounds, and also these compounds are non-electrolytes.(Author)

REACH-related substitution within the Danish printing industry

DEFF Research Database (Denmark)

Larsen, Henrik Fred; Bøg, Carsten; Markussen, Helene

are running a substitution project. A major part of the work has been mapping the presence of chemicals which are potential candidates for substitution (e.g. PBT, CMR, vPvB, EDS) within the Danish printing industry. The mapping comprises a combination of a literature study and an investigation of the actual......The accomplishment of the EU REACH regulation will most probably promote substitution within sectors handling a lot of different chemicals like the printing industry. With the aim of being at the cutting edge of this development the Danish EPA together with the Danish printing industry and IPU...... fulfil one or more of the criteria (e.g. CMR, EDS) for the REACH Annex XIV candidate list (authorisation). The paper presents the results of the mapping of chemical candidates and the first results of the actual substitutions. Keywords: REACH, chemicals, substitution, printing industry....

Anaerobic biotransformation of roxarsone and related N-substituted phenylarsonic acids

Science.gov (United States)

Cortinas, I.; Field, J.A.; Kopplin, M.; Garbarino, J.R.; Gandolfi, A.J.; Sierra-Alvarez, R.

2006-01-01

Large quantities of arsenic are introduced into the environment through land application of poultry litter containing the organoarsenical feed additive roxarsone (3-nitro-4-hydroxyphenylarsonic acid). The objective of this study was to evaluate the bioconversion of roxarsone and related N-substituted phenylarsonic acid derivatives under anaerobic conditions. The results demonstrate that roxarsone is rapidly transformed in the absence of oxygen to the corresponding aromatic amine, 4-hydroxy-3-aminophenylarsonic acid (HAPA). The formation of HAPA is attributable to the facile reduction of the nitro group. Electron-donating substrates, such as hydrogen gas, glucose, and lactate, stimulated the rate of nitro group reduction, indicating a microbial role. During long-term incubations, HAPA and the closely related 4-aminophenylarsonic acid (4-APA) were slowly biologically eliminated by up to 99% under methanogenic and sulfate-reducing conditions, whereas little or no removal occurred in heat-killed inoculum controls. Arsenite and, to a lesser extent, arsenate were observed as products of the degradation. Freely soluble forms of the inorganic arsenical species accounted for 19-28% of the amino-substituted phenylarsonic acids removed. This constitutes the first report of a biologically catalyzed rupture of the phenylarsonic group under anaerobic conditions. ?? 2006 American Chemical Society.

Lifting Term Rewriting Derivations in Constructor Systems by Using Generators

Directory of Open Access Journals (Sweden)

Adrián Riesco

2015-01-01

Full Text Available Narrowing is a procedure that was first studied in the context of equational E-unification and that has been used in a wide range of applications. The classic completeness result due to Hullot states that any term rewriting derivation starting from an instance of an expression can be "lifted" to a narrowing derivation, whenever the substitution employed is normalized. In this paper we adapt the generator- based extra-variables-elimination transformation used in functional-logic programming to overcome that limitation, so we are able to lift term rewriting derivations starting from arbitrary instances of expressions. The proposed technique is limited to left-linear constructor systems and to derivations reaching a ground expression. We also present a Maude-based implementation of the technique, using natural rewriting for the on-demand evaluation strategy.

Protein substitute for children and adults with phenylketonuria.

Science.gov (United States)

Yi, Sarah H L; Singh, Rani H

2015-02-27

Phenylketonuria is an inherited metabolic disorder characterised by an absence or deficiency of the enzyme phenylalanine hydroxylase. The aim of treatment is to lower blood phenylalanine concentrations to the recommended therapeutic range to prevent developmental delay and support normal growth. Current treatment consists of a low-phenylalanine diet in combination with a protein substitute which is free from or low in phenylalanine. Guidance regarding the use, dosage, and distribution of dosage of the protein substitute over a 24-hour period is unclear, and there is variation in recommendations among treatment centres. This is an update of a Cochrane review first published in 2005, and previously updated in 2008. To assess the benefits and adverse effects of protein substitute, its dosage, and distribution of dose in children and adults with phenylketonuria who are adhering to a low-phenylalanine diet. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Trials Register which consists of references identified from comprehensive electronic database searches and hand searches of relevant journals and abstract books of conference proceedings. We also contacted manufacturers of the phenylalanine-free and low-phenylalanine protein substitutes for any data from published and unpublished randomised controlled trials.Date of the most recent search of the Group's Inborn Errors of Metabolism Trials Register: 03 April 2014. All randomised or quasi-randomised controlled trials comparing: any dose of protein substitute with no protein substitute; an alternative dosage; or the same dose, but given as frequent small doses throughout the day compared with the same total daily dose given as larger boluses less frequently. Both authors independently extracted data and assessed trial quality. Three trials (69 participants) are included in this review. One trial investigated the use of protein substitute in 16 participants, while a further two trials investigated the

5-Nitroimidazole Derivatives and their Antimicrobial Activity

International Nuclear Information System (INIS)

Khan, K.M.; Salar, U.; Yousuf, S.; Naz, F.

2016-01-01

5-Nitroimidazole derivatives 2-8 were synthesized from secnidazole. The syntheses were accomplished in two steps which start from the oxidation of secnidazole to the secnidazolone 1. Secnidazolone 1 was converted into its hydrazone derivative 2-8 by treating with different substituted acid hydrazide. Compounds 2-8 were evaluated for their antimicrobial activity against Gram-positive and Gram-negative bacteria, compounds 3 and 4 showed the significant activity against Staphylococcus epidermidis, however, compound 2 showed good inhibitions against Corynebacterium diphtheria when compared with the standard. Compound 3 showed good inhibitory potential against tested Gram-negative bacterial strains i.e. Enterobacter aerogene, Escherichia coli, Salmonella typhi, Salmonella paratyphi A, Shigella flexeneri and Vibrio choleriae. All synthetic derivatives were also tested against eight fungal stains, however, they were weekly active against Aspergillus flavus and Candida albican. The synthesized compounds were characterized by different spectroscopy techniques. (author)

Muon substituted free radicals

International Nuclear Information System (INIS)

Burkhard, P.; Fischer, H.; Roduner, E.; Strub, W.; Gygax, F.N.; Brinkman, G.A.; Louwrier, P.W.F.; McKenna, D.; Ramos, M.; Webster, B.C.

1984-01-01

Spin polarized energetic positive muons are injected as magnetic probes into unsaturated organic liquids. They are implemented via fast chemical processes ( -10 s) in various molecules. Of particular interest among these are muonium substituted free radicals. The technique allows determination of accurate rate coefficients for fast chemical reactions of radicals. Furthermore, radiochemical processes occuring in picoseconds after injection of the muon are studied. Of fundamental interest are also the structural and dynamical implications of substituting a proton by a muon, or in other terms, a hydrogen atom by a muonium atom. Selected examples for each of these three types of experiments are given. (Auth.)

N,N'-dihydroxyamidines: a new prodrug principle to improve the oral bioavailability of amidines.

Science.gov (United States)

Reeh, Christiane; Wundt, Judith; Clement, Bernd

2007-12-27

N, N'-dihydroxybenzamdine represents a model compound for a new prodrug principle to improve the oral bioavailability of drugs containing amidine functions. The activation of the prodrug could be demonstrated in vitro by porcine and human subcellular enzyme fractions, the mitochondrial benzamidoxime reducing system, and porcine hepatocytes. In vivo, the bioavailability of benzamidine after oral application of N, N'-dihydroxybenzamidine was about 91% and exceeded that of benzamidine after oral application of benzamidoxime, being about 74% (Liu, L.; Ling, Y.; Havel, C.; Bashnick, L.; Young, W.; Rai, R.; Vijaykumar, D.; Riggs, J. R.; Ton, T.; Shaghafi, M.; Graupe, D.; Mordenti, J.; Sukbuntherng, J. Species comparison of in vitro and in vivo conversion of five N-hydroxyamidine prodrugs of fVIIA inhibitors to their corresponding active amidines. Presented at the 13th North America ISSX Meeting, Maui, HI, 2005).

Synthesis and pharmacological evaluation of N-substituted 2-(2-oxo-2H-chromen-4-yloxy)propanamide as cyclooxygenase inhibitors.

Science.gov (United States)

Rambabu, D; Mulakayala, Naveen; Ismail; Kumar, K Ravi; Kumar, G Pavan; Mulakayala, Chaitanya; Kumar, Chitta Suresh; Kalle, Arunasree M; Rao, M V Basaveswara; Oruganti, Srinivas; Pal, Manojit

2012-11-01

A series of novel N-substituted 2-(2-oxo-2H-chromen-4-yloxy)propanamide derivatives were synthesized via converting the readily available 4-hydroxy coumarin to the corresponding ethyl 2-(2-oxo-2H-chromen-4-yloxy)propanoate followed by hydrolysis and then reacting with different substituted amines. The molecular structures of two representative compounds, that is, 3 and 5l were confirmed by single crystal X-ray diffraction study. All the compounds synthesized were evaluated for their cyclooxygenase (COX) inhibiting properties in vitro. The compound 5i showed balanced selectivity towards COX-2 over COX-1 inhibition and good docking scores when docked into the COX-2 protein. Copyright © 2012 Elsevier Ltd. All rights reserved.

Separation of trivalent actinides and lanthanides with some substituted oligopyridines and triazines in synergy with 2-bromodecanoic acid. (Presented at the International Solvent Extraction Conference, July 1999 in Barcelona)

International Nuclear Information System (INIS)

Enarsson, Aa.; Spjuth, L.; Liljenzin, J.O.; Kaellvenius, G.

2000-01-01

The separation of trivalent actinides and lanthanides with some substituted oligopyridines and triazines in synergy with 2-bromodecanoic acid was studied. All ligands, except the quinolinyl-derivatives, showed high metal extraction and good separation factors for trivalent actinides over lanthanides. The substituted di-pyridyltriazines and the quaterpyridine showed the highest distribution ratios and quater- and quinquepyridine the highest separation factors, at low nitric acid concentration. The basicity of the different ligands were determined by non-aqueous titration in acetonitrile media and was related to the metal extraction. The substituted di-pyridyltriazines, which showed the highest metal extraction also showed the lowest basicity

Are Synonymous Substitutions in Flowering Plant Mitochondria Neutral?

Science.gov (United States)

Wynn, Emily L; Christensen, Alan C

2015-10-01

Angiosperm mitochondrial genes appear to have very low mutation rates, while non-gene regions expand, diverge, and rearrange quickly. One possible explanation for this disparity is that synonymous substitutions in plant mitochondrial genes are not truly neutral and selection keeps their occurrence low. If this were true, the explanation for the disparity in mutation rates in genes and non-genes needs to consider selection as well as mechanisms of DNA repair. Rps14 is co-transcribed with cob and rpl5 in most plant mitochondrial genomes, but in some genomes, rps14 has been duplicated to the nucleus leaving a pseudogene in the mitochondria. This provides an opportunity to compare neutral substitution rates in pseudogenes with synonymous substitution rates in the orthologs. Genes and pseudogenes of rps14 have been aligned among different species and the mutation rates have been calculated. Neutral substitution rates in pseudogenes and synonymous substitution rates in genes are significantly different, providing evidence that synonymous substitutions in plant mitochondrial genes are not completely neutral. The non-neutrality is not sufficient to completely explain the exceptionally low mutation rates in land plant mitochondrial genomes, but selective forces appear to play a small role.

Microwave Assisted Synthesis of Some New Heterocyclic Spiro-Derivatives with Potential Antimicrobial and Antioxidant Activity

Directory of Open Access Journals (Sweden)

Mohamed Mohamed Youssef

2010-12-01

Full Text Available Homophthalic anhydride reacts with different aromatic amines to produce N-substituted homophthalimides. Bromination of the latter produces 4,4-dibromo-homophthalimide derivatives that can be used as precursors for spiro-derivatives. The dibromo derivatives react with different binucleophilic reagents to produce several spiro-isoquinoline derivatives. Reaction of the dibromo derivatives with malononitrile produces dicyanomethylene derivatives which react with different binucleophiles to produce new spiro-derivatives. Structures of the newly synthesized compounds are proved using spectroscopic methods such as IR, 1H-NMR and 13C-NMR. The newly synthesized compounds were tested for their antimicrobial and antioxidant activities, showing weak or no antimicrobial activity. On the other hand select compounds showed promising antioxidant activities.

Synthesis, characterization, and subcellular localization studies of amino acid-substituted porphyrinic pigments

Science.gov (United States)

van Diggelen, Lisa; Khin, Hnin; Conner, Kip; Shao, Jenny; Sweezy, Margaretta; Jung, Anna H.; Isaac, Meden; Simonis, Ursula

2009-06-01

Stopping cancer in its path occurs when photosensitizers (PSs) induce apoptotic cell death after their exposure to light and the subsequent formation of reactive oxygen species. In pursuit of our hypothesis that mitochondrial localizing PSs will enhance the efficacy of the photosensitizing process in photodynamic therapy, since they provoke cell death by inducing apoptosis, we synthesized and characterized tetraphenylporphyrins (TPPs) that are substituted at the paraphenyl positions by two amino acids and two fluoro or hydroxyl groups, respectively. They were prepared according to the Lindsey-modified Adler-Longo methodology using trifluoromethanesulfonylchloride (CF3SO2Cl) as a catalyst instead of trifluoroacetic acid. The use of CF3SO2Cl yielded cleaner products in significantly higher yields. During the synthesis, not only the yields and work-up procedure of the TPPs were improved by using CF3SO2Cl as a catalyst, but also a better means of synthesizing the precursor dipyrromethanes was tested by using indium(III) chloride. Column chromatography, HPLC, and NMR spectroscopy were used to separate and characterize the di-amino acid-dihydroxy, or difluoro-substituted porphyrins and to ascertain their purity before subcellular localization studies were carried out. Studies using androgen-sensitive human prostate adenocarcinoma cells LNCaP revealed that certain amino acid substituted porphyrins that are positively charged in the slightly acidic medium of cancer cells are very useful in shedding light on the targets of TPPs in subcellular organelles of cancer cells. Although some of these compounds have properties of promising photosensitizers by revealing increased water solubility, acidic properties, and innate ability to provoke cell death by apoptosis, the cell killing efficacy of these TPPs is low. This correlates with their subcellular localization. The di-amino acid, di-hydroxy substituted TPPs localize mainly to the lysosomes, whereas the di-fluoro-substituted

Arylazoindazole Photoswitches : Facile Synthesis and Functionalization via SNAr Substitution

NARCIS (Netherlands)

Travieso-Puente, Raquel; Budzak, Simon; Chen, Juan; Stacko, Peter; Jastrzebski, Johann T B H; Jacquemin, Denis; Otten, Edwin

2017-01-01

A straightforward synthetic route to arylazoindazoles via nucleophilic aromatic substitution is presented. Upon deprotonation of the NH group, a C6F5-substituted formazan undergoes facile cyclization as a result of intermolecular nucleophilic substitution (SNAr). This new class of azo photoswitches

Asymmetric hydrogenation of quinolines catalyzed by iridium complexes of monodentate BINOL-derived phosphoramidites

NARCIS (Netherlands)

Mrsic, Natasa; Lefort, Laurent; Boogers, Jeroen A. F.; Minnaard, Adriaan J.; Feringa, Ben L.; de Vries, Johannes G.; Mršić, Nataša

The monodentate BINOL-derived phosphoramidite PipPhos is used as ligand for the iridium-catalyzed asymmetric hydrogenation of 2- and 2,6-substituted quinolines. If tri-ortho-tolylphosphine and/or chloride salts are used as additives enantioselectivities are strongly enhanced up to 89%. NMR indicates

Goods-Time Elasticity of Substitution in Health Production.

Science.gov (United States)

Du, Juan; Yagihashi, Takeshi

2017-11-01

We examine how inputs for health production, in particular, medical care and health-enhancing time, are combined to improve health. The estimated elasticity of substitution from a constant elasticity of substitution production function is significantly less than one for the working-age population, rejecting the unit elasticity of substitution used in previous studies. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Kinetic response study in chemiresistive gas sensor based on carbon nanotube surface functionalized with substituted phthalocyanines

Science.gov (United States)

Sharma, Anshul Kumar; Kumar, Pankaj; Saini, Rajan; Bedi, R. K.; Mahajan, Aman

2016-05-01

A kind of hybrid material is prepared by functionalizing multi-wall carbon nanotubes (MWCNTs-COOH) with substituted copper phthalocyanine and the formation of CuPcOC8/MWCNTs-COOH hybrid is confirmed by scanning electron microscopy and transmission electron microscopy. The results indicated that on the surface of nanotubes substituted CuPcOC8 derivatives has been successfully anchored through π-π stacking interaction. The gas sensing application of the fabricated hybrid material is tested upon exposure to different hazardous species, specifically NO2, NO, Cl2 and NH3 at operating temperature of 150˚C. It has been demonstrated that for Cl2 minimum detection limit of CuPcOC8/MWCNTs-COOH hybrid is 100 ppb. The response of hybrid sensor is found to be increased with increase in the concentration of Cl2.

Enhanced osteoconductivity of sodium-substituted hydroxyapatite by system instability.

Science.gov (United States)

Sang Cho, Jung; Um, Seung-Hoon; Su Yoo, Dong; Chung, Yong-Chae; Hye Chung, Shin; Lee, Jeong-Cheol; Rhee, Sang-Hoon

2014-07-01

The effect of substituting sodium for calcium on enhanced osteoconductivity of hydroxyapatite was newly investigated. Sodium-substituted hydroxyapatite was synthesized by reacting calcium hydroxide and phosphoric acid with sodium nitrate followed by sintering. As a control, pure hydroxyapatite was prepared under identical conditions, but without the addition of sodium nitrate. Substitution of calcium with sodium in hydroxyapatite produced the structural vacancies for carbonate ion from phosphate site and hydrogen ion from hydroxide site of hydroxyapatite after sintering. The total system energy of sodium-substituted hydroxyapatite with structural defects calculated by ab initio methods based on quantum mechanics was much higher than that of hydroxyapatite, suggesting that the sodium-substituted hydroxyapatite was energetically less stable compared with hydroxyapatite. Indeed, sodium-substituted hydroxyapatite exhibited higher dissolution behavior of constituent elements of hydroxyapatite in simulated body fluid (SBF) and Tris-buffered deionized water compared with hydroxyapatite, which directly affected low-crystalline hydroxyl-carbonate apatite forming capacity by increasing the degree of apatite supersaturation in SBF. Actually, sodium-substituted hydroxyapatite exhibited markedly improved low-crystalline hydroxyl-carbonate apatite forming capacity in SBF and noticeably higher osteoconductivity 4 weeks after implantation in calvarial defects of New Zealand white rabbits compared with hydroxyapatite. In addition, there were no statistically significant differences between hydroxyapatite and sodium-substituted hydroxyapatite on cytotoxicity as determined by BCA assay. Taken together, these results indicate that sodium-substituted hydroxyapatite with structural defects has promising potential for use as a bone grafting material due to its enhanced osteoconductivity compared with hydroxyapatite. © 2013 Wiley Periodicals, Inc.

Synthesis, characterization and serum albumin binding studies of vitamin K3 derivatives.

Science.gov (United States)

Suganthi, Murugesan; Elango, Kuppanagounder P

2017-01-01

Synthesis, characterization and bovine serum albumin (BSA) binding properties of three derivatives of vitamin K3 have been described. Results of UV-Vis and fluorescence spectra indicate complexation between BSA and the ligands with conformational changes in protein, which is strongly supported by synchronous and three dimensional fluorescence studies. Addition of the ligands quenches the fluorescence of BSA which is accompanied by reduction in quantum yield (Ф) from 0.1010 to 0.0775-0.0986 range. Thermodynamic investigations reveal that hydrophobic interaction is the major binding force in the spontaneous binding of these ligands with BSA. The binding constants obtained depend on the substituent present in the quinone ring, which correlates linearly with the Taft's field substituent constant (σ F ). The results show that compound with strong electron withdrawing nitro-group forms relatively stronger complex with BSA than amino and thioglycolate substituted ones. Circular dichroism studies show that the α-helical content of the protein, upon complexation with the ligands, decreases in the case of amino and nitro substituted vitamin K3 while increases in thioglycolate substituted compound. Molecular docking studies indicated that the vitamin K3 derivatives are surrounded by hydrophobic residues of the BSA molecule, which is in good agreement with the results of fluorescence spectral and thermodynamic studies. Copyright © 2016 Elsevier B.V. All rights reserved.

40 CFR 721.4596 - Diazo substituted carbomonocyclic metal complex.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Diazo substituted carbomonocyclic... Specific Chemical Substances § 721.4596 Diazo substituted carbomonocyclic metal complex. (a) Chemical... as a diazo substituted carbomonocyclic metal complex (PMN P-94-1039) is subject to reporting under...

Synthesis and stability of strongly acidic benzamide derivatives

DEFF Research Database (Denmark)

Diness, Frederik; Bjerrum, Niels J.; Begtrup, Mikael

2018-01-01

Reactivity studies of strong organic acids based on the replacement of one or both of the oxygens in benzoic acids with the trifluoromethanesulfonamide group are reported. Novel derivatives of these types of acids were synthesized in good yields. The generated N-triflylbenzamides were further...... functionalized through cross-coupling and nucleophilic aromatic substitution reactions. All compounds were stable in dilute aqueous solutions. Studies of stability under acidic and basic conditions are also reported....

Microwave-Assisted Synthesis of Phenothiazine and Quinoline Derivatives

Science.gov (United States)

Găină, Luiza; Cristea, Castelia; Moldovan, Claudia; Porumb, Dan; Surducan, Emanoil; Deleanu, Călin; Mahamoud, Abdalah; Barbe, Jacques; Silberg, Ioan A.

2007-01-01

Application of a dynamic microwave power system in the chemical synthesis of some phenothiazine and quinoline derivatives is described. Heterocyclic ring formation, aromatic nucleophilic substitution and heterocyclic aldehydes/ketones condensation reactions were performed on solid support, or under solvent free reaction conditions. The microwave-assisted Duff formylation of phenothiazine was achieved. Comparison of microwave-assisted synthesis with the conventional synthetic methods demonstrates advantages related to shorter reaction times and in some cases better reaction yields.

Microwave-Assisted Synthesis of Phenothiazine and Qinoline Derivatives

Directory of Open Access Journals (Sweden)

Ioan A. Silberg

2007-02-01

Full Text Available Application of a dynamic microwave power system in the chemical synthesis ofsome phenothiazine and quinoline derivatives is described. Heterocyclic ring formation,aromatic nucleophilic substitution and heterocyclic aldehydes/ketones condensationreactions were performed on solid support, or under solvent free reaction conditions. Themicrowave-assisted Duff formylation of phenothiazine was achieved. Comparison ofmicrowave-assisted synthesis with the conventional synthetic methods demonstratesadvantages related to shorter reaction times and in some cases better reaction yields.

Cytotoxic activity and apoptosis-inducing potential of di-spiropyrrolidino and di-spiropyrrolizidino oxindole andrographolide derivatives.

Directory of Open Access Journals (Sweden)

Sumit Kumar Dey

Full Text Available Anticancer role of andrographolide is well documented. To find novel potent derivatives with improved cytotoxicity than andrographolide on cancer cells, two series of di-spiropyrrolidino- and di-spiropyrrolizidino oxindole andrographolide derivatives prepared by cyclo-addition of azomethine ylide along with sarcosine or proline (viz. sarcosine and proline series respectively and substitution of different functional groups (-CH3, -OCH3 and halogens were examined for their cytotoxic effect on a panel of six human cancer cell lines (colorectal carcinoma HCT116 cells, pancreatic carcinoma MiaPaCa-2 cells, hepatocarcinoma HepG2 cells, cervical carcinoma HeLa cells, lung carcinoma A549 and melanoma A375 cells. Except halogen substituted derivatives of proline series (viz. CY2, CY14 and CY15 for Br, Cl and I substitution respectively, none of the other derivatives showed improved cytotoxicity than andrographolide in the cancer cell lines examined. Order of cytotoxicity of the potent compounds is CY2>CY14>CY15>andrographolide. Higher toxicity was observed in HCT116, MiaPaCa-2 and HepG2 cells. CY2, induced death of HCT116 (GI50 10.5, MiaPaCa-2 (GI50 11.2 and HepG2 (GI50 16.6 cells were associated with cell rounding, nuclear fragmentation and increased percentage of apoptotic cells, cell cycle arrest at G1 phase, ROS generation, and involvement of mitochondrial pathway. Upregulation of Bax, Bad, p53, caspases-3,-9 and cleaved PARP; downregulation of Bcl-2, cytosolic NF-κB p65, PI3K and p-Akt; translocation of P53/P21, NF-κB p65 were seen in CY2 treated HCT116 cells. Thus, three halogenated di-spiropyrrolizidino oxindole derivatives of andrographolide are found to be more cytotoxic than andrographolide in some cancer cells. The most potent derivative, CY2 induced death of the cancer cells involves ROS dependent mitochondrial pathway like andrographolide.

Cytotoxic Activity and Apoptosis-Inducing Potential of Di-spiropyrrolidino and Di-spiropyrrolizidino Oxindole Andrographolide Derivatives

Science.gov (United States)

Hazra, Abhijit; Naskar, Subhendu; Nandy, Abhishek; Munda, Rudra Narayan; Das, Subhadip; Chatterjee, Nabanita; Mondal, Nirup Bikash; Banerjee, Sukdeb; Saha, Krishna Das

2013-01-01

Anticancer role of andrographolide is well documented. To find novel potent derivatives with improved cytotoxicity than andrographolide on cancer cells, two series of di-spiropyrrolidino- and di-spiropyrrolizidino oxindole andrographolide derivatives prepared by cyclo-addition of azomethine ylide along with sarcosine or proline (viz. sarcosine and proline series respectively) and substitution of different functional groups (-CH3, -OCH3 and halogens) were examined for their cytotoxic effect on a panel of six human cancer cell lines (colorectal carcinoma HCT116 cells, pancreatic carcinoma MiaPaCa-2 cells, hepatocarcinoma HepG2 cells, cervical carcinoma HeLa cells, lung carcinoma A549 and melanoma A375 cells). Except halogen substituted derivatives of proline series (viz. CY2, CY14 and CY15 for Br, Cl and I substitution respectively), none of the other derivatives showed improved cytotoxicity than andrographolide in the cancer cell lines examined. Order of cytotoxicity of the potent compounds is CY2>CY14>CY15>andrographolide. Higher toxicity was observed in HCT116, MiaPaCa-2 and HepG2 cells. CY2, induced death of HCT116 (GI50 10.5), MiaPaCa-2 (GI50 11.2) and HepG2 (GI50 16.6) cells were associated with cell rounding, nuclear fragmentation and increased percentage of apoptotic cells, cell cycle arrest at G1 phase, ROS generation, and involvement of mitochondrial pathway. Upregulation of Bax, Bad, p53, caspases-3,-9 and cleaved PARP; downregulation of Bcl-2, cytosolic NF-κB p65, PI3K and p-Akt; translocation of P53/P21, NF-κB p65 were seen in CY2 treated HCT116 cells. Thus, three halogenated di-spiropyrrolizidino oxindole derivatives of andrographolide are found to be more cytotoxic than andrographolide in some cancer cells. The most potent derivative, CY2 induced death of the cancer cells involves ROS dependent mitochondrial pathway like andrographolide. PMID:23472133

Photophysical Properties of Pheophorbide-a Derivatives and Their Photodynamic Therapeutic Effects on a Tumor Cell Line In Vitro

Directory of Open Access Journals (Sweden)

Kang-Kyun Wang

2014-01-01

Full Text Available Pheophorbide-a derivatives have been reported to be potential photosensitizers for photodynamic therapy (PDT. In this study, photophysics of pheophorbide-a derivatives (PaDs were investigated along with their photodynamic tumoricidal effect in vitro. PaDs were modified by changing the coil length and/or making the hydroxyl group (–OH substitutions. Their photophysical properties were studied by steady-state and time-resolved spectroscopic methods. The photodynamic tumoricidal effect was evaluated in the mouse breast cancer cell line (EMT6. Lifetime and quantum yield of fluorescence and quantum yields of triplet state and singlet oxygen were studied to determine the dynamic energy flow. The coil length of the substituted alkyl group did not significantly affect the spectroscopic properties. However, the substitution with the hydroxyl group increased the quantum yields of the triplet state and the singlet oxygen due to the enhanced intersystem crossing. In order to check the application possibility as a photodynamic therapy agent, the PaDs with hydroxyl group were studied for the cellular affinity and the photodynamic tumoricidal effect of EMT6. The results showed that the cellular affinity and the photodynamic tumoricidal effect of PaDs with the hydroxyl group depended on the coil-length of the substituted alkyl group.

Questioning nuclear waste substitution: a case study.

Science.gov (United States)

Marshall, Alan

2007-03-01

This article looks at the ethical quandaries, and their social and political context, which emerge as a result of international nuclear waste substitution. In particular it addresses the dilemmas inherent within the proposed return of nuclear waste owned by Japanese nuclear companies and currently stored in the United Kingdom. The UK company responsible for this waste, British Nuclear Fuels Limited (BNFL), wish to substitute this high volume intermediate-level Japanese-owned radioactive waste for a much lower volume of much more highly radioactive waste. Special focus is given to ethical problems that they, and the UK government, have not wished to address as they move forward with waste substitution. The conclusion is that waste substitution can only be considered an ethical practice if a set of moderating conditions are observed by all parties. These conditions are listed and, as of yet, they are not being observed.

40 CFR 721.10043 - Dineopentyl-4-substituted phthalate (generic).

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Dineopentyl-4-substituted phthalate... Specific Chemical Substances § 721.10043 Dineopentyl-4-substituted phthalate (generic). (a) Chemical... as dineopentyl-4-substituted phthalate (PMN P-02-697) is subject to reporting under this section for...

Import Substitution in Regional Industrial Production: Theoretical and Practical Aspects

Directory of Open Access Journals (Sweden)

Yevgeniy Georgievich Animitsa

2015-09-01

Full Text Available The article proves the important role of import substitution in the economic security protection of state and its regions, especially in times of crisis, geopolitical and economical instability. The authors argue that the problem of import substitution is not modern, trendy scientific stream. The issue of displacement of import goods by domestic ones was brought up in famous classic theories of mercantilists. The particular emphasis is placed on the analysis and systematization of different scientific approaches, which are utilized by native and foreign scientists to bring out the matter of “import substitution,” to determine its essential characteristics. The authors suggest their own interpretation of the import substitution notion. In the article, the most significant pro and contra arguments in import substitution policy are defined. The regional aspects in the import substitution are approved: case study — organization of industrial import substitution in the Sverdlovsk region. In the article, the authors analyze the subject matter of the Program “Development of Intraregional Industrial Cooperation and Implementation of an Import Substitution in Branches of Industry in the Sverdlovsk Region.” It is resumed, that active policy of import substitution in the industry may become the driver of regional economic development.

Educating T-Shaped professionals to meet substitution challenges and developing business models for substitution and recycling

Science.gov (United States)

Arroyo, Ana; Mendibil Eguiluz, Javier; Sánchez Cupido, Laura

2018-03-01

One strategy to overcome the challenges related to critical raw materials (CRMs) is their substitution and recycling. However, the bright scientific idea, proof of concept or laboratory demonstration need to cross the valley of death in order to become stated as ‘a substitute’ instead of ‘a potential substitute’. Most PhD students and Post Docs specialize within a given thematic area; for example on specific materials or on substitution in a certain application. This specialization could limit the ability to generate innovations and profitable business models if there are not enough tools and skills to transform new knowledge and research results into an appealing value proposition towards customers and to a business opportunity for the current markets. The project proposes a framework for developing substitution and recycling related cross-sectorial skills and tools. These are applied for training business-related competences e.g. teamwork, management, communication, value proposition and business models design, especially within RTOs and industries. The proposed learning itinerary can radically improve the path from scientific proof of concept into innovation and lean start up or industrial market launch. The developed framework is tested by a pilot group having several topics within the areas of substitution and recycling of critical raw materials.

Synthesis and Herbicidal Activity of 5-Heterocycloxy-3-substituted-1-(3-trifluoromethyl)phenyl-1H-pyrazole

Institute of Scientific and Technical Information of China (English)

XU Han; HU Xu-hong; ZOU Xiao-mao; ZHU You-quan; LIU Bin; HU Fang-zhong; YANG Hua-zheng

2012-01-01

The authors synthesized a series of novel 5-heterocycloxy-3-substituted-1-(3-trifluoromethyl)phenyl-1H- pyrazole derivatives.Herbicidal activities of the two intermediate compounds and thirteen target compounds were evaluated via Brassica napus and Echinochloa crusgalli(L.) Beauv tests.Bioassay results show that some of the compounds exhibit better inhibiting activities against Brassica napus and some of the compounds exhibit bleaching activities against Echinochloa crusgalli(L.) Beauv at 100 μg/mL.

Consequence of patient substitution of nattokinase for warfarin after aortic valve replacement with a mechanical prosthesis

OpenAIRE

Elahi, Maqsood M.; Choi, Charles H.; Konda, Subbareddy; Shake, Jay G.

2015-01-01

This report describes a patient's self-substitution of nattokinase for the vitamin K antagonist warfarin after aortic valve replacement with a mechanical prosthesis. Nattokinase is an enzyme derived from a popular fermented soybean preparation in Japan (natto), which has fibrinolytic properties and is gaining popularity in nontraditional health journals and nonmedical health websites as an over-the-counter thrombolytic. After nearly a year of use of nattokinase without warfarin, the patient d...

Synthesis, characterization and photophysical properties of ESIPT reactive triazine derivatives

International Nuclear Information System (INIS)

Kuplich, Marcelo D.; Grasel, Fabio S.; Campo, Leandra F.; Rodembusch, Fabiano S.; Stefani, Valter

2012-01-01

Four new reactive fluorescent triazine derivatives were obtained from nucleophilic aromatic substitution of cyanuric chloride. The compounds were characterized by infrared spectroscopy (IR), nuclear magnetic resonance ( 13 C and 1 H NMR) and high resolution mass spectrometry (HRMS MALDI). UV-Vis and steady-state fluorescence (in solution and in solid state) spectroscopies were also applied to characterize the photophysical behavior. The dyes are fluorescent by an intramolecular proton transfer mechanism (ESIPT) in the blue-orange region, with a large Stokes shift between 6365-10290 cm-1. The fluorescent cyanuric derivatives could successfully react with cellulose fibers to give new fluorescent cellulosic materials. (author)

Reaction of organic ytterbium derivatives with alkyl- and arylhalogenides

International Nuclear Information System (INIS)

Rybakova, L.F.; Syutkina, O.P.; Garbar, A.V.; Petrov, Eh.S.

1988-01-01

Interaction of a series of organic halogenides with organic bivalent ytterbium derivatives (like Grignard reagent, RYbX, where R=CH 3 , C 6 H 5 ; X=Br, I) under metal complex catalysis is studied. Aromatic and aliphatic ytterbium derivatives undergo a reaction of cross combination with organic iodides and bromides under catalysis by NiCl 2 (PPh 3 ) 2 and Pd(PPh 3 ) 4 complexes. Therewith organo-ytterbium compounds quantitatively react with alkyl (aryl) iodides, bromine substitution for iodine in arylhalogenides results in decrease of yield of cross-combination products. Reactions of organo-ytterbium compounds with organic halogenides are more effectively catalysed by nickel complexes than by palladium ones

Sustainable Effects of Small Hydropower Substituting Firewood Program in Majiang County, Guizhou Province, China

Directory of Open Access Journals (Sweden)

Xiaoxia Zhang

2017-06-01

Full Text Available Small hydropower substituting fuel (SHSF is an ecological environment protection program to improve regional ecosystems and alleviate poverty. However, the sustainability of SHSF programs remains controversial due to lingering doubts about its potential for socioeconomic development and its environmental impacts. The sustainability of SHSF was examined based on field investigations and household questionnaire surveys. The results were as follows: (1 Biomass of SHSF protected masson pine (Pinus massoniana and weeping cypress (Platycladus orientalis plantations were 11.06 t·ha−1 and 7.15 t·ha−1 higher than unprotected plantations, respectively. Furthermore, the differences in ecosystem biomass were mainly derived from arbor biomass. While the energy conversion efficiency based on field investigations was merely 1.28 kg (kWh−1, which was only 64% of the empirical value and 54% of the guideline for accounting for the ecological benefit of small hydropower substituting fuel. (2 Households’ total income in SHSF villages was higher than in households with access to a hydropower plant but no substituting fuel or households with no hydropower plant. (3 Most of the households had a positive attitude towards SHSF because of its cheaper electricity and associated ecological environmental improvements. Overall, our results suggest optimistic and sustainable prospects for the SHSF program; however, continued education and policy communications are needed to sustain program success.

Trace maps of general substitutional sequences

International Nuclear Information System (INIS)

Kolar, M.; Nori, F.

1990-01-01

It is shown that for arbitrary n, there exists a trace map for any n-letter substitutional sequence. Trace maps are explicitly obtained for the well-known circle and Rudin-Shapiro sequences which can be defined by means of substitution rules on three and four letters, respectively. The properties of the two trace maps and their consequences for various spectral properties are briefly discussed

Substituted decision making: elder guardianship.

Science.gov (United States)

Leatherman, Martha E; Goethe, Katherine E

2009-11-01

The goal of this column is to help experienced clinicians navigate the judicial system when they are confronted with requests for capacity evaluations that involve guardianship (conservatorship). The interface between the growing elderly medical population and increasing requests for substituted decision making is becoming more complex. This column will help practicing psychiatrists understand the medical, legal, and societal factors involved in adult guardianship. Such understanding is necessary in order to effectively perform guardianship evaluations and adequately inform courts, patients, and families about the psychiatric diagnoses central to substituted decision making.

Effects of methyl substitution on the auto-ignition of C16 alkanes

KAUST Repository

Lapuerta, Magín

2015-12-18

The auto-ignition quality of diesel fuels, quantified by their cetane number or derived cetane number (DCN), is a critical design property to consider when producing and upgrading synthetic paraffinic fuels. It is well known that auto-ignition characteristics of paraffinic fuels depend on their degree of methyl substitution. However, there remains a need to study the governing chemical functionalities contributing to such ignition characteristics, especially in the case of methyl substitutions, which have not been studied in detail. In this work, the auto-ignition of 2,6,10-trimethyltridecane has been compared with the reference hydrocarbons used for cetane number determination, i.e. n-hexadecane and heptamethylnonane, all of them being C16 isomers. Results from a constant-volume combustion chamber under different pressure and temperature initial conditions showed that the ignition delay time for both cool flame and main combustion events increased less from n-hexadecane to trimethyltridecane than from trimethyltridecane to heptamethylnonane. Additional experimental results from blends of these hydrocarbons, together with kinetic modelling, showed that auto-ignition times and combustion rates were correlated to the concentration of the functional groups indicative of methyl substitution, although not in a linear manner. When the concentration of these functional groups decreased, the first stage OH radical concentration increased and ignition delay times decreased, whereas when their concentration increased, H2O2 production was slower and ignition was retarded. Contrary to the ignition delay times, DCN was correlated linearly with functional groups, thus homogenizing the range of values and clarifying the differences between fuels.

Exact substitute processes for diffusion-reaction systems with local complete exclusion rules

International Nuclear Information System (INIS)

Schulz, Michael; Reineker, Peter

2005-01-01

Lattice systems with one species diffusion-reaction processes under local complete exclusion rules are studied analytically starting from the usual master equations with discrete variables and their corresponding representation in a Fock space. On this basis, a formulation of the transition probability as a Grassmann path integral is derived in a straightforward manner. It will be demonstrated that this Grassmann path integral is equivalent to a set of Ito stochastic differential equations. Averages of arbitrary variables and correlation functions of the underlying diffusion-reaction system can be expressed as weighted averages over all solutions of the system of stochastic differential equations. Furthermore, these differential equations are equivalent to a Fokker-Planck equation describing the probability distribution of the actual Ito solutions. This probability distribution depends on continuous variables in contrast to the original master equation, and their stochastic dynamics may be interpreted as a substitute process which is completely equivalent to the original lattice dynamics. Especially, averages and correlation functions of the continuous variables are connected to the corresponding lattice quantities by simple relations. Although the substitute process for diffusion-reaction systems with exclusion rules has some similarities to the well-known substitute process for the same system without exclusion rules, there exists a set of remarkable differences. The given approach is not only valid for the discussed single-species processes. We give sufficient arguments to show that arbitrary combinations of unimolecular and bimolecular lattice reactions under complete local exclusions may be described in terms of our approach

Effects of methyl substitution on the auto-ignition of C16 alkanes

KAUST Repository

Lapuerta, Magí n; Herná ndez, Juan J.; Sarathy, Mani

2015-01-01

The auto-ignition quality of diesel fuels, quantified by their cetane number or derived cetane number (DCN), is a critical design property to consider when producing and upgrading synthetic paraffinic fuels. It is well known that auto-ignition characteristics of paraffinic fuels depend on their degree of methyl substitution. However, there remains a need to study the governing chemical functionalities contributing to such ignition characteristics, especially in the case of methyl substitutions, which have not been studied in detail. In this work, the auto-ignition of 2,6,10-trimethyltridecane has been compared with the reference hydrocarbons used for cetane number determination, i.e. n-hexadecane and heptamethylnonane, all of them being C16 isomers. Results from a constant-volume combustion chamber under different pressure and temperature initial conditions showed that the ignition delay time for both cool flame and main combustion events increased less from n-hexadecane to trimethyltridecane than from trimethyltridecane to heptamethylnonane. Additional experimental results from blends of these hydrocarbons, together with kinetic modelling, showed that auto-ignition times and combustion rates were correlated to the concentration of the functional groups indicative of methyl substitution, although not in a linear manner. When the concentration of these functional groups decreased, the first stage OH radical concentration increased and ignition delay times decreased, whereas when their concentration increased, H2O2 production was slower and ignition was retarded. Contrary to the ignition delay times, DCN was correlated linearly with functional groups, thus homogenizing the range of values and clarifying the differences between fuels.

Substitute energy resource policy in Japan

International Nuclear Information System (INIS)

Umehara, Katsuhiko

1980-01-01

Japan depends 88% of energy resources and 99.8% of petroleum on imports. The solution of energy problems is now made internationally. As the means for Japan, there are the substitution of other resources for petroleum and its promotion. However, this involves the considerable funds for the development and utilization, which must be borne by the people in the form of tax. For governmental financing, a special account must be set up for the particular purpose. In the research and development of new energy resources, new institution is required. The following matters are described: petroleum shortage coming even in 1980s, the international need of substitute energy development, the need for establishing measures for substitute energy resources, acquisition of the funds, special-account governmental financing, and an institute of new energy development. (author)

Multisensory integration, sensory substitution and visual rehabilitation

DEFF Research Database (Denmark)

Proulx, Michael J; Ptito, Maurice; Amedi, Amir

2014-01-01

Sensory substitution has advanced remarkably over the past 35 years since first introduced to the scientific literature by Paul Bach-y-Rita. In this issue dedicated to his memory, we describe a collection of reviews that assess the current state of neuroscience research on sensory substitution...

Synthesis and antibacterial studies of some novel isoxazoline derivatives

Directory of Open Access Journals (Sweden)

TEJASKUMAR SHAH

2007-05-01

Full Text Available A series of 3-[3-(2,4-dichloro-5-fluorophenyl-5-(2-furyl-4,5-dihydro-1H-pyrazol-1-yl]-5-(substituted phenyl/2-thienylisoxazolines (4a-j were prepared. The structures of the isoxazoline derivatives were confirmed on the bases of elemental analysis and spectral data. The compounds were screened for their in vitro antibacterial activity using gram-positive bacteria and gram-negative bacteria.

Constructing HVS-Based Optimal Substitution Matrix Using Enhanced Differential Evolution

Directory of Open Access Journals (Sweden)

Shu-Fen Tu

2013-01-01

Full Text Available Least significant bit (LSB substitution is a method of information hiding. The secret message is embedded into the last k bits of a cover-image in order to evade the notice of hackers. The security and stego-image quality are two main limitations of the LSB substitution method. Therefore, some researchers have proposed an LSB substitution matrix to address these two issues. Finding the optimal LSB substitution matrix can be conceptualized as a problem of combinatorial optimization. In this paper, we adopt a different heuristic method based on other researchers’ method, called enhanced differential evolution (EDE, to construct an optimal LSB substitution matrix. Differing from other researchers, we adopt an HVS-based measurement as a fitness function and embed the secret by modifying the pixel to a closest value rather than simply substituting the LSBs. Our scheme extracts the secret by modular operations as simple LSB substitution does. The experimental results show that the proposed embedding algorithm indeed improves imperceptibility of stego-images substantially.

DOES CURRENCY SUBSTITUTION AFFECT EXCHANGE RATE VOLATILITY?

Directory of Open Access Journals (Sweden)

Hisao Kumamoto

2014-10-01

Full Text Available This study investigates the impacts of the degree of currency substitution on nominal exchange rate volatility in seven countries (Indonesia, the Philippines, the Czech Republic, Hungary, Poland, Argentina, and Peru. We use the Threshold ARCH model to consider the ratchet effect of currency substitution and sample periods in the 2000s, during which time the economies of the sample countries stabilized, while the U.S. dollar and euro depreciated against other major currencies following the recent global financial crisis. The presented empirical analyses show that the degree of currency substitution has significant positive effects on the conditional variance of the depreciation rate of the nominal exchange rate in most sample countries. Moreover, a shock to the depreciation rate of the nominal exchange rate has asymmetric effects on the conditional variance, depending on the sign. One possible explanation for these differential effects is the existence of the ratchet effect of currency substitution.

Pd(II)-Catalyzed Ortho- or Meta-C–H Olefination of Phenol Derivatives

Science.gov (United States)

Dai, Hui-Xiong; Li, Gang; Zhang, Xing-Guo; Stepan, Antonia F.

2013-01-01

A combination of weakly coordinating auxiliaries and ligand acceleration allows for the development of both ortho- and meta-selective C–H olefination of phenol derivatives. These reactions demonstrate the feasibility of directing C–H functionalizations when functional groups are distal to target C–H bonds. The meta-C–H functionalization of electron-rich phenol derivatives is unprecedented and orthogonal to previous electrophilic substitution of phenols in terms of regioselectivity. These methods are also applied to functionalize α-phenoxyacetic acids, a fibrate class of drug scaffolds. PMID:23614807

The role of biomass in US industrial interfuel substitution

International Nuclear Information System (INIS)

Jones, Clifton T.

2014-01-01

The role of biomass in US industrial interfuel substitution in the industrial sector has typically been analyzed using data for the four traditional fuels of coal, oil, electricity and natural gas. However, the use of biomass as an industrial fuel in the US has grown, and now exceeds that of coal. Using data from 1960 to 2011, interfuel substitution in the US industrial sector is modeled with a dynamic linear logit model which includes biomass alongside the other four traditional fuels. Adding biomass to the model reduces somewhat the estimated own-price and cross-price elasticities for the other four fuels, while revealing that biomass and natural gas are substitute fuels. This implies that previous studies excluding biomass may have overestimated the potential for interfuel substitution, giving policy makers an inaccurate impression of the ability of carbon taxes or other environmental regulation to reduce greenhouse gas (GHG) emissions. - Highlights: • Biomass usage by the US industrial sector now exceeds coal usage. • Previous interfuel substitution studies have not included biomass as a fuel. • Linear logit model is used to examine role of biomass in interfuel substitution. • Including biomass in the model lowers estimated price elasticities for traditional fuels. • Biomass is found to be a substitute for natural gas for industrial users

4-Substituted-2-Methoxyphenol: Suitable Building Block to Prepare New Bioactive Natural-like Hydroxylated Biphenyls.

Science.gov (United States)

Dettori, Maria Antonietta; Fabbri, Davide; Pisano, Marina; Rozzo, Carla; Palmieri, Giuseppe; Dess, Alessandro; Dallocchio, Roberto; Delogu, Giovanna

2015-02-01

A small collection of eugenol- and curcumin-analog hydroxylated biphenyls was prepared by straightforward methods starting from natural 4-substituted-2-methoxyphenols and their antitumoral activity was evaluated in vitro . Two curcumin-biphenyl derivatives showed interesting growth inhibitory activities on different malignant melanoma cell lines with IC 50 ranging from 13 to 1 µM. Preliminary molecular modeling studies were carried out to evaluate conformations and dihedral angles suitable for antiproliferative activity in hydroxylated biphenyls bearing a side aliphatic chain.

Synthesis of New Cytotoxic Aminoanthraquinone Derivatives via Nucleophilic Substitution Reactions

Directory of Open Access Journals (Sweden)

Hasimah Alimon

2013-07-01

Full Text Available Aminoanthraquinones were successfully synthesized via two reaction steps. 1,4-Dihydroxyanthraquinone (1 was first subjected to methylation, reduction and acylation to give an excellent yield of anthracene-1,4-dione (3, 1,4-dimethoxyanthracene-9,10-dione (5 and 9,10-dioxo-9,10-dihydroanthracene-1,4-diyl diacetate (7. Treatment of 1, 3, 5 and 7 with BuNH2 in the presence of PhI(OAc2 as catalyst produced seven aminoanthraquinone derivatives 1a, b, 3a, and 5a–d. Amination of 3 and 5 afforded three new aminoanthraquinones, namely 2-(butylaminoanthracene-1,4-dione (3a, 2-(butylaminoanthracene-9,10-dione (5a and 2,3-(dibutylaminoanthracene-9,10-dione (5b. All newly synthesised aminoanthraquinones were examined for their cytotoxic activity against MCF-7 (estrogen receptor positive human breast and Hep-G2 (human hepatocellular liver carcinoma cancer cells using MTT assay. Aminoanthraquinones 3a, 5a and 5b exhibited strong cytotoxicity towards both cancer cell lines (IC50 1.1–13.0 µg/mL.

Structure and electronic properties of Alq3 derivatives with electron acceptor/donor groups at the C4 positions of the quinolate ligands: a theoretical study.

Science.gov (United States)

Rao, Joshi Laxmikanth; Bhanuprakash, Kotamarthi

2011-12-01

The molecular structures of the ground (S(0)) and first singlet excited (S(1)) states of Alq3 derivatives in which pyrazolyl and 3-methylpyrazolyl groups are substituted at the C4 positions of the 8-hydroxyquinolate ligands as electron acceptors, and piperidinyl and N-methylpiperazinyl groups are substituted at the same positions as electron donors, have been optimized using the B3LYP/6-31G and CIS/6-31G methods, respectively. In order to analyze the electronic transitions in these derivatives, the frontier molecular orbital characteristics were analyzed systematically, and it was found that the highest occupied molecular orbital is localized on the A ligand while the lowest unoccupied molecular orbital is localized on the B ligand in their ground states, similar to what is seen for mer-Alq3. The absorption and emission spectra were evaluated at the TD-PBE0/6-31G level, and it was observed that electron acceptor substitution causes a red-shift in the emission spectra, which is also seen experimentally. The reorganization energies were calculated at the B3LYP/6-31G level and the results show that acceptor/donor substitution has a significant effect on the intrinsic charge mobilities of these derivatives as compared to mer-Alq3.

Ugi-Smiles couplings of 4-substituted pyridine derivatives : a fast access to chloroquine analogues

NARCIS (Netherlands)

El Kaïm, Laurent; Grimaud, Laurence; Pravin, Patil; Patil, Pravin

2012-01-01

4-Hydroxy and mercapto pyridines were successfully tested in Ugi-Smiles couplings. Such multicomponent reactions applied to quinoline derivatives afford a very convenient and short synthesis of antimalarial analogues.

Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

OpenAIRE

Goonesekere, Nalin CW

2009-01-01

Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution ...

Effect of substitution groups in carbon-13 NMR of tri-substituted camphors; Efeitos de substituintes em RMN de carbono-13 de canforas 3-substituidas

Energy Technology Data Exchange (ETDEWEB)

Kaiser, Carlos R; Rittner, Roberto [Universidade Estadual de Campinas, SP (Brazil). Inst. de Quimica; Basso, Ernani A [Universidade Estadual de Maringa, PR (Brazil). Dept. de Quimica Inorganica

1994-12-31

This work presents and discusses the empirical effects of substitution groups in the carbon-13 NMR spectra of tri-substituted camphors and their correlation with the chemical properties of such substitution groups such as electronegativity. The obtained results are presented and discussed

Improved method for the determination of the cortisol production rate using high-performance liquid chromatography and liquid scintillation counting

NARCIS (Netherlands)

van Ingen, H. E.; Endert, E.

1988-01-01

Two new methods for the determination of the cortisol production rate using reversed-phase high-performance liquid chromatography are described. One uses ultraviolet detection at 205 nm, the other on-line post-column derivatization with benzamidine, followed by fluorimetric detection. The specific

Novel 6FDA-based polyimides derived from sterically hindered Tröger's base diamines: Synthesis and gas permeation properties

KAUST Repository

Ghanem, Bader

2016-04-30

Two novel Tröger\\'s base-based di-o-substituted diamine monomers were synthesized and used to prepare two intrinsically microporous 6FDA-based polyimides (PIM-PI-TB-1 and PIM-PI-TB-2) with high molecular weight, high thermal stability and excellent solubility in common organic solvents. Compared to previously reported methods for preparing TB-based diamines, which are based on reduction of dimerized nitro-substituted anilines or condensation of phenylenediamine derivatives with dianhydrides, the novel protocol can be used to prepare different functionalized TB-based diamine monomers from a wide variety of aniline derivatives. PIM-PI-TB-1 (made from 6FDA and dibromo-tetramethyl-substituted TB diamine) and PIM-PI-TB-2 (made from 6FDA and tetramethyl-substituted TB diamine) are intrinsically microporous polymers with high BET surface areas of 440 m2/g and 580 m2/g, respectively. Pure-gas permeability coefficients of He, H2, N2, O2, CH4, and CO2 were measured at 35 °C and 2 bar for fresh and 180 days aged films. Both TB-based polyimides exhibited high gas permeability with moderate selectivity. The gas permeability dropped significantly coupled with a moderate increase in selectivity after long-term physical aging of 180 days.

Novel 6FDA-based polyimides derived from sterically hindered Tröger's base diamines: Synthesis and gas permeation properties

KAUST Repository

Ghanem, Bader; Alaslai, Nasser Y.; Miao, Xiaohe; Pinnau, Ingo

2016-01-01

Two novel Tröger's base-based di-o-substituted diamine monomers were synthesized and used to prepare two intrinsically microporous 6FDA-based polyimides (PIM-PI-TB-1 and PIM-PI-TB-2) with high molecular weight, high thermal stability and excellent solubility in common organic solvents. Compared to previously reported methods for preparing TB-based diamines, which are based on reduction of dimerized nitro-substituted anilines or condensation of phenylenediamine derivatives with dianhydrides, the novel protocol can be used to prepare different functionalized TB-based diamine monomers from a wide variety of aniline derivatives. PIM-PI-TB-1 (made from 6FDA and dibromo-tetramethyl-substituted TB diamine) and PIM-PI-TB-2 (made from 6FDA and tetramethyl-substituted TB diamine) are intrinsically microporous polymers with high BET surface areas of 440 m2/g and 580 m2/g, respectively. Pure-gas permeability coefficients of He, H2, N2, O2, CH4, and CO2 were measured at 35 °C and 2 bar for fresh and 180 days aged films. Both TB-based polyimides exhibited high gas permeability with moderate selectivity. The gas permeability dropped significantly coupled with a moderate increase in selectivity after long-term physical aging of 180 days.

Kinetic response study in chemiresistive gas sensor based on carbon nanotube surface functionalized with substituted phthalocyanines

Energy Technology Data Exchange (ETDEWEB)

Sharma, Anshul Kumar; Saini, Rajan; Bedi, R. K.; Mahajan, Aman, E-mail: dramanmahajan@yahoo.co.in, E-mail: anshulsharma.phy@gmail.com [Material Science Laboratory, Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Kumar, Pankaj [Department of Applied Sciences, I.K. Gujral Punjab Technical University, Kapurthala 144601 (India)

2016-05-06

A kind of hybrid material is prepared by functionalizing multi-wall carbon nanotubes (MWCNTs-COOH) with substituted copper phthalocyanine and the formation of CuPcOC{sub 8}/MWCNTs-COOH hybrid is confirmed by scanning electron microscopy and transmission electron microscopy. The results indicated that on the surface of nanotubes substituted CuPcOC{sub 8} derivatives has been successfully anchored through π-π stacking interaction. The gas sensing application of the fabricated hybrid material is tested upon exposure to different hazardous species, specifically NO{sub 2}, NO, Cl{sub 2} and NH{sub 3} at operating temperature of 150°C. It has been demonstrated that for Cl{sub 2} minimum detection limit of CuPcOC{sub 8}/MWCNTs-COOH hybrid is 100 ppb. The response of hybrid sensor is found to be increased with increase in the concentration of Cl{sub 2}.

21 CFR 184.1259 - Cocoa butter substitute.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Cocoa butter substitute. 184.1259 Section 184.1259... FOR HUMAN CONSUMPTION (CONTINUED) DIRECT FOOD SUBSTANCES AFFIRMED AS GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1259 Cocoa butter substitute. (a) The common or...

40 CFR 721.562 - Substituted alkylamine salt.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted alkylamine salt. 721.562 Section 721.562 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.562 Substituted alkylamine salt...

Law of substitution for mixed arrays

International Nuclear Information System (INIS)

Koudelka, A.J.

1987-01-01

The nuclear safety justification of a mixed array of dissimilar fissile units of metal units and dilute solution units, according to Clayton, has been a persistent and nagging problem. Dissimilar uranium metal or dissimilar uranium solution units in a mixed array can also create a modeling nightmare for the nuclear criticality safety engineer. Now, a calculational method known as the Law of Substitution has been developed to ensure that the k/sub eff/ of an array of uranium metal and uranium solution units will satisfy any k/sub eff/ limit set by the nuclear safety engineer. The nuclear criticality safety engineer can utilize the Law of Substitution to safely mix or substitute different uranium metal units, different uranium solution units, and more importantly, uranium metal and dilute UO 2 solution units in an array. The Law of Substitution is as follows: (1) calculate the k/sub eff/ of each unit type in its own infinite planar array. (2) Determine the edge-to-edge spacing of the infinite planar array of each type of unit to satisfy a desired k/sub eff/. (3) Select the largest edge-to-edge spacing from among the similar units in their infinite planar arrays and use that spacing for the finite or infinite planar array of mixed units

Influence of substitution on the proton donor and proton acceptor abilities of molecules. III. Study of chlorine and ftorine substitution alcohol

International Nuclear Information System (INIS)

Nurulloev, M.; Narziev, B.N.; Islomov, Z.; Fayzieva, M.

2006-01-01

This work gives the study of influence of chlorine and ftorine atoms as substitutions to proton donor and proton acceptor ability of primary, secondary and tertiary alifatic alcohol. In accordance to developed method the proton donor ability of studied substances are determined. It is shown that the quantity of proton donor ability of reactionary center of the molecules depend on substitution nature and its proton acceptor quantity. Proposed that substitution influence of these molecule mainly transferred by inductive effect

Electron transport and nonlinear optical properties of substituted aryldimesityl boranes: a DFT study.

Directory of Open Access Journals (Sweden)

Altaf Hussain Pandith

Full Text Available A comprehensive theoretical study was carried out on a series of aryldimesityl borane (DMB derivatives using Density Functional theory. Optimized geometries and electronic parameters like electron affinity, reorganization energy, frontiers molecular contours, polarizability and hyperpolarizability have been calculated by employing B3PW91/6-311++G (d, p level of theory. Our results show that the Hammett function and geometrical parameters correlates well with the reorganization energies and hyperpolarizability for the series of DMB derivatives studied in this work. The orbital energy study reveals that the electron releasing substituents increase the LUMO energies and electron withdrawing substituents decrease the LUMO energies, reflecting the electron transport character of aryldimesityl borane derivatives. From frontier molecular orbitals diagram it is evident that mesityl rings act as the donor, while the phenylene and Boron atom appear as acceptors in these systems. The calculated hyperpolarizability of secondary amine derivative of DMB is 40 times higher than DMB (1. The electronic excitation contributions to the hyperpolarizability studied by using TDDFT calculation shows that hyperpolarizability correlates well with dipole moment in ground and excited state and excitation energy in terms of the two-level model. Thus the results of these calculations can be helpful in designing the DMB derivatives for efficient electron transport and nonlinear optical material by appropriate substitution with electron releasing or withdrawing substituents on phenyl ring of DMB system.

Substituting environmentally relevant flame retardants: assessment fundamentals. Vol. 1: results and summary overview; Erarbeitung von Bewertungsgrundlagen zur Substitution umweltrelevanter Flammschutzmittel. Bd. 1: Ergebnisse und zusammenfassende Uebersicht

Energy Technology Data Exchange (ETDEWEB)

Leisewitz, A.; Kruse, H.; Schramm, E.

2001-04-01

The study examines the status, trends and alternatives (substitution and reduction potentials) in the use of flame retardants in selected product sectors: construction; electronics and electrical engineering; rail vehicles; textiles/upholstery. In addition, the study characterises thirteen flame retardants in terms of material flows, applications and toxicology/ecotoxicology. Vol. I: Summary overview of flame retardant applications in Germany in 1999/2000; characterisation of 13 flame retardants in terms of substance properties and application-specific characteristics, range of applications and quantities; derivation of assessment fundamentals for flame retardants, focussing on toxicology/ecotoxicology, suitability for closed-loop substance management, and potential for substitution and reduction; summary assessment of 13 flame retardants; summary overview of flame retardant applications. Vol. II: Analysis of flame retardant applications (state of the art, trends, alternatives) in: unsaturated polyester (UP) resins (rail vehicles); polyurethane (PU) insulating foams and one component foams (OCF) (construction sector); plastics for generic uses in electronic and electrical equipment, in casings for electronic and electrical equipment and in printed circuit boards (electronics/electrical engineering); and in upholstery and mattresses (textile applications). Vol. III: Toxicological/ecotoxicological profiles of substances: Decabromodiphenyl oxide; Tetrabromobisphenol A; Bis[pentabromophenyl]ethane; Hexabromocyclodo-decane, Tris[chloropropyl]phosphate, Resorcinol-bis-diphenylphosphate; N-Hydroxymethyl-3-dimethylphosphonopropionamide, Red phosphorus, Ammonium polyphosphate, Melamin cyanurate, Aluminiumtrihydroxide, Sodium borate decahydrate, Antimony trioxide. (orig.) [German] Untersucht werden Stand, Trends und Alternativen (Substitutions- und Minderungspotentiale) beim Einsatz von Flammschutzmitteln (FSM) in ausgewaehlten Produkten aus: Baubereich, Elektrotechnik

[Contingency management in opioid substitution treatment].

Science.gov (United States)

Specka, M; Böning, A; Scherbaum, N

2011-07-01

The majority of opiate-dependent patients in substitution treatment show additional substance-related disorders. Concomitant use of heroin, alcohol, benzodiazepines or cocaine compromises treatment success. Concomitant drug use may be treated by using contingency management (CM) which is based on learning theory. In CM, abstinence from drugs, as verified by drug screenings, is reinforced directly and contingently. Reinforcers used in CM studies with substituted patients were, amongst others, vouchers and take-home privileges. Studies in the USA show a medium average effect of CM on drug consumption rates and abstinence. The effects decrease markedly after the end of the intervention. We discuss whether CM is applicable within the German substitution treatment system and how it can be combined with other interventions such as selective detoxification treatments or cognitive-behavioural programmes. © Georg Thieme Verlag KG Stuttgart · New York.

Substitution between Cars within the Household

DEFF Research Database (Denmark)

de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects...... of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices...

Synthesis of Phthalimide Derivatives as Potential PPAR-γ Ligands

Directory of Open Access Journals (Sweden)

So Hyeon Eom

2016-06-01

Full Text Available Paecilocin A, a phthalide derivative isolated from the jellyfish-derived fungus Paecilomyces variotii, activates PPAR-γ (Peroxisome proliferator-activated receptor gamma in rat liver Ac2F cells. Based on a SAR (Structure-activity relationships study and in silico analysis of paecilocin A-mimetic derivatives, additional N-substituted phthalimide derivatives were synthesized and evaluated for PPAR-γ agonistic activity in both murine liver Ac2F cells and in human liver HepG2 cells by luciferase assay, and for adipogenic activity in 3T3-L1 cells. Docking simulation indicated PD6 was likely to bind most strongly to the ligand binding domain of PPAR-γ by establishing crucial H-bonds with key amino acid residues. However, in in vitro assays, PD1 and PD2 consistently displayed significant PPAR-γ activation in Ac2F and HepG2 cells, and adipogenic activity in 3T3-L1 preadipocytes.

Substitution as a Device of Grammatical Cohesion in English Contexts

Directory of Open Access Journals (Sweden)

Mohammad Reza Hasannejad

2012-05-01

Full Text Available The present study set out to investigate the effect of teaching substitution as a kind of grammatical cohesion on the true identification of confusing substitution elements with cohesive or non-cohesive roles in different contexts and also the production of modal, reporting and conditional contexts through clausal substitution acquaintance. To this end, the following procedures were taken. First 120 male and female EFL students were selected from Iranshahr Azad University. Having administered the language proficiency test, researchers selected 80 students as intermediate subjects according to their TOEFL band scores. First, pretests of cohesion identification (substitution and production of modal, reporting and conditional environments were administered to both control and experimental groups. Then, the experimental group was exposed to the teaching of the above-said above-mentioned cohesive device. Finally, post-tests of substitution elements’ identification and modal, reporting and conditional contexts’ production through clausal substitution familiarity were administered. The results showed that cohesive device treatment helped students on the true identification of substitution elements. Another finding proved that EFL students might have no difficulty in learning certain rules or classification of rules and application of their clausal substitution knowledge in creating modal, reporting and conditional contexts. Our findings can have implications for the field of language learning and teaching.

1-ethyl gallate-2-substituted phenoxymethyl benzimidazoles: synthesis, molecular structure, antimicrobial activities and complex with cr(iii)

International Nuclear Information System (INIS)

Zhao, L.; Wu, J.; Wu, J.; Wang, Z.; Gu, H.

2017-01-01

The design of gallate and benzimidazole containing derivatives is expected to produce new bioactive molecules with multiple applications. Here the synthesis of eight novel benzimidazole compounds containing ethyl gallate and substituted phenoxymethyl units are reported. Firstly, the ring closure reaction between o-phenylendiamine and substituted phenoxyacetic acids resulted in 2-substituted phenoxymethyl benzimidazoles that were then modified by the N-hydroxyethylation with 2-chloroethyl alcohol under a phase transfer catalysis condition. The obtained 1-hydroxyethyl-2-substituted phenoxymethyl benzimidazoles were finally translated into the target title compounds 8a-h by an indirect esterification method in which three O-H groups of gallic acid were first protected by acetyls and deprotected after the esterification reaction by adding hydrazine hydrate. The structures of the title products 8a-h were fully characterized and confirmed by elemental analysis, MS, IR, 1H-NMR, 13C-NMR and single crystal X-ray diffraction techniques. Antimicrobial tests by inhibition zones indicated that these compounds exhibited diverse inhibitory effects against the test bacteria and fungi, and the type and position of the substituent groups in the phenoxymethyl moieties had obvious influence on their antimicrobial activities. Furthermore, the Cr(III) complex of 8h was synthesized, and various spectral, elemental and thermal analysis results confirmed that the central Cr(III) atom coordinated with adjacent hydroxyl groups of two 8h ligands, nitrate and H2O, respectively. (author)

Ring-substituted 4-Hydroxy-1H-quinolin-2-ones: Preparation and Biological Activity

Directory of Open Access Journals (Sweden)

Jiri Dohnal

2009-03-01

Full Text Available In the study, a series of twelve ring-substituted 4-hydroxy-1H-quinolin-2-one derivatives were prepared. The procedures for synthesis of the compounds are presented. The compounds were analyzed using RP-HPLC to determine lipophilicity and tested for their photosynthesis-inhibiting activity using spinach (Spinacia oleracea L. chloroplasts. All the synthesized compounds were also evaluated for antifungal activity using in vitro screening with eight fungal strains. For all the compounds, the relationships between the lipophilicity and the chemical structure of the studied compounds are discussed, as well as their structure-activity relationships (SAR.

Associations between generic substitution and patient-related factors

DEFF Research Database (Denmark)

Østergaard Rathe, Jette

Associations between generic substitution and patient-related factors Jette Østergaard Rathe1, Pia V. Larsen1, Morten Andersen2, Janus L. Thomsen3, Maja S. Paulsen1, Jens Søndergaard1 1. Research Unit of General Practice, Institute of Public Health, University of Southern Denmark 2. Centre...... for Pharmacoepidemiology, Karolinska Institutet, Department of Medicine Solna, Stockholm, Sweden 3. Danish Quality Unit of General Practice, Odense, Denmark Background Generic substitution means that chemically equivalent but less expensive drugs are dispensed in place of a brand name product. Although generic medicines...... by definition are bioequivalent to their brand name counterparts there are concerns about whether generic substitution is always accompanied by clinical equivalence in terms of effectiveness and that it may cause concerns and thereby causing some skepticism towards generic substitution. There is, however...

Synthesis and biological evaluation of new C-12(α/β)-(N-) sulfamoyl-phenylamino-14-deoxy-andrographolide derivatives as potent anti-cancer agents.

Science.gov (United States)

Kandanur, Sai Giridhar Sarma; Nanduri, Srinivas; Golakoti, Nageswara Rao

2017-07-01

Andrographolide, the major diterpenoidal constituent of Andrographis paniculata (Acanthaceae) and its derivatives have been reported to possess plethora of biological properties including potent anti-cancer activity. In this work, synthesis and in-vitro anti-cancer evaluation of new C-12-substituted aryl amino 14-deoxy-andrographolide derivatives (III a-f) are reported. The substitutions include various sulfonamide moieties -SO 2 -NH-R 1 . The new derivatives (III a-e) exhibited improved cytotoxicity (GI 50 , TGI and LC 50 ) compared to andrographolide (I) and the corresponding 3,14,19-O-triacetyl andrographolide (II) when evaluated against 60 NCI cell line panel. Compounds III c and III e are found to be non-toxic to normal human dermal fibroblasts (NHDF) cells compared to reference drug THZ-1. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dual Inhibition of AChE and BChE with the C-5 Substituted Derivative of Meldrum’s Acid: Synthesis, Structure Elucidation, and Molecular Docking Studies

Directory of Open Access Journals (Sweden)

Haroon Mehfooz

2017-07-01

Full Text Available Alzheimer’s disease (AD lies in the category of those diseases which are still posing challenges to medicinal chemists, and the search for super-effective drugs for the treatment of AD is a work in progress. The inhibition of cholinesterase is considered a viable strategy to enhance the level of acetylcholine in the brain. The C-5 substituted derivative of Meldrum’s acid was synthesized and screened against acetylcholinesterase (AChE and butyrylcholinesterase (BChE enzyme inhibition activity. The simple and unique structure of synthesized derivative 3 was found to be good for the dual inhibition of both enzymes (AChE and BChE. 2,2-Dimethyl-5-(([2-(trifluoromethyl phenyl]aminomethylidene-1,3-dioxane-4,6-dione (3 showed significant inhibition against AChE, with an IC50 value of 1.13 ± 0.03 µ M (Standard Neostigmine 22.2 ± 3.2 µM, and moderate inhibition against BChE, with an IC50 value of 2.12 ± 1.22 µM (Standard Neostigmine 49.6 ± 6.11 µM. The structural insights reveal that compound 3 possesses intriguing reactive groups, which can potentially evoke the non-covalent interactions and possibly assist by binding in the active site of the target protein. Docking simulations revealed that the compound 3 showed binding inside the active site gorges of both AChE and BChE. An excellent agreement was obtained, as the best docked poses showed important binding features mostly based on interactions due to oxygen atoms and the aromatic moieties of the compound. The docking computations coupled with the experimental findings ascertained that the compound 3 can serve as a scaffold for the dual inhibitors of the human acetylcholine esterases.

Exploring 6-(substituted sulfonyl)imidazopyridines as a potential scaffold for the design of 5-HT6 ligands

International Nuclear Information System (INIS)

Heloire, V.M.; Furman, C.; Melnyk, P.; Carato, P.

2013-01-01

Cognitive dysfunction is a characteristic of various forms of dementia such as Alzheimer's disease. We have focused on the 5-HT 6 receptor in order to identify potent ligands. Herein we report the design of a novel series of 6-sulfonylimidazole derivatives substituted with an alkylamino chain at the 2- or 3-position, their synthesis, and their ability to interact with 5-HT 6 receptors as evaluated in radioligand binding assays. (author)

Synthesis, Leishmanicidal Activity and Theoretical Evaluations of a Series of Substituted bis-2-Hydroxy-1,4-Naphthoquinones

Directory of Open Access Journals (Sweden)

Morgana V. de Araújo

2014-09-01

Full Text Available A series of eight substituted bis-2-hydroxy-1,4-naphthoquinone derivatives was synthesized through lawsone condensation with various aromatic and aliphatic aldehydes under mild acidic conditions. The title compounds were evaluated for antileishmanial activity in vitro against Leishmania amazonensis and Leishmania braziliensis promastigotes; six compounds showed good activity without significant toxic effects. The compound with the highest activity was used for an in vivo assay with Leishmania amazonensis.

Diffusion of anthracene derivatives on Cu(111) studied by STM and DFT

Science.gov (United States)

Wyrick, Jonathan; Bartels, Ludwig; Einstein, Theodore

2014-03-01

Substituted anthracenes have drawn attention due to their ability to diffuse uniaxially on a Cu(111) surface. We compare anthracene to three of its derivatives whose 9,10 hydrogens are replaced by elements of the chalcogen group that act as linkers binding the molecules to a Cu(111) substrate. DFT calculations shed light on STM imaging and diffusion studies on the three substituted species. We present an analysis of the DFT results in which energetic contributions to the diffusion barriers are partitioned among the Kohn-Sham orbitals, allowing us to make assignments as to how each orbital affects diffusion for each species and draw comparisons between them. Present address: Center for Nanoscale Science and Technology, NIST, Gaithersburg, MD.

Biology-Oriented Syntheses (BIOS) of Novel Santonic-1,3,4-oxadiazole Derivatives under Microwave-Irradiation and their Antimicrobial Activity

International Nuclear Information System (INIS)

Salar, U.; Khan, K. M.; Naz, F.; Siddiqui, N. I.

2015-01-01

Novel 2-thio substituted 1,3,4-oxadiazole derivatives of santonic acid (13-18) were synthesized. The synthesis of these derivatives was comprised of six steps which start from the basic hydrolysis of santonin 1 to the santoninic acid 2 followed by in situ rearrangement of 2 into santonic acid 3. Santonic acid 3 was then converted into its acyl imidazole derivative 4 followed by hydrazinolysis to give santonic carbohydrazide 5 which was further converted into santonic-1,3,4-oxadiazole-2-thiol 6. Santonic-1,3,4-oxadiazole-2-thiol 6 was alkylated to afford 2-thio substituted 1,3,4-oxadiazole derivatives of santonic acid (13-18). All the synthetic steps were carried out under microwave irradiation in controlled parameters. Compounds 13-18 along with intervening intermediates 5 and 6 were evaluated for their antimicrobial potential. Compound 14 showed appreciably good activity against Staphylococcus epidermidis. On the other hand compounds 6 and 17 demonstrated good activity against Escherichia coli and Shigella flexeneri, respectively. Compound 6 showed good antifungal activity. The synthesized compounds were characterized by different spectroscopy techniques. (author)

Long term substitution treatment (maintenance treatment of opioid dependent persons

Directory of Open Access Journals (Sweden)

Wirl, Charlotte

2007-03-01

Full Text Available Health political background: Methadone substitution treatment in Germany is introduced in 1988 in the framework of a scientific pilot study in North Rhein Westphalia. Recent statistics show that by now a broad offer of substitution treatment exists. From 1 June 2002 to 31 December 2003 113,000 substitution treatments have been recorded as being started of which around 56,000 have been recorded as ongoing treatments by 1 December 2003. Scientific background: Substitution treatment (treatment of opioid-dependent persons using substitution substances is one part of addiction treatment. Its goals are harm reduction and the stabilisation of opioid dependent persons. Integration of opioid-dependent persons in a treatment-setting, reduction of consumption of psychoactive substances, reduction of risk behaviour (primarily related to infectious diseases, decrease of mortality and improvements concerning the social, psychic and physic situation are seen as a success of substitution treatment as maintenance therapy. Research questions: The aim of this HTA report is to investigate which indicators can be used to evaluate the effectiveness of substitution treatment. Based on these indicators an evaluation of the medical, social and economical benefit of substitution treatment - also in relation to abstinence oriented treatment - is carried out. Methods: A systematic literature search was performed in 31 international databases which yielded 2451 articles with publication date between 1995 and February 2005. Results: After a twofold selection process 32 publications were included for assessment and 276 publications were used as background literature. Despite serious restrictions due to selection bias and dropout in most studies focusing on substitution treatment, reduction of consumption of illegal opioids, reduction of risk behaviour, criminal behaviour, mortality and incidence of HIV can be seen as an empirically proven success of substitution treatment

Ugi-Smiles couplings of 4-substituted pyridine derivatives: a fast access to chloroquine analogues.

Science.gov (United States)

El Kaïm, Laurent; Grimaud, Laurence; Pravin, Patil

2012-01-20

4-Hydroxy and mercapto pyridines were successfully tested in Ugi-Smiles couplings. Such multicomponent reactions applied to quinoline derivatives afford a very convenient and short synthesis of antimalarial analogues. © 2011 American Chemical Society

Synthesis of New Imidazolidin-2,4-dione and 2-Thioxoimidazolidin-4-ones via C-Phenylglycine Derivatives

Directory of Open Access Journals (Sweden)

José Alixandre de Sousa Luis

2009-12-01

Full Text Available Hydantoins and their derivatives constitute a group of pharmaceutical compounds with anticonvulsant and antiarrhythmic properties, and are also used against diabetes. N-3 and C-5 substituted imidazolidines are examples of such products. As such, we have developed a synthesis of 2,4-dione and 2-thioxo-4-one imidazolidinic derivatives by reaction of amino acids with C-phenylglycine, phenyl isocyanate and phenyl isothiocyanate. Four amino-derivatives IG(1-4 and eight imidazolidinic derivatives, IM(1-8, were obtained in yields of 70–74%. The mass, infrared, 1H and 13C-NMR spectra of representative products are discussed.

Cascade alkylarylation of substituted N-allylbenzamides for the construction of dihydroisoquinolin-1(2H-ones and isoquinoline-1,3(2H,4H-diones

Directory of Open Access Journals (Sweden)

Ping Qian

2016-02-01

Full Text Available An oxidative reaction for the synthesis of 4-alkyl-substituted dihydroisoquinolin-1(2H-ones with N-allylbenzamide derivatives as starting materials has been developed. The radical alkylarylation reaction proceeds through a sequence of alkylation and intramolecular cyclization. The substituent on the C–C double bond was found to play a key role for the progress of the reaction to give the expected products with good chemical yields. Additionally, N-methacryloylbenzamides were also suitable substrates for the current reaction and provided the alkyl-substituted isoquinoline-1,3(2H,4H-diones in good yield.

X-ray sensitization of chromatids with unifilarly and bifilarly substituted DNA

International Nuclear Information System (INIS)

Wolff, S.

1981-01-01

When cells are grown for two rounds of DNA replication in the presence of the thymidine analogue 5-bromodeoxyuridine, chromosomes containing one chromatid with unifilarly substituted DNA and one with bifilarly substituted DNA are found. These can be distinguished by harlequin staining techniques that stain one chromatid dark and one light. When the degree of substitution is 60% or greater, 3 times as many X-ray-induced chromatid breaks are produced as in unsubstituted chromatids. This represents maximal sensitization. The unifilarly substituted (dark) chromatid is as sensitive as its bifilarly substituted (light) sister chromatid. If cells are grown in low concentrations of 5-bromodeoxyuridine (BrdUrd), then the amount of substitution is less and the bifilarly substituted chromatic is more sensitive than the unifilarly substituted one. When large numbers of cells are grown in very low concentrations of BrdUrd, the analogue is almost completely depleted during the first round of replication leading to harlequin chromosomes containing one unsubstituted (dark) and one unifilarly substituted (light) chromatid. Under these conditions a maximal sensitization between light-staining and dark-staining chromatids can occur. This can be confused with the differential sensitivity between unifilarly and bifilarly substituted chromatids. The apparent discrepant results obtained by different investigators are most likely caused by the use of very low levels of BrdUrd in some of the experiments. (orig.)

[Currently available skin substitutes].

Science.gov (United States)

Oravcová, Darina; Koller, Ján

2014-01-01

The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. Autologous split or full-thickness skin graft are the best definitive burn wound coverage, but it is constrained by the limited available sources, especially in major burns. Donor site morbidities in term of additional wounds and scarring are also of concern of the autograft application. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. This paper reviews currently available skin substitutes, produced in not for-profit skin banks as well as commercially available. They are divided according to type of material included, as biological, biosynthetic and synthetic and named respectively.

Coralline hydroxyapatite bone graft substitutes in a canine metaphyseal defect model: Radiographic-biomechanical correlation

International Nuclear Information System (INIS)

Sartoris, D.J.; Resnick, D.; Holmes, R.E.; Tencer, A.F.; Texas Univ., Dallas; Mooney, V.

1986-01-01

Radiographic and biomechanical assessment of a new type of bone graft substitute derived from reef-building sea coral was performed in a canine metaphyseal defect model. Blocks of this material and autogenous iliac crest graft were implanted, respectively, into the right and left proximal tibial metaphyses of eight dogs. Qualitative and quantitative radiographic evaluation was performed in the immediate postoperative period and at 6 months after surgery. Biomechanical testing was carried out on all grafts following harvest at 6 months, as well as on nonimplanted coralline hydroxyapatite and autogenous iliac cancellous bone. In contrast to autografts, incorporation of coralline implants was characterized by predictable osseous growth and apposition with preservation of intrinsic architecture. Greater percent increase in radiography density, higher ultimate compressive strength, and lower stiffness with incorporation were documented advantages of coralline hydroxyapatite over autogenous graft. Densitometric measurements correlated moderately with strength for both types of graft material (r=0.65). These promising results have important implications to the clinical application of coralline hydroxyapatite bone graft substitutes as an alternative to autogenous grafting. (orig.)

Evaluating rare amino acid substitutions (RGC_CAMs in a yeast model clade.

Directory of Open Access Journals (Sweden)

Kenneth Polzin

Full Text Available When inferring phylogenetic relationships, not all sites in a sequence alignment are equally informative. One recently proposed approach that takes advantage of this inequality relies on sites that contain amino acids whose replacement requires multiple substitutions. Identifying these so-called RGC_CAM substitutions (after Rare Genomic Changes as Conserved Amino acids-Multiple substitutions requires that, first, at any given site in the amino acid sequence alignment, there must be a minimum of two different amino acids; second, each amino acid must be present in at least two taxa; and third, the amino acids must require a minimum of two nucleotide substitutions to replace each other. Although theory suggests that RGC_CAM substitutions are expected to be rare and less likely to be homoplastic, the informativeness of RGC_CAM substitutions has not been extensively evaluated in biological data sets. We investigated the quality of RGC_CAM substitutions by examining their degree of homoplasy and internode certainty in nearly 2.7 million aligned amino acid sites from 5,261 proteins from five species belonging to the yeast Saccharomyces sensu stricto clade whose phylogeny is well-established. We identified 2,647 sites containing RGC_CAM substitutions, a number that contrasts sharply with the 100,887 sites containing RGC_non-CAM substitutions (i.e., changes between amino acids that require only a single nucleotide substitution. We found that RGC_CAM substitutions had significantly lower homoplasy than RGC_non-CAM ones; specifically RGC_CAM substitutions showed a per-site average homoplasy index of 0.100, whereas RGC_non-CAM substitutions had a homoplasy index of 0.215. Internode certainty values were also higher for sites containing RGC_CAM substitutions than for RGC_non-CAM ones. These results suggest that RGC_CAM substitutions possess a strong phylogenetic signal and are useful markers for phylogenetic inference despite their rarity.

Anthropogenic areas as incidental substitutes for original habitat.

Science.gov (United States)

Martínez-Abraín, Alejandro; Jiménez, Juan

2016-06-01

One speaks of ecological substitutes when an introduced species performs, to some extent, the ecosystem function of an extirpated native species. We suggest that a similar case exists for habitats. Species evolve within ecosystems, but habitats can be destroyed or modified by natural and human-made causes. Sometimes habitat alteration forces animals to move to or remain in a suboptimal habitat type. In that case, the habitat is considered a refuge, and the species is called a refugee. Typically refugee species have lower population growth rates than in their original habitats. Human action may lead to the unintended generation of artificial or semiartificial habitat types that functionally resemble the essential features of the original habitat and thus allow a population growth rate of the same magnitude or higher than in the original habitat. We call such areas substitution habitats and define them as human-made habitats within the focal species range that by chance are partial substitutes for the species' original habitat. We call species occupying a substitution habitat adopted species. These are 2 new terms in conservation biology. Examples of substitution habitats are dams for European otters, wheat and rice fields for many steppeland and aquatic birds, and urban areas for storks, falcons, and swifts. Although substitution habitats can bring about increased resilience against the agents of global change, the conservation of original habitat types remains a conservation priority. © 2016 Society for Conservation Biology.

Pitfalls of the most commonly used models of context dependent substitution

Directory of Open Access Journals (Sweden)

Huttley Gavin A

2008-12-01

Full Text Available Abstract Background Neighboring nucleotides exert a striking influence on mutation, with the hypermutability of CpG dinucleotides in many genomes being an exemplar. Among the approaches employed to measure the relative importance of sequence neighbors on molecular evolution have been continuous-time Markov process models for substitutions that treat sequences as a series of independent tuples. The most widely used examples are the codon substitution models. We evaluated the suitability of derivatives of the nucleotide frequency weighted (hereafter NF and tuple frequency weighted (hereafter TF models for measuring sequence context dependent substitution. Critical properties we address are their relationships to an independent nucleotide process and the robustness of parameter estimation to changes in sequence composition. We then consider the impact on inference concerning dinucleotide substitution processes from application of these two forms to intron sequence alignments from primates. Results We prove that the NF form always nests the independent nucleotide process and that this is not true for the TF form. As a consequence, using TF to study context effects can be misleading, which is shown by both theoretical calculations and simulations. We describe a simple example where a context parameter estimated under TF is confounded with composition terms unless all sequence states are equi-frequent. We illustrate this for the dinucleotide case by simulation under a nucleotide model, showing that the TF form identifies a CpG effect when none exists. Our analysis of primate introns revealed that the effect of nucleotide neighbors is over-estimated under TF compared with NF. Parameter estimates for a number of contexts are also strikingly discordant between the two model forms. Conclusion Our results establish that the NF form should be used for analysis of independent-tuple context dependent processes. Although neighboring effects in general are

Spectrophotometric determination of copper in alkaline solutions and evaluation of some hydroxy-substituted 1,10-phenanthrolines as chromogenic reagents.

Science.gov (United States)

Dunbar, W E; Schilt, A A

1972-09-01

Seven new hydroxy-substituted 1,10-phenanthroline derivatives have been evaluated as chromogenic reagents for the determination of copper in strongly alkaline solution. The most sensitive of these, 2,9-dimethyl-4,7-dihydroxy-1,10-phenanthroline, has proven to be highly effective in a simple, rapid procedure for determining trace amounts of copper in sodium hydroxide, potassium carbonate, sodium phosphate or ammonium hydroxide.

Dissecting the Structure-Function Relationship of a Fungicidal Peptide Derived from the Constant Region of Human Immunoglobulins

OpenAIRE

Ciociola, Tecla; Pertinhez, Thelma A.; Giovati, Laura; Sperindè, Martina; Magliani, Walter; Ferrari, Elena; Gatti, Rita; D'Adda, Tiziana; Spisni, Alberto; Conti, Stefania; Polonelli, Luciano

2016-01-01

Synthetic peptides encompassing sequences related to the complementarity-determining regions of antibodies or derived from their constant region (Fc peptides) were proven to exert differential antimicrobial, antiviral, antitumor, and/or immunomodulatory activities in vitro and/or in vivo, regardless of the specificity and isotype of the parental antibody. Alanine substitution derivatives of these peptides exhibited unaltered, increased, or decreased candidacidal activities in vitro. The bioac...

Microwave-induced facile synthesis of water-soluble fluorogenic alginic acid derivatives.

Science.gov (United States)

Chhatbar, Mahesh U; Meena, Ramavatar; Prasad, Kamalesh; Chejara, Dharmesh R; Siddhanta, A K

2011-04-01

A facile microwave-induced method was developed for synthesizing water-soluble fluorescent derivatives of alginic acid (ALG) with four different diamines, hydrazine (HY), ethylenediamine (EDA), 1,6-hexanediamine (HDA), and 1,4-cyclohexanediamine (CHDA), followed by a cross-linking reaction with a natural cross linker genipin. The ethylenediamine derivative of alginic acid (ALG-EDA) exhibited good fluorescent activity, which upon cross linking was enhanced threefold. The other amide derivatives, for example, ALG-HY, ALG-HDA, and ALG-CHDA, were not fluorescent, but their respective crosslinked products exhibited excellent fluorescent activity. The fluorescence intensity had an inverse correlation with the number of carbon atoms present in the amine, which in turn was a function of degree of substitution (DS). These fluorescent polysaccharide derivatives are of potential utility in the domain of sensor applications. Copyright © 2011 Elsevier Ltd. All rights reserved.

Synthesis, fluorescence properties and the promising cytotoxicity of pyrene-derived aminophosphonates.

Science.gov (United States)

Lewkowski, Jarosław; Rodriguez Moya, Maria; Wrona-Piotrowicz, Anna; Zakrzewski, Janusz; Kontek, Renata; Gajek, Gabriela

2016-01-01

A large series of variously substituted amino(pyren-1-yl)methylphosphonic acid derivatives was synthesized using a modified aza-Pudovik reaction in 20-97% yields. The fluorescence properties of the obtained compounds were investigated revealing that N-alkylamino(pyren-1-yl)methylphosphonic derivatives are stronger emissive compounds than the corresponding N-aryl derivatives. N-Benzylamino(pyren-1-yl)methylphosphonic acid displayed strong fluorescence (ΦF = 0.68) in phosphate-buffered saline (PBS). The influence of a series of derivatives on two colon cancer cell lines HT29 and HCT116 was also investigated. The most promising results were obtained for N-(4-methoxyphenyl)amino(pyren-1-yl)methylphosphonate, which was found to be cytotoxic for the HCT116 cancer cell line (IC50 = 20.8 μM), simultaneously showing weak toxicity towards normal lymphocytes (IC50 = 230.8 µM).

Synthesis, fluorescence properties and the promising cytotoxicity of pyrene–derived aminophosphonates

Directory of Open Access Journals (Sweden)

Jarosław Lewkowski

2016-06-01

Full Text Available A large series of variously substituted amino(pyren-1-ylmethylphosphonic acid derivatives was synthesized using a modified aza-Pudovik reaction in 20–97% yields. The fluorescence properties of the obtained compounds were investigated revealing that N-alkylamino(pyren-1-ylmethylphosphonic derivatives are stronger emissive compounds than the corresponding N-aryl derivatives. N-Benzylamino(pyren-1-ylmethylphosphonic acid displayed strong fluorescence (ΦF = 0.68 in phosphate-buffered saline (PBS. The influence of a series of derivatives on two colon cancer cell lines HT29 and HCT116 was also investigated. The most promising results were obtained for N-(4-methoxyphenylamino(pyren-1-ylmethylphosphonate, which was found to be cytotoxic for the HCT116 cancer cell line (IC50 = 20.8 μM, simultaneously showing weak toxicity towards normal lymphocytes (IC50 = 230.8 µM.

Chiral monolithic absorbent constructed by optically active helical-substituted polyacetylene and graphene oxide: preparation and chiral absorption capacity.

Science.gov (United States)

Li, Weifei; Wang, Bo; Yang, Wantai; Deng, Jianping

2015-02-01

Chiral monolithic absorbent is successfully constructed for the first time by using optically active helical-substituted polyacetylene and graphene oxide (GO). The preparative strategy is facile and straightforward, in which chiral-substituted acetylene monomer (Ma), cross-linker (Mb), and alkynylated GO (Mc) undergo copolymerization to form the desired monolithic absorbent in quantitative yield. The resulting monoliths are characterized by circular dichroism, UV-vis absorption, scanning electron microscopy (SEM), FT-IR, Raman, energy-dispersive spectrometer (EDS), X-ray diffraction (XRD), Brunauer-Emmett-Teller (BET), XPS, and thermogravimetric analysis (TGA) techniques. The polymer chains derived from Ma form chiral helical structures and thus provide optical activity to the monoliths, while GO sheets contribute to the formation of porous structures. The porous structure enables the monolithic absorbents to demonstrate a large swelling ratio in organic solvents, and more remarkably, the helical polymer chains provide optical activity and further enantio-differentiating absorption ability. The present study establishes an efficient and versatile methodology for preparing novel functional materials, in particular monolithic chiral materials based on substituted polyacetylene and GO. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Synthesis and Bioactivity of Pyrazole Acyl Thiourea Derivatives

Directory of Open Access Journals (Sweden)

Jian Wu

2012-05-01

Full Text Available Sixteen novel pyrazole acyl thiourea derivatives 6 were synthesized from monomethylhydrazine (phenylhydrazine and ethyl acetoacetate. The key 5-chloro-3-methyl-1-substituted-1H-pyrazole-4-carbonyl chloride intermediates 4 were first generated in four steps through cyclization, formylation, oxidation and acylation. Thess were then reacted with ammonium thiocyanate in the presence of PEG-400 to afford 5-chloro-3-methyl-1-substituted-1H-pyrazole-4-carbonyl isothiocyanates 5. Subsequent reaction with fluorinated aromatic amines resulted in the formation of the title compounds. The synthesized compound were unequivocally characterized by IR, ¹H-NMR, ¹³C-NMR and elemental analysis and some of the synthesized compounds displayed good antifungal activities against Gibberella zeae, Fusarium oxysporum, Cytospora mandshurica and anti-TMV activity in preliminary antifungal activity tests.

Substitute fluid examinations for liquid manure

Directory of Open Access Journals (Sweden)

Schrader Kevin

2017-01-01

Full Text Available For the farming industry it is essential to use liquid manure as natural fertilizer. Through new agricultural regulation 2015 in Germany the industry must develop new liquid manure spreader systems because the ammonia and methane emission are limited. In a research project the University of Applied Sciences Zwickau and some other industry partners will develop such a new innovative liquid manure spreader. The new liquid manure spreader should use pulsating air to distribute the liquid manure exactly. The pulsating air, which flows through the pipelines, should be analysed at a test station. For examinations at this test station it is important to find another substitute fluid because liquid manure smells strong, is not transparent and is also not homogeneous enough for scientific investigations. Furthermore it is important to ensure that the substitute fluid is, like liquid manure, a non-Newtonian fluid. The substitute fluid must be a shear-thinning substance - this means the viscosity decrease at higher shear rate. Many different samples like soap-water-farragoes, jelly-water-farragoes, agar-water-farragoes, soap-ethanol-farragoes and more are, for the project, examined in regard of their physical properties to find the best substitute fluid. The samples are examined at the rotational viscometer for viscosity at various shear rates and then compared with the viscosity values of liquid manure.

Substitute fluid examinations for liquid manure

Science.gov (United States)

Schrader, Kevin; Riedel, Marco; Eichert, Helmut

For the farming industry it is essential to use liquid manure as natural fertilizer. Through new agricultural regulation 2015 in Germany the industry must develop new liquid manure spreader systems because the ammonia and methane emission are limited. In a research project the University of Applied Sciences Zwickau and some other industry partners will develop such a new innovative liquid manure spreader. The new liquid manure spreader should use pulsating air to distribute the liquid manure exactly. The pulsating air, which flows through the pipelines, should be analysed at a test station. For examinations at this test station it is important to find another substitute fluid because liquid manure smells strong, is not transparent and is also not homogeneous enough for scientific investigations. Furthermore it is important to ensure that the substitute fluid is, like liquid manure, a non-Newtonian fluid. The substitute fluid must be a shear-thinning substance - this means the viscosity decrease at higher shear rate. Many different samples like soap-water-farragoes, jelly-water-farragoes, agar-water-farragoes, soap-ethanol-farragoes and more are, for the project, examined in regard of their physical properties to find the best substitute fluid. The samples are examined at the rotational viscometer for viscosity at various shear rates and then compared with the viscosity values of liquid manure.