WorldWideScience

Sample records for bengal region derived

  1. Sonodynamically-induced cytotoxicity by rose bengal derivative and microbubbles in isolated sarcoma 180 cells

    Science.gov (United States)

    Sugita, Nami; Hosokawa, Mami; Sunaga, Naoki; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko; Umemura, Shin-ichiro

    2015-07-01

    It is known that the combination of ultrasound and sonodynamic sensitizer (SDS) is effective in noninvasive tumor treatment, referred to as sonodynamic therapy (SDT). Microbubbles have been used in ultrasound therapy as well. The purpose of this paper is to clarify the effect of microbubbles on SDT. Sarcoma 180 cells were suspended in air-saturated phosphate-buffered saline and exposed to ultrasound with the SDS rose bengal derivative (RBD) in standing wave mode in the presence and absence of microbubbles [sonazoid (SZ)]. The ultrasonically induced cytotoxicity with RBD and SZ was about 20 times higher than without either, and about 80% of the SZ microbubbles were destructed by ultrasonic exposure in as short as five seconds. Since microbubbles induce significant cytotoxicity even with short duration, low intensity ultrasound, the application of microbubbles in SDT shows promise in anti-tumor treatment.

  2. Spectrum of hemoglobin variants in the population of northern region of West Bengal: An ethnogenetic proposition

    Directory of Open Access Journals (Sweden)

    Bidyut Krishna Goswami

    2014-01-01

    Full Text Available Context: The birth of transfusion-dependent states of hemoglobinopathies including thalassemias is preventable by population screening and genetic counseling. Magnitude is not addressed in the Northern Region of West Bengal where many ethnic variants inhabit. Aims and Objectives: The aim of the following study is to find out the burden of different entities of hemoglobinopathies, their correlation with ethnicity and the "at risk" groups. Subjects and Methods: A descriptive study was conducted from the Hematology Unit of North Bengal Medical College over 1 year on the subjects underwent screening for hemoglobinopathies for detection of abnormal hemoglobin (Hb variants by "cation-exchange high-performance liquid chromatography" principle along with other relevant tests. Statistical Analysis: Data was analyzed by frequency distribution and Chi-square test assuming P value as 95% of the level of significance using the SPSS version 16 (SPSS Inc., Chicago, Illinois, U.S.A. Result: Abnormal Hb variant was 47.5% among 1872. Hb E trait (34.4% was most common followed by Hb E disease (25.3% and others. Hb E disorders (92.7% were observed mostly among Rajbangsi population while E-β-thalassemias (40% in the Muslims and a heterogeneous pattern noted among tribal and mongoloid. Conclusion: Hb E hemoglobinopathies was high among Rajbangsi and Muslims with identification of some other hemoglobinopathies involving tribal and mongoloid.

  3. The hepatic excretion of 131I-rose bengal and sup(99m)Tc-IDA derivatives in Rotor's syndrome

    International Nuclear Information System (INIS)

    Galli, G.; Focacci, C.; Maini, C.L.; Salvatori, M.; Troncone, L.; Fedeli, G.L.; Rapaccini, G.L.

    1982-01-01

    Bilirubin kinetics and hepatobiliary excretion of some exogenous anions (BSP, 131 I-rose bengal, diethyl and parabutyl-IDA labeled with sup(99m)Tc) were studied in three patients presenting with Rotor's syndrome. Two were brothers; a noja undiced fraternal twin of one of them was also evaluated. The hepatic clearance of the radiopharmaceuticals was imparired in the affected patients but the degree of impairment was different among the tested anions, i.e., maximal for 99 Tc-diethyl-IDA and minimal for 131 I-rose bengal. Parabutyl-IDA was cleared better than the diethyl derivative. The metabolic derangement seems to be the level of transfer from plasma to liver and of the hepatic storage, rather than at the level of hepatocyte excretory pathways, as in the case of Dubin-Johnson syndrome. (orig.)

  4. Wind stress, curl and vertical velocity in the Bay of Bengal during southwest monsoon, 1984

    Digital Repository Service at National Institute of Oceanography (India)

    Babu, M.T.; Heblekar, A.K.; Murty, C.S.

    Wind distribution observed during southwest monsoon of 1984 has used to derive the mean wind stress for the season at every 1 degree square grid and curl over the Bay of Bengal. Two regions of maximum wind stress are present over the Bay of Bengal...

  5. Estimation of regional-scale groundwater flow properties in the Bengal Basin of India and Bangladesh

    Science.gov (United States)

    Michael, H.A.; Voss, C.I.

    2009-01-01

    Quantitative evaluation of management strategies for long-term supply of safe groundwater for drinking from the Bengal Basin aquifer (India and Bangladesh) requires estimation of the large-scale hydrogeologic properties that control flow. The Basin consists of a stratified, heterogeneous sequence of sediments with aquitards that may separate aquifers locally, but evidence does not support existence of regional confining units. Considered at a large scale, the Basin may be aptly described as a single aquifer with higher horizontal than vertical hydraulic conductivity. Though data are sparse, estimation of regional-scale aquifer properties is possible from three existing data types: hydraulic heads, 14C concentrations, and driller logs. Estimation is carried out with inverse groundwater modeling using measured heads, by model calibration using estimated water ages based on 14C, and by statistical analysis of driller logs. Similar estimates of hydraulic conductivities result from all three data types; a resulting typical value of vertical anisotropy (ratio of horizontal to vertical conductivity) is 104. The vertical anisotropy estimate is supported by simulation of flow through geostatistical fields consistent with driller log data. The high estimated value of vertical anisotropy in hydraulic conductivity indicates that even disconnected aquitards, if numerous, can strongly control the equivalent hydraulic parameters of an aquifer system. ?? US Government 2009.

  6. Hydroclimatology of Dual Peak Cholera Incidence in Bengal Region: Inferences from a Spatial Explicit Model

    Science.gov (United States)

    Bertuzzo, E.; Mari, L.; Righetto, L.; Casagrandi, R.; Gatto, M.; Rodriguez-Iturbe, I.; Rinaldo, A.

    2010-12-01

    The seasonality of cholera and its relation with environmental drivers are receiving increasing interest and research efforts, yet they remain unsatisfactorily understood. A striking example is the observed annual cycle of cholera incidence in the Bengal region which exhibits two peaks despite the main environmental drivers that have been linked to the disease (air and sea surface temperature, zooplankton density, river discharge) follow a synchronous single-peak annual pattern. A first outbreak, mainly affecting the coastal regions, occurs in spring and it is followed, after a period of low incidence during summer, by a second, usually larger, peak in autumn also involving regions situated farther inland. A hydroclimatological explanation for this unique seasonal cycle has been recently proposed: the low river spring flows favor the intrusion of brackish water (the natural environment of the causative agent of the disease) which, in turn, triggers the first outbreak. The summer rising river discharges have a temporary dilution effect and prompt the repulsion of contaminated water which lowers the disease incidence. However, the monsoon flooding, together with the induced crowding of the population and the failure of the sanitation systems, can possibly facilitate the spatial transmission of the disease and promote the autumn outbreak. We test this hypothesis using a mechanistic, spatially explicit model of cholera epidemic. The framework directly accounts for the role of the river network in transporting and redistributing cholera bacteria among human communities as well as for the annual fluctuation of the river flow. The model is forced with the actual environmental drivers of the region, namely river flow and temperature. Our results show that these two drivers, both having a single peak in the summer, can generate a double peak cholera incidence pattern. Besides temporal patterns, the model is also able to qualitatively reproduce spatial patterns characterized

  7. Controls on groundwater flow in the Bengal Basin of India and Bangladesh: regional modeling analysis

    Science.gov (United States)

    Michael, Holly A.; Voss, Clifford I.

    2009-11-01

    Groundwater for domestic and irrigation purposes is produced primarily from shallow parts of the Bengal Basin aquifer system (India and Bangladesh), which contains high concentrations of dissolved arsenic (exceeding worldwide drinking water standards), though deeper groundwater is generally low in arsenic. An essential first step for determining sustainable management of the deep groundwater resource is identification of hydrogeologic controls on flow and quantification of basin-scale groundwater flow patterns. Results from groundwater modeling, in which the Bengal Basin aquifer system is represented as a single aquifer with higher horizontal than vertical hydraulic conductivity, indicate that this anisotropy is the primary hydrogeologic control on the natural flowpath lengths. Despite extremely low hydraulic gradients due to minimal topographic relief, anisotropy implies large-scale (tens to hundreds of kilometers) flow at depth. Other hydrogeologic factors, including lateral and vertical changes in hydraulic conductivity, have minor effects on overall flow patterns. However, because natural hydraulic gradients are low, the impact of pumping on groundwater flow is overwhelming; modeling indicates that pumping has substantially changed the shallow groundwater budget and flowpaths from predevelopment conditions.

  8. The threat from sea and land. Regional report 2: the Bay of Bengal.

    Science.gov (United States)

    1994-01-01

    This article reports on the environmental threat caused by the Bay of Bengal on the economic situation in Bangladesh and India. More than four-fifths of Bangladesh amount to an extended delta at the confluence of one of the largest river systems in the world, comprising the Ganges, Brahmaputra, and Meghna. In the Brahmaputra watershed, the rate of deforestation caused soil erosion in the Himalayas is five times as much as in the geological past. This sediment loading is often considered to be a prime factor in downstream flooding. Because of this, Bangladesh agriculture products were damaged, which led to economic instability. Furthermore, as a result of the combined impacts of population growth, poverty, no land, and inadequate food supplies, many migrated into the neighboring Indian areas. Moreover, the susceptibility of the Bay of Bengal to cyclones has caused a great number of deaths leaving millions of people homeless. Cyclone episodes are expected to be more frequent as global warming continues. Furthermore, Bangladesh was estimated to be only 5 meters above sea level, which is considered vulnerable to sea level rise. On top of these problems, trouble from the other side of Bangladesh was also predicted with the combined outflow of the Ganges, Brahmaputra, and Meghna leading to more national damage.

  9. Controls on groundwater flow in the Bengal Basin of India and Bangladesh: Regional modeling analysis

    Science.gov (United States)

    Michael, H.A.; Voss, C.I.

    2009-01-01

    Groundwater for domestic and irrigation purposes is produced primarily from shallow parts of the Bengal Basin aquifer system (India and Bangladesh), which contains high concentrations of dissolved arsenic (exceeding worldwide drinking water standards), though deeper groundwater is generally low in arsenic. An essential first step for determining sustainable management of the deep groundwater resource is identification of hydrogeologic controls on flow and quantification of basin-scale groundwater flow patterns. Results from groundwater modeling, in which the Bengal Basin aquifer system is represented as a single aquifer with higher horizontal than vertical hydraulic conductivity, indicate that this anisotropy is the primary hydrogeologic control on the natural flowpath lengths. Despite extremely low hydraulic gradients due to minimal topographic relief, anisotropy implies large-scale (tens to hundreds of kilometers) flow at depth. Other hydrogeologic factors, including lateral and vertical changes in hydraulic conductivity, have minor effects on overall flow patterns. However, because natural hydraulic gradients are low, the impact of pumping on groundwater flow is overwhelming; modeling indicates that pumping has substantially changed the shallow groundwater budget and flowpaths from predevelopment conditions. ?? Springer-Verlag 2009.

  10. Geoid and gravity anomaly data of conjugate regions of Bay of Bengal and Enderby Basin: New constraints on breakup and early spreading history between India and Antarctica

    Digital Repository Service at National Institute of Oceanography (India)

    Krishna, K.S.; Michael, L.; Bhattacharyya, R.; Majumdar, T.J.

    the anomalies. Since the magnetic anomalies in the western Enderby Basin have lower amplitude, Gaina et al. (2007) could not identify the anomalies with confidence and found difficulty to correlate the spreading history with that of the central and eastern... Geoid and gravity anomaly data of conjugate regions of Bay of Bengal and Enderby Basin – new constraints on breakup and early spreading history between India and Antarctica K.S. Krishna*, Laju Michael National Institute of Oceanography, Council...

  11. An assessment of TropFlux and NCEP air-sea fluxes on ROMS simulations over the Bay of Bengal region

    Science.gov (United States)

    Dey, Dipanjan; Sil, Sourav; Jana, Sudip; Pramanik, Saikat; Pandey, P. C.

    2017-12-01

    This study presents an assessment of the TropFlux and the National Centers for Environmental Prediction (NCEP) reanalysis air-sea fluxes in simulating the surface and subsurface oceanic parameters over the Bay of Bengal (BoB) region during 2002-2014 using the Regional Ocean Modelling System (ROMS). The assessment has been made by comparing the simulated fields with in-situ and satellite observations. The simulated surface and subsurface temperatures in the TropFlux forced experiment (TropFlux-E) show better agreement with the Research Moored Array for African-Asian-Australian Monsoon Analysis (RAMA) and Argo observations than the NCEP forced experiment (NCEP-E). The BoB domain averaged sea surface temperature (SST) simulated in the NCEP-E is consistently cooler than the satellite SST, with a root mean square error (RMSE) of 0.79 °C. Moreover, NCEP-E shows a limitation in simulating the observed seasonal cycle of the SST due to substantial underestimation of the pre-monsoon SST peak. These limitations are mostly due to the lower values of the NCEP net heat flux. The seasonal and interannual variations of SST in the TropFlux-E are better comparable to the observations with correlations and skills more than 0.80 and 0.90 respectively. However, SST is overestimated during summer monsoon periods mainly due to higher net heat flux. The superiority of TropFlux forcing over the NCEP reanalysis can also be seen when simulating the interannual variabilities of the magnitude and vertical extent of Wyrtki jets at two equatorial RAMA buoy locations. The jet is weaker in the NCEP-E relative to the TropFlux-E and observations. The simulated sea surface height anomalies (SSHA) from both the experiments are able to capture the regions of positive and negative SSHA with respect to satellite-derived altimeter data with better performance in the TropFlux-E. The speed of the westward propagating Rossby wave along 18°N in the TropFlux-E is found to be about 4.7 cm/s, which is close to

  12. Ferromanganese micronodules from Bengal Fan

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O.S.; Gujar, A.R.; Rao, Ch.M.

    The occurrence of ferromanganese micronodules, hitherto unreported from any fan-valley system of the world, has been recorded from over 0.22 million km sup(2) area located in the middle fan region of the Bay of Bengal. Their abundance is higher...

  13. Seroepidemiology of bluetongue in South Bengal

    Directory of Open Access Journals (Sweden)

    Arkendu Halder

    2016-01-01

    Full Text Available Aim: With the aim of revealing the epidemiological intricacies of bluetongue (BT in the southern part of West Bengal state, the present study was undertaken to assess seroprevalence of BT along with identification of the vector of the disease, i.e., Culicoides midges available in the region in their breeding season with conducive environmental factors, if any. Materials and Methods: A total of 1509 (sheep-504, goat-1005 samples were collected from three different agroclimatic zones of South Bengal viz. new alluvial, red laterite and coastal saline. To detect anti-BT antibodies in the collected serum samples, indirect-enzyme-linked immunosorbent assay (i-ELISA was performed. Culicoides midges were collected from those agro-climatic zones of South Bengal for species identification. The meteorological parameters, viz. temperature (maximum and minimum, rainfall and relative humidity of three agro-climatic zones of South Bengal were analyzed for the months of July to December during 2010-2013. Results: The overall seropositivity was 33.13% and 30.24% in sheep and goat, respectively as assessed by i-ELISA. In South Bengal, the predominant species of Culicoides found were Culicoides schultzei, Culicoides palpifer and Culicoides definitus. Conclusion: Since virus transmitting species of Culicoides midges could be detected in South Bengal, besides high seropositivity in ruminants, the possibility of circulating BT virus in South Bengal is quite imminent.

  14. Strong variability in bacterioplankton abundance and production in central and western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, V.; Ramaiah, N.; Paul, J.T.; Sardessai, S.; Jyothibabu, R.; Gauns, M.

    to low or no nutrient injections into the surface, primary production in Bay of Bengal is reportedly low. As a consequence, the Bay of Bengal is considered as a region of low biological productivity. Along with many biological parameters, bacterioplankton...

  15. Indoor gamma radiation dose levels in West Bengal using passive dosimeters

    International Nuclear Information System (INIS)

    Shetty, P.G.; Sahu, S.K.; Swarnkar, M.; Takale, R.A.; Pandit, G.G.

    2016-01-01

    Geography of West Bengal, a state in eastern India, is diverse, of high peaks of Himalaya in the northern extremes to coastal regions down south, with regions such as plateau and Ganges delta intervening in between. West Bengal is only state in India where Himalayas are in the north and Sea is at the south, with both plains and plateaus covering the remaining region. West Bengal is divided into three main divisions known as the Jalpaiguri division, Burdwan division and the Presidency division. It shows the district map of West Bengal. The result of preliminary indoor gamma radiation monitoring carried out in different districts of West Bengal is given in this paper

  16. Seasonal variation of sea surface temperature in the Bay of Bengal during 1992 as derived from NOAA-AVHRR SST data

    Digital Repository Service at National Institute of Oceanography (India)

    Murty, V.S.N.; Subrahmanyam, B.; Rao, L.V.G.; Reddy, G.V.

    . The spatial variation of Standard Deviation of SST bias was particularly high (less than 0.7) in the western Bay when compared to other parts of the Bay of Bengal. The monthly maps of AVHRR SST clearly depicted the seasonal cycle of SST showing the well known...

  17. Study of the Genetic Diversity of the Ornamental Fish Badis badis (Hamilton-Buchanan, 1822 in the Terai Region of Sub-Himalayan West Bengal, India

    Directory of Open Access Journals (Sweden)

    Tanmay Mukhopadhyay

    2014-01-01

    Full Text Available Dwarf chameleon fish or Badis badis, a lesser known ornamental freshwater fish, has recently been included in the Indian threatened category of fish list. There are insufficient studies with regard to the assessment of genetic background of this ichthyofauna, especially in the western sub-Himalayan region of West Bengal, India, popularly known as the Terai. The present study is the first attempt to investigate the present status of the genetic background of this species in the Mahananda and Balason rivers, major streams of this region. Twenty-one selective RAPD primers generated 53 and 60 polymorphic fragments in the Mahananda and Balason populations, respectively. The proportion of polymorphic loci, Nei’s genetic diversity (H, and Shannon’s index (H′ were 0.4416, 0.1654±0.2023, and 0.2450±0.2907, respectively, in Mahananda river population and were 0.5041, 0.1983±0.2126, and 0.2901±0.3037, respectively, in Balason river population. Inbreeding coefficient and degree of gene differentiation were also calculated. The H and H′ were found to be 0.1601±0.1944 and 0.2363±0.2782, respectively, in overall Mahananda-Balason river system. Our study revealed considerable lack of genetic variation among the individuals of Badis badis. The genetic data obtained from the present study lend support to the view that there is a scope of stock improvement for this ichthyofauna.

  18. Distinct repeat motifs at the C-terminal region of CagA of Helicobacter pylori strains isolated from diseased patients and asymptomatic individuals in West Bengal, India

    Directory of Open Access Journals (Sweden)

    Chattopadhyay Santanu

    2012-05-01

    Full Text Available Abstract Background Infection with Helicobacter pylori strains that express CagA is associated with gastritis, peptic ulcer disease, and gastric adenocarcinoma. The biological function of CagA depends on tyrosine phosphorylation by a cellular kinase. The phosphate acceptor tyrosine moiety is present within the EPIYA motif at the C-terminal region of the protein. This region is highly polymorphic due to variations in the number of EPIYA motifs and the polymorphism found in spacer regions among EPIYA motifs. The aim of this study was to analyze the polymorphism at the C-terminal end of CagA and to evaluate its association with the clinical status of the host in West Bengal, India. Results Seventy-seven H. pylori strains isolated from patients with various clinical statuses were used to characterize the C-ternimal polymorphic region of CagA. Our analysis showed that there is no correlation between the previously described CagA types and various disease outcomes in Indian context. Further analyses of different CagA structures revealed that the repeat units in the spacer sequences within the EPIYA motifs are actually more discrete than the previously proposed models of CagA variants. Conclusion Our analyses suggest that EPIYA motifs as well as the spacer sequence units are present as distinct insertions and deletions, which possibly have arisen from extensive recombination events. Moreover, we have identified several new CagA types, which could not be typed by the existing systems and therefore, we have proposed a new typing system. We hypothesize that a cagA gene encoding higher number EPIYA motifs may perhaps have arisen from cagA genes that encode lesser EPIYA motifs by acquisition of DNA segments through recombination events.

  19. Numerical simulation of mesoscale surface pressure features with trailing stratiform squall lines using WRF -ARW model over Gangetic West Bengal region

    Science.gov (United States)

    Dawn, Soma; Satyanarayana, A. N. V.

    2018-01-01

    In the present study, an attempt has been made to investigate the simulation of mesoscale surface pressure patterns like pre-squall mesolow, mesohigh and wake low associated with leading convective line-trailing stratiform (TS) squall lines over Gangetic West Bengal (GWB). For this purpose, a two way interactive triple nested domain with high resolution WRF model having2 km grid length in the innermost domain is used. The model simulated results are compared with the available in-situ observations obtained as a part of Severe Thunderstorm: Observations and Regional Modeling (STORM) programme, reflectivity products of Doppler Weather Radar (DWR) Kolkata and TRMM rainfall. Three TS squall lines (15 May 2009, 5 May 2010 and 7 May 2010) are chosen during pre-monsoon thunderstorm season for this study. The model simulated results of diurnal variation of temperature, relative humidity, wind speed and direction at the station Kharagpur in GWB region reveal a sudden fall in temperature, increase in the amount of relative humidity and sudden rise in wind speed during the arrival of the storms. Such results are well comparable with the observations though there are some leading or lagging of time in respect of actual occurrences of such events. The study indicates that the model is able to predict the occurrences of three typical surface pressure features namely: pre-squall mesolow, meso high and wake low. The predicted surface parameters like accumulated rainfall, maximum reflectivity and vertical profiles (temperature, relative humidity and winds) are well accorded with the observations. The convective and stratiform precipitation region of the TS squall lines are well represented by the model. A strong downdraft is observed to be a contributory factor for formation of mesohigh in the convective region of the squall line. Wake low is observed to reside in the stratiform rain region and the descending dry air at this place has triggered the wake low through adiabatic

  20. On the occurrence of ferromanganese micronodules from the sediments of the Bengal Fan: A high terrigenous sediment input region

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O.S.; Gujar, A.R.; Rao, Ch.M.

    to decrease in abundance down-core. The core from the eastern region had micronodules down to deeper levels than the western side. Todorokite is the manganese mineral present in the micronodules. Associated mineral phases are quartz, feldspar and phillipsite...

  1. Geochemistry of ferromanganese micronodules and associated Mn and trace metals diagenesis at high terrigenous depositional site of middle fan region, Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O

    The influence of sedimentation on the morphology, growth and geochemistry of the micronodules, and on Mn enrichment in the sediments of the Bay of Bengal has been evaluated. Mn accumulation is 307-219 mg cm u2 kyr u-1 in cores having 20-17 cm kyr u...

  2. Role of institutional entrepreneurship in the creation of regional solar PV energy markets : Contrasting developments in Gujarat and West Bengal

    NARCIS (Netherlands)

    Jolly, Suyash

    2017-01-01

    With political initiatives, such as the National Solar Mission by Government of India, rapid development of grid connected solar PV energy in India has occurred in the recent times. However, an interesting puzzle is with respect to significant regional differences in Indian states despite similar

  3. Regional Ecological Corridors - MLCCS derived 2008

    Data.gov (United States)

    Minnesota Department of Natural Resources — Identification of potential ecological corridors between the MLCCS derived ecological patches (ear_eco08py3). This was generated using cost / distance analysis,...

  4. Regionally Significant Ecological Areas - MLCCS derived 2008

    Data.gov (United States)

    Minnesota Department of Natural Resources — This is an analysis of regionally significant Terrestrial and Wetland Ecological Areas in the seven county metropolitan area. Individual forest, grassland and...

  5. Examination of aerosol distributions and radiative effects over the Bay of Bengal and the Arabian Sea region during ICARB using satellite data and a general circulation model

    Directory of Open Access Journals (Sweden)

    R. Cherian

    2012-02-01

    Full Text Available In this paper we analyse aerosol loading and its direct radiative effects over the Bay of Bengal (BoB and Arabian Sea (AS regions for the Integrated Campaign on Aerosols, gases and Radiation Budget (ICARB undertaken during 2006, using satellite data from the MODerate Resolution Imaging Spectroradiometer (MODIS on board the Terra and Aqua satellites, the Aerosol Index from the Ozone Monitoring Instrument (OMI on board the Aura satellite, and the European-Community Hamburg (ECHAM5.5 general circulation model extended by Hamburg Aerosol Module (HAM. By statistically comparing with large-scale satellite data sets, we firstly show that the aerosol properties measured during the ship-based ICARB campaign and simulated by the model are representative for the BoB and AS regions and the pre-monsoon season. In a second step, the modelled aerosol distributions were evaluated by a comparison with the measurements from the ship-based sunphotometer, and the satellite retrievals during ICARB. It is found that the model broadly reproduces the observed spatial and temporal variability in aerosol optical depth (AOD over BoB and AS regions. However, AOD was systematically underestimated during high-pollution episodes, especially in the BoB leg. We show that this underprediction of AOD is mostly because of the deficiencies in the coarse mode, where the model shows that dust is the dominant component. The analysis of dust AOD along with the OMI Aerosol Index indicate that missing dust transport that results from too low dust emission fluxes over the Thar Desert region in the model caused this deficiency. Thirdly, we analysed the spatio-temporal variability of AOD comparing the ship-based observations to the large-scale satellite observations and simulations. It was found that most of the variability along the track was from geographical patterns, with a minor influence by single events. Aerosol fields were homogeneous enough to yield a good statistical agreement

  6. Household Survey of Pesticide Practice, Deliberate Self-Harm, and Suicide in the Sundarban Region of West Bengal, India

    Directory of Open Access Journals (Sweden)

    Sohini Banerjee

    2013-01-01

    Full Text Available The toxicological impact and intentional ingestion of pesticides are major public health concerns globally. This study aimed to estimate the extent of deliberate self-harm (DSH and suicides (suicidal behaviour and document pesticide practices in Namkhana block of the Sundarban region, India. A cross-sectional study was conducted in 1680 households (21 villages following a mixed random and cluster design sampling. The survey questionnaire (Household Information on Pesticide Use and DSH was developed by the research team to elicit qualitative and quantitative information. The Kappa statistic and McNemar’s test were used to assess the level of agreement and association between respondents’ and investigators’ opinions about safe storage of pesticides. Over five years, 1680 households reported 181 incidents of suicidal behaviour. Conflict with family members was the most frequently reported reason for suicidal behaviour (53.6%. The Kappa statistic indicated poor agreement between respondents and investigators about safe storage of pesticides. The pesticide-related annual DSH rate was 158.1 (95% CI 126.2–195.5, and for suicide it was 73.4 (95% CI 52.2–100.3 per 100,000. Unsafe pesticide practice and psychosocial stressors are related to the high rates of suicidal behaviour. An intersectoral approach involving the local governments, agricultural department and the health sector would help to reduce the magnitude of this public health problem.

  7. Deposition of chromium in aquatic ecosystem from effluents of handloom textile industries in Ranaghat–Fulia region of West Bengal, India

    Directory of Open Access Journals (Sweden)

    Tanmay Sanyal

    2015-11-01

    Full Text Available Accumulation of chromium (Cr was determined in water, sediment, aquatic plants, invertebrates and fish in aquatic ecosystems receiving effluents from handloom textile industries in Ranaghat–Fulia region of West Bengal in India. Cr was determined in the samples by atomic absorption spectrophotometer and data were analyzed functionally by Genetic Algorithm to determine trend of depositions of Cr in the sediment and water. Area plot curve was used to represent accumulation of Cr in biota. The results indicate that the aquatic ecosystems receiving the effluents from handloom textile factories are heavily contaminated by Cr. The contamination is hardly reflected in the concentration of Cr in water, but sediment exhibits seasonal fluctuation in deposition of Cr, concentration reaching to as high as 451.0 μg g−1 during the peak production period. There is a clear trend of gradual increase in the deposition of Cr in the sediment. Aquatic weed, insect and mollusk specimens collected from both closed water bodies (S1 & S2 and riverine resources (S3 & S4 showed high rate of accumulation of Cr. Maximum concentration of Cr was detected in roots of aquatic weeds (877.5 μg g−1. Fish specimens collected from the polluted sites (S3 & S4 of river Churni showed moderate to high concentration of Cr in different tissues. Maximum concentration was detected in the liver of Glossogobius giuris (679.7 μg g−1 during monsoon followed by gill of Mystus bleekeri (190.0 μg g−1 and gut of G. giuris (123.7 μg g−1 during summer. Eutropiichthys vacha showed moderately high concentration of Cr in different tissues (65–99 μg g−1 while Puntius sarana showed relatively low concentration of Cr (below detection limit to 18.0 μg g−1 in different tissues except in gill (64.4 μg g−1.

  8. Atmospheric dry deposition of inorganic and organic nitrogen to the Bay of Bengal: Impact of continental outflow

    Digital Repository Service at National Institute of Oceanography (India)

    Srinivas, B.; Sarin, M.M.; Sarma, V.V.S.S.

    neutralizing species in the atmosphere such as mineral aerosols and sea salts (Pakkanen, 1996). Particulate NH 4 + is derived from gaseous NH 3 , which is supplied to the atmosphere as a result of agricultural activities. Until recently, the principal... of Bengal. In IGP, biomass burning emissions (post-harvest burning of agricultural-waste) is a dominant source of pollutants. In addition, large-scale application of fertilizers (ammonia and urea based) in the agricultural dominated region represent a...

  9. An Efficient Composition for Bengal Lights.

    Science.gov (United States)

    Comet, M.; Schreyeck, L.; Fuzellier, H.

    2002-01-01

    Reports the discovery of an efficient base composition for making bengal lights that is obtained with potassium chlorate and thiourea. Combining this mixture with appropriate flame coloring can produce several impressive bengal lights. (DDR)

  10. The biology of the Arabian Sea and Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Gauns, M.

    This article focusses on the variability in physics and chemistry of the region and investigate its influence on the biology. This article is largely based on the recent observations made during the India JGOFS and BOBPS (Bay of Bengal Process Study...

  11. Zooplankton biomass and composition in the western Bay of Bengal during late sw monsoon

    Digital Repository Service at National Institute of Oceanography (India)

    Achuthankutty, C.T.; Madhupratap, M.; Nair, V.R.; Nair, S.R.S.; Rao, T.S.S.

    and neritic regions of the southwestern Bay of Bengal. Other groups like chaetognaths, ostracods, amphipods, euphausiids, fish eggs, fish larvae, polychaetes, cladocerans, planktonic molluscs, etc. contributed to a lesser percentage of the general composition...

  12. Geomorphology and geology of the Bay of Bengal and the Andaman Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, V.P.; Kessarkar, P.M.

    -slope region. The 'Bengal Fan' is a major physiographic feature. The Andaman Sea consists of several seamounts, valleys and fracture zones. Reefal structures occur around the Andaman Islands and on the outer shelf off Visakhapatnam. Lithogenic sediments (clayey...

  13. Primary Schooling in West Bengal

    Science.gov (United States)

    Sen, Amartya

    2010-01-01

    With his Nobel Prize award money, Amartya Sen set up the Pratichi Trust which carries out research, advocacy and experimental projects in basic education, primary health care, and women's development in West Bengal and Bangladesh. Professor Sen himself took active interest in this work--helping set the agenda, looking at the evidence from…

  14. Regional perfusion and oxygenation of tumors upon methylxanthine derivative administration

    International Nuclear Information System (INIS)

    Kelleher, Debra K.; Thews, Oliver; Vaupel, Peter

    1998-01-01

    Purpose: The use of methylxanthine derivatives has been postulated as a means of increasing tumor perfusion and thus ameliorating tumor hypoxia. The aim of this study was to quantify and compare the effects of three methylxanthine derivatives: pentoxifylline (PX), torbafylline (TB), and HWA 138 (HW) on tumor perfusion and oxygenation. Methods and Materials: Anesthetized Sprague Dawley rats with DS-sarcomas implanted subcutaneously onto the hind foot dorsum were used in this study. Mean arterial blood pressure (MABP) was measured throughout experiments. Regional red blood cell (RBC) flux was monitored using a multichannel laser Doppler device and tumor oxygenation on a more global level was assessed polarographically using an O 2 -sensitive catheter electrode. The methylxanthine derivatives were administered as a single dose intraperitoneally (for PX 50 mg/kg; for TB and HW 75 mg/kg). Results: Following drug administration, initial decreases in MABP down to 75% of baseline values were observed for all three substances. PX, HW, and TB caused initial transient reductions in mean RBC flux followed by gradual increases to values of 137 ± 27 %, 139 ± 14 %, and 122 ± 14 % respectively at t = 60 min. Following a small initial decrease upon drug administration, O 2 partial pressure (pO 2 ) rose to 160 ± 31 %, 153 ± 34 %, and 121 ± 11 % for PX, HW, and TB, respectively at t = 60 min. At the end of the observation period (t = 90 min), increases in RBC flux and pO 2 were still evident. When individual tumors were considered, a variety of patterns (including opposing effects) for changes in RBC flux were seen, not necessarily reflected in the mean values. Thus, while the methylxanthine derivatives caused an increased average tumor perfusion, there is evidence suggesting that a redistribution of tumor blood flow occurs which may amplify preexisting heterogeneity. Conclusions: Substantial improvements in tumor oxygenation and perfusion were observed after administration of

  15. Identification of interspecific hybrids between loquat (eriobotrya japonica lindl.) and bengal loquat (e. bengalensis hook.)

    International Nuclear Information System (INIS)

    Wang, Y.; Deng, Q.; Zeng, J.; Zhang, J.

    2017-01-01

    Loquat (Eriobotrya japonica Lindl.) is an important subtropical fruit; however, loquat fruitlets are vulnerable to cold injury in winter, which significantly decreases loquat yield in most production regions. In the present study, two loquat cultivars ('Dawuxing' and '4-1-5') and one wild loquat (E. bengalensis Hook., Bengal loquat), were used for interspecific hybridization to produce hybrids with characteristics of spring blooming to avoid cold injury of fruitlets. Hybrid seedlings were derived from direct cross (loquat as female parent and Bengal loquat as male parent) and reciprocal cross. The authenticity of 47 hybrid seedlings was confirmed using inter-simple sequence repeat (ISSR) molecular markers; and leaf morphological characteristics of the hybrid offspring and parents were preliminarily studied and compared. The results suggested that 23 true direct cross hybrids and 12 true reciprocal cross hybrids were obtained, with hybrid authenticity rates of 100 and 50.0%, respectively. Thus, a novel method of distant hybridization for loquat breeding was developed, and with their various genetic and morphological characteristics these hybrids could be valuable germplasms for horticultural use. (author)

  16. Seabed morphology and gas venting features in the continental slope region of KrishnaeGodavari basin, Bay of Bengal: Implications in gas–hydrate exploration

    Digital Repository Service at National Institute of Oceanography (India)

    Dewangan, P.; Ramprasad, T.; Ramana, M.V.; Mazumdar, A.; Desa, M.; Badesab, F.K.

    by the tectonic settings of the region. For example, structures formed due to salt or shale tectonics govern the occurrence of gas hydrate in northwestern Gulf of Mexico slope and Niger Delta front (Hovland et al., 1997; Milkov and Sassen, 2001). The seismic.... confirms that paleo-cold seeps in KG offshore basin (Mazumdar et al., 2009). Similar cold seep locations and high methane flux are reported from Gulf of Mexico where the salt diapir creates numerous faults which act as pathways for the fluid...

  17. Workflow with pitfalls to derive a regional airborne magnetic compilation

    Science.gov (United States)

    Brönner, Marco; Baykiev, Eldar; Ebbing, Jörg

    2017-04-01

    Today, large scale magnetic maps are usually a patchwork of different airborne surveys from different size, different resolution and different years. Airborne magnetic acquisition is a fast and economic method to map and gain geological and tectonic information for large areas, onshore and offshore. Depending on the aim of a survey, acquisition parameters like altitude and profile distance are usually adjusted to match the purpose of investigation. The subsequent data processing commonly follows a standardized workflow comprising core-field subtraction and line leveling to yield a coherent crustal field magnetic grid for a survey area. The resulting data makes it possible to correlate with geological and tectonic features in the subsurface, which is of importance for e.g. oil and mineral exploration. Crustal scale magnetic interpretation and modeling demand regional compilation of magnetic data and the merger of adjacent magnetic surveys. These studies not only focus on shallower sources, reflected by short to intermediate magnetic wavelength anomalies, but also have a particular interest in the long wavelength deriving from deep seated sources. However, whilst the workflow to produce such a merger is supported by quite a few powerful routines, the resulting compilation contains several pitfalls and limitations, which were discussed before, but still are very little recognized. The maximum wavelength that can be resolved of each individual survey is directly related to the survey size and consequently a merger will contribute erroneous long-wavelength components in the magnetic data compilation. To minimize this problem and to homogenous the longer wavelengths, a first order approach is the combination of airborne and satellite magnetic data commonly combined with the compilation from airborne data, which is sufficient only under particular preconditions. A more advanced approach considers the gap in frequencies between airborne and satellite data, which motivated

  18. Environmental impact of aquaculture-sedimentation and nutrient loadings from shrimp culture of the southeast coastal region of the Bay of Bengal.

    Science.gov (United States)

    Das, Biplob; Khan, Yusuf Sharif Ahmed; Das, Pranab

    2004-01-01

    Nutrient loadings were measured for surface seawater and bottom sediments of semi-intensive and improved extensive shrimp culture pond, adjacent estuary, and fallow land in the south-east coastal region of Bangladesh during August, 2000-January, 2001 to evaluate the impact of shrimp culture. The mean levels of nutrients found in the pond surface water were 108.780 mg/L for CaCO3, 0.526 mg/L for NH4+ -N, 3.075 wt% for organic carbon, 7.00 mg/L for PO4-P, 5.57 mg/L for NO3-N, and 7.33 mg/L for chlorophyll-a. The maximum mean value of H2S (0.232 mg/L) was found in estuarine water. Nutrients loading were found to be decreased with distance from the shrimp farm discharge unit in estuarine water. The mean level of organic matter, total nitrogen, and organic carbon were found in higher concentrations in sediments of cultured pond compared to bottom soil of adjacent fallow land at the same elevation. Extractable Ca values were found in higher concentration (550.33 ppt) in adjacent fallow land, as the shrimps for molting in shrimp ponds use extractable Ca. The relation between seawater H2S value and sediment pH (r = - 0.94); sediment organic carbon and sediment pH values (r = -0.76), sediment total nitrogen and sediment pH (r = -0.74) were found to be highly negatively correlated. Whereas the relation between seawater H2S value and sediment total nitrogen (r = 0.92), water NH4+ -N and sediment pH (r = 0.66) were found to be positively correlated. The results revealed that load of nutrients at eutrophic level in estuarine water, and decrease of soil pH; leading to acid sulphate soil formation indicates a negative impact of shrimp culture.

  19. Deriving local demand for stumpage from estimates of regional supply and demand.

    Science.gov (United States)

    Kent P. Connaughton; Gerard A. Majerus; David H. Jackson

    1989-01-01

    The local (Forest-level or local-area) demand for stumpage can be derived from estimates of regional supply and demand. The derivation of local demand is justified when the local timber economy is similar to the regional timber economy; a simple regression of local on nonlocal prices can be used as an empirical test of similarity between local and regional economies....

  20. Magnetic anomalies in Central Bengal fan

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, T.C.S.; Lakshminarayana, S.; Sarma, K.V.L.N.S.

    Total magnetic field anomalies recorded over the Central Bengal Fan are analysed and the depths to the magnetic basement are computed using the analytical signal and the Werner deconvolution methods. To the west and east of 85 degrees E...

  1. Numerical modelling of tides and storm surges in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sindhu, B.

    were done. A storm surge model was developed to simulate total water levels and derived surges caused by low pressure systems identified during the past 27 years (1974-2000) in the Bay of Bengal. Study also estimated the return levels of extreme sea...

  2. Properties of the HII Regions Derived Using Integral Field Spectroscopy

    Directory of Open Access Journals (Sweden)

    Sebastian F. Sánchez

    2013-01-01

    Full Text Available Here we review some of our more recent results on the observed properties of HII regions using Integral Field Spectroscopy. In particular, we illustrate the use of this technique to study in detail the ionization conditions across the nebulae for galactic HII regions (focused on the Orion Nebula and the statistical study of large samples of extragalactic HII regions. We review the reported new scaling relation between the local mass density and the oxygen abundance across the disk galaxies and the recently discovered universal gradient for oxygen abundances. We update our previous results the lack of a dependence of the Mass-Metallicity relation with the starformation rate, including new unpublished data. Finally we discuss on the relation between the ionization conditions in the nebulae and the underlying stellar population. All together our results indicate that disk galaxies present a chemical enrichment dominated by an inside-out growth scenario, with a less evident effect of radial migrations and/or outflows.

  3. Properties of the HII Regions Derived Using Integral Field Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Sánchez, Sebastián F.

    2013-01-01

    Roč. 2013, č. 1 (2013), 596501/1-596501/14 ISSN 1687-7969 Grant - others:Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR(CZ) M100031241; Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR(CZ) M100031201 Program:M Institutional support: RVO:67985815 Keywords : H-II regions * star -foraming galaxies * chemo-spectrophotometric evolution Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 1.234, year: 2013

  4. Storm surge in the Bay of Bengal and Arabian Sea: The problem and its prediction

    Digital Repository Service at National Institute of Oceanography (India)

    Dube, S.K.; Rao, A.D.; Sinha, P.C.; Murty, T.S.; Bahulayan, N.

    to annual economic losses in these countries. Thus, the real time monitoring and warning of storm surge is of great concern for this region. The goal of this paper is to provide an overview of major aspects of the storm surge problem in the Bay of Bengal...

  5. Observed seasonal variability of barrier layer in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Pankajakshan, T.; Muraleedharan, P.M.; Rao, R.R.; Somayajulu, Y.K.; Reddy, G.V.; Revichandran, C.

    The observed formation of Barrier Layer (BL) and the seasonal variability of BL thickness (BLT) in the Bay of Bengal are examined utilizing the most comprehensive data set. Thick BL (~50m) first appears in the coastal region of the northeastern bay...

  6. Recent foraminiferal assemblages from the continental shelf sediments of Madras, Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Setty, M.G.A.P.

    During the 15th cruise of INS Kistna, as part of the International Indian Ocean Expedition, several sub-surface samples were collected, (using LaFond-Dietz snapper), from the continental shelf region of the Bay of Bengal. Samples from two locations...

  7. Hydroclimatic mechanisms of cholera transmission in the Bengal Delta

    Science.gov (United States)

    Tretkoff, Ernie

    2011-07-01

    Cholera, a deadly waterborne disease, remains a major threat in many areas of the world, including the Bengal Delta region. In this region, cholera outbreaks have two annual peaks; the first occurs during the dry season in the spring, and the second occurs in the fall following the wet season. However, the large-scale hydroclimatic processes underlying the propagation of the disease have not been well understood. Akanda et al. show that cholera outbreaks in the Bengal Delta region propagate from the coast to inland and from spring to fall following two distinct transmission cycles. The first outbreak begins in the spring near the coast when northward movement of plankton-rich seawater and increasing salinity promote the growth of cholera-causing bacteria in rivers, which are used for irrigation, sanitation, and consumption. The second outbreak begins in the fall, after summer floods and monsoons affect sanitation conditions that aid in bacterial transmission by contaminating waters over much of Bangladesh. (Water Resources Research, doi:10.1029/ 2010WR009914, 2011)

  8. Morphological features in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, K.V.L.N.S.; Ramana, M.V.; Subrahmanyam, V.; Krishna, K.S.; Ramprasad, T.; Desa, M.

    history of the Fan. After India's soft collision with the Eurasian plate, these events may have played a critical role in shaping various morphological features since late Eocene in the Bay of Bengal. The present 12 kHz Echo sounder data collected along...

  9. Derivation of a regional active-optical reflectance sensor corn algorithm

    Science.gov (United States)

    Active-optical reflectance sensor (AORS) algorithms developed for in-season corn (Zea mays L.) N management have traditionally been derived using sub-regional scale information. However, studies have shown these previously developed AORS algorithms are not consistently accurate when used on a region...

  10. Undergraduate Collaborative Research: Distribution of Plant Wax Biomarkers in Miocene-age Sediments from the Bengal Fan (IODP Exp 354)

    Science.gov (United States)

    Cho, P. G.; Vidal, E.; Paek, J. H.; Borsook, A.; Lee, W.; Wu, M. S.; Ponton, C.; Galy, V.; Feakins, S. J.

    2017-12-01

    Our research aims to understand past climatic variability in the monsoon-influenced Ganges-Brahmaputra catchment as recorded by plant wax molecules exported and sequestered in the sediments of the Bengal Fan. Samples from the late Miocene were selected from cores retrieved by the IODP (International Ocean Discovery Program) Expedition 354 that recently drilled the central Bengal Fan along a transect at 8°N. Fan sedimentation includes sand, silt, and clay mostly derived from the Himalayan range via turbiditic transport within the Bengal fan. Sedimentation is highly episodic in the fan, but a transect of drilled sites provides a record of terrigenous sediment exported and buried over the last 20 million years. A team of researchers at the University of Southern California worked to collectively process 468 samples for compound specific biomarker identification and quantification. The samples derive from Site U1451 and U1455 ranging from 0 to 1097m depth (CSF-A). Total organic carbon ranges from 0.04-0.84%. To date, 300 samples have been solvent-extracted and prepared for plant wax analyses. Long chain n-alkanoic acids and n-alkanes were identified and quantified using GC-MS and GC-FID, respectively. In the samples quantified so far, we find ΣC24-34 n-alkanoic acid concentrations from 0.07-14.16 μg/g of dry sediment and ΣC25-35 n-alkanes from 0.04-4.61 μg/g. Concentrations of C30 n-alkanoic acid range from 0.01-1.92 μg/g of dry sediment and of C33 n-alkane from lipid extract was analyzed at the Woods Hole Oceanographic Institution using a GC-TOF-MS. Overall, these extracts are dominated by plant-wax compounds and other diagnostic terrestrial molecules (e.g. plant terpenoids and sterols). The results from this effort contribute to a larger mission to reconstruct vegetation and climate change, over the past 20 million years in the core of the monsoon-influenced region, through compound-specific isotope analyses of the plant waxes extracted from these samples.

  11. On watermass mixing ratios and regenerated silicon in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, D.P.; Sarma, V.V.; Rao, V.S.; Sudhakar, U.; Gupta, G.V.M.

    Regeneration of silicon on mixing in the Bay of Bengal have been computed from six water masses [Bay of Bengal low saline water (BBLS), Bay of Bengal subsurface water (BBSS), northern southeast high salinity water (NSEHS), north Indian intermediate...

  12. Wind Atlas of Bay of Bengal with Satellite Wind Measurement

    DEFF Research Database (Denmark)

    Nadi, Navila Rahman

    footstep towards offshore wind energy analysis for this region. Generally, it is difficult to find offshore wind data relative to the wind turbine hub heights, therefore a starting point is necessary to identify the possible wind power density of the region. In such scenario, Synthetic aperture radars (SAR......The objective of this study is to obtain appropriate offshore location in the Bay of Bengal, Bangladesh for further development of wind energy. Through analyzing the previous published works, no offshore wind energy estimation has been found here. That is why, this study can be claimed as the first......) have proven useful. In this study, SAR based dataset- ENVISAT ASAR has been used for Wind Atlas generation. Furthermore, a comparative study has been performed with Global Wind Atlas (GWA) to determine a potential offshore wind farm. Additionally, the annual energy production of that offshore windfarm...

  13. Miocene denudation history of Himalaya deduced from IODP Exp. 354 Bengal Fan

    Science.gov (United States)

    Kohki, Y.; Cruz, J. W.; Osaki, A.; Manoj, M. C.; Hatano, N.; France-Lanord, C.; Spiess, V.; Klaus, A.

    2017-12-01

    The submarine Bengal Fan is the largest submarine fan on Earth and covers the whole Bay of Bengal. The sediments are fed by the Ganges and Brahmaputra rivers reflecting India-Asia plate collision. The sediments recovered from IODP Expedition 354 Bengal Fan record the uplift history of the Himalayan orogenic system. We examined the chemical composition of detrital garnets in the Miocene deposits from Site U1451, where drilling reached to basal horizon of the fan deposits, in order to reveal the detailed denudation history of Himalayan metamorphic rocks. For this purpose, the comparison of chemical composition between detrital garnet in the Bengal Fan deposits and metamorphic garnet in Himalayan metamorphic rocks was carried out. The chemical composition of the metamorphic garnet from Higher Himalayan Crystalline (HHC) in Karnali and Kaligandaki areas, western Nepal, was examined for chemical reference to detrital garnets in Bengal Fan. The metamorphic garnets in "Formation I (Le Fort, 1975)" in HHC are characterized by almandine-rich garnet with high pyrope content. Also, the garnets in "Formation II" are remarked by two types of garnets, i.e., almandine-rich and grandite-rich garnets. Meanwhile, the composition of garnets in "Formation III" is almandine-rich garnet with low pyrope content. In the Bengal Fan deposits, the characteristic garnets, which show the similarity to the metamorphic garnet in HHC, is not found from the Lower Miocene (Burdigalian) deposits. In the Middle and Upper Miocene deposits, the almandine-rich garnets characteristic in Formation I, are normally included. At the basal part of the Middle Miocene (Langhian), almandine-rich garnets with low pyrope content, suggesting the derivation from Formation III, are remarkable. The grandite-rich garnets from Formation II are sporadically found In the Upper Miocene deposits (Tortonian-Messinian). Above chemical comparison between the detrital garnets in Bengal Fan and metamorphic garnets from HHC

  14. The last glacial cycle documented on the Lower Bengal Fan - chronological and paleoclimate implications

    Science.gov (United States)

    Weber, M. E.; Dekens, P.; Reilly, B.; Lantzsch, H.; Selkin, P. A.; Das, S. K.; Williams, T.; Martos, Y. M.; Adhikari, R. R.; Gyawali, B. R.; Jia, G.; Fox, L. R.; Ge, J.; Manoj, M. C.; Savian, J. F.; Meynadier, L.; Spiess, V.; France-Lanord, C.; Klaus, A.

    2016-12-01

    IODP Expedition 354 set out in February to March 2015 to drill seven sites along an east west oriented core transect of 320 km length at 8°N in the Bengal Fan (France-Lanord et al., 2015). Sediments show complex intercalation of turbiditic and hemipelagic deposits, documenting the interaction of fan evolution and paleoceanographic history. Hemipelagic sequences represent a several meter thick top layer of Late Quaternary sediment. Deposits are either rich in biogenic opal/clay or in carbonate. We studied physical, optical, geochemical, grain-size, and stable isotopic properties of this top layer to establish a time frame, estimate sedimentary properties, and assess the development of the region during the last glacial cycle. For this purpose, we sampled Site U1452C-1H continuously for the uppermost 480 cm in 2-cm increments. Preliminary results indicate the Toba Ash 1 (74 ka) is a distinct time marker in most physical property data sets. Records of wet-bulk density as well as color reflectance b* (the red-green component) and L* (the lightness) show a dominant precession cyclicity. Hence, we are able to provide an insolation-tuned chronology for the last 200 ka (MIS1 - 7). These records agree well with d18O records retrieved from Chinese caves. An independent age model is derived from records of relative paleointensity (RPI), including the assessment of the Laschamp Event ( 40 ka), and on RPI tuning to global templates. We will compare both chronologies and evaluate their chronological and paleoclimatic implications. We will also present preliminary grain-size and paleoceanographic proxy data (sea-surface temperature, sea-surface salinity, and Mg/Ca) as well as color endmember modeling to reconstruct ice volume, marine biological productivity, nutrient supply, and deep-water circulation. The sedimentologic, oceanographic and climatic conditions are linked to changes in monsoonal strength and terrestrial input, which will also be studied using sedimentary proxies

  15. Observed changes in ocean acidity and carbon dioxide exchange in the coastal Bay of Bengal - a link to air pollution

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, V.V.S.S.; Krishna, M.S.; Paul, Y.S.; Murty, V.S.N.

    acidity and carbon dioxide exchange in the coastal Bay of Bengal � a link to air pollution By V. V. S. S. SARMA*, M. S. KRISHNA, Y. S. PAUL and V. S. N. MURTY, CSIR�National Institute of Oceanography, 176 Lawsons Bay Colony, Visakhapatnam, India... atmosphere boundary layer over the Bay of Bengal (mean: 5.7 mg m�3) compared to fluxes in the Arabian Sea (mean: 2.9 mg m�3), indicating that the former receives more pollutants than the latter region during January to April when air flow from land to sea...

  16. Preponderance of a few diatom species among the highly diverse microphytoplankton assemblages in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Paul, J.T.; Ramaiah, N.; Gauns, M.; Fernandes, V.

    The microphytoplankton assemblages were studied from water samples collected at eight discrete depths in the top 120 m at five central [open ocean] and four western [shelf/slope region] locations in the Bay of Bengal. The Bay is a low...

  17. The rearing system of Black Bengal Goat and their farmers in West Bengal, India

    Directory of Open Access Journals (Sweden)

    Santanu Bera

    2011-12-01

    Full Text Available Bengal Goat is a precious germplasm of West Bengal. Mostly the women (91.3% of the farming families in West Bengal rear goat. Goat rearing is a subsidiary income source to rural poor along with agriculture. In majority of cases the flock size ranges from 1 to 4 (56%. Male female ratio in adult flock is observed as 1:8 in field condition. The animals are mostly housed along with residential housing (67.1%; houses are mostly kachha type (82.63% with earthen floor (86.47% and straw roof (91.33%. All most all the farmers used to graze their goats for feeding. Ponds water is the major source for drinking water (58.14% of goats. Black Bengal Goats have natural resistant power to many diseases but are vulnerable to cold, water logging situation, diarrhoea, ecto and entro parasitic infestation and respiratory diseases. Under field condition mortality rate is 9.63%. [Vet. World 2011; 4(6.000: 254-257

  18. Preliminary objective regionalization of the Mediterranean basin derived from surface-wave tomography

    Directory of Open Access Journals (Sweden)

    L. Pujades

    1997-06-01

    Full Text Available An objective regionalization of the Mediterranean basin is derived from a tomographic study based on the fundamental mode of Rayleigh waves. The database is formed by seismic wavetrains recorded at very-broadband stations belonging to MedNet and other cooperative stations, located in the Mediterranean area. The data treatment consists of application of spectral filtering techniques aimed to determine path-averaged group velocities, computation of local group velocity maps for some periods and classification of the studied area in several homogeneous regions according to Principal Component Analysis (PCA and Average Linkage (AL algorithms. Finally, the group velocity dispersion curves representing each homogeneous region are compared and possible correlation between these regions and seismotectonic and structural characteristics are discussed.

  19. Origins of Eddy Kinetic Energy in the Bay of Bengal

    Science.gov (United States)

    Chen, Gengxin; Li, Yuanlong; Xie, Qiang; Wang, Dongxiao

    2018-03-01

    By analyzing satellite observational data and ocean general circulation model experiments, this study investigates the key processes that determine the spatial distribution and seasonality of intraseasonal eddy kinetic energy (EKE) within the Bay of Bengal (BOB). It is revealed that a complicated mechanism involving both local and remote wind forcing and ocean internal instability is responsible for the generation and modulation of EKE in this region. High-level EKE mainly resides in four regions: east of Sri Lanka (Region 1), the western BOB (Region 2), northwest of Sumatra (Region 3), and the coastal rim of the BOB (Region 4). The high EKE levels in Regions 1 and 2 are predominantly produced by ocean internal instability, which contributes 90% and 79%, respectively. Prominent seasonality is also observed in these two regions, with higher EKE levels in boreal spring and fall due to enhanced instability of the East Indian Coast Current and the Southwest Monsoon Current, respectively. In contrast, ocean internal instability contributes 49% and 52% of the total EKE in Regions 3 and 4, respectively, whereas the atmospheric forcing of intraseasonal oscillations (ISOs) also plays an important role. ISOs produce EKE mainly through wind stress, involving both the remote effect of equatorial winds and the local effect of monsoonal winds. Equatorial-origin wave signals significantly enhance the EKE levels in Regions 3 and 4, in the form of reflected Rossby waves and coastal Kelvin waves, respectively. The local wind forcing effect through Ekman pumping also has a significant contribution in Regions 3 and 4 (24% and 22%, respectively).

  20. Some heat and moisture budgets over Bay of Bengal during MONSOON 17 experiment

    International Nuclear Information System (INIS)

    Bhaskar Rao, D.V.

    1985-12-01

    Heat and moisture budgets have been estimated for the period 13-18 August 1977 over Bay of Bengal using data collected from USSR ships during MONSOON 77 experiment. The divergence, relative vorticity and vertical p-velocity fields are derived. The apparent heat source and moisture sink are obtained for the period. The vertical-time sections of the derived fields are presented and the distributions are compared for undisturbed conditions during the period of study. The results show strong convective motions during the disturbed period indicating the importance of convection in the monsoon depressions. (author)

  1. Extraction of Rose Bengal into chloroform

    International Nuclear Information System (INIS)

    Lengyel, J.; Vecernik, J.; Krtil, J.

    1982-01-01

    The paper describes the extraction of Rose Bengal (RB)into chloroform. A radiometric method with the aid of 131 Ilabelled RB was used. The efficiency of the extraction in dependence on pH and RB concentration was studied. For the interpretation of the extraction data the values of pK 1 and pK 2 of RB were determined spectrophotometrical-ly and potentiometrically. A mechanism for the RB extraction into chloroform on the basis of IR measurements is proposed. (author)

  2. High yielding rice mutants for West Bengal

    International Nuclear Information System (INIS)

    Debnath, A.R.; Sen, S.

    1980-01-01

    Four high yielding mutants with specific genetic corrections of the simply inherited characters were developed from IR-8 through X-irradiation. Recurrent selections of the promising isolates were made under diverse agro-climatic conditions in Winter and Summer seasons of West Bengal. The isolates CNM 6 and CNM 25 belonging to early maturity group and CNM 20 and CNM 31, to mid-early maturity group were finally selected at X 5 generation on the basis of their resistance qualities, maturity period and grain yield. They were evaluated upto X 10 qeneration at multi-locations as Pre-release and Minikit Varieties at State level. They were also placed at the National Screening Nursery (NSN) for screening against multiple diseases and pests at the National level. CNM 6 is reported to be promising in IRTP nurseries. It is reported that CNM 25 (IET 5646) ranked 2nd on the basis of average grain yield, CNM 20 (IET 5937) and CNM 31 (IET 5936) were resistant to diseases and with yield comparable to Jaya. These four productive mutants of superior types are widely accepted. CNM 6 is recommended for cultivation in Bankura and Birbhum districts and CNM 25 and CNM 31 in the different agro-climatic zones of West Bengal. (author)

  3. IASI-derived NH3 enhancement ratios relative to CO for the tropical biomass burning regions

    Science.gov (United States)

    Whitburn, Simon; Van Damme, Martin; Clarisse, Lieven; Hurtmans, Daniel; Clerbaux, Cathy; Coheur, Pierre-François

    2017-10-01

    Vegetation fires are a major source of ammonia (NH3) in the atmosphere. Their emissions are mainly estimated using bottom-up approaches that rely on uncertain emission factors. In this study, we derive new biome-specific NH3 enhancement ratios relative to carbon monoxide (CO), ERNH3 / CO (directly related to the emission factors), from the measurements of the IASI sounder onboard the Metop-A satellite. This is achieved for large tropical regions and for an 8-year period (2008-2015). We find substantial differences in the ERNH3 / CO ratios between the biomes studied, with calculated values ranging from 7 × 10-3 to 23 × 10-3. For evergreen broadleaf forest these are typically 50-75 % higher than for woody savanna and savanna biomes. This variability is attributed to differences in fuel types and size and is in line with previous studies. The analysis of the spatial and temporal distribution of the ERNH3 / CO ratio also reveals a (sometimes large) within-biome variability. On a regional level, woody savanna shows, for example, a mean ERNH3 / CO ratio for the region of Africa south of the Equator that is 40-75 % lower than in the other five regions studied, probably reflecting regional differences in fuel type and burning conditions. The same variability is also observed on a yearly basis, with a peak in the ERNH3 / CO ratio observed for the year 2010 for all biomes. These results highlight the need for the development of dynamic emission factors that take into better account local variations in fuel type and fire conditions. We also compare the IASI-derived ERNH3 / CO ratio with values reported in the literature, usually calculated from ground-based or airborne measurements. We find general good agreement in the referenced ERNH3 / CO ratio except for cropland, for which the ERNH3 / CO ratio shows an underestimation of about 2-2.5 times.

  4. Pro-region engineering for improved yeast display and secretion of brain derived neurotrophic factor.

    Science.gov (United States)

    Burns, Michael L; Malott, Thomas M; Metcalf, Kevin J; Puguh, Arthya; Chan, Jonah R; Shusta, Eric V

    2016-03-01

    Brain derived neurotrophic factor (BDNF) is a promising therapeutic candidate for a variety of neurological diseases. However, it is difficult to produce as a recombinant protein. In its native mammalian context, BDNF is first produced as a pro-protein with subsequent proteolytic removal of the pro-region to yield mature BDNF protein. Therefore, in an attempt to improve yeast as a host for heterologous BDNF production, the BDNF pro-region was first evaluated for its effects on BDNF surface display and secretion. Addition of the wild-type pro-region to yeast BDNF production constructs improved BDNF folding both as a surface-displayed and secreted protein in terms of binding its natural receptors TrkB and p75, but titers remained low. Looking to further enhance the chaperone-like functions provided by the pro-region, two rounds of directed evolution were performed, yielding mutated pro-regions that further improved the display and secretion properties of BDNF. Subsequent optimization of the protease recognition site was used to control whether the produced protein was in pro- or mature BDNF forms. Taken together, we have demonstrated an effective strategy for improving BDNF compatibility with yeast protein engineering and secretion platforms. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Natural radionuclides in the Arabian Sea and Bay of Bengal: distribution and evaluation of particle scavenging processes

    International Nuclear Information System (INIS)

    Sarin, M.M.; Rengarajan, R.; Somayajulu, B.L.K.

    1994-01-01

    Vertical and temporal variations in the activities of 234 Th, 210 Po and 210 Pb have been measured, in both dissolved and particulate phases, at several stations in the eastern Arabian Sea and north-central Bay of Bengal. A comparative study allows us to make inferences about the particle associated scavenging processes in these two seas having distinct biogeochemical properties. A common feature of the 234 Th profiles, in the Arabian Sea and Bay of Bengal, is that the dissolved as well as total (dissolved + particulate) activity of 234 Th is deficient in the surface 200 m with respect of its parent, 238 U. This gross deficiency is attributed to the preferential removal of 234 Th by adsorption onto settling particles which account for its net loss from the surface waters. The scavenging rates of dissolved 234 Th are comparable in these two basins. The temporal variations in the 234 Th- 238 U disequilibrium are significantly pronounced both in the Arabian Sea and Bay of Bengal indicating that the scavenging rates are more influenced by the increased abundance of particles rather than their chemical make-up. The Bay of Bengal and the Arabian Sea appear to be the regions of most intense particle moderated scavenging processes in the world oceans. This is evidenced by the gross disequilibria exhibited by the three isotope pairs used in this study. (author). 33 refs., 8 figs., 5 tabs

  6. Observing storm surges in the Bay of Bengal from satellite altimetry

    Digital Repository Service at National Institute of Oceanography (India)

    Antony, C.; Testut, L.; Unnikrishnan, A.S.

    with the large tidal ranges give rise to extreme sea level in the head bay and surrounding regions. Moreover, low-lying nature of the coast and the dense population in the region make the coasts of the northern Bay of Bengal highly vulnerable to storm surges...-gauge data during the passage of the hurricane Igor that crossed Newfoundland in 2010. For this event, St. John’s tide gauge recorded a maximum surge of 94 cm and Jason-2 (the track located 89 km away from the tide-gauge station) showed positive sea-level...

  7. Who's behind that mask and cape? The Asian leopard cat's Agouti (ASIP) allele likely affects coat colour phenotype in the Bengal cat breed.

    Science.gov (United States)

    Gershony, L C; Penedo, M C T; Davis, B W; Murphy, W J; Helps, C R; Lyons, L A

    2014-12-01

    Coat colours and patterns are highly variable in cats and are determined mainly by several genes with Mendelian inheritance. A 2-bp deletion in agouti signalling protein (ASIP) is associated with melanism in domestic cats. Bengal cats are hybrids between domestic cats and Asian leopard cats (Prionailurus bengalensis), and the charcoal coat colouration/pattern in Bengals presents as a possible incomplete melanism. The complete coding region of ASIP was directly sequenced in Asian leopard, domestic and Bengal cats. Twenty-seven variants were identified between domestic and leopard cats and were investigated in Bengals and Savannahs, a hybrid with servals (Leptailurus serval). The leopard cat ASIP haplotype was distinguished from domestic cat by four synonymous and four non-synonymous exonic SNPs, as well as 19 intronic variants, including a 42-bp deletion in intron 4. Fifty-six of 64 reported charcoal cats were compound heterozygotes at ASIP, with leopard cat agouti (A(P) (be) ) and domestic cat non-agouti (a) haplotypes. Twenty-four Bengals had an additional unique haplotype (A2) for exon 2 that was not identified in leopard cats, servals or jungle cats (Felis chaus). The compound heterozygote state suggests the leopard cat allele, in combination with the recessive non-agouti allele, influences Bengal markings, producing a darker, yet not completely melanistic coat. This is the first validation of a leopard cat allele segregating in the Bengal breed and likely affecting their overall pelage phenotype. Genetic testing services need to be aware of the possible segregation of wild felid alleles in all assays performed on hybrid cats. © 2014 The Authors. Animal Genetics published by John Wiley & Sons Ltd on behalf of Stichting International Foundation for Animal Genetics.

  8. Surface layer temperature inversion in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Pankajakshan, T.; Gopalakrishna, V.V.; Muraleedharan, P.M.; Reddy, G.V.; Araligidad, N.

    Hydrographic and XBT data archived in the Indian Oceanographic Data Centre (IODC) are used to understand the process of temperature inversions occurring in the Bay of Bengal. The following aspects of the inversions are addressed: i) annual...

  9. Surface layer temperature inversion in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Pankajakshan, T.; Gopalakrishna, V.V.; Muraleedharan, P.M.; Reddy, G.V.; Araligidad, N.; Shenoy, Shrikant

    Surface layer temperature inversion occurring in the Bay of Bengal has been addressed. Hydrographic data archived in the Indian Oceanographic Data Center are used to understand various aspects of the temperature inversion of surface layer in the Bay...

  10. Circulation and geostrophic transport in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, D.P.; Murty, V.S.N.

    Utilising the hydrographic data collected during the early northeast monsoon of 1983 and southwest monsoon of 1984, the circulation of waters of the Bay of Bengal and the associated volume transport have been studied in the upper 1000 m...

  11. DDT residues in sediments from the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarkar, A.; SenGupta, R.

    in the sediments from the Bay of Bengal. Peterson grab and hydrographic winch was used to collect the sediment samples. Each sample was extracted and cleaned. Residues were detected by electron capture gas chromatography. A range variation in the concentration...

  12. Primary production in the Bay of Bengal during August 1977

    Digital Repository Service at National Institute of Oceanography (India)

    Devassy, V.P.; Bhattathiri, P.M.A.; Radhakrishna, K.

    Primary production, chlorophyll @ia@@, phaeophytin, phytoplankton and particulate organic carbon (POC) were studied at 14 stations in the Bay of Bengal during August 1977. Column primary production, chlorophyll @ia@@, and phaeopigments varied from 0...

  13. Physical oceanography of the Bay of Bengal and Andaman Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Varkey, M.J.; Murty, V.S.N.; Suryanarayana, A.

    Physical oceanography of the Bay of Bengal and Andaman Sea is reviewed for the first time. All available information for over 50 years is consolidated in this review. To begin with, information on peripheral or related aspects of climate...

  14. Salt balance and mixing in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Varkey, M.J.

    Basic fields of temperature salinity, density and currents in the Bay of Bengal are investigated using data archieved at the National Oceanographic Data Centre (NODC) Washington, D.C. and the Indian National Oceanographic Data Centre (INODC...

  15. Canonical sound speed profile for the central Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Murty, T.V.R.; PrasannaKumar, S.; Somayajulu, Y.K.; Sastry, J.S.; De Figueiredo, R.J.P.

    Following Munk's canonical theory, an algorithm has been presented for computing sound channel parameters in the western and southern Bay of Bengal. The estimated canonical sound speed profile using these parameters has been compared with computed...

  16. Description of temperature dependence of phosphorescence attenuation kinetics of rose Bengal dye at presence of anthracene on the silica heterogeneous surface by the exponential regression method

    International Nuclear Information System (INIS)

    Karstina, S.G.; Markova, M.P.

    2002-01-01

    In the work rose Bengal dye (triplet energy donor) and aromatic hydrocarbon anthracene (triplet energy acceptor) were selected in the capacity of examined substances. The substances were sorption on the SiO 2 porous surface. Measurement have been conducted on the laser device allowing to register of examined composition phosphorescence with time resolution 300 ns at wave length 710 nm. In the result of attenuation kinetic analysis for rose Bengal phosphorescence the empiric formula allowing describing processes of luminescence damping on the heterogeneous surfaces with fractal structure was derived

  17. RF cavity design exploiting a new derivative-free trust region optimization approach

    Directory of Open Access Journals (Sweden)

    Abdel-Karim S.O. Hassan

    2015-11-01

    Full Text Available In this article, a novel derivative-free (DF surrogate-based trust region optimization approach is proposed. In the proposed approach, quadratic surrogate models are constructed and successively updated. The generated surrogate model is then optimized instead of the underlined objective function over trust regions. Truncated conjugate gradients are employed to find the optimal point within each trust region. The approach constructs the initial quadratic surrogate model using few data points of order O(n, where n is the number of design variables. The proposed approach adopts weighted least squares fitting for updating the surrogate model instead of interpolation which is commonly used in DF optimization. This makes the approach more suitable for stochastic optimization and for functions subject to numerical error. The weights are assigned to give more emphasis to points close to the current center point. The accuracy and efficiency of the proposed approach are demonstrated by applying it to a set of classical bench-mark test problems. It is also employed to find the optimal design of RF cavity linear accelerator with a comparison analysis with a recent optimization technique.

  18. Reconstructing Sea Surface Conditions in the Bay of Bengal during the Mid-Pleistocene Transition

    Science.gov (United States)

    Lagos, A. D.; Dekens, P.; Reilly, B. T.; Selkin, P. A.; Meynadier, L.; Savian, J. F.

    2017-12-01

    During the Mid-Pleistocene Transition (MPT, 0.8-1.2Ma) Earth's glacial cycles transitioned from responding primarily to 41kyr obliquity cycles to responding to 100kyr eccentricity cycles. In the tropics, sea surface temperature (SST) in the eastern tropical Pacific cooled through the MPT, suggesting a strengthening of the equatorial Pacific zonal temperature gradient (Medina-Elizalde & Lea, 2005). The strong SST gradient would have intensified Walker Cell convection during the MPT and built up latent heat in the western Pacific, which could cause cold SST anomalies in the northern Indian Ocean (Liu et al., 2015). Due to a scarcity of records, it is unclear how climate and oceanic conditions evolved in the Indian Ocean during the MPT. A set of recent IODP expeditions, including 353 and 354, cored sediment from the Bay of Bengal. Several sites recovered by expedition 353 will be ideal for reconstructing monsoon intensity through time, while the expedition 354 cores from a longitudinal transect at 8°N are in a region not directly impacted by changes in freshwater input due to direct precipitation or run off. The sites are influenced by the northeastern migration of equatorial Indian Ocean water via the Southwest Monsoon Current, which supplies significant moisture to the monsoon. Expedition 354's southern Bay of Bengal sites are well situated for better understanding the link between the tropical Indian Ocean and the northern Bay of Bengal. We reconstructed sea surface conditions at IODP site 1452 (8°N, 87°E, 3670m water depth) in the distal Bengal Fan. A 3 meter long section of the core has been identified as the MPT using the Bruhnes/Matuyama, Jaramillo, and Cobb Mountain paleomagnetic reversals (France-Lanord et al., 2016). This section of site 1452 was sampled every 2cm ( 2kyr resolution). Approximately 30 G. sacculifer, a surface dwelling planktonic foraminifera, were picked from the 355-425μm size fraction. We measured Mg/Ca and δ18O on splits of the same

  19. Dissecting the Structure-Function Relationship of a Fungicidal Peptide Derived from the Constant Region of Human Immunoglobulins

    OpenAIRE

    Ciociola, Tecla; Pertinhez, Thelma A.; Giovati, Laura; Sperindè, Martina; Magliani, Walter; Ferrari, Elena; Gatti, Rita; D'Adda, Tiziana; Spisni, Alberto; Conti, Stefania; Polonelli, Luciano

    2016-01-01

    Synthetic peptides encompassing sequences related to the complementarity-determining regions of antibodies or derived from their constant region (Fc peptides) were proven to exert differential antimicrobial, antiviral, antitumor, and/or immunomodulatory activities in vitro and/or in vivo, regardless of the specificity and isotype of the parental antibody. Alanine substitution derivatives of these peptides exhibited unaltered, increased, or decreased candidacidal activities in vitro. The bioac...

  20. Intra-District Disparities in Primary Education: A Case Study of Bankura District, West Bengal

    Directory of Open Access Journals (Sweden)

    Krishnendu Maji

    2017-03-01

    Full Text Available The level of education and its response to different educational opportunities vary from one spatial unit to another depending on various factors like social, economic, cultural, and institutional. It is understood that certain regions acquire relative advancements over others in terms of human resource development and human capital formation. The key purpose of this research is to examine the intra-district disparities in primary education in Bankura District one of the districts of West Bengal. It ranks 11thamong the 19 districts of West Bengal (Human Development Report, 2007.  Overall literacy rate of the district stands at 70.26% but the district scores low in terms of female literacy rates, which is 60.05%,whereas the male literacy rate is 80.05%, which is a huge gender literacy gap of 20%. There are also regional inequalities existing at block level. Kotulpur ranks first with a literacy rate of 78.01% while Saltora occupies the bottom position with literacy rate of just 61.45% (Census of India, 2011. The level of educational development is dependent on several factors—enrolment ratio, dropout and repetition rates, pupil-teacher ratio, habitations covered by educational institutions, space-student ratio, drinking water and sanitation facilities in school, etc. In this context, the present study aims at examining the issues of intra-district disparities in educational attainment with regard to various educational amenities of Bankura district, West Bengal. Ten attributes have been selected to examine the level of development in primary education. It is clear from the study that the level of development in eastern part of the district is relatively better in comparison to other regions. Economic backwardness and physical bottlenecks continue to be major issues in western blocks.

  1. HELMINTHIASIS IN A BENGAL TIGER (PANTHERA TIGRIS TIGRIS - A CASE REPORT

    Directory of Open Access Journals (Sweden)

    Shivaji Bhattacharya

    2012-12-01

    Full Text Available During post mortem examination of a wild male adult Bengal Tiger of Pirkhali of Sundarban Tiger Reserve, West Bengal, India,Toxocara cati and Taenia hydatigena was observed in the stomach and intestine.

  2. Past and present status of the Indian Tiger in northern West Bengal, India: an overview

    OpenAIRE

    J.K. Mallick

    2010-01-01

    Changes in the distribution range and the estimates of Tiger (Panthera tigris) populations in northern West Bengal from the late 19th century to 2009 were examined in detail. According to a 2004 census there were 70 tigers in the region, while a 2008 estimate put the number at 8-12. The tiger survives only in protected areas of terai and duars extending over about 1000km2 of Buxa, Jaldapara, Neora Valley and Mahananda, the Panighat and Bamanpokhri Ranges of Kurseong Division and the Chilapata...

  3. Study of high-resolution satellite geoid and gravity anomaly data over the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Majumdar, T. J.; Krishna, K.S.; Chatterjee, S.; Bhattacharya, R.; Michael, L.

    research vessels. Solid line shows location of the profile along which interpreted seismic results and var i- ous products of satellite gravity data are shown in Fi gure 4. RESEARCH COMMUNICATIONS CURRENT SCIENCE, VOL. 90, NO. 2 , 25 JANUARY 2006... depth le v els. Location o f the profile is shown with solid line in Figure 3. of the Bay of Bengal can be reasonably co n sidered in mapping the structural features of the region. Thereby the results can be used to study the tectonics...

  4. Relative Sea Level Trends Along the Coast of the Bay of Bengal

    Science.gov (United States)

    Becker, M.; Calmant, S.; Papa, F.; Delebecque, C.; Islam, A. S.; Shum, C. K.

    2016-12-01

    In the coastal belt of the Bay of Bengal, the sea level rise is one of a major threat, linked to climate change, which drastically affects the livelihoods of millions of people. A comprehensive understanding of sea level trends and its variability in this region is therefore crucial and should help to anticipate the impacts of climate change and implement adaptation strategies. This region is bordered mostly by Bangladesh, India, Malaysia, Myanmar, and Thailand. Here, we revisit the sea level changes in the Bay of Bengal region from tide gauges and satellite altimetry over the period 1993-2014. The 23 monthly mean tide gauge records, used in this study, are retrieved from PSMSL (15 records) and supplemented with Bangladeshi observations (8 records). We show that, over the satellite altimetry era, the sea level interannual/decadal variability is mainly due to ocean thermal expansion variability driven by IOD/ENSO events and their low frequency modulation. We focus on relative sea level rise at major coastal cities and try to separate the climatic signal (long term trend plus interannual/decadal variability) from local effects, in particular vertical land movements. Results from GPS are analysed where available. When no such data exist, vertical land movements are deduced from the combined use of tide gauge and altimetry data. While the analysis is performed over the whole region, a particular attention is given to the low-lyingBangladesh's coastal area.

  5. Developmental toxicity in flounder embryos exposed to crude oils derived from different geographical regions.

    Science.gov (United States)

    Jung, Jee-Hyun; Lee, Eun-Hee; Choi, Kwang-Min; Yim, Un Hyuk; Ha, Sung Yong; An, Joon Geon; Kim, Moonkoo

    2017-06-01

    Crude oils from distinct geographical regions have distinct chemical compositions, and, as a result, their toxicity may be different. However, developmental toxicity of crude oils derived from different geographical regions has not been extensively characterized. In this study, flounder embryos were separately exposed to effluents contaminated by three crude oils including: Basrah Light (BLO), Pyrenees (PCO), and Sakhalin Vityaz (SVO), in addition to a processed fuel oil (MFO-380), to measure developmental toxicity and for gene expressions. Each oil possessed a distinct chemical composition. Edema defect was highest in embryos exposed to PCO and MFO-380 that both have a greater fraction of three-ring PAHs (33% and 22%, respectively) compared to BLO and SVO. Observed caudal fin defects were higher in embryos exposed to SVO and MFO-380, which are both dominated by naphthalenes (81% and 52%, respectively). CYP1A gene expressions were also highest in embryos exposed to SVO and MFO-380. Higher incidence of cardiotoxicity and lower nkx 2.5 expression were detected in embryos exposed to PCO. Unique gene expression profiles were observed in embryos exposed to crude oils with distinct compositions. This study demonstrates that crude oils of different geographical origins with different compositional characteristics induce developmental toxicity to different degrees. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Evaluation of the sustainability of deep groundwater as an arsenic-safe resource in the Bengal Basin

    OpenAIRE

    Michael, Holly A.; Voss, Clifford I.

    2008-01-01

    Tens of millions of people in the Bengal Basin region of Bangladesh and India drink groundwater containing unsafe concentrations of arsenic. This high-arsenic groundwater is produced from shallow (150 m where groundwater arsenic concentrations are nearly uniformly low, and many more wells are needed, however, the sustainability of deep, arsenic-safe groundwater has not been previously assessed. Deeper pumping could induce downward migration of dissolved arsenic, permanently destroying the dee...

  7. AoA Region: South Asian Seas

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.W.A.

    is an environmental assessment for the entire Bay of Bengal region (BOBP/ REP/67) prepared for the Swedish Centre for Coastal Development and Management of Aquatic Resources by Holmgren (1994) under the Bay of Bengal Programme. This assessment provides information...-based activities (UNEP 2001) includes information on the South Asian Seas region. Under the Environment Management-Capacity Building Project implemented by the Indian Ministry of Environment and Forests with funding support from the World Bank, the Integrated...

  8. Associations between accelerometer-derived physical activity and regional adiposity in young men and women.

    Science.gov (United States)

    Smith, H A; Storti, K L; Arena, V C; Kriska, A M; Gabriel, K K Pettee; Sutton-Tyrrell, K; Hames, K C; Conroy, M B

    2013-06-01

    Empirical evidence supports an inverse relationship between physical activity (PA) and adiposity, but studies using detailed measures of both are scarce. The relationship between regional adiposity and accelerometer-derived PA in men and women are described. Cross-sectional analysis included 253 participants from a weight loss study limited to ages 20-45 years and BMI 25-39.9 kg m(-2) . PA data were collected with accelerometers and expressed as total accelerometer counts and average amount of time per day accumulated in different intensity levels [sedentary, light-, and moderate-to-vigorous intensity PA (MVPA)]. Accumulation of time spent above 100 counts was expressed as total active time. Computed tomography (CT) was used to measure abdominal and adipose tissue (AT). Multivariate linear regression analyses were used to assess the relationship between regional adiposity (dependent variable) and the various PA levels (independent variable), and were executed separately for men and women, adjusting for wear time, age, race, education, and BMI. Among males, light activity was inversely associated with total AT (β = -0.19; P = 0.02) as well as visceral AT (VAT) (β = -0.30; P = 0.03). Among females sedentary time was positively associated with VAT (β = 0.11; P = 0.04) and total active time was inversely associated with VAT (β = -0.12; P = 0.04). Findings from this study suggest that PA intensity level may influence regional adiposity differently in men and women. Additional research is needed in larger samples to clarify the difference in these associations by sex, create recommendations for the frequency, duration and intensity of PA needed to target fat deposits, and determine if these recommendations should differ by sex. Copyright © 2013 The Obesity Society.

  9. Climate induced changes in the circulation and dispersal patterns of the fluvial sources during late Quaternary in the middle Bengal Fan

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O.S.; Vogelsang, E.

    From a transact along 15˚N latitude in the middle Bengal Fan, temporal and spatial variations in the granulometric parameters and clay minerals in 14C dated box cores from the eastern, the central and the western regions were studied to determine...

  10. Mammals of Kalimpong Hills, Darjeeling District, West Bengal, India

    Directory of Open Access Journals (Sweden)

    J.K. Mallick

    2012-10-01

    Full Text Available Neora Valley National Park (NVNP in the Kalimpong Hills, Darjeeling District, having a wide range of altitudinal variations (183-3,200 m and climatic conditions and forming an ecological trijunction with Sikkim and Bhutan, is the last virgin wilderness in West Bengal. It is a global hotspot for the unique ecosystem, where tropical, sub-tropical, temperate and sub-temperate forests represent a wealth of biodiversity including many threatened and rare mammals. It is the prime habitat of Ailurus fulgens (estimated population 28-32, Neofelis nebulosa (population unassessed, Ursus thibetanus (18, Bos gaurus (81, Hemitragus jemlahicus (32, Naemorhedus goral (73, Capricornis sumatraensis (89, Rusa unicolor (286, Muntiacus vaginalis (590 and Sus scrofa (615. Discovery of Panthera tigris (20 in 1998 prompted the forest department to include NVNP as a sensitive wildlife zone. Many authors recorded the mammalian diversity in Darjeeling District since the mid-nineteenth century, but most of them referred to the Darjeeling Hills. The documentations on Kalimpong Hills are scarce because of the dense canopy, thick undergrowth and inaccessible terrain, particularly in the pristine forests of Neora Valley. Consequently, a comprehensive compendium of the mammals in this region was not prepared. A study was undertaken in 2008-2009 with a view to bridging this knowledge-gap and presenting an updated account of the mammalian species in this new short-listed World Heritage Site and surrounding forests of the Kalimpong Hills based on literature review, questionnaire survey, direct sighting and indirect evidences. During June-October 1916, N.A. Baptista recorded 29 mammalian species (22 genera out of 563 specimens collected, from the region. The present study registered 99 species (68 genera after 94 years.

  11. MHC class I–associated peptides derive from selective regions of the human genome

    Science.gov (United States)

    Pearson, Hillary; Granados, Diana Paola; Durette, Chantal; Bonneil, Eric; Courcelles, Mathieu; Rodenbrock, Anja; Laverdure, Jean-Philippe; Côté, Caroline; Thibault, Pierre

    2016-01-01

    MHC class I–associated peptides (MAPs) define the immune self for CD8+ T lymphocytes and are key targets of cancer immunosurveillance. Here, the goals of our work were to determine whether the entire set of protein-coding genes could generate MAPs and whether specific features influence the ability of discrete genes to generate MAPs. Using proteogenomics, we have identified 25,270 MAPs isolated from the B lymphocytes of 18 individuals who collectively expressed 27 high-frequency HLA-A,B allotypes. The entire MAP repertoire presented by these 27 allotypes covered only 10% of the exomic sequences expressed in B lymphocytes. Indeed, 41% of expressed protein-coding genes generated no MAPs, while 59% of genes generated up to 64 MAPs, often derived from adjacent regions and presented by different allotypes. We next identified several features of transcripts and proteins associated with efficient MAP production. From these data, we built a logistic regression model that predicts with good accuracy whether a gene generates MAPs. Our results show preferential selection of MAPs from a limited repertoire of proteins with distinctive features. The notion that the MHC class I immunopeptidome presents only a small fraction of the protein-coding genome for monitoring by the immune system has profound implications in autoimmunity and cancer immunology. PMID:27841757

  12. Production technology of 131I-rose bengal

    International Nuclear Information System (INIS)

    Hradilek, P.; Miklik, M.; Kopicka, K.; Kronrad, L.

    1983-01-01

    A detailed description is presented of the production equipment and production process used for Rose Bengal labelled with 131 I designed for use in nuclear medicine. The apparatus was installed in the semi-hot cell laboratory of the Nuclear Research Institute at Rez. The processed activity is around 20 GBq, the average yield of the ion exchange reaction between non-radioactive Rose Bengal and 131 I-labelled sodium iodide is 90%. The unreacted active sodium iodide is separated and the resulting product is diluted and processed into a drug presentation, sterilized and after random control is distributed in 14 days intervals to medical workplaces. (M.D.)

  13. Rapid labelling of rose bengal and iothalamate with radioiodine

    International Nuclear Information System (INIS)

    Alvarez, J.

    1981-01-01

    Rapid and simple methods for tagging rose bengal and iothalamate with radioactive iodine are proposed. In both cases, the reaction takes place in a penicillintype vial. In the first method, Chloramine-T, was added to a vial containing rose bengal and radioiodide. Tagging iothalamate requires heating a mixture of iothalamate and radioactive iodine in the autoclave. A high radiochemical yield was obtained in the two procedures. This obviated the need of separating the small amount of free radioiodine present in the final product. (author)

  14. Fast radioiodination of rose bengal at room temperature

    International Nuclear Information System (INIS)

    Verbruggen, R.F.

    1987-01-01

    Polyhalogenated dyes based on aromatic ring systems such as fluorosceins have been used for the evaluation of hepatobiliary function since 1909. In 1955 rose bengal was radioiodinated and a radiocontrastdye become a radiopharmaceutical. In the present study an improved method, based on the chloramine-T method, has been developed for labelling rose bengal. This method was chosen for its short reaction time, its mild conditions and its high yield. The optimum values of the reaction parameters have been determined, and resulted in a slightly higher yield, within a shorter time and without breakdown products being present

  15. Independent evaluation of the SNODAS snow depth product using regional scale LiDAR-derived measurements

    Science.gov (United States)

    Hedrick, A.; Marshall, H.-P.; Winstral, A.; Elder, K.; Yueh, S.; Cline, D.

    2014-06-01

    Repeated Light Detection and Ranging (LiDAR) surveys are quickly becoming the de facto method for measuring spatial variability of montane snowpacks at high resolution. This study examines the potential of a 750 km2 LiDAR-derived dataset of snow depths, collected during the 2007 northern Colorado Cold Lands Processes Experiment (CLPX-2), as a validation source for an operational hydrologic snow model. The SNOw Data Assimilation System (SNODAS) model framework, operated by the US National Weather Service, combines a physically-based energy-and-mass-balance snow model with satellite, airborne and automated ground-based observations to provide daily estimates of snowpack properties at nominally 1 km resolution over the coterminous United States. Independent validation data is scarce due to the assimilating nature of SNODAS, compelling the need for an independent validation dataset with substantial geographic coverage. Within twelve distinctive 500 m × 500 m study areas located throughout the survey swath, ground crews performed approximately 600 manual snow depth measurements during each of the CLPX-2 LiDAR acquisitions. This supplied a dataset for constraining the uncertainty of upscaled LiDAR estimates of snow depth at the 1 km SNODAS resolution, resulting in a root-mean-square difference of 13 cm. Upscaled LiDAR snow depths were then compared to the SNODAS-estimates over the entire study area for the dates of the LiDAR flights. The remotely-sensed snow depths provided a more spatially continuous comparison dataset and agreed more closely to the model estimates than that of the in situ measurements alone. Finally, the results revealed three distinct areas where the differences between LiDAR observations and SNODAS estimates were most drastic, suggesting natural processes specific to these regions as causal influences on model uncertainty.

  16. The regulation of growth and metabolism of kidney stem cell with regional specificity using extracellular matrix derived from kidney

    OpenAIRE

    O’Neill, John D.; Freytes, Donald O.; Anandappa, Annabelle; Oliver, Juan A.; Vunjak-Novakovic, Gordana

    2013-01-01

    Native extracellular matrix (ECM) that is secreted and maintained by resident cells is of great interest for cell culture and cell delivery. We hypothesized that specialized bioengineered niches for stem cells can be established using ECM-derived scaffolding materials. Kidney was selected as a model system because of the high regional diversification of renal tissue matrix. By preparing the ECM from three specialized regions of the kidney (cortex, medulla, and papilla; whole kidney, heart, an...

  17. Dynamical significance of tides over the Bay of Bengal

    Science.gov (United States)

    Bhagawati, Chirantan; Pandey, Suchita; Dandapat, Sumit; Chakraborty, Arun

    2018-06-01

    Tides play a significant role in the ocean surface circulations and vertical mixing thereby influencing the Sea Surface Temperatures (SST) as well. This, in turn, plays an important role in the global circulation when used as a lower boundary condition in a global atmospheric general circulation model. Therefore in the present study, the dynamics of tides over the Bay of Bengal (BoB) is investigated through numerical simulations using a high resolution (1/12°) Regional Ocean Modeling System (ROMS). Based on statistical analysis it is observed that incorporation of explicit tidal forcing improves the model performance in simulating the basin averaged monthly surface circulation features by 64% compared to the simulation without tides. The model simulates also Mixed Layer Depth (MLD) and SST realistically. The energy exchange between tidal oscillations and eddies leads to redistribution of surface kinetic energy density with a net decrease of 0.012 J m-3 in the western Bay and a net increase of 0.007 J m-3 in the eastern Bay. The tidal forcing also affects the potential energy anomaly and vertical mixing thereby leading to a fall in monthly MLD over the BoB. The mixing due to tides leads to a subsequent reduction in monthly SST and a corresponding reduction in surface heat exchange. These results from the numerical simulation using ROMS reveal that tides have a significant influence over the air-sea heat exchange which is the most important parameter for prediction of Tropical Cyclone frequency and its future variability over the BoB.

  18. Lateral variation in crustal and mantle structure in Bay of Bengal based on surface wave data

    Science.gov (United States)

    Kumar, Amit; Mukhopadhyay, Sagarika; Kumar, Naresh; Baidya, P. R.

    2018-01-01

    Surface waves generated by earthquakes that occurred near Sumatra, Andaman-Nicobar Island chain and Sunda arc are used to estimate crustal and upper mantle S wave velocity structure of Bay of Bengal. Records of these seismic events at various stations located along the eastern coast of India and a few stations in the north eastern part of India are selected for such analysis. These stations lie within regional distance of the selected earthquakes. The selected events are shallow focused with magnitude greater than 5.5. Data of 65, 37, 36, 53 and 36 events recorded at Shillong, Bokaro, Visakhapatnam, Chennai and Trivandrum stations respectively are used for this purpose. The ray paths from the earthquake source to the recording stations cover different parts of the Bay of Bengal. Multiple Filtering Technique (MFT) is applied to compute the group velocities of surface waves from the available data. The dispersion curves thus obtained for this data set are within the period range of 15-120 s. Joint inversion of Rayleigh and Love wave group velocity is carried out to obtain the subsurface information in terms of variation of S wave velocity with depth. The estimated S wave velocity at a given depth and layer thickness can be considered to be an average value for the entire path covered by the corresponding ray paths. However, we observe variation in the value of S wave velocity and layer thickness from data recorded at different stations, indicating lateral variation in these two parameters. Thick deposition of sediments is observed along the paths followed by surface waves to Shillong and Bokaro stations. Sediment thickness keeps on decreasing as the surface wave paths move further south. Based on velocity variation the sedimentary layer is further divided in to three parts; on top lay unconsolidated sediment, underlain by consolidated sediment. Below this lies a layer which we consider as meta-sediments. The thickness and velocity of these layers decrease from north

  19. Monitoring groundwater storage changes in the highly dynamic Bengal Basin: validation of GRACE measurements

    Science.gov (United States)

    Shamsudduha, M.; Taylor, R. G.; Longuevergne, L.

    2011-12-01

    Monitoring of spatio-temporal changes in terrestrial water storage (ΔTWS) provides valuable information regarding the basin-scale dynamics of hydrological systems. Recent satellite measurements of the ΔTWS under the Gravity Recovery and Climate Experiment (GRACE) enable the derivation of groundwater storage changes (ΔGWS) where in situ data are limited. In the well monitored and highly-dynamic Bengal Basin of Bangladesh, we test the ability of GRACE measurements to trace the seasonality and trend in groundwater storage associated with intensive groundwater abstraction for dry-season irrigation and wet-season (monsoonal) recharge. Two different GRACE products (CSR and GRGS) and data processing methods (gridded and spherical harmonics) are also compared. Results show that GRACE derived estimates of recent (2003 to 2007) ΔGWS correlate well (r=0.77 to 0.93, p-value CSR for these estimates. ΔGWS accounts for 44% of the total variation in ΔTWS in the Bengal Basin. Changes in surface water storage (ΔSWS) estimated from a network of 298 river gauging stations and soil moisture storage (ΔSMS) derived from Land Surface Models explain 22% and 33% of ΔTWS respectively. Groundwater depletion estimated from borehole hydrographs (-0.52±0.30 km3/yr) is within the range of satellite-derived estimates (-0.44 to -2.04 km3/yr) that result from uncertainty associated with ΔSMS (CLM, NOAH, VIC) and GRACE data processing techniques. Recent (2003 to 2007) estimates of groundwater depletion are substantially greater than the long-term (1985 to 2007) mean (-0.21±0.03 km3/yr) and are explained primarily by substantial increases in groundwater abstraction for the dry-season irrigation and drinking water supplies over the last two decades.

  20. Forcing mechanisms of the Bay of Bengal circulation

    Digital Repository Service at National Institute of Oceanography (India)

    Vinayachandran, P.N.; Shetye, S.R.; Sengupta, D.; Gadgil, S.

    A state-of-the-art ocean general circulation model, set up for the North Indian Ocean and driven by climatological wind stress simulates most of the observed features of the near-surface circulation of the Bay of Bengal. The prominent features...

  1. Upwelling features near Sri Lanka in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    ShreeRam, P.; Rao, L.V.G.

    , the southwest monsoon in summer and the northeast monsoon in winter. The wind stress associated with these winds cause mass drift of oceanic waters leading to upwelling and downwelling. The upwelling features in the Bay of Bengal with a special mention about...

  2. Late Quaternary sedimentation in eastern Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O.S; Mascarenhas, A; Paropkari, A; Rao, Ch.M.

    This study presents variations in various size measures, calcium carbonate, organic carbon, clay mineralogy and major and trace elements in a core (5.40 m long, 2713 m depth) from the eastern Bay of Bengal. On a CM diagram, the sediments of the core...

  3. Magnetic basement in the central Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, K.V.L.N.S.; Ramana, M.V.; Ramprasad, T.; Desa, M.; Subrahmanyam, V.; Krishna, K.S.; Rao, M.M.M.

    Analyses of about 6000 km of processed magnetic data in the central Bay of Bengal using Analytical Signal Processing and Werner Deconvolution techniques revealed that the depth to top of the magnetic basement varies between 5 and 12 km from the sea...

  4. Bay of Bengal Process Studies (BOBPS) Final Report

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Sardessai, S.; Ramaiah, N.; Bhosle, N.B.; Ramaswamy, V.; Ramesh, R.; Sharada, M.K.; Sarin, M.M.; Sarupria, J.S.; Muraleedharan, U.

    E, and 4 were along western boundary - were covered. In all 35 parameters were measured. Several new insights are emerging out of the BOBPS data analysis. We now understand why Bay of Bengal is a biologically low productive basin. This is largely due...

  5. Nitrous oxide in the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.W.A.; Jayakumar, D; Nair, M.; DileepKumar, M.; George, M.D

    Extensive observations on nitrous oxide (N@d2@@O) in the atmosphere and waters of the western Bay of Bengal during March-April 1991 yield surface saturations and atmospheric fluxes ranging from 89.3 to 213.9% (mean 125.2%), and from 0.10 to 10...

  6. Local Sustainable Energy Assessment of Uttarakhand and West Bengal

    DEFF Research Database (Denmark)

    Andersen, Jan; Lund, Søren

    The publication reports a sustainable energy assessment at the local project site of the HighARCS project in Nainital, Uttarakhand and Buxa, West Bengal, India. The assessment has been made as a contribution to the elaboration of biodiversity conservation and livelihoods improvement action plans...

  7. Rose bengal-sensitized nanocrystalline ceria photoanode for dye ...

    Indian Academy of Sciences (India)

    The bandgap of 2.93 eV is calculated using UV–visible ... Keywords. Wide bandgap; dye-sensitized solar cells; CeO2; rose bengal dye. 1. ... and renewable energy, its high-cost production and installa- tion excludes direct commercial use. It is an urgent require- .... surface leads to oxygen vacancies and defects, whose influ-.

  8. Δ14C level of annual plants and fossil fuel derived CO2 distribution across different regions of China

    International Nuclear Information System (INIS)

    Xi, X.T.; Ding, X.F.; Fu, D.P.; Zhou, L.P.; Liu, K.X.

    2013-01-01

    The 14 C level in annual plants is a sensitive tracer for monitoring fossil fuel derived CO 2 in the atmosphere. Corn leave samples were selected from different regions of China, including high mountains in the Tibetan Plateau, grassland in Inner Mongolia, and inland and coastal cities during the summer of 2010. The 14 C/ 12 C ratio of the samples was measured with the NEC compact AMS system at the Institute of Heavy Ion Physics, Peking University. The fossil fuel derived CO 2 was estimated by comparing the measured Δ 14 C values of corn leave samples to background atmospheric Δ 14 C level. The influences of topography, meteorological conditions and carbon cycling processes on the fossil fuel derived CO 2 concentration are considered when interpreting the data. Our results show a clear association of the low Δ 14 C values with regions where human activities are intensive.

  9. Regional scale climatic trends derived from Younger Dryas glaciers in the U.K.

    Science.gov (United States)

    Pearce, D.; Rea, B. R.; Barr, I.; Small, D.; McDougall, D.

    2014-12-01

    In the U.K., the glacial geomorphological record has been utilised to infer paleo-glacier geometries and ice dynamics, with much of this work focussing on the Scottish Highlands during the Younger Dryas (YD; c. 12.9 - 11.7 ka BP). During the YD the West Highlands Ice-cap covered the majority of the Scottish Highlands (c. 13,000 sq mi), which is thought to have affected accumulation rates beyond the ice-cap margins, resulting in a steep (c. 80%) easterly decline in precipitation and smaller ice-masses. We present multi-proxy data investigating YD glaciation in the Tweedsmuir Hills, Southern Uplands, Scotland (55°46' N, 03°34' W), suggesting conditions were less arid. The area forms the most easterly upland region in the Southern Uplands and south of the West Highlands Ice-cap, reaching an altitude of 840 m and covering c. 200 sq mi. Results of air-photo interpretation and field mapping, which utilised a morphostratigraphic approach, have demonstrated a more extensive glaciation than previously mapped. The reconstruction consists of two separate icefields covering an area c. 40 sq mi. and new 14C dates of basal contact organics place the ice-mass within the context of the YD but new Cosmogenic Nuclide Analysis (CNA) of bedrock and in situ boulders are inconclusive, implying limited erosion and limited resetting during the YD. Equilibrium Line Altitudes are calculated to have ranged from c. 419 - 634 m. Paleo-precipitation values were derived using two precipitation-temperature relationships and suggest slightly lower totals than YD ice-masses located on the west coast of the U.K. but do not support a significant easterly reduction in precipitation. Analysis of present-day (c. 30 year) meteorological data across the U.K. demonstrates a pronounced reduction in precipitation of c. 50% on the east coast. This disparity between present-day and glacier-based YD precipitation patterns is partly attributable to the methodology employed in glacier reconstruction and

  10. Regional rainfall climatologies derived from Special Sensor Microwave Imager (SSM/I) data

    Science.gov (United States)

    Negri, Andrew J.; Adler, Robert F.; Nelkin, Eric J.; Huffman, George J.

    1994-01-01

    Climatologies of convective precipitation were derived from passive microwave observations from the Special Sensor Microwave Imager using a scattering-based algorithm of Adler et al. Data were aggregated over periods of 3-5 months using data from 4 to 5 years. Data were also stratified by satellite overpass times (primarily 06 00 and 18 00 local time). Four regions (Mexico, Amazonia, western Africa, and the western equatorial Pacific Ocean (TOGA COARE area) were chosen for their meteorological interest and relative paucity of conventional observations. The strong diurnal variation over Mexico and the southern United States was the most striking aspect of the climatologies. Pronounced morning maxima occured offshore, often in concativities in the coastline, the result of the increased convergence caused by the coastline shape. The major feature of the evening rain field was a linear-shaped maximum along the western slope of the Sierra Madre Occidental. Topography exerted a strong control on the rainfall in other areas, particularly near the Nicaragua/Honduras border and in Guatemala, where maxima in excess of 700 mm/month were located adjacent to local maxima in terrain. The correlation between the estimates and monthly gage data over the southern United States was low (0.45), due mainly to poor temporal sampling in any month and an inadequate sampling of the diurnal cycle. Over the Amazon Basin the differences in morning versus evening rainfall were complex, with an alternating series of morning/evening maxima aligned southwest to northeast from the Andes to the northeast Brazilian coast. A real extent of rainfall in Amazonia was slightly higher in the evening, but a maximum in morning precipitation was found on the Amazon River just east of Manaus. Precipitation over the water in the intertropical convergence zone (ITCZ) north of Brazil was more pronounced in the morning, and a pronounced land-/sea-breeze circulation was found along the northeast coast of Brazil

  11. A Regional-Scale Assessment of Satellite Derived Precipitable Water Vapor Across The Amazon Basin

    Science.gov (United States)

    DeLiberty, Tracy; Callahan, John; Guillory, Anthony R.; Jedlovec, Gary

    2000-01-01

    Atmospheric water vapor is widely recognized as a key climate variable, linking an assortment of poorly understood and complex processes. It is a major element of the hydrological cycle and provides a mechanism for energy exchange among many of the Earth system components. Reducing uncertainty in our current knowledge of water vapor and its role in the climate system requires accurate measurement, improved modeling techniques, and long-term prediction. Satellites have the potential to satisfy these criteria, as well as provide high resolution measurements that are not available from conventional sources. The focus of this paper is to examine the temporal and mesoscale variations of satellite derived precipitable water vapor (PW) across the Amazon Basin. This region is pivotal in the functioning of the global climate system through its abundant release of latent heat associated with heavy precipitation events. In addition, anthropogenic deforestation and biomass burning activities in recent decades are altering the conditions of the atmosphere, especially in the planetary boundary layer. A physical split-window (PSW) algorithm estimates PW using images from the GOES satellites along with the NCEP/NCAR Reanalysis data that provides the first guess information. Retrievals are made at a three-hourly time step during daylight hours in the Amazon Basin and surrounding areas for the months of June and October in 1988 (dry year) and 1995 (wet year). Spatially continuous fields are generated 5 times daily at 12Z, 15Z, 18Z, 21Z, and 00Z. These fields are then averaged to create monthly and 3 hourly monthly grids. Overall, the PSW estimates PW reasonable well in the Amazon with MAE ranging from 3.0 - 9.0 mm and MAE/observed mean around 20% in comparison to radiosonde observations. The distribution of PW generally mimics that of precipitation. Maximum values (42 - 52 mm) are located in the Northwest whereas minimum values (18 - 27 mm) are found along Brazil's East coast. Aside

  12. Total petroleum hydrocarbon in the tissues of some commercially important fishes of the Bay of Bengal.

    Science.gov (United States)

    Ansari, Zakir A; Desilva, Classy; Badesab, Shahin

    2012-11-01

    The present study reports the level of total petroleum hydrocarbon (TPH) in 27 commercially important fish, crustaceans and cephalopods from Orissa coast, Bay of Bengal to provide the baseline data for oil contamination in marine biota. The results showed significant differences in the TPH concentration in different species. Of all fish, Carangoides malabaricus showed the maximum TPH level (av. 13.70 μg g(-1)). In cephalopods, Loligo recorded the maximum TPH (av. 14.87 μg g(-1)) while Metapenaeus dobsoni recorded the maximum TPH (av. 13.18 μg g(-1)) among crustaceans. The concentration of TPH recorded in the present study were higher than the reported values from other studies in Bay of Bengal but were comparable with those of other Indian coast and Gulf water. The species recording maximum concentration and giving significant correlation coefficient may be of interest in oil pollution monitoring and can be used as indicator of hydrocarbon pollution in the region. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Spatial Association of Wetlands over Physical Variants in Barind Tract of West Bengal, India.

    Directory of Open Access Journals (Sweden)

    Rajeb Tarani Das

    2016-07-01

    Full Text Available Abstract: Barind tract of west Bengal is an uplifted old alluvial plain area where only <1 percent area is covered by wetland. Present paper concentrates on general understanding of wetland association with different geographical settings like geological, geomorphological lithological structure and altitudinal gradations. Detail investigation reveals that geological and morphological structure do not have deep influence on wetland formation and their distribution in particular favourable sub-region. But altitudinal control on wetland is noticeable. An irregular distribution of wetland is found throughout the region because of multi parametric influence on it. In recent decades wetlands in barind tract has been undergoing into rapid loss. Continuous encroachment of agricultural field and newly built-up area to wetland are considered as main causes of wetland loss in barind tract.

  14. A fractional derivative approach to full creep regions in salt rock

    DEFF Research Database (Denmark)

    Zhou, H. W.; Wang, C. P.; Mishnaevsky, Leon

    2013-01-01

    Based on the definition of the constant-viscosity Abel dashpot, a new creep element, referred to as the variable-viscosity Abel dashpot, is proposed to characterize damage growth in salt rock samples during creep tests. Ultrasonic testing is employed to determine a formula of the variable viscosity...... coefficient, indicating that the change of the variable viscosity coefficient with the time meets a negative exponent law. In addition, by replacing the Newtonian dashpot in the classical Nishihara model with the variable-viscosity Abel dashpot, a damage-mechanism-based creep constitutive model is proposed...... on the basis of time-based fractional derivative. The analytic solution for the fractional-derivative creep constitutive model is presented. The parameters of the fractional derivative creep model are determined by the Levenberg–Marquardt method on the basis of the experimental results of creep tests on salt...

  15. The comparison of physical properties derived from gas and dust in a massive star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

    2014-05-10

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  16. The comparison of physical properties derived from gas and dust in a massive star-forming region

    International Nuclear Information System (INIS)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve

    2014-01-01

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  17. Source parameters of the Bay of Bengal earthquake of 21 May 2014 and related seismotectonics of 85°E and 90°E ridges

    Science.gov (United States)

    Prakash, Rajesh; Prajapati, Sanjay Kumar; Srivastava, Hari Narain

    2018-01-01

    Source parameters of the Bay of Bengal earthquake of 21 May 2014 have been studied using full waveform inversion. Its source mechanism thus determined the orientation of the strike slip faulting as NW-SE/NE-SW. The occurrence of past earthquakes along the NE-SW nodal plane suggested its preference as the main fault which could result from the transmission of stresses from the Indian plate boundary. High stress drop of this earthquake (216 bar) is attributed to its location in the intraplate region, strike slip faulting and focus in the colder upper mantle. Comparison of the stress drop of deeper focus Hindukush earthquakes with that of the Bay of Bengal earthquake showed a smaller felt radius due to fractured lithosphere in the Himalayas vis-a-vis more efficient propagation of seismic waves in the peninsular region from the source region of this recent earthquake. The seismological evidence presented for the 85°E and 90°E ridges shows the predominance of strike slip faulting with thrusting on both the ridges. Integrating their source mechanism with that of the May 2014 earthquake, it could be inferred that the Bay of Bengal region (excluding Andaman Sumatra subduction zone) is characterised predominantly by strike slip faulting in the region north of latitude 20°N and strike slip with thrusting in the remaining portion.

  18. Vestas Pinaria Region: Original Basaltic Achondrite Material Derived from Mixing Upper and Lower Crust

    Science.gov (United States)

    Mcfadden, L. A.; Combe, Jean-Philippe; Ammannito, Eleonora; Frigeri, Alessandro; Stephan, Katrin; Longobardo, Andrea; Palomba, Ernesto; Tosi, Federico; Zambon, Francesca; Krohn, Katrin; hide

    2015-01-01

    Analysis of data from the Dawn mission shows that the Pinaria region of Vesta spanning a portion of the rim of the Rheasilvia basin is bright and anhydrous. Reflectance spectra, absorption band centers, and their variations, cover the range of pyroxenes from diogenite-rich to howardite and eucrite compositions, with no evidence of olivine in this region. By examining band centers and depths of the floor, walls and rims of six major craters in the region, we find a lane of diogenite-rich material next to howardite-eucrite material that does not follow the local topography. The source of this material is not clear and is probably ejecta from post-Rheasilvia impacts. Material of a howardite-eucrite composition originating from beyond the Rheasilvia basin is evident on the western edge of the region. Overall, the Pinaria region exposes the complete range of basaltic achondrite parent body material, with little evidence of contamination of non-basaltic achondrite material. With both high reflectance and low abundance of hydrated material, this region of Vesta may be considered the "Pinaria desert".

  19. Waves off Gopalpur, northern Bay of Bengal during cyclone Phailin.

    Digital Repository Service at National Institute of Oceanography (India)

    Amrutha, M.M.; SanilKumar, V.; Anoop, T.R.; Nair, T.M.B.; Nherakkol, A.; Jeyakumar, C.

    , 1073–1083, 2014 www.ann-geophys.net/32/1073/2014/ doi:10.5194/angeo-32-1073-2014 © Author(s) 2014. CC Attribution 3.0 License. Waves off Gopalpur, northern Bay of Bengal during Cyclone Phailin M. M. Amrutha1, V. Sanil Kumar1, T. R. Anoop1, T. M..., 1073–1083, 2014 www.ann-geophys.net/32/1073/2014/ M. M. Amrutha et al.: Waves off Gopalpur, northern Bay of Bengal during Cyclone Phailin 1075 Figure 1. Track of the Cyclone Phailin from 8 October 2013 03:00 UTC to 13 October 2013 06:00 UTC. S(f )= αg 2...

  20. Insight on invasions and resilience derived from spatiotemporal discontinuities of biomass at local and regional scales

    Science.gov (United States)

    Angeler, David G.; Allen, Criag R.; Johnson, Richard K.

    2012-01-01

    Understanding the social and ecological consequences of species invasions is complicated by nonlinearities in processes, and differences in process and structure as scale is changed. Here we use discontinuity analyses to investigate nonlinear patterns in the distribution of biomass of an invasive nuisance species that could indicate scale-specific organization. We analyze biomass patterns in the flagellate Gonyostomum semen (Raphidophyta) in 75 boreal lakes during an 11-year period (1997-2007). With simulations using a unimodal null model and cluster analysis, we identified regional groupings of lakes based on their biomass patterns. We evaluated the variability of membership of individual lakes in regional biomass groups. Temporal trends in local and regional discontinuity patterns were analyzed using regressions and correlations with environmental variables that characterize nutrient conditions, acidity status, temperature variability, and water clarity. Regionally, there was a significant increase in the number of biomass groups over time, indicative of an increased number of scales at which algal biomass organizes across lakes. This increased complexity correlated with the invasion history of G. semen and broad-scale environmental change (recovery from acidification). Locally, no consistent patterns of lake membership to regional biomass groups were observed, and correlations with environmental variables were lake specific. The increased complexity of regional biomass patterns suggests that processes that act within or between scales reinforce the presence of G. semen and its potential to develop high-biomass blooms in boreal lakes. Emergent regional patterns combined with locally stochastic dynamics suggest a bleak future for managing G. semen, and more generally why invasive species can be ecologically successful.

  1. Preparation of Labelled I131 Rose-Bengal

    International Nuclear Information System (INIS)

    Mayani, Mbutyabo; Chabouri, Galaal.

    1978-01-01

    Rose bengal purified on a Sephadex G-25 column has been labelled with iodine-131. The exchange reaction has been undertaken in an ether - alcohol medium. The influence of different factors (iodine concentration, Psup(h), purity and chemical form of the substratum, reaction rate) on the labelling yield has been studied. Radiochemical yield of 90% have been obtained in some conditions instead of the normal 80% reported in the literature

  2. Comparison of aquifer characteristics derived from local and regional aquifer tests.

    Science.gov (United States)

    Randolph, R.B.; Krause, R.E.; Maslia, M.L.

    1985-01-01

    A comparison of the aquifer parameter values obtained through the analysis of a local and a regional aquifer test involving the same area in southeast Georgia is made in order to evaluate the validity of extrapolating local aquifer-test results for use in large-scale flow simulations. Time-drawdown and time-recovery data were analyzed by using both graphical and least-squares fitting of the data to the Theis curve. Additionally, directional transmissivity, transmissivity tensor, and angle of anisotropy were computed for both tests. -from Authors Georgia drawdown transmissivity regional aquifer tests

  3. Radon derived air mass fetch regions during the ACE-Asia campaign

    International Nuclear Information System (INIS)

    Chambers, S.; Zahorowski, W.; Werczynski, S.; Wang, T.; Poon, S.; Kim, J.; Oh, S.-N.; Knag, H.; Uematsu, M.; Matsumoto, K.

    2003-01-01

    Seasonal variations in fetch regions for air masses exhibiting the greatest and least terrestrial influence at three sites in East Asia are discussed. Results are based on the first year of hourly atmospheric radon concentration observations made as part of the Asian Aerosol Characterisation Experiment (ACE-Asia). Fetch regions for Asian continental outflow to the Pacific Basin within the boundary layer are shown to be distinct from corresponding tropospheric outflow events. Analysis of the hourly radon time series in conjunction with back trajectory analysis indicates the presence of a large localised radon source in south eastern China

  4. BLOOD PROTEIN TRANSFERRIN POLYMOROPHISM IN BLACK BENGAL GOAT

    Directory of Open Access Journals (Sweden)

    Rajesh Paul

    2017-12-01

    Full Text Available The present investigation was carried out with an aim to explore the polymorphism of a blood protein tranferrin using starch gel electrophoresis technique in a total of unrelated 199 Black Bengal goats available in four different districts of West Bengal, India. Banding patterns of transferrin in starch gel revealed six phenovariants TfAA, TfAB, TfBC, TfBB, TfAC and TfCC comprising of three allelomorphs, TfA, TfB and TfC. The genotype frequencies were found to be observed 0.211, 0.347, 0.136, 0.106, 0.136 and 0.065 for six genotypes and the allelic frequencies were 0.452, 0.347 and 0.201 for three alleles, respectively. Result of Chi-square test revealed that the population under study was in Hardy Weinberg Equilibrium. There were polymorphism in Transferrin protein and the presence of differences among the frequencies of the three alleles by categories could be a source of genetic variation in Black Bengal goat.

  5. 9 CFR 94.20 - Gelatin derived from horses or swine, or from ruminants that have not been in any region where...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Gelatin derived from horses or swine... § 94.20 Gelatin derived from horses or swine, or from ruminants that have not been in any region where bovine spongiform encephalopathy exists. Gelatin derived from horses or swine, or from ruminants that...

  6. Diet of Bengal Tigers (Panthera tigris tigris in Chitwan National Park, Nepal

    Directory of Open Access Journals (Sweden)

    Bhandari Shivish

    2017-10-01

    Full Text Available We studied the diet of the Bengal tigers (Panthera tigris tigris in Chitwan National Park, Nepal, by identifying 109 prey items from 85 tiger scats. Tigers in this region fed upon eight different mammal species. Chital (Axis axis was the major prey with a frequency of 45% of the Tigers’ diet. The occurrence of other prey species included sambar (Cervus unicolor, 23%, wild pig (Sus scrofa, 15%, hog deer (Axis porcinus, 9%, barking deer (Muntiacus muntjak, 4%, and gaur (Bos gaurus, 2%. Tigers also hunted livestock, but this prey comprised a small component of the relative biomass (buffalo 5% and cow 2%. Our study suggests that the tiger depends mostly upon wild prey for its subsistence in the Chitwan National Park, but will also sporadically hunt livestock.

  7. Gold-198 and rose bengal marked with iodine-131 in the diagnostic of hepatic vesicular affections

    International Nuclear Information System (INIS)

    Manambelona Razafimalaza, J.

    1961-06-01

    Colloidal gold-198 makes it possible to obtain clear images of hepatic parenchyma; the examination can be repeated from different angles thus demonstrating the presence of pathologically inert regions, whether they be hydatic cysts, abscesses or neoplasia. The study of the disappearance curve for the colloid, together with a measurement of the blood volume, makes it possible also to calculate the hepatic flow. Using Rose Bengal marked with iodine-131, it is possible to obtain images of the liver and of the bile ducts, and to follow the elimination of the dye in the intestines. The simultaneous recording of the disappearance curves for the blood and of the appearance of the dye in the intestines constitutes an useful working test which is particularly sensible for evaluating the permeability of the bile ducts and, to a certain degree, the site of an obstruction. (author) [fr

  8. Problems in Deriving Italian Regional Differences in Intelligence from 2009 PISA Data

    Science.gov (United States)

    Cornoldi, Cesare; Giofre, David; Martini, Angela

    2013-01-01

    Recent results of international assessment programs (e.g., PISA) have shown a large difference in high school students' performance between northern and southern Italy. On this basis, it has been argued that the discrepancy reflects differences in average intelligence of the inhabitants of regions and is associated with genetic factors ( and ).…

  9. An AHP-derived method for mapping the physical vulnerability of coastal areas at regional scales

    Directory of Open Access Journals (Sweden)

    G. Le Cozannet

    2013-05-01

    Full Text Available Assessing coastal vulnerability to climate change at regional scales is now mandatory in France since the adoption of recent laws to support adaptation to climate change. However, there is presently no commonly recognised method to assess accurately how sea level rise will modify coastal processes in the coming decades. Therefore, many assessments of the physical component of coastal vulnerability are presently based on a combined use of data (e.g. digital elevation models, historical shoreline and coastal geomorphology datasets, simple models and expert opinion. In this study, we assess the applicability and usefulness of a multi-criteria decision-mapping method (the analytical hierarchy process, AHP to map physical coastal vulnerability to erosion and flooding in a structured way. We apply the method in two regions of France: the coastal zones of Languedoc-Roussillon (north-western Mediterranean, France and the island of La Réunion (south-western Indian Ocean, notably using the regional geological maps. As expected, the results show not only the greater vulnerability of sand spits, estuaries and low-lying areas near to coastal lagoons in both regions, but also that of a thin strip of erodible cliffs exposed to waves in La Réunion. Despite gaps in knowledge and data, the method is found to provide a flexible and transportable framework to represent and aggregate existing knowledge and to support long-term coastal zone planning through the integration of such studies into existing adaptation schemes.

  10. Microbiome-Derived Lipopolysaccharide Enriched in the Perinuclear Region of Alzheimer’s Disease Brain

    Directory of Open Access Journals (Sweden)

    Yuhai Zhao

    2017-09-01

    Full Text Available Abundant clinical, epidemiological, imaging, genetic, molecular, and pathophysiological data together indicate that there occur an unusual inflammatory reaction and a disruption of the innate-immune signaling system in Alzheimer’s disease (AD brain. Despite many years of intense study, the origin and molecular mechanics of these AD-relevant pathogenic signals are still not well understood. Here, we provide evidence that an intensely pro-inflammatory bacterial lipopolysaccharide (LPS, part of a complex mixture of pro-inflammatory neurotoxins arising from abundant Gram-negative bacilli of the human gastrointestinal (GI tract, are abundant in AD-affected brain neocortex and hippocampus. For the first time, we provide evidence that LPS immunohistochemical signals appear to aggregate in clumps in the parenchyma in control brains, and in AD, about 75% of anti-LPS signals were clustered around the periphery of DAPI-stained nuclei. As LPS is an abundant secretory product of Gram-negative bacilli resident in the human GI-tract, these observations suggest (i that a major source of pro-inflammatory signals in AD brain may originate from internally derived noxious exudates of the GI-tract microbiome; (ii that due to aging, vascular deficits or degenerative disease these neurotoxic molecules may “leak” into the systemic circulation, cerebral vasculature, and on into the brain; and (iii that this internal source of microbiome-derived neurotoxins may play a particularly strong role in shaping the human immune system and contributing to neural degeneration, particularly in the aging CNS. This “Perspectives” paper will further highlight some very recent developments that implicate GI-tract microbiome-derived LPS as an important contributor to inflammatory-neurodegeneration in the AD brain.

  11. Improvement of Global and Regional Mean Sea Level Trends Derived from all Altimetry Missions.

    Science.gov (United States)

    Ablain, Michael; Benveniste, Jérôme; Faugere, Yannice; Larnicol, Gilles; Cazenave, Anny; Johannessen, Johnny A.; Stammer, Detlef; Timms, Gary

    2012-07-01

    The global mean sea level (GMSL) has been calculated on a continual basis since January 1993 using data from satellite altimetry missions. The global mean sea level (MSL) deduced from TOPEX/Poseidon, Jason-1 and Jason-2 is increasing with a global trend of 3.2 mm from 1993 to 2010 applying the post glacial rebound (MSL Aviso website http://www.jason.oceanobs.com/msl). Besides, the regional sea level trends bring out an inhomogeneous repartition of the ocean elevation with local MSL slopes ranging from +/- 8 mm/year. A study published in 2009 [Ablain et al., 2009] has shown that the global MSL trend uncertainty was estimated at +/-0.6 mm/year with a confidence interval of 90%. The main sources of errors at global and regional scales are due to the orbit calculation and the wet troposphere correction. But others sea-level components have also a significant impact on the long-term stability of MSL as for instance the stability of instrumental parameters and the atmospheric corrections. Thanks to recent studies performed in Sea Level Essential Climate Variable Project in the frame of the Climate Change Initiative, an ESA Programme, in addition to activities performed within the SALP/CNES, strong improvements have been provided for the estimation of the global and regional MSL trends. In this paper, we propose to describe them; they concern the orbit calculation thanks to new gravity fields, the atmospheric corrections thanks to ERA-interim reanalyses, the wet troposphere corrections thanks to the stability improvement, and also empirical corrections allowing us to link regional time series together better. These improvements are described at global and regional scale for all the altimetry missions.

  12. Tsunami hazard in the Caribbean: Regional exposure derived from credible worst case scenarios

    Science.gov (United States)

    Harbitz, C. B.; Glimsdal, S.; Bazin, S.; Zamora, N.; Løvholt, F.; Bungum, H.; Smebye, H.; Gauer, P.; Kjekstad, O.

    2012-04-01

    The present study documents a high tsunami hazard in the Caribbean region, with several thousands of lives lost in tsunamis and associated earthquakes since the XIXth century. Since then, the coastal population of the Caribbean and the Central West Atlantic region has grown significantly and is still growing. Understanding this hazard is therefore essential for the development of efficient mitigation measures. To this end, we report a regional tsunami exposure assessment based on potential and credible seismic and non-seismic tsunamigenic sources. Regional tsunami databases have been compiled and reviewed, and on this basis five main scenarios have been selected to estimate the exposure. The scenarios comprise two Mw8 earthquake tsunamis (north of Hispaniola and east of Lesser Antilles), two subaerial/submarine volcano flank collapse tsunamis (Montserrat and Saint Lucia), and one tsunami resulting from a landslide on the flanks of the Kick'em Jenny submarine volcano (north of Grenada). Offshore tsunami water surface elevations as well as maximum water level distributions along the shore lines are computed and discussed for each of the scenarios. The number of exposed people has been estimated in each case, together with a summary of the tsunami exposure for the earthquake and the landslide tsunami scenarios. For the earthquake scenarios, the highest tsunami exposure relative to the population is found for Guadeloupe (6.5%) and Antigua (7.5%), while Saint Lucia (4.5%) and Antigua (5%) have been found to have the highest tsunami exposure relative to the population for the landslide scenarios. Such high exposure levels clearly warrant more attention on dedicated mitigation measures in the Caribbean region.

  13. Hydrological differentiation and spatial distribution of high altitude wetlands in a semi-arid Andean region derived from satellite data

    Science.gov (United States)

    Otto, M.; Scherer, D.; Richters, J.

    2011-05-01

    High Altitude Wetlands of the Andes (HAWA) belong to a unique type of wetland within the semi-arid high Andean region. Knowledge about HAWA has been derived mainly from studies at single sites within different parts of the Andes at only small time scales. On the one hand, HAWA depend on water provided by glacier streams, snow melt or precipitation. On the other hand, they are suspected to influence hydrology through water retention and vegetation growth altering stream flow velocity. We derived HAWA land cover from satellite data at regional scale and analysed changes in connection with precipitation over the last decade. Perennial and temporal HAWA subtypes can be distinguished by seasonal changes of photosynthetically active vegetation (PAV) indicating the perennial or temporal availability of water during the year. HAWA have been delineated within a region of 12 800 km2 situated in the Northwest of Lake Titicaca. The multi-temporal classification method used Normalized Differenced Vegetation Index (NDVI) and Normalized Differenced Infrared Index (NDII) data derived from two Landsat ETM+ scenes at the end of austral winter (September 2000) and at the end of austral summer (May 2001). The mapping result indicates an unexpected high abundance of HAWA covering about 800 km2 of the study region (6 %). Annual HAWA mapping was computed using NDVI 16-day composites of Moderate Resolution Imaging Spectroradiometer (MODIS). Analyses on the relation between HAWA and precipitation was based on monthly precipitation data of the Tropical Rain Measurement Mission (TRMM 3B43) and MODIS Eight Day Maximum Snow Extent data (MOD10A2) from 2000 to 2010. We found HAWA subtype specific dependencies on precipitation conditions. A strong relation exists between perennial HAWA and snow fall (r2: 0.82) in dry austral winter months (June to August) and between temporal HAWA and precipitation (r2: 0.75) during austral summer (March to May). Annual changes in spatial extend of perennial HAWA

  14. Climatic and anthropogenic factors changing spawning pattern and production zone of Hilsa fishery in the Bay of Bengal

    OpenAIRE

    M. Shohidullah Miah

    2015-01-01

    Hilsa (Tenualosa ilisha Hamilton) as a single species accounts 12% for more than half of the total marine catches. About 2% of the entire population of the country is directly or indirectly engaged with Hilsa fishing. Hilsa has a wide geographical distribution in Asia from the Persian Gulf to the South China Sea. Particularly large stocks are found in Upper Bay of Bengal (BoB) region sustained by the large river systems. The global Hilsa catch is reported 75% from Bangladesh water, 15% from M...

  15. Wind-driven coastal upwelling along the western boundary of the Bay of Bengal during the southwest monsoon

    Digital Repository Service at National Institute of Oceanography (India)

    Shetye, S.R.; Shenoi, S.S.C.; Gouveia, A.D.; Michael, G.S.; Sundar, D.; Nampoothiri, G.

    The western boundary regions of the world's oceans generally show the influence of remote forcing by the presence of a western boundary current. On the continental shelf off Florida, U.S.A., influence of the Gulf Stream is felt at locations as shallow as 75... upwelling on the Bay of Bengal 1403 ee" ~t 32 i i* Fig. 6. bo" , e.5, , , to" Salinity (ppt) at the surface. Dots indicate station locations. using available climatologies. The charts for 10-day mean ship-drift averaged over 1 ° x 1 ° given...

  16. Paleoceanographic history of the Lower Bengal Fan during the last glacial cycle - IODP Expedition 354

    Science.gov (United States)

    Dekens, P. S.; Weber, M. E.; Lantzsch, H.; Das, S. K.; Williams, T.; Adhikari, R. R.; Jia, G.; Fox, L. R.; Ge, J.; Manoj, M. C.; Savian, J. F.; Reilly, B. T.; Selkin, P. A.; Meynadier, L.; Spiess, V.; France-Lanord, C.; Sharma, B.

    2015-12-01

    IODP Expedition 354 drilled a ~320 km long transect of seven sites on the Lower Bengal Fan at 8o N in the Northern Indian Ocean. The sediments cores recovered record a complex relationship between turbiditic and hemipelagic environments. This variability offers a unique opportunity to link our understanding of tectonic and terrestrial processes with climate and oceanography. With the exception the westernmost Site U1454, all sites show a several meter thick, hemipelagic top layer, usually representing Late Quaternary sediment. We present physical, geochemical and stable isotopic properties of this interval to establish a time frame and assess the paleoceanographic development of the region during the last glacial cycle. We sampled Site U1452C-1H continuously for the uppermost 480 cm of hemipelagic sediment in 2-cm increments. Preliminary results indicate the Toba Ash 1 (0.74 ka) is a distinct time marker in all physical properties. Furthermore, wet-bulk density as well as color reflectance b* (the red-green component) and L* (the lightness) show a dominant precession cyclicity. Hence, we are able to provide an insolation-tuned chronology for the last 200 ka (MIS1 - 7) as a preliminary age model. These records agree well with d18O records retrieved from Chinese caves. We will present a preliminary paleoceanographic proxy data to reconstruct sea-surface temperature (SST), sea-surface salinity (SSS), ice volume, marine biological productivity, nutrient supply, and deep-water circulation. These oceanographic and climate conditions are linked to changes in monsoonal strength and terrestrial input using sedimentary proxies to reconstruct chemical weathering and sediment sources and transport time. This work addresses one of the primary cruise objectives - linking monsoon variability, regional and global climate, and Bay of Bengal sediment deposition.

  17. Improvement of global and regional mean sea level derived from satellite altimetry multi missions

    Science.gov (United States)

    Ablain, M.; Faugere, Y.; Larnicol, G.; Picot, N.; Cazenave, A.; Benveniste, J.

    2012-04-01

    With the satellite altimetry missions, the global mean sea level (GMSL) has been calculated on a continual basis since January 1993. 'Verification' phases, during which the satellites follow each other in close succession (Topex/Poseidon--Jason-1, then Jason-1--Jason-2), help to link up these different missions by precisely determining any bias between them. Envisat, ERS-1 and ERS-2 are also used, after being adjusted on these reference missions, in order to compute Mean Sea Level at high latitudes (higher than 66°N and S), and also to improve spatial resolution by combining all these missions together. The global mean sea level (MSL) deduced from TOPEX/Poseidon, Jason-1 and Jason-2 provide a global rate of 3.2 mm from 1993 to 2010 applying the post glacial rebound (MSL aviso website http://www.jason.oceanobs.com/msl). Besides, the regional sea level trends bring out an inhomogeneous repartition of the ocean elevation with local MSL slopes ranging from + 8 mm/yr to - 8 mm/year. A study published in 2009 [Ablain et al., 2009] has shown that the global MSL trend unceratainty was estimated at +/-0.6 mm/year with a confidence interval of 90%. The main sources of errors at global and regional scales are due to the orbit calculation and the wet troposphere correction. But others sea-level components have also a significant impact on the long-term stability of MSL as for instance the stability of instrumental parameters and the atmospheric corrections. Thanks to recent studies performed in the frame of the SALP project (supported by CNES) and Sea-level Climate Change Initiative project (supported by ESA), strong improvements have been provided for the estimation of the global and regional MSL trends. In this paper, we propose to describe them; they concern the orbit calculation thanks to new gravity fields, the atmospheric corrections thanks to ERA-interim reanalyses, the wet troposphere corrections thanks to the stability improvement, and also empirical corrections

  18. Change in the intensity of low-salinity water inflow from the Bay of Bengal into the Eastern Arabian Sea from the Last Glacial Maximum to the Holocene: Implications for monsoon variations

    Digital Repository Service at National Institute of Oceanography (India)

    Mahesh, B.S.; Banakar, V.K.

    A 100–400 km wide region of the coastal Eastern Arabian Sea (EAS), off the west-coast of India, is characterized by a low-salinity tongue formed by the inflow of low-salinity surface water from the Bay of Bengal (BoB). This low-salinity tongue...

  19. Environmental gamma radiation measurements over the Bay of Bengal around Kalpakkam and in Chennai Harbor

    International Nuclear Information System (INIS)

    Surya Prakash, G.; Baskaran, R.; Venkatraman, B.; Rajagopal, V.; Mohanty, Ajit Kumar

    2012-01-01

    DAE site Kalpakkam, encompassing several operating nuclear facilitates is enclosed in a strip of land between the Bay of Bengal on the east and Buckingham Canal on the west. Approximately about 50% of the Emergency Prone Zone (EPZ) area around the plant lies in the Bay of Bengal. The radiation levels around Kalpakkam nuclear complex is monitored by Environmental Survey Laboratory (ESL) at Kalpakkam. The survey has been carried out up to 16 km in the land areas. Though radioactivity levels in the seawater and the food produce derived from the sea are monitored and reported by ESL, data on the ambient radiation levels over the sea has not been reported. The paper describes the campaign based ambient gamma radiation level measurements done during the past few years. The radiation level measurements done at selected locations varied between 8 and 115 nGyh -1 (0.8 and 11.5 μRh -1 ) during the first campaign and 14 and 170 nGyh -1 (1.4 and 17 μRh -1 ) during the second campaign. The average dose rate observed from both the campaigns was 62 nGyh 1 (6.2 μRh -1 ). During the campaign period we are looked in to any interference from the 41 Ar released from the MAPS reactor also. The third campaign at the Chennai harbor (∼ 60 km north of Kalpakkam) the observed radiation levels were between 15 nGyh -1 (1.5 μRh -1 ) and 12.2 nGyh -1 (12.2 μRh -1 ). This paper discussed the details of the techniques and the measurement

  20. Influence of traditional agricultural practices on mobilization of arsenic from sediments to groundwater in Bengal delta.

    Science.gov (United States)

    Farooq, S H; Chandrasekharam, D; Berner, Z; Norra, S; Stüben, D

    2010-11-01

    In the wake of the idea that surface derived dissolved organic carbon (DOC) plays an important role in the mobilization of arsenic (As) from sediments to groundwater and may provide a vital tool in understanding the mechanism of As contamination (mobilization/fixation) in Bengal delta; a study has been carried out. Agricultural fields that mainly cultivate rice (paddy fields) leave significantly large quantities of organic matter/organic carbon on the surface of Bengal delta which during monsoon starts decomposing and produces DOC. The DOC thus produced percolates down with rain water and mobilizes As from the sediments. Investigations on sediment samples collected from a paddy field clearly indicate that As coming on to the surface along with the irrigation water accumulates itself in the top few meters of sediment profile. The column experiments carried out on a 9 m deep sediment profile demonstrates that DOC has a strong potential to mobilize As from the paddy fields and the water recharging the aquifer through such agricultural fields contain As well above the WHO limit thus contaminating the shallow groundwater. Experiment also demonstrates that decay of organic matter induces reducing condition in the sediments. Progressively increasing reducing conditions not only prevent the adsorption of As on mineral surfaces but also cause mobilization of previously sorbed arsenic. There seems to be a cyclic pattern where As from deeper levels comes to the surface with irrigational water, accumulates itself in the sediments, and ultimately moves down to the shallow groundwater. The extensive and continual exploitation of intermediate/deep groundwater accelerates this cyclic process and helps in the movement of shallow contaminated groundwater to the deeper levels. Copyright © 2010 Elsevier Ltd. All rights reserved.

  1. The extraction behaviour of the Rose Bengal labelled with 131I in the presence of cationic surfactants

    International Nuclear Information System (INIS)

    Lengyel, J.; Krtil, J.; Kuban, V.

    1989-01-01

    The extraction behaviour of the Rose Bengal in the presence of not only Septonex, but also other cationic surfactants (cetyltrimethylammonium bromide, cetylpyridinium bromide) was studied. The extraction constants of the ion associates of the Rose Bengal with cationic surfactants were determined radiometrically with the aid of Rose Bengal labelled with 131 I. (author) 8 refs.; 1 tab

  2. Communities' vision of benefits derived from ecotourism in Amacayacu National Park (Amazon region, Colombia)

    International Nuclear Information System (INIS)

    Ochoa Fonseca, Fredy Alfonso; James, Johannie; Marquez, German

    2013-01-01

    Ecotourism is an opportunity to create development, conservation and benefits for communities. Under these principles in 2004 National Parks gave in concession the ecotourism services of PNN Amacayacu. This process has generated questions and discomfort. This research analyzes the communities' vision of the PNN Amacayacu about the benefits derived from ecotourism through a qualitative methodology that establishes the community perception on the issue. Results show ecotourism as an exogenous development model that generates some economic income but also impacts livelihoods and local culture. It also shows that there are benefits more valued by the community as participation in decision-making. This research highlights the relevance of inquiring which type of development ecotourism brings and the importance that communities themselves decide on development through ecotourism.

  3. Topographic soil wetness index derived from combined Alaska-British Columbia datasets for the Gulf of Alaska region

    Science.gov (United States)

    D'Amore, D. V.; Biles, F. E.

    2016-12-01

    The flow of water is often highlighted as a priority in land management planning and assessments related to climate change. Improved measurement and modeling of soil moisture is required to develop predictive estimates for plant distributions, soil moisture, and snowpack, which all play important roles in ecosystem planning in the face of climate change. Drainage indexes are commonly derived from GIS tools with digital elevation models. Soil moisture classes derived from these tools are useful digital proxies for ecosystem functions associated with the concentration of water on the landscape. We developed a spatially explicit topographically derived soil wetness index (TWI) across the perhumid coastal temperate rainforest (PCTR) of Alaska and British Columbia. Developing applicable drainage indexes in complex terrain and across broad areas required careful application of the appropriate DEM, caution with artifacts in GIS covers and mapping realistic zones of wetlands with the indicator. The large spatial extent of the model has facilitated the mapping of forest habitat and the development of water table depth mapping in the region. A key element of the TWI is the merging of elevation datasets across the US-Canada border where major rivers transect the international boundary. The unified TWI allows for seemless mapping across the international border and unified ecological applications. A python program combined with the unified DEM allows end users to quickly apply the TWI to all areas of the PCTR. This common platform can facilitate model comparison and improvements to local soil moisture conditions, generation of streamflow, and ecological site conditions. In this presentation we highlight the application of the TWI for mapping risk factors related to forest decline and the development of a regional water table depth map. Improved soil moisture maps are critical for deriving spatial models of changes in soil moisture for both plant growth and streamflow across

  4. Crustal structure beneath Beijing and its surrounding regions derived from gravity data

    Science.gov (United States)

    Jiang, Wenliang; Zhang, Jingfa; Lu, Xiaocui; Lu, Jing

    2011-06-01

    In this paper we use gravity data to study fine crustal structure and seismogenic environment beneath Beijing and its surrounding regions. Multi-scale wavelet analysis method is applied to separating gravity fields. Logarithmic power spectrum method is also used to calculate depth of gravity field source. The results show that the crustal structure is very complicated beneath Beijing and its surrounding areas. The crustal density exhibits laterally inhomogeneous. There are three large scale tectonic zones in North China, i.e., WNW-striking Zhangjiakou-Bohai tectonic zone (ZBTZ), NE-striking Taihang piedmont tectonic zone (TPTZ) and Cangxian tectonic zone (CTZ). ZBTZ and TPTZ intersect with each other beneath Beijing area and both of them cut through the lithosphere. The upper and middle crusts consist of many small-scale faults, uplifts and depressions. In the lower crust, these small-scale tectonic units disappear gradually, and they are replaced by large-scale tectonic units. In surrounding regions of Beijing, ZBTZ intersects with several other NE-striking tectonic units, such as Cangxian uplift, Jizhong depression and Shanxi Graben System (SGS). In west of Taihangshan uplift, gravity anomalies in upper and middle crusts are correlated with geological and topographic features on the surface. Compared with the crust, the structure is comparatively simple in uppermost mantle. Earthquakes mainly occurred in upper and middle crusts, especially in transitional regions between high gravity anomaly and low gravity anomaly. Occurrence of large earthquakes may be related to the upwelling of upper mantle and asthenosphere heat flow materials, such as Sanhe earthquake ( M S8.0) and Tangshan earthquake ( M S7.8).

  5. Imaging derived cortical thickness reduction in high-functioning autism: key regions and temporal slope.

    Science.gov (United States)

    Scheel, Christian; Rotarska-Jagiela, Anna; Schilbach, Leonhard; Lehnhardt, Fritz G; Krug, Barbara; Vogeley, Kai; Tepest, Ralf

    2011-09-15

    Cortical thickness (CT) changes possibly contribute to the complex symptomatology of autism. The aberrant developmental trajectories underlying such differences in certain brain regions and their continuation in adulthood are a matter of intense debate. We studied 28 adults with high-functioning autism (HFA) and 28 control subjects matched for age, gender, IQ and handedness. A surface-based whole brain analysis utilizing FreeSurfer was employed to detect CT differences between the two diagnostic groups and to investigate the time course of age-related changes. Direct comparison with control subjects revealed thinner cortex in HFA in the posterior superior temporal sulcus (pSTS) of the left hemisphere. Considering the time course of CT development we found clusters around the pSTS and cuneus in the left and the paracentral lobule in the right hemisphere to be thinner in HFA with comparable age-related slopes in patients and controls. Conversely, we found clusters around the supramarginal gyrus and inferior parietal lobule (IPL) in the left and the precentral and postcentral gyrus in the right hemisphere to be thinner in HFA, but with different age-related slopes in patients and controls. In the latter regions CT showed a steady decrease in controls but no analogous thinning in HFA. CT analyses contribute in characterizing neuroanatomical correlates of HFA. Reduced CT is present in brain regions involved in social cognition. Furthermore, our results demonstrate that aberrant brain development leading to such differences is proceeding throughout adulthood. Discrepancies in prior morphometric studies may be induced by the complex time course of cortical changes. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Derivation of water vapour absorption cross-sections in the red region

    Science.gov (United States)

    Lal, M.; Chakrabarty, D. K.

    1994-01-01

    Absorption spectrum in 436 to 448 nm wavelength region gives NO2 and O3 column densities. This spectrum can also give H2O column density. The spectrum in the range of 655 to 667 nm contains absorption due to NO3 and H2O. Combining the absorption spectra in the wavelength ranges of 436 to 448 and 655 to 667 nm, water vapor absorption cross-sections in this range comes out to be of the order of 2.0 x 10(exp -24) cm(exp -2).

  7. Future trends in urbanization and coastal water pollution in the Bay of Bengal: the lived experience

    NARCIS (Netherlands)

    Zinia, N.J.; Kroeze, C.

    2015-01-01

    The Bay of Bengal includes coastal seas of several countries, including Bangladesh, India, and Myanmar. We present scenarios for future river export of eutrophying nutrients into the Bay of Bengal, and the role of urbanization therein. We used NEWS (Nutrient Export from WaterSheds) model to analyze

  8. Enhanced particle fluxes in Bay of Bengal inducEd. by injection of freshwater

    Digital Repository Service at National Institute of Oceanography (India)

    Ittekkot, V.; Nair, R.R.; Honjo, S.; Ramaswamy, V.; Bartsch, M.; Manganini, S.J.; Desai, B.N.

    deployed three sediment-trap moorings (two traps in each mooring) in the northern, central and southern parts of the Bay of Bengal, respectively. The Bay of Bengal is suitable for such a study, because some of the world's largest rivers supply pulses...

  9. Extraction method for the determination of inorganic iodides in Rose Bengal labelled with 131I

    International Nuclear Information System (INIS)

    Lengyel, J.; Krtil, J.; Vecernik, J.

    1982-01-01

    An extraction method for the determination of inorganic iodides in Rose Bengal preparations labelled with 131 I is described. The method is based on the quantitative extraction of Rose Bengal into chloroform from acidic medium while the inorganic iodides remain in the aqueous phase. The method is simple, rapid, and reproducible. (author)

  10. A comparative study of vertical stabilities in the Arabian sea and Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sastry, J.S.; Rao, D.P.

    Stabilities in the upper 300 m in the Arabian Sea and the Bay of Bengal are computed and presented seasonwise. The water column in the Bay of Bengal is more strongly stratified than that in the Arabian Sea. These studies suggest that the vertical...

  11. Early cellular responses against tributyltin chloride exposure in primary cultures derived from various brain regions.

    Science.gov (United States)

    Mitra, Sumonto; Siddiqui, Waseem A; Khandelwal, Shashi

    2014-05-01

    Tributyltin (TBT) is a potent biocide and commonly used in various industrial sectors. Humans are mainly exposed through the food chain. We have previously demonstrated tin accumulation in brain following TBT-chloride (TBTC) exposure. In this study, effect of TBTC on dissociated cells from different brain regions was evaluated. Cytotoxicity assay (MTT), mode of cell death (Annexin V/PI assay), oxidative stress parameters (ROS and lipid peroxidation), reducing power of the cell (GSH), mitochondrial membrane potential (MMP) and intracellular Ca(2+) were evaluated to ascertain the effect of TBTC. Expression of glial fibrillary acidic protein (GFAP) was measured to understand the effect on astroglial cells. TBTC as low as 30 nM was found to reduce GSH levels, whereas higher doses of 300 and 3000 nM induced ROS generation and marked loss in cell viability mainly through apoptosis. Striatum showed higher susceptibility than other regions, which may have further implications on various neurological aspects. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Application of individual foraminifera Mg/Ca and δ18O analyses for paleoceanographic reconstructions in the Bay of Bengal and other active depositional environments

    Science.gov (United States)

    Fritz-Endres, T.; Dekens, P.; Fehrenbacher, J. S.; Spero, H. J.; Stine, A.

    2017-12-01

    Paleoceanographic research traditionally focuses on regions where sediment deposition is minimally affected by transport. However, sediment fans near tectonically active regions provide an opportunity to link oceanographic climate to terrestrial processes. Sediment cores recovered during IODP Expedition 354 in the Bay of Bengal include hemipelagic sections that record the history of tectonic uplift and the development of the Indian Monsoon through the last 10 Ma. Although these cores provide a unique opportunity to link marine and terrestrial climate, the complex depositional environment requires that the source of foraminifera is carefully considered before using these proxies to reconstruct oceanographic conditions. Foraminifera in Bengal Fan sediments may have been transported via turbidity currents from the northern Bay of Bengal, where the seasonal variability of SST and SSS is larger compared to the southern Bay of Bengal. We measured single Globigerinoides sacculifer Mg/Ca and δ18O from mudline samples of IODP Site U1454 (8.4°N, 85.5°E, 3721 m water depth) near the modern active channel and Site U1449 (8.4°N, 88.7°E, 3653 m water depth) far from channel activity. We compare these sites to single G. sacculifer from the core-top sample of Site 342KL (20.6°N, 90.1°E, 1256 m water depth) located on the continental shelf. Each foraminifera lives 2-4 weeks and the distribution of 60 to 80 data points reflects the seasonal range of SST and SSS at the location where the foraminifera calcified. Measurements in foraminifera from Site U1449 (away from active channel) are statistically different from the site in the northern Bay of Bengal and more consistent with local conditions. Conversely, foraminifera from the site near the active channel reflect a combined signal of local conditions recorded from the site far from channel activity and those recorded from the continental shelf. This suggests a portion of foraminifera from the active channel site have been

  13. Densities and derived thermodynamic properties of binary (alkanol + boldine) mixtures in the compressed liquid region

    International Nuclear Information System (INIS)

    Durán-Zenteno, Moisés S.; Pérez-López, Hugo I.; Galicia-Luna, Luis A.; Elizalde-Solis, Octavio

    2012-01-01

    Highlights: ► We measured densities for {alkanol (ethanol or 1-propanol) + boldine} mixtures. ► Liquid densities are reported in the ranges of (1 to 20) MPa and (313 to 363) K. ► Thermodynamic derived properties were calculated using an empirical correlation. ► Extrapolated densities at atmospheric pressure agree with the literature data. - Abstract: In this work, densities of two binary systems of {alkanol (ethanol and 1-propanol) + boldine} are measured at temperatures from (313 to 363) K and pressures up to 20 MPa using an Anton Paar vibrating tube densimeter. Each (alkanol + boldine) system was prepared at five diluted compositions with respect to the alkaloid. These are (x 2 = 0.0012, 0.0074, 0.0136, 0.0196, 0.0267) and (x 2 = 0.0018, 0.0046, 0.0077, 0.0112, 0.0142) mixed in ethanol and 1-propanol, respectively. Experimental densities are correlated using an empirical 6-parameter equation with deviations within 0.04%. Extrapolated densities at atmospheric pressure agree with the literature data. Isobaric expansivity, isothermal compressibility, thermal pressure coefficient, and internal pressure have been calculated.

  14. Serotonin regulates brain-derived neurotrophic factor expression in select brain regions during acute psychological stress

    Institute of Scientific and Technical Information of China (English)

    De-guo Jiang; Shi-li Jin; Gong-ying Li; Qing-qing Li; Zhi-ruo Li; Hong-xia Ma; Chuan-jun Zhuo; Rong-huan Jiang; Min-jie Ye

    2016-01-01

    Previous studies suggest that serotonin (5-HT) might interact with brain-derived neurotrophic factor (BDNF) during the stress response. However, the relationship between 5-HT and BDNF expression under purely psychological stress is unclear. In this study, one hour before psychological stress exposure, the 5-HT1A receptor agonist 8-OH-DPAT or antagonist MDL73005, or the 5-HT2A receptor agonist DOI or antagonist ketanserin were administered to rats exposed to psychological stress. Immunohistochemistry andin situ hybridization revealed that after psychological stress, with the exception of the ventral tegmental area, BDNF protein and mRNA expression levels were higher in the 5-HT1A and the 5-HT2A receptor agonist groups compared with the solvent control no-stress or psychological stress group in the CA1 and CA3 of the hippocampus, prefrontal cortex, central amygdaloid nucleus, dorsomedial hypothalamic nucleus, dentate gyrus, shell of the nucleus accumbens and the midbrain periaqueductal gray. There was no signiifcant difference between the two agonist groups. In contrast, after stress exposure, BDNF protein and mRNA expression levels were lower in the 5-HT1A and 5-HT2A receptor antagonist groups than in the solvent control non-stress group, with the exception of the ventral tegmental area. Our ifndings suggest that 5-HT regulates BDNF expression in a rat model of acute psychological stress.

  15. Regional N2O fluxes in Amazonia derived from aircraft vertical profiles

    Science.gov (United States)

    D'Amelio, M. T. S.; Gatti, L. V.; Miller, J. B.; Tans, P.

    2009-11-01

    Nitrous oxide (N2O) is the third most important anthropogenic greenhouse gas. Globally, the main sources of N2O are nitrification and denitrification in soils. About two thirds of the soil emissions occur in the tropics and approximately 20% originate in wet rainforest ecosystems, like the Amazon forest. The work presented here involves aircraft vertical profiles of N2O from the surface to 4 km over two sites in the Eastern and Central Amazon: Tapajós National Forest (SAN) and Cuieiras Biologic Reserve (MAN), and the estimation of N2O fluxes for regions upwind of these sites. To our knowledge, these regional scale N2O measurements in Amazonia are unique and represent a new approach to looking regional scale emissions. The fluxes upwind of MAN exhibited little seasonality, and the annual mean was 2.1±1.0 mg N2O m-2 day-1, higher than that for fluxes upwind of SAN, which averaged 1.5±1.6 mg N2O m-2 day-1. The higher rainfall around the MAN site could explain the higher N2O emissions, as a result of increased soil moisture accelerating microbial nitrification and denitrification processes. For fluxes from the coast to SAN seasonality is present for all years, with high fluxes in the months of March through May, and in November through December. The first peak of N2O flux is strongly associated with the wet season. The second peak of high N2O flux recorded at SAN occurs during the dry season and can not be easily explained. However, about half of the dry season profiles exhibit significant correlations with CO, indicating a larger than expected source of N2O from biomass burning. The average CO:N2O ratio for all profiles sampled during the dry season is 94±77 mol CO:mol N2O and suggests a larger biomass burning contribution to the global N2O budget than previously reported.

  16. Regional life cycle assessment of soybean derived biodiesel for transportation fleets

    International Nuclear Information System (INIS)

    Xue Xiaobo; Collinge, William O.; Shrake, Scott O.; Bilec, Melissa M.; Landis, Amy E.

    2012-01-01

    Although the life cycle environmental impacts of biofuels have been recently reported, studies that focus on specific regions and use real fleet data for the use phase are still lacking. In Pennsylvania, the Penn Security Fuels Initiative required 2% biodiesel (B2), effective on January 1, 2010, with higher blending levels required in the future if production thresholds are met. This study quantifies the environmental impacts of biodiesel blends to meet increasing regional biodiesel demand. A process life cycle model was developed using data collected from collaboration with Pennsylvania Department of Transportation. For PennDOT, both in-state and out-of-state production scenarios were analyzed to estimate the possible environmental impacts of biodiesel blends. The results show that fertilizer usage in the agricultural phase, soy oil extraction and refining, feedstock and fuel transportation, and fuel combustion in the use phase are main contributors to biodiesel’s life cycle environmental impacts for all blends. Comparing biodiesels with ultra low sulfur diesel, significant environmental tradeoffs exist between global warming potential and eutrophication. For Pennsylvania, an in-state farming and processing preference has the lowest environmental impacts for B5. However, the limited area of farmlands in Pennsylvania may not satisfy the state’s biodiesel needs with higher blending levels. - Highlights: ► This study quantifies the environmental impacts of biodiesel policy in Pennsylvania. ► Fertilizer usage, soy oil refining and fuel combustion are the main contributing stages. ► Environmental tradeoffs exist between global warming and eutrophication impact categories. ► In-state farming and processing has the lowest environmental impact at current production levels.

  17. Independent evaluation of the SNODAS snow depth product using regional-scale lidar-derived measurements

    Science.gov (United States)

    Hedrick, A.; Marshall, H.-P.; Winstral, A.; Elder, K.; Yueh, S.; Cline, D.

    2015-01-01

    Repeated light detection and ranging (lidar) surveys are quickly becoming the de facto method for measuring spatial variability of montane snowpacks at high resolution. This study examines the potential of a 750 km2 lidar-derived data set of snow depths, collected during the 2007 northern Colorado Cold Lands Processes Experiment (CLPX-2), as a validation source for an operational hydrologic snow model. The SNOw Data Assimilation System (SNODAS) model framework, operated by the US National Weather Service, combines a physically based energy-and-mass-balance snow model with satellite, airborne and automated ground-based observations to provide daily estimates of snowpack properties at nominally 1 km resolution over the conterminous United States. Independent validation data are scarce due to the assimilating nature of SNODAS, compelling the need for an independent validation data set with substantial geographic coverage. Within 12 distinctive 500 × 500 m study areas located throughout the survey swath, ground crews performed approximately 600 manual snow depth measurements during each of the CLPX-2 lidar acquisitions. This supplied a data set for constraining the uncertainty of upscaled lidar estimates of snow depth at the 1 km SNODAS resolution, resulting in a root-mean-square difference of 13 cm. Upscaled lidar snow depths were then compared to the SNODAS estimates over the entire study area for the dates of the lidar flights. The remotely sensed snow depths provided a more spatially continuous comparison data set and agreed more closely to the model estimates than that of the in situ measurements alone. Finally, the results revealed three distinct areas where the differences between lidar observations and SNODAS estimates were most drastic, providing insight into the causal influences of natural processes on model uncertainty.

  18. Bulk mineralogy of the NE Syrtis and Jezero crater regions of Mars derived through thermal infrared spectral analyses

    Science.gov (United States)

    Salvatore, M. R.; Goudge, T. A.; Bramble, M. S.; Edwards, C. S.; Bandfield, J. L.; Amador, E. S.; Mustard, J. F.; Christensen, P. R.

    2018-02-01

    We investigated the area to the northwest of the Isidis impact basin (hereby referred to as "NW Isidis") using thermal infrared emission datasets to characterize and quantify bulk surface mineralogy throughout this region. This area is home to Jezero crater and the watershed associated with its two deltaic deposits in addition to NE Syrtis and the strong and diverse visible/near-infrared spectral signatures observed in well-exposed stratigraphic sections. The spectral signatures throughout this region show a diversity of primary and secondary surface mineralogies, including olivine, pyroxene, smectite clays, sulfates, and carbonates. While previous thermal infrared investigations have sought to characterize individual mineral groups within this region, none have systematically assessed bulk surface mineralogy and related these observations to visible/near-infrared studies. We utilize an iterative spectral unmixing method to statistically evaluate our linear thermal infrared spectral unmixing models to derive surface mineralogy. All relevant primary and secondary phases identified in visible/near-infrared studies are included in the unmixing models and their modeled spectral contributions are discussed in detail. While the stratigraphy and compositional diversity observed in visible/near-infrared spectra are much better exposed and more diverse than most other regions of Mars, our thermal infrared analyses suggest the dominance of basaltic compositions with less observed variability in the amount and diversity of alteration phases. These results help to constrain the mineralogical context of these previously reported visible/near-infrared spectral identifications. The results are also discussed in the context of future in situ investigations, as the NW Isidis region has long been promoted as a region of paleoenvironmental interest on Mars.

  19. Critical Reflectance Derived from MODIS: Application for the Retrieval of Aerosol Absorption over Desert Regions

    Science.gov (United States)

    Wells, Kelley C.; Martins, J. Vanderlei; Remer, Lorraine A.; Kreidenweis, Sonia M.; Stephens, Graeme L.

    2012-01-01

    Aerosols are tiny suspended particles in the atmosphere that scatter and absorb sunlight. Smoke particles are aerosols, as are sea salt, particulate pollution and airborne dust. When you look down at the earth from space sometimes you can see vast palls of whitish smoke or brownish dust being transported by winds. The reason that you can see these aerosols is because they are reflecting incoming sunlight back to the view in space. The reason for the difference in color between the different types of aerosol is that the particles arc also absorbing sunlight at different wavelengths. Dust appears brownish or reddish because it absorbs light in the blue wavelengths and scatters more reddish light to space, Knowing how much light is scattered versus how much is absorbed, and knowin that as a function of wavelength is essential to being able to quantify the role aerosols play in the energy balance of the earth and in climate change. It is not easy measuring the absorption properties of aerosols when they are suspended in the atmosphere. People have been doing this one substance at a time in the laboratory, but substances mix when they are in the atmosphere and the net absorption effect of all the particles in a column of air is a goal of remote sensing that has not yet been completely successful. In this paper we use a technique based on observing the point at which aerosols change from brightening the surface beneath to darkening it. If aerosols brighten a surface. they must scatter more light to space. If they darken the surface. they must be absorbing more. That cross over point is called the critical reflectance and in this paper we show that critical reflectance is a monotonic function of the intrinsic absorption properties of the particles. This parameter we call the single scattering albedo. We apply the technique to MODIS imagery over the Sahara and Sahel regions to retrieve the single scattering albedo in seven wavelengths, compare these retrievals to ground

  20. Auroral zone E-region conductivities during solar minimum derived from EISCAT data

    International Nuclear Information System (INIS)

    Schlegel, K.

    1988-01-01

    From two years of EISCAT data (1985-1986, a period of low solar activity) 8337 E-region conductivity profiles have been calculated as 5-min averages. From these profiles the height of the conductivity maxima for the Hall and Pedersen conductivities (H max ), the height-integrated Hall and Pedersen conductivities and the ratio of both have been computed. Histograms as well as average values of these quantities are displayed as a function of K p and of magnetic local time. The former results showed quantitatively the increase of the conductivities and the decrease of H max with increasing magnetic activity. The latter results revealed that on the average the conductivities are maximal in the early morning hours due to hard particle precipitation, H max being affected both by the solar zenith angle and by particle precipitation. The solar zenith angle dependence of the conductivities is only significant for low K p -values. Latitudinal profiles of the height-integrated conductivities show quantitatively the southward shift of the average conductivity maximum with increasing magnetic activity

  1. Hydrological differentiation and spatial distribution of high altitude wetlands in a semi-arid Andean region derived from satellite data

    Directory of Open Access Journals (Sweden)

    M. Otto

    2011-05-01

    Full Text Available High Altitude Wetlands of the Andes (HAWA belong to a unique type of wetland within the semi-arid high Andean region. Knowledge about HAWA has been derived mainly from studies at single sites within different parts of the Andes at only small time scales. On the one hand, HAWA depend on water provided by glacier streams, snow melt or precipitation. On the other hand, they are suspected to influence hydrology through water retention and vegetation growth altering stream flow velocity. We derived HAWA land cover from satellite data at regional scale and analysed changes in connection with precipitation over the last decade. Perennial and temporal HAWA subtypes can be distinguished by seasonal changes of photosynthetically active vegetation (PAV indicating the perennial or temporal availability of water during the year. HAWA have been delineated within a region of 12 800 km2 situated in the Northwest of Lake Titicaca. The multi-temporal classification method used Normalized Differenced Vegetation Index (NDVI and Normalized Differenced Infrared Index (NDII data derived from two Landsat ETM+ scenes at the end of austral winter (September 2000 and at the end of austral summer (May 2001. The mapping result indicates an unexpected high abundance of HAWA covering about 800 km2 of the study region (6 %. Annual HAWA mapping was computed using NDVI 16-day composites of Moderate Resolution Imaging Spectroradiometer (MODIS. Analyses on the relation between HAWA and precipitation was based on monthly precipitation data of the Tropical Rain Measurement Mission (TRMM 3B43 and MODIS Eight Day Maximum Snow Extent data (MOD10A2 from 2000 to 2010. We found HAWA subtype specific dependencies on precipitation conditions. A strong relation exists between perennial HAWA and snow fall (r2: 0.82 in dry austral winter months (June to August and between temporal HAWA and precipitation (r2: 0.75 during austral summer

  2. Source of marine turbidites on the Andaman-Nicobar Islands: Nicobar Fan, Bengal Fan or paleo-Irrawaddy?

    Science.gov (United States)

    Carter, A.

    2017-12-01

    Marine turbidites from an axially fed submarine fan are intermittently exposed across the entire chain of the Andaman-Nicobar Islands. Known as the Andaman Flysch (AF) and loosely assigned to the Paleogene, it has been proposed that these rocks are sourced from the Himalaya and thus provide a unique window into early stages of orogenesis. Where the turbidites came from has been subject to debate; they are either Bengal Fan or forearc deposits cut off from the Bengal Fan and possibly sourced from the Irrawaddy delta. Following recent IODP drilling in the eastern Indian Ocean (Expeditions 354 and 362) it is now possible resolve this by comparing the provenance of AF turbidites with the Bengal and Nicobar Fans. The Andaman Flysch can be traced as detached outcrops all along the western side of the main islands of Andaman over a strike length of more than 200 km. Exposures along the east coast are confined to South Andaman Island. Petrographic and geochemical data show a common continental crust signal with minor contributions from arc material. But, there are also differences whereby west coast sandstones show significantly higher quartz content and less feldspars and rock fragments. Staurolite is also present in all samples from the western side, but is absent from east coast samples. Both detrital zircon U-Pb and Bulk rock Nd data record the presence of arc material likely from Myanmar. Detrital zircon data from the Nicobar Fan match the Andaman turbidites and indicate sources from the Greater and Tethyan Himalaya mixed with sediment from the Burmese arc. Transfer of Irrawaddy derived sediment to the Nicobar Fan is ruled out as sediment transfer across the fore-arc to the west was restricted by the then exposed Yadana and M8 highs in the north and the Sewell and Alcock Rises to the south. Sediment isopachs of the Martaban back arc basin, the main north-south-oriented depocentre in the Andaman Sea related to the development of the Thanlwin -Irrawaddy delta system

  3. The effects of PPR on the reproductive health of Black Bengal goats and the possible role played by oxidative stress.

    Science.gov (United States)

    Kumar, Pankaj; Dey, Amitava; Kumar, Abhay; Ray, Pradeep Kumar; Chandran, Poolangulam Chinnakkan; Kumari, Rashmi Rekha; Kumar, Manish

    2018-03-28

    Outbreaks of Peste des petits ruminants (PPR) viral disease in Black Bengal goats were investigated from the middle Indo-Gangetic Plains of India. Clinical profile of PPR-affected flocks was recorded from four different outbreak sites of the region. The PPR outbreak was diagnosed serologically using commercially available sandwich ELISA kit. Relatively, low mortality rate (mean 26.75%) for PPR outbreak was recorded due to the endemic status of the disease. To understand the role of oxidative stress in PPR virus pathogenesis, various oxidant and antioxidant parameters in goats infected with PPR were estimated and compared with the uninfected/healthy goats of the same flock. The measured high level of pro-oxidant malondialdehyde (MDA) obtained from lipid peroxidation along with lower levels of anti-oxidants viz. superoxide dismutase (SOD), glutathione peroxidase (GPx) and catalase (CAT) in PPR-affected Black Bengal goats suggests oxidative stress as one of the mechanism of pathogenesis of PPR virus. In addition, the correlation of oxidative stress due to PPR and the resulting reproductive disorders in the female goats were evaluated. The abortion in pregnant does observed during PPR outbreak was proportional to debility and oxidative stress manifested during PPR infection. The reproductive performance of recovered female goats in the period of 18 months of monitoring was significantly compromised in terms of kidding and twinning frequency. The mortality rate in kids born from PPR-recovered goats was significantly higher compared to those from health goats in the first 9 months post-recovery. From the present study, it may be concluded that together with the PPR virus, infection in goats and the resulting oxidative stress play a vital role for abortion and reduced post-reproductive performance in Black Bengal female goat.

  4. Linear time series modeling of GPS-derived TEC observations over the Indo-Thailand region

    Science.gov (United States)

    Suraj, Puram Sai; Kumar Dabbakuti, J. R. K.; Chowdhary, V. Rajesh; Tripathi, Nitin K.; Ratnam, D. Venkata

    2017-12-01

    This paper proposes a linear time series model to represent the climatology of the ionosphere and to investigate the characteristics of hourly averaged total electron content (TEC). The GPS-TEC observation data at the Bengaluru international global navigation satellite system (GNSS) service (IGS) station (geographic 13.02°N , 77.57°E ; geomagnetic latitude 4.4°N ) have been utilized for processing the TEC data during an extended period (2009-2016) in the 24{th} solar cycle. Solar flux F10.7p index, geomagnetic Ap index, and periodic oscillation factors have been considered to construct a linear TEC model. It is evident from the results that solar activity effect on TEC is high. It reaches the maximum value (˜ 40 TECU) during the high solar activity (HSA) year (2014) and minimum value (˜ 15 TECU) during the low solar activity (LSA) year (2009). The larger magnitudes of semiannual variations are observed during the HSA periods. The geomagnetic effect on TEC is relatively low, with the highest being ˜ 4 TECU (March 2015). The magnitude of periodic variations can be seen more significantly during HSA periods (2013-2015) and less during LSA periods (2009-2011). The correlation coefficient of 0.89 between the observations and model-based estimations has been found. The RMSE between the observed TEC and model TEC values is 4.0 TECU (linear model) and 4.21 TECU (IRI2016 Model). Further, the linear TEC model has been validated at different latitudes over the northern low-latitude region. The solar component (F10.7p index) value decreases with an increase in latitude. The magnitudes of the periodic component become less significant with the increase in latitude. The influence of geomagnetic component becomes less significant at Lucknow GNSS station (26.76°N, 80.88°E) when compared to other GNSS stations. The hourly averaged TEC values have been considered and ionospheric features are well recovered with linear TEC model.

  5. Groundwater System of Sundarbans (Basanti), West Bengal, India

    DEFF Research Database (Denmark)

    Kopmann, Moritz; Binning, Philip John; Bregnhøj, Henrik

    2018-01-01

    In Basanti, a rural block in the Sundarbans, West Bengal, the water availability is vital for its inhabitants. Groundwater levels are decreasing, and a proper understanding of key factors influencing the water resource is required. In the following, a social review of Basanti is given followed...... by a geologic and hydrostratigraphic analysis. The main hydrologic flows, a water balance, and the trend of salinity in the groundwater are presented. Finally, available long- and short-term drawdown data of South 24 Parganas and Basanti to determine groundwater level and annual recharge trends. The assessment...

  6. The tectonic origin of the Bay of Bengal and Bangladesh

    Digital Repository Service at National Institute of Oceanography (India)

    Talwani, M.; Desa, M.; Ismaiel, M.; Krishna, K.S.

    direction for the Indian plate.  4. The 85°E Ridge was initially evolved as a fracture zone, and subsequently associated with volcanism.   5. The oceanic crust of the Western Basin of the Bay of Bengal is older than the crust of the Eastern Basin and Bangla... it a northern extension of the 86°E fracture zone, while Sar et al. [2009] suggested it could have a continental origin. Gibbons et al. [2013] inferred that the 85°E Ridge and the Kerguelen Fracture Zone formed as conjugate flanks of a 'leaky...

  7. The regulation of growth and metabolism of kidney stem cells with regional specificity using extracellular matrix derived from kidney.

    Science.gov (United States)

    O'Neill, John D; Freytes, Donald O; Anandappa, Annabelle J; Oliver, Juan A; Vunjak-Novakovic, Gordana V

    2013-12-01

    Native extracellular matrix (ECM) that is secreted and maintained by resident cells is of great interest for cell culture and cell delivery. We hypothesized that specialized bioengineered niches for stem cells can be established using ECM-derived scaffolding materials. Kidney was selected as a model system because of the high regional diversification of renal tissue matrix. By preparing the ECM from three specialized regions of the kidney (cortex, medulla, and papilla; whole kidney, heart, and bladder as controls) in three forms: (i) intact sheets of decellularized ECM, (ii) ECM hydrogels, and (iii) solubilized ECM, we investigated how the structure and composition of ECM affect the function of kidney stem cells (with mesenchymal stem cells, MSCs, as controls). All three forms of the ECM regulated KSC function, with differential structural and compositional effects. KSCs cultured on papilla ECM consistently displayed lower proliferation, higher metabolic activity, and differences in cell morphology, alignment, and structure formation as compared to KSCs on cortex and medulla ECM, effects not observed in corresponding MSC cultures. These data suggest that tissue- and region-specific ECM can provide an effective substrate for in vitro studies of therapeutic stem cells. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Cationic Phosphorus Dendrimer Enhances Photodynamic Activity of Rose Bengal against Basal Cell Carcinoma Cell Lines.

    Science.gov (United States)

    Dabrzalska, Monika; Janaszewska, Anna; Zablocka, Maria; Mignani, Serge; Majoral, Jean Pierre; Klajnert-Maculewicz, Barbara

    2017-05-01

    In the last couple of decades, photodynamic therapy emerged as a useful tool in the treatment of basal cell carcinoma. However, it still meets limitations due to unfavorable properties of photosensitizers such as poor solubility or lack of selectivity. Dendrimers, polymers widely studied in biomedical field, may play a role as photosensitizer carriers and improve the efficacy of photodynamic treatment. Here, we describe the evaluation of an electrostatic complex of cationic phosphorus dendrimer and rose bengal in such aspects as singlet oxygen production, cellular uptake, and phototoxicity against three basal cell carcinoma cell lines. Rose bengal-cationic dendrimer complex in molar ratio 5:1 was compared to free rose bengal. Obtained results showed that the singlet oxygen production in aqueous medium was significantly higher for the complex than for free rose bengal. The cellular uptake of the complex was 2-7-fold higher compared to a free photosensitizer. Importantly, rose bengal, rose bengal-dendrimer complex, and dendrimer itself showed no dark toxicity against all three cell lines. Moreover, we observed that phototoxicity of the complex was remarkably enhanced presumably due to high cellular uptake. On the basis of the obtained results, we conclude that rose bengal-cationic dendrimer complex has a potential in photodynamic treatment of basal cell carcinoma.

  9. Basic studies on the hepatobiliary scintigraphy with 123I-rose bengal

    International Nuclear Information System (INIS)

    Narabayashi, Isamu; Ito, Yasuhiko; Otsuka, Nobuaki; Muranaka, Akira; Konno, Katsunobu.

    1979-01-01

    The purpose of this investigation is to evaluate the values of 123 I-rose bengal. sup(99m)Tc-labels for the hepatobiliary radiopharmaceutical are not fully satisfied because of greater urinary excretion, especially in cases of hyperbilirubinemia. 123 I is a lower gamma ray energy emitter more suitable for imaging and has a short half life with 13 hours. Commercially obtained rose bengal was purified using Sephadex G-25 column on gelfiltration. 123 I-rose bengal was prepared using iodine exchange reaction between nonradioactive rose bengal and Na 123 I. Radiochemical purity of 123 I-rose bengal was examined by paper chromatography. Biological distribution of 123 I-rose bengal in rabbits at 1 hours after intravenous injection indicated that the tracer was cleared from the blood to the liver, thereafter excreted into the small intestine through the common bile duct. Hepatic uptake and excretion of activity has been measured for 60 minutes using a scintillation camera in conjunction with a VTR system. There existed no significant relative to those of 131 I-rose bengal. Serial scintigraphic images showed satisfactorily better images even in a rabbit with complete obstructive jaundice. (author)

  10. Photoinjector optimization using a derivative-free, model-based trust-region algorithm for the Argonne Wakefield Accelerator

    Science.gov (United States)

    Neveu, N.; Larson, J.; Power, J. G.; Spentzouris, L.

    2017-07-01

    Model-based, derivative-free, trust-region algorithms are increasingly popular for optimizing computationally expensive numerical simulations. A strength of such methods is their efficient use of function evaluations. In this paper, we use one such algorithm to optimize the beam dynamics in two cases of interest at the Argonne Wakefield Accelerator (AWA) facility. First, we minimize the emittance of a 1 nC electron bunch produced by the AWA rf photocathode gun by adjusting three parameters: rf gun phase, solenoid strength, and laser radius. The algorithm converges to a set of parameters that yield an emittance of 1.08 μm. Second, we expand the number of optimization parameters to model the complete AWA rf photoinjector (the gun and six accelerating cavities) at 40 nC. The optimization algorithm is used in a Pareto study that compares the trade-off between emittance and bunch length for the AWA 70MeV photoinjector.

  11. Some cogent observations on amoebic hepatopathies using radioactive rose bengal

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, B N; Jha, B K

    1975-08-01

    Amoebic hepatopathies in this paper refers to three clinical syndromes described as hepatic amoebiasis, liver abscess and amoebic hepatitis. Forty-six patients with clinical symptomatology suggestive of amoebic hepatopathy were investigated with /sup 131/I rose bengal. Size, shape, position and parenchymal functions of their livers were estimated by assessing rose bengal blood clearance rate and scanning procedures. It was observed that there was true hepatomegaly and hepatic dysfunction in cases of hepatic abscess but not in amoebic hepatitis patients. Furthermore, hepatic abscess cases always had a ''cold'' area in their liver scans even at very early stage. On the other hand, amoebic hepatitis patients had normal size, shape and function of the liver--which was further confirmed by liver biopsy in five of them. These livers were palpable because of their low anatomical position (Ptosis). All the cases of hepatic abscess (except two) were treated by antiamoebic drugs without resorting to aspiration and serial scans showed complete resolution. Hence it is seen that aspiration in managing these cases (irrespective of the size) in early stages is not indicated at all. Thirty per cent of these patients developed jaundice and again size of the abscess was not critical. Surprisingly, amoebic hepatitis cases also showed improvement to oral anti-amoebic drugs. Liver, if at all involved in these cases, was due to chronic bowel disorders and treatment of bowel gives them symptomatic relief. However, no direct evidence could be brought out to prove existence of amoebic hepatitis by these techniques.

  12. Controlling the Regional Identity of hPSC-Derived Neurons to Uncover Neuronal Subtype Specificity of Neurological Disease Phenotypes

    Directory of Open Access Journals (Sweden)

    Kent Imaizumi

    2015-12-01

    Full Text Available The CNS contains many diverse neuronal subtypes, and most neurological diseases target specific subtypes. However, the mechanism of neuronal subtype specificity of disease phenotypes remains elusive. Although in vitro disease models employing human pluripotent stem cells (PSCs have great potential to clarify the association of neuronal subtypes with disease, it is currently difficult to compare various PSC-derived subtypes. This is due to the limited number of subtypes whose induction is established, and different cultivation protocols for each subtype. Here, we report a culture system to control the regional identity of PSC-derived neurons along the anteroposterior (A-P and dorsoventral (D-V axes. This system was successfully used to obtain various neuronal subtypes based on the same protocol. Furthermore, we reproduced subtype-specific phenotypes of amyotrophic lateral sclerosis (ALS and Alzheimer’s disease (AD by comparing the obtained subtypes. Therefore, our culture system provides new opportunities for modeling neurological diseases with PSCs.

  13. An Intrathermocline Eddy and a tropical cyclone in the Bay of Bengal

    OpenAIRE

    Gordon, Arnold L.; Shroyer, Emily; Murty, V. S. N.

    2017-01-01

    The Bay of Bengal, subjected to monsoonal forcing and tropical cyclones, displays a complex field of ocean eddies. On 5 December 2013 a sub-surface vortex or Intrathermocline Eddy (ITE) composed of water characteristic of the Andaman Sea was observed within the thermocline of the western Bay of Bengal. We propose that the ITE was the product of Tropical Cyclone Lehar interaction on 27 November 2013 with a westward propagating surface eddy from the eastern Bay of Bengal. While Lehar?s interact...

  14. Petroleum hydrocarbon concentrations in eight mollusc species along Tamilnadu coast, Bay of Bengal, India.

    Science.gov (United States)

    Veerasingam, S; Venkatachalapathy, R; Sudhakar, S; Raja, P; Rajeswari, V

    2011-01-01

    Eight mollusc species and sediment samples collected from three different stations along Tamilnadu coast, Bay of Bengal, India were analysed for the levels of petroleum hydrocarbons to elucidate the status of the petroleum residues in mollusc meant for human consumption. The concentrations of petroleum hydrocarbons in sediments along Tamilnadu coast varied from 5.04-25.5 microg/g dw (dry weight). High concentration of petroleum hydrocarbons in the sediment of Uppanar estuary (25.5 +/- 1.45 microg/g dw) was perhaps land and marine based anthropogenic sources of this region. The petroleum hydrocarbon residues in eight mollusc species collected from Uppanar, Vellar and Coleroon estuaries varied between 2.44-6.04 microg/g ww (wet weight). Although the concentration of petroleum hydrocarbons in sediment of the Uppanar region was markedly higher than the background, the petroleum hydrocarbon residues in mollusc collected from Uppanar estuary did not suggest bioaccumulation. The results signified that industrial growth has affected the aquatic environments and regular monitoring will help to adopt stringent pollution control measures for better management of the aquatic region.

  15. Distribution of some biochemical compounds in the sediments of the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Bhosle, N.B.; Dhople, V.M.

    Surficial sediment samples collected from the continental shelf and slope of the Bay of Bengal were studied for the distribution of organic carbon and its constituent fractions such as carbohydrates, proteins, amino acids and lipids. Organic carbon...

  16. Particulate carbohydrate in the euphotic zone of the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Bhosle, N; De; Shirodkar, P.V.; Reddy, C.V.G.

    Particulate matter collected from the Bay of Bengal was analysed for carbohydrate and chlorophyll a. The distribution of chlorophyll a was different from that of carbohydrate. Chlorophyll a increased from north to south, whereas carbohydrate levels...

  17. A first note on Japanese encephalitis virus isolation from Culex quinquefasciatus Say in Northern West Bengal.

    Directory of Open Access Journals (Sweden)

    V. Thenmozhi

    2014-03-01

    Full Text Available Japanese encephalitis (JE is endemic in many parts of India including the state of West Bengal. In West Bengal, the first major outbreaks of JE occurred in the districts of Bankura and Burdwan in 1973. The Culex vishnui subgroup of mosquitoes has been implicated as major vectors of JE. However in India, JE virus (JEV has been isolated from 16 species of mosquitoes. During September 2011, JE cases were reported from four districts -Jalpaiguri, Darjeeling, Dinajpur and Cooch Behar of West Bengal (North. Adult mosquitoes were collected, identified, pooled and screened for JEV using antigen capture ELISA. Out of 279 mosquito pools tested, one pool of Cx. pseudovishnui and three pools of Cx. quinquefasciatus were found positive for JEV. The ELISA positive pools were further confirmed as JEV by insect bioassay (Toxo-IFA. Two pools of Cx. quinquefasciatus were confirmed as JEV. This represents the first report of JEV isolation from Cx. quinquefasciatus in West Bengal.

  18. Surface layer temperature inversion in the Bay of Bengal: Main characteristics and related mechanisms

    Digital Repository Service at National Institute of Oceanography (India)

    Pankajakshan, T.; Suresh, I.; Gautham, S.; PrasannaKumar, S.; Lengaigne, M.; Rao, R.R.; Neetu, S.; Hegde, A.

    Surface layer temperature inversion (SLTI), a warm layer sandwiched between surface and subsurface colder waters, has been reported to frequently occur in conjunction with barrier layers in the Bay of Bengal (BoB), with potentially commensurable...

  19. Surface layer conditions of the atmosphere over western Bay of Bengal during Monex

    Digital Repository Service at National Institute of Oceanography (India)

    Anto, A.F.; Rao, L.V.G.; Somayajulu, Y.K.

    Based on surface meteorological data and wave data collected from 2 stations in the western Bay of Bengal in July 1979, surface layer (SL) conditions of the atmosphere for different situations of surface circulations and the associated sea surface...

  20. Seasonal cycle of physical forcing and biological response in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Nuncio, M.; Narvekar, J.; Ramaiah, N.; Sardessai, S.; Gauns, M.; Fernandes, V.; Paul, J.T.; Jyothibabu, R.; Jayaraj, K.A.

    supported an efficient nutrient supply by cold core eddies. It resulted in the highest mean column integrated chlorophyll as well as primary productivity. Perennially low surface chlorophyll in the Bay of Bengal was largely controlled by the physical...

  1. Is the biological productivity in the Bay of Bengal light limited?

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Narvekar, J.; Nuncio, M.; Kumar, A.; Ramaiah, N.; Sardessai, S.; Gauns, M.; Fernandes, V.; Paul, J.

    Recent measurements of chlorophyll, primary productivity (PP) and nutrients along the central Bay of Bengal (BOB) during summer, fall and spring intermonsoons showed that the northern bay becomes less productive compared to the south in summer...

  2. Biochemical composition and caloric potential of zooplankton from Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sreepada, R.A.; Rivonker, C.U.; Parulekar, A.H.

    Proximate composition and variations in protein, lipid, carbohydrate, ash and organic carbon in zooplankton from 42 stations in the Bay of Bengal are reported. Average percentages of moisture, protein, lipid, carbohydrate, ash and carbon were 85...

  3. Sound field computations in the Bay of Bengal using parabolic equation method

    Digital Repository Service at National Institute of Oceanography (India)

    Navelkar, G.S.; Somayajulu, Y.K.; Murty, C.S.

    Effect of the cold core eddy in the Bay of Bengal on acoustic propagation was analysed by parabolic equation (PE) method. Source depth, frequency and propagation range considered respectively for the two numerical experiments are 150 m, 400 Hz, 650...

  4. Circulation and distribution of some hydrographical properties during the late winter in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, D.P.; Sastry, J.S.

    Charts showing dynamic topography, mass distribution, temperature, salinity, dissolved oxygen and inorganic phosphate in the upper layers of the Bay of Bengal for the late winter period were analysed and presented. The near surface circulation has...

  5. Estimates of vertical velocities and eddy coefficients in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Varkey, M.J.; Sastry, J.S.

    Vertical velocities and eddy coefficients in the intermediate depths of the Bay of Bengal are calculated from mean hydrographic data for 300 miles-squares. The linear current density (sigma- O) versus log-depth plots show steady balance between...

  6. High new production in the Bay of Bengal: Possible causes and implications

    Digital Repository Service at National Institute of Oceanography (India)

    Kumar, S.; Ramesh, R.; Sardessai, S.; Sheshshayee, M.S.

    The first measurements of new production (sup(15) N tracer technique), the component of primary production that sustains on extraneous nutrient inputs to the euphotic zone, in the Bay of Bengal is reported. Experiments done in two different seasons...

  7. Detection of Bay of Bengal eddies from TOPEX and insitu observations

    Digital Repository Service at National Institute of Oceanography (India)

    Ali, M.M.; Sharma, R.; Gopalakrishna, V.V.

    Oceanic eddies are characterised by gradients in the sea surface height (SSH) and temperature both at the surface and the subsurface. However, since the Bay of Bengal waters are more stratified, the gradients in SST may not develop though...

  8. Marine magnetic studies in the northern Bay of Bengal, preliminary results

    Digital Repository Service at National Institute of Oceanography (India)

    Ramana, M.V.; Subrahmanyam, V.; Krishna, K.S.; Chaubey, A.K.; Sarma, K.V.L.N.S.; Murty, G.P.S.; Murty, P.S.N.; Rao, D.G.; Mittal, G.S.; Drolia, R.K.

    The bathymetric and total magnetic intensity data collected along six E-W tracks were analysed and presented as stacked anomaly profiles. A first order basement configuration model was generated across the Bay of Bengal. The model studies indicate...

  9. Distribution of calanoid copepods in the Arabian sea and Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Stephen, R.

    The distribution of calanoid copepods from the northern Arabian Sea and Bay of Bengal is discussed in relation to thermocline. The inshore offshore zonation of a neritic, shelf an oceanic communities was traced based on the species composition...

  10. Land cover in Upper Egypt assessed using regional and global land cover products derived from MODIS imagery.

    Science.gov (United States)

    Fuller, Douglas O; Parenti, Michael S; Gad, Adel M; Beier, John C

    2012-01-01

    Irrigation along the Nile River has resulted in dramatic changes in the biophysical environment of Upper Egypt. In this study we used a combination of MODIS 250 m NDVI data and Landsat imagery to identify areas that changed from 2001-2008 as a result of irrigation and water-level fluctuations in the Nile River and nearby water bodies. We used two different methods of time series analysis -- principal components (PCA) and harmonic decomposition (HD), applied to the MODIS 250 m NDVI images to derive simple three-class land cover maps and then assessed their accuracy using a set of reference polygons derived from 30 m Landsat 5 and 7 imagery. We analyzed our MODIS 250 m maps against a new MODIS global land cover product (MOD12Q1 collection 5) to assess whether regionally specific mapping approaches are superior to a standard global product. Results showed that the accuracy of the PCA-based product was greater than the accuracy of either the HD or MOD12Q1 products for the years 2001, 2003, and 2008. However, the accuracy of the PCA product was only slightly better than the MOD12Q1 for 2001 and 2003. Overall, the results suggest that our PCA-based approach produces a high level of user and producer accuracies, although the MOD12Q1 product also showed consistently high accuracy. Overlay of 2001-2008 PCA-based maps showed a net increase of 12 129 ha of irrigated vegetation, with the largest increase found from 2006-2008 around the Districts of Edfu and Kom Ombo. This result was unexpected in light of ambitious government plans to develop 336 000 ha of irrigated agriculture around the Toshka Lakes.

  11. Examination of Regional Trends in Cloud Properties over Surface Sites Derived from MODIS and AVHRR using the CERES Cloud Algorithm

    Science.gov (United States)

    Smith, W. L., Jr.; Minnis, P.; Bedka, K. M.; Sun-Mack, S.; Chen, Y.; Doelling, D. R.; Kato, S.; Rutan, D. A.

    2017-12-01

    Recent studies analyzing long-term measurements of surface insolation at ground sites suggest that decadal-scale trends of increasing (brightening) and decreasing (dimming) downward solar flux have occurred at various times over the last century. Regional variations have been reported that range from near 0 Wm-2/decade to as large as 9 Wm-2/decade depending on the location and time period analyzed. The more significant trends have been attributed to changes in overhead clouds and aerosols, although quantifying their relative impacts using independent observations has been difficult, owing in part to a lack of consistent long-term measurements of cloud properties. This paper examines new satellite based records of cloud properties derived from MODIS (2000-present) and AVHRR (1981- present) data to infer cloud property trends over a number of surface radiation sites across the globe. The MODIS cloud algorithm was developed for the NASA Clouds and the Earth's Radiant Energy System (CERES) project to provide a consistent record of cloud properties to help improve broadband radiation measurements and to better understand cloud radiative effects. The CERES-MODIS cloud algorithm has been modified to analyze other satellites including the AVHRR on the NOAA satellites. Compared to MODIS, obtaining consistent cloud properties over a long period from AVHRR is a much more significant challenge owing to the number of different satellites, instrument calibration uncertainties, orbital drift and other factors. Nevertheless, both the MODIS and AVHRR cloud properties will be analyzed to determine trends, and their level of consistency and correspondence with surface radiation trends derived from the ground-based radiometer data. It is anticipated that this initial study will contribute to an improved understanding of surface solar radiation trends and their relationship to clouds.

  12. Estimating Error in SRTM Derived Planform of a River in Data-poor Region and Subsequent Impact on Inundation Modeling

    Science.gov (United States)

    Bhuyian, M. N. M.; Kalyanapu, A. J.

    2017-12-01

    Accurate representation of river planform is critical for hydrodynamic modeling. Digital elevation models (DEM) often falls short in accurately representing river planform because they show the ground as it was during data acquisition. But, water bodies (i.e. rivers) change their size and shape over time. River planforms are more dynamic in undisturbed riverine systems (mostly located in data-poor regions) where remote sensing is the most convenient source of data. For many of such regions, Shuttle Radar Topographic Mission (SRTM) is the best available source of DEM. Therefore, the objective of this study is to estimate the error in SRTM derived planform of a river in a data-poor region and estimate the subsequent impact on inundation modeling. Analysis of Landsat image, SRTM DEM and remotely sensed soil data was used to classify the planform activity in an 185 km stretch of the Kushiyara River in Bangladesh. In last 15 years, the river eroded about 4.65 square km and deposited 7.55 square km area. Therefore, current (the year 2017) river planform is significantly different than the SRTM water body data which represents the time of SRTM data acquisition (the year 2000). The rate of planform shifting significantly increased as the river traveled to downstream. Therefore, the study area was divided into three reaches (R1, R2, and R3) from upstream to downstream. Channel slope and meandering ratio changed from 2x10-7 and 1.64 in R1 to 1x10-4 and 1.45 in R3. However, more than 60% erosion-deposition occurred in R3 where a high percentage of Fluvisols (98%) and coarse particles (21%) were present in the vicinity of the river. It indicates errors in SRTM water body data (due to planform shifting) could be correlated with the physical properties (i.e. slope, soil type, meandering ratio etc.) of the riverine system. The correlations would help in zoning activity of a riverine system and determine a timeline to update DEM for a given region. Additionally, to estimate the

  13. Vulnerability of deep groundwater in the Bengal Aquifer System to contamination by arsenic

    Science.gov (United States)

    Burgess, W.G.; Hoque, M.A.; Michael, H.A.; Voss, C.I.; Breit, G.N.; Ahmed, K.M.

    2010-01-01

    Shallow groundwater, the primary water source in the Bengal Basin, contains up to 100 times the World Health Organization (WHO) drinking-water guideline of 10g l 1 arsenic (As), threatening the health of 70 million people. Groundwater from a depth greater than 150m, which almost uniformly meets the WHO guideline, has become the preferred alternative source. The vulnerability of deep wells to contamination by As is governed by the geometry of induced groundwater flow paths and the geochemical conditions encountered between the shallow and deep regions of the aquifer. Stratification of flow separates deep groundwater from shallow sources of As in some areas. Oxidized sediments also protect deep groundwater through the ability of ferric oxyhydroxides to adsorb As. Basin-scale groundwater flow modelling suggests that, over large regions, deep hand-pumped wells for domestic supply may be secure against As invasion for hundreds of years. By contrast, widespread deep irrigation pumping might effectively eliminate deep groundwater as an As-free resource within decades. Finer-scale models, incorporating spatial heterogeneity, are needed to investigate the security of deep municipal abstraction at specific urban locations. ?? 2010 Macmillan Publishers Limited. All rights reserved.

  14. A first note on Japanese encephalitis virus isolation from Culex quinquefasciatus Say in Northern West Bengal.

    OpenAIRE

    V. Thenmozhi; T. Mariappan; R. Krishnamoorthy; R. Krishnamoorthi; T. Balaji; B. K. Tyagi; V. Thenmozhi

    2014-01-01

    Japanese encephalitis (JE) is endemic in many parts of India including the state of West Bengal. In West Bengal, the first major outbreaks of JE occurred in the districts of Bankura and Burdwan in 1973. The Culex vishnui subgroup of mosquitoes has been implicated as major vectors of JE. However in India, JE virus (JEV) has been isolated from 16 species of mosquitoes. During September 2011, JE cases were reported from four districts -Jalpaiguri, Darjeeling, Dinajpur and Cooch Behar of West Ben...

  15. Influence of environmental settings on the prevalence of Trichodesmium spp. in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Hegde, S.; Anil, A.C.; Patil, J.S.; Mitbavkar, S.; Venkat, K.; Gopalakrishna, V.V.

    ) Influence of physical pro- cesses and freshwater discharge on the seasonality of phytoplankton regime in the Bay of Bengal. Cont Shelf Res 20:313–330 Gordon AL (2001) Interocean exchange. In: Sidler G, Church J, Gould J (eds) Ocean circulation and climate...: acanil@nio.org Influence of environmental settings on the prevalence of Trichodesmium spp. in the Bay of Bengal Sahana Hegde, Arga Chandrashekar Anil*, Jagadish S. Patil, Smita Mitbavkar, Venkat Krishnamurthy, Vissa V. Gopalakrishna National Institute...

  16. I-131 rose bengal excretion test is not dead

    International Nuclear Information System (INIS)

    Antico, V.F.; Denhartog, P.; Ash, J.M.; Gilday, D.L.; Houle, S.

    1985-01-01

    One hundred and thirty I-131 Rose Bengal Excretion Studies (RBI) were performed on 84 patients over nine years. In 90% (56/60) of cases with biliary atresia, the 72-hour RBI was less than or equal to 7%. In only 12.5% (3/24) of cases with neonatal hepatitis was the 72-hour RBI less than or equal to 7%. The accuracy of the test was 91% with a specificity of 88%. Thirty patients later were studied following a Kasai procedure. The RBI test reliably predicted the patency of the anastomosis. The authors conclude that the 72-hour RBI is a reliable test in the diagnosis of biliary atresia and in the documentation of biliary patency following surgery, provided adequate care is taken in stool collection and measurement

  17. Topogrid Derived 10 Meter Resolution Digital Elevation Model of the Shenandoah National Park and Surrounding Region, Virginia

    Science.gov (United States)

    Chirico, Peter G.; Tanner, Seth D.

    2004-01-01

    Explanation The purpose of developing a new 10m resolution DEM of the Shenandoah National Park Region was to more accurately depict geologic structure, surfical geology, and landforms of the Shenandoah National Park Region in preparation for automated landform classification. Previously, only a 30m resolution DEM was available through the National Elevation Dataset (NED). During production of the Shenandoah10m DEM of the Park the Geography Discipline of the USGS completed a revised 10m DEM to be included into the NED. However, different methodologies were used to produce the two similar DEMs. The ANUDEM algorithm was used to develop the Shenadoah DEM data. This algorithm allows for the inclusion of contours, streams, rivers, lake and water body polygons as well as spot height data to control the elevation model. A statistical analysis using over 800 National Geodetic Survey (NGS) first and second order vertical control points reveals that the Shenandoah10m DEM, produced as a part of the Appalachian Blue Ridge Landscape project, has a vertical accuracy of ?4.87 meters. The metadata for the 10m NED data reports a vertical accuracy of ?7m. A table listing the NGS control points, the elevation comparison, and the RMSE for the Shenandoah10m DEM is provided. The process of automated terrain classification involves developing statistical signatures from the DEM for each type of surficial deposit and landform type. The signature will be a measure of several characteristics derived from the elevation data including slope, aspect, planform curvature, and profile curvature. The quality of the DEM is of critical importance when extracting terrain signatures. The highest possible horizontal and vertical accuracy is required. The more accurate Shenandoah 10m DEM can now be analyzed and integrated with the geologic observations to yield statistical correlations between the two in the development of landform and surface geology mapping projects.

  18. Continuous day-time time series of E-region equatorial electric fields derived from ground magnetic observatory data

    Science.gov (United States)

    Alken, P.; Chulliat, A.; Maus, S.

    2012-12-01

    The day-time eastward equatorial electric field (EEF) in the ionospheric E-region plays an important role in equatorial ionospheric dynamics. It is responsible for driving the equatorial electrojet (EEJ) current system, equatorial vertical ion drifts, and the equatorial ionization anomaly (EIA). Due to its importance, there is much interest in accurately measuring and modeling the EEF. However, there are limited sources of direct EEF measurements with full temporal and spatial coverage of the equatorial ionosphere. In this work, we propose a method of estimating a continuous day-time time series of the EEF at any longitude, provided there is a pair of ground magnetic observatories in the region which can accurately track changes in the strength of the EEJ. First, we derive a climatological unit latitudinal current profile from direct overflights of the CHAMP satellite and use delta H measurements from the ground observatory pair to determine the magnitude of the current. The time series of current profiles is then inverted for the EEF by solving the governing electrodynamic equations. While this method has previously been applied and validated in the Peruvian sector, in this work we demonstrate the method using a pair of magnetometers in Africa (Samogossoni, SAM, 0.18 degrees magnetic latitude and Tamanrasset, TAM, 11.5 degrees magnetic latitude) and validate the resulting EEF values against the CINDI ion velocity meter (IVM) instrument on the C/NOFS satellite. We find a very good 80% correlation with C/NOFS IVM measurements and a root-mean-square difference of 9 m/s in vertical drift velocity. This technique can be extended to any pair of ground observatories which can capture the day-time strength of the EEJ. We plan to apply this work to more observatory pairs around the globe and distribute real-time equatorial electric field values to the community.

  19. Assessment of Rose Bengal vs. Riboflavin Photodynamic Therapy for Inhibition of Fungal Keratitis Isolates

    Science.gov (United States)

    Arboleda, Alejandro; Miller, Darlene; Cabot, Florence; Taneja, Mukesh; Aguilar, Mariela C.; Alawa, Karam; Amescua, Guillermo; Yoo, Sonia H.; Parel, Jean-Marie

    2014-01-01

    Purpose To compare the in vitro effect of rose bengal and riboflavin as photosensitizing agents for photodynamic therapy (PDT) on fungal isolates that are common causes of fungal keratitis Design Experimental study Methods Three isolates (Fusarium solani, Aspergillus fumigatus, Candida albicans) recovered from patients with confirmed fungal keratitis were used in the experiments. Isolates were grown on Sabouraud-Dextrose agar, swabbed and prepared in suspension, and one milliliter aliquots were inoculated onto test plates in triplicate. Test plates were separated into 5 groups: Group 1 - no treatment, Group 2 - 0.1% rose bengal alone, Group 3 - 518 nm irradiation alone, Group 4 - riboflavin PDT (riboflavin + 375 nm irradiation), and Group 5 - rose bengal PDT (rose bengal + 518 nm irradiation). Irradiation was performed over a circular area using either a green LED array (peak wavelength: 518 nm) or a UV-A LED array (peak wavelength: 375 nm). Test plates were irradiated with an energy density of 5.4 J/cm2. Later, plates were placed in a 30° C incubator and observed for growth. Results Rose bengal-mediated PDT successfully inhibited the growth of all three fungal isolates in the irradiated area. All other groups exhibited unrestricted growth throughout the plate. Conclusions Rose bengal-mediated PDT successfully inhibited the growth of three types of fungi. No other experimental groups, including riboflavin-mediated PDT, had any inhibitory effect on the isolates. The results might be useful for the treatment of patients suffering from corneal infection. PMID:24792103

  20. Sanctified madness: the God-intoxicated saints of Bengal.

    Science.gov (United States)

    Morinis, A

    1985-01-01

    The saintly madman is a familiar character in South Asia. To outer appearances he is no different from a lunatic, but the mad saint comes to be revered because his idiocy is popularly believed to arise from a different cause than ordinary madness. The common psychopath neglects social conventions because his consciousness is dimmed by incapacity; the saintly madman also breaches convention, but does so because his heightened consciousness has liberated him from the bonds of convention that entrap ordinary people. In the terms of Hinduism, he has tasted the divine nectar of God-realization and has returned to the human realm intoxicated by the experience. In this paper two popular God intoxicated saints of Bengal are discussed. The question is posed whether 'God intoxication' can be considered a culture-bound syndrome of Bengal. The concept of 'culture bound syndrome' is found to be too narrow to encompass the most significant issues to arise from reflection on the characteristics of the God intoxicated. These larger issues have to do with the relationship between cultural practices and models and mental states (whether deviant, as implied by the term 'syndrome' although deviance does not always carry the negative connotation implicit in 'syndrome', or normal). It is suggested that all cultures culture a limited range of mental states and thus the questions posed by the notion of culture bound syndromes are subsumed by larger questions about the relationship of all mind-states to the socio-cultural environment which conditions them. The conclusion is that God intoxication is indeed a uniquely Bengali mental condition, with variants throughout South Asia and kinship to other mystical states, but that the concept of 'syndrome' is not useful.

  1. Expression profile analysis of aorta-gonad-mesonephros region-derived stromal cells reveals genes that regulate hematopoiesis

    International Nuclear Information System (INIS)

    Nagao, Kenji; Ohta, Takayuki; Hinohara, Atsushi; Tahara, Tomoyuki; Hagiwara, Tetsuya; Maeda, Yoshitake; Yoneya, Takashi; Sohma, Yoshiaki; Heike, Toshio; Nakahata, Tatsutoshi; Inagaki, Yoshimasa; Nishikawa, Mitsuo

    2008-01-01

    The aorta-gonad-mesonephros (AGM) region is involved in the generation and maintenance of the first definitive hematopoietic stem cells (HSCs). A mouse AGM-derived cell line, AGM-S3, was shown to support the development of HSCs. To elucidate the molecular mechanisms regulating early hematopoiesis, we obtained subclones from AGM-S3, one of which was hematopoiesis supportive (S3-A9) and the other one of which was non-supportive (S3-A7), and we analyzed their gene expression profiles by gene chip analysis. In the present study, we found that Glypican-1 (GPC1) was highly expressed in the supportive subclone AGM-S3-A9. Over-expression of GPC1 in non-supportive cells led to the proliferation of progenitor cells in human cord blood when cocultured with the transfected-stromal cells. Thus, GPC1 may have an important role in the establishment of a microenvironment that supports early events in hematopoiesis

  2. Hydroclimatic drivers, Water-borne Diseases, and Population Vulnerability in Bengal Delta

    Science.gov (United States)

    Akanda, A. S.; Jutla, A. S.

    2012-04-01

    Water-borne diarrheal disease outbreaks in the Bengal Delta region, such as cholera, rotavirus, and dysentery, show distinct seasonal peaks and spatial signatures in their origin and progression. However, the mechanisms behind these seasonal phenomena, especially the role of regional climatic and hydrologic processes behind the disease outbreaks, are not fully understood. Overall diarrheal disease prevalence and the population vulnerability to transmission mechanisms thus remain severely underestimated. Recent findings suggest that diarrheal incidence in the spring is strongly associated with scarcity of freshwater flow volumes, while the abundance of water in monsoon show strong positive correlation with autumn diarrheal burden. The role of large-scale ocean-atmospheric processes that tend to modulate meteorological, hydrological, and environmental conditions over large regions and the effects on the ecological states conducive to the vectors and triggers of diarrheal outbreaks over large geographic regions are not well understood. We take a large scale approach to conduct detailed diagnostic analyses of a range of climate, hydrological, and ecosystem variables to investigate their links to outbreaks, occurrence, and transmission of the most prevalent water-borne diarrheal diseases. We employ satellite remote sensing data products to track coastal ecosystems and plankton processes related to cholera outbreaks. In addition, we investigate the effect of large scale hydroclimatic extremes (e.g., droughts and floods, El Nino) to identify how diarrheal transmission and epidemic outbreaks are most likely to respond to shifts in climatic, hydrologic, and ecological changes over coming decades. We argue that controlling diarrheal disease burden will require an integrated predictive surveillance approach - a combination of prediction and prevention - with recent advances in climate-based predictive capabilities and demonstrated successes in primary and tertiary prevention

  3. Distribution of ozone and its precursors over Bay of Bengal during winter 2009: role of meteorology

    Directory of Open Access Journals (Sweden)

    L. M. David

    2011-09-01

    Full Text Available Measurements of ozone and NO2 were carried out in the marine environment of the Bay of Bengal (BoB during the winter months, December 2008–January 2009, as part of the second Integrated Campaign for Aerosols, gases and Radiation Budget conducted under the Geosphere Biosphere Programme of the Indian Space Research Organization. The ozone mixing ratio was found to be high in the head and the southeast BoB with a mean value of 61 ± 7 ppb and 53 ± 6 ppb, respectively. The mixing ratios of NO2 and CO were also relatively high in these regions. The spatial patterns were examined in the light of airflow patterns, air mass back trajectories and other meteorological conditions and satellite retrieved maps of tropospheric ozone, NO2, CO, and fire count in and around the region. The distribution of these gases was strongly associated with the transport from the adjoining land mass. The anthropogenic activities and forest fires/biomass burning over the Indo Gangetic Plains and other East Asian regions contribute to ozone and its precursors over the BoB. Similarity in the spatial pattern suggests that their source regions could be more or less the same. Most of the diurnal patterns showed decrease of the ozone mixing ratio during noon/afternoon followed by a nighttime increase and a morning high. Over this oceanic region, photochemical production of ozone involving NO2 was not very active. Water vapour played a major role in controlling the variation of ozone. An attempt is made to simulate ozone level over the north and south BoB using the photochemical box model (NCAR-MM. The present observed features were compared with those measured during the earlier cruises conducted in different seasons.

  4. Synchronization of Well Log Data and Geophysical Data with Remote Sensing Technique to Develop the Hydrocarbon System of Bengal Basin

    Science.gov (United States)

    Kesh, S.; Samadder, P. K.

    2012-12-01

    Remote sensing along with more conventional exploration techniques such as geophysics and reconnaissance field mapping can help to establish regional geologic relationships, to extract major structural features and to pinpoint anomalous patterns. Many well have been drilled in Bengal basin still no commercially viable reserves have been discovered. Geophysical well logging is used in virtually every oil well. It is the primary means by which we characterize the subsurface in search of hydrocarbons. Oil and gas exploration activities for large areas require ground gravity surveys to facilitate detailed geological interpretations for subsurface features integrating geological cross-sections with the sub-surface structural trends leads to the identification of prospect areas. Remote sensing, geological and geophysical data integration provide accurate geometric shapes of the basins. Bengal basin has a sedimentary fill of 10-15 km, is the northernmost of the east coast basins of India In the first phase Remote sensing satellite sensors help in identifying surface anomaly which indicates the presence of hydrocarbon reservoirs providing regional geological settings of petroleferous basins. It provides accurate and visual data for directly determining geometric shapes of basin. It assists in the selection of exploration regions by defining the existence of sedimentary basin. Remote sensing methods can generate a wealth of information useful in determining the value of exploratory prospecting. In the second phase Well Log data provide relative subsurface information for oil and gas exploration. Remote sensing data are merged with other available information such as Aeromagnetic, gravity, geochemical surveys and 2D seismic surveys. The result of this phase is to estimate the outcome of oil discovery probabilities for locating oil prospects

  5. Evaluation of regional fracture properties for groundwater ...

    Indian Academy of Sciences (India)

    lia district, West Bengal (India) were studied to find out the spatial pattern and consistency of such fracture ... Fracture networks have the potentiality to ... Regional scale groundwater development is important in ..... tory well sites, spatial distribution of hydrologi- ... in hard rocks: A case study from Sunnfjord, Western. Norway ...

  6. Past and present status of the Indian Tiger in northern West Bengal, India: an overview

    Directory of Open Access Journals (Sweden)

    J.K. Mallick

    2010-03-01

    Full Text Available Changes in the distribution range and the estimates of Tiger (Panthera tigris populations in northern West Bengal from the late 19th century to 2009 were examined in detail. According to a 2004 census there were 70 tigers in the region, while a 2008 estimate put the number at 8-12. The tiger survives only in protected areas of terai and duars extending over about 1000km2 of Buxa, Jaldapara, Neora Valley and Mahananda, the Panighat and Bamanpokhri Ranges of Kurseong Division and the Chilapata and Kodalbusty Ranges under Wildlife-III Division. Tigers became extinct in Chapramari Sanctuary about a decade back; Gorumara sightings were recorded up to the 1980s. The species has already lost about 1000km2 of its historic range in the territorial forest divisions of Darjeeling, Jalpaiguri, Cooch Behar, Dinajpur and Malda Districts. The State Forest Department has undertaken efforts involving regular monitoring, protection measures and habitat improvements and tigers are now being sighted in areas where they were absent for years. Resident tigers appear to be expanding their ranges to new areas, sometimes at higher altitudes as in Neora Valley National Park and Buxa Tiger Reserve crossing into Bhutan and Sikkim.

  7. Variability in productivity controlled by haline stratification over 300ky in the Bay of Bengal.

    Science.gov (United States)

    Da Silva, R.; Mazumdar, A.; Peketi, A.; Joshi, R.; Shaji, A.; Naik, B. G.; Carvalho, M.; Molleti, S.

    2017-12-01

    The unique hydrographic setting of the Bay of Bengal (BoB) makes it an ideal tropical marine system to study the influence of regional and global forcings on productivity and [CO2aq] through the late quaternary. Enormous fresh water flux into the BoB and consequent haline stratification significantly weakens the convective mixing and wind driven processes which are commonly responsible for transport of nutrients to the euphotic zone driving primary productivity. Here, we present a high resolution organic carbon-Calcium carbonate burial flux and δ13CTOC records for the last 300 ky. A giant Calypso piston corer was used on board ORV Marion Dufresne (MD-161) for the retrieval of the sediment core MD161-19 (core length: 39 m) off Mahanadi Basin (Lat.:18º59.1020"; Long.:85º41.1669") in western BoB at a water depth of 1480m. The results show significant productivity variation at marine isotope sub-stages and millennial timescales. Colder sub-stages and stadials (Dansgard-Oeschger cycle) show boost in productivity which may be attributed to thinning of low salinity water cap, thereby facilitating efficient nutrient transport across the euphotic zone by the combination of wind driven processes (entrainment and upwelling), convective mixing and cold core eddies. Our long term high resolution data indicates a possibility of marked changes in productivity/ biogeochemistry of BOB in the future due to global warming, in turn affecting coastal economy.

  8. Petroleum hydrocarbon concentrations in marine sediments along Chennai Coast, Bay of Bengal, India.

    Science.gov (United States)

    Venkatachalapathy, R; Veerasingam, S; Ramkumar, T

    2010-10-01

    The spatial and temporal distribution of petroleum hydrocarbons (PHC) in marine sediments along the Chennai coast, Bay of Bengal was quantified by Ultra-Violet Fluorescence (UVF) Spectroscopy. The concentration of PHC in surface sediments varied from 1.88 to 39.76 ppm. The highest values obtained in the northern part of the study area, where shipping activities and land-based waste waters disposed into sea through the rivers like Kuvam and Adayar. The Adayar (7.26-16.83 ppm) and Kuvam (5.5-39.72 ppm) cores reveal a clear horizon of increase in PHC above 50 and 35 cm respectively. PHC values showed a decreasing pattern with depth in all sediment cores suggesting the excess anthropogenic loading occurring in the recent past. The present study revealed that the PHC values of Chennai coastal sediments are lower than the values reported from selected costal areas including the sediment of the Mumbai coast (7.6-42.8 ppm), Arabian Sea. The results will be useful for pollution monitoring program along the coastal region and also to check the level of petroleum hydrocarbons in marine sediments.

  9. Variations of trace gases over the Bay of Bengal during the summer monsoon

    Science.gov (United States)

    Girach, I. A.; Ojha, Narendra; Nair, Prabha R.; Tiwari, Yogesh K.; Kumar, K. Ravi

    2018-02-01

    In situ measurements of near-surface ozone (O3), carbon monoxide (CO), and methane (CH4) were carried out over the Bay of Bengal (BoB) as a part of the Continental Tropical Convergence Zone (CTCZ) campaign during the summer monsoon season of 2009. O3, CO and CH4 mixing ratios varied in the ranges of 8-54 ppbv, 50-200 ppbv and 1.57-2.15 ppmv, respectively during 16 July-17 August 2009. The spatial distribution of mean tropospheric O3 from satellite retrievals is found to be similar to that in surface O3 observations, with higher levels over coastal and northern BoB as compared to central BoB. The comparison of in situ measurements with the Monitoring Atmospheric Composition & Climate (MACC) global reanalysis shows that MACC simulations reproduce the observations with small mean biases of 1.6 ppbv, -2.6 ppbv and 0.07 ppmv for O3, CO and CH4, respectively. The analysis of diurnal variation of O3 based on observations and the simulations from Weather Research and Forecasting coupled with Chemistry (WRF-Chem) at a stationary point over the BoB did not show a net photochemical build up during daytime. Satellite retrievals show limitations in capturing CH4 variations as measured by in situ sample analysis highlighting the need of more shipborne in situ measurements of trace gases over this region during monsoon.

  10. Cultural context and impact of alcohol use in the Sundarban Delta, West Bengal, India.

    Science.gov (United States)

    Chowdhury, Arabinda N; Ramakrishna, Jayashree; Chakraborty, Ajoy K; Weiss, Mitchell G

    2006-08-01

    Hazardous alcohol consumption is a worldwide problem with many locally distinctive features across cultures, but studies to guide policy in developing countries are notably lacking. This community study aimed to clarify local patterns of alcohol use in six villages of West Bengal, India. It considered the variety of local alcoholic preparations, who consumed them, when, and where. It sought to determine how social changes in the region influence changing patterns of acceptable and problem use of alcohol. Ethnographic methods included participant observation and focus group discussions. The qualitative data analysis of field notes and transcripts included a review of full texts and a computer-assisted analysis of thematically coded segments with reference to a structured agenda. We found that drinking is an integral feature of the cultural landscape. Locally brewed rice beer (handia), palm wine (tadi), distilled country liquor (chullu), and so-called Indian-made foreign liquor (IMFL) are consumed in these villages. Each is identified with particular segments of society and settings in these communities. Reported effects of problem drinking included social disturbances, family discord, and domestic violence. Increasing problem alcohol use was attributed by villagers to social changes resulting from development, which were otherwise valued, such as improved transportation and communications. In a field dominated by Western and urban studies, this research clarifies features of alcohol availability, use, and acceptance in a neglected rural area of India. It illustrates the limitations of western clinical models of dependence and the importance of clarifying sociocultural conditions that define locally acceptable and problem use.

  11. Modelling crop land use change derived from influencing factors selected and ranked by farmers in North temperate agricultural regions.

    Science.gov (United States)

    Mehdi, Bano; Lehner, Bernhard; Ludwig, Ralf

    2018-08-01

    To develop meaningful land use scenarios, drivers that affect changes in the landscape are required. In this study, driving factors that influence farmers to change crops on their farm were determined. A questionnaire was administered to four independent groups of farmers who identified and ranked influencing factors pertaining to their choices of crops. The farmers were located in two mid-latitude agricultural watersheds (in Germany and Canada). The ranked influencing factors were used to develop a "farmer driven" scenario to 2040 in both watersheds. Results showed that the most important influencing factors for farmers to change crops were the "economic return of the crop" and "market factors". Yet, when the drivers of crop land use change were grouped into two categories of "financial" and "indirectly-related financial" factors, the "financial" factors made up approximately half of the influencing factors. For some responses, the "indirectly-related financial" factors (i.e. "access to farm equipment", the "farm experience", and "climate") ranked higher than or just as high as the financial factors. Overall, in the four farmer groups the differences between the rankings of the influencing factors were minor, indicating that drivers may be transferable between farms if the farmers are full-time and the farming regions have comparable growing seasons, access to markets, similar technology, and government programs for farm income. In addition to the "farmer driven" scenario, a "policy driven" scenario was derived for each watershed based only on available information on the financial incentives provided to farmers (i.e. agricultural subsidies, income support, crop insurance). The influencing factors ranked by the farmers provided in-depth information that was not captured by the "policy driven" scenario and contributed to improving predictions for crop land use development. This straight-forward method to rank qualitative data provided by farmers can easily be

  12. The relationship between the endothelium-derived vasoactive factor and regional cerebral blood flow in acute stroke

    International Nuclear Information System (INIS)

    Li Jiaqiang; Li Wei

    1999-01-01

    Objective: To explore the plasma concentration of the endothelium-derived vasoactive factors such as endothelin (ET), thromboxane B 2 (TXB 2 ), 6-keto-prostaglandin F 1α (6-K-PGF 1α ) and their effects on regional cerebral blood flow (rCBF). Methods: Plasma ET, TXB 2 , 6-K-PGF 1α were measured with radioimmunoassay in 64 patients with acute stroke and 30 control subjects. Meanwhile, the rCBF was determined using 133 Xe inhalation method in all patients and the control group. The data of stroke group were studied by t test. The linear correlation between alterations of vasoactive factors and rCBF was analysed. Results: The mean ET, TXB 2 plasma level [respectively (103.8 +- 42.6) and (152.2 +- 59.1) ng/L] was significantly higher in 64 stroke patients than in normal subjects [respectively (47.8 +- 7.8) and (84.4 +- 11.5) ng/L], P 1α [(93.7 +- 28.8) ng/L] as compared with the healthy controls [(104.7 +- 17.4) ng/L, P -1 ·min -1 ; mean: (46.9 +- 7.9) mL·100 g -1 ·min -1 vs (63.3 +- 6.5) mL·100 g -1 ·min -1 , P 2 in patients with large infarct or hemorrhage volume were markedly higher than those of patients with small foci; to the opposite, rCBF was decreased remarkably. The same situation was seen while compared the date of patients with basilar nuclei stroke with those of patients with lobar stroke. Both ET and TXB 2 had a significant negative correlation with rCBF ( r = -0.751, -0.454, P 2 and rCBF might be useful in assessment of brain damage caused by acute stroke

  13. Oxygen-independent direct deoxyribonucleic acid backbone breakage caused by rose bengal and visible light

    Energy Technology Data Exchange (ETDEWEB)

    Peak, M J; Peak, J G; Foote, C S; Krinsky, N I

    1984-01-01

    An oxygen enhancement ratio of 10 for the induction of backbone single-strand breaks (SSBs) in purified deoxyribonucleic acid (DNA) by monochromatic 365 nm UV radiation was obtained. Similarly, a dose reduction factor of 10 was observed when the DNA was irradiated in the presence of 0.1 M diazabicyclo(2.2.2)octane (DABCO). To determine whether this breakage of DNA was due to the action of a reactive oxygen species such as singlet oxygen, we used the photosensitizing dye Rose Bengal and visible light as a system for generating singlet oxygen. Treatment of the DNA with Rose Bengal and 545 nm monochromatic light enhanced the rate of induction of SSBs six times, compared with the rate we obtained when the light was used alone. Elimination of oxygen or addition of 0.1 M DABCO during the 545 nm irradiation in the presence of Rose Bengal did not alter the enhancement of SSBs in the DNA caused by Rose Bengal and 545 nm radiation. The induction of SSBs in the DNA caused by irradiation of the DNA by 545 nm light in the presence of Rose Bengal was not enhanced by the use of D/sub 2/O instead of H/sub 2/O as a solvent. The results indicate that Rose Bengal plus visible light can cause biological damage without the intermediacy of reactive oxygen species, i.e. Rose Bengal and visible light can react directly with biological material, in reactions that appear to be type I photosensitized processes, independent of singlet oxygen as an intermediate.

  14. Phytoplankton size structure in the southern Bay of Bengal modified by the Summer Monsoon Current and associated eddies: Implications on the vertical biogenic flux..

    Digital Repository Service at National Institute of Oceanography (India)

    Jyothibabu, R; Vinayachandran, P. N.; Madhu, N.V.; Robin, R; Karman, C.; Jagadeesan, L.; Anjusha, A.

    . Mar. Syst., vol.143; 2015; 98–119 Phytoplankton Size Structure in the Southern Bay of Bengal Modified by the Summer Monsoon Current and Associated Eddies: Implications on the Vertical Biogenic Flux R. Jyothibabu1*, P. N. Vinayachandran2, N. V.... Madhu1, R.S. Robin3, C. Karnan1, L. Jagadeesan1, A. Anjusha1 1CSIR – National Institute of Oceanography, Regional Centre, Kochi, India 2Centre for Atmospheric and Ocean Sciences, Indian Institute of Science, Bangalore, India 3Integrated Coastal...

  15. Diversity of killer cell immunoglobulin-like receptor genes in the Bengali population of northern West Bengal, India.

    Science.gov (United States)

    Guha, P; Bhattacharjee, S; Chaudhuri, T K

    2014-12-01

    The Indian Subcontinent exhibits extensive diversity in its culture, religion, ethnicity and linguistic heritage, which symbolizes extensive genetic variations within the populations. The highly polymorphic Killer cell Immunoglobulin-like Receptor (KIR) family plays an important role in tracing genetic differentiation in human population. In this study, we aimed to analyse the KIR gene polymorphism in the Bengali population of northern West Bengal, India. To our knowledge, this is the first report on the KIR gene polymorphism in the Bengalis of West Bengal, India. Herein, we have studied the distribution of 14 KIR genes (KIR3DL1-3DL3, KIR2DL1-2DL5, KIR2DS1-2DS5 AND KIR3DS1) and two pseudogenes (KIR3DP1 and 2DP1) in the Bengalis. Apart from the framework genes (KIR2DL4, 3DL2, 3DL3 and 3DP1), which are present in all the individuals, the gene frequencies of other KIR genes varied between 0.34 and 0.88. Moreover, upon comparing the KIR polymorphism of the Bengalis with the available published data of other world populations, it has been found that the Indo-European-speaking Bengalis from the region share both Dravidian and Indo-Aryan gene pool with considerable influences of mongoloid and European descents. Furthermore, evidences from previously published data on human leucocyte antigen and Y-chromosome haplogroup diversity support the view. Our results will help to understand the genetic background of the Bengali population, in illustrating the population migration events in the eastern and north-eastern part of India, in explaining the extensive genetic admixture amongst the different linguistic groups of the region and also in KIR-related disease researches. © 2014 John Wiley & Sons Ltd.

  16. A simple method to forecast the frequency of depressions and cyclones over Bay of Bengal during summer monsoon season

    Science.gov (United States)

    Sadhuram, Y.; Maneesha, K.; Suneeta, P.

    2018-04-01

    In this study, an attempt has been made to develop a simple multiple regression model to forecast the total number of depressions and cyclones (TNDC) over Bay of Bengal during summer monsoon (June-September) season using the data for the period, 1995-2016. Four potential predictors (zonal wind speed at 850 hPa in May and April SST in the North Australia-Indonesia region, 05°S-15°S; 120°E-160°E; March NINO 3.4 SST and geopotential height at 200 hPa in the region, 0°N-10°N; 80°E-100°E) have been identified to forecast TNDC. A remarkably high multiple correlation coefficient of 0.92 has been observed with the TNDC which explains 85% variability. The methodology has been tested for the recent 5 years (2012-2016) and found a good agreement between the observed and forecast values of TNDC except in 2015 in which the observed and predicted TNDC were 2 and 0, respectively. It is interesting to see high and significant correlations between the above predictors and the genesis potential parameter (GPP) during summer monsoon season. This GPP depends on the relative vorticity at 850 hPa, mid troposphere relative humidity, thermal instability between 850 and 500 hPa, and vertical wind shear between 200 and 850 hPa. It is inferred that the above predictors are influencing the environmental conditions over Bay of Bengal which, in turn, influencing the genesis of cyclones during summer monsoon season. The impact of ENSO (El-Nino-Southern Oscillation) and La-Nina in TNDC is examined and found that the vertical wind shear and relative vorticity are high and the GPP was almost double in ENSO compared with that in La-Nina which favoured high (low) TNDC under ENSO (La-Nina).

  17. Petroleum hydrocarbon concentrations in ten commercial fish species along Tamilnadu coast, Bay of Bengal, India.

    Science.gov (United States)

    Veerasingam, S; Venkatachalapathy, R; Raja, P; Sudhakar, S; Rajeswari, V; Asanulla, R Mohamed; Mohan, R; Sutharsan, P

    2011-05-01

    The aim of the present study was to evaluate the distribution of petroleum hydrocarbons in ten commercial fish species and water samples in three estuaries along Tamilnadu coast, Bay of Bengal, India. Fish and water samples collected from Tamilnadu coast, India, were extracted and analyzed for petroleum hydrocarbons by ultraviolet fluorescence (UVF) spectroscopy. The petroleum hydrocarbon concentration (PHC) in coastal waters and fish species varied between 2.28 and 14.02 μg/l and 0.52 and 2.05 μg/g, respectively. The highest PHC concentration was obtained in Uppanar estuarine waters (14.02 ± 0.83) and the lowest was observed in Vellar estuarine waters (2.28 ± 0.25). Among the ten fish species, Sardinella longiceps have high PHC concentration from all the locations. This study suggests that S. longiceps can be used as a good biological indicator for petroleum hydrocarbon pollution in water. The concentration of petroleum hydrocarbons in coastal waters along Tamilnadu coast is markedly higher than that in the background, but there is no evidence for its increase in fish of this region. From a public health point, petroleum hydrocarbon residue levels in all fish samples analyzed in this study are considerably lower than the hazardous levels. At present, as Tamilnadu coastal area is in a rapid development stage of new harbour, chemical industries, power plants, oil exploration and other large-scale industries, further assessment of petroleum hydrocarbons and the various hydrodynamic conditions acting in the region are to be studied in detail and continuous pollution monitoring studies should be conducted for improving the aquatic environment. The results will also be useful for pollution monitoring program along the coastal region and also to check the levels of petroleum hydrocarbons.

  18. Diversity, metabolic properties and arsenic mobilization potential of indigenous bacteria in arsenic contaminated groundwater of West Bengal, India.

    Science.gov (United States)

    Paul, Dhiraj; Kazy, Sufia K; Gupta, Ashok K; Pal, Taraknath; Sar, Pinaki

    2015-01-01

    Arsenic (As) mobilization in alluvial aquifers is caused by a complex interplay of hydro-geo-microbiological activities. Nevertheless, diversity and biogeochemical significance of indigenous bacteria in Bengal Delta Plain are not well documented. We have deciphered bacterial community compositions and metabolic properties in As contaminated groundwater of West Bengal to define their role in As mobilization. Groundwater samples showed characteristic high As, low organic carbon and reducing property. Culture-independent and -dependent analyses revealed presence of diverse, yet near consistent community composition mostly represented by genera Pseudomonas, Flavobacterium, Brevundimonas, Polaromonas, Rhodococcus, Methyloversatilis and Methylotenera. Along with As-resistance and -reductase activities, abilities to metabolize a wide range carbon substrates including long chain and polyaromatic hydrocarbons and HCO3, As3+ as electron donor and As5+/Fe3+ as terminal electron acceptor during anaerobic growth were frequently observed within the cultivable bacteria. Genes encoding cytosolic As5+ reductase (arsC) and As3+ efflux/transporter [arsB and acr3(2)] were found to be more abundant than the dissimilatory As5+ reductase gene arrA. The observed metabolic characteristics showed a good agreement with the same derived from phylogenetic lineages of constituent populations. Selected bacterial strains incubated anaerobically over 300 days using natural orange sand of Pleistocene aquifer showed release of soluble As mostly as As3+ along with several other elements (Al, Fe, Mn, K, etc.). Together with the production of oxalic acid within the biotic microcosms, change in sediment composition and mineralogy indicated dissolution of orange sand coupled with As/Fe reduction. Presence of arsC gene, As5+ reductase activity and oxalic acid production by the bacteria were found to be closely related to their ability to mobilize sediment bound As. Overall observations suggest that

  19. Intensification of Aila (May 2009) due to a warm core eddy in the north Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sadhuram, Y.; Maneesha, K.; Murty, T.V.R.

    A very severe cyclonic storm "Aila" hit West Bengal on 26 May 2009. The storm intensified when it encountered with a warm core (SST = 31 degrees C) anti-cyclonic eddy (ACE4) in the north Bay of Bengal. The storm intensity increased by 43 percent due...

  20. Microbial Assessment of Chevon of Black Bengal Goat

    Directory of Open Access Journals (Sweden)

    S Parvin

    2017-12-01

    Full Text Available This study was conducted to assess the microbial load of Black Bengal goat meat during handling and selling in different markets of Mymensingh, Bangladesh. Total 27 samples were collected from three different places of the city, including KR market, Seshmore and Mesua Bazar. These samples were subjected to determine Total Viable Count (TVC, Total Coliform Count (TCC and Yeast Mold Count (YMC by using standard protocols. In raw meat, mean value of TVC were highest in Seshmore market (5.24±0.42 log cfu/g at 0 hour but having no significant differences with other two places. In case of TCC and YMC highest count were in meat of Mesua Bazar. In case of TCC, difference were observed (P<0.05 among the markets. At 5 hours all the bacterial counts were increased having significant differences with the initial count and in most of the cases the bacterial count crossed the acceptable limit. This was may be due to the unhygienic practices of butchers. Consumers were not conscious. Suggestion has been given to improve the knowledge on hygiene among the meat producers to reduce microbial load.

  1. Creatinine, diet, micronutrients, and arsenic methylation in West Bengal, India.

    Science.gov (United States)

    Basu, Arin; Mitra, Soma; Chung, Joyce; Guha Mazumder, D N; Ghosh, Nilima; Kalman, David; von Ehrenstein, Ondine S; Steinmaus, Craig; Liaw, Jane; Smith, Allan H

    2011-09-01

    Ingested inorganic arsenic (InAs) is methylated to monomethylated (MMA) and dimethylated metabolites (DMA). Methylation may have an important role in arsenic toxicity, because the monomethylated trivalent metabolite [MMA(III)] is highly toxic. We assessed the relationship of creatinine and nutrition--using dietary intake and blood concentrations of micronutrients--with arsenic metabolism, as reflected in the proportions of InAS, MMA, and DMA in urine, in the first study that incorporated both dietary and micronutrient data. We studied methylation patterns and nutritional factors in 405 persons who were selected from a cross-sectional survey of 7,638 people in an arsenic-exposed population in West Bengal, India. We assessed associations of urine creatinine and nutritional factors (19 dietary intake variables and 16 blood micronutrients) with arsenic metabolites in urine. Urinary creatinine had the strongest relationship with overall arsenic methylation to DMA. Those with the highest urinary creatinine concentrations had 7.2% more arsenic as DMA compared with those with low creatinine (p creatinine concentration was the strongest biological marker of arsenic methylation efficiency, and therefore should not be used to adjust for urine concentration in arsenic studies. The new finding that animal fat intake has a positive relationship with MMA% warrants further assessment in other studies. Increased MMA% was also associated, to a lesser extent, with low serum selenium and folate.

  2. Gold-198 and rose bengal marked with iodine-131 in the diagnostic of hepatic vesicular affections; L'or{sup 198} et le rose bengale marque a l'iode{sup 131} dans le diagnostic des affections hepatovesiculaires

    Energy Technology Data Exchange (ETDEWEB)

    Manambelona Razafimalaza, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1961-06-15

    Colloidal gold-198 makes it possible to obtain clear images of hepatic parenchyma; the examination can be repeated from different angles thus demonstrating the presence of pathologically inert regions, whether they be hydatic cysts, abscesses or neoplasia. The study of the disappearance curve for the colloid, together with a measurement of the blood volume, makes it possible also to calculate the hepatic flow. Using Rose Bengal marked with iodine-131, it is possible to obtain images of the liver and of the bile ducts, and to follow the elimination of the dye in the intestines. The simultaneous recording of the disappearance curves for the blood and of the appearance of the dye in the intestines constitutes an useful working test which is particularly sensible for evaluating the permeability of the bile ducts and, to a certain degree, the site of an obstruction. (author) [French] L'or colloidal-198 permet d'obtenir avec nettete des images du parenchyme hepatique; l'examen peut etre repete sous plusieurs incidences mettant ainsi en evidence les zones muettes pathologiques, qu'il s'agisse de kystes hydatiques, d'abces ou de neoplasies. L'etude de la courbe d'epuration du colloide completee par une mesure du volume sanguin offre en outre la possibilite de calculer le debit hepatique. A l'aide du rose bengale marque a l'iode-131, il est possible d'obtenir des images du foie et de la vesicule biliaire, et de suivre l'elimination intestinale du colorant. L'enregistrement simultane des courbes d'epuration sanguine et d'apparition intestinale constitue une epreuve fonctionnelle particulierement sensible pour apprecier la permeabilite des voies biliaires et dans une certaine mesure le site d'une obstruction. (auteur)

  3. Computer-aided pathophysiological analysis of /sup 131/I rose bengal hepatogram

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, A [Kobe Univ. (Japan). School of Medicine

    1976-06-01

    The author analysed /sup 131/I-rose bengal (R.B.) hepatograms over the liver region using digital simulation technique to determine the hepatobiliary functions separately and to compare the rate constants obtained from the kinetic model and the results obtained from conventional liver function tests. A total of 112 cases were observed including various liver and gallbladder diseases and 8 normal subjects. Fasting patients were given intravenous injections of 300 ..mu..Ci of /sup 131/I-R.B. Hepatic uptake and excretion of radioactivity were measured for 120 minutes using a gamma camera. Two regions, one over the right lobe and the other over the gallbladder, were studied. The author applied a 3 compartment analysis to the /sup 131/I-R.B. hepatogram. Measured /sup 131/I-R.B. hepatogram was printed out on a line printer with curve pattern indices. Assumed rate constants and relative volume indices were placed on punch cards. Computer-aided simulation curves were printed on a line printer with curve pattern indices. The measured hepatogram and the simulated hepatogram were compared. The blood flow index (K/sub 21/), the hepatocellular function index (K/sub 32/) and the intrahepatic biliary excretion index (K/sub 03/) were obtained with the schematic presentation of the curves. Rate constants from the kinetic model correlated well with conventional liver function tests. In normal liver and hepatobiliary diseases, there were high statistical correlations between K/sub 21/ and Ksub(L) /sup 131/I-R.B. Retention (%), between K/sub 32/ and Cholinesterase, and between K/sub 03/ and Alkaliphosphatase. However, there was a low statistical correlation between the results of the simulation study and the results of liver function tests in the cases of obstructive jaundice and intrahepatic cholestasis.

  4. Computer-aided pathophysiological analysis of 131I rose bengal hepatogram

    International Nuclear Information System (INIS)

    Matsumoto, Akira

    1976-01-01

    The author analysed 131 I-rose bengal (R.B.) hepatograms over the liver region using digital simulation technique to determine the hepatobiliary functions separately and to compare the rate constants obtained from the kinetic model and the results obtained from conventional liver function tests. A total of 112 cases were observed including various liver and gallbladder diseases and 8 normal subjects. Fasting patients were given intravenous injections of 300 μCi of 131 I-R.B. Hepatic uptake and excretion of radioactivity were measured for 120 minutes using a gamma camera. Two regions, one over the right lobe and the other over the gallbladder, were studied. The author applied a 3 compartment analysis to the 131 I-R.B. hepatogram. Measured 131 I-R.B. hepatogram was printed out on a line printer with curve pattern indices. Assumed rate constants and relative volume indices were placed on punch cards. Computer-aided simulation curves were printed on a line printer with curve pattern indices. The measured hepatogram and the simulated hepatogram were compared. The blood flow index (K 21 ), the hepatocellular function index (K 32 ) and the intrahepatic biliary excretion index (K 03 ) were obtained with the schematic presentation of the curves. Rate constants from the kinetic model correlated well with conventional liver function tests. In normal liver and hepatobiliary diseases, there were high statistical correlations between K 21 and Ksub(L) 131 I-R.B. Retention (%), between K 32 and Cholinesterase, and between K 03 and Alkaliphosphatase. However, there was a low statistical correlation between the results of the simulation study and the results of liver function tests in the cases of obstructive jaundice and intrahepatic cholestasis. (Evans, J.)

  5. Wind effect on salt transport variability in the Bay of Bengal

    Science.gov (United States)

    Sandeep, K. K.; Pant, V.

    2017-12-01

    The Bay of Bengal (BoB) exhibits large spatial variability in sea surface salinity (SSS) pattern caused by its unique hydrological, meteorological and oceanographical characteristics. This SSS variability is largely controlled by the seasonally reversing monsoon winds and the associated currents. Further, the BoB receives substantial freshwater inputs through excess precipitation over evaporation and river discharge. Rivers like Ganges, Brahmaputra, Mahanadi, Krishna, Godavari, and Irawwady discharge annually a freshwater volume in range between 1.5 x 1012 and 1.83 x 1013 m3 into the bay. A major volume of this freshwater input to the bay occurs during the southwest monsoon (June-September) period. In the present study, a relative role of winds in the SSS variability in the bay is investigated by using an eddy-resolving three dimensional Regional Ocean Modeling System (ROMS) numerical model. The model is configured with realistic bathymetry, coastline of study region and forced with daily climatology of atmospheric variables. River discharges from the major rivers are distributed in the model grid points representing their respective geographic locations. Salt transport estimate from the model simulation for realistic case are compared with the standard reference datasets. Further, different experiments were carried out with idealized surface wind forcing representing the normal, low, high, and very high wind speed conditions in the bay while retaining the realistic daily varying directions for all the cases. The experimental simulations exhibit distinct dispersal patterns of the freshwater plume and SSS in different experiments in response to the idealized winds. Comparison of the meridional and zonal surface salt transport estimated for each experiment showed strong seasonality with varying magnitude in the bay with a maximum spatial and temporal variability in the western and northern parts of the BoB.

  6. Acid-base, optical and extraction properties of Rose Bengal in the presence of surfactants

    International Nuclear Information System (INIS)

    Lengyel, J.; Krtil, J.; Kuban, V.

    1989-01-01

    Changes in the optical and acid-base characteristics of Rose Bengal in the presence of cationic (Septones - SPX, hexadecyltrimethylammonium bromide - CTMAB and hexadecylpyridinium bromide - CPB), anionic (sodium dodecylsuulfate - SDS) and nonionic (Triton X-100) surfactants in submicellar and micellar concentrations were studied spectrophotometrically. The conditional dissociation constants of Rose Bengal pK ai * depend on the kind and concentration of cationic surfactant. Changes in pK ai * values are described in terms of formation of ion associates of the dye with the surfactant of the composition QHB and Q 2 B. The extraction constants of the ion associates in chloroform were determined radiometrically with the aid of Rose Bengal labelled with 131 I. (author). 4 figs., 3 tabs., 22 refs

  7. Tiger, Bengal and Domestic Cat Embryos Produced by Homospecific and Interspecific Zona-Free Nuclear Transfer.

    Science.gov (United States)

    Moro, L N; Jarazo, J; Buemo, C; Hiriart, M I; Sestelo, A; Salamone, D F

    2015-10-01

    The aim of this study was to evaluate three different cloning strategies in the domestic cat (Felis silvestris) and to use the most efficient to generate wild felid embryos by interspecific cloning (iSCNT) using Bengal (a hybrid formed by the cross of Felis silvestris and Prionailurus bengalensis) and tiger (Panthera tigris) donor cells. In experiment 1, zona-free (ZP-free) cloning resulted in higher fusion and expanded blastocyst rates with respect to zona included cloning techniques that involved fusion or injection of the donor cell. In experiment 2, ZP-free iSCNT and embryo aggregation (2X) were assessed. Division velocity and blastocyst rates were increased by embryo aggregation in the three species. Despite fewer tiger embryos than Bengal and cat embryos reached the blastocyst stage, Tiger 2X group increased the percentage of blastocysts with respect to Tiger 1X group (3.2% vs 12.1%, respectively). Moreover, blastocyst cell number was almost duplicated in aggregated embryos with respect to non-aggregated ones within Bengal and tiger groups (278.3 ± 61.9 vs 516.8 ± 103.6 for Bengal 1X and Bengal 2X groups, respectively; 41 vs 220 ± 60 for Tiger 1X and Tiger 2X groups, respectively). OCT4 analysis also revealed that tiger blastocysts had higher proportion of OCT4-positive cells with respect to Bengal blastocysts and cat intracytoplasmic sperm injection blastocysts. In conclusion, ZP-free cloning has improved the quality of cat embryos with respect to the other cloning techniques evaluated and was successfully applied in iSCNT complemented with embryo aggregation. © 2015 Blackwell Verlag GmbH.

  8. Diagenesis and reservoir quality of Bhuban sandstones (Neogene), Titas Gas Field, Bengal Basin, Bangladesh

    Science.gov (United States)

    Aminul Islam, M.

    2009-06-01

    This study deals with the diagenesis and reservoir quality of sandstones of the Bhuban Formation located at the Titas Gas Field of Bengal Basin. Petrographic study including XRD, CL, SEM and BSE image analysis and quantitative determination of reservoir properties were carried out for this study. The sandstones are fine to medium-grained, moderately well to well sorted subfeldspathic arenites with subordinate feldspathic and lithic arenites. The diagenetic processes include clay infiltration, compaction and cementation (quartz overgrowth, chlorite, kaolinite, calcite and minor amount of pyrite, dolomite and K-feldspar overgrowth). Quartz is the dominant pore occluding cement and generally occurred as small euhedral crystals, locally as large pyramidal crystals in the primary pores. Pressure solution derived from grain contact is the main contributor of quartz overgrowths. Chlorite occurs as pore-lining and pore filling cement. In some cases, chlorite helps to retain porosity by preventing quartz overgrowth. In some restricted depth interval, pore-occlusion by calcite cement is very much intense. Kaolinite locally developed as vermiform and accelerated the minor porosity loss due to pore-occlusion. Kaolinite/chlorite enhances ineffective microporosity. Kaolinite is a by-product of feldspar leaching in the presence of acidic fluid produced during the maturation of organic matter in the adjacent Miocene or deeper Oligocene source rocks. The relation between diagenesis and reservoir quality is as follows: the initial porosity was decreased by compaction and cementation and then increased by leaching of the metastable grains and dissolution of cement. Good quality reservoir rocks were deposited in fluvial environment and hence quality of reservoir rocks is also environment selective. Porosity and permeability data exhibit good inverse correlation with cement. However, some data points indicate multiple controls on permeability. Reservoir quality is thus controlled by

  9. Assessment of groundwater quality in Kashipur Block, Purulia district, West Bengal

    Science.gov (United States)

    Kundu, Anindita; Nag, S. K.

    2018-03-01

    Hydrogeochemical investigation of groundwater resources of Kashipur Block, Purulia district, West Bengal has been carried out to assess the water quality for domestic and irrigation uses. Twenty groundwater samples were collected and analyzed for pH, electrical conductivity, total dissolved solids, hardness, major anions (CO3 2-, HCO3 -, Cl-, SO4 2-, F-) and cations (Ca2+, Mg2+, Fe2+, Na+, K+). Study results reveal that the groundwater of the area is mostly acidic in nature. The trend amongst average ionic concentrations of cations and anions is Mg2+ > Ca2+ > Na+ > Fe2+ > K+ and Cl- > HCO3 - > CO3 2- > SO4 2- > F- respectively during the post monsoon whereas the trend for cations and anions are Mg2+ > Ca2+> Na+ > K+ > Fe and Cl- > HCO3 - > SO4 2- > F- > CO3 - in pre monsoon session, respectively. To explore the ionic toxicity of the study area, the derived parameters like sodium adsorption ratio, soluble sodium percentage, residual sodium carbonate, magnesium adsorption ratio, Kelly's ratio and permeability index were calculated. The hydro geochemical data suggest that weathering of rock forming minerals along with secondary contributions from agricultural and anthropogenic sources are mainly controlling the groundwater composition of Kashipur Block, Purulia District. According to piper diagram, water samples of most of the area of the block are fresh water and in some areas sulphate rich throughout the year. All samples are distributed to central rock dominance category. Groundwater chemistry of this block is mainly controlled by the interaction existing between the litho units and the percolating water into the subsurface domain. However, the groundwater quality and suitability of this study area can be termed as good to moderate with a few exceptions which have been encountered on a local scale.

  10. Daily temperature and precipitation extremes in the Baltic Sea region derived from the BaltAn65+ reanalysis

    Science.gov (United States)

    Toll, Velle; Post, Piia

    2018-04-01

    Daily 2-m temperature and precipitation extremes in the Baltic Sea region for the time period of 1965-2005 is studied based on data from the BaltAn65 + high resolution atmospheric reanalysis. Moreover, the ability of regional reanalysis to capture extremes is analysed by comparing the reanalysis data to gridded observations. The shortcomings in the simulation of the minimum temperatures over the northern part of the region and in the simulation of the extreme precipitation over the Scandinavian mountains in the BaltAn65+ reanalysis data are detected and analysed. Temporal trends in the temperature and precipitation extremes in the Baltic Sea region, with the largest increases in temperature and precipitation in winter, are detected based on both gridded observations and the BaltAn65+ reanalysis data. However, the reanalysis is not able to capture all of the regional trends in the extremes in the observations due to the shortcomings in the simulation of the extremes.

  11. Satellite derived trends in NO2 over the major global hotspot regions during the past decade and their inter-comparison

    International Nuclear Information System (INIS)

    Ghude, Sachin D.; Van der A, R.J.; Beig, G.; Fadnavis, S.; Polade, S.D.

    2009-01-01

    We assessed satellite derived tropospheric NO 2 distribution on a global scale and identified the major NO 2 hotspot regions. Combined GOME and SCIAMACHY measurements for the period 1996-2006 have been used to compute the trends over these regions. Our analysis shows that tropospheric NO 2 column amounts have increased over the newly and rapidly developing regions like China (11 ± 2.6%/year), south Asia (1.76 ± 1.1%/year), Middle East (2.3 ± 1%/year) and South Africa (2.4 ± 2.2%/year). Tropospheric NO 2 column amounts show some decrease over the eastern US (-2 ± 1.5%/year) and Europe (0.9 ± 2.1%/year). We found that although tropospheric NO 2 column amounts decreased over the major developed regions in the past decade, the present tropospheric NO 2 column amounts over these regions are still significantly higher than those observed over newly and rapidly developing regions (except China). Tropospheric NO 2 column amounts show some decrease over South America and Central Africa, which are major biomass burning regions in the Southern Hemisphere. - Trends in tropospheric column NO 2 over newly developing regions.

  12. DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-12-01

    Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

  13. An intrathermocline eddy and a tropical cyclone in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Gordon, A.L.; Shroyer, E.; Murty, V.S.N.

    RepoRts | 7:46218 | DOI: 10.1038/srep46218 www.nature.com/scientificreports An Intrathermocline Eddy and a tropical cyclone in the Bay of Bengal Arnold L. Gordon1, Emily Shroyer2 & V. S. N. Murty3 The Bay of Bengal, subjected to monsoonal forcing..., India. Correspondence and requests for materials should be addressed to A.L.G. (email: agordon@ldeo.columbia.edu) Received: 17 October 2016 Accepted: 13 March 2017 Published: 12 April 2017 OPEN www.nature.com/scientificreports/ 2Scientific RepoRts | 7...

  14. Lithogenic fluxes in the Bay of Bengal measured by sediment traps

    Digital Repository Service at National Institute of Oceanography (India)

    Ramaswamy, V.; VijayKumar, B.; Parthiban, G.; Ittekkot, V.; Nair, R.R.

    -Sea Research I, Vol. 44, No. 5, pp. 793410, 1997 0 1997 Elsevier Science Ltd PII: S0967-0637(96)00117-3 All tights reserved. Printed in Great Britain 09674x37/97 917.00+0.00 Lithogenic fluxes in the Bay of Bengal measured by sediment traps V. RAMASWAMY,* B... of amorphous silica in marine sediments. Journal of Sedimentary Petrology, 50, 215-225. Emmel, F. J. and Curray, J. R. (1984) The Bengal submarine fan, northeastern Indian Ocean. Geo-Marine Letters, 3, 119-124. Goldberg, E. D. and Griffin, J. J. (1970...

  15. River inputs and organic matter fluxes in the northern Bay of Bengal: Fatty acids

    Digital Repository Service at National Institute of Oceanography (India)

    Reemtsma, T.; Ittekkot, V.; Bartsch, M.; Nair, R.R

    ) 55-71 55 Elsevier Science Publishers B.V., Amsterdam \\[RA\\] River inputs and organic matter fluxes in the northern Bay of Bengal: fatty acids T. Reemtsma a, V. Ittekkot a, M. Bartsch a and R.R. Nair b alnstitut fiir Biogeochemie und Meereschemie..., R.R., 1993. River inputs and organic matter fluxes in the northern Bay of Bengal: fatty acids. Chem. Geol., 103: 55-71. Total particulate matter flux and organic carbon and fatty acid fluxes associated with settling particles collected during...

  16. Internal structure of the 85°E ridge, Bay of Bengal: Evidence for multiphase volcanism

    Digital Repository Service at National Institute of Oceanography (India)

    Ismaiel, M.; Krishna, K.S.; Srinivas, K.; Mishra, J.; Saha, D.

    fragments 3 of Elan Bank and part of the present Kerguelen Plateau (Talwani et al., 2016). As a result, age of the oceanic floor in the Western Basin of the Bay of Bengal is older than the other parts. In southeastern quarter of the Bay of Bengal... interpreted as carbonate bank (Gopala Rao et al., 1997; Karuppuswamy, 2013), therefore, we too conjecture the lens shaped reflection free zone identified on our profiles as a carbonate bank, and this may have formed when the defunct volcanic structure...

  17. Measurement of inhomogeneous activity distribution in paper chromatography using 131I-labelled rose bengal

    International Nuclear Information System (INIS)

    Strietzel, M.

    1976-01-01

    The inhomogeneous activity distribution of 131 I-labelled rose bengal after paper chromatographic separation has been evaluated. Superposing autoradiograms obtained by different exposure times on the original strip, the fraction boundaries are transferred to the latter and cut out. The cuttings are measured in an automatic sample changer under constant geometrical conditions. The methodical error ranges from 5 to 10 per cent. This method was used to test the stability of 131 I-labelled rose bengal over a period of 4 to 5 half-lives

  18. Variability in ozone and its precursor gases over the Bay of Bengal during post-monsoon

    Science.gov (United States)

    Mallik, Chinmay; Lal, Shyam; Venkataramani, Sethuram; Naja, Manish; Ojha, Narendra

    2013-04-01

    O3 and precursor gases were measured during a ship campaign over the Bay of Bengal (BoB) during 28 October -17 November, 2010. The measurements revealed the large spatial heterogeneity in trace gas levels over the BoB during post-monsoon months. The heterogeneity was attributed to unique transport patterns over north and south BoB during this period. Four distinct types of air-masses influenced by heavy pollution from nearby source regions (49% time over North-West Myanmar, East Bangladesh and North-East India), mixed type (25% time over Myanmar, Thailand and Vietnam and 75% time over East BoB), affected by long-range transport of pollutants (59% time over continental South Myanmar, Vietnam and Hong-Kong region of China) and pristine marine (99% time over oceanic regions) were identified. Among these, the continental air masses were fresher compared to marine air masses. High O3 and CO levels were observed in air masses coming from South-East Asia. O3, C4H10 and alkenes were highest in air masses arriving from eastern IGP, Bangladesh, Myanmar via the North BoB. The C2H2 to CO slope of 0.004 and C3H8 to CO slope of 0.003 indicated predominance of biofuel/biomass burning in air masses from South-East Asia. The i-C4H10 to n- C4H10 value of 0.62 indicated contributions of urban/industrial sources in air masses arriving from Bangladesh, India and North-West Myanmar. 'Potential Source Contribution Function' analysis indicated fire impacted South of Myanmar and Thailand regions as potential contributors to high CO levels above 260 ppbv measured on 14 November. Observed enhancements in surface CO during 2-3 November were attributed to the faster transport of continental pollutants associated with cyclonic winds. The O3 e-fold time of 2.3 days indicated the higher rate of O3 destruction over the BoB due to higher precursor levels. Principle component analysis indicated that transport from continental source regions played a major role in determining the chemical composition

  19. Transformation of Agricultural Land for Urbanisation, Infrastructural Development and Question of Future Food Security: Cases from Parts of Hugli District, West Bengal

    Directory of Open Access Journals (Sweden)

    Giyasuddin Siddique

    2017-11-01

    Full Text Available Developing countries of the world encounter urbanisation and infrastructural development in or around the fertile tracts and the absence of any landuse plan for desired land use change has led to conversion of farmlands, which is detrimental to future food security and environmental quality. Hugli district is traditionally well known as one of the most prosperous agricultural regions of West Bengal but the district is experiencing rapid urban extension and infrastructural development towards productive agricultural land since 1991. This has caused decline in the amount of agricultural production which may be treated as an indicator of increasing threat to the long run sustainable livelihood security of the people of the whole of West Bengal. This article critically explores the transformation of agricultural (farm land because of growing rate of urbanisation and infrastructural development, which in turn poses the question of threat to food (in security. Although, this is a growing problem across the universe, this article probes the future food security questions of Hugli district, West Bengal by examining the impact of the highly intertwined indicators of urbanisation and infrastructural development on agricultural (farm land use and its effect on food security. Regression analysis, Spearman’s Ranking Correlation Coefficient, Remote Sensing technologies, Markov Chain Model, Projection of future population growth and yield rate are employed to understand the depth of the problem. The result not only shows a direct negative correlation between urban extension and agricultural areal contraction but also the supervised classification of satellite imageries shows that there is rapid change of rural land use from 1996-2016. There is no match between future population growth and future yield rate of crops and the Markov Chain Model further predicts that the cropland will decrease from 62.77% to 42.90% and the built up area will increase from 31

  20. A recurrent human papillomavirus integration site at chromosome region 12q14-q15 in SW756 and SK-v cell lines derived from genital tumors

    International Nuclear Information System (INIS)

    Sastre-Garau, X.; Couturier, J.; Favre, M.; Orth, G.

    1995-01-01

    The SW756 cell line, derived from an invasive cancer of the uterine cervix, harbours integrated human papillomavirus (HPV) 18 DNA sequences which have been located in chromosome band 12q13. By in situ hybridization experiments with tritiated and digoxigenin-labelled HPV18 probes on R-banded chromosomes, we now localize the integrated viral sequences in 12q14-q15. Interestingly, we have previously localized integrated HPV16 sequences in the same chromosomal region in SK-v cells, derived from a pre-invasive vulvar neoplasia. The chromosomal region 12q14-q15 could thus correspond to a preferential site for the integration of HPV DNA in genital tumors. (authors). 29 refs., 2 figs

  1. Recent Regional Climate State and Change - Derived through Downscaling Homogeneous Large-scale Components of Re-analyses

    Science.gov (United States)

    Von Storch, H.; Klehmet, K.; Geyer, B.; Li, D.; Schubert-Frisius, M.; Tim, N.; Zorita, E.

    2015-12-01

    Global re-analyses suffer from inhomogeneities, as they process data from networks under development. However, the large-scale component of such re-analyses is mostly homogeneous; additional observational data add in most cases to a better description of regional details and less so on large-scale states. Therefore, the concept of downscaling may be applied to homogeneously complementing the large-scale state of the re-analyses with regional detail - wherever the condition of homogeneity of the large-scales is fulfilled. Technically this can be done by using a regional climate model, or a global climate model, which is constrained on the large scale by spectral nudging. This approach has been developed and tested for the region of Europe, and a skillful representation of regional risks - in particular marine risks - was identified. While the data density in Europe is considerably better than in most other regions of the world, even here insufficient spatial and temporal coverage is limiting risk assessments. Therefore, downscaled data-sets are frequently used by off-shore industries. We have run this system also in regions with reduced or absent data coverage, such as the Lena catchment in Siberia, in the Yellow Sea/Bo Hai region in East Asia, in Namibia and the adjacent Atlantic Ocean. Also a global (large scale constrained) simulation has been. It turns out that spatially detailed reconstruction of the state and change of climate in the three to six decades is doable for any region of the world.The different data sets are archived and may freely by used for scientific purposes. Of course, before application, a careful analysis of the quality for the intended application is needed, as sometimes unexpected changes in the quality of the description of large-scale driving states prevail.

  2. Antimelanoma CTL recognizes peptides derived from an ORF transcribed from the antisense strand of the 3′ untranslated region of TRIT1

    Directory of Open Access Journals (Sweden)

    Rolf K Swoboda

    2014-01-01

    Full Text Available Noncoding regions of the genome play an important role in tumorigenesis of cancer. Using expression cloning, we have identified a cytotoxic T lymphocyte (CTL–defined antigen that recognizes a protein sequence derived from an open reading frame transcribed from the reverse strand in the 3′ untranslated region of tRNA isopentenyltransferase 1 (TRIT1. A peptide derived from this open reading frame (ORF sequence and predicted to bind to HLA-B57, sensitized HLA-B57+ tumor cells to lysis by CTL793. The peptide also induced a CTL response in peripheral blood mononuclear cells (PBMC of patient 793 and in two other melanoma patients. The CTL lysed peptide-pulsed HLA-B57+ target cells and melanoma cells with endogenous antigen expression. The recognition of this antigen is not limited to HLA-B57-restricted CTLs. An HLA-A2 peptide derived from the ORF was able to induce CTLs in PBMC of 2 HLA-A2+ patients. This study describes for the first time a CTL-defined melanoma antigen that is derived from an ORF on the reverse strand of the putative tumor suppressor gene TRIT1. This antigen has potential use as a vaccine or its ability to induce CTLs in vitro could be used as a predictive biomarker.

  3. Study of Sea Surface Temperatures changes due to tropical cyclone fanoos in the southwest Bay of Bengal using satellite and argo observations

    Science.gov (United States)

    Krishna Kailasam, Muni

    Sea surface temperature (SST) plays an important role in the studies of global climate system and as a boundary condition for operational numerical forecasts. Estimation of SST has tra-ditionally been performed with satellite based sensors operating in the infrared (IR) portion of the electromagnetic spectrum, where the ocean emissivity is close to unity. The National Oceanic and Atmospheric Administration (NOAA) satellite series, the GOES Imagers on the Geostationary Operational Environmental Satellites, the Along Track Scanning Radiometer (ATSR) on the European Remote Sensing satellites and the Moderate Resolution Imaging Spectroradiometer (MODIS) on the NASA EOS platform are successful examples of IR sen-sors currently used for operational SST retrievals. Significant progress in SST retrieval from remote sensing data came with the introduction of a new low-frequency channel (10.7 GHz) on microwave (MW) sensors. The anthropogenic effects over a period of time resulted in increase of infrared absorbers such as greenhouse gases and absorbing aerosol would produce increase of both daytime maximum and nighttime minimum temperatures. In contrast, the increases of visible reflectors such as sulfate aerosols and low cloud amount would result in a decrease of the daytime maximum temperature. Solar radiation, wind stress and vertical mixing are known to be the three major factors impacting the SST seasonal variations. In the present study, impact of absorbing aerosols on the sea surface temperature (SST) over Bay of Bengal (BoB) region was investigated. Increased aerosol loading over BoB was observed due to advection of aerosols from continental region consisting of absorbing particles primarily from dust and biomass burning. This increased loading over BoB resulted in reduction of surface reaching solar radiation. Tropical Rainfall Measuring Mission (TRMM) Microwave Imager (TMI) de-rived SST over BoB showed negative correlation with OMI-Aerosol Index (AI) (R = 0.87) and

  4. Hydroclimatic influences on seasonal and spatial cholera transmission cycles: Implications for public health intervention in the Bengal Delta

    Science.gov (United States)

    Akanda, Ali Shafqat; Jutla, Antarpreet S.; Alam, Munirul; de Magny, Guillaume Constantin; Siddique, A. Kasem; Sack, R. Bradley; Huq, Anwar; Colwell, Rita R.; Islam, Shafiqul

    2011-03-01

    Cholera remains a major public health threat in many developing countries around the world. The striking seasonality and annual recurrence of this infectious disease in endemic areas remain of considerable interest to scientists and public health workers. Despite major advances in the ecological and microbiological understanding of Vibrio cholerae, the causative agent of the disease, the role of underlying large-scale hydroclimatic processes in propagating the disease for different seasons and spatial locations is not well understood. Here we show that the cholera outbreaks in the Bengal Delta region are propagated from the coastal to the inland areas and from spring to fall by two distinctly different transmission cycles, premonsoon and postmonsoon, influenced by coastal and terrestrial hydroclimatic processes, respectively. A coupled analysis of the regional hydroclimate and cholera incidence reveals a strong association of the space-time variability of incidence peaks with seasonal processes and extreme climatic events. We explain how the asymmetric seasonal hydroclimatology affects regional cholera dynamics by providing a coastal growth environment for bacteria in spring, while propagating the disease to fall by monsoon flooding. Our findings may serve as the basis for "climate-informed" early warnings and for prompting effective means for intervention and preempting epidemic cholera outbreaks in vulnerable regions.

  5. Dynamic Response of Satellite-Derived Vegetation Growth to Climate Change in the Three North Shelter Forest Region in China

    Directory of Open Access Journals (Sweden)

    Bin He

    2015-08-01

    Full Text Available Since the late 1970s, the Chinese government has initiated ecological restoration programs in the Three North Shelter Forest System Project (TNSFSP area. Whether accelerated climate change will help or hinder these efforts is still poorly understood. Using the updated and extended AVHRR NDVI3g dataset from 1982 to 2011 and corresponding climatic data, we investigated vegetation variations in response to climate change. The results showed that the overall state of vegetation in the study region has improved over the past three decades. Vegetation cover significantly decreased in 23.1% and significantly increased in 21.8% of the study area. An increase in all three main vegetation types (forest, grassland, and cropland was observed, but the trend was only statistically significant in cropland. In addition, bare and sparsely vegetated areas, mainly located in the western part of the study area, have significantly expanded since the early 2000s. A moisture condition analysis indicated that the study area experienced significant climate variations, with warm-wet conditions in the western region and warm-dry conditions in the eastern region. Correlation analysis showed that variations in the Normalized Difference Vegetation Index (NDVI were positively correlated with precipitation and negatively correlated with temperature. Ultimately, climate change influenced vegetation growth by controlling the availability of soil moisture. Further investigation suggested that the positive impacts of precipitation on NDVI have weakened in the study region, whereas the negative impacts from temperature have been enhanced in the eastern study area. However, over recent years, the negative temperature impacts have been converted to positive impacts in the western region. Considering the variations in the relationship between NDVI and climatic variables, the warm–dry climate in the eastern region is likely harmful to vegetation growth, whereas the warm

  6. Prospecting Russula senecis: a delicacy among the tribes of West Bengal

    Directory of Open Access Journals (Sweden)

    Somanjana Khatua

    2015-03-01

    Full Text Available Russula senecis, a worldwide distributed mushroom, is exclusively popular among the tribal communities of West Bengal for food purposes. The present study focuses on its reliable taxonomic identification through macro- and micro-morphological features, DNA barcoding, confirmation of its systematic placement by phylogenetic analyses, myco-chemicals and functional activities. For the first time, the complete Internal Transcribed Spacer region of R. senecis has been sequenced and its taxonomic position within subsection Foetentinae under series Ingratae of the subgen. Ingratula is confirmed through phylogenetic analysis. For exploration of its medicinal properties, dried basidiocarps were subjected for preparation of a heat stable phenol rich extract (RusePre using water and ethanol as solvent system. The antioxidant activity was evaluated through hydroxyl radical scavenging (EC50 5 µg/ml, chelating ability of ferrous ion (EC50 0.158 mg/ml, DPPH radical scavenging (EC50 1.34 mg/ml, reducing power (EC50 2.495 mg/ml and total antioxidant activity methods (13.44 µg ascorbic acid equivalent/mg of extract. RusePre exhibited antimicrobial potentiality against Listeria monocytogenes, Bacillus subtilis, Pseudomonas aeruginosa and Staphylococcus aureus. Furthermore, different parameters were tested to investigate its chemical composition, which revealed the presence of appreciable quantity of phenolic compounds, along with carotenoids and ascorbic acid. HPLC-UV fingerprint indicated the probable existence of at least 13 phenolics, of which 10 were identified (pyrogallol > kaempferol > quercetin > chlorogenic acid > ferulic acid, cinnamic acid > vanillic acid > salicylic acid > p-coumaric acid > gallic acid. Result from the present work suggests that the fraction, RusePre, may open novel prospect as a functional ingredient in antioxidant supplements and in drugs to treat infectious disease.

  7. Composition, diversity and foraging guilds of avifauna in a suburban area of southern West Bengal, India

    Directory of Open Access Journals (Sweden)

    Mukhopadhyay Shiladitya

    2017-12-01

    Full Text Available Avian communities are very good indicators of any ecosystem. Despite the alarming consequences of rapid urbanization, studies of avian diversity in the human-dominated landscapes of India are very few. Therefore, we studied the avian assemblage of Bongaon in southern West Bengal, India, a suburban area whose avifauna has thus far remained undocumented. Bird surveys were carried out from June 2015 to May 2016, following the fixed-radius (25 m point count method together with opportunistic observations. We recorded 119 avian species belonging to 53 families. Ardeidae was the most diverse avian family in the study area (RDi value = 5.882. Among the recorded avifauna, 89 species were resident, 26 species were winter visitors, three species were summer visitors, and one species was a passage migrant. Species richness of the resident and passage migrant species did not vary seasonally, while the winter and summer visitors displayed significant seasonal variation. In this suburban area, the species richness of feeding guilds varied significantly. Most birds were insectivorous (41.2%, followed by carnivorous (24.4%, omnivorous (18.5%, granivorous (7.6%, frugivorous (3.4%, nectarivorous (3.4% and herbivorous species (1.7%. Maximum species richness was recorded in November and minimum species richness in July. Black-headed Ibis Threskiornis melanocephalus and Alexandrine Parakeet Psittacula eupatria are two near-threatened species found in this region. Interestingly, six species having a globally declining trend are still very common in the study area. Long-term studies are required to monitor any change in the avian communities of this suburban landscape resulting from urbanization.

  8. Lessons Learned From Developing a Sustainable Arsenic-Safe Water Program in West Bengal, India Over a Period of Eight Years

    Science.gov (United States)

    Smith, M. M.; Liaw, J.; Hira, A.; Guha, P.; Pal, S. S.; Hore, T.; Smith, A. H.

    2010-12-01

    Arsenic is a carcinogen, and causes many cancers and noncancer diseases. Recent findings have shown that exposure to arsenic in drinking water as a child or before birth can cause illness and death even as an adult. In the West Bengal region of India, more than six million people are drinking crystal clear but arsenic-contaminated water from tubewells. Project Well, a non-profit organization based in California, has provided safe drinking water to villages in West Bengal since 2001 through modern modified dugwells, currently numbering 163. Along the way, Project Well has faced the challenge of persuading people to stop consuming good-tasting, arsenic-laced water and instead drink chlorinated water, which is safe but may have the smell of chlorine. Additionally, West Bengal receives abundant annual rainfall, and hence it is difficult to convince people to pay for treated water. From its inception, the Project Well program was set up with a tracking system to assess the efficacy of the modern dugwells, which has helped identify where technical improvements were needed. Continuous interaction with community-based user groups has also helped overcome many constraints and make the program sustainable. Project Well monitoring records from August 2010 show that out of 163 modern dugwells, 48 percent were being used, providing water for 2948 villagers; 23 percent were closed; 6 percent were dry (11 districts of West Bengal were in a drought); 6 percent required maintenance; and 7 percent were not used. Arsenic concentrations in the modern dugwells were measured every year during peak season when the water table was low and the median arsenic concentration of operational dugwells over the eight years between 2002 and 2010 was 15 ppb (the permissible limit in India is 50 ppb). Each year, about 6 to 10 percent of the dugwells have arsenic levels above 50 ppb during the summer season, when the water level is low. Bacterial counts, i.e., total coliform and fecal coliform, are

  9. Accuracy Assessment of Lidar-Derived Digital Terrain Model (dtm) with Different Slope and Canopy Cover in Tropical Forest Region

    Science.gov (United States)

    Salleh, M. R. M.; Ismail, Z.; Rahman, M. Z. A.

    2015-10-01

    Airborne Light Detection and Ranging (LiDAR) technology has been widely used recent years especially in generating high accuracy of Digital Terrain Model (DTM). High density and good quality of airborne LiDAR data promises a high quality of DTM. This study focussing on the analysing the error associated with the density of vegetation cover (canopy cover) and terrain slope in a LiDAR derived-DTM value in a tropical forest environment in Bentong, State of Pahang, Malaysia. Airborne LiDAR data were collected can be consider as low density captured by Reigl system mounted on an aircraft. The ground filtering procedure use adaptive triangulation irregular network (ATIN) algorithm technique in producing ground points. Next, the ground control points (GCPs) used in generating the reference DTM and these DTM was used for slope classification and the point clouds belong to non-ground are then used in determining the relative percentage of canopy cover. The results show that terrain slope has high correlation for both study area (0.993 and 0.870) with the RMSE of the LiDAR-derived DTM. This is similar to canopy cover where high value of correlation (0.989 and 0.924) obtained. This indicates that the accuracy of airborne LiDAR-derived DTM is significantly affected by terrain slope and canopy caver of study area.

  10. ACCURACY ASSESSMENT OF LIDAR-DERIVED DIGITAL TERRAIN MODEL (DTM WITH DIFFERENT SLOPE AND CANOPY COVER IN TROPICAL FOREST REGION

    Directory of Open Access Journals (Sweden)

    M. R. M. Salleh

    2015-10-01

    Full Text Available Airborne Light Detection and Ranging (LiDAR technology has been widely used recent years especially in generating high accuracy of Digital Terrain Model (DTM. High density and good quality of airborne LiDAR data promises a high quality of DTM. This study focussing on the analysing the error associated with the density of vegetation cover (canopy cover and terrain slope in a LiDAR derived-DTM value in a tropical forest environment in Bentong, State of Pahang, Malaysia. Airborne LiDAR data were collected can be consider as low density captured by Reigl system mounted on an aircraft. The ground filtering procedure use adaptive triangulation irregular network (ATIN algorithm technique in producing ground points. Next, the ground control points (GCPs used in generating the reference DTM and these DTM was used for slope classification and the point clouds belong to non-ground are then used in determining the relative percentage of canopy cover. The results show that terrain slope has high correlation for both study area (0.993 and 0.870 with the RMSE of the LiDAR-derived DTM. This is similar to canopy cover where high value of correlation (0.989 and 0.924 obtained. This indicates that the accuracy of airborne LiDAR-derived DTM is significantly affected by terrain slope and canopy caver of study area.

  11. Desenvolvimento do fruto da lichieira (Litchi chinensis Sonn. 'Bengal' Fruit development in 'Bengal' litchi (Litchi chinensis Sonn.

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Chamhum Salomão

    2006-04-01

    Full Text Available Estudou-se o desenvolvimento do fruto da lichieira (Litchi chinensis Sonn. 'Bengal'. Realizaram-se amostragens semanais, com início aos 35 dias após a antese e término no início da senescência dos frutos. A partir do 77º dia após a antese, os frutos foram decompostos em pericarpo, semente e arilo. A antese ocorreu na primeira semana de setembro. Foram ajustados modelos sigmoidais simples para acúmulo de matéria seca, comprimento e diâmetro. Para o acúmulo de matéria seca, uma fase inicial, de crescimento lento, prolongou-se até o 63º dia após a antese e coincidiu com um período de intensa queda natural de frutos. Do 63º ao 98º dia após a antese, houve uma fase de rápido acúmulo de matéria seca. Até o 77º dia, pericarpo e semente foram os principais responsáveis pelo acúmulo de matéria seca. Oitenta e oito por cento do comprimento e 65% do diâmetro máximos foram atingidos nesse período. Do 84º ao 98º dia após a antese, o desenvolvimento do fruto foi determinado basicamente pelo arilo. As dimensões e a matéria seca do fruto estabilizaram-se a partir do 98º dia após a antese. O ponto de colheita comercial dos frutos, caracterizado pela coloração avermelhada do pericarpo, ocorreu a partir do 112º dia após a antese. Verificou-se um quadro senescente nos frutos a partir do 119º dia após a antese.It was studied the fruit development in 'Bengal' litchi (Litchi chinensis Sonn.. The samples were taken weekly 35 days after anthesis until the beginning of fruit senescence. From the 77th day after anthesis, fruits were decomposed in pericarp, aril and seed. Anthesis occurred in the first week of September. The fruit dry matter, length and diameter followed a single-sigmoid pattern. For dry matter accumulation, an initial phase, of slow growth, ended the 63rd day after anthesis and was coincident with a period of intense fruit drop. The next phase occurred from the 63rd to the 98th day and showed a rapid dry matter

  12. Rose Bengal- and Riboflavin-Mediated Photodynamic Therapy to Inhibit Methicillin-Resistant Staphylococcus aureus Keratitis Isolates.

    Science.gov (United States)

    Halili, Francisco; Arboleda, Alejandro; Durkee, Heather; Taneja, Mukesh; Miller, Darlene; Alawa, Karam A; Aguilar, Mariela C; Amescua, Guillermo; Flynn, Harry W; Parel, Jean-Marie

    2016-06-01

    To evaluate the in vitro efficacy of rose bengal- and riboflavin-mediated photodynamic therapy for inhibition of methicillin-resistant Staphylococcus aureus (MRSA) isolates. Experimental study. Two different multidrug-resistant, clinical MRSA isolates were grown on nutrient agar, prepared in suspension, and adjusted to concentrations of 1.5 × 10(4) colony-forming units per milliliter. Bacterial suspensions were mixed with rose bengal, riboflavin, or water according to experimental group. Tested in triplicate, groups included: Group I, MRSA control; Group II, MRSA with 0.1% rose bengal; Group III, MRSA with 0.03% rose bengal; and Group IV, MRSA with 0.1% riboflavin. All experimental groups were exposed to 3 lighting conditions: dark, ambient room light for 30 minutes, and 5.4 J/cm(2) with either green light-emitting diode (LED) or ultraviolet-A (UV-A) irradiation. Plates were photographed at 72 hours and custom software measured bacterial growth inhibition. Complete growth inhibition of both MRSA strains was demonstrated (1) for both rose bengal concentrations under ambient and green LED irradiation, and (2) for the 0.1% rose bengal in the dark. The 0.03% rose bengal in dark conditions showed complete inhibition of strain 2 but incomplete inhibition of strain 1. Riboflavin showed almost complete inhibition with UV-A irradiation but demonstrated minimal inhibition for both strains in dark and ambient light conditions. Rose bengal- and riboflavin-mediated photodynamic therapy demonstrated complete growth inhibition in vitro of 2 multidrug-resistant MRSA strains. Rose bengal was also effective in dark and ambient conditions. These results may have implications for in vivo therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Monitoring groundwater storage changes in the highly seasonal humid tropics: Validation of GRACE measurements in the Bengal Basin

    Science.gov (United States)

    Shamsudduha, M.; Taylor, R. G.; Longuevergne, L.

    2012-02-01

    Satellite monitoring of changes in terrestrial water storage provides invaluable information regarding the basin-scale dynamics of hydrological systems where ground-based records are limited. In the Bengal Basin of Bangladesh, we test the ability of satellite measurements under the Gravity Recovery and Climate Experiment (GRACE) to trace both the seasonality and trend in groundwater storage associated with intensive groundwater abstraction for dry-season irrigation and wet-season (monsoonal) recharge. We show that GRACE (CSR, GRGS) datasets of recent (2003 to 2007) groundwater storage changes (ΔGWS) correlate well (r = 0.77 to 0.93, p value CSR. Changes in surface water storage estimated from a network of 298 river gauging stations and soil-moisture derived from Land Surface Models explain 22% and 33% of ΔTWS, respectively. Groundwater depletion estimated from borehole hydrographs (-0.52 ± 0.30 km3 yr-1) is within the range of satellite-derived estimates (-0.44 to -2.04 km3 yr-1) that result from uncertainty associated with the simulation of soil moisture (CLM, NOAH, VIC) and GRACE signal-processing techniques. Recent (2003 to 2007) estimates of groundwater depletion are substantially greater than long-term (1985 to 2007) mean (-0.21 ± 0.03 km3 yr-1) and are explained primarily by substantial increases in groundwater abstraction for the dry-season irrigation and public water supplies over the last two decades.

  14. Seasonal variability of Internal tide energetics in the western Bay of Bengal

    Science.gov (United States)

    Mohanty, S.; Rao, A. D.

    2017-12-01

    The Internal Waves (IWs) are generated by the flow of barotropic tide over the rapidly varying and steep topographic features like continental shelf slope, seamounts, etc. These waves are an important phenomena in the ocean due to their influence on the density structure and energy transfer into the region. Such waves are also important in submarine acoustics, underwater navigation, offshore structures, ocean mixing and biogeochemical processes, etc. over the shelf-slope region. The seasonal variability of internal tides in the western Bay of Bengal is examined by using three-dimensional MITgcm model. The numerical simulations are performed for different periods covering August-September, 2013; November-December, 2013 and March-April, 2014 representing monsoon, post-monsoon and pre-monsoon seasons respectively during which high temporal resolution observed data sets are available. The model is initially validated through the spectral estimate of density and the baroclinic velocities. From the estimate, it is found that its peak is associated with the semi-diurnal frequency at all the depths in both observations and model simulations for November-December and March-April. However in August, the estimate is found to be maximum near the inertial frequency at all available depths. EOF analysis suggests that about 70-80% of the total variance comes from Mode-1 semi-diurnal internal tide in both observations as well as in the model simulations. The phase speed, group speed and wavelength are found to be maximum for post-monsoon season compared to other two seasons. To understand the generation and propagation of internal tides over this region, barotropic-to-baroclinic M2 tidal energy conversion and energy flux are examined. The barotropic-to-baroclinic conversion occurs intensively along the shelf-slope regions and propagate towards the coast. The model simulated energy dissipation rate infers that its maximum occurs at the generation sites and hence the local mixing

  15. Meso-scale atmospheric events promote phytoplankton blooms in the coastal Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Maneesha, K.; Sarma, V.V.S.S.; Reddy, N.P.C.; Sadhuram, Y.; Murty, T.V.R.; Sarma, V.V.; DileepKumar, M.

    mixing does not cool SST in the post monsoon north Bay of Bengal; Atmos. Sci. Letts. 9 1–6. Senjyu T and Watanabe T 1999 A sudden temperature decrease along the Sanin coast induced by a typhoon; Umi to Sora 75 1–8 (in Japanese with English abstract...

  16. Colorectal Cancer: A Study of Risk Factors in a Tertiary Care Hospital of North Bengal

    OpenAIRE

    Bhattacharya, Sumanta; Bhattacharya, Saikat; Basu, Rivu; Bera, Pranati; Halder, Aniket

    2014-01-01

    Aim: Age, sex, living place (urban or rural), smoking, alcohol consumption, dietary pattern, obesity are considered as risk factors for Colorectal cancer. Our study was done to evaluate the association between these risk factors and colorectal cancer in the population of North Bengal.

  17. The Political Economy of English Education in Muslim Bengal: 1871-1912.

    Science.gov (United States)

    Rahim, Aminur

    1992-01-01

    Examines explanations for lack of progress by Muslims in English education in East Bengal, colonial British India (now Bangladesh). Argues that urban-based, elitist English education failed to provide opportunities to rural Muslim farmers, and that, after the British formulated educational policies meeting Muslim needs, that community responded…

  18. The movement and implications of the Ganges-Bramhaputra runoff on entering the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Shetye, S.R.

    The Ganges-Brahmaputra rivers discharge annually approximately 10 sup(2) m sup(3) of freshwater into the Bay of Bengal at its northern end. We propose that the spread of this water, accompaniEd. by mixing with the ambient waters, occurs in three...

  19. Iodate in inshore and offshore waters of Central Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, V.V.

    Biological stripping of iodate in the surface waters is noticed in the inshore and offshore waters of Bay of Bengal. A good correlation is observed between iodate and phosphate and nitrate and the molar ratios determined being NO3: PO4: IO3 = 88...

  20. Dissolved petroleum hydrocarbons along the oil tanker route in the southern Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Topgi, R; Noronha, R; Fondekar, S.P.; SenGupta, R

    Concentrations of dissolved petroleum hydrocarbons during 3 cruises (Nos. 51, 66 and 68) of R V Gaveshani, along the oil tanker route, in the southern Bay of Bengal at 0, 10 and 20 m were 19.95 + or - 3.38, 16.78 + or - 2.53 and 13.45 + or - 2.17 mu...

  1. Visible lights induced polymerization reactions: interactions between rose bengal and iron aren complex

    International Nuclear Information System (INIS)

    Burget, D.; Grotzinger, C.; Jacques, P.; Fouassier, J.P.

    1999-01-01

    The present paper is devoted to an investigation of the interactions between Rose Bengal (RB) and an Iron aren (Irg(+)) complex that are usable in visible light induced polymerization reactions. Steady state and flash photolysis experiments were performed in order to elucidate the nature of the intermediates formed after light excitation. A complete scheme of evolution of the excited states is discussed

  2. N2 production rates limited by nitrite availability in the Bay of Bengal oxygen minimum zone

    DEFF Research Database (Denmark)

    Bristow, Laura A.; Callbeck, C. M.; Larsen, M

    2017-01-01

    with isotopically labelled nitrogen compounds and analyse geochemical signatures of these processes in the water column. We find that the Bay of Bengal supports denitrifier and anammox microbial populations, mediating low, but significant N loss. Yet, unlike other oxygen minimum zones, our measurements using...

  3. Filamentous fungal population and species diversity from the continental slope of Bay of Bengal, India

    Science.gov (United States)

    Das, Surajit; Lyla, Parameswari Somasundharan; Khan, Syed Ajmal

    2009-03-01

    Filamentous fungal diversity from the sediments of the continental slope of Bay of Bengal was studied. Sediment samples were collected during two voyages in 2004 and 2005. Filamentous fungal population from both the cruises showed a range of 5.17-59.51 CFU/g and 3.47-29.68 CFU/g, respectively. Totally 16 fungal genera were recorded from both the cruises. Aspergillus was found to be the dominant genus and the overall percentage occurrence was as follows: Deuteromycotina 74%, Ascomycotina 17%, Basidiomycotina 4% and non-sporulating 5%. Diversity indices were calculated and during both the cruises species richness ( d) varied from 0.912 to 3.622 and 1.443 to 4.588; evenness ( J') varied from 0.9183 to 1.000 and 0.8322 to 1.000 and Shannon-Wiener index ( H' log 2) varied from 0.9183 to 1.000 and 1.000 to 3.690. The higher diversity was found in Divipoint transect (northern Bay of Bengal). 95% confidence interval and ellipse showed that the stations were well lying within the funnel. Cluster analysis and MDS grouped the northern transects which showed higher diversity. BVSTEP resulted in isolation of 23 species which were most influential in the marine filamentous fungal diversity of the continental slope of Bay of Bengal. Thus, a lower population range and higher diversity of marine filamentous marine fungi in the sediments of the continental slope of Bay of Bengal was recorded.

  4. Long-chain alkaenone unsaturation index as sea surface temperature proxy in southwest Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, N.S.; Pasha, S.K.G.; SriRamKrishna, M.; Shirodkar, P.V.; Yadava, M.G.; Rao, K.M.

    As a proxy of the sea surface temperature (SST), C sub(37) long-chain alkenones (LCAs) preserved in sediments of the southwestern Bay of Bengal and dating back to the last glacial period, were identified in SIM GC-EI MS spectra run at m/z 530...

  5. Evidences of climatic variations during Late Pleistocene- Holocene in the eastern Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O.S; Borole, D.V.; Gujar, A; Mascarenhas, A; Mislankar, P.G.; Rao, Ch.M.

    Based upon the variations of clay minerals, sediment texture, heavy mineral assemblage and sup(230)Th excess in the Late Pleistocene sediments of a hemipelagic core from the eastern Bay of Bengal (2713 m water depth), 35 cm and 73-78 cm levels...

  6. A modeling study of the processes of surface salinity seasonal cycle in the Bay of Bengal.

    Digital Repository Service at National Institute of Oceanography (India)

    Akhil, V.P.; Durand, F.; Lengaigne, M.; Vialard, J.; Keerthi, M.G.; Gopalakrishna, V.V.; Deltel, C.; Papa, F.; Montegut, C.deB.

    of Science, Bangalore, India, 5LOS, IFREMER, Plouzan�e, France Abstract In response to the Indian Monsoon freshwater forcing, the Bay of Bengal exhibits a very strong seasonal cycle in sea surface salinity (SSS), especially near the mouths of the Ganges...

  7. Inter- and intra-annual variations in the population of Tripos from the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Chitari, R.R.; Anil, A.C.; Kulkarni, V.V.; Narale, D.D.; Patil, J.S.

    -K transect. In the C-P transect high numbers of T. furca can be attributed to mesoscale eddies, whereas in the P-K transect, it can be attributed to riverine discharge. The results point that, Tripos persists throughout the year in the Bay of Bengal and tend...

  8. Upper ocean variability in the Bay of Bengal during the tropical cyclones Nargis and Laila

    Digital Repository Service at National Institute of Oceanography (India)

    Maneesha, K.; Murty, V.S.N.; Ravichandran, M.; Lee, T.; Yu, W.; McPhaden, M.J.

    -monsoon north Bay of Bengal, Atmos. Sci. Let. Doi:10.1002/asl.162. Shay, L.K., G.J.Goni and P.G. Black (2000) , Effects of warm oceanic features on hurricane opal, Mon.Wea.Rev., 128, 1366-1383 Subrahmanyam, B., V.S.N. Murty, Ryan J. Sharp and James J...

  9. Trace metal dynamics in zooplankton from the Bay of Bengal during summer monsoon

    Digital Repository Service at National Institute of Oceanography (India)

    Rejomon, G.; DineshKumar, P.K.; Nair, M.; Muraleedharan, K.R.

    Trace metal (Fe, Co, Ni, Cu, Zn, Cd, and Pb) concentrations in zooplankton from the mixed layer were investigated at 8 coastal and 20 offshore stations in the western Bay of Bengal during the summer monsoon of 2003. The ecotoxicological importance...

  10. Enhanced abundance of tintinnids under elevated CO2 level from coastal Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Biswas, H.; Gadi, S.D.; Venkataramana, V.; Bharathi, M.D.; Priyan, R.K.; Manjari, D.T.; DileepKumar, M.

    of marine plankton to increasing CO2 concentrations. Natural water samples from the coastal Bay of Bengal were incubated under the ambient condition and high CO2 levels (703-711 latm) for 5 days in May and June 2010. A significant negative correlation...

  11. Diurnal variability of surface fluxes at an oceanic station in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, Y.V.B.; Rao, D.P.

    Diurnal variability of the surface fluxes and ocean heat content was studied using the time-series data on marine surface meteorological parameters and upper ocean temperature collected at an oceanic station in the Bay of Bengal during 1st to 8th...

  12. Numerical model for wind-driven circulation in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Bahulayan, N.; Varadachari, V.V.R.

    Wind-driven circulation in the Bay of Bengal, generated by a southwest wind of constant speed (10 m.sec -1) and direction (225 degrees TN), is presented. A non-linear hydrodynamic model is used for the simulation of circulation. Numerical...

  13. Chemical absorption of acoustic energy due to an eddy in the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Navelkar, G.S.; Murty, T.V.R.; Somayajulu, Y.K.; Murty, C.S.

    Acoustic energy losses due to chemical absorption, within the western Bay of Bengal, in the presence of a subsurface meso-scale cold core eddy has been analysed. These estimates, for two different frequencies - 400 Hz and 10 kHz, find applications...

  14. Energy and generating mechanism of a subsurface, cold core eddy in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Babu, M.T.; Rao, D.P.

    Computation of available potential energy (APE) of a recently observed cold core, subsurface eddy (centered at 17 degrees 40'N and 85 degrees 19'E) in the Bay of Bengal revealed that the energy maxima associated with the eddy was of the order of 1...

  15. Trace metal concentrations in zooplankton from the eastern Arabian Sea and western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Rejomon, G.; Balachandran, K.K.; Nair, M.; Joseph, T.; DineshKumar, P.K.; Achuthankutty, C.T.; Nair, K.K.C.; Pillai, N.G.K.

    Trace metal contents in zooplankton samples were estimated as a part of the Marine Research-Living Resource program at 24 stations in the Bay of Bengal (November, 2002) and 29 stations in the Arabian Sea (September-October, 2003) during the Cruises...

  16. Seasonal wave characteristics of the Arabian Sea and the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Vijayarajan, P.K.; Varkey, M.J.; Joseph, M.X.

    of charts. The maxima of the average heights in both the Arabian Sea and the Bay of Bengal (3.2 m and 3.1 m) have been observed during the monsoon season even though the number of cyclone and depression days were maximum in May and November, respectively...

  17. Changing sedimentary environment during the late Quaternary: Sedimentological and isotopic evidence from the distal Bengal Fan

    Digital Repository Service at National Institute of Oceanography (India)

    Kessarkar, P.M.; Rao, V.P.; Ahmad, S.M.; Patil, S.K.; AnilKumar, A.; AnilBabu, G.; Chakraborty, S.; SounderRajan, R

    The sediments recovered from two gravity cores of the lower and distal Bengal Fan were investigated for sedimentological properties and Sr -Nd isotopes.Each core exhibits two distinct units, the lower unit 2 and upper unit 1 sediments. The unit 2...

  18. Mixed layer variability and chlorophyll a biomass in the Bay of Bengal.

    Digital Repository Service at National Institute of Oceanography (India)

    Narvekar, J.; PrasannaKumar, S.

    , the chlorophyll biomass decreases rapidly due to reduction in sunlight by suspended sediment. In the south, advection of high salinity waters from the Arabian Sea and westward propagating Rossby waves from the eastern Bay of Bengal led to the formation of deep...

  19. Lithosphere structure and upper mantle characteristics below the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, G.S.; Radhakrishna, M.; Sreejith, K.M.; Krishna, K.S.; Bull, J.M.

    The oceanic lithosphere in the Bay of Bengal (BOB) formed 80-120 Ma following the breakup of eastern Gondwanaland. Since its formation, it has been affected by the emplacement of two long N-S trending linear aseismic ridges (85°E and Ninetyeast...

  20. Upper ocean stratification and circulation in the northern Bay of Bengal during southwest monsoon of 1991

    Digital Repository Service at National Institute of Oceanography (India)

    Gopalakrishna, V.V.; Murty, V.S.N.; Sengupta, D.; Shenoy, Shrikant; Araligidad, N.

    and the role of near-surface stratified layer in the Bay of Bengal. Proceedings of PORSEC 2000, Vol. I, pp. 453–457. Pond, S., Pickard, G.L., 1983. Introductory Dynamic Oceano- graphy, Pergamon Press, New York, 241pp. Sengupta,D.,Senan,R.,Goswamy,B.N.,2001...

  1. The Sex Education Debates: Teaching "Life Style" in West Bengal, India

    Science.gov (United States)

    Chakravarti, Paromita

    2011-01-01

    This paper examines the recent controversies surrounding the decision to introduce sex education in secondary schools in India to combat the rapid spread of HIV and AIDS in the country. While 11 Indian states have banned it, the Left-ruled state of West Bengal has designed a teachers' manual to impart sex education. However, a close analysis of…

  2. Role of biology in the air–sea carbon flux in the Bay of Bengal

    Indian Academy of Sciences (India)

    Abstract. A physical-biological-chemical model (PBCM)is used for investigating the seasonal cycle of air –sea carbon flux and for assessing the effect of the biological processes on seasonal time scale in the Arabian Sea (AS)and Bay of Bengal (BoB),where the surface waters are subjected to contrasting physical conditions.

  3. Sighting of Elymnias panthera (Lepidoptera: Nymphalidae: Satyrinae in West Bengal, eastern India

    Directory of Open Access Journals (Sweden)

    A.B. Roy

    2010-01-01

    Full Text Available The Tawny Palmfly butterfly, Elymnias panthera (Lepidoptera: Nymphalidae: Satyrinae, is a Malayan species that is also known from the Nicobar Islands. Here we report sighting of E. panthera from the Bethuadahari Wildlife Sanctuary in West Bengal, eastern India. This is the first sighting of the species from mainland India, and is a possible range extension of the species into northeastern India.

  4. Lithological and mineralogical changes observed in a core from the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Reddy, N.P.C.; Rao, K.M.; Putra, S.V.S; Rao, Ch.M.

    Lithological and mineralogical studies were carried out on sediments from a 650 cm long core from the north western Bay of Bengal at a depth of 2700 m. These studies demarcate a boundary at 380 cm designated as unit 1 from 0-380 cm and unit 2 from...

  5. Distribution and seasonal abundance of carangid larvae in the Arabian sea and Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Peter, K.J.; Balachandran, T.

    Carangid larvae were recorded from 8.8% of the International Indian Ocean Expedition (IIOE) stations in the Arabian Sea and 13.2% in the Bay of Bengal. Their total contribution was 1.1% of the total larvae collected. The highest number of larvae...

  6. Sound speed structure in the Arabian Sea and the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Navelkar, G.S.; Murty, T.V.R.; Somayajulu, Y.K.; Murty, C.S.

    Sound speed computed from annual mean temperature and salinity data of Levitus reveals that spatial variation in the Arabian Sea is greater than that in the Bay of Bengal. Maximum spatial variation of sound speed in the Arabian Sea noticed between...

  7. Curstal evolution and sedimentation history of the Bay of Bengal since the cretaceous

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, D.G.; Krishna, K.S.; Sar, D.

    on three latitudinal profiles) in the Bay of Bengal. The trend of the fracture zones, the locations of the magnetic chron 34, and the Cretaceous Magnetic Quiet Zone suggest that Greater India separated from Antarctica after a period of transform motion...

  8. Determinants of Rural Industrial Entrepreneurship of Farmers in West Bengal : A Structural Equations Approach

    NARCIS (Netherlands)

    Folmer, Henk; Dutta, Subrata; Oud, Han

    2010-01-01

    This article presents a structural equations model of rural industrial entrepreneurship (RIE) among farmers in the Bardhaman district, West Bengal, India. It identifies the determinants of RIE but also analyzes impacts of RIE on its endogenous determinants. Age, education, marital status, number of

  9. Determinants of rural industrial entrepreneurship of farmers in West Bengal: A structural equations approach

    NARCIS (Netherlands)

    Folmer, H.; Dutta, S.; Oud, J.H.L.

    2010-01-01

    This article presents a structural equations model of rural industrial entrepreneurship (RIE) among farmers in the Bardhaman district, West Bengal, India. It identifies the determinants of RIE but also analyzes impacts of RIE on its endogenous determinants. Age, education, marital status, number of

  10. Transportation scenario of Black Bengal goats in Gabtoli and Sirajganj markets of Bangladesh

    Directory of Open Access Journals (Sweden)

    Mohammed Nazmus sakib

    2016-03-01

    Conclusion: From this study it is concluded that Black Bengal goats became physically unfit during long time transportation although majority of the farmers took proper management practices. Therefore, changes in behavioral responses might be alleviated through creating awareness to animal raiser as well transporter. [J Adv Vet Anim Res 2016; 3(1.000: 38-44

  11. Studies on the planktonic Decapoda and Stomatopoda (Crustacea) from the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Paulinose, V.T.; Nair, V.R.; Goswami, S.C.

    Abundance and distribution of decapods and stomatopods were studied, based on 90 samples collected from the western Bay of Bengal (Lat. 09 degrees 58' and 20 degrees 50'N and long. 80 degrees 00'E) between 24 August and 2 October, 1976. The decapod...

  12. Particle fluxes in the Bay of Bengal measurEd. by sediment traps

    Digital Repository Service at National Institute of Oceanography (India)

    Ramaswamy, V.; Parthiban, G.

    Particle fluxes were measured between October, 1987 and March, 1988 using six automated time series sediment traps at three locations in the northern, central and southern Bay of Bengal. Particle fluxes varied between 16.8 and 345 mg m/2 day/1...

  13. An experimental study of radiative fluxes in the south Bay of Bengal

    Indian Academy of Sciences (India)

    Time series measurements of radiative fluxes were made onboard INS Sagardhwani (SD) in the south Bay of Bengal near DS3 (13°N and 87°E) during the BOBMEX field experiment. An inter- comparison experiment conducted at DS3 showed that the radiative fluxes measured by Kipp and Zonen, Albedo meter and net ...

  14. Acoustic propagation within a surface duct in the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Navelkar, G.S.; Murty, T.V.R.; Murty, C.S.

    Sound speed structure forms a surface duct in the upper 50 m layer in the western Bay of Bengal during late July. A range-dependent acoustic ray computation shows that some rays emanating from a source within the upper 30 m, get trapped within...

  15. Modeling Salinity Exchanges Between the Equatorial Indian Ocean and the Bay of Bengal

    Science.gov (United States)

    2016-06-01

    parameters such as shortwave and long- wave radiation, specific humidity, and air temperature were taken from TropFlux data ( Praveen Kumar et  al...Bengal. Journal of Geophysical Research 120:3,315–3,329, http://dx.doi.org/10.1002/2014JC010340. Praveen Kumar, B., J. Vialard, M. Lengaigne, V.S. Murty

  16. Auto-correlation analysis of wave heights in the Bay of Bengal

    Indian Academy of Sciences (India)

    Time series observations of significant wave heights in the Bay of Bengal were subjected to auto- correlation analysis to determine temporal variability scale. The analysis indicates an exponen- tial fall of auto-correlation in the first few hours with a decorrelation time scale of about six hours. A similar figure was found earlier ...

  17. Seasonal cyclogenesis and the role of near-surface stratified layer in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Murty, V.S.N.; Sarma, M.S.S.; Tilvi, V.

    The role of the near-surface stratified layer developed due to the spread of low salinity waters under the influence of freshwater influx on the cyclogenesis over the Bay of Bengal is addressed. The seasonal variation of the Effective Oceanic Layer...

  18. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    Science.gov (United States)

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  19. Relation of zonal plasma drift and wind in the equatorial F region as derived from CHAMP observations

    Directory of Open Access Journals (Sweden)

    J. Park

    2013-06-01

    Full Text Available In this paper we estimate zonal plasma drift in the equatorial ionospheric F region without counting on ion drift meters. From June 2001 to June 2004 zonal plasma drift velocity is estimated from electron, neutral, and magnetic field observations of Challenging Mini-satellite Payload (CHAMP in the 09:00–20:00 LT sector. The estimated velocities are validated against ion drift measurements by the Republic of China Satellite-1/Ionospheric Plasma and Electrodynamics Instrument (ROCSAT-1/IPEI during the same period. The correlation between the CHAMP (altitude ~ 400 km estimates and ROCSAT-1 (altitude ~ 600 km observations is reasonably high (R ≈ 0.8. The slope of the linear regression is close to unity. However, the maximum westward drift and the westward-to-eastward reversal occur earlier for CHAMP estimates than for ROCSAT-1 measurements. In the equatorial F region both zonal wind and plasma drift have the same direction. Both generate vertical currents but with opposite signs. The wind effect (F region wind dynamo is generally larger in magnitude than the plasma drift effect (Pedersen current generated by vertical E field, thus determining the direction of the F region vertical current.

  20. A radiometric method for the determination of cationic detergents with the aid of Rose Bengal labelled with 131I

    International Nuclear Information System (INIS)

    Lengyel, J.; Krtil, J.; Vecernik, J.

    1983-01-01

    A novel radiometric method for the determination of cationic detergents represented by carbetoxypentadecyltrimethylammonium bromide (Septonex) is described. The method is based on the extraction of an ion associate Septonex-Rose Bengal from an alkaline medium into chloroform. Rose Bengal labelled with 131 I ( 131 I-RB) was used as a radioreagent. The 131 I activity in the extract is proportional to the cationic detergent concentration in the solution to be analyzed. The optimum conditions for the determination of Septonex were found and the composition of the extractable complexes Rose Bengal-Septonex was determined. (author)

  1. Simultaneous /sup 99m/Tc-p-butyl-IDA and 131I-rose bengal scintigraphy in neonatal jaundice

    International Nuclear Information System (INIS)

    Collier, B.D.; Treves, S.; Davis, M.A.; Heyman, S.; Subramanian, G.; McAfee, J.G.

    1980-01-01

    Eight neonates with jaundice were studied simultaneously with /sup 99m/Tc-p-butyl-IDA and 131 I-rose bengal. Due to physical decay, /sup 99m/Tc-p-butyl-IDA failed to demonstrate delayed excretion through the patent extrahepatic biliary tract in 3 of 5 patients with concomitant hepatitis; 131 I-rose bengal showed small-bowel activity in all 5. Neither agent demonstrated small-bowel activity in 3 neonates with extrahepatic biliary atresia. Based on this clinical trial, 131 I-rose bengal remains the radiopharmaceutical of choice for distinguishing between hepatitis and biliary atresia in these patients

  2. MEASUREMENT OF SURFACE SOLAR UV-B RADIATION AT TROPICAL COASTAL STATION BAKKHALI IN WEST BENGAL, INDIA

    OpenAIRE

    R. BHATTACHARYA; A. BHOUMICK

    2012-01-01

    Surface solar ultraviolet irradiance has been measured at Bakkhali (21.8ºN, 87.8ºE), a tropical rural station on the coast of Bay of Bengal, India in West Bengal. The measurements show a remarkable variation in UV-B load exists with a peak value at noon. The blockage of direct UV radiation in mangrove forest of costal site appears low when compared with UV load beneath the multiple trees of Mangifera indica in an inland site of Kalyani (22058' N, 88028' E), West Bengal. Mangrove forests have ...

  3. Development and testing of monoclonal antibody-based rapid immunodiagnostic test kits for direct detection of Vibrio cholerae O139 synonym Bengal.

    Science.gov (United States)

    Hasan, J A; Huq, A; Nair, G B; Garg, S; Mukhopadhyay, A K; Loomis, L; Bernstein, D; Colwell, R R

    1995-11-01

    We report on the development and testing of two monoclonal antibody-based rapid immunodiagnostic test kits, BengalScreen, a coagglutination test, and Bengal DFA, a direct fluorescent-antibody test, for direct detection of Vibrio cholerae O139 synonym Bengal in clinical and environmental specimens. The BengalScreen test requires less than 5 min to complete and can be used in the field. Bengal DFA, being more sensitive than BengalScreen, requires only one reagent and less than 20 min for detection and enumeration of V. cholerae O139 synonym Bengal. In tests for specificity, all 40 strains of V. cholerae O139 reacted with both test kits, whereas 157 strains of heterologous species examined did not, yielding 100% specificity in this study. A field trial was conducted in with both BengalScreen and Bengal DFA, and the results were compared with those obtained by conventional culture methods. BengalScreen demonstrated a sensitivity of 95%, a specificity of 100%, a positive predictive value of 100%, and a negative predictive value of 94%. Results obtained by Bengal DFA, on the other hand, were 100% sensitive and 100% specific and yielded 100% positive and negative predictive values compared with culture methods. In a second evaluation, 93 stool specimens from Mexico that were negative for V. cholerae O139 by culture were also tested with both the BengalScreen and Bengal DFA kits. None of the 93 specimens were positive for V. cholerae O139 by both tests. A concentration method was optimized for screening of environmental water samples for V. cholerae O139 synonym Bengal with rapid test kits. BengalScreen results were unequivocally positive when water samples contained at least 2.0 x 10(3) CFU/ml, whereas Bengal DFA demonstrated an unequivocally positive reaction when the water sample contained at least 1.5 x 10(2) CFU/ml. When Bengal DFA was compared with conventional culture methods for enumeration of V. cholerae O139 synonym Bengal organisms, no difference was observed.

  4. {Delta}{sup 14}C level of annual plants and fossil fuel derived CO{sub 2} distribution across different regions of China

    Energy Technology Data Exchange (ETDEWEB)

    Xi, X.T.; Ding, X.F.; Fu, D.P. [State Key Laboratory of Nuclear Physics and Technology and Institute of Heavy Ion Physics, School of Physics, Peking University, Beijing 100871 (China); Zhou, L.P. [Laboratory for Earth Surface Processes, Department of Geography, Peking University, Beijing 100871 (China); Liu, K.X., E-mail: kxliu@pku.edu.cn [State Key Laboratory of Nuclear Physics and Technology and Institute of Heavy Ion Physics, School of Physics, Peking University, Beijing 100871 (China)

    2013-01-15

    The {sup 14}C level in annual plants is a sensitive tracer for monitoring fossil fuel derived CO{sub 2} in the atmosphere. Corn leave samples were selected from different regions of China, including high mountains in the Tibetan Plateau, grassland in Inner Mongolia, and inland and coastal cities during the summer of 2010. The {sup 14}C/{sup 12}C ratio of the samples was measured with the NEC compact AMS system at the Institute of Heavy Ion Physics, Peking University. The fossil fuel derived CO{sub 2} was estimated by comparing the measured {Delta}{sup 14}C values of corn leave samples to background atmospheric {Delta}{sup 14}C level. The influences of topography, meteorological conditions and carbon cycling processes on the fossil fuel derived CO{sub 2} concentration are considered when interpreting the data. Our results show a clear association of the low {Delta}{sup 14}C values with regions where human activities are intensive.

  5. Neurons derived from different brain regions are inherently different in vitro: a novel multiregional brain-on-a-chip.

    Science.gov (United States)

    Dauth, Stephanie; Maoz, Ben M; Sheehy, Sean P; Hemphill, Matthew A; Murty, Tara; Macedonia, Mary Kate; Greer, Angie M; Budnik, Bogdan; Parker, Kevin Kit

    2017-03-01

    Brain in vitro models are critically important to developing our understanding of basic nervous system cellular physiology, potential neurotoxic effects of chemicals, and specific cellular mechanisms of many disease states. In this study, we sought to address key shortcomings of current brain in vitro models: the scarcity of comparative data for cells originating from distinct brain regions and the lack of multiregional brain in vitro models. We demonstrated that rat neurons from different brain regions exhibit unique profiles regarding their cell composition, protein expression, metabolism, and electrical activity in vitro. In vivo, the brain is unique in its structural and functional organization, and the interactions and communication between different brain areas are essential components of proper brain function. This fact and the observation that neurons from different areas of the brain exhibit unique behaviors in vitro underline the importance of establishing multiregional brain in vitro models. Therefore, we here developed a multiregional brain-on-a-chip and observed a reduction of overall firing activity, as well as altered amounts of astrocytes and specific neuronal cell types compared with separately cultured neurons. Furthermore, this multiregional model was used to study the effects of phencyclidine, a drug known to induce schizophrenia-like symptoms in vivo, on individual brain areas separately while monitoring downstream effects on interconnected regions. Overall, this work provides a comparison of cells from different brain regions in vitro and introduces a multiregional brain-on-a-chip that enables the development of unique disease models incorporating essential in vivo features. NEW & NOTEWORTHY Due to the scarcity of comparative data for cells from different brain regions in vitro, we demonstrated that neurons isolated from distinct brain areas exhibit unique behaviors in vitro. Moreover, in vivo proper brain function is dependent on the

  6. Fe-C-S systematics in Bengal Fan sediments

    Science.gov (United States)

    Volvoikar, S. P.; Mazumdar, A.; Goswami, H.; Pujari, S.; Peketi, A.

    2017-12-01

    Global biogeochemical cycles of iron, carbon and sulfur (Fe-C-S) are interrelated. Sulfate reduction in marine sediments is the major factor controlling the cycling and burial of carbon, sulfur and iron. Organoclastic sulfate reduction and anaerobic oxidation of methane (AOM) are the two main processes responsible for sulfate reduction in marine sediments. The amount and reactivity of organic matter, iron minerals and concentrations of dissolved sulfide in pore water control the burial of iron sulfide and organic bound sulfur in marine sediments. Here we investigate the sulfidization process in a sediment core from the western part of upper Bay of Bengal fan characterized by efficient burial of organic matter with siliclastic load. A 30 m long sediment core (MD 161/29, Lat. 170 18.04' N, Long. 870 22.56' E, water depth: 2434m) was collected onboard Marion Dufresne (May, 2007) and studied for Fe-S speciation and organic matter characterization. Buffered dithionite extractable iron (FeD) varies from 0.71 to 1.43 wt % (Avg. 0.79 wt %). FeD represents Fe oxides and oxyhydroxides mainly, ferrihydrite, lepidocrocite, goethite and hematite. Acid volatile sulfur (AVS) varies from 0.0015 to 0.63 wt % (avg: 0.058 wt %), while chromium reducible sulfur (CRS) varies from 0.00047 to 0.29 wt % (avg. 0.054 wt %). Based on the vertical distribution patterns of FeD, AVS and CRS, the core is divided into three zones, the lower (3000 to 1833 cm), middle (1833 to 398 cm) and upper (398 cm to surface) zones. FeD shows higher concentration in the lower zone. FeTR (FeOx + FeD + FeCRS + FeAVS) also exhibit higher concentration in this zone, suggesting higher availability of reactive iron for iron sulfide precipitation. AVS, elemental sulfur, spikes of CRS and gradual enrichment of δ34SAVS and δ34SCRS with sharp peaks in-between is noted in the lower zone. The gradual enrichment of δ34SAVS and δ34SCRS is the outcome of late diagenetic pyritization with higher availability of sulfide

  7. Glacier changes and climate trends derived from multiple sources in the data scarce Cordillera Vilcanota region, Southern Peruvian Andes

    OpenAIRE

    N. Salzmann; C. Huggel; M. Rohrer; W. Silverio; B. G. Mark; P. Burns; C. Portocarrero

    2012-01-01

    The role of glaciers as temporal water reservoirs is particularly pronounced in the (outer) tropics because of the very distinct wet/dry seasons. Rapid glacier retreat caused by climatic changes is thus a major concern, and decision makers demand urgently for regional/local glacier evolution trends, ice mass estimates and runoff assessments. However, in remote mountain areas, spatial and temporal data coverage is typically very scarce and this is further complicated by a high spatial and temp...

  8. Cosmic ray air showers in the knee energy region

    Indian Academy of Sciences (India)

    The cosmic ray extensive air showers in the knee energy region have been studied by the North Bengal University array. The differential size spectra at different atmospheric depths show a systematic shift of the knee towards smaller shower size with the increase in atmospheric depth. The measured values of spectral ...

  9. Thermodynamic structure of the marine atmosphere over the region ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    course of observations the ship moved from an open ... Marine boundary layer; thermodynamic structure; saturation point; Bay of Bengal Monsoon Experiment; .... when the low-pressure area is close to the ship the pressure is low and as the system moves away, the .... over oceanic regions to characterize the differences.

  10. A quantitative index of regional blood flow in canine myocardium derived noninvasively with N-13 ammonia and dynamic positron emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Ratib, O.; Gambhir, S.S.; Krivokapich, J.; Huang, S.C.; Phelps, M.E.; Schelbert, H.R. (Univ. of California, Los Angeles School of Medicine (USA))

    1991-01-01

    To derive a quantitative index of regional myocardial blood flow, the arterial input function of the flow tracer N-13 ammonia and the regional myocardial N-13 activity concentrations were noninvasively determined in 29 experiments in eight dogs. N-13 ammonia was administered intravenously and cross-sectional images were acquired dynamically using an ECAT III positron emission tomograph with an effective in-plane resolution of 13.46 mm full-width half-maximum. Time-activity curves were derived from the serial images by assigning regions of interest to the left ventricular myocardium and left ventricular blood pool. Tracer net extractions were estimated from the myocardial time-activity concentrations at various times after tracer injection and the integral of the arterial input function. Myocardial blood flow was altered by intravenous dipyridamole, morphine, propranolol and partial or complete occlusion of the left anterior descending coronary artery, and ranged from 9 to 860 ml/min per 100 g. Estimates of tracer net extractions were most accurate when determined from the myocardial N-13 activity concentrations at 60 s divided by the integral of the arterial input function to that time. These estimates correlated with regional myocardial blood flows determined independently by the microsphere technique by y = x (1 - 0.64(e-114/x); SEE = 22.9; r = 0.94). First pass extraction fractions of N-13 ammonia determined noninvasively with this approach declined with higher flows in a nonlinear fashion and were similar to those determined invasively by direct intracoronary N-13 ammonia injections. The findings indicate that an accurate index of regional myocardial blood flow can be obtained noninvasively by high temporal sampling of arterial and myocardial tracer activity concentrations with positron emission tomography.

  11. Effects of nutrient enrichment derived from fish farming activities on macroinvertebrate assemblages in a subtropical region of Hong Kong.

    Science.gov (United States)

    Gao, Qin-Feng; Cheung, Kwok-Leung; Cheung, Siu-Gin; Shin, Paul K S

    2005-01-01

    To study the correlation between nutrient enrichment derived from fish farming activities and changes in macrobenthic assemblages, a one-year field study was conducted in Kau Sai Bay marine fish culture zone of Hong Kong. Bimonthly sediment samples were collected at six stations: two at the fish cages, two near the boundary of the fish culture area, and two reference sites further away from the culture area. Sediment physico-chemical characteristics in terms of silt/clay fraction, moisture content, total organic carbon (TOC), total Kjeldahl nitrogen (TKN) and total phosphorus (TP) were analyzed. The macrobenthos (>0.5 mm) present in the sediment were sorted, identified and enumerated. On average, TOC, TKN and TP levels at the fish cage stations were 82.8%, 128.5% and 1315.7% higher than those at the reference stations, respectively. As a result, the N:P molar ratio was greatly reduced from 8.75 at the reference stations to 1.83 at the fish cage stations. Univariate and multivariate analyses revealed that diversity of macrofauna was significantly reduced and community structure differed at the fish cage stations relative to the reference sites. The intermediary stations near the fish culture area showed a transitional state of disturbance. Faunal diversity was negatively correlated with nutrient level, reflecting the adverse impacts of nutrient enrichment derived from fish farming activities on the benthic assemblages. Whilst in subtropical Asia-Pacific trash fish is the major feed for fish culture resulting in a higher nutrient loading and nutrient ratio accumulated in the sediment beneath the fish rafts, the effects of nutrient enrichment on macrobenthic assemblages are comparable to that in temperate waters owing to relatively high sediment metabolism rate and smaller fish culture scale in Hong Kong.

  12. Atmospheric weighting functions and surface partial derivatives for remote sensing of scattering planetary atmospheres in thermal spectral region: general adjoint approach

    International Nuclear Information System (INIS)

    Ustinov, Eugene A.

    2005-01-01

    An approach to formulation of inversion algorithms for remote sensing in the thermal spectral region in the case of a scattering planetary atmosphere, based on the adjoint equation of radiative transfer (Ustinov (JQSRT 68 (2001) 195; JQSRT 73 (2002) 29); referred to as Papers 1 and 2, respectively, in the main text), is applied to the general case of retrievals of atmospheric and surface parameters for the scattering atmosphere with nadir viewing geometry. Analytic expressions for corresponding weighting functions for atmospheric parameters and partial derivatives for surface parameters are derived. The case of pure atmospheric absorption with a scattering underlying surface is considered and convergence to results obtained for the non-scattering atmospheres (Ustinov (JQSRT 74 (2002) 683), referred to as Paper 3 in the main text) is demonstrated

  13. The MENA Region - an Optimal Currency Area? Evaluating its Stability by Taylor-Rule derived Stress Tests

    OpenAIRE

    Mouchera Karara

    2013-01-01

    The introduction of the European currency union and the EURO as common currency was an unprecedented experiment in monetary history. Not surprisingly, it has attracted a lot of attention to the concept of monetary unions, and it has the potential to be a role model for other parts of the world. This paper aims at identifying potential currency unions in the MENA region. To assess their sustainability, the optimal interest rates of the members of each potential union is estimated and used to c...

  14. Chemical and serologic definition of two unique D region-encoded molecules in the wild-derived mouse strain B10.GAA37.

    Science.gov (United States)

    Lillehoj, E P; Walsh, W D; Potter, T; Lee, D R; Coligan, J E; Hansen, T H

    1984-12-01

    Detailed serologic and biochemical characterization of D region products of the wild-derived mouse strain B10.GAA37 (Dw16) were performed and compared with previous studies of the D region products of the H-2d,b, and q haplotypes. Serologic analysis revealed that the antigens encoded by the Dw16 region express a unique combination of specificities defined by monoclonal antibodies (mAb) with established activity for the Ld and Dd molecules. Two out of five anti-Ld-reactive mAb reacted with B10.GAA37 cells, whereas one of three anti-Dd mAb showed B10.GAA37 reactivity. Sequential immunoprecipitation of B10.GAA37 antigens demonstrated the existence of at least two antigenically distinct molecules (designated Dw16 and Lw16) encoded by genes associated with the Dw16 region. Peptide map comparisons of the Dw16 and Lw16 molecules defined multiple differences in their primary protein structure, suggesting they are products of separate genes. Structural comparisons of the Lw16 and Dw16 molecules with the Ld and Dd molecules implied a) that the Dw16 and Dd regions did not result from a recent evolutionary divergence of a common primordial haplotype, and b) that the Lw16 and Dw16 molecules are more structurally homologous to each other than the Ld and Dd molecules are. Comparison of these findings with our previous studies of antigens encoded by the D regions suggest that each of these haplotypes has unique properties in terms of the number of gene products expressed and/or the structural relatedness of products of the same region.

  15. Why is mean sea level along the Indian coast higher in the Bay of Bengal than in the Arabian Sea?

    Digital Repository Service at National Institute of Oceanography (India)

    Shankar, D.; Shetye, S.R.

    Levelling observations conducted during the Great Trigonometrical Survey of India (1858-1909) and subsequent observations showed that mean sea level along the coast of India is higher in the Bay of Bengal than in the Arabian Sea, the difference...

  16. Cathodic protection of mild steel and copper in deep waters of the Arabian Sea and Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sawant, S.S.; Venkat, K.; Wagh, A.B.

    Performance of cathodic protection system to mild steel and copper in deep (> 1000 m) oceanic waters of the Arabian Sea and Bay of Bengal has been assessed using aluminium and mild steel sacrificial anodes. The corrosion rates of unprotected metals...

  17. Distribution of clay minerals in marine sediments off Chennai, Bay of Bengal, India: Indicators of sediment sources and transport processes .

    Digital Repository Service at National Institute of Oceanography (India)

    Veerasingam, S.; Venkatachalapathy, R.; Ramkumar, T.

    Clay mineralogy, texture size and statistical analyses were carried out on surface sediments from the continental shelf of Chennai, Bay of Bengal, India. The purpose of this study is to characterize the clay mineral distribution and its relation...

  18. Lack of seasonality in phytoplankton standing stock (chlorophyll a) and production in the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Madhu, N.V.; Jyothibabu, R.; Maheswaran, P.A.; Gerson, V.J.; Gopalakrishnan, T.C.; Nair, K.K.C.

    The investigations in the western Bay of Bengal (BoB) during summer, winter and spring intermonsoon periods evidenced lack of pronounced seasonal variation in phytoplankton standing stock (chlorophyll a) and primary production. The supply...

  19. Investigation of XBT and XCTD biases in the Arabian Sea and the Bay of Bengal with implications for climate studies

    Digital Repository Service at National Institute of Oceanography (India)

    Boyer, T.; Gopalakrishna, V.V.; Reseghetti, F.; Naik, A.; Suneel, V.; Ravichandran, M.; Ali, N.P.M.; Rafeeq, M.M.M.; Chico, R.A.

    XCTD, basin-specific FREs are possible for the Bay of Bengal, but not for the Arabian Sea. The XCTD FRE velocity coefficients are significantly higher than the XCTD manufacturers’ FRE coefficient or those from previous tests, possibly resulting from...

  20. Geostatistical analysis and isoscape of ice core derived water stable isotope records in an Antarctic macro region

    Science.gov (United States)

    Hatvani, István Gábor; Leuenberger, Markus; Kohán, Balázs; Kern, Zoltán

    2017-09-01

    Water stable isotopes preserved in ice cores provide essential information about polar precipitation. In the present study, multivariate regression and variogram analyses were conducted on 22 δ2H and 53 δ18O records from 60 ice cores covering the second half of the 20th century. Taking the multicollinearity of the explanatory variables into account, as also the model's adjusted R2 and its mean absolute error, longitude, elevation and distance from the coast were found to be the main independent geographical driving factors governing the spatial δ18O variability of firn/ice in the chosen Antarctic macro region. After diminishing the effects of these factors, using variography, the weights for interpolation with kriging were obtained and the spatial autocorrelation structure of the dataset was revealed. This indicates an average area of influence with a radius of 350 km. This allows the determination of the areas which are as yet not covered by the spatial variability of the existing network of ice cores. Finally, the regional isoscape was obtained for the study area, and this may be considered the first step towards a geostatistically improved isoscape for Antarctica.

  1. Global and Seasonal Scintillation Morphology in the Equatorial Region Derived from ROCSAT-1 In-situ Data

    Directory of Open Access Journals (Sweden)

    Yen-Hung Liu

    2012-01-01

    Full Text Available The global/seasonal distributions of the scintillation occurrence rate are obtained from the in-situ density measurement of the ROCSAT-1 using a modified procedure reported by Wernik et al. (2007. A least-squares curve fitting in the optimal trust region is used to obtain the spectral slope for the density irregularity structure and the outer scale of the scintillation. The distribution of the S4 index for the weak scintillation (S4 < 0.3 is almost identical to that of the equatorial irregularity distribution reported in the literature. However, as the scintillation becomes stronger (0.3 < S4 < 0.6, the latitudinal distribution moves to the equatorial ionization anomaly (EIA region. In addition, the distributions of the outer scale values that are useful for the study of the physical evolution of the irregularity structure are also obtained. The occurrence distribution of scintillation activity with several parameters such as dip-latitude, longitude, local time, solar activity, and geomagnetic activity during different seasons are presented and discussed in this paper.

  2. Increased wetness confounds Landsat-derived NDVI trends in the central Alaska North Slope region, 1985-2011

    Science.gov (United States)

    Raynolds, Martha K.; Walker, Donald A.

    2016-08-01

    Satellite data from the circumpolar Arctic have shown increases in vegetation indices correlated to warming air temperatures (e.g. Bhatt et al 2013 Remote Sensing 5 4229-54). However, more information is needed at finer scales to relate the satellite trends to vegetation changes on the ground. We examined changes using Landsat TM and ETM+ data between 1985 and 2011 in the central Alaska North Slope region, where the vegetation and landscapes are relatively well-known and mapped. We calculated trends in the normalized difference vegetation index (NDVI) and tasseled-cap transformation indices, and related them to high-resolution aerial photographs, ground studies, and vegetation maps. Significant, mostly negative, changes in NDVI occurred in 7.3% of the area, with greater change in aquatic and barren types. Large reflectance changes due to erosion, deposition and lake drainage were evident. Oil industry-related changes such as construction of artificial islands, roads, and gravel pads were also easily identified. Regional trends showed decreases in NDVI for most vegetation types, but increases in tasseled-cap greenness (56% of study area, greatest for vegetation types with high shrub cover) and tasseled-cap wetness (11% of area), consistent with documented degradation of polygon ice wedges, indicating that increasing cover of water may be masking increases in vegetation when summarized using the water-sensitive NDVI.

  3. Regional differences in the expression of brain-derived neurotrophic factor (BDNF) pro-peptide, proBDNF and preproBDNF in the brain confer stress resilience.

    Science.gov (United States)

    Yang, Bangkun; Yang, Chun; Ren, Qian; Zhang, Ji-Chun; Chen, Qian-Xue; Shirayama, Yukihiko; Hashimoto, Kenji

    2016-12-01

    Using learned helplessness (LH) model of depression, we measured protein expression of brain-derived neurotrophic factor (BDNF) pro-peptide, BDNF precursors (proBDNF and preproBDNF) in the brain regions of LH (susceptible) and non-LH rats (resilience). Expression of preproBDNF, proBDNF and BDNF pro-peptide in the medial prefrontal cortex of LH rats, but not non-LH rats, was significantly higher than control rats, although expression of these proteins in the nucleus accumbens of LH rats was significantly lower than control rats. This study suggests that regional differences in conversion of BDNF precursors into BDNF and BDNF pro-peptide by proteolytic cleavage may contribute to stress resilience.

  4. Study of the KIR gene profiles and analysis of the phylogenetic relationships of Rajbanshi population of West Bengal, India.

    Science.gov (United States)

    Guha, Pokhraj; Bhattacharjee, Soumen; Nayak, Chittaranjan; Chaudhuri, Tapas Kumar

    2013-05-01

    The natural killer (NK) cells have distinct receptors called killer cell immunoglobulin-like receptors (KIR) which are responsible for regulating NK cell responses to infections and malignancy. The extensive variations in the number and type of KIR genes can be used as a tool to understand the differentiation of populations and also for tracing genetic background. In this study, we have aimed to analyze the KIR gene polymorphism in the Rajbanshi population of West Bengal, India. To our knowledge this is the first report on the KIR gene polymorphism in the Rajbanshis, a population widely distributed in the Terai and Dooars region of West Bengal, India. Herein, we have studied the gene distribution of 14 KIR genes (KIR3DL1-3DL3, KIR 2DL1-2DL5, 2DS1-2DS5 and 3DS1) and two pseudogenes (KIR3DP1 and 2DP1). The gene frequencies and genotypic frequencies were calculated, based on which statistical analyses were performed. The presence of a considerable number of genotypic profiles suggests substantial diversity in the KIR gene pool of the Rajbanshis in the region studied. Apart from the framework genes (KIR2DL4, 3DL2, 3DL3 and 3DP1) present in all the individuals, the gene frequencies of other KIR genes varied between 0.84 and 0.15. Moreover the KIR polymorphisms of the Rajbanshis were also compared with that of available published data of the populations of other ethnicities. Though the Rajbanshi population showed a tendency to cluster with other Indian population based on KIR gene frequencies, the influence of Tibeto-Burman Lineage on their KIR genotypic profiles cannot be overlooked. Furthermore, evidences from previously published data on Y chromosome haplogroup diversity study on Rajbanshis support the view. Our results will not only help to understand the genetic background of the Rajbanshi population, but also in tracing the population migration events in the North-Eastern part of India and in illustrating the extensive genetic admixture amongst the different

  5. Instantaneous radioiodination of rose bengal at room temperature and a cold-kit therefor. [DOE patent application

    Science.gov (United States)

    O'Brien, H. Jr.; Hupf, H.B.; Wanek, P.M.

    The disclosure relates to the radioiodination of rose bengal at room temperature and a cold-kit therefor. A purified rose bengal tablet is stirred into acidified ethanol at or near room temperature, until a suspension forms. Reductant-free /sup 125/I/sup -/ is added and the resulting mixture stands until the exchange label reaction occurs at room temperature. A solution of sterile isotonic phosphate buffer and sodium hydroxide is added and the final resulting mixture is sterilized by filtration.

  6. Glacier changes and climate trends derived from multiple sources in the data scarce Cordillera Vilcanota region, southern Peruvian Andes

    Science.gov (United States)

    Salzmann, N.; Huggel, C.; Rohrer, M.; Silverio, W.; Mark, B. G.; Burns, P.; Portocarrero, C.

    2013-01-01

    The role of glaciers as temporal water reservoirs is particularly pronounced in the (outer) tropics because of the very distinct wet/dry seasons. Rapid glacier retreat caused by climatic changes is thus a major concern, and decision makers demand urgently for regional/local glacier evolution trends, ice mass estimates and runoff assessments. However, in remote mountain areas, spatial and temporal data coverage is typically very scarce and this is further complicated by a high spatial and temporal variability in regions with complex topography. Here, we present an approach on how to deal with these constraints. For the Cordillera Vilcanota (southern Peruvian Andes), which is the second largest glacierized cordillera in Peru (after the Cordillera Blanca) and also comprises the Quelccaya Ice Cap, we assimilate a comprehensive multi-decadal collection of available glacier and climate data from multiple sources (satellite images, meteorological station data and climate reanalysis), and analyze them for respective changes in glacier area and volume and related trends in air temperature, precipitation and in a more general manner for specific humidity. While we found only marginal glacier changes between 1962 and 1985, there has been a massive ice loss since 1985 (about 30% of area and about 45% of volume). These high numbers corroborate studies from other glacierized cordilleras in Peru. The climate data show overall a moderate increase in air temperature, mostly weak and not significant trends for precipitation sums and probably cannot in full explain the observed substantial ice loss. Therefore, the likely increase of specific humidity in the upper troposphere, where the glaciers are located, is further discussed and we conclude that it played a major role in the observed massive ice loss of the Cordillera Vilcanota over the past decades.

  7. Glacier changes and climate trends derived from multiple sources in the data scarce Cordillera Vilcanota region, southern Peruvian Andes

    Directory of Open Access Journals (Sweden)

    N. Salzmann

    2013-01-01

    Full Text Available The role of glaciers as temporal water reservoirs is particularly pronounced in the (outer tropics because of the very distinct wet/dry seasons. Rapid glacier retreat caused by climatic changes is thus a major concern, and decision makers demand urgently for regional/local glacier evolution trends, ice mass estimates and runoff assessments. However, in remote mountain areas, spatial and temporal data coverage is typically very scarce and this is further complicated by a high spatial and temporal variability in regions with complex topography. Here, we present an approach on how to deal with these constraints. For the Cordillera Vilcanota (southern Peruvian Andes, which is the second largest glacierized cordillera in Peru (after the Cordillera Blanca and also comprises the Quelccaya Ice Cap, we assimilate a comprehensive multi-decadal collection of available glacier and climate data from multiple sources (satellite images, meteorological station data and climate reanalysis, and analyze them for respective changes in glacier area and volume and related trends in air temperature, precipitation and in a more general manner for specific humidity. While we found only marginal glacier changes between 1962 and 1985, there has been a massive ice loss since 1985 (about 30% of area and about 45% of volume. These high numbers corroborate studies from other glacierized cordilleras in Peru. The climate data show overall a moderate increase in air temperature, mostly weak and not significant trends for precipitation sums and probably cannot in full explain the observed substantial ice loss. Therefore, the likely increase of specific humidity in the upper troposphere, where the glaciers are located, is further discussed and we conclude that it played a major role in the observed massive ice loss of the Cordillera Vilcanota over the past decades.

  8. Seasonal evaluation of the land surface scheme HTESSEL against remote sensing derived energy fluxes of the Transdanubian region in Hungary

    Directory of Open Access Journals (Sweden)

    E. L. Wipfler

    2011-04-01

    Full Text Available The skill of the land surface model HTESSEL is assessed to reproduce evaporation in response to land surface characteristics and atmospheric forcing, both being spatially variable. Evaporation estimates for the 2005 growing season are inferred from satellite observations of the Western part of Hungary and compared to model outcomes. Atmospheric forcings are obtained from a hindcast run with the Regional Climate Model RACMO2. Although HTESSEL slightly underpredicts the seasonal evaporative fraction as compared to satellite estimates, the mean, 10th and 90th percentile of this variable are of the same magnitude as the satellite observations. The initial water as stored in the soil and snow layer does not have a significant effect on the statistical properties of the evaporative fraction. However, the spatial distribution of the initial soil and snow water significantly affects the spatial distribution of the calculated evaporative fraction and the models ability to reproduce evaporation correctly in low precipitation areas in the considered region. HTESSEL performs weaker in dryer areas. In Western Hungary these areas are situated in the Danube valley, which is partly covered by irrigated cropland and which also may be affected by shallow groundwater. Incorporating (lateral groundwater flow and irrigation, processes that are not included now, may improve HTESSELs ability to predict evaporation correctly. Evaluation of the model skills using other test areas and larger evaluation periods is needed to confirm the results.

    Based on earlier sensitivity analysis, the effect of a number of modifications to HTESSEL has been assessed. A more physically based reduction function for dry soils has been introduced, the soil depth is made variable and the effect of swallow groundwater included. However, the combined modification does not lead to a significantly improved performance of HTESSEL.

  9. Profile of hemoglobin D trait in West Bengal, India

    Directory of Open Access Journals (Sweden)

    Tuphan K. Dolai

    2014-04-01

    Full Text Available Hemoglobin (Hb D Punjab is one of the most commonly observed abnormal hemoglobinopathy worldwide. There was no systematic large published study to investigate the characteristic of Hb D Punjab trait in India. This study was conducted in school and college students, newly married couples and pregnant women after proper counseling in the rural areas of West Bengal state in eastern India. Complete blood count was done by Sysmax Automated Hematology Analyzer KX 21 (Sysmex Corp., Kobe, Japan and thalassemia testing was done using high-performance liquid chromatography (Variant TM - Bio-Rad Lab., Hercules, CA, USA. A total of 46,139 individuals were screened for hemoglobinopathies. Hb D trait was found in 0.35%. Hypochromia rather than microcytosis is consistent finding in Hb D trait. Anisocytosis is absent in Hb D trait. In almost all (99.37% cases, Hb D is within 40% of total hemoglobin. This data is likely to be helpful for screening of hemoglobinopathy in resource poor setting.  血红蛋白(Hb D Punjab是全球最普遍的异常血红蛋白病之一。在印度,之前并没有研究D型特征血红蛋白病的大型出版物。本研究在印度东部的西孟加拉邦的农村地区进行,研究对象是接受过相关咨询后的在校生,大学生,新婚夫妇和孕妇。完整的血细胞计数由日本神户市Sysmex公司的KX21自动化血液分析仪完成,血液测试由美国加州赫拉克勒斯Variant-Bio-Rad实验室通过高效液相色谱法完成。总计46139人被筛查,D型特征血红蛋白病的发现率为0.35%。血红蛋白过少而非小红细胞症,是D型特征血红蛋白病的主要症状。红细胞大小不均没有在D型特征血红蛋白病中被检测出。在所有的情况中(99.37%),D型特征血红蛋白占所有血红蛋白总数的40%。这些数据有利于在资源匮乏地区对血红蛋白病的筛查。

  10. Expedition 354 on the Bengal fan: a Neogene record of Himalayan erosion

    Science.gov (United States)

    France-Lanord, C.; Spiess, V.; Schwenk, T.; Klaus, A.; Galy, A.

    2017-12-01

    Drilling in the Bengal fan generated a comprehensive record of Himalayan erosion over the Neogene and Quaternary. It documents the interplay between Himalayan tectonic and the monsoon. The fan is predominantly composed of detrital turbiditic sediments originating from Himalayan rivers, and transported through the delta and shelf canyon, supplying turbidity currents loaded with a wide spectrum of grain sizes. Turbiditic deposition makes that record at a given site is discontinuous which was the reason for an E-W transect approach. Exp. 354 drilled seven sites along a 320 km E-W transect at 8°N allowing the restitution of an almost complete record of Himalayan erosion at the scale of the Neogene. In spite of the transect's extension, a long absence of deposition was observed between 0.6 to 1.2 Ma indicating that turbiditic depocenter was derived more to the West for ca. 600 kyr. Turbidites have clear Himalayan origin with close mineralogical and isotopic analogy with those of the modern Ganga-Brahmaputra river sediments. Geochemistry shows relatively stable compositions throughout the Neogene and Quaternary and reveal a very weak regime of chemical weathering with no significant variation through time. Concentrations in mobile elements such as Na and K relative to Al are significantly higher than in modern sediments suggesting that weathering is amplified in the modern time. Low weathering of the sediments at 8°N indicates that erosion was dominated by physical processes and that transport is rapid enough to prevent evolution of particles in the floodplain. In the modern Himalaya, low weathering is achieved primarily by landslides and rapid transfer through the floodplain, i.e. limited recycling of sediment deposited in the floodplain. Both processes are favoured by the seasonality and the intensity of the monsoon. Although relatively stable, source tracers such as Sr-Nd isotopic compositions, and detrital carbonate compositions show organised variations with time

  11. Comparative mapping of DNA probes derived from the V{sub k} immunoglobulin gene regions on human and great ape chromosomes by fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Arnold, N.; Wienberg, J.; Ermert, K. [Universitaet Muenchen (Germany)] [and others

    1995-03-01

    Fluorescence in situ hybridization (FISH) of cosmid clones of human V{sub K} gene regions to human and primate chromosomes contributed to the dating of chromosome reorganizations in evolution. A clone from the K locus at 2p11-p12 (cos 106) hybridized to the assumed homologous chromosome bands in the chimpanzees Pan troglodytes (PTR) and P. paniscus (PPA), the Gorilla gorilla (GGO), and the orangutan Pongo Pygmaeus (PPY). Human and both chimpanzees differed from gorilla and orangutan by the mapping of cos 170, a clone derived from chromosome 2cen-q11.2; the transposition of this orphon to the other side of the centromere can, therefore, be dated after the human/chimpanzee and gorilla divergence. Hybridization to homologous bands was also found with a cosmid clone containing a V{sub K}I orphon located on chromosome 1 (cos 115, main signal at 1q31-q32), although the probe is not fully unique. Also, a clone derived from the orphon V{sub K} region on chromosome 22q11 (cos 121) hybridized to the homologous bands in the great apes. This indicates that the orphons on human chromosomes 1 and 22 had been translocated early in primate evolution. 18 refs., 2 figs.

  12. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry.

    Science.gov (United States)

    Babrak, Lmar; McGarvey, Jeffery A; Stanker, Larry H; Hnasko, Robert

    2017-10-01

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibodies (rAb). This determination can be achieved by sequence analysis of immunoglobulin (Ig) transcripts obtained from a monoclonal antibody (MAb) producing hybridoma and subsequent expression of a rAb. However the polyploidy nature of a hybridoma cell often results in the added expression of aberrant immunoglobulin-like transcripts or even production of anomalous antibodies which can confound production of rAb. An incorrect VR sequence will result in a non-functional rAb and de novo assembly of Ig primary structure without a sequence map is challenging. To address these problems, we have developed a methodology which combines: 1) selective PCR amplification of VR from both the heavy and light chain IgG from hybridoma, 2) molecular cloning and DNA sequence analysis and 3) tandem mass spectrometry (MS/MS) on enzyme digests obtained from the purified IgG. Peptide analysis proceeds by evaluating coverage of the predicted primary protein sequence provided by the initial DNA maps for the VR. This methodology serves to both identify and verify the primary structure of the MAb VR for production as rAb. Published by Elsevier Ltd.

  13. Commercialization of animal-derived remedies as complementary medicine in the semi-arid region of Northeastern Brazil.

    Science.gov (United States)

    Alves, Rômulo R N; Léo Neto, Nivaldo A; Brooks, Sharon E; Albuquerque, Ulysses P

    2009-07-30

    In this study, we aim to document the use of animal species in traditional medicine and healing practices in the semi-arid region of Northeastern Brazil. While widespread and of great importance to large population that has limited access to contemporary medicine, such practices are poorly understood and the potential value of medicinal animal species largely unknown. Based on interviews with the merchants of medicinal animals, we calculated the informant consensus factor (ICF) to determine the consensus over which species are effective for particular ailments, as well as the species relative importance to determine the extent of potential utilization of each species. We describe the therapeutic effects of 36 animal species used medicinally. The zootherapeutical products sold commercially are used to treat 40 health problems that were classified into 10 broad categories. We also highlight those species valued for their effectiveness against a range of ailments. The highest ICF value (0.91) was cited for diseases of the skin and subcutaneous tissue, which include relief of symptoms such as acne and furuncles. This study demonstrates that many animal species play an important role in healing practices. Animals provide the raw materials for remedies prescribed clinically and are also used in the form of amulets and charms in magic-religious rituals and ceremonies. The medicinal value of animal species depends on the local knowledge that exists within user communities, and therefore, the conservation of animal species is imperative to the preservation of local medicinal knowledge and culture.

  14. Fréchet derivative with respect to the shape of a strongly convex nonscattering region in optical tomography

    Science.gov (United States)

    Hyvönen, Nuutti

    2007-10-01

    The aim of optical tomography is to reconstruct the optical properties inside a physical body, e.g. a neonatal head, by illuminating it with near-infrared light and measuring the outward flux of photons on the object boundary. Because a brain consists of strongly scattering tissue with imbedded cavities filled by weakly scattering cerebrospinal fluid, propagation of near-infrared photons in the human head can be treated by combining the diffusion approximation of the radiative transfer equation with geometrical optics to obtain the radiosity-diffusion forward model of optical tomography. At the moment, a disadvantage with the radiosity-diffusion model is that the locations of the transparent cavities must be known in advance in order to be able to reconstruct the physiologically interesting quantities, i.e., the absorption and the scatter in the strongly scattering brain tissue. In this work we show that the boundary measurement map of optical tomography is Fréchet differentiable with respect to the shape of a strongly convex nonscattering region. Using this result, we introduce a numerical algorithm for approximating an unknown nonscattering cavity by a ball if the background diffuse optical properties of the object are known. The functionality of the method is demonstrated through two-dimensional numerical experiments.

  15. Regional Variability of Agriculturally-Derived Nitrate-Nitrogen in Shallow Groundwater in China, 2004–2014

    Directory of Open Access Journals (Sweden)

    Jing Li

    2018-05-01

    Full Text Available Increasing diffuse nitrate loading of groundwater has long been a major environmental and health concern in China, but little is known about the spatial and temporal variability of nitrate concentrations in groundwater at regional scales. The aim of this study was to assess the spatial distribution and variation of nitrate-nitrogen (NO3−-N concentrations in groundwater. We used groundwater quality monitoring data and soil physical characteristics from 21 agro-ecosystems in China for years 2004 to 2014. The results indicated that NO3−-N concentrations were highly variable in shallow groundwater across the landscape. Over the study period, most of the NO3−-N concentrations were below the World Health Organization permissible limit for drinking water (<10 mg N·L. NO3−-N concentrations in groundwater neither significantly increased nor decreased in most agro-ecosystems, but fluctuated with seasons. In addition, groundwater NO3−-N under purple soil (6.81 mg·L−1 and Aeolian sandy soil (6.02 mg·L−1 were significantly higher (p < 0.05 than that under other soil types, and it was medium-high (4.49 mg·L−1 under aquic cinnamon soil. Elevated nitrate concentrations occurred mainly in oasis agricultural areas of northwestern China, where farmlands with coarse-textured soils use flood irrigation. Therefore, arid and semi-arid areas are expected to sustain high NO3−-N concentrations in groundwater. Mitigation strategies can prevent this problem, and include control of N fertilizer input, balanced fertilization, proper rotation system, adoption of improved irrigation methods, and establishment of environmental policies.

  16. Fresh Water River discharges as observed by SMOS in the Arabian Sea and the Bay of Bengal

    Science.gov (United States)

    Olmedo, Estrella; Ballabrera-Poy, Joaquim; Turiel, Antonio

    2017-04-01

    The Bay of Bengal (BoB) and the Arabian Sea (AS) are two peculiar regions in the Indian Ocean exhibiting a wide range of Sea Surface Salinity (SSS) values. In the BoB, the strong summer monsoon rainfall and the continental run-offs into these semi-enclosed basins result in an intense dilution of the surface seawater in the northern part of the Bay, thereby inducing some of the lowest SSS water masses found in the tropical belt. In the AS, because of the intense variability associated with the monsoon cycle, water mass structure in the upper layers of the AS shows enormous variability in the space and time. As such, the role of the salinity in these regions is crucial in the ocean dynamics of these regions. After more than 7 years in orbit, the Soil Moisture and Ocean Salinity (SMOS) mission [1] continues to provide a series of salinity data that could be used to monitor the SSS variations in these climatically relevant regions, provided that systematic errors due to land contamination are reduced. Recently-developed algorithms for SSS retrieval [2] have improved the filtering criteria and the mitigation of the systematic bias, providing coherent SSS retrievals close to the land masses. In this work we have analyzed the SSS in 2-degree boxes located at the mouth of the main rivers in the BoB: Ganges-Brahmaputra, Irrawady, Mahanadi, Godovari; and in the AS: Indus. We have first tried to validate the SMOS salinity retrievals with in situ measurements. Since there is few available in situ data, we have also compared the climatological SSS behavior derived from SMOS with the ones provided by the World Ocean Atlas [3]. We have also compared the SMOS SSS data with historical data of discharges [4] and [5], ocean currents from the Ocean Surface Current Analyses Real-time (OSCAR) [6], Sea Surface Temperature from Operational Sea Surface Temperature and Sea Ice Analysis (OSTIA) [7],[8] and [9] and Chlorophyll data [10]. The conclusion of this work is that, when the proper

  17. Basement structure of the United Arab Emirates derived from an analysis of regional gravity and aeromagnetic database

    Science.gov (United States)

    Ali, M. Y.; Fairhead, J. D.; Green, C. M.; Noufal, A.

    2017-08-01

    Gravity and aeromagnetic data covering the whole territory of the United Arab Emirates (UAE) have been used to evaluate both shallow and deep geological structures, in particular the depth to basement since it is not imaged by seismic data anywhere within the UAE. Thus, the aim has been to map the basement so that its structure can help to assess its control on the distribution of hydrocarbons within the UAE. Power spectrum analysis reveals gravity and magnetic signatures to have some similarities, in having two main density/susceptibility interfaces widely separated in depth such that regional-residual anomaly separation could effectively be undertaken. The upper density/susceptibility interface occurs at a depth of about 1.0 km while the deeper interface varies in depth throughout the UAE. For gravity, this deeper interface is assumed to be due to the combined effect of lateral changes in density structures within the sediments and in depth of basement while for magnetics it is assumed the sediments have negligible susceptibility and the anomalies unrelated to the volcanic/magmatic bodies result from only changes in depth to basement. The power spectrum analysis over the suspect volcanic/magmatic bodies indicates they occur at 5 km depth. The finite tilt-depth and finite local wavenumber methods were used to estimate depth to source and only depths that agree to within 10% of each other were used to generate the depth to basement map. This depth to basement map, to the west of the UAE-Oman Mountains, varies in depth from 5 km to in excess of 15 km depth and is able to structurally account for the location of the shear structures, seen in the residual magnetic data, and the location of the volcanic/magmatic centres relative to a set of elongate N-S to NE-SW trending basement highs. The majority of oilfields in the UAE are located within these basement highs. Therefore, the hydrocarbon distribution in the UAE basin appears to be controlled by the location of the

  18. Chronic arsenic toxicity in Bangladesh and West Bengal, India--a review and commentary.

    Science.gov (United States)

    Rahman, M M; Chowdhury, U K; Mukherjee, S C; Mondal, B K; Paul, K; Lodh, D; Biswas, B K; Chanda, C R; Basu, G K; Saha, K C; Roy, S; Das, R; Palit, S K; Quamruzzaman, Q; Chakraborti, D

    2001-01-01

    Fifty districts of Bangladesh and 9 districts in West Bengal, India have arsenic levels in groundwater above the World Health Organization's maximum permissible limit of 50 microg/L. The area and population of 50 districts of Bangladesh and 9 districts in West Bengal are 118,849 km2 and 104.9 million and 38,865 km2 and 42.7 million, respectively. Our current data show arsenic levels above 50 microg/ L in 2000 villages, 178 police stations of 50 affected districts in Bangladesh and 2600 villages, 74 police stations/blocks of 9 affected districts in West Bengal. We have so far analyzed 34,000 and 101,934 hand tube-well water samples from Bangladesh and West Bengal respectively by FI-HG-AAS of which 56% and 52%, respectively, contained arsenic above 10 microg/L and 37% and 25% arsenic above 50 microg/L. In our preliminary study 18,000 persons in Bangladesh and 86,000 persons in West Bengal were clinically examined in arsenic-affected districts. Of them, 3695 (20.6% including 6.11% children) in Bangladesh and 8500 (9.8% including 1.7% children) in West Bengal had arsenical dermatological features. Symptoms of chronic arsenic toxicity developed insidiously after 6 months to 2 years or more of exposure. The time of onset depends on the concentration of arsenic in the drinking water, volume of intake, and the health and nutritional status of individuals. Major dermatological signs are diffuse or spotted melanosis, leucomelanosis, and keratosis. Chronic arsenicosis is a multisystem disorder. Apart from generalized weakness, appetite and weight loss, and anemia, our patients had symptoms relating to involvement of the lungs, gastrointestinal system, liver, spleen, genitourinary system, hemopoietic system, eyes, nervous system, and cardiovascular system. We found evidence of arsenic neuropathy in 37.3% (154 of 413 cases) in one group and 86.8% (33 of 38 cases) in another. Most of these cases had mild and predominantly sensory neuropathy. Central nervous system involvement

  19. STATE OF FAUNAL STATUS WITH SPECIAL REFERENCE TO BENGAL TIGER (Panthera tigris tigris IN SUNDARBAN DELTA

    Directory of Open Access Journals (Sweden)

    Shivaji Bhattacharya

    2011-07-01

    Full Text Available The mangrove ecology of Sundarban delta is one of the global biodiversity hotspots. The ecology harbours the Bengal Tiger (Panthera tigris tigris besides other. The species is highly threatened as per Red Data Book. The ecology has suffered huge degradation over the years by many known and unknown forces of varying magnitude. Though various efforts are being made to conserve the ecology but yet the degradation could not be checked up to expectation. The effect of degradation is clearly reflected through the status of Panthera tigris tigris in its natural habitat. Hence the different aspects of faunal status with special reference to Bengal Tiger in Sundarban ecology during about last two decades has been searched and discussed briefly.

  20. Arsenic Groundwater Contamination in Bengal: a Coupled Geochemical and Geophysical Study

    Science.gov (United States)

    Charlet, L.; Ansari, A. A.; Dietrich, M.; Latscha, A.; LeBeux, A.; Chatterjee, D.; Mallik, S. B.

    2001-05-01

    Arsenic contamination in drinking water is a problem of great concern in Ganges delta region, and could be one of the largest natural calamity in the world. In the present study, a contamination plume located in the Lalpur area (Chakdaha Block, Nadia District, West Bengal, India) was studied. A coupled geochemical and geophysical approach was employed to understand the mechanism of arsenic mobilisation from the sediments to groundwater, as a first step towards a global explanation of the phenomenon for other contaminated areas in the Ganges delta. The groundwater As concentration, in the 10 km x 10 km studied area, ranges from 10 to 500 ppb. In situ chemical speciation of arsenic was carried out and various geochemical parameters were measured in representative contaminated wells to interpret the mobilization mechanism in terms of redox kinetics. Through geophysical investigations, subsurface lithology, sediment depositional and geomorphological characteristics were determined and correlated with the arsenic contamination processes. From a geomorphological viewpoint, the contaminated area is located in an abandoned paleochannel of the Hooghly river, interpreted as the active site of deposition of fine sediments which were preserved as clay pockets at certain depths. These clay pockets are rich in organic matter, which may be the driving force for redox potential change and thus, may have driven the mobilisation of arsenic in groundwater. The clay pockets rich in organic matter presumably represent the major reservoir where arsenic is sitting and getting released due to redox mechanism. They are sampled at present. A piezometric depression cone characterized by a radial groundwater flow is located underneath the highly populated Lalpur area. The arsenic plume appears to migrate from the Hooghly river towards the cone of depression following the water flowpath, and this shall be verified in forthcoming field campaigns. As (III) constitutes 42 % of the total As

  1. Inequity in Hospitalization Care: A Study on Utilization of Healthcare Services in West Bengal, India

    Directory of Open Access Journals (Sweden)

    Montu Bose

    2015-01-01

    Full Text Available Background Out of eight commonly agreed Millennium Development Goals (MDG, six are related to the attainment of Universal Health Coverage (UHC throughout the globe. This universalization of health status suggests policies to narrow the gap in access and benefit sharing between different socially and economically underprivileged classes with that of the better placed ones and a consequent expansion of subsidized healthcare appears to be a common feature for most of the developing nations. The National Health Policy in India (2002 suggests expansion of market-based care for the affording class and subsidized care for the deserving class of the society. So, the benefit distribution of this limited public support in health sector is important to examine to study the welfare consequences of the policy. This paper examines the nature of utilizationto inpatient care by different socio-economic groups across regions and gender in West Bengal (WB, India. The benefit incidence of public subsidies across these socio-economic groups has also been verified for different types of services like medicines, diagnostics and professional care etc. Methods National Sample Survey Organization (NSSO has collected information on all hospitalized cases (60th round, 2004 with a recall period of 365 days from the sampled households through stratified random sampling technique. The data has been used to assess utilization of healthcare services during hospitalization and the distribution of public subsidies among the patients of different socio-economic background; a Benefit Incidence Analysis (BIA has also been carried out. Results Analysis shows that though the rate of utilization of public hospitals is quite high, other complementary services like medicine, doctor and diagnostic tests are mostly purchased from private market. This leads to high Out-of-Pocket (OOP expenditure. Moreover, BIA reveals that the public subsidies are mostly enjoyed by the relatively better

  2. Inequity in hospitalization care: a study on utilization of healthcare services in West Bengal, India.

    Science.gov (United States)

    Bose, Montu; Dutta, Arijita

    2015-01-01

    Out of eight commonly agreed Millennium Development Goals (MDG), six are related to the attainment of Universal Health Coverage (UHC) throughout the globe. This universalization of health status suggests policies to narrow the gap in access and benefit sharing between different socially and economically underprivileged classes with that of the better placed ones and a consequent expansion of subsidized healthcare appears to be a common feature for most of the developing nations. The National Health Policy in India (2002) suggests expansion of market-based care for the affording class and subsidized care for the deserving class of the society. So, the benefit distribution of this limited public support in health sector is important to examine to study the welfare consequences of the policy. This paper examines the nature of utilization to inpatient care by different socio-economic groups across regions and gender in West Bengal (WB), India. The benefit incidence of public subsidies across these socio-economic groups has also been verified for different types of services like medicines, diagnostics and professional care etc. National Sample Survey Organization (NSSO) has collected information on all hospitalized cases (60(th) round, 2004) with a recall period of 365 days from the sampled households through stratified random sampling technique. The data has been used to assess utilization of healthcare services during hospitalization and the distribution of public subsidies among the patients of different socio-economic background; a Benefit Incidence Analysis (BIA) has also been carried out. Analysis shows that though the rate of utilization of public hospitals is quite high, other complementary services like medicine, doctor and diagnostic tests are mostly purchased from private market. This leads to high Out-of-Pocket (OOP) expenditure. Moreover, BIA reveals that the public subsidies are mostly enjoyed by the relatively better placed patients, both socially and

  3. High spatial resolution radiation budget for Europe: derived from satellite data, validation of a regional model; Raeumlich hochaufgeloeste Strahlungsbilanz ueber Europa: Ableitung aus Satellitendaten, Validation eines regionalen Modells

    Energy Technology Data Exchange (ETDEWEB)

    Hollmann, R. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Atmosphaerenphysik

    2000-07-01

    Since forty years instruments onboard satellites have been demonstrated their usefulness for many applications in the field of meteorology and oceanography. Several experiments, like ERBE, are dedicated to establish a climatology of the global Earth radiation budget at the top of the atmosphere. Now the focus has been changed to the regional scale, e.g. GEWEX with its regional sub-experiments like BALTEX. To obtain a regional radiation budget for Europe in the first part of the work the well calibrated measurements from ScaRaB (scanner for radiation budget) are used to derive a narrow-to-broadband conversion, which is applicable to the AVHRR (advanced very high resolution radiometer). It is shown, that the accuracy of the method is in the order of that from SCaRaB itself. In the second part of the work, results of REMO have been compared with measurements of ScaRaB and AVHRR for March 1994. The model reproduces the measurements overall well, but it is overestimating the cold areas and underestimating the warm areas in the longwave spectral domain. Similarly it is overestimating the dark areas and underestimating the bright areas in the solar spectral domain. (orig.)

  4. An evolutionary conserved region (ECR in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex

    Directory of Open Access Journals (Sweden)

    Haddley Kate

    2011-05-01

    Full Text Available Abstract Background Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs, in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1 supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a a strong enhancer that functions in neurons and b a transcription factor that may modulate the function of that enhancer.

  5. Financial Inclusion in India: A case-study of West Bengal

    OpenAIRE

    Chattopadhyay, Sadhan Kumar

    2011-01-01

    The study observes that although there has been an improvement in outreach activity in the banking sector, the achievement in respect of financial inclusion is not significant in West Bengal. An index of financial inclusion (IFI) has been developed in the study using data on three dimensions of financial inclusion. It is revealed from the index that Kolkata district leads with the highest value of IFI, while rest of the districts show a very low level of financial inclusion. This implies that...

  6. Primary completion rates across socio-religious communities in West Bengal

    OpenAIRE

    Husain, Zakir; Chatterjee, Amrita

    2009-01-01

    Primary completion rates of Muslims in West Bengal are substantially lower than that of upper caste communities as well as backward castes, scheduled castes and tribes. Further, analysis of age-specific pcr indicates that differences in pcr between Muslims and other communities may have actually increased in recent years. An econometric analysis reveals that age, gender, household size and expenditure levels, education and gender of decision-maker, etc, are importan...

  7. Observations of barrier layer formation in the Bay of Bengal during summer monsoon

    Digital Repository Service at National Institute of Oceanography (India)

    Vinayachandran, P.N.; Murty, V.S.N.; RameshBabu, V.

    monsoon, J. Geophys. Res., 107(C12), 8018, doi:10.1029/2001JC000831, 2002. 1. Introduction [2] Several monsoon lows and depressions, that contrib- ute substantially to the summer monsoon rainfall of the Indian subcontinent, form over the Bay of Bengal... August–September, 1990,Murtyetal.[1996]foundthatthemixedlayerbasedon a temperature criterion is deeper than that using density. The regionwithrelativelyfreshwaterwithhighSSTappearstobe an excellent breeding ground for the formation of monsoon depressions...

  8. Sediment pathways and emergence of Himalayan source material in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Krishna, K.S.; Ismaiel, M.; Srinivas, K.; Gopala Rao, D.; Mishra, J.; Saha, D.

    . R., Emmel, F. J. and Moore, D. G., The Bengal Fan: geometry, stratigraphy, history and processes. Mar. Petrol. Geol., 2003, 19, 1191–1223. 26. Bull, J. M. and Scrutton, R. A., Seismic reflection images of intraplate deformation, central Indian... information on the linkage among Himalayan tectonics, Asian climate and erosional history of the Himalaya. There is a general belief that the sediment dis- charge from the Himalaya to the BoB had begun around the Eocene (~40 Ma)9...

  9. Ichthyofaunal Diversity and Water Quality in the Kangsabati Reservoir, West Bengal, India

    OpenAIRE

    Amalesh Bera; Manojit Bhattacharya; Bidhan Chandra Patra; Utpal Kumar Sar

    2014-01-01

    The ichthyofauna in relation to water quality was studied on monthly basis from March, 2010 to February, 2011 in the Kangsabati Reservoir, West Bengal. The study revealed that physicochemical parameters of Kangsabati Reservoir were congenial for 39 fish species of commercial importance, belonging to 7 orders, 15 families, and 26 genera. The Cypriniformes were dominant with 17 species, followed by Siluriformes and Perciformes, with 7 species each, Channiformes with 3 species, Osteoglossifor...

  10. Measurement of duodenogastric reflux: standardization of a new technique using Rose Bengal 131I

    International Nuclear Information System (INIS)

    Pires, P.W.A.; Camargo, E.E.; Mittelstaedt, W.E.M.; Speranzini, M.B.; Oliveira, M.R. de

    1988-01-01

    A nasogastric tube was introduced under radioscopic control into the stomach of 20 normal persons. After fixing the tube, Rose Bengal I 131 was injected intravenously. The individuals were then subdivided in two groups: a and B. group A: gastric fluid samples were aspirated for two hours in the ten cases in this group. Group B: A standard liquid diet was introduced via the nasogastric tube. Samples were also collected for two hours. (M.A.C.) [pt

  11. Mesozooplankton production, grazing and respiration in the Bay of Bengal: Implications for net heterotrophy

    Science.gov (United States)

    Fernandes, Veronica; Ramaiah, N.

    2016-03-01

    Mesozooplankton samples were collected from the mixed layer along a central (along 88°E) and a western transect in the Bay of Bengal during four seasons covered between 2001 and 2006 in order to investigate spatio-temporal variability in their biomass. At these stations, grazing and respiration rates were measured from live zooplankton hauled in from the surface during December 2005. Akin to the mesozooplankton "paradox" in the central and eastern Arabian Sea, biomass in the mixed layer was more or less invariant in the central and western Bay of Bengal, even as the chl a showed marginal temporal variation. By empirical equation, the mesozooplankton production rate calculated to be 70-246 mg C m- 2 d- 1 is on par with the Arabian Sea. Contrary to the conventional belief, mesozooplankton grazing impact was up to 83% on primary production (PP). Low PP coupled with very high zooplankton production (70% of PP) along with abundant bacterial production (50% of the PP; Ramaiah et al., 2009) is likely to render the Bay of Bengal net heterotrophic, especially during the spring intermonsoon. Greater estimates of fecal pellet-carbon egestion by mesozooplankton compared to the average particulate organic carbon flux in sediment traps, implies that much of the matter is recycled by heterotrophic communities in the mixed layer facilitating nutrient regeneration for phytoplankton growth. We also calculated that over a third of the primary production is channelized for basin-wide zooplankton respiration that accounts for 52 Mt C annually. In the current scenario of global warming, if low (primary) productive warm pools like the Bay of Bengal continue to be net heterotrophic, negative implications like enhanced emission of CO2 to the atmosphere, increased particulate flux to the deeper waters and greater utilization of dissolved oxygen resulting in expansion of the existing oxygen minimum zone are imminent.

  12. Contours, This Layer was derived from the USGS National Elevation Dataset (NED) based on 7.5 minute Digital Elevation Model (DEM) image files., Published in 1999, 1:24000 (1in=2000ft) scale, Atlanta Regional Commission.

    Data.gov (United States)

    NSGIC Regional | GIS Inventory — Contours dataset current as of 1999. This Layer was derived from the USGS National Elevation Dataset (NED) based on 7.5 minute Digital Elevation Model (DEM) image...

  13. Increasing trend of Japanese encephalitis cases in West Bengal, India - a threat to paediatric population

    Directory of Open Access Journals (Sweden)

    Debjani Taraphdar

    2012-10-01

    Full Text Available Objective: To detect the Japanese encephalitis virus (JEV as the etiologic agent from the acute encephalitis syndrome (AES cases mainly amongst the children and young adults from vaccinated and non-vaccinated districts of West Bengal. Methods: For the detection of JEV, a total of 828 sera were referred from vaccinated and non vaccinated districts of West Bengal during 2005-2011. Japanese encephalitis (JE positive cases were confirmed by ELISA and RT-PCR method. Results: Out of 828 cases, 245 samples were positive by ELISA method and 46 samples were positive by RT-PCR method. Out of 291 total positive cases, 162 (55.6% were below 20 years of age. Initially in 2005, JE cases were highest amongst the children and young adults (0-20 years. After vaccination, although the JE cases declined gradually in the vaccinated districts, but again from 2010, JE cases from the said age group showed an increasing trend from those districts. JE cases were also reported from other endemic zones of this state, which were still non-vaccinated. Conclusions: In West Bengal, JE cases are still predominated among children and young adults till the year 2011. Mass scale vaccination programme and investigation on the circulating strains are essentially required to find out the reasons of increasing tendency of JE cases in this state.

  14. Incidence of Japanese Encephalitis among Acute Encephalitis Syndrome Cases in West Bengal, India

    Directory of Open Access Journals (Sweden)

    Bhaswati Bandyopadhyay

    2013-01-01

    Full Text Available Background and Objectives. Japanese encephalitis (JE is the most important cause of acute and epidemic viral encephalitis. Every year sporadic JE cases are reported from the various districts of West Bengal, indicating its endemicity in this state. JE vaccination programme has been undertaken by the State Health Department of West Bengal. This study was aimed at seeing the present scenario of JE among acute encephalitis syndrome (AES cases in West Bengal. Materials and Methods. Blood and/or CSF samples were referred from suspected AES cases to the referral virology laboratory of the Calcutta School of Tropical Medicine from different hospitals of Kolkata. IgM antibody capture ELISA was performed on the CSF and serum samples by JE virus MAC ELISA kit supplied by the National Institute of Virology, Pune. Results. The present study reveals that 22.76% and 5% of the AES cases were positive for JE IgM in 2011 and 2012, respectively. JE is mainly prevalent in children and adolescents below 20 years of age with no gender predilection. Although the percentages of JE positive cases were high in 2011, it sharply decreased thereafter possibly due to better awareness programs, due to mass vaccination, or simply due to natural epidemiological niche periodicity due to herd immunity.

  15. Variability of resistance in Black Bengal goats naturally infected with Haemonchus contortus.

    Science.gov (United States)

    Kumar, Ratnesh; Ranjan, Sanjeev; Vishnu, P Guru; Negi, Mamta; Senapati, P K; Charita, V Gnani

    2015-03-01

    A total 290 Black Bengal goats (6 buck, 109 doe and 175 kids born from 11 sires) were studied to evaluate the variability of resistance in Black Bengal goats naturally infected with Haemonchus contortus. The variability of resistance in Black Bengal goat was studied for both genetic and non-genetic factors like village, sex, age dam, sire, dam resistance group and offspring resistance group. Male kids have slightly higher resistance than female kids although it was not significant. Resistance of kids was increased as age increases and kid population showed significantly different resistance status among the offspring resistant groups. The doe population showed significantly different LEPG as per the resistance group in all the collections. The present study found that the resistance of kids under sire were varied significantly and observed that the kids under sire 1, 6-8 were significantly more resistant than the kids of the sire 2, 5 and 11 in 3rd collection and it is also noticed that maternal genetic effect has a very little impact on resistance of kids. Males (buck) were most resistant and the kids were least resistant and the resistance of dam was in between the male and kids population.

  16. An Intrathermocline Eddy and a tropical cyclone in the Bay of Bengal

    Science.gov (United States)

    Gordon, Arnold L.; Shroyer, Emily; Murty, V. S. N.

    2017-04-01

    The Bay of Bengal, subjected to monsoonal forcing and tropical cyclones, displays a complex field of ocean eddies. On 5 December 2013 a sub-surface vortex or Intrathermocline Eddy (ITE) composed of water characteristic of the Andaman Sea was observed within the thermocline of the western Bay of Bengal. We propose that the ITE was the product of Tropical Cyclone Lehar interaction on 27 November 2013 with a westward propagating surface eddy from the eastern Bay of Bengal. While Lehar’s interaction with the ocean initially removes heat from the upper layers of the eddy, air-sea flux is limited as the deeper portions of the eddy was subducted into the stratified thermocline, inhibiting further interaction with the atmosphere. The ITE core from 30 to 150 m is thus isolated from local air-sea fluxes by strong stratification at the mixed layer base, and its periphery is stable to shear instability, suggestive of longevity and the ability to carry water far distances with minimal modification.

  17. A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

    Directory of Open Access Journals (Sweden)

    Jinquan Chen

    Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

  18. Seven year satellite observations of the mean structures and variabilities in the regional aerosol distribution over the oceanic areas around the Indian subcontinent

    Directory of Open Access Journals (Sweden)

    S. K. Nair

    2005-09-01

    Full Text Available Aerosol distribution over the oceanic regions around the Indian subcontinent and its seasonal and interannual variabilities are studied using the aerosol optical depth (AOD derived from NOAA-14 and NOAA-16 AVHRR data for the period of November 1995–December 2003. The air-mass types over this region during the Asian summer monsoon season (June–September are significantly different from those during the Asian dry season (November–April. Hence, the aerosol loading and its properties over these oceanic regions are also distinctly different in these two periods. During the Asian dry season, the Arabian Sea and Bay of Bengal are dominated by the transport of aerosols from Northern Hemispheric landmasses, mainly the Indian subcontinent, Southeast Asia and Arabia. This aerosol transport is rather weak in the early part of the dry season (November–January compared to that in the later period (February–April. Large-scale transport of mineral dust from Arabia and the production of sea-salt aerosols, due to high surface wind speeds, contribute to the high aerosol loading over the Arabian Sea region during the summer monsoon season. As a result, the monthly mean AOD over the Arabian Sea shows a clear annual cycle with the highest values occurring in July. The AOD over the Bay of Bengal and the Southern Hemisphere Indian Ocean also displays an annual cycle with maxima during March and October, respectively. The amplitude of the annual variation is the largest in coastal Arabia and the least in the Southern Hemisphere Indian Ocean. The interannual variability in AOD is the largest over the Southeast Arabian Sea (seasonal mean AOD varies from 0.19 to 0.42 and the northern Bay of Bengal (seasonal mean AOD varies from 0.24 to 0.39 during the February–April period and is the least over the Southern Hemisphere Indian Ocean. This study also investigates the altitude regions and pathways of dominant aerosol transport by combining the AOD distribution with

  19. Population and prey of the Bengal Tiger Panthera tigris tigris (Linnaeus, 1758 (Carnivora: Felidae in the Sundarbans, Bangladesh

    Directory of Open Access Journals (Sweden)

    M.M.H. Khan

    2012-02-01

    Full Text Available The results from intensive small scale surveys are often difficult to extrapolate to wider spatial scales, yet an understanding at such scales is critical for assessing the minimum densities and populations of rare and wide ranging species. In this paper, the minimum size of population and minimum density estimates of Bengal Tigers Panthera tigris tigris and its prey were conducted from 2005 to 2007 using camera traps for 90 days and using distance sampling surveys for over 200 days, respectively. The results were extrapolated from the core study area in Katka-Kochikhali, southeastern Sundarbans, to five additional sites using indices of abundance. With the use of 10 camera-traps at 15 trap-points, field data provided a total of 829 photos, including seven photos of five individual tigers. A total of 5.0 (SE = 0.98 tigers (adults and sub-adults are thus estimated in the core area with an estimated density of 4.8 tigers/100km2. Distance sampling surveys conducted on large mammalian prey species obtained an overall density estimate of 27.9 individuals/km2 and a biomass density of 1,037kg/km2. Indices of abundance were obtained by using tiger track sighting rates (number of tracks/km of riverbank and the sighting rates of the prey species (number of prey/km of riverbank in the core area and in five additional sites across the region. The densities of tiger tracks and sighting rates of prey were strongly correlated suggesting a wide scale relationship between predator and prey in the region. By combining the estimates of absolute density with indices of abundance, an average of 3.7 tigers/100km2 across the region is estimated, which given an area of 5,770km2, predicts a minimum of approximately 200 tigers in the Bangladesh Sundarbans.

  20. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  1. A simple derivation and analysis of a helical cone beam tomographic algorithm for long object imaging via a novel definition of region of interest

    International Nuclear Information System (INIS)

    Hu Jicun; Tam, Kwok; Johnson, Roger H

    2004-01-01

    We derive and analyse a simple algorithm first proposed by Kudo et al (2001 Proc. 2001 Meeting on Fully 3D Image Reconstruction in Radiology and Nuclear Medicine (Pacific Grove, CA) pp 7-10) for long object imaging from truncated helical cone beam data via a novel definition of region of interest (ROI). Our approach is based on the theory of short object imaging by Kudo et al (1998 Phys. Med. Biol. 43 2885-909). One of the key findings in their work is that filtering of the truncated projection can be divided into two parts: one, finite in the axial direction, results from ramp filtering the data within the Tam window. The other, infinite in the z direction, results from unbounded filtering of ray sums over PI lines only. We show that for an ROI defined by PI lines emanating from the initial and final source positions on a helical segment, the boundary data which would otherwise contaminate the reconstruction of the ROI can be completely excluded. This novel definition of the ROI leads to a simple algorithm for long object imaging. The overscan of the algorithm is analytically calculated and it is the same as that of the zero boundary method. The reconstructed ROI can be divided into two regions: one is minimally contaminated by the portion outside the ROI, while the other is reconstructed free of contamination. We validate the algorithm with a 3D Shepp-Logan phantom and a disc phantom

  2. Karyopherin-mediated nuclear import of the homing endonuclease VMA1-derived endonuclease is required for self-propagation of the coding region.

    Science.gov (United States)

    Nagai, Yuri; Nogami, Satoru; Kumagai-Sano, Fumi; Ohya, Yoshikazu

    2003-03-01

    VMA1-derived endonuclease (VDE), a site-specific endonuclease in Saccharomyces cerevisiae, enters the nucleus to generate a double-strand break in the VDE-negative allelic locus, mediating the self-propagating gene conversion called homing. Although VDE is excluded from the nucleus in mitotic cells, it relocalizes at premeiosis, becoming localized in both the nucleus and the cytoplasm in meiosis. The nuclear localization of VDE is induced by inactivation of TOR kinases, which constitute central regulators of cell differentiation in S. cerevisiae, and by nutrient depletion. A functional genomic approach revealed that at least two karyopherins, Srp1p and Kap142p, are required for the nuclear localization pattern. Genetic and physical interactions between Srp1p and VDE imply direct involvement of karyopherin-mediated nuclear transport in this process. Inactivation of TOR signaling or acquisition of an extra nuclear localization signal in the VDE coding region leads to artificial nuclear localization of VDE and thereby induces homing even during mitosis. These results serve as evidence that VDE utilizes the host systems of nutrient signal transduction and nucleocytoplasmic transport to ensure the propagation of its coding region.

  3. Chemistry of uranium, thorium, and radium isotopes in the Ganga-Brahmaputra river system: Weathering processes and fluxes to the Bay of Bengal

    Science.gov (United States)

    Sarin, M. M.; Krishnaswami, S.; somayajulu, B. L. K.; Moore, W. S.

    1990-05-01

    The most comprehensive data set on uranium, thorium, and radium isotopes in the Ganga-Brahmaputra, one of the major river systems of the world, is reported here. The dissolved 238U concentration in these river waters ranges between 0.44 and 8.32 μ/1, and it exhibits a positive correlation with major cations (Na + K + Mg + Ca). The 238U /∑Cations ratio in waters is very similar to that measured in the suspended sediments, indicating congruent weathering of uranium and major cations. The regional variations observed in the [ 234U /238U ] activity ratio are consistent with the lithology of the drainage basins. The lowland tributaries (Chambal, Betwa, Ken, and Son), draining through the igneous and metamorphic rocks of the Deccan Traps and the Vindhyan-Bundelkhand Plateau, have [ 234U /238U ] ratio in the range 1.16 to 1.84. This range is significantly higher than the near equilibrium ratio (~1.05) observed in the highland rivers which drain through sedimentary terrains. The dissolved 226Ra concentration ranges between 0.03 and 0.22 dpm/1. The striking feature of the radium isotopes data is the distinct difference in the 228Ra and 226Ra abundances between the highland and lowland rivers. The lowland waters are enriched in 228Ra while the highland waters contain more 226Ra. This difference mainly results from the differences in their weathering regimes. The discharge-weighted mean concentration of dissolved 238U in the Ganga (at Patna) and in the Brahmaputra (at Goalpara) are 1.81 and 0.63 μ/1, respectively. The Ganga-Brahmaputra river system constitutes the major source of dissolved uranium to the Bay of Bengal. These rivers transport annually about 1000 tons of uranium to their estuaries, about 10% of the estimated global supply of dissolved uranium to the oceans via rivers. The transport of uranium by these rivers far exceeds that of the Amazon, although their water discharge is only about 20% of that of the Amazon. The high intensity of weathering of uranium in

  4. Subsurface ammonium maxima in northern Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Satyanarayana, D.; Sahu, S.D.; Panigrahy, P.K.; Sarma, V.V.; Suguna, C.

    environments: The eastern tropical North Pacific Ocean and the Cariaco Trench. PhD Thesis, University of California at Los Angeles, 270 pp. Codispoti, L. A. (1981). Temporal nutrient variability in three different upwelling regions. In Coastal Upwelling, ed...

  5. Seismotectonics of the Indian subcontinent and the Bengal fan

    Digital Repository Service at National Institute of Oceanography (India)

    Murthy, K.S.R.

    The great Sumatra earthquake of 26th December, 2004 (0629 hrs IST) followed by the unique Indian ocean tsunami have added a new dimension to the natural hazard scenario of the country. Hitherto, the coastal region is associated mainly...

  6. Calcium phosphate saturation in the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Naik, S.; Reddy, C.V.G.

    Temperature, inorganic phosphate concentration and pH seem to be the major factors influencing the degree of saturation of calcium phosphate in sea water. Two water regions can be demarcated in the study area based on the saturation patterns...

  7. Evaluation of the crustal deformations in the northern region of Lake Nasser (Egypt) derived from 8 years of GPS campaign observations

    Science.gov (United States)

    Rayan, A.; Fernandes, R. M. S.; Khalil, H. A.; Mahmoud, S.; Miranda, J. M.; Tealab, A.

    2010-04-01

    The proper evaluation of crustal deformations in the Aswan (Egypt) region is crucial due to the existence of one major artificial structure: the Aswan High Dam. This construction induced the creation of one of the major artificial lakes: Lake Nasser, which has a surface area of about 5200 km 2 with a maximum capacity of 165 km 3. The lake is nearly 550 km long (more than 350 km within Egypt and the remainder in Sudan) and 35 km across at its widest point. Great attention has focused on this area after the November 14, 1981 earthquake ( ML = 5.7), with its epicenter southwest of the High Dam. In order to evaluate the present-day kinematics of the region, its relationship with increasing seismicity, and the possible influence of the Aswan High Dam operation, a network of 11 GPS sites was deployed in the area. This network has been reobserved every year since 2000 in campaign style. We present here the results of the analysis of the GPS campaign time-series. These time-series are already long enough to derive robust solutions for the motions of these stations. The computed trends are analyzed within the framework of the geophysical and geological settings of this region. We show that the observed displacements are significant, pointing to a coherent intraplate extensional deformation pattern, where some of the major faults (e.g., dextral strike-slip Kalabsha fault and normal Dabud fault) correspond to gradients of the surface deformation field. We also discuss the possible influence of the water load on the long-term deformation pattern.

  8. CHEMICAL EVOLUTION OF THE UNIVERSE AT 0.7 < z < 1.6 DERIVED FROM ABUNDANCE DIAGNOSTICS OF THE BROAD-LINE REGION OF QUASARS

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, H. [Laboratory of Infrared High-resolution Spectroscopy, Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan); Yoshii, Y.; Kawara, K., E-mail: sameshima@cc.kyoto-su.ac.jp [Institute of Astronomy, School of Science, University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan)

    2017-01-10

    We present an analysis of Mg ii λ 2798 and Fe ii UV emission lines for archival Sloan Digital Sky Survey (SDSS) quasars to explore the diagnostics of the magnesium-to-iron abundance ratio in a broad-line region cloud. Our sample consists of 17,432 quasars selected from the SDSS Data Release 7 with a redshift range of 0.72 <  z  < 1.63. A strong anticorrelation between the Mg ii equivalent width (EW) and the Eddington ratio is found, while only a weak positive correlation is found between the Fe ii EW and the Eddington ratio. To investigate the origin of these differing behaviors of Mg ii and Fe ii emission lines, we perform photoionization calculations using the Cloudy code, where constraints from recent reverberation mapping studies are considered. We find from calculations that (1) Mg ii and Fe ii emission lines are created at different regions in a photoionized cloud, and (2) their EW correlations with the Eddington ratio can be explained by just changing the cloud gas density. These results indicate that the Mg ii/Fe ii flux ratio, which has been used as a first-order proxy for the Mg/Fe abundance ratio in chemical evolution studies with quasar emission lines, depends largely on the cloud gas density. By correcting this density dependence, we propose new diagnostics of the Mg/Fe abundance ratio for a broad-line region cloud. In comparing the derived Mg/Fe abundance ratios with chemical evolution models, we suggest that α -enrichment by mass loss from metal-poor intermediate-mass stars occurred at z  ∼ 2 or earlier.

  9. A methodological approach for deriving regional crop rotations as basis for the assessment of the impact of agricultural strategies using soil erosion as example.

    Science.gov (United States)

    Lorenz, Marco; Fürst, Christine; Thiel, Enrico

    2013-09-01

    Regarding increasing pressures by global societal and climate change, the assessment of the impact of land use and land management practices on land degradation and the related decrease in sustainable provision of ecosystem services gains increasing interest. Existing approaches to assess agricultural practices focus on the assessment of single crops or statistical data because spatially explicit information on practically applied crop rotations is mostly not available. This provokes considerable uncertainties in crop production models as regional specifics have to be neglected or cannot be considered in an appropriate way. In a case study in Saxony, we developed an approach to (i) derive representative regional crop rotations by combining different data sources and expert knowledge. This includes the integration of innovative crop sequences related to bio-energy production or organic farming and different soil tillage, soil management and soil protection techniques. Furthermore, (ii) we developed a regionalization approach for transferring crop rotations and related soil management strategies on the basis of statistical data and spatially explicit data taken from so called field blocks. These field blocks are the smallest spatial entity for which agricultural practices must be reported to apply for agricultural funding within the frame of the European Agricultural Fund for Rural Development (EAFRD) program. The information was finally integrated into the spatial decision support tool GISCAME to assess and visualize in spatially explicit manner the impact of alternative agricultural land use strategies on soil erosion risk and ecosystem services provision. Objective of this paper is to present the approach how to create spatially explicit information on agricultural management practices for a study area around Dresden, the capital of the German Federal State Saxony. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Dietary Patterns Derived Using Exploratory and Confirmatory Factor Analysis are Stable and Generalizable Across Race, Region, and Gender Subgroups in the REGARDS Study

    Science.gov (United States)

    Judd, Suzanne E.; Letter, Abraham J.; Shikany, James M.; Roth, David L.; Newby, P. K.

    2015-01-01

    Background: Examining diet as a whole using dietary patterns as exposures is a complementary method to using single food or nutrients in studies of diet and disease, but the generalizability of intake patterns across race, region, and gender in the United States has not been established. Objective: To employ rigorous statistical analysis to empirically derive dietary patterns in a large bi-racial, geographically diverse population and examine whether results are stable across population subgroups. Design: The present analysis utilized data from 21,636 participants in the Reasons for Geographic and Racial Differences in Stroke (REGARDS) study who completed the Block 98 food frequency questionnaire. We employed exploratory factor analysis and confirmatory factor analyses on 56 different food groups iteratively and examined differences by race, region, and sex to determine the optimal factor solution in our sample. Results: Five dietary patterns emerged: the “Convenience” pattern was characterized by mixed dishes; the “Plant-based” pattern by fruits, vegetables, and fish; the “Sweets/Fats” pattern by sweet snacks, desserts, and fats and oils; the “Southern” pattern by fried foods, organ meat, and sweetened beverages; and the “Alcohol/Salads” pattern by beer, wine, liquor, and salads. Differences were most pronounced in the Southern pattern with black participants, those residing in the Southeast, and participants not completing high school having the highest scores. Conclusion: Five meaningful dietary patterns emerged in the REGARDS study and showed strong congruence across race, sex, and region. Future research will examine associations between these patterns and health outcomes to better understand racial disparities in disease and inform prevention efforts. PMID:25988129

  11. Dietary patterns derived using exploratory and confirmatory factor analysis are stable and generalizable across race, region, and gender subgroups in the REGARDS study

    Directory of Open Access Journals (Sweden)

    Suzanne E Judd

    2015-01-01

    Full Text Available Background: Examining diet as a whole using dietary patterns as exposures is a complementary method to using single food or nutrients in studies of diet and disease, but the generalizability of patterns across race, region, and gender in the United States has not been established. Objective: To employ rigorous statistical analysis to empirically derive dietary patterns in a large bi-racial, geographically diverse population and examine whether results are stable across population subgroups.Design: The present analysis utilized data from 21,636 participants in the Reasons for Geographic and Racial Differences in Stroke (REGARDS study who completed the Block98 food frequency questionnaire. We employed exploratory factor analysis and confirmatory factor analyses on 56 different food groups iteratively and examined differences by race, region, sex to determine the optimal factor solution in our sample. Results: Five dietary patterns emerged: the Convenience pattern was characterized by mixed dishes; the Plant-based pattern by fruits, vegetables, and fish; the Sweets/Fats pattern by sweet snacks, desserts, and fats and oils; the Southern pattern by fried foods, organ meat, and sweetened beverages; and the Alcohol/Salads pattern by beer, wine, liquor, and salads. Differences were most pronounced in the Southern pattern with black participants, those residing in the Southeast, and participants not completing high school having the highest scores. Conclusions: Five meaningful dietary patterns emerged in the REGARDS study and showed strong congruence across race, sex and region. Future research will examine associations between these patterns and health outcomes to better understand racial disparities in disease and inform prevention efforts.

  12. Brain-Derived Neurotrophic Factor Val66Met Polymorphism Affects the Relationship Between an Anxiety-Related Personality Trait and Resting Regional Cerebral Blood Flow.

    Science.gov (United States)

    Wei, Shau-Ming; Eisenberg, Daniel P; Nabel, Katherine G; Kohn, Philip D; Kippenhan, J Shane; Dickinson, Dwight; Kolachana, Bhaskar; Berman, Karen F

    2017-03-01

    Brain-derived neurotrophic factor (BDNF) is an important modulator of constitutive stress responses mediated by limbic frontotemporal circuits, and its gene contains a functional polymorphism (Val66Met) that may influence trait stress sensitivity. Reports of an association of this polymorphism with anxiety-related personality traits have been controversial and without clear neurophysiological support. We, therefore, determined the relationship between resting regional cerebral blood flow (rCBF) and a well-validated measure of anxiety-related personality, the TPQ Harm Avoidance (HA) scale, as a function of BDNF Val66Met genotype. Sixty-four healthy participants of European ancestry underwent resting H215O positron emission tomography scans. For each genotype group separately, we first determined the relationship between participants' HA scores and their resting rCBF values in each voxel across the entire brain, and then directly compared these HA-rCBF relationships between Val66Met genotype groups. HA-rCBF relationships differed between Val homozygotes and Met carriers in several regions relevant to stress regulation: subgenual cingulate, orbital frontal cortex, and the hippocampal/parahippocampal region. In each of these areas, the relationship was positive in Val homozygotes and negative in Met carriers. These data demonstrate a coupling between trait anxiety and basal resting blood flow in frontolimbic neurocircuitry that may be determined in part by genetically mediated BDNF signaling. Published by Oxford University Press 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  13. Aminostratigraphy of sediments of the SW Bay or Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, N.S.; Krishna, M.S.R; Pasha, S.K.G.; Yadava, M.G.; Rao, K.M.

    inexpensive. Hence, we wanted to perform the amino acid enantiomeric estimation on I n dian marginal sediments. We followed an amino acid deriv a tization procedure involving the following sequence of r e actions in which the N - trifluoroacetyl... isopropyl e s ters are formed 7 . However, by adopting the reaction cond i tions as reported by Goodfriend 7 , we could not get reproducible results even after r e peating the reaction under several combinations of conditions. We rea l...

  14. Rapid generation of sub-type, region-specific neurons and neural networks from human pluripotent stem cell-derived neurospheres

    Directory of Open Access Journals (Sweden)

    Aynun N. Begum

    2015-11-01

    Full Text Available Stem cell-based neuronal differentiation has provided a unique opportunity for disease modeling and regenerative medicine. Neurospheres are the most commonly used neuroprogenitors for neuronal differentiation, but they often clump in culture, which has always represented a challenge for neurodifferentiation. In this study, we report a novel method and defined culture conditions for generating sub-type or region-specific neurons from human embryonic and induced pluripotent stem cells derived neurosphere without any genetic manipulation. Round and bright-edged neurospheres were generated in a supplemented knockout serum replacement medium (SKSRM with 10% CO2, which doubled the expression of the NESTIN, PAX6 and FOXG1 genes compared with those cultured with 5% CO2. Furthermore, an additional step (AdSTEP was introduced to fragment the neurospheres and facilitate the formation of a neuroepithelial-type monolayer that we termed the “neurosphederm”. The large neural tube-type rosette (NTTR structure formed from the neurosphederm, and the NTTR expressed higher levels of the PAX6, SOX2 and NESTIN genes compared with the neuroectoderm-derived neuroprogenitors. Different layers of cortical, pyramidal, GABAergic, glutamatergic, cholinergic neurons appeared within 27 days using the neurosphederm, which is a shorter period than in traditional neurodifferentiation-protocols (42–60 days. With additional supplements and timeline dopaminergic and Purkinje neurons were also generated in culture too. Furthermore, our in vivo results indicated that the fragmented neurospheres facilitated significantly better neurogenesis in severe combined immunodeficiency (SCID mouse brains compared with the non-fragmented neurospheres. Therefore, this neurosphere-based neurodifferentiation protocol is a valuable tool for studies of neurodifferentiation, neuronal transplantation and high throughput screening assays.

  15. Managed European-Derived Honey Bee, Apis mellifera sspp, Colonies Reduce African-Matriline Honey Bee, A. m. scutellata, Drones at Regional Mating Congregations.

    Science.gov (United States)

    Mortensen, Ashley N; Ellis, James D

    2016-01-01

    African honey bees (Apis mellifera scutellata) dramatically changed the South American beekeeping industry as they rapidly spread through the Americas following their introduction into Brazil. In the present study, we aimed to determine if the management of European-derived honey bees (A. mellifera sspp.) could reduce the relative abundance of African-matriline drones at regional mating sites known as drone congregation areas (DCAs). We collected 2,400 drones at six DCAs either 0.25 km or >2.8 km from managed European-derived honey bee apiaries. The maternal ancestry of each drone was determined by Bgl II enzyme digestion of an amplified portion of the mitochondrial Cytochrome b gene. Furthermore, sibship reconstruction via nuclear microsatellites was conducted for a subset of 1,200 drones to estimate the number of colonies contributing drones to each DCA. Results indicate that DCAs distant to managed European apiaries (>2.8 km) had significantly more African-matriline drones (34.33% of the collected drones had African mitochondrial DNA) than did DCAs close (0.25 km) to managed European apiaries (1.83% of the collected drones had African mitochondrial DNA). Furthermore, nuclear sibship reconstruction demonstrated that the reduction in the proportion of African matriline drones at DCAs near apiaries was not simply an increase in the number of European matriline drones at the DCAs but also the result of fewer African matriline colonies contributing drones to the DCAs. Our data demonstrate that the management of European honey bee colonies can dramatically influence the proportion of drones with African matrilines at nearby drone congregation areas, and would likely decreasing the probability that virgin European queens will mate with African drones at those drone congregation areas.

  16. Managed European-Derived Honey Bee, Apis mellifera sspp, Colonies Reduce African-Matriline Honey Bee, A. m. scutellata, Drones at Regional Mating Congregations

    Science.gov (United States)

    Mortensen, Ashley N.; Ellis, James D.

    2016-01-01

    African honey bees (Apis mellifera scutellata) dramatically changed the South American beekeeping industry as they rapidly spread through the Americas following their introduction into Brazil. In the present study, we aimed to determine if the management of European-derived honey bees (A. mellifera sspp.) could reduce the relative abundance of African-matriline drones at regional mating sites known as drone congregation areas (DCAs). We collected 2,400 drones at six DCAs either 0.25 km or >2.8 km from managed European-derived honey bee apiaries. The maternal ancestry of each drone was determined by Bgl II enzyme digestion of an amplified portion of the mitochondrial Cytochrome b gene. Furthermore, sibship reconstruction via nuclear microsatellites was conducted for a subset of 1,200 drones to estimate the number of colonies contributing drones to each DCA. Results indicate that DCAs distant to managed European apiaries (>2.8 km) had significantly more African−matriline drones (34.33% of the collected drones had African mitochondrial DNA) than did DCAs close (0.25 km) to managed European apiaries (1.83% of the collected drones had African mitochondrial DNA). Furthermore, nuclear sibship reconstruction demonstrated that the reduction in the proportion of African matriline drones at DCAs near apiaries was not simply an increase in the number of European matriline drones at the DCAs but also the result of fewer African matriline colonies contributing drones to the DCAs. Our data demonstrate that the management of European honey bee colonies can dramatically influence the proportion of drones with African matrilines at nearby drone congregation areas, and would likely decreasing the probability that virgin European queens will mate with African drones at those drone congregation areas. PMID:27518068

  17. Progenitor-derivative relationships of Hordeum polyploids (Poaceae, Triticeae inferred from sequences of TOPO6, a nuclear low-copy gene region.

    Directory of Open Access Journals (Sweden)

    Jonathan Brassac

    Full Text Available Polyploidization is a major mechanism of speciation in plants. Within the barley genus Hordeum, approximately half of the taxa are polyploids. While for diploid species a good hypothesis of phylogenetic relationships exists, there is little information available for the polyploids (4×, 6× of Hordeum. Relationships among all 33 diploid and polyploid Hordeum species were analyzed with the low-copy nuclear marker region TOPO6 for 341 Hordeum individuals and eight outgroup species. PCR products were either directly sequenced or cloned and on average 12 clones per individual were included in phylogenetic analyses. In most diploid Hordeum species TOPO6 is probably a single-copy locus. Most sequences found in polyploid individuals phylogenetically cluster together with sequences derived from diploid species and thus allow the identification of parental taxa of polyploids. Four groups of sequences occurring only in polyploid taxa are interpreted as footprints of extinct diploid taxa, which contributed to allopolyploid evolution. Our analysis identifies three key species involved in the evolution of the American polyploids of the genus. (i All but one of the American tetraploids have a TOPO6 copy originating from the Central Asian diploid H. roshevitzii, the second copy clustering with different American diploid species. (ii All hexaploid species from the New World have a copy of an extinct close relative of H. californicum and (iii possess the TOPO6 sequence pattern of tetraploid H. jubatum, each with an additional copy derived from different American diploids. Tetraploid H. bulbosum is an autopolyploid, while the assumed autopolyploid H. brevisubulatum (4×, 6× was identified as allopolyploid throughout most of its distribution area. The use of a proof-reading DNA polymerase in PCR reduced the proportion of chimerical sequences in polyploids in comparison to Taq polymerase.

  18. Using multi-year reanalysis-derived recharge rates to drive a groundwater model for the Lake Tana region of Blue Nile Basin, Ethiopia

    Science.gov (United States)

    Dokou, Z.; Kheirabadi, M.; Nikolopoulos, E. I.; Moges, S. A.; Bagtzoglou, A. C.; Anagnostou, E. N.

    2017-12-01

    Ethiopia's high inter-annual variability in local precipitation has resulted in droughts and floods that stress local communities and lead to economic and food insecurity. Better predictions of water availability can supply farmers and water management authorities with critical guidance, enabling informed water resource allocation and management decisions that will in turn ensure food and water security in the region. The work presented here focuses on the development and calibration of a groundwater model of the Lake Tana region, one of the most important sub-basins of the Blue Nile River Basin. Groundwater recharge, which is the major groundwater source in the area, depends mainly on the seasonality of precipitation and the spatial variation in geology. Given that land based precipitation data are sparse in the region, two approaches for estimating groundwater recharge were used and compared that both utilize global atmospheric reanalysis driven by remote sensing datasets. In the first approach, the reanalysis precipitation dataset (ECMWF reanalysis adjusted based on GPCC) together with evapotranspiration and surface run-off estimates are used to calculate the groundwater recharge component using water budget equations. In the second approach, groundwater recharge estimates (subsurface runoff) are taken directly from a Land Surface model (FLDAS Noah), provided at a monthly time scale and 0.1˚ x 0.1˚ spatial resolution. The reanalysis derived recharge rates in both cases are incorporated into the groundwater model MODFLOW, which in combination with a Lake module that simulates the Lake water budget, offers a unique capability of improving the predictability of groundwater and lake levels in the Lake Tana basin. Model simulations using the two approaches are compared against in-situ observations of groundwater and lake levels. This modeling effort can be further used to explore climate variability effects on groundwater and lake levels and provide guidance to

  19. Regional and monthly and clear-sky aerosol direct radiative effect (and forcing derived from the GlobAEROSOL-AATSR satellite aerosol product

    Directory of Open Access Journals (Sweden)

    G. E. Thomas

    2013-01-01

    Full Text Available Using the GlobAEROSOL-AATSR dataset, estimates of the instantaneous, clear-sky, direct aerosol radiative effect and radiative forcing have been produced for the year 2006. Aerosol Robotic Network sun-photometer measurements have been used to characterise the random and systematic error in the GlobAEROSOL product for 22 regions covering the globe. Representative aerosol properties for each region were derived from the results of a wide range of literature sources and, along with the de-biased GlobAEROSOL AODs, were used to drive an offline version of the Met Office unified model radiation scheme. In addition to the mean AOD, best-estimate run of the radiation scheme, a range of additional calculations were done to propagate uncertainty estimates in the AOD, optical properties, surface albedo and errors due to the temporal and spatial averaging of the AOD fields. This analysis produced monthly, regional estimates of the clear-sky aerosol radiative effect and its uncertainty, which were combined to produce annual, global mean values of (−6.7 ± 3.9 W m−2 at the top of atmosphere (TOA and (−12 ± 6 W m−2 at the surface. These results were then used to give estimates of regional, clear-sky aerosol direct radiative forcing, using modelled pre-industrial AOD fields for the year 1750 calculated for the AEROCOM PRE experiment. However, as it was not possible to quantify the uncertainty in the pre-industrial aerosol loading, these figures can only be taken as indicative and their uncertainties as lower bounds on the likely errors. Although the uncertainty on aerosol radiative effect presented here is considerably larger than most previous estimates, the explicit inclusion of the major sources of error in the calculations suggest that they are closer to the true constraint on this figure from similar methodologies, and point to the need for more, improved estimates of both global aerosol loading and aerosol optical properties.

  20. The energy-irrigation nexus and its impact on groundwater markets in eastern Indo-Gangetic basin: Evidence from West Bengal, India

    International Nuclear Information System (INIS)

    Mukherji, Aditi

    2007-01-01

    South Asia in general and India in particular is heavily dependent on groundwater for supporting its largely agrarian population. Informal pump irrigation services markets have played an important role in providing access to irrigation to millions of small and marginal farmers and had positive equity, efficiency and sustainable impacts in water-abundant regions such as West Bengal. Quite predictably, in such pump lift-based economy, fortunes of energy and irrigation sectors are closely entwined. This has often been called the 'energy-irrigation' nexus. There are two major sources of energy for pumping groundwater, viz. electricity and diesel. Most of the current discourse in the field has looked only at the 'electricity-irrigation' nexus to the exclusion of the 'diesel-irrigation nexus'. This paper looks at both these aspects. In doing so, it makes two propositions. First, high flat-rate electricity tariff encourages development of water markets whereby the water buyers-who are mostly small and marginal farmers-benefit through access to irrigation. Second, low rate of rural electrification has forced majority of farmers to depend on diesel for groundwater pumping and the steep increase in diesel prices over the last few years has resulted in economic scarcity of groundwater. This in turn has had serious negative impacts on crop production and farm incomes. Using primary field data from West Bengal, India, this paper makes a case for rapid rural electrification and continuation of high flat-rate tariff, which would in turn support developed groundwater markets and provide access to irrigation to the poor and marginal farmers

  1. Numerical modelling of groundwater flow to understand the impacts of pumping on arsenic migration in the aquifer of North Bengal Plain

    Science.gov (United States)

    Sikdar, P. K.; Chakraborty, Surajit

    2017-03-01

    In this paper, numerical simulations of regional-scale groundwater flow of North Bengal Plain have been carried out with special emphasis on the arsenic (As)-rich alluvium filled gap between the Rajmahal hills on the west and the Garo hills on the east. The proposed concern of this modelling arose from development that has led to large water table declines in the urban area of English Bazar block, Malda district, West Bengal and possible transport of As in the near future from the adjacent As-polluted aquifer. Groundwater occurs under unconfined condition in a thick zone of saturation within the Quaternary alluvial sediments. Modelling indicates that current pumping has significantly changed the groundwater flowpaths from pre-development condition. At the present pumping rate, the pumping wells of the urban area may remain uncontaminated till the next 25 yrs, considering only pure advection of water but some water from the As-polluted zone may enter wells by 50 yrs. But geochemical and other processes such as adsorption, precipitation, redox reaction and microbial activity may significantly retard the predicted rate by advective transport. In the rural areas, majority of the water pumped from the aquifer is for irrigation, which is continuously re-applied on the surface. The near-vertical nature of the flowpaths indicates that, where As is present or released at shallow depths, it will continue to occur in pumping wells. Modelling also indicates that placing all the pumping wells at depths below 100 m may not provide As-free water permanently.

  2. Air Pollution over North-West Bay of Bengal in the Early Post-Monsoon Season Based on NASA MERRAero Data

    Science.gov (United States)

    Kishcha, Pavel; DaSilva, Arlindo M.; Starobinets, Boris; Alpert, Pinhas

    2013-01-01

    The MERRA Aerosol Reanalysis (MERRAero) has been recently developed at NASA's Global Modeling Assimilation Office (GMAO). This reanalysis is based on a version of the GEOS-5 model radiatively coupled with GOCART aerosols, and it includes assimilation of bias-corrected Aerosol Optical Thickness (AOT) from the MODIS sensor on both Terra and Aqua satellites. Our main finding is that, in October, in the absence of aerosol sources in north-west Bay of Bengal (BoB), MERRAero showed increasing AOT trends over north-west BoB exceeding those over the east of the Ganges basin. The Ganges basin is characterized by significant population growth accompanied by developing industry, agriculture, and increasing transportation: this has resulted in declining air quality. MERRAero data for the period 2002-2009 was used to study AOT trends over north-west Bay of Bengal (BoB) in the early post-monsoon season. This season is characterized by aerosol transport from the Ganges basin to north-west BoB by prevailing winds; and still significant rainfall of over 150 mmmonth. Different aerosol components showed strong increasing AOT trends over north-west BoB. The following factors contributed to the increasing AOT trend over the area in question in October: an increasing number of days when prevailing winds blew from land to sea, resulting in a drier environment and an increase in air pollution over north-west BoB; wind convergence was observed over north-west BoB causing the accumulation of aerosol particles over that region, when prevailing winds blew from land to sea. MERRAero aerosol reanalysis can be used on a global scale.

  3. Effect of carbon tetrachloride and Liv-52 on the clearance rate of 131I-Rose bengal in rat liver

    International Nuclear Information System (INIS)

    Dhawan, D.; Goel, A.; Karkara, K.

    1991-01-01

    131 I-Rose bengal clearance test has been immensely used for the clinical assessment of functional hepatic abnormalities. It has been observed that external collimated scintillation probe employing 131 I-Rose bengal is a rapid and less erroneous way of assessing polygonal cell function in liver. The present study demonstrates the protection of liver by Liv-52 from the deleterious effects of carbon tetrachloride (CCl 4 ) by determining the biological half-life of 131 I-Rose bengal in male albino rats. An increase in the biological half-life of the radio-iodinated dye was observed following CCl 4 intoxication which was reversed by Liv-52 treatment. (author). 15 refs., 2 tabs

  4. Comparison of GPS derived TEC with the TEC predicted by IRI 2012 model in the southern Equatorial Ionization Anomaly crest within the Eastern Africa region

    Science.gov (United States)

    Sulungu, Emmanuel D.; Uiso, Christian B. S.; Sibanda, Patrick

    2018-04-01

    We have compared the TEC obtained from the IRI-2012 model with the GPS derived TEC data recorded within southern crest of the EIA in the Eastern Africa region using the monthly means of the 5 international quiet days for equinoxes and solstices months for the period of 2012 - 2013. GPS-derived TEC data have been obtained from the Africa array and IGS network of ground based dual-frequency GPS receivers from four stations (Kigali (1.95°S, 30.09°E; Geom. Lat. 11.63°S), Malindi (2.99°S, 40.19°E; Geom. Lat. 12.42°S), Mbarara (0.60°S, 30.74°E; Geom. Lat. 10.22°S) and Nairobi (1.22°S, 36.89°E; Geom. Lat. 10.69°S)) located within the EIA crest in this region. All the three options for topside Ne of IRI-2012 model and ABT-2009 for bottomside thickness have been used to compute the IRI TEC. Also URSI coefficients were considered in this study. These results are compared with the TEC estimated from GPS measurements. Correlation Coefficients between the two sets of data, the Root-Mean Square Errors (RMSE) of the IRI-TEC from the GPS-TEC, and the percentage RMSE of the IRI-TEC from the GPS-TEC have been computed. Our general results show that IRI-2012 model with all three options overestimates the GPS-TEC for all seasons and at all stations, and IRI-2001 overestimates GPS-TEC more compared with other options. IRI-Neq and IRI-01-corr are closely matching in most of the time. The observation also shows that, GPS TEC are underestimated by TEC from IRI model during noon hours, especially during equinoctial months. Further, GPS-TEC values and IRI-TEC values using all the three topside Ne options show very good correlation (above 0.8). On the other hand, the TEC using IRI-Neq and IRI-01- corr had smaller deviations from the GPS-TEC compared to the IRI-2001.

  5. Regional Inversion of the Maximum Carboxylation Rate (Vcmax) through the Sunlit Light Use Efficiency Estimated Using the Corrected Photochemical Reflectance Ratio Derived from MODIS Data

    Science.gov (United States)

    Zheng, T.; Chen, J. M.

    2016-12-01

    The maximum carboxylation rate (Vcmax), despite its importance in terrestrial carbon cycle modelling, remains challenging to obtain for large scales. In this study, an attempt has been made to invert the Vcmax using the gross primary productivity from sunlit leaves (GPPsun) with the physiological basis that the photosynthesis rate for leaves exposed to high solar radiation is mainly determined by the Vcmax. Since the GPPsun can be calculated through the sunlit light use efficiency (ɛsun), the main focus becomes the acquisition of ɛsun. Previous studies using site level reflectance observations have shown the ability of the photochemical reflectance ratio (PRR, defined as the ratio between the reflectance from an effective band centered around 531nm and a reference band) in tracking the variation of ɛsun for an evergreen coniferous stand and a deciduous broadleaf stand separately and the potential of a NDVI corrected PRR (NPRR, defined as the product of NDVI and PRR) in producing a general expression to describe the NPRR-ɛsun relationship across different plant function types. In this study, a significant correlation (R2 = 0.67, p<0.001) between the MODIS derived NPRR and the site level ɛsun calculated using flux data for four Canadian flux sites has been found for the year 2010. For validation purpose, the ɛsun in 2009 for the same sites are calculated using the MODIS NPRR and the expression from 2010. The MODIS derived ɛsun matches well with the flux calculated ɛsun (R2 = 0.57, p<0.001). Same expression has then been applied over a 217 × 193 km area in Saskatchewan, Canada to obtain the ɛsun and thus GPPsun for the region during the growing season in 2008 (day 150 to day 260). The Vcmax for the region is inverted using the GPPsun and the result is validated at three flux sites inside the area. The results show that the approach is able to obtain good estimations of Vcmax values with R2 = 0.68 and RMSE = 8.8 μmol m-2 s-1.

  6. Gravity anomalies and crustal structure of the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Subrahmanyam, V.; Krishna, K.S.; Murthy, I.V.R.; Sarma, K.V.L.N.S.; Desa, M.; Ramana, M.V.; KameshRaju, K.A.

    in the Moho. Each depression of the Moho is associated with a basement high. The depression beneath the 85 degrees E Ridge is about 6 km deep from the regional Moho boundary, which is at variance to the earlier results. It is suggested that the depressions may...

  7. Effectiveness of first-aid training on school students in Singur Block of Hooghly District, West Bengal

    Directory of Open Access Journals (Sweden)

    Lina Bandyopadhyay

    2017-01-01

    Full Text Available Objective: First aid is the helping behavior and initial care provided for an acute illness or injury. Students have the potential for changing the health scenario of the society if properly groomed and educated. The objective of the study is to evaluate the effectiveness of educational intervention on the first aid among middle school students of a rural school in West Bengal. Materials and Methods: A total of 230, 6th and 7th standard students were given a self-administered questionnaire for assessing their baseline knowledge about management of common injuries followed by educational intervention with a systematically devised teaching module during February to March 2016. Post intervention evaluation of their knowledge acquisition was done after 2 weeks with same questionnaire. Results: The baseline knowledge on the management of selected injuries was found to be insufficient among the study subjects. Paired t-test was performed to compare the pre- and post-test scores of knowledge and attitude of the students about first aid, and there was a significant change in knowledge from pretest score (mean = 1.50, standard deviation [SD] =0.47 to posttest score (mean = 6.53, SD = 1.30. To quantify the effectiveness of health education, effect size (Cohen's d was derived. For knowledge score, Cohen's d was 5.14 with large effect size indicating highly effective impact of the training program. Significant change was also noticed regarding attitude regarding first aid as evident from increase in pretest score (mean = 1.19, SD = 0.96 to posttest score (mean = 3.17, SD = 1.03; Cohen's d was 1.88 with medium effect size. Conclusion: Inculcating first-aid training in the school curriculum can be a fruitful investment in ensuring proper and timely management of illnesses and injuries not only for the school children but also for the community at large.

  8. Effectiveness of first-aid training on school students in Singur Block of Hooghly District, West Bengal.

    Science.gov (United States)

    Bandyopadhyay, Lina; Manjula, M; Paul, Bobby; Dasgupta, Aparajita

    2017-01-01

    First aid is the helping behavior and initial care provided for an acute illness or injury. Students have the potential for changing the health scenario of the society if properly groomed and educated. The objective of the study is to evaluate the effectiveness of educational intervention on the first aid among middle school students of a rural school in West Bengal. A total of 230, 6 th and 7 th standard students were given a self-administered questionnaire for assessing their baseline knowledge about management of common injuries followed by educational intervention with a systematically devised teaching module during February to March 2016. Post intervention evaluation of their knowledge acquisition was done after 2 weeks with same questionnaire. The baseline knowledge on the management of selected injuries was found to be insufficient among the study subjects. Paired t -test was performed to compare the pre- and post-test scores of knowledge and attitude of the students about first aid, and there was a significant change in knowledge from pretest score (mean = 1.50, standard deviation [SD] =0.47) to posttest score (mean = 6.53, SD = 1.30). To quantify the effectiveness of health education, effect size (Cohen's d) was derived. For knowledge score, Cohen's d was 5.14 with large effect size indicating highly effective impact of the training program. Significant change was also noticed regarding attitude regarding first aid as evident from increase in pretest score (mean = 1.19, SD = 0.96) to posttest score (mean = 3.17, SD = 1.03); Cohen's d was 1.88 with medium effect size. Inculcating first-aid training in the school curriculum can be a fruitful investment in ensuring proper and timely management of illnesses and injuries not only for the school children but also for the community at large.

  9. A brief study on the imprints of seismo tectonic activities in the crust of central and southern Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, K.V.L.N.S.; Subrahmanyam, A; Subrahmanyam, V.; Murty, G.P.S.; Rao, K.M.

    .Previousresults indicate that IT Imprintsof seismo tectonicactivities inthe crustof pans of Bay of Bengal --~ . i' . " " "'. ,. Fig.S. Sarellirederil'ed gral'iry allomaly data of Hm' of BellRalsho'A'i1ll!the imprillls of cru.\\.talstructure alld glm'in' lows (After Salld.... - April 2007. Vol. XXVIII '\\10.1& 2 pp 55 to 62 A BRIEF STUDY ON IMPRINTS OF SEISMO TECTONIC ,\\CTIVITIES IN THE CRUST OF CENTRAL AND SOUTHERN BAY OF BENGAL K.V.L.N.S.Sarma,A.S. Subrahmanyam, V.Subrahmanyam, G.P.S. Murty and K. Mohana Rao Nationallll...

  10. Drifting and meandering of Olive Ridley Sea turtles in the Bay of Bengal: Role of oceanic Rossby waves

    Digital Repository Service at National Institute of Oceanography (India)

    Ram, P.S.; Rao, S.A.; Sadhuram, Y.

    in the direction of geostrophic currents. It is found that the locations of these thermal fronts in the Bay of Bengal are primarily determined by the Oceanic Rossby waves and local Ekman pumping. Key Words: Bay of Bengal, Circulation, Cyclonic and Anti... drawn with black dots shows the meandering path of the rest of the three turtles. Locations of the turtles at different times are also shown as white stars. A strong anti-cyclonic gyre (warm core eddy) centered at 17º N with SSHD above 30 cm...

  11. First report of Seuratascaris numidica Seurat, 1917 (Nematoda: Ascarididae) and other helminths from amphibians of West Bengal, India.

    Science.gov (United States)

    Sou, Sujan K; Bursey, Charles R

    2017-03-01

    Studies on nematode parasites from anuran hosts from Eastern India, particularly West Bengal, are rare. To our knowledge, there is a report of larvae of Monhysterides sp. (a fish parasite) from cysts within the body cavity and musculature of Duttaphrynus melanostictus, Hoplobatrachus tigerinus and Euphlyctis hexadactylus as well as descriptions of Aplectana duttaphryni from D. melanostictus , Aplectana dubrajpuri from H. tigerinus , Cosmocerca microhylae from Microhyla rubra and Rhabdias bulbicauda from D. melanostictus . Here, we report mature individuals of typical anuran parasites, Diplodiscus amphichrus and Seuratascaris numidica , from H. tigerinus and larvae of Acuariidae (a bird parasite) from Fejervarya limnocharis collected in Kulti, West Bengal.

  12. Detection of emerging antibiotic resistance in bacteria isolated from subclinical mastitis in cattle in West Bengal

    Directory of Open Access Journals (Sweden)

    Arnab Das

    2017-05-01

    Full Text Available Aim: The aim of this work was to detect antibiotic resistance in Gram-negative bacteria isolated from subclinical mastitis in cattle in West Bengal. Materials and Methods: The milk samples were collected from the cattle suffering with subclinical mastitis in West Bengal. The milk samples were inoculated into the nutrient broth and incubated at 37°C. On the next day, the growth was transferred into nutrient agar and MacConkey agar. All the pure cultures obtained from nutrient agar slant were subjected to Gram-staining and standard biochemical tests. All the bacterial isolates were tested in vitro for their sensitivity to different antibiotics commonly used in veterinary practices. All Gram-negative isolates including positive control were subjected to polymerase chain reaction (PCR for detection of blaCTX-M, blaTEM, blaSHV, blaVIM, tetA, tetB, tetC, and tetM genes considered for extended-spectrum β-lactamase (ESBL, metallo-β-lactamase, and tetracycline resistance. Results: In total, 50 Gram-negative organisms (Escherichia coli, Proteus, Pseudomonas, Klebsiella, and Enterobacter were isolated from milk samples of subclinical mastitis infected cattle. Among these Gram-negative isolates, 48% (24/50 were found either ESBL producing or tetracycline resistant. Out of total 50 Gram-negative isolates, blaCTX-M was detected in 18 (36% isolates, and 6 (12% harbored blaTEM genes in PCR. None of the isolates carried blaSHV genes. Further, in this study, 5 (10% isolates harbored tet(A gene, and 8 (16% isolates carried tet(B gene. No tet(C gene was detected from the isolates. Conclusion: This study showed emerging trend of antibiotic-resistant Gram-negative bacteria associated with subclinical mastitis in cattle in West Bengal, India.

  13. Doomed to drown? Sediment dynamics in the human-controlled floodplains of the active Bengal Delta

    Directory of Open Access Journals (Sweden)

    Kimberly G. Rogers

    2017-11-01

    Full Text Available The Ganges-Brahmaputra-Meghna (Bengal Delta in Bangladesh has been described as a delta in peril of catastrophic coastal flooding because sediment deposition on delta plain surfaces is insufficient to offset rates of subsidence and sea level rise. Widespread armoring of the delta by coastal embankments meant to protect crops from flooding has limited natural floodplain deposition, and in the tidally dominated delta, dikes lead to rapid compaction and lowered land surface levels. This renders the deltaic floodplains susceptible to flooding by sea level rise and storm surges capable of breaching poorly maintained embankments. However, natural physical processes are spatially variable across the delta front and therefore the impact of dikes on sediment dispersal and morphology should reflect these variations. We present the first ever reported sedimentation rates from the densely populated and human-controlled floodplains of the central lower Bengal Delta. We combine direct sedimentation measurements and short-lived radionuclides to show that transport processes and lateral sedimentation are highly variable across the delta. Overall aggradation rates average 2.3 ± 9 cm y–1, which is more than double the estimated average rate of local sea level rise; 83% of sampled sites contained sediment tagged with detectable 7 Be, indicating flood-pulse sourced sediments are widely delivered to the delta plain, including embanked areas. A numerical model is then used to demonstrate lateral accretion patterns arising from 50 years of sedimentation delivered through smaller order channels. Dominant modes of transport are reflected in the sediment routing and aggradation across the lower delta plain, though embankments are major controls on sediment dynamics throughout the delta. This challenges the assumption that the Bengal Delta is doomed to drown; rather it signifies that effective preparation for climate change requires consideration of how infrastructure

  14. Comparison of lidar-derived PM10 with regional modeling and ground-based observations in the frame of MEGAPOLI experiment

    Directory of Open Access Journals (Sweden)

    J.-C. Raut

    2011-10-01

    Full Text Available An innovative approach using mobile lidar measurements was implemented to test the performances of chemistry-transport models in simulating mass concentrations (PM10 predicted by chemistry-transport models. A ground-based mobile lidar (GBML was deployed around Paris onboard a van during the MEGAPOLI (Megacities: Emissions, urban, regional and Global Atmospheric POLlution and climate effects, and Integrated tools for assessment and mitigation summer experiment in July 2009. The measurements performed with this Rayleigh-Mie lidar are converted into PM10 profiles using optical-to-mass relationships previously established from in situ measurements performed around Paris for urban and peri-urban aerosols. The method is described here and applied to the 10 measurements days (MD. MD of 1, 15, 16 and 26 July 2009, corresponding to different levels of pollution and atmospheric conditions, are analyzed here in more details. Lidar-derived PM10 are compared with results of simulations from POLYPHEMUS and CHIMERE chemistry-transport models (CTM and with ground-based observations from the AIRPARIF network. GBML-derived and AIRPARIF in situ measurements have been found to be in good agreement with a mean Root Mean Square Error RMSE (and a Mean Absolute Percentage Error MAPE of 7.2 μg m−3 (26.0% and 8.8 μg m−3 (25.2% with relationships assuming peri-urban and urban-type particles, respectively. The comparisons between CTMs and lidar at ~200 m height have shown that CTMs tend to underestimate wet PM10 concentrations as revealed by the mean wet PM10 observed during the 10 MD of 22.4, 20.0 and 17.5 μg m−3 for lidar with peri-urban relationship, and POLYPHEMUS and CHIMERE models, respectively. This leads to a RMSE (and a MAPE of 6.4 μg m−3 (29.6% and 6.4 μg m−3 (27.6% when considering POLYPHEMUS and CHIMERE CTMs, respectively. Wet integrated PM10 computed (between the ground and 1 km above the ground level from lidar, POLYPHEMUS and CHIMERE results

  15. Sources and sinks of CO2 in the west coast of Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sarma, V.V.S.S.; Krishna, M.S.; Rao, V.D.; Viswanadham, R.; Kumar, N.A.; Kumari, T.R.; Gawade, L.; Ghatkar, S.; Tari, A.

    inthewestcoastof BayofBengal By V. V. S. S. SARMA 1 *, M. S. KRISHNA 1 ,V.D.RAO 1 , R. VISWANADHAM 1 , N. A. KUMAR 1 ,T.R.KUMARI 2 , L. GAWADE 1 ,S.GHATKAR 1 ANDA.TARI 1 1 NationalInstituteofOceanography,CouncilofScientificandIndustrialResearch(CSIR),176Lawsons... Access article distributed under the terms of the Creative Commons Attribution-Noncommercial 3.0 Unported License (http://creativecommons.org/licenses/by-nc/3.0/), permitting all non-commercial use, distribution, and reproduction in any medium, provided...

  16. Determination of inorganic radioiodine in 131I- Rose Bengal and 131I- bromosulphthalein

    International Nuclear Information System (INIS)

    Toledo e Souza, I.T. de; Pereira, N.P.S. de; Silva, C.P.G. da.

    1985-01-01

    A rapid miniaturized chromatographic system was developed for fast determination of the proportion of inorganic radioactive iodide from radiopharmaceuticals 131 I-Rose Bengal and 131 I-Bromosulphthalein. Using 33% W/V aqueous solution of ammonium sulphate pH 7,5 as a solvent Rf values for radiopharmaceuticals, iodide, iodate to Rf 0,0 0,5 0,9 respectively. The chromatographic quality control procedures are easy to use, rapid and can be incorporated in a routine quality control program. (Author) [pt

  17. Present scenario of hemoglobinopathies in West Bengal, India: An analysis of a large population

    OpenAIRE

    Prakas Kumar Mandal; Suman Kumar Maji; Tuphan Kanti Dolai

    2014-01-01

    Background: To find out the prevalence of hemoglobinopathies by screening large population in West Bengal from Eastern India. Materials and Methods: A total of 50,487 subjects are screened for hemoglobinopathies from June 2010 to August 2013. A 2.5 ml of venous blood samples were collected in the tri-potassium EDTA vacuum container from each subject and tested with automated blood cell counter (Sysmex KX21) for red cell indices. Diagnosis of hemoglobinopathies was done by VARIANT TM (Bio-Rad ...

  18. Post-tsunami oceanographic conditions in southern Arabian Sea and Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    AnilKumar, N.; Sarma, Y.V.B.; Babu, K.N.; Sudhakar, M.; Pandey, P.C.

    m depth. This high - salinity water mass was earlier ident i fied as Arabian Sea High Salinity Water mass ( ASHSW), which forms in the northern Arabian Sea du r- ing winter 12 . A pool of low - s a linity waters occupies the upper 50 m around... of t he Bay of Bengal du r ing the southwest monsoon season flows southward along the coast by the coastal currents during winter period 9 . The relatively high s a line waters (33.7 psu) are seen north of Nagapattinam, separating two low - salinity...

  19. Life cycle of eddies along the western boundary of the Bay of Bengal and their implications

    Digital Repository Service at National Institute of Oceanography (India)

    Nuncio, M.; PrasannaKumar, S.

    ., Antonov, J.I., 2002. World Ocean Atlas 2001: Objective Analysis, Data statistics and Figures, CD-ROM documentation, National Oceanographic Data center, Silver Spring, MD, 17pp Gopalan, A.K.S., GopalaKrishna, V.V. , Ali, M.M., Sharma, R., 2000.... Sci. 22, 12-16. Pond, S., G.L. Pickard, 1978. Introductory dynamic oceanography, Pergamon Press, Oxford, UK., 241pp. Potemra, J.T., M.E. Luther, J.J. O'brien, 1991. The seasonal circulation of the upper ocean in the Bay of Bengal, J...

  20. Geo-environmental changes and agricultural land development in Bengal Delta

    International Nuclear Information System (INIS)

    Miyamoto, Shinji; Uchida, Haruo; Ando, Kazuo; Salim, Muhammad

    2010-01-01

    We analyzed changes in the relationship between geo-environment and agricultural land development around the central Jamuna (Brahmaputra) River, central Bangladesh. Based on sedimentary facies analysis and AMS radiocarbon dating, some conclusions are as follows: (1) Natural levees along the Jamuna River formed until ca. 12 to 11 k cal yrs BP; (2) Homesteads (bari-bhiti) were repaired by public works (mati-kata) following some flood events; (3) Paddy fields and homesteads were created since ca. 1.3 k cal yrs BP around central Bangladesh (central Bengal Delta). (author)

  1. Seasonal and spatial distribution of particulate organic matter in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, L.; Bhosle, N.B.; Matondkar, S.G.P.; Bhushan, R.

    spatial differences were observed for the offshore stations in SPIM (Table 1). 3.4. POC and % POC In the Bay of Bengal, the surface POC concentrations ranged from 4.3 to 11.1 µMC, 3.1 to 10.9 µMC, and 4.3 to 9.0 µMC in the SWM, FIM, and SPIM.... This is NIO contribution no. 4435. 10 References Bale, A., Morris, A., 1998. Organic carbon in suspended particulate material in the North Sea: effect of mixing resuspended and background particles. Cont. Shelf Res. 18, 1333 –1345. Bates, N. R., Dennis, A...

  2. Comparison of publically available Moho depth and crustal thickness grids with newly derived grids by 3D gravity inversion for the High Arctic region.

    Science.gov (United States)

    Lebedeva-Ivanova, Nina; Gaina, Carmen; Minakov, Alexander; Kashubin, Sergey

    2016-04-01

    We derived Moho depth and crustal thickness for the High Arctic region by 3D forward and inverse gravity modelling method in the spectral domain (Minakov et al. 2012) using lithosphere thermal gravity anomaly correction (Alvey et al., 2008); a vertical density variation for the sedimentary layer and lateral crustal variation density. Recently updated grids of bathymetry (Jakobsson et al., 2012), gravity anomaly (Gaina et al, 2011) and dynamic topography (Spasojevic & Gurnis, 2012) were used as input data for the algorithm. TeMAr sedimentary thickness grid (Petrov et al., 2013) was modified according to the most recently published seismic data, and was re-gridded and utilized as input data. Other input parameters for the algorithm were calibrated using seismic crustal scale profiles. The results are numerically compared with publically available grids of the Moho depth and crustal thickness for the High Arctic region (CRUST 1 and GEMMA global grids; the deep Arctic Ocean grids by Glebovsky et al., 2013) and seismic crustal scale profiles. The global grids provide coarser resolution of 0.5-1.0 geographic degrees and not focused on the High Arctic region. Our grids better capture all main features of the region and show smaller error in relation to the seismic crustal profiles compare to CRUST 1 and GEMMA grids. Results of 3D gravity modelling by Glebovsky et al. (2013) with separated geostructures approach show also good fit with seismic profiles; however these grids cover the deep part of the Arctic Ocean only. Alvey A, Gaina C, Kusznir NJ, Torsvik TH (2008). Integrated crustal thickness mapping and plate recon-structions for the high Arctic. Earth Planet Sci Lett 274:310-321. Gaina C, Werner SC, Saltus R, Maus S (2011). Circum-Arctic mapping project: new magnetic and gravity anomaly maps of the Arctic. Geol Soc Lond Mem 35, 39-48. Glebovsky V.Yu., Astafurova E.G., Chernykh A.A., Korneva M.A., Kaminsky V.D., Poselov V.A. (2013). Thickness of the Earth's crust in the

  3. Extremely large anthropogenic-aerosol contribution to total aerosol load over the Bay of Bengal during winter season

    Directory of Open Access Journals (Sweden)

    D. G. Kaskaoutis

    2011-07-01

    Full Text Available Ship-borne observations of spectral aerosol optical depth (AOD have been carried out over the entire Bay of Bengal (BoB as part of the W-ICARB cruise campaign during the period 27 December 2008–30 January 2009. The results reveal a pronounced temporal and spatial variability in the optical characteristics of aerosols mainly due to anthropogenic emissions and their dispersion controlled by local meteorology. The highest aerosol amount, with mean AOD500>0.4, being even above 1.0 on specific days, is found close to the coastal regions in the western and northern parts of BoB. In these regions the Ångström exponent is also found to be high (~1.2–1.25 indicating transport of strong anthropogenic emissions from continental regions, while very high AOD500 (0.39±0.07 and α380–870 values (1.27±0.09 are found over the eastern BoB. Except from the large α380–870 values, an indication of strong fine-mode dominance is also observed from the AOD curvature, which is negative in the vast majority of the cases, suggesting dominance of an anthropogenic-pollution aerosol type. On the other hand, clean maritime conditions are rather rare over the region, while the aerosol types are further examined through a classification scheme based on the relationship between α and dα. It was found that even for the same α values the fine-mode dominance is larger for higher AODs showing the strong continental influence over the marine environment of BoB. Furthermore, there is also an evidence of aerosol-size growth under more turbid conditions indicative of coagulation and/or humidification over specific BoB regions. The results obtained using OPAC model show significant fraction of soot aerosols (~6 %–8 % over the eastern and northwestern BoB, while coarse-mode sea salt particles are found to dominate in the southern parts of BoB.

  4. Air-sea interaction and formation of the Asian summer monsoon onset vortex over the Bay of Bengal

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Guoxiong; Liu, Yimin; Mao, Jiangyu [Chinese Academy of Sciences, State Key Laboratory of Numerical Modeling for Atmospheric Sciences and Geophysical Fluid Dynamics (LASG), Institute of Atmospheric Physics, P.O. Box 9804, Beijing (China); Guan, Yue [Chinese Academy of Sciences, State Key Laboratory of Numerical Modeling for Atmospheric Sciences and Geophysical Fluid Dynamics (LASG), Institute of Atmospheric Physics, P.O. Box 9804, Beijing (China); Graduate University of Chinese Academy of Sciences, Beijing (China); Yan, Jinghui [China Meteorological Administration, National Climate Center, Beijing (China)

    2012-01-15

    In spring over the southern Bay of Bengal (BOB), a vortex commonly develops, followed by the Asian summer monsoon onset. An analysis of relevant data and a case study reveals that the BOB monsoon onset vortex is formed as a consequence of air-sea interaction over BOB, which is modulated by Tibetan Plateau forcing and the land-sea thermal contrast over the South Asian area during the spring season. Tibetan Plateau forcing in spring generates a prevailing cold northwesterly over India in the lower troposphere. Strong surface sensible heating is then released, forming a prominent surface cyclone with a strong southwesterly along the coastal ocean in northwestern BOB. This southwesterly induces a local offshore current and upwelling, resulting in cold sea surface temperatures (SSTs). The southwesterly, together with the near-equatorial westerly, also results in a surface anticyclone with descending air over most of BOB and a cyclone with ascending air over the southern part of BOB. In the eastern part of central BOB, where sky is clear, surface wind is weak, and ocean mixed layer is shallow, intense solar radiation and low energy loss due to weak surface latent and sensible heat fluxes act onto a thin ocean layer, resulting in the development of a unique BOB warm pool in spring. Near the surface, water vapor is transferred from northern BOB and other regions to southeastern BOB, where surface sensible heating is relatively high. The atmospheric available potential energy is generated and converted to kinetic energy, thereby resulting in vortex formation. The vortex then intensifies and moves northward, where SST is higher and surface sensible heating is stronger. Meanwhile, the zonal-mean kinetic energy is converted to eddy kinetic energy in the area east of the vortex, and the vortex turns eastward. Eventually, southwesterly sweeps over eastern BOB and merges with the subtropical westerly, leading to the onset of the Asian summer monsoon. (orig.)

  5. Modeling Tropical Cyclone Storm Surge and Wind Induced Risk Along the Bay of Bengal Coastline Using a Statistical Copula

    Science.gov (United States)

    Bushra, N.; Trepanier, J. C.; Rohli, R. V.

    2017-12-01

    High winds, torrential rain, and storm surges from tropical cyclones (TCs) cause massive destruction to property and cost the lives of many people. The coastline of the Bay of Bengal (BoB) ranks as one of the most susceptible to TC storm surges in the world due to low-lying elevation and a high frequency of occurrence. Bangladesh suffers the most due to its geographical setting and population density. Various models have been developed to predict storm surge in this region but none of them quantify statistical risk with empirical data. This study describes the relationship and dependency between empirical TC storm surge and peak reported wind speed at the BoB using a bivariate statistical copula and data from 1885-2011. An Archimedean, Gumbel copula with margins defined by the empirical distributions is specified as the most appropriate choice for the BoB. The model provides return periods for pairs of TC storm surge and peak wind along the BoB coastline. The BoB can expect a TC with peak reported winds of at least 24 m s-1 and surge heights of at least 4.0 m, on average, once every 3.2 years, with a quartile pointwise confidence interval of 2.7-3.8 years. In addition, the BoB can expect peak reported winds of 62 m s-1 and surge heights of at least 8.0 m, on average, once every 115.4 years, with a quartile pointwise confidence interval of 55.8-381.1 years. The purpose of the analysis is to increase the understanding of these dangerous TC characteristics to reduce fatalities and monetary losses into the future. Application of the copula will mitigate future threats of storm surge impacts on coastal communities of the BoB.

  6. Circulations in the Bay of Bengal and the Arabian Sea with Reference to Safe Disposal of Radioactive Wastes Near the Indian Coasts; Les Circulations dans les Eaux du Golfe du Bengale et de la Mer d'Oman et l'Elimination sans Danger des Dechets Radioactifs pres des Cotes Indiennes; 0426 0418 0420 0414 ; Circulaciones en el Golfo de Bengala e en el Mar Arabico con Relacion a la Evacuacion sin Riesgos de Desechos Radiactivos Frente al Litoral Indio

    Energy Technology Data Exchange (ETDEWEB)

    Rama Sastry, A. A. [Meteorological Office, Poona 5 (India)

    1960-07-01

    The author briefly reviews the general knowledge of oceanographic conditions in the Bay of Bengal and the Arabian Sea. On the basis of studies made for some years by the numerous oceanographic stations which operate along the coasts of India, the author studies such oceanographic conditions from the point of view of the safe disposal of radioactive wastes and, using data collected by various expeditions in the Indian Ocean, he studies the physical oceanography of the region north of the equator. Early knowledge of the oceanography of the Bay of Bengal and the Arabian Sea is briefly reviewed. In the light of the numerous oceanographic stations occupied along the coasts of India, in recent years, oceanographic conditions with reference to safe disposal of radioactive wastes into the sea are discussed. Also utilizing the data collected by different expeditions to the Indian Ocean, the physical oceanography of the region north of the equator has been studied. In the upper 200 m there are at least three different water masses both in the Bay of Bengal and the Arabian Sea. Because of very great dilution in the Bay of Bengal, the surface waters could be further sub-classified. From horizontal distributions of various oceanographic parameters, circulation at different levels along the Indian Coasts is given for the upper 150 m and the same is inferred down to 500 m from the vertical sections. The level of no motion seems to be well above the 500 m depth level and fluctuates both in space and time. Mixing of water is deduced from the T-S relations. The seasons of occurrence of upwelling and sinking along the coasts and the region affected are given. Intensity of up we I ling along the coast is more pronounced and during that period a complete overturning of water over the continental shelf takes place. In deeper levels, water masses in the order of their abundance are the Indian equatorial water, Antarctic intermediate water together with Red Sea water and a slight

  7. Rose Bengal Photothrombosis by Confocal Optical Imaging In Vivo: A Model of Single Vessel Stroke.

    Science.gov (United States)

    Talley Watts, Lora; Zheng, Wei; Garling, R Justin; Frohlich, Victoria C; Lechleiter, James Donald

    2015-06-23

    In vivo imaging techniques have increased in utilization due to recent advances in imaging dyes and optical technologies, allowing for the ability to image cellular events in an intact animal. Additionally, the ability to induce physiological disease states such as stroke in vivo increases its utility. The technique described herein allows for physiological assessment of cellular responses within the CNS following a stroke and can be adapted for other pathological conditions being studied. The technique presented uses laser excitation of the photosensitive dye Rose Bengal in vivo to induce a focal ischemic event in a single blood vessel. The video protocol demonstrates the preparation of a thin-skulled cranial window over the somatosensory cortex in a mouse for the induction of a Rose Bengal photothrombotic event keeping injury to the underlying dura matter and brain at a minimum. Surgical preparation is initially performed under a dissecting microscope with a custom-made surgical/imaging platform, which is then transferred to a confocal microscope equipped with an inverted objective adaptor. Representative images acquired utilizing this protocol are presented as well as time-lapse sequences of stroke induction. This technique is powerful in that the same area can be imaged repeatedly on subsequent days facilitating longitudinal in vivo studies of pathological processes following stroke.

  8. Metering of agricultural power supply in West Bengal, India: Who gains and who loses?

    International Nuclear Information System (INIS)

    Mukherji, A.; Das, B.; Majumdar, N.; Nayak, N.C.; Sethi, R.R.; Sharma, B.R.

    2009-01-01

    As a part of the ongoing power sector reforms in India, the state of West Bengal is in the process of metering agricultural electricity supply. This paper presents a first cut assessment of this initiative. Results suggest that the majority of the pump owners benefit from the reforms in two ways: first by having to pay a lower electricity bill for same usage and second through increased profit margins by selling water. This is because in response to the changed incentive structure, water prices rose sharply by 30-50% immediately after metering. In contrast, water buyers have lost out by having to pay higher water charges and face adverse terms of contract. Impact of metering on operation of groundwater markets and volume of groundwater extracted is less clear; they may expand, contract or remain unchanged, though water use efficiency is likely to go up. At current tariff rates, the electricity utilities are likely to earn less revenue than before. These findings are context specific and hold good for West Bengal where high flat tariff had fostered competitive groundwater markets and hence cannot be generalised for other Indian states.

  9. A study on association of smoking and gastric carcinoma in the residents of West Bengal

    Directory of Open Access Journals (Sweden)

    Ashis Kumar Saha, Goutam Chatterjee, Subhas Chandra Hazra

    2014-07-01

    Full Text Available Objectives: The aim of the study is to know the association of tobacco intake in the form of smoking and chewing with gastric carcinoma in West Bengal. Materials and methods: Total 28860 patients (smokers and tobacco chewer 17240, nonsmokers 11620 were interrogated before performing upper gastrointestinal endoscopy. Among the smokers and tobacco chewers, isolated bidi and cigarette smokers were 5067, 9323 and 2850 respectively. Among 542 gastric cancer cases, smokers were 301 (165 cigarette and 136 bidi smokers and tobacco chewers 82 respectively. Then comparisons were done: 1. to know the incidence of smokers and nonsmokers in total number of patients, the influence of bidi and cigarette smoking on gastric carcinoma, 3] Effects of the early starters and number of cigarettes/bidi per day on gastric carcinogenesis. Again, comparisons were done to know influence of bidi and cigarettes on the sites of gastric carcinoma. Results: Bidi smokers, earlier starters of smoking and significantly (P<0.0001 suffered from gastric carcinoma. Heavy drinkers were mostly affected (P<0.0001. Conclusions: Bidi smokers, young heavy smokers were mostly affected. So there were strong associations between bidi smoking and gastric carcinoma in the residents of West Bengal.

  10. The dynamics of arsenic in four paddy fields in the Bengal delta

    International Nuclear Information System (INIS)

    Stroud, Jacqueline L.; Norton, Gareth J.; Islam, M. Rafiqul; Dasgupta, Tapash; White, Rodger P.; Price, Adam H.; Meharg, Andrew A.; McGrath, Steve P.; Zhao Fangjie

    2011-01-01

    Irrigation with arsenic contaminated groundwater in the Bengal Delta may lead to As accumulation in the soil and rice grain. The dynamics of As concentration and speciation in paddy fields during dry season (boro) rice cultivation were investigated at 4 sites in Bangladesh and West Bengal, India. Three sites which were irrigated with high As groundwater had elevated As concentrations in the soils, showing a significant gradient from the irrigation inlet across the field. Arsenic concentration and speciation in soil pore water varied temporally and spatially; higher As concentrations were associated with an increasing percentage of arsenite, indicating a reductive mobilization. Concentrations of As in rice grain varied by 2-7 fold within individual fields and were poorly related with the soil As concentration. A field site employing alternating flooded-dry irrigation produced the lowest range of grain As concentration, suggesting a lower soil As availability caused by periodic aerobic conditions. - Research highlights: → Irrigation with As-contaminated groundwater resulted in a gradient of As concentration in the soil. → Arsenic concentration in paddy standing water decreased as arsenite was oxidised to arsenate. → Soil pore water As increased with the %arsenite, suggesting reductive mobilisation. → Alternative flooded-dry conditions led to lowest range of As concentration in rice grain. - Spatial variations of arsenic concentrations in paddy soil and waters do not correlate to within-field variations of arsenic concentrations in rice grain.

  11. Molecular analysis of microbial community in arsenic-rich groundwater of Kolsor, West Bengal.

    Science.gov (United States)

    Sarkar, Angana; Paul, Dhiraj; Kazy, Sufia K; Sar, Pinaki

    2016-01-01

    Bacterial community composition within the highly arsenic (As) contaminated groundwater from Kolsur, West Bengal was analyzed over a period of 3 years using 16S rRNA gene clone library and Denaturing Gradient Gel Electrophoresis (DGGE). Molecular phylogenetic study revealed abundance of α-Proteobacteria (56%) and Firmicutes (29%) along with members of β-Proteobacteria, Verrucomicrobia and Sphingobacteria as relatively minor groups. Along with consistent physicochemical environment, a stable microbial community structure comprising of bacterial genera Agrobacterium-Rhizobium, Ochrobactrum, Pseudomonas, Anoxybacillus and Penibacillus was recorded over the three years study period. Presence of cytosolic arsenate reductase (arsC) gene was observed within the microbial community. Phylogenetic analyses revealed that all the arsC sequences were closely related to the same gene from γ-proteobacterial members while the community was consisted of mainly α-proteobacterial groups. Such phylogenetic incongruence between 16S rRNA and arsC genes possibly indicated horizontal gene transfer (HGT) of the ars genes within the groundwater community. Overall, the study reported a nearly stable geomicrobial environment and genetic determinant related to As homeostasis gene, and provided a better insight on biogeochemistry of As contaminated aquifer of West Bengal.

  12. The development of mental hospitals in West Bengal: A brief history and changing trends.

    Science.gov (United States)

    Bhattacharyya, Ranjan

    2018-02-01

    The communication between G. S Bose and Sigmund Freud is a well-documented fact, and philosophical blend of rich cultural experiences is unique to modification of traditional psychoanalysis in the context of development of psychiatry in West Bengal. The Calcutta lunatic asylum was established at Bhowanipore, and first general hospital psychiatric unit was formed at R. G. Kar Medical College, Calcutta. Prof. Ajita Chakraborty was a pioneer to describe her struggling days in the early career and shared her views with experiences in her autobiography. The volume and quality of research work, especially in the field of epidemiology led by Dr. D. N. Nandi is worth mentioning. A jail had been converted to mental hospital which is the largest in terms of bed strength ( n = 350) at Berhampore, Murshidabad district where Kazi Nazrul Islam and Netaji Subhas Chandra Bose had spent some period as prisoner during British rules. Bankura was the first district in West Bengal to start District Mental Health program. The various nongovernmental organizations are working together in public-private partnership model or indigenous ways in tandem over years for the betterment of mental health services both at institutional and community level.

  13. Is Ramadan Fasting Cardio-protective? A Study in a Village of West Bengal

    Directory of Open Access Journals (Sweden)

    Aparajita Dasgupta

    2017-06-01

    Full Text Available Background: Islam is the second largest religion of the World (23% and Muslims are the second largest majority of Indian Republic (14.3%. Ramadan is the ninth and holiest month(Hijra of the 12-month Islamic calendar during which Muslims fast from dawn to dusk each day maintaining certain rules (consuming food/drink once, avoiding smoking and sexual activity, as well as impure thoughts, words and immoral behavior. It is observed by Muslims as a month of fasting to commemorate the first revelation of the Qur'an to Muhammad. Aims & Objectives: To evaluate the effect of Ramadan on cardio-metabolic profile among adult Muslims residing in rural West Bengal. Methods and Materials: The present study was a longitudinal community based study done among 43 Muslims residing in a village of West Bengal during 6thJune to 7th July 2016. Cardio-metabolic profile (physical activity, diet, BMI, blood pressure, blood lipids and glucose were assessed before, during and after Ramadan. Results: There was a significant reduction in VLDL and TG level while significant elevation in HDL level along with the reduction in Framingham risk score after fasting. All the anthropometric measurements along with blood pressure reduced significantly after Ramadan with significant reduction in intake of all micro-nutrients during Ramadan. However physical activity also reduced significantly during Ramadan. Conclusion: Our study had found no detrimental effects of Ramadan fasting on the contrary has an overall beneficial effect on cardiovascular profile was observed.

  14. Shore protection for the coast of Mousuni Island in West Bengal, India

    Directory of Open Access Journals (Sweden)

    V Sundar

    2016-08-01

    Full Text Available The Mousuni Island in West Bengal, India is wide-open to Bay of Bengal. This island by virtue of its location is exposed to river flow as well as wave action. It is thus subjected to severe erosion along its south-western coastal stretch and also significantly affecting agriculture due to seawater inundation. This is due to the lower level of bund crest elevation combined with high water levels during coastal flooding. The most suitable method to arrest the shore erosion and salt water intrusion is to divert the flow gradually toward the deeper section of the channel. To meet this requirement, after carrying out a comprehensive profiling of the existing bund, bank connected series of spurs with locally available construction materials and unskilled labor are proposed. In order to design these spurs, the magnitude and direction of sediment movement along the stretch is estimated. The layout of protection measures is proposed based on a detailed analysis of site conditions and the environmental conditions. The tranquility inside the proposed coastal protecting structure is substantiated with a two-dimensional horizontal flow model. Furthermore, the behavior of the shorelines has been studied numerically with the proposed coastal protection measure. The detailed analysis of the results from the numerical model and the protection measure are discussed in this article.

  15. Serum Chemistry Variables of Bengal Tigers (Panthera tigris tigris Kept in Various Forms of Captivity

    Directory of Open Access Journals (Sweden)

    U. Farooq*, S. Sajjad1, M. Anwar1 and B.N. Khan2

    2012-05-01

    Full Text Available There is a dearth of published literature regarding the effect of captivity on serum chemistry variables of tigers kept in the zoos and wildlife sanctuaries. The present study was hence conducted to determine and compare serum chemistry values in tigers of Bengal origin (Panthera tigris tigris kept in captivity at Lahore zoo (LZ (n=4 and in semi natural environment of Lahore Wildlife Park (LWP (n=6, Pakistan. The tigers kept at LZ had significantly (P<0.05 higher mean concentrations of Cl- (108.6±0.57 versus 105.6±0.49 mmol/l and a significantly lower creatinine (1.78±0.06 versus 3.04±0.35mg/dl and AST values (41.66±0.77 versus 54.88±4.22 U/l than tigers kept at LWP. No other significant differences in serum chemistry were observed for both forms of captivity. Results would be useful for the evaluation of physiological and pathological alterations in wild and captive tiger individuals and populations not only in Pakistan but also for other countries harboring the Bengal tigers.

  16. Menstruation and menstrual hygiene among adolescent girls of West Bengal, India: A school based comparative study

    Directory of Open Access Journals (Sweden)

    Adrija Datta

    2012-11-01

    Full Text Available Background: Adolescents are often less informed, less experienced, and less comfortable accessing reproductive health information and services than adults. In many developing countries, a culture of silence surrounds the topic of menstruation and related issues; as a result many young girls lack appropriate and sufficient information regarding menstrual hygiene. This may result in incorrect and unhealthy behaviour during their menstrual period. Objectives: To assess and compare knowledge, belief, ideas, source of knowledge and practice of menstrual hygiene between school-going adolescents in an urban and a rural school of West Bengal, India. Methods: Cross-sectional, descriptive study was conducted among adolescent female students of Howrah district of West Bengal, India in the year 2011. Data was collected by pre-designed, pre-tested semi-structured self administered questionnaire. Results: The mean age at menarche was 12.1 years among urban and 12.2 years among the rural participants. More than 80% participants had some restrictions imposed during menstruation. Significantly higher number of urban girls had pre-menarchal knowledge on menstruation and used sanitary napkins. Conclusions: Menstrual hygiene is a vital aspect of health education for adolescent girls. For improvement of menstrual hygiene, sanitary napkins should be made universally available and affordable.

  17. Menstruation and menstrual hygiene among adolescent girls of West Bengal, India: A school based comparative study

    Directory of Open Access Journals (Sweden)

    Adrija Datta

    2012-01-01

    Full Text Available Background: Adolescents are often less informed, less experienced, and less comfortable accessing reproductive health information and services than adults. In many developing countries, a culture of silence surrounds the topic of menstruation and related issues; as a result many young girls lack appropriate and sufficient information regarding menstrual hygiene. This may result in incorrect and unhealthy behaviour during their menstrual period. Objectives: To assess and compare knowledge, belief, ideas, source of knowledge and practice of menstrual hygiene between school-going adolescents in an urban and a rural school of West Bengal, India. Methods: Cross-sectional, descriptive study was conducted among adolescent female students of Howrah district of West Bengal, India in the year 2011. Data was collected by pre-designed, pre-tested semi-structured self administered questionnaire. Results: The mean age at menarche was 12.1 years among urban and 12.2 years among the rural participants. More than 80% participants had some restrictions imposed during menstruation. Significantly higher number of urban girls had pre-menarchal knowledge on menstruation and used sanitary napkins. Conclusions: Menstrual hygiene is a vital aspect of health education for adolescent girls. For improvement of menstrual hygiene, sanitary napkins should be made universally available and affordable.

  18. Chronic natural arsenic exposure affecting histoarchitecture of gonads in Black Bengal goats (Capra aegagrushircus

    Directory of Open Access Journals (Sweden)

    Md. Abdul Wares

    2015-06-01

    Full Text Available Arsenic is a major water pollutant that may cause serious health hazard (e.g., infertility in human and animal. We evaluated the changes in histoarchitecture of testes and ovaries of adult Black Bengal goats (n=10 reared in arsenic affected areas in Bangladesh. Grossly, we found insignificant variations among the testes and ovaries, but histological evaluation revealed an extensive alteration in morphology of both testes and ovaries in the arsenic affected goats. In testes, the thickening of tunica albugenia and trabeculae, widening of intertubular space between seminiferous tubules, and narrowing in diameter of seminiferous tubules were observed. In ovaries of arsenic affected goats, significant decrease in number of primary follicles and antral follicles were observed. The diameters of secondary and antral follicles were significantly reduced. The granulosa layer of antral follicles showed marked thickening. The findings indicate that chronic arsenic exposure alters the histoarchitecture of both male and female gonads in Black Bengal goat, and thereby may affect their reproductive performance.

  19. Spectral Wave Characteristics in the Nearshore Waters of Northwestern Bay of Bengal

    Science.gov (United States)

    Anjali Nair, M.; Sanil Kumar, V.; Amrutha, M. M.

    2018-03-01

    The spectral wave characteristics in the nearshore waters of northwestern Bay of Bengal are presented based on the buoy-measured data from February 2013 to December 2015 off Gopalpur at 15-m water depth. The mean seasonal significant wave height and mean wave period indicate that the occurrence of higher wave heights and wave periods is during the southwest monsoon period (June-September). 74% of the sea surface height variance in a year is a result of waves from 138 to 228° and 16% are from 48 to 138°. Strong inter-annual variability is observed in the monthly average wave parameters due to the occurrence of tropical cyclones. Due to the influence of the tropical cyclone Phailin, maximum significant wave height of 6.7 m is observed on 12 October 2013 and that due to tropical cyclone Hudhud whose track is 250 southwest of the study location is 5.84 m on 12 October 2014. Analysis revealed that a single tropical cyclone influenced the annual maximum significant wave height and not the annual average value which is almost same ( 1 m) in 2014 and 2015. The waves in the northwestern Bay of Bengal are influenced by the southwest and northeast monsoons, southern ocean swells and cyclones.

  20. Characterization of aqueous rose bengal dye solution for the measurement of low doses of gamma radiation

    International Nuclear Information System (INIS)

    Hasan Mahmood Khan; Khan, A.A.

    2010-01-01

    Aqueous solution of rose bengal dye has been studied spectrophotometrically as a gamma-ray dosimeter for the measurement of low doses of radiation. The useful dose range was found to be from 50 to 1000 Gy when the measurements were made at 549 nm. The effects of temperature and light conditions on the stability of response during post-irradiation storage were also investigated. When stored in dark at room temperature, the dosimetric solutions showed a stable response up to 22 days. The storage of irradiated solutions in diffused sunlight showed a stable response only up to 6 days. When exposed to direct sunlight, very prominent and fast bleaching of dye solution occurred. At low storage temperature (ca. 11 deg C), dosimetric response was found to be stable up to 22 days while at higher temperature (ca. 30 deg C), the response of dosimetric solution was stable only up to 6 days. The rose bengal aqueous solution showed promising characteristics as a low dose radiation dosimeter when stored at lower temperatures (<25 deg C) in dark. (author)

  1. HAEMATOLOGICAL IMPACT OF NATURALLY OCCURING TICK BORNE HAEMOPARASITIC INFECTIONS IN CATTLE OF WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Apurba Debbarma

    2017-12-01

    Full Text Available Haemoparasites reduces productivity and may lead to high mortality among animals. The present study was carried out to evaluate the heamotological change in cattle of different districts in West Bengal, India affected with naturally occurring tick- borne haemoparasitic diseases (TBHD. A total of 310 cattle blood samples were screened for the presence of haemoparasites from July, 2015 to June, 2016. The blood samples were examined for haemoparasites by making thin blood smear and staining with Giemsa’s stain. The result showed that108 (34.84% cattle were found positive with TBHD, out of which 22.9% were Theileria sp, 5.8% were Babesia sp., 11.93% Anaplasma sp., and 5.8% were having mixed infection, respectively. The positive samples were subjected to estimations of haematological parameters i. e. Haemoglobin concentration (Hb, packed cell volume (PCV, total erythrocyte count (TEC and Total leucocytes count (TLC using standard protocol. The haematological analysis showed statistically a significant (p<0.01 decreased levels of Hb, PCV, TEC and TLC in infected groups of cattle compared to infection free group cattle. This is probably the first systematic report in West Bengal, India. The result showed the haemoparasites have a negative impact on haematological parameters. This study may be useful in disease epidemiological map preparation, parasitic control policy preparation of the study areas.

  2. The Significance Of Experience Of West Bengal For Poverty Alleviation In Bangladesh

    Directory of Open Access Journals (Sweden)

    A. A. Nemova

    2017-01-01

    Full Text Available The article analyzes socio-economic problems and ways of eliminating poverty in Bangladesh. The focal point of the research is poverty among rural population which is the most vulnerable one. The author’s assumption is that the main reason for rural poverty is historical inequality of land property distribution in Bangladesh. The existing measures of poverty alleviation in Bangladesh (micro crediting among others have made the country a role model for development. However, due to the limited potential of micro crediting a broader program of socio-economic reforms is required for any country striving to provide inclusive development. Using comparative-historical method the article compares the experience of Bangladesh and Indian state of West Bengal in implementing agricultural reforms aimed at improving life of the poor. West Bengal under the CPM rule is considered as a state with strong government whereas Bangladesh is considered as a state with weak government but rather strong non-governmental actors (NGOs. The article makes a conclusion that a weak institutional power of Bangladesh is one of the main reasons why agricultural reforms have not been adopted in this country and that poverty elimination there requires structural reforms to redistribute land property and to guarantee rural population legal and economic equality.

  3. Human immunodeficiency virus-associated lipodystrophy: an objective definition based on dual-energy x-ray absorptiometry-derived regional fat ratios in a South Asian population.

    Science.gov (United States)

    Asha, Hesarghatta Shyamasunder; Seshadri, Mandalam Subramaniam; Paul, Thomas Vizhalil; Abraham, Ooriapadickal Cherian; Rupali, Priscilla; Thomas, Nihal

    2012-01-01

    To develop an objective definition of human immunodeficiency virus (HIV)-associated lipodystrophy by using regional fat mass ratios and to assess the utility of anthropometric and skinfold measurements in the initial screening for lipodystrophy. Male patients between 25 and 50 years old with proven HIV infection (highly active antiretroviral therapy [HAART]-naïve subjects and those receiving successful HAART) were studied and compared with body mass index (BMI)-matched HIV-negative control subjects. Anthropometric variables, body composition, dual-energy x-ray absorptiometry findings, and metabolic variables were compared among the 3 study groups and between those patients with and those without lipodystrophy. Trunk fat/lower limb fat mass ratio >2.28 identified 54.3% of patients with HIV receiving HAART as having lipodystrophy and had the highest odds ratio for predicting metabolic syndrome. The "clinical diagnosis of lipodystrophy" and the "clinical scoring system" had too many false-positive and false-negative results. Triceps skinfold thickness (SFT)/BMI ratio ≤0.49 and abdominal SFT/triceps SFT ratio >1.385 have good sensitivity but poor specificity in identifying lipodystrophy. In comparison with HAART-naïve patients with HIV, those receiving HAART had significantly higher insulin resistance, and a significantly greater proportion had impaired glucose tolerance and dyslipidemia. Among patients receiving HAART, those with lipodystrophy had a greater degree of insulin resistance, higher triglyceride levels, and lower levels of high-density lipoprotein cholesterol. The trunk fat/lower limb fat mass ratio in BMI-matched normal subjects can be used to derive cutoff values to define lipodystrophy objectively in HIV-infected patients. Defining lipodystrophy in this way is better than other methods of identifying those patients with increased cardiovascular risk. Triceps SFT/BMI and abdominal SFT/triceps SFT ratios may be useful as screening tools in resource

  4. Observations of 1,1-difluoroethane (HFC-152a) at AGAGE and SOGE monitoring stations in 1994-2004 and derived global and regional emission estimates

    Science.gov (United States)

    Greally, B. R.; Manning, A. J.; Reimann, S.; McCulloch, A.; Huang, J.; Dunse, B. L.; Simmonds, P. G.; Prinn, R. G.; Fraser, P. J.; Cunnold, D. M.; O'Doherty, S.; Porter, L. W.; Stemmler, K.; Vollmer, M. K.; Lunder, C. R.; Schmidbauer, N.; Hermansen, O.; Arduini, J.; Salameh, P. K.; Krummel, P. B.; Wang, R. H. J.; Folini, D.; Weiss, R. F.; Maione, M.; Nickless, G.; Stordal, F.; Derwent, R. G.

    2007-03-01

    Ground-based in situ measurements of 1,1-difluoroethane (HFC-152a, CH3CHF2) which is regulated under the Kyoto Protocol are reported under the auspices of the AGAGE (Advanced Global Atmospheric Gases Experiment) and SOGE (System of Observation of halogenated Greenhouse gases in Europe) programs. Observations of HFC-152a at five locations (four European and one Australian) over a 10 year period were recorded. The annual average growth rate of HFC-152a in the midlatitude Northern Hemisphere has risen from 0.11 ppt/yr to 0.6 ppt/yr from 1994 to 2004. The Southern Hemisphere annual average growth rate has risen from 0.09 ppt/yr to 0.4 ppt/yr from 1998 to 2004. The 2004 average mixing ratio for HFC-152a was 5.0 ppt and 1.8 ppt in the Northern and Southern hemispheres, respectively. The annual cycle observed for this species in both hemispheres is approximately consistent with measured annual cycles at the same locations in other gases which are destroyed by OH. Yearly global emissions of HFC-152a from 1994 to 2004 are derived using the global mean HFC-152a observations and a 12-box 2-D model. The global emission of HFC-152a has risen from 7 Kt/yr to 28 Kt/yr from 1995 to 2004. On the basis of observations of above-baseline elevations in the HFC-152a record and a consumption model, regional emission estimates for Europe and Australia are calculated, indicating accelerating emissions from Europe since 2000. The overall European emission in 2004 ranges from 1.5 to 4.0 Kt/year, 5-15% of global emissions for 1,1-difluoroethane, while the Australian contribution is negligible at 5-10 tonnes/year, <0.05% of global emissions.

  5. Mapping of Daily Mean Air Temperature in Agricultural Regions Using Daytime and Nighttime Land Surface Temperatures Derived from TERRA and AQUA MODIS Data

    Directory of Open Access Journals (Sweden)

    Ran Huang

    2015-07-01

    Full Text Available Air temperature is one of the most important factors in crop growth monitoring and simulation. In the present study, we estimated and mapped daily mean air temperature using daytime and nighttime land surface temperatures (LSTs derived from TERRA and AQUA MODIS data. Linear regression models were calibrated using LSTs from 2003 to 2011 and validated using LST data from 2012 to 2013, combined with meteorological station data. The results show that these models can provide a robust estimation of measured daily mean air temperature and that models that only accounted for meteorological data from rural regions performed best. Daily mean air temperature maps were generated from each of four MODIS LST products and merged using different strategies that combined the four MODIS products in different orders when data from one product was unavailable for a pixel. The annual average spatial coverage increased from 20.28% to 55.46% in 2012 and 28.31% to 44.92% in 2013.The root-mean-square and mean absolute errors (RMSE and MAE for the optimal image merging strategy were 2.41 and 1.84, respectively. Compared with the least-effective strategy, the RMSE and MAE decreased by 17.2% and 17.8%, respectively. The interpolation algorithm uses the available pixels from images with consecutive dates in a sliding-window mode. The most appropriate window size was selected based on the absolute spatial bias in the study area. With an optimal window size of 33 × 33 pixels, this approach increased data coverage by up to 76.99% in 2012 and 89.67% in 2013.

  6. Hydronephrosis with ureteritis developed in C57BL/6N mice carrying the congenic region derived from MRL/MpJ-type chromosome 11.

    Science.gov (United States)

    Ichii, Osamu; Chihara, Masataka; Lee, Shin-Hyo; Nakamura, Teppei; Otsuka-Kanazawa, Saori; Horino, Taro; Elewa, Yaser Hosny Ali; Kon, Yasuhiro

    2017-03-01

    Inbred MRL/MpJ mice show several unique phenotypes in tissue regeneration processes and the urogenital and immune systems. Clarifying the genetic and molecular bases of these phenotypes requires the analysis of their genetic susceptibility locus. Herein, hydronephrosis development was incidentally observed in MRL/MpJ-derived chromosome 11 (D11Mit21-212)-carrying C57BL/6N-based congenic mice, which developed bilateral or unilateral hydronephrosis in both males and females with 23.5% and 12.5% prevalence, respectively. Histopathologically, papillary malformations of the transitional epithelium in the pelvic-ureteric junction seemed to constrict the ureter luminal entrance. Characteristically, eosinophilic crystals were observed in the lumen of diseased ureters. These ureters were surrounded by infiltrating cells mainly composed of numerous CD3 +  T-cells and B220 +  B-cells. Furthermore, several Iba-1 +  macrophages, Gr-1 +  granulocytes, mast cells and chitinase 3-like 3/Ym1 (an important inflammatory lectin)-positive cells were detected. Eosinophils also accumulated to these lesions in diseased ureters. Some B6.MRL-(D11Mit21-D11Mit212) mice had duplicated ureters. We determined >100 single nucleotide variants between C57BL/6N- and MRL/MpJ-type chromosome 11 congenic regions, which were associated with nonsynonymous substitution, frameshift or stopgain of coding proteins. In conclusion, B6.MRL-(D11Mit21-D11Mit212) mice spontaneously developed hydronephrosis due to obstructive uropathy with inflammation. Thus, this mouse line would be useful for molecular pathological analysis of obstructive uropathy in experimental medicine.

  7. Changes in intense tropical cyclone activity for the western North Pacific during the last decades derived from a regional climate model simulation

    Science.gov (United States)

    Barcikowska, Monika; Feser, Frauke; Zhang, Wei; Mei, Wei

    2017-11-01

    An atmospheric regional climate model (CCLM) was employed to dynamically downscale atmospheric reanalyses (NCEP/NCAR 1, ERA 40) over the western North Pacific and South East Asia. This approach is used for the first time to reconstruct a tropical cyclone climatology, which extends beyond the satellite era and serves as an alternative data set for inhomogeneous observation-derived records (Best Track Data sets). The simulated TC climatology skillfully reproduces observations of the recent decades (1978-2010), including spatial patterns, frequency, lifetime, trends, variability on interannual and decadal time scales and their association with the large-scale circulation patterns. These skills, facilitated here with the spectral nudging method, seem to be a prerequisite to understand the factors determining spatio-temporal variability of TC activity over the western North Pacific. Long-term trends (1948-2011 and 1959-2001) in both simulations show a strong increase of intense tropical cyclone activity. This contrasts with pronounced multidecadal variations found in observations. The discrepancy may partly originate from temporal inhomogeneities in atmospheric reanalyses and Best Track Data, which affect both the model-based and observational-based trends. An adjustment, which removes the simulated upward trend, reduces the apparent discrepancy. Ultimately, our observational and modeling analysis suggests an important contribution of multi-decadal fluctuations in the TC activity during the last six decades. Nevertheless, due to the uncertainties associated with the inconsistencies and quality changes of those data sets, we call for special caution when reconstructing long-term TC statistics either from atmospheric reanalyses or Best Track Data.

  8. Sedimentology and arsenic pollution in the Bengal Basin: insight into arsenic occurrence and subsurface geology.

    Science.gov (United States)

    Hills, Andrew; McArthur, John

    2014-05-01

    The Bengal delta system is a geologically recent feature overlying a deeply incised palaeo-surface formed during the Last Glacial Maximum. This surface is a series of terraces and valleys created by river incision (Goodbred & Kuehl 2003). The terraces were weathered, forming a thin, indurated laterite deposit (Goodbred & Kuehl 2000) at depths greater than 50 m. McArthur et al. (2008) define this as a palaeosol and have identified it at depths greater than 30 m though out Bangladesh and West Bengal. It has been observed that arsenic concentrations at these sites are lower than the rest of the delta. It has been assumed that the surface morphology at sites where there is a palaeosol are similar and can therefore be characterised by remote sensing, in the form of Google Earth images. Sites were selected in Bangladesh and West Bengal, from work by McArthur et al. (2011); Hoque et al. (2012), where groundwater chemistry and sedimentology data are available making it possible to determine if the subsurface is a palaeo-channel or palaeo-interfluve. Arsenic concentration data have been inputted into Google Earth and the palaeo-channels marked where the arsenic concentration is greater than 10 µg/L, and palaeo-interfluves where arsenic concentration is less than 10 µg/L. The surface morphologies in these domains have been examined for similarities, and it was shown that avulsion scars and abandoned river channels are found where arsenic concentrations are greater than 10 µg/L. Conversely the surrounding areas that are devoid of channel scars have arsenic concentrations less than 10 µg/L. Using the correlation between avulsion features being representative of palaeo-channels and high arsenic concentrations, sites were selected that had a similar surface morphology to the type localities. A comparison of these images and arsenic concentrations showed that the postulate is valid for over 80 percent of cases. Where this is not valid, this could indicate that the subsurface

  9. Anicteric dilatation of the biliary tree demonstrated by ultrasound 131I rose bengal liver scan and PTC

    International Nuclear Information System (INIS)

    Kapoor, R.; Saha, M.M.; Gupta, A.K.

    1991-01-01

    An uncommon case of gross dilatation of biliary tract, without clinical or biochemical evidence of jaundice, is presented. Dilatation of bile ducts was initially demonstrated on ultrasound and it was subsequently confirmed by 131 I rose bengal liver can, PTC and at surgery. (author). 6 refs., 3 figs

  10. Corrosion of metals and alloys in the coastal and deep waters of the Arabian Sea and the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Sawant, S.S.; Venkat, K.; Wagh, A.B.

    Corrosion rate of mild steel (MS), stainless steel (SS), copper, brass and cupro-nickel has been determinEd. by exposing metallic coupons in coastal and oceanic waters of the Arabian Sea and Bay of Bengal. Amongst the metals and alloys under study...

  11. The fauna of brackish ponds at Port Canning, Lower Bengal Part 1 - Introduction and Preliminary Account of the Fauna

    Digital Repository Service at National Institute of Oceanography (India)

    Annandale, N.

    A general survey the fauna of brackishwater ponds at Port Canning, Lower Bengal, India, was carried out The Port Canning is situated on the Matla river having numerous creeks which runup into the delta of the Ganges about sixty miles from the open...

  12. Differential response of winter cooling on biological production in the northeastern Arabian Sea and northwestern Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Jyothibabu, R.; Maheswaran, P.A; Madhu, N.V.; Asharaf, T.T.M.; Gerson, V.J.; Haridas, P.; Venugopal, P.; Revichandran, C.; Nair, K.K.C.; Gopalakrishnan, T.C.

    The northern parts of the twin seas bordering the Indian subcontinent, the Arabian Sea (AS) and Bay of Bengal (BOB), were studied during the winter monsoon. Higher biological production was observed in the AS (chlorophyll a 47.5 mg m sup(-2...

  13. Coupling between suboxic condition in sediments of the western Bay of Bengal and southwest monsoon intensification: A geochemical study

    Digital Repository Service at National Institute of Oceanography (India)

    Pattan, J.N; Mir, I.A.; Parthiban, G.; Karapurkar, S.G.; Matta, V.M.; Naidu, P.D.; Naqvi, S.W.A.

    Reconstruction of paleo-redox conditions in a radiocarbon (14C) dated sediment core (SK-218/1), covering the past 45 ka (thousand calendar years), collected from the western Bay of Bengal (Lat: 14 degrees 02′N; Long: 82 degrees 00′E) at a water...

  14. Geochemical characterization of the Krishna–Godavari and Mahanadi offshore basin (Bay of Bengal) sediments: A comparative study of provenance

    Digital Repository Service at National Institute of Oceanography (India)

    Mazumdar, A.; Kocherla, M.; Carvalho, M.A.; Peketi, A.; Joshi, R.K.; Mahalaxmi, P.; Joao, H.M.; Jisha, R.

    and further extends offshore into the Bay of Bengal (Fig. 1).  It is a passive pericratonic basin covering an area of 260,000 km2 with water depth exceeding 3000 m (including deep offshore) (Singh, 2008). The Mahanadi offshore area represents a pull...

  15. Acoustic propagations in the presence of a subsurface cold core eddy in the Bay of Bengal - A case study

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Navelkar, G.S.; Murty, T.V.R.; Murty, C.S.

    Acoustic characteristics of a cold core eddy, observed in the Bay of Bengal during southwest monsoon period is studied using CTD data along the western boundary. The presence of eddy brings about a reduction in the ambient sound speEd. by 10 m.s sup...

  16. Thermal response of upper layers of Bay of Bengal to forcing of a severe cyclonic storm: A case study

    Digital Repository Service at National Institute of Oceanography (India)

    Gopalakrishna, V.V.; Murty, V.S.N.; Sarma, M.S.S.; Sastry, J.S.

    Upper ocean response to forcing of a severe cyclonic storm during May 1990 in the western Bay of Bengal was studied using the XBT data sets collected (4 d after passage of storm) under Indian TOGA programme. A maximum lowering in the sea surface...

  17. The effect of semi-permanent eddies on the distribution of mesozooplankton in the central Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, V.

    Five locations in the central Bay of Bengal (BoB) along a longitudinal transect at 88E were sampled during the Fall Intermonsoon, 2002 for mesozooplankton biomass, abundance, groups and copepod species composition. Stations at 9N and 18N had...

  18. Past 20,000-year history of Himalayan aridity: Evidence from oxygen isotope records in the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O.S.

    Late Quaternary climate history of the Himalayas is inferred from sea surface salinity (SSS) changes determined from the oxygen isotope in planktonic foraminifers, in a turbidity-free, 14C-dated core from the Bay of Bengal. The heaviest d18O...

  19. Hydrocarbons in the Bay of Bengal and Central Indian Basin bottom sediments: Indicators of geochemical processes in the lithosphere

    Digital Repository Service at National Institute of Oceanography (India)

    Chernova, T.G.; Paropkari, A.L.; Pikovskii, Yu.I.; Alekseeva, T.A.

    A study on the bulk distributions and molecular structures of n-alkanes and polycyclic aromatic hydrocarbons (PAH) in organic matter of the sediments from the Bay of Bengal and the Eastern and Central Indian Basins was underdaken. The former two...

  20. Simulation of barotropic wind-driven circulation in tbe Bay of Bengal and Andaman Sea during premonsoon and postmonsoon seasons

    Digital Repository Service at National Institute of Oceanography (India)

    Unnikrishnan, A.S.; Bahulayan, N.

    Two-dimensional vertically integrated model has been used to simulate depth-mean wind-driven circulation during premonsoon and postmonsoon seasons in the upper layers of the Bay of Bengal and Andaman Sea. The model is integrated for 365 d, forcEd...

  1. Towards Ladyland: Rokeya Sakhawat Hossain and the Movement for Women's Education in Bengal, "c." 1900-"c." 1932

    Science.gov (United States)

    Bagchi, Barnita

    2009-01-01

    This paper analyses the work of Rokeya Sakhawat Hossain (1880-1932), urban Bengali Muslim educator and writer, placing her in the wider context of women organising themselves in associations to create social change through education for women, in the province of undivided Bengal in colonial India, from "c." 1900 to "c." 1932. A…

  2. Salinity maxima associated with some sub-surface water masses in the upper layers of the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Varadachari, V.V.R.; Murty, C.S.; Reddy, C.V.G.

    The distribution of some sub-surface water masses in the western bay of Bengal during the south-west monsoon period is presented. Based on the salinity maxima and sigma t values the existence of waters of Persian Gulf and Red Sea origin could...

  3. Hydrography and biogeochemistry of the north western Bay of Bengal and the north eastern Arabian Sea during winter monsoon

    Digital Repository Service at National Institute of Oceanography (India)

    Balachandran, K.K.; Laluraj, C.M.; Jyothibabu, R.; Madhu, N.V.; Muraleedharan, K.R.; Vijay, J.G.; Maheswaran, P.A.; Ashraf, T.T.M.; Nair, K.K.C.; Achuthankutty, C.T.

    in the Arabian Sea is driven by net heat loss from the ocean, whereas the Bay of Bengal does not contribute to such large heat loss to the atmosphere. It appears that the subduction of high saline Arabian Sea water mass is the mechanism behind the formation of a...

  4. Influence of El Niño and Indian Ocean Dipole on sea level variability in the Bay of Bengal

    Science.gov (United States)

    Sreenivas, P.; Gnanaseelan, C.; Prasad, K. V. S. R.

    2012-01-01

    Zonally oscillating seasonal equatorial winds generate pairs of upwelling and downwelling Kelvin waves in the Equatorial Indian Ocean, which then advance in to the coastal Bay of Bengal. The first (second) equatorial upwelling Kelvin wave has its origin in the western (eastern) basin, whereas the downwelling Kelvin waves originate in the central basin. The observed interannual variability of these Kelvin waves is highly governed by the associated zonal wind changes in the central and eastern equatorial Indian Ocean during the anomalous years. The second downwelling (upwelling) Kelvin wave is absent (weak) during El Niño (La Niña) years, whereas the second upwelling Kelvin wave strengthened during El Niño years both in the equatorial Indian Ocean and Bay of Bengal. The large scale off equatorial Rossby waves occasionally feedback the equatorial Kelvin waves, which then strengthen the Bay of Bengal coastal Kelvin waves. The coastal Kelvin waves and the associated radiated Rossby waves from east play a dominant role in the mesoscale eddy generation in Bay of Bengal. The analysis of cyclogenesis characteristics in the bay over the past 65 years revealed that the active (suppressed) phases of cyclogenesis are coinciding with the downwelling (upwelling) planetary waves which influence the cyclone heat potential by altering the thermocline depth.

  5. Spatial variations of DMS, DMSP and phytoplankton in the Bay of Bengal during the summer monsoon 2001

    Digital Repository Service at National Institute of Oceanography (India)

    Shenoy, D.M.; Paul, J.T.; Gauns, M.; Ramaiah, N.; DileepKumar, M.

    in the radiation balance of the earth. During the summer monsoon of 2001 measurements were made for DMS and DMSPt (total DMSP) together with related biological parameters in the Bay of Bengal. Both DMS and DMSPt were restricted to the upper 40 m of the water column...

  6. Intrusion of the Bay of Bengal water into the Arabian Sea during winter monsoon and associated chemical and biological response

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Narvekar, J.; Kumar, A.; Shaji, C.; Anand, P.; Sabu, P.; Rijomon, G.; Josia, J.; Jayaraj, K.A.; Radhika, A.; Nair, K.K.C.

    off. The hydrological imbalance thus created on an annual scale will have to be balanced by the inter-basin exchange. In winter this happens through the intrusion of Bay of Bengal waters into the Arabian Sea, when the southward flowing East India...

  7. Hydrographical features of the southern and central Bay of Bengal during the transition period between winter and summer

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, L.V.G.; Jayaraman, R.

    During Feb.-Mar. 1963, INS KISTNA has carried out its 6th and 7th oceanographic cruises in the southern and central parts of Bay of Bengal under the Indian Programme of IIOE. With the physical oceanographic data collected in these cruises...

  8. Analysis of multi-channel seismic reflection and magnetic data along 13 degrees N latitude across the Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, D.G.; Bhattacharya, G.C.; Ramana, M.V.; Subrahmanyam, V.; Ramprasad, T.; Krishna, K.S.; Chaubey, A.K.; Murty, G.P.S.; Srinivas, K.; Desa, M.; Reddy, S.I.; Ashalata, B.; Subrahmanyam, C.; Mital, G.S.; Drolia, R.K.; rai, S.N.; Ghosh, S.K.; Singh, R.N.; Majumdar, M.

    Analysis of the multi-channel seismic reflection, magnetic and bathymetric data collected along a transect, 1110 km long parallel to 13 degrees N lat. across the Bay of Bengal was made. The transect is from the continental shelf off Madras...

  9. New technique using [125I]labeled rose bengal for the quantification in blood samples of pipecuronium bromide, a muscle relaxant drug

    International Nuclear Information System (INIS)

    Schopfer, C.; Benakis, A.; Pittet, J.-F.; Tassonyi, E.

    1991-01-01

    A new technique involving the use of [ 125 I]labeled rose bengal for the quantification of pipecuronium bromide (a muscle relaxant drug) is presented. This technique, which is based on the ability of rose bengal to react with pipecuronium and then form a complex which can be extracted into an organic solvent, involves two steps: the purification and labeling of rose bengal with 125 I, and the quantification of pipecuronium. The specific activity of the compound (106 μCi/mg) allows for the quantification of pipecuronium in biological samples at concentrations as low as 5 ng/ml. (author)

  10. Variations of the Indian summer monsoon over the Mio-Pliocene recorded in the Bengal Fan (IODP Exp354): implications for the evolution of the terrestrial biosphere.

    Science.gov (United States)

    Galy, Valier; Feakins, Sarah; Karkabi, Elias; Ponton, Camilo; Galy, Albert; France-Lanord, Christian

    2017-04-01

    A pressing challenge in climate research is understanding the temporal evolution of the Indian monsoon system; its response to global and regional climatic controls (including warming); as well as implications in terms of vegetation (C4 expansion), erosion of the Himalaya and carbon sequestration in the Bengal Fan. Studies on climate dynamics have recently offered new insights into the mechanistic controls on the monsoon: the tectonic boundary of the Himalaya is implicated as the major control on Indian summer monsoon dynamics today. Since this region has been uplifted since at least the late Oligocene, it is possible to test the response of monsoon precipitation to global and regional climate change, and also understand feedbacks on the climate system via carbon sequestration in the Bengal Fan. The evidence for monsoon intensity changes across the Miocene and Pliocene is currently incomplete given temporal uncertainty and diagenesis in terrestrial records; biases in the records reconstructed from the distal fan; and conflicting evidence from wind speed and aridity metrics for a stronger or weaker monsoon. Our alternative approach is therefore to study the basin-wide hydrological changes recorded in a multi-proxy, multi-site study of the marine sediments of the Bengal Fan recovered during IODP expedition 354. In turbiditic sediments of Himalayan origin, the late Miocene C4 expansion was found in all three long records recovered during expedition 354 (i.e. at sites U1451, U1450 and U1455, from East to West) based on stable carbon isotope composition of terrestrial leaf-wax compounds. Cores from sites U1455 (a reoccupation of DSDP Leg 22 Site 218) provide the highest resolution record of the C4 transition, which appears to occur abruptly within a relatively continuous series of turbiditic sequences. Bio- and magneto-stratigraphic dating of these records by members of Expedition 354 science party is underway and will provide the best stratigraphic constraint of the C4

  11. Immunization of rabbits with synthetic peptides derived from a highly conserved β-sheet epitope region underneath the receptor binding site of influenza A virus

    Directory of Open Access Journals (Sweden)

    Ideno S

    2013-11-01

    Full Text Available Shoji Ideno,1,3 Kaoru Sakai,1 Mikihiro Yunoki,2–4 Ritsuko Kubota-Koketsu,3,5 Yuji Inoue,3 Shota Nakamura,6 Teruo Yasunaga,6 Yoshinobu Okuno,5 Kazuyoshi Ikuta3 1Infectious Pathogen Research Section, Central Research Laboratory, Research and Development Division, Japan Blood Products Organization, Kobe, Japan; 2Research and Development Promotion Section, Research and Development Division, Japan Blood Products Organization, Tokyo, Japan; 3Department of Virology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan; 4Department of Veterinary Microbiology, School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu, Hokkaido, Japan; 5Kanonji Institute, The Research Foundation for Microbial Diseases of Osaka University, Kanonji, Kagawa, Japan; 6Department of Genome Informatics, Genome Information Research Center, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan Background: There is increasing concern about the speed with which health care providers can administer prophylaxis and treatment in an influenza pandemic. Generally, it takes several months to manufacture an influenza vaccine by propagation of the virus in chicken eggs or cultured cells. Newer, faster protocols for the production of vaccines that induce broad-spectrum immunity are therefore highly desirable. We previously developed human monoclonal antibody B-1 that shows broadly neutralizing activity against influenza A virus H3N2. B-1 recognizes an epitope region that includes an antiparallel β-sheet structure underneath the receptor binding site of influenza hemagglutinin (HA. In this study, the efficacy of a synthetic peptide vaccine derived from this epitope region against influenza A was evaluated. Materials and methods: Two peptides were synthesized, the upper and lower peptides. These peptides comprise amino acid residues 167–187 and 225–241, respectively, of the B-1 epitope region of HA, which is involved in

  12. Integrating effective drought index (EDI) and remote sensing derived parameters for agricultural drought assessment and prediction in Bundelkhand region of India

    Science.gov (United States)

    Padhee, S. K.; Nikam, B. R.; Aggarwal, S. P.; Garg, V.

    2014-11-01

    Drought is an extreme condition due to moisture deficiency and has adverse effect on society. Agricultural drought occurs when restraining soil moisture produces serious crop stress and affects the crop productivity. The soil moisture regime of rain-fed agriculture and irrigated agriculture behaves differently on both temporal and spatial scale, which means the impact of meteorologically and/or hydrological induced agriculture drought will be different in rain-fed and irrigated areas. However, there is a lack of agricultural drought assessment system in Indian conditions, which considers irrigated and rain-fed agriculture spheres as separate entities. On the other hand recent advancements in the field of earth observation through different satellite based remote sensing have provided researchers a continuous monitoring of soil moisture, land surface temperature and vegetation indices at global scale, which can aid in agricultural drought assessment/monitoring. Keeping this in mind, the present study has been envisaged with the objective to develop agricultural drought assessment and prediction technique by spatially and temporally assimilating effective drought index (EDI) with remote sensing derived parameters. The proposed technique takes in to account the difference in response of rain-fed and irrigated agricultural system towards agricultural drought in the Bundelkhand region (The study area). The key idea was to achieve the goal by utilizing the integrated scenarios from meteorological observations and soil moisture distribution. EDI condition maps were prepared from daily precipitation data recorded by Indian Meteorological Department (IMD), distributed within the study area. With the aid of frequent MODIS products viz. vegetation indices (VIs), and land surface temperature (LST), the coarse resolution soil moisture product from European Space Agency (ESA) were downscaled using linking model based on Triangle method to a finer resolution soil moisture product

  13. Effect of temperature variation on hormonal concentration at various gestation stages in black Bengal goat

    Directory of Open Access Journals (Sweden)

    Binod Kumar

    2015-09-01

    Full Text Available Aim: The present study was conducted to evaluate the effect of risingtemperature on the metabolic as well as the reproductive performance of the black Bengal goat. Materials and Methods: A total 27 numbers of non-pregnant black Bengal goats of the same parity comprised the experimental animals. The selected goats were randomly assigned to 3 groups of 9 each, maintaining uniformity in body weight (average 14-18 kg. Goats in Group-I were kept between the temperature ranges of 35-40°C, in Group-II between 20°Cand 27°C, and Group-III were kept under loose housing system and serve as a control. Goats in all the groups were bred naturally. Blood was collected prior to feeding in the morning on the day 1 (estrus, 20, 45, 90, and 135, expected day of parturition and also 2 days after parturition from goats of all the three groups. Results: It was observed that the level of plasma estrogen decreased (p˂0.05 up to day 45 of gestation, then after increased up to 135 days of gestation and was maximum on expected day of parturition which was significantly (p˂0.05 higher than all the values. Plasma progesterone level increased from day 20 and was the highest on day 90 and then decreased significantly (p˂0.05 on expected date of parturition. The luteinizing hormone value decreased significantly (p˂0.05 on expected day of parturition and day 2 after parturition in all the groups. Follicle stimulating hormone concentration showed a significant (p˂0.05 decrease from day 1 to 2 days after parturition in all the groups. The plasma triiodothyronine (T3 level did not vary between and within the treatment groups at any stage of the experiment. The plasma thyroxine (T4 level varied significantly (p˂0.01 within and (p˂0.05 between groups at all stages of reproduction. A significant (p<0.05 variation in plasma cortisol concentration in all the groups increased significantly until the day of parturition and dropped significantly (p<0.01 in 2 days after

  14. Thermohaline structure and circulation in the upper layers of the southern Bay of Bengal during BOBMEX-Pilot (October-November 1998)

    Digital Repository Service at National Institute of Oceanography (India)

    RameshBabu, V.; Murty, V.S.N.; Rao, L.V.G.; Prabhu, C.V.; Tilvi, V.

    Hydrographic data collected on board ORV Sagar Kanya in the southern Bay of Bengal during the BOBMEX-Pilot programme (October -- November 1998) have been used to describe the thermohaline structure and circulation in the upper 200m water column...

  15. Objective mapping of observed sub-surface mesoscale cold core eddy in the Bay of Bengal by stochastic inverse technique with tomographically simulated travel times

    Digital Repository Service at National Institute of Oceanography (India)

    Murty, T.V.R.; Rao, M.M.M.; Sadhuram, Y.; Sridevi, B.; Maneesha, K.; SujithKumar, S.; Prasanna, P.L.; Murthy, K.S.R.

    of Bengal during south-west monsoon season and explore possibility to reconstruct the acoustic profile of the eddy by Stochastic Inverse Technique. A simulation experiment on forward and inverse problems for observed sound velocity perturbation field has...

  16. Simulations of Cyclone Sidr in the Bay of Bengal with a High-Resolution Model: Sensitivity to Large-Scale Boundary Forcing

    Science.gov (United States)

    Kumar, Anil; Done, James; Dudhia, Jimy; Niyogi, Dev

    2011-01-01

    The predictability of Cyclone Sidr in the Bay of Bengal was explored in terms of track and intensity using the Advanced Research Hurricane Weather Research Forecast (AHW) model. This constitutes the first application of the AHW over an area that lies outside the region of the North Atlantic for which this model was developed and tested. Several experiments were conducted to understand the possible contributing factors that affected Sidr s intensity and track simulation by varying the initial start time and domain size. Results show that Sidr s track was strongly controlled by the synoptic flow at the 500-hPa level, seen especially due to the strong mid-latitude westerly over north-central India. A 96-h forecast produced westerly winds over north-central India at the 500-hPa level that were notably weaker; this likely caused the modeled cyclone track to drift from the observed actual track. Reducing the model domain size reduced model error in the synoptic-scale winds at 500 hPa and produced an improved cyclone track. Specifically, the cyclone track appeared to be sensitive to the upstream synoptic flow, and was, therefore, sensitive to the location of the western boundary of the domain. However, cyclone intensity remained largely unaffected by this synoptic wind error at the 500-hPa level. Comparison of the high resolution, moving nested domain with a single coarser resolution domain showed little difference in tracks, but resulted in significantly different intensities. Experiments on the domain size with regard to the total precipitation simulated by the model showed that precipitation patterns and 10-m surface winds were also different. This was mainly due to the mid-latitude westerly flow across the west side of the model domain. The analysis also suggested that the total precipitation pattern and track was unchanged when the domain was extended toward the east, north, and south. Furthermore, this highlights our conclusion that Sidr was influenced from the west

  17. Climatic and anthropogenic factors changing spawning pattern and production zone of Hilsa fishery in the Bay of Bengal

    Directory of Open Access Journals (Sweden)

    M. Shohidullah Miah

    2015-03-01

    Full Text Available Hilsa (Tenualosa ilisha Hamilton as a single species accounts 12% for more than half of the total marine catches. About 2% of the entire population of the country is directly or indirectly engaged with Hilsa fishing. Hilsa has a wide geographical distribution in Asia from the Persian Gulf to the South China Sea. Particularly large stocks are found in Upper Bay of Bengal (BoB region sustained by the large river systems. The global Hilsa catch is reported 75% from Bangladesh water, 15% from Myanmar, 5% from India and 5% from other countries such as Thailand and Iran. Hilsa is a highly migratory and anadromous fish with the same migratory and same breeding behavior as that of Atlantic Salmon fish (Salmo sp.. Due to various anthropogenic activities, climate change effect, increased siltation and rising of the river basins, the migratory routes as well as spawning grounds of Hilsa are disturbed, displaced or even destroyed. During last two decades hilsa production from inland water declined about 20%, whereas marine water yield increased about 3 times. Major Hilsa to catch has been gradually shifted from inland to marine water. Hilsa fish ascend for spawning migration from sea into estuaries. It has been found that the major spawning areas have been shifted to the lower estuarine regions of Hatia, Sandwip and Bhola. At the spawning ground of Hilsa, the fishing level F=1.36 yr−1, where in the river Meghna the Fmsy=0.6 yr−1 and exploitation rate E=0.70 is (Emsy>0.5. Oceanographic changes viz. high turbidity increased flooding, more tidal action and changes of salinity etc. have accelerated the change of migration patterns of spawning, growth and its production. Hilsa fecundity ranges from 1.5 to 2.0 million eggs for fish ranging in length from 35 to 50 cm. Hilsa fecundity is declining in different areas due to climate change and the declining fecundity impacting greatly on Hilsa production. Due to shifting of the spawning ground at the lower

  18. VISUAL OUTCOME OF OCULAR INJURY IN PAEDIATRIC POPULATION PRESENTING AT TERTIARY EYE CARE CENTRE IN WEST BENGAL

    Directory of Open Access Journals (Sweden)

    Somnath Das

    2017-07-01

    Full Text Available BACKGROUND Ocular trauma is an important worldwide cause of visual morbidity. It includes a spectrum of simple ocular surface foreign bodies, minute corneal abrasions to devastating perforating injuries causing blindness. Children are particularly susceptible to ocular trauma. Identification of the cause of injuries among children may help in determining the most effective measures to prevent visual loss. The purpose of this study is to analyse visual status at the time of presentation and to find the time gap between the occurrence of trauma and presentation, intervention and visual outcome in paediatric ocular trauma at Regional Institute of Ophthalmology, Kolkata, West Bengal. MATERIALS AND METHODS A total of 100 children (age 0-14 yrs. who attended outpatient department and emergency of Regional Institute of Ophthalmology and got admitted were included in the study. Detailed history regarding mode of injury, type of injury, time of injury and time elapsed to attend the hospital from the onset of injury noted. Recording of visual acuity and detailed clinical examination done. Appropriate medical and surgical treatment given as per the standard protocol after assessing the type of injury. Visual outcome assessed by doing follow up at presentation at 1 month and 6 month after injury. RESULTS Our study showed that 37% of the children who presented to us had visual acuity between 2/60 and Perception of light (PL positive. 7% had vision between 6/6 and 6/12. PL was denied in 5% patients. Majority (44% of the children who suffered ocular trauma presented to our hospital between 25-48 hrs. of injury. 88 out 100 patients who were hospitalised were operated within the first 24 hours. At one month after injury, 28% had visual acuity between 6/60 and 3/60 and six months after injury, 25% had visual acuity between 6/18 and 6/36. CONCLUSION Close supervision at home, school and playground, public awareness and education regarding the hazardous nature of

  19. Marked bengal pink. A dynamic test using marking doses; its value in jaundice diagnosis

    International Nuclear Information System (INIS)

    Kellershohn, C.; Desgrez, A.; Delaloye, B.

    1961-01-01

    The authors do a historic calling back of the differential study of jaundices thanks to the semi logarithmic gradients of expurgation of bromine sulphone-phthalein and thanks to the time of appearance of this material in the bile collected by duodenal tubing. They sum up likewise the foreign works which lead to take the place of this test, the outside count at the level of the head, the liver, and the abdomen after intravenous injection of a running dose of marked Rose Bengal. They specify the technical conditions of this test and report an experience which corroborate its value, its accuracy and the interest of its using in the different types of jaundices (hepatitis and obstructive types). (author) [fr

  20. Human and cattle population changes in deltaic West Bengal, India between 1977-1987

    Energy Technology Data Exchange (ETDEWEB)

    Odend' hal, S.

    1988-03-01

    In 1967-1970, 3.81 km/sup 2/ of a densely populated deltaic area of Hooghly district in West Bengal, India was intensively studied. This same area was resurveyed in 1977 and 1987. From 1977-1987, the human population has increased 10.1%, while the number of households has increased 25%. The total number of children below 10 years of age has diminished. The cattle have increased 26.5%. The number of working-age male cattle has dropped significantly with reliance, primarily on hand tractor power for field cultivation. The number of female cattle has increased substantially. Artificial insemination and the use of temperate breeds of bulls have had an obvious impact. Improvements in the general environment were observed.

  1. An outbreak of Koro among 19 workers in a jute mill in south Bengal

    Directory of Open Access Journals (Sweden)

    Suddhendu Chakraborty

    2011-01-01

    Full Text Available Koro is a culture-bound syndrome that is characterized by the belief of retraction of genitals into the abdomen. It was initially reported in Asian countries, as having a usual acute and brief course. Two case clusters have been described in this article. Both occurred in the same jute mill in southern West Bengal among the workers. The case clusters depict unique socioeconomic factors and interesting health-seeking behavior toward koro. All the cases had a self-limiting course and reasonably good outcome. The case cluster yet again confirms that koro is not as rare as it is thought of and social and economic factors continue to play an important role in the etiology of the disease.

  2. PREVALENCE OF BOVINE HERPES VIRUS - 1 IN ORGANIZED FARMS OF WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-06-01

    Full Text Available Infectious Bovine Rhinotracheitis, caused by Bovine Herpesvirus-1 (BoHV-1 maintains latency in trigeminal nerve ganglia of bovine. The sero-positive bull infected with BoHV-1 secretes the virus through semen intermittently, when the immune system is compromised. Sera from bulls housed at different bull stations were analyzed using gE protein specific IDEXX Kit, which showed 78.69% positivity. Each batch of semen from sero-positive bull was investigated further for presence of virus in semen by Real Time-PCR technique for validation of presence of virus in the frozen semen doses using gB specific primers and probe, which showed 0.968 % semen batches positive. This study showed that despite high sero prevalence in bull, the semen excretes very negligible amount of the virus indicating the subtypes circulating in farms of West Bengal, India is assumed to be respiratory type.

  3. Assessment of alpha activity of building materials commonly used in West Bengal, India

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Dipak [School of Studies in Environmental Radiation and Archaeological Sciences, Jadavpur University, Kolkata 700 032 (India); Nuclear and Particle Physics Research Centre, Department of Physics, Jadavpur University, Kolkata 700 032 (India)], E-mail: dipakghosh_in@yahoo.com; Deb, Argha; Bera, Sukumar; Sengupta, Rosalima; Patra, Kanchan Kumar [School of Studies in Environmental Radiation and Archaeological Sciences, Jadavpur University, Kolkata 700 032 (India); Nuclear and Particle Physics Research Centre, Department of Physics, Jadavpur University, Kolkata 700 032 (India)

    2008-02-15

    This paper, reports for the first time, an extensive study of alpha activity of all widely used building materials (plaster of Paris, stone chips, marble, white cement, mosaic stone, limestone, sand, granite, cement brick, asbestos, red brick, cement tile, ceramic tile and ceramics) in West Bengal, India. The alpha activities have been measured using Solid State Nuclear Track Detector (SSNTD), a very sensitive detector for alpha particles. The samples were collected from local markets of Kolkata. The measured average alpha activities ranged from 22.7 {+-} 2.5 to 590.6 {+-} 16.8 Bq kg{sup -1}. The alpha activity of ceramic tiles was highest and provides additional data to estimate the effect of environmental radiation exposure on human health.

  4. Assessment of alpha activity of building materials commonly used in West Bengal, India

    International Nuclear Information System (INIS)

    Ghosh, Dipak; Deb, Argha; Bera, Sukumar; Sengupta, Rosalima; Patra, Kanchan Kumar

    2008-01-01

    This paper, reports for the first time, an extensive study of alpha activity of all widely used building materials (plaster of Paris, stone chips, marble, white cement, mosaic stone, limestone, sand, granite, cement brick, asbestos, red brick, cement tile, ceramic tile and ceramics) in West Bengal, India. The alpha activities have been measured using Solid State Nuclear Track Detector (SSNTD), a very sensitive detector for alpha particles. The samples were collected from local markets of Kolkata. The measured average alpha activities ranged from 22.7 ± 2.5 to 590.6 ± 16.8 Bq kg -1 . The alpha activity of ceramic tiles was highest and provides additional data to estimate the effect of environmental radiation exposure on human health

  5. Removal of arsenic from ground water samples collected from West Bengal, India

    International Nuclear Information System (INIS)

    Ajith, Nicy; Swain, K.K.; Dalvi, Aditi A.; Verma, R.

    2015-01-01

    Arsenic contamination in ground water is one of the major concerns in many parts of the world including Bangladesh and India. Considering the high toxicity of arsenic, World Health Organization (WHO) has set a provisional guideline value of 10 μg L -1 for arsenic in drinking water. Several methods have been adopted for the removal of arsenic from drinking water. Most of the methods fail to remove As(III), the most toxic form of arsenic. An extra oxidative treatment step is essential for effective removal of total arsenic. Manganese dioxide (MnO 2 ) oxidizes As(III) to As(V). Removal of arsenic from water using manganese dioxide has been reported. During this work, removal of arsenic from ground water samples collected from arsenic contaminated area of West Bengal, India were carried out using MnO 2

  6. Anaesthetic management of two Bengal tiger (Panthera tigris tigris cubs for fracture repair

    Directory of Open Access Journals (Sweden)

    Gareth E. Zeiler

    2013-11-01

    Full Text Available This case series describes the anaesthetic management of two sibling Bengal tiger (Panthera tigris tigris cubs that were found to have spontaneous femur fractures due to severe nutritional secondary hyperparathyroidism. Both cubs received a combination of medetomidine (25 µg/kg and ketamine (4 mg/kg intramuscularly and were maintained with isoflurane in oxygen. An epidural injection of morphine (0.1 mg/kg and ropivacaine (1.6 mg/kg was administered to both tigers, which allowed a low end-tidal isoflurane concentration to be maintained throughout the femur fracture reduction operations. Both cubs experienced profound bradycardia and hypotension during general anaesthesia, and were unresponsive to anticholinergic treatment. Possible causes for these cardiovascular complications included: drug pharmacodynamics (medetomidine, morphine, isoflurane, decreased sympathetic tone due to the epidural (ropivacaine and hypothermia. These possible causes are discussed in detail.

  7. A Study on Problems of Hijras in West Bengal Based on Neutrosophic Cognitive Maps

    Directory of Open Access Journals (Sweden)

    Kalyan Mondal

    2014-09-01

    Full Text Available This paper deals with the problems faced by Hijras in West Bengal in order to find its solutions using neutrosophic cognitive maps. Florentin Smarandache and Vasantha Kandasamy studied neutrosophic cognitive map which is an extension of fuzzy cognitive map by incorporating indeterminacy. Hijras is considered as neither man nor woman in biological point of view. They are in special gender identity (third gender in Indian society. In their daily life, they have to face many of problems in social aspects. Some of the problems namely, absence of social security, education problem, bad habits, health problem, stigma and discrimination, access to information and service problem, violence, Hijra community issues, and sexual behavior problem are considered in this study. Based on the expert’s opinion and the notion of indeterminacy, we formulate neutrosophic cognitive map. Then we studied the effect of two instantaneous state vectors separately on connection matrix E and neutrosophic adjacency matrix N(E.

  8. Milk marketing under cooperative and non-cooperative marketing channels: Evidence from west Bengal

    Directory of Open Access Journals (Sweden)

    Sarker Debnarayan

    2010-01-01

    Full Text Available The present study is an attempt to empirically investigate the price spread, marketing costs, marketing margins, marketing efficiency, and profit efficiency among market middlemen under cooperative and non-cooperative marketing channels in the domestic trade market of liquid milk in West Bengal. One of the important findings of this study is that, although the inter-market (and intramarket price variation for liquid milk under the cooperative marketing agency in not far from uniformity, and all marketing agencies under cooperative channels receive much lower abnormal profit per unit of milk as compared with non-cooperative channels, the former fails to provide much economic benefit, either to the producer or to the consumer, because of the burden of much higher fixed cost per unit of liquid milk.

  9. Evaluation of registered visually disabled individuals in a district of West Bengal, India

    Directory of Open Access Journals (Sweden)

    Ghosh Sambuddha

    2008-01-01

    Full Text Available Objective: To identify the sociodemographic characteristics, degree and cause of visual disability among certified visually disabled individuals in a rural district of West Bengal, India and to identify possible lacunae, if any, in the existing certification system. Materials and Methods: A cross-sectional study by secondary data analysis of medical records of 155 visually disabled individuals and their 310 eyes. Demographical features, diagnosis, percentage of visual disability and work activity status of each individual were analyzed. Results: One hundred and thirty one (84.52% individuals had 100% disability. The number of males was significantly higher than that of females. Fifty eight (37.42% individuals were below 21 years of age. Phthisis bulbi was the most common cause followed by microphthalmos. Further, 81.29% patients had the same lesion bilaterally. Conclusion: Patients with higher grades of disability have attended certification boards. A large number of disabled individuals comprised children and young adults. Male gender bias demands concern.

  10. Physiological responses of coastal phytoplankton (Visakhapatnam, SW Bay of Bengal, India) to experimental copper addition.

    Science.gov (United States)

    Biswas, Haimanti; Bandyopadhyay, Debasmita

    2017-10-01

    Trace amount of copper (Cu) is essential for many physiological processes; however, it can be potentially toxic at elevated levels. The impact of variable Cu concentrations on a coastal phytoplankton community was investigated along a coastal transect in SW Bay of Bengal. A small increase in Cu supply enhanced the concentrations of particulate organic carbon, particulate organic nitrogen, biogenic silica, total pigment, phytoplankton cell and total bacterial count. At elevated Cu levels all these parameters were adversely affected. δ 13 C POM and δ 15 N POC reflected a visible signature of both beneficial and toxic impacts of Cu supply. Skeletonema costatum, the dominant diatom species, showed higher tolerance to increasing Cu levels relative to Chaetoceros sp. Cyanobacteria showed greater sensitivity to copper than diatoms. The magnitude of Cu toxicity on the phytoplankton communities was inversely related to the distance from the coast. Co-enrichment of iron alleviated Cu toxicity to phytoplankton. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Studies on thyroid activity at sexual maturity in the male and female Bengal goats

    International Nuclear Information System (INIS)

    Varshney, V.P.; Pande, J.K.; Sanwal, P.C.

    1980-01-01

    Thyroid activity at sexual maturity in the male and female Black Bengal goats was investigated. No change could be recorded at the attainment of sexual maturity in either of the sexes. The cyclic female goats also failed to reflect any change in the thyroid activity during any phase of the oestrous cycle. Again the male goats also failed to reflect any differences in the thyroid activity from the females, either during their immature, or during their mature life. The observations presented thus reflect that the thyroid activity in goats is not influenced by the attainments of sexual maturity or by the sex, in this species. The thyroid gland activity was assessed by using the in vitro technique of triiodothyronine- 125 I uptake by resin. (author)

  12. Tobacco abuse among school going adolescents in a rural area of West Bengal, India.

    Science.gov (United States)

    Mukherjee, Anindya; Sinha, Abhik; Taraphdar, Pranita; Basu, Gandhari; Chakrabarty, Debadatta

    2012-01-01

    Adolescents are vulnerable targets of tobacco industry with all consequences of usage. Studies reveal that tobacco abuse is rising in this age group in India. A cross sectional survey was carried out in two coeducational high schools of Anandanagar village of Singur block, Hooghly district, West Bengal among 276 students of VIII-IX standard to study the knowledge and abuse of tobacco and to find out influencing socio-demographic factors. Knowledge score was higher in females, students from nuclear families, and those with literate parents. Low prevalence of tobacco intake was obtained among the students, with 9.8% reported having ever used smokeless tobacco and 4.3% ever smoked. Tobacco intake was higher among those with a history of parental tobacco intake. Continued information education and communication (IEC) activities should be conducted by the school authorities, with involvement of nongovernment organizations (NGOs) and parents for primary prevention.

  13. Ornamental fish goldfish,Carassius auratusand related parasites in three districts of West Bengal, India

    Directory of Open Access Journals (Sweden)

    Mukti Chanda

    2011-01-01

    Full Text Available The lucrative business of ornamental fish culture in West Bengal (Mainly in three districts-Howrah, North and South 24 Parganas are facing loses due to the invasion of different ecto- and endo-parasites. The present study shows that the ornamental fish (Goldfish - Carassius auratus are mainly affected with ecto-parasites like Ichthyophthirius sp., Dactylogyrus sp., Gyrodactylus sp., Argulus sp. and endo-parasites like Procamallanus sp. and Cucullanus sp. The intensity of infection is high in case of Ichthyophthirius sp. and the intensity of the infection is high in summer months when the temperature is high or moderately high. In cooler months the intensity of the infection is lower as because the parasites are unable to breed or scarcity of food particles.

  14. Effect of Monsoon on spatio-temporal variation of groundwater chemistry and stable isotopic signatures: insights for concomitant arsenic mobilization in West Bengal, India

    Science.gov (United States)

    Majumder, S.; Datta, S.; Nath, B.; Neidhardt, H.; Roman-Ross, G.; Berner, Z.; Hidalgo, M.; Chatterjee, D.; Sarkar, S.

    2017-12-01

    Large-scale groundwater abstraction was hypothesized to be one of the important factors controlling release and distribution of arsenic (As) in aquifers of Bengal Basin. In this study, we studied the groundwater/surface water geochemistry of two different geomorphic domains within the Chakdaha Block, West Bengal, to identify potential influences of groundwater withdrawal on the hydrochemical evolution of the aquifer. This has been done as a function of different water inputs (monsoon rain, irrigation and downward percolation from surface water impoundments) to the groundwater system and associated As mobilization. A low-land flood plain (with relatively more reducing aquifer) and a natural levee (less reducing aquifer) have been chosen for this purpose. The stable isotopic signatures of oxygen (δ18O) and hydrogen (δ2H) falls sub-parallel to the Global Meteoric Water Line (GMWL), with precipitation and subsequent evaporation seems to be the major controlling factor on the water isotopic composition. This shows a contribution of evaporation influenced water, derived from various surface water bodies, pointing at large-scale groundwater withdrawal helping drawdown of the evaporated surface water. In case of flood plain wells, the stable isotope composition and the Cl/Br molar ratio in local groundwater have revealed vertical recharge within the flood plain area to be the major recharge process, especially during the post-monsoon season. However, both evaporation and vertical mixing are visibly controlling the groundwater recharge in the natural levee area. A possible inflow of organic carbon to the aquifer during the monsoonal recharge process is noticeable, with an increase in dissolved organic carbon (DOC) concentration from 1.33 to 6.29 mg/L on passing from pre- to post-monsoon season. Concomitant increase in AsT, Fe(II) and HCO3- during the post monsoon season, being more pronounced in the flood plain samples, indicates a possible initial episode of reductive

  15. Nomophobic behaviors among smartphone using medical and engineering students in two colleges of West Bengal.

    Science.gov (United States)

    Dasgupta, Pallabi; Bhattacherjee, Sharmistha; Dasgupta, Samir; Roy, Jayanta Kumar; Mukherjee, Abhijit; Biswas, Romy

    2017-01-01

    Growing smartphone usage among global and Indian college students has resulted in considerable issues of "nomophobia" (NMP) or feelings of discomfort or anxiety experienced by individuals whenever unable to use their smartphones. This significantly impacts their health, work, and study. The objective of this study is to find out the prevalence of NMP among smartphone using medical and engineering undergraduates of West Bengal and to compare the nomophobic behaviors, its predictors, and smartphone usage among them. A cross-sectional study was conducted among 303 medical and 305 engineering undergraduates in West Bengal using a validated NMP questionnaire consisting of four factors. Comparison of means of individual questions and factor scores was done. Nomophobic clusters among the two groups were identified using two-stage cluster analysis. Binary logistic regression was used for comparison of predictors of NMP. Engineering students showed a higher proportion of nomophobics (44.6%) than medical students (42.6%). Significant higher means was observed among engineering students for the factor "giving upconvenience" and individual variables like "scared due to running out of battery," "nervous due to disconnection from online identity," "uncomfortable when unable stay up-to-date with social media" and "anxious when unable to check E-mails." A Higher proportion of nomophobics among both groups were females, those owning smartphone beyond 2 years, having monthly mobile bill above Rs. 200 and spending over 4 h daily on smartphone. NMP has emerged as a significant cause of concern among both the groups. Standardized measures for identification and appropriate psychobehavioral therapy for those seeking help might alleviate the problem.

  16. Electron Microscopic, Genetic and Protein Expression Analyses of Helicobacter acinonychis Strains from a Bengal Tiger

    Science.gov (United States)

    Tegtmeyer, Nicole; Rivas Traverso, Francisco; Rohde, Manfred; Oyarzabal, Omar A.; Lehn, Norbert; Schneider-Brachert, Wulf; Ferrero, Richard L.; Fox, James G.; Berg, Douglas E.; Backert, Steffen

    2013-01-01

    Colonization by Helicobacter species is commonly noted in many mammals. These infections often remain unrecognized, but can cause severe health complications or more subtle host immune perturbations. The aim of this study was to isolate and characterize putative novel Helicobacter spp. from Bengal tigers in Thailand. Morphological investigation (Gram-staining and electron microscopy) and genetic studies (16SrRNA, 23SrRNA, flagellin, urease and prophage gene analyses, RAPD DNA fingerprinting and restriction fragment polymorphisms) as well as Western blotting were used to characterize the isolated Helicobacters. Electron microscopy revealed spiral-shaped bacteria, which varied in length (2.5–6 µm) and contained up to four monopolar sheathed flagella. The 16SrRNA, 23SrRNA, sequencing and protein expression analyses identified novel H. acinonychis isolates closely related to H. pylori. These Asian isolates are genetically very similar to H. acinonychis strains of other big cats (cheetahs, lions, lion-tiger hybrid and other tigers) from North America and Europe, which is remarkable in the context of the great genetic diversity among worldwide H. pylori strains. We also found by immunoblotting that the Bengal tiger isolates express UreaseA/B, flagellin, BabA adhesin, neutrophil-activating protein NapA, HtrA protease, γ-glutamyl-transpeptidase GGT, Slt lytic transglycosylase and two DNA transfer relaxase orthologs that were known from H. pylori, but not the cag pathogenicity island, nor CagA, VacA, SabA, DupA or OipA proteins. These results give fresh insights into H. acinonychis genetics and the expression of potential pathogenicity-associated factors and their possible pathophysiological relevance in related gastric infections. PMID:23940723

  17. Reconstructing Oceanographic Conditions From the Holocene to the Last Glacial Maximum in the Bay of Bengal

    Science.gov (United States)

    Miller, J.; Dekens, P. S.; Weber, M. E.; Spiess, V.; France-Lanord, C.

    2015-12-01

    The International Ocean Discovery Program (IODP) Expedition 354 drilled 7 sites in the Bay of Bengal, providing a unique opportunity to improve our understanding of the link between glacial cycles, tropical oceanographic changes, and monsoon strength. Deep-sea sediment cores of the Bengal Fan fluctuate between sand, hemipelagic and terrestrial sediment layers. All but one of the sites (U1454) contain a layer of calcareous clay in the uppermost part of the core that is late Pleistocene in age. During Expedition 354 site U1452C was sampled at high resolution (every 2cm) by a broad group of collaborators with the goal of reconstructing monsoon strength and oceanographic conditions using a variety of proxies. The top 480 cm of site U1452C (8ºN, 87ºE, 3671m water depth) contains primarily nannofossil rich calcareous clay. The relatively high abundance of foraminifera will allow us to generate a high resolution record of sea surface temperature (SST) and sea surface salinity (SSS) using standard foraminifera proxies. We will present oxygen isotopes (δ18O) and Mg/Ca data of mixed layer planktonic foraminifera from the top 70cm of the core, representing the Holocene to the last glacial maximum. δ18O of planktonic foraminifera records global ice volume and local SST and SSS, while Mg/Ca of foraminifera is a proxy for SST. The paired Mg/Ca and δ18O measurements on the same samples of foraminifera, together with published estimates with global ocean δ18O, can be used to reconstruct both SST and local δ18O of seawater, which is a function of the evaporation/precipitation balance. In future work, the local SSS and SST during the LGM will be paired with terrestrial and other oceanic proxies to increase our understanding of how global climate is connected to monsoon strength.

  18. Is Ramadan Fasting Cardio-protective? A Study in a Village of West Bengal

    Directory of Open Access Journals (Sweden)

    Aparajita Dasgupta

    2017-06-01

    Full Text Available Background: Islam is the second largest religion of the World (23% and Muslims are the second largest majority of Indian Republic (14.3%. Ramadan is the ninth and holiest month(Hijra of the 12-month Islamic calendar during which Muslims fast from dawn to dusk each day maintaining certain rules (consuming food/drink once, avoiding smoking and sexual activity, as well as impure thoughts, words and immoral behavior. It is observed by Muslims as a month of fasting to commemorate the first revelation of the Qur'an to Muhammad. Aims & Objectives: To evaluate the effect of Ramadan on cardio-metabolic profile among adult Muslims residing in rural West Bengal. Methods and Materials: The present study was a longitudinal community based study done among 43 Muslims residing in a village of West Bengal during 6thJune to 7th July 2016. Cardio-metabolic profile (physical activity, diet, BMI, blood pressure, blood lipids and glucose were assessed before, during and after Ramadan. Results: There was a significant reduction in VLDL and TG level while significant elevation in HDL level along with the reduction in Framingham risk score after fasting. All the anthropometric measurements along with blood pressure reduced significantly after Ramadan with significant reduction in intake of all micro-nutrients during Ramadan. However physical activity also reduced significantly during Ramadan. Conclusion: Our study had found no detrimental effects of Ramadan fasting on the contrary has an overall beneficial effect on cardiovascular profile was observed.

  19. Electron microscopic, genetic and protein expression analyses of Helicobacter acinonychis strains from a Bengal tiger.

    Directory of Open Access Journals (Sweden)

    Nicole Tegtmeyer

    Full Text Available Colonization by Helicobacter species is commonly noted in many mammals. These infections often remain unrecognized, but can cause severe health complications or more subtle host immune perturbations. The aim of this study was to isolate and characterize putative novel Helicobacter spp. from Bengal tigers in Thailand. Morphological investigation (Gram-staining and electron microscopy and genetic studies (16SrRNA, 23SrRNA, flagellin, urease and prophage gene analyses, RAPD DNA fingerprinting and restriction fragment polymorphisms as well as Western blotting were used to characterize the isolated Helicobacters. Electron microscopy revealed spiral-shaped bacteria, which varied in length (2.5-6 µm and contained up to four monopolar sheathed flagella. The 16SrRNA, 23SrRNA, sequencing and protein expression analyses identified novel H. acinonychis isolates closely related to H. pylori. These Asian isolates are genetically very similar to H. acinonychis strains of other big cats (cheetahs, lions, lion-tiger hybrid and other tigers from North America and Europe, which is remarkable in the context of the great genetic diversity among worldwide H. pylori strains. We also found by immunoblotting that the Bengal tiger isolates express UreaseA/B, flagellin, BabA adhesin, neutrophil-activating protein NapA, HtrA protease, γ-glutamyl-transpeptidase GGT, Slt lytic transglycosylase and two DNA transfer relaxase orthologs that were known from H. pylori, but not the cag pathogenicity island, nor CagA, VacA, SabA, DupA or OipA proteins. These results give fresh insights into H. acinonychis genetics and the expression of potential pathogenicity-associated factors and their possible pathophysiological relevance in related gastric infections.

  20. Electron microscopic, genetic and protein expression analyses of Helicobacter acinonychis strains from a Bengal tiger.

    Science.gov (United States)

    Tegtmeyer, Nicole; Rivas Traverso, Francisco; Rohde, Manfred; Oyarzabal, Omar A; Lehn, Norbert; Schneider-Brachert, Wulf; Ferrero, Richard L; Fox, James G; Berg, Douglas E; Backert, Steffen

    2013-01-01

    Colonization by Helicobacter species is commonly noted in many mammals. These infections often remain unrecognized, but can cause severe health complications or more subtle host immune perturbations. The aim of this study was to isolate and characterize putative novel Helicobacter spp. from Bengal tigers in Thailand. Morphological investigation (Gram-staining and electron microscopy) and genetic studies (16SrRNA, 23SrRNA, flagellin, urease and prophage gene analyses, RAPD DNA fingerprinting and restriction fragment polymorphisms) as well as Western blotting were used to characterize the isolated Helicobacters. Electron microscopy revealed spiral-shaped bacteria, which varied in length (2.5-6 µm) and contained up to four monopolar sheathed flagella. The 16SrRNA, 23SrRNA, sequencing and protein expression analyses identified novel H. acinonychis isolates closely related to H. pylori. These Asian isolates are genetically very similar to H. acinonychis strains of other big cats (cheetahs, lions, lion-tiger hybrid and other tigers) from North America and Europe, which is remarkable in the context of the great genetic diversity among worldwide H. pylori strains. We also found by immunoblotting that the Bengal tiger isolates express UreaseA/B, flagellin, BabA adhesin, neutrophil-activating protein NapA, HtrA protease, γ-glutamyl-transpeptidase GGT, Slt lytic transglycosylase and two DNA transfer relaxase orthologs that were known from H. pylori, but not the cag pathogenicity island, nor CagA, VacA, SabA, DupA or OipA proteins. These results give fresh insights into H. acinonychis genetics and the expression of potential pathogenicity-associated factors and their possible pathophysiological relevance in related gastric infections.

  1. Clinical management of maggot wounds in Bengal Tigers (Panthera tigris tigris

    Directory of Open Access Journals (Sweden)

    Anup Kumar Talukder

    2017-03-01

    Full Text Available Objecitve: Maggot wound is common in domestic and pet animals but report on maggot wound treatment in wildlife species is scanty. The study reported here the surgical and conservative management of maggot wounds including anesthetic protocol and postoperative care in two Bengal tigers (Panthera tigris tigris. Materials and methods: One female and one male tiger were presented with maggot wounds for treatment at the Bangabandhu Sheikh Mujib Safari Park, Gazipur, Bangladesh. Tigers were anesthetized with combined injection of xylazine (dosed at 1.0 mg/kg bwt, IM and ketamine hydrochloride (dosed at 3.5 mg/kg bwt, IM. Superficial maggots were removed from wounds using sterile tissue forceps. Gauze soaked in oil of turpentine was allowed to remain in each wound pocket for 5 min for the removal of deep-seated maggots. Finally, wounds were dressed with tincture iodine to clean out the dead tissue debris and to induce inflammation for rapid healing. A single subcutaneous injection of ivermectin (dosed at 200 µg/kg bwt, IM was given in each tiger. In addition, long acting oxytetracycline (dosed at 10 mg/kg bwt, IM on 48 h interval for six days, chlorpheniramine maleate (dosed at 1 mg/kg bwt, IM once daily for three days, and ascorbic acid (dosed at 250 mg/tiger, IM once daily for seven days were administered in both tigers. Results: The tigers were recovered successfully without any complications in two weeks following treatment. Conclusion: Surgical management using oil of turpentine and tincture iodine along with parenteral administration of ivermectin, long acting oxytetracycline and chlorpheniramine maleate are effective for successful management of maggot wounds in Bengal tigers. [J Adv Vet Anim Res 2017; 4(1.000: 104-109

  2. Evaluation of some selected herbs on arsenic-affected cattle in Nadia District, West Bengal, India.

    Science.gov (United States)

    Hazarika, Jantu M; Sarkar, Prasanta K; Chattopadhyay, Abichal; Mandal, Tapan K; Sarkar, Samar

    2015-04-01

    Arsenic poisoning due to contaminated subsoil water is one of the most alarming environment hazards in West Bengal, India. Cattle are also affected by arsenic due to ingestion of arsenic contaminated water, paddy straw, crops and vegetables. Thirty milch cattle having arsenic content in the range of 3.5 to 4.5 mg/kg in hair were chosen for this experiment from cattle of five respective villages in Nadia District, West Bengal, India. The cattle were divided into three groups containing 10 animals each. Group I cattle were treated with turmeric powder (Curcuma longa) 20 g/day orally for 60 days. Group II cattle were treated with turmeric powder (10 g/day) and Amaranthus spinosus powder (10 g/day) orally for 60 days. Group III cattle were treated with turmeric powder (10 g/day) and Eclipta alba powder (10 g/day) orally for 60 days. Ten apparently healthy milch cows with no history of exposure to arsenic were selected and kept as control group (group IV). Arsenic content in hair, faeces, urine and milk; different biochemical and haematological parameters and DNA fragmentation percentage assay were carried out before commencement of the treatment, after 30 days and after 60 days of treatment. The test drugs were found significantly (p < 0.05) effective to eliminate arsenic from the body and lead to significant improvement in different biochemistry, pathology and DNA fragmentation assay. These drugs also give protection from possible damage caused by arsenic exposure.

  3. Bengal Bay clone ST772-MRSA-V outbreak: conserved clone causes investigation challenges.

    Science.gov (United States)

    Blomfeldt, A; Larssen, K W; Moghen, A; Haugum, K; Steen, T W; Jørgensen, S B; Aamot, H V

    2017-03-01

    The Bengal Bay clone, ST772-MRSA-V, associated with multi-drug resistance, Panton-Valentine leukocidin (PVL) and skin and soft tissue infections, is emerging worldwide. In Norway, a country with low prevalence of meticillin-resistant Staphylococcus aureus (MRSA), increased occurrence of ST772-MRSA-V has also caused hospital outbreaks. The conserved nature of this clone challenged the outbreak investigations. To evaluate the usefulness of S. aureus protein A (spa) typing, multiple-locus variable number tandem repeat fingerprinting/analysis (MLVF/MLVA) and pulsed-field gel electrophoresis (PFGE) when investigating outbreaks with a conserved MRSA clone. A panel of 25 MRSA isolates collected in 2004-2014, consisting of six hospital outbreak isolates and 19 sporadic isolates, were analysed using spa typing, polymerase chain reaction detection of genes encoding PVL, MLVF/MLVA and PFGE. All isolates were ST772-MRSA-V-t657 and resistant to erythromycin, gentamicin and norfloxacin, and 88% were PVL positive. PFGE could not discriminate between the isolates (≥85% similarity). MLVF resolved five types [Simpson's index of diversity (SID)=0.56], MLVA resolved six types (SID=0.66), and both methods separated the hospital isolates into two defined outbreaks. MLVF/MLVA could not discriminate all epidemiologically unlinked cases and identical genotypes originated from a timespan of 10 years. MLVA was regarded as most suitable due to its higher discriminatory power and ability to provide unambiguous profiles. However, the Bengal Bay clone may require higher resolution methods for exact demarcation of outbreaks due to low diversity among isolates. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  4. Sub-surface Biogeochemical Characteristics and Its Effect on Arsenic Cycling in the Holocene Gray Sand Aquifers of the Lower Bengal Basin

    Directory of Open Access Journals (Sweden)

    Devanita Ghosh

    2017-12-01

    Full Text Available High arsenic (As content in the fertile delta plains of West Bengal has been widely reported since the 1990s. The shallow gray sand aquifers (GSA deposited during the Holocene, are more commonly used as potable water sources, but they have high As levels. The release of As into groundwater is influenced by indigenous microbial communities metabolizing different organic carbon sources present in the GSA sediments. After pre-screening the groundwater for assessing their microbial phylogenetic diversity, two 50-m deep boreholes were drilled in the GSAs, and 19 sediment samples were recovered from each core. In each of these samples, grain-size distribution, sequential extraction, and quantification of trace metals and total extractable lipids were analyzed. The aquifer sediments consisted of medium to fine micaceous sand with clay lenses in between them; a thick clay layer occurred on top of both boreholes. Arsenic concentration in these sediments varied from 1.80 to 41.0 mg/kg and was mostly associated with the oxide and silicate-rich crystalline minerals. Arsenic showed a significant correlation with Fe in all fractions, suggesting the presence of Fe-(oxy-hydroxides bound As minerals. The diagnostic lipid biomarkers showed presence of compounds derived from higher plants (epicuticular waxes and microbial inputs. The biomarkers were abundant in clay and silt-rich layers. The samples indicated preferential preservation of n-alkanes over other functional compounds (e.g., alcohols and fatty acids, that are more reactive, and hence subject to further degradation. Sediments recovered from the borehole indicated the presence of Eustigmatophytes and vascular plant waxes that are mostly surface-derived. The sedimentary lipids also indicated the presence of complex petroleum-derived hydrocarbons. These compounds provide organic substrates, and support the preferential survival of specific microbial communities in these sediments.

  5. Seasonal and Intraseasonal Variability of Mesoscale Convective Systems over the South Asian Monsoon Region

    Energy Technology Data Exchange (ETDEWEB)

    Virts, Katrina S.; Houze, Robert A.

    2016-12-01

    Seasonal and intraseasonal differences in mesoscale convective systems (MCSs) over South Asia are examined using A-Train satellites, a ground-based lightning network, and reanalysis fields. Pre-monsoon (April-May) MCSs occur primarily over Bangladesh and the eastern Bay of Bengal. During the monsoon (June-September), small MCSs occur over the Meghalaya Plateau and northeast Himalayan notch, while large and connected MCSs are most widespread over the Bay of Bengal. Monsoon MCSs produce less lightning and exhibit more extensive stratiform and anvil reflectivity structures in CloudSat observations than do pre-monsoon MCSs. During the monsoon season, Bay of Bengal and Meghalaya Plateau MCSs vary with the 30-60 day northward-propagating intraseasonal oscillation, while northeast Himalayan notch MCSs are associated with weak large-scale anomalies but locally enhanced CAPE. During intraseasonal active periods, a zone of enhanced large and connected MCSs, precipitation, and lightning extends from the northeastern Arabian Sea southeast over India and the Bay of Bengal, flanked by suppressed anomalies. Spatial variability is observed within this enhancement zone: lightning is most enhanced where MCSs are less enhanced, and vice versa. Reanalysis composites indicate that Bay of Bengal MCSs are associated with monsoon depressions, which are frequent during active monsoon periods, while Meghalaya Plateau MCSs are most frequent at the end of break periods, as anomalous southwesterly winds strengthen moist advection toward the terrain. Over both regions, MCSs exhibit more extensive stratiform and anvil regions and less lightning when the large-scale environment is moister, and vice versa.

  6. Assessment of radionuclide concentration in three crustaceans species of the bay of Bengal; Mesure de la concentration de radionucleides dans trois especes de crustaces du golfe du Bengale

    Energy Technology Data Exchange (ETDEWEB)

    Hasan, C.K.; Zafar, M. [Chittagong Univ., Institute of Marine Sciences (Bangladesh); Chowdhury, M.I.; Kamal, M. [Radioactivity Testing and Monitoring Laboratory, Bangladesh Atomic Energy Commission, Chittagong (Bangladesh)

    2006-10-15

    The natural ({sup 226}Ra, {sup 228}Th, {sup 232}Th and {sup 40}K) and anthropogenic ({sup 137}Cs) radionuclides concentrations in three crustaceans species (Penaeus monodon, Metapenaeus monoceros and Panulirus versicolor), collected from the bay of Bengal, were determined with an aim of assessing any internal radiation hazard due to consumption of the shell fishes and establishing a database for radioactivity levels of the species. Very low level of radioactivity was observed in all the species. The average activity of {sup 226}Ra observed in P. monodon was 1.21 {+-} 0.27 Bq kg{sup -1} fw; in M. monoceros was 0.70 {+-}0.08 Bq kg{sup -1} fw, and in Panulirus versicolor was 1.04 {+-} 0.09 Bq kg{sup -1} fw. The activity of {sup 232}Th observed in these species was 1.30 {+-} 0.37, 0.76 {+-} 0.34 and 1.32 {+-} 0.70 Bq kg{sup -1} fw, and {sup 228}Th was 0.55 {+-} 0.26, 0.31 {+-} 0.14 and 0.74 {+-} 0.22 Bq kg{sup -1} fw, respectively. The average activity of {sup 40}K observed in these species was 12.56 {+-} 1.18, 6.38 {+-}1.02 and 10.07 {+-} 1.52 Bq kg{sup -1} fw, respectively. The activity of radiocaesium ({sup 137}Cs) was below detection limit. The results indicate that the natural and artificial radionuclides observed in three crustaceans species are safe for human health. A significant relationship was observed between {sup 226}Ra and {sup 232}Th in both the P. monodon (r = 0.839, p {<=} 0.05, df = 4) and the Panulirus versicolor (r = 0.906, p {<=} 0.05, df = 4). (authors)

  7. Modeling the effect of Rose Bengal on growth and decay patterns of Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus

    Science.gov (United States)

    Al-Akhras, M.-Ali H.; Shorman, Mohammad Al; Masadeh, Majed M.; Aljarrah, Khaled; Ababneh, Zaid

    2018-02-01

    Most infections caused by (Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus) are hospital and community acquired infections in patients. Bacterial growths incorporated with photosensitizing material (Rose Bengal) with and without light were investigated. The results demonstrated that the viable counts are increasing in absence of light (in dark) for all samples incorporated with Rose Bengal. Variation in growth phases were noticed as expected, but there is no significant change in decay phases. Convenient and adequate mathematical modeling is in very good agreement with the experimental results and showed to be a very good approach of characterization the growth behaviors of the bacteria. Bandwidths are independent of bacteria group (gram-positive or gram-negative) but it seems totally dependent on the oxygen requirements; an anaerobic bacterium takes broader bandwidths than aerobic bacteria. This concludes that the growth and lethal rates of anaerobic are much greater than aerobic.

  8. New Spectrophotometric and Conductometric Methods for Macrolide Antibiotics Determination in Pure and Pharmaceutical Dosage Forms Using Rose Bengal

    Directory of Open Access Journals (Sweden)

    Rania A. Sayed

    2013-01-01

    Full Text Available Two Simple, accurate, precise, and rapid spectrophotometric and conductometric methods were developed for the estimation of erythromycin thiocyanate (I, clarithromycin (II, and azithromycin dihydrate (III in both pure and pharmaceutical dosage forms. The spectrophotometric procedure depends on the reaction of rose bengal and copper with the cited drugs to form stable ternary complexes which are extractable with methylene chloride, and the absorbances were measured at 558, 557, and 560 nm for (I, (II, and (III, respectively. The conductometric method depends on the formation of an ion-pair complex between the studied drug and rose bengal. For the spectrophotometric method, Beer's law was obeyed. The correlation coefficient ( for the studied drugs was found to be 0.9999. The molar absorptivity (, Sandell’s sensitivity, limit of detection (LOD, and limit of quantification (LOQ were also calculated. The proposed methods were successfully applied for the determination of certain pharmaceutical dosage forms containing the studied drugs

  9. A simple chemical free arsenic removal method for community water supply - A case study from West Bengal, India

    International Nuclear Information System (INIS)

    Sen Gupta, B.; Chatterjee, S.; Rott, U.; Kauffman, H.; Bandopadhyay, A.; DeGroot, W.; Nag, N.K.; Carbonell-Barrachina, A.A.; Mukherjee, S.

    2009-01-01

    This report describes a simple chemical free method that was successfully used by a team of European and Indian scientists ( (www.qub.ac.uk/tipot)) to remove arsenic (As) from groundwater in a village in West Bengal, India. Six such plants are now in operation and are being used to supply water to the local population ( (www.insituarsenic.org)). The study was conducted in Kasimpore, a village in North 24 Parganas District, approximately 25 km from Kolkata. In all cases, total As in treated water was less than the WHO guideline value of 10 μg L -1 . The plant produces no sludge and the operation cost is 1.0 US$ per day for producing 2000 L of potable water. - This work presents the chemical free arsenic removal method from groundwater and its successful implementation in West Bengal for community water supply.

  10. Biogeochemical Controls on the Release and Accumulation of Mn and As in Shallow Aquifers, West Bengal, India

    Directory of Open Access Journals (Sweden)

    Michael A. Vega

    2017-06-01

    Full Text Available HIGHLIGHTSManganese and arsenic concentrations are elevated in Murshidabad groundwater.Manganese release appears to be independent of dissolved organic matter quality.Mineral precipitation and dissolution reactions impact fate of manganese.Arsenic concentrations are related to dissolved organic matter quantity and quality.The prevalence of manganese (Mn in Southeast Asian drinking water has recently become a topic of discussion, particularly when concurrent with elevated arsenic (As. Although Mn groundwater geochemistry has been studied, the link between dissolved organic matter (DOM quality and Mn release is less understood. This work evaluates characteristics of DOM, redox chemistry, and the distribution of Mn within Murshidabad, West Bengal, India. Shallow aquifer samples were analyzed for cations, anions, dissolved organic carbon, and DOM properties using 3-dimensional fluorescence excitation emission matrices followed by parallel factor modeling analyses. Two biogeochemical regimes are apparent, separated geographically by the river Bhagirathi. East of the river, where Eh and nitrate (NO3− values are low, humic-like DOM coexists with high dissolved Mn, As, and Fe. West of the river, lower dissolved As and Fe concentrations are coupled with more protein-like DOM and higher NO3− and Eh values. Dissolved Mn concentrations are elevated in both regions. Based on the distribution of available electron acceptors, it is hypothesized that groundwater east of the Bhagirathi, which is more reducing and enriched in dissolved Fe and Mn but depleted in NO3−, is chemically dominated by Mn(IV/Fe(III reduction processes. West of the river where NO3− is abundant yet dissolved Fe is absent, NO3− and Mn(IV likely buffer redox conditions such that Eh values are not sufficiently reducing to release Fe into the dissolved phase. The co-occurrence of humic-like DOM with dissolved As, Fe, and Mn in the more reducing aquifers may reflect complex formation

  11. Specific bone region localization of osteolytic versus osteoblastic lesions in a patient-derived xenograft model of bone metastatic prostate cancer

    Directory of Open Access Journals (Sweden)

    Takeshi Hirata

    2016-10-01

    Conclusion: PCSD1 cells reproducibly induced bone loss leading to osteolytic lesions at the ends of the femur, and, in contrast, induced aberrant bone formation leading to osteoblastic lesions along the femur shaft. Therefore, the interaction of PCSD1 cells with different bone region-specific microenvironments specified the type of bone lesion. Our approach can be used to determine if different bone regions support more therapy resistant tumor growth, thus, requiring novel treatments.

  12. On the circulation in the Bay of Bengal during northern spring inter-monsoon (March-April 1987)

    Digital Repository Service at National Institute of Oceanography (India)

    Babu, M.T.; Sarma, Y.V.B.; Murty, V.S.N.; Vethamony, P.

    ) indicated an anticyclonic circulation with a northeastward flow in the western bay duringMarch–April ( La Fond and La Fond 1968; Duing, 1970; Wyrtki, 1971). The temperature field obtained from satellite- based advanced very high resolution radiometer (AVHRR.... Pergamon. New York, pp. 451–475. Duing,W.,1970.Themonsoonregimeofcurrentsin theIndian Ocean. University Press of Hawaii, Honolulu, USA, 68pp. Eigenheer,A.,Quadfasel,D.,2000.SeasonalvariabilityoftheBay of Bengal circulation inferred from TOPEX...

  13. Relationship between summer monsoon rainfall and cyclogenesis over Bay of Bengal during post-monsoon (October-December) season

    Digital Repository Service at National Institute of Oceanography (India)

    Sadhuram, Y; Maneesha, K.

    peak monsoon (October–November) season and concluded that the frequency of cyclones is modulated by negative and positive IOD rather than El-Nino and La-Nina. In this study, the relationship between southwest monsoon rainfall (June–September) and TNDC... Relationship between summer monsoon rainfall and cyclogenesis over Bay of Bengal during post-monsoon (October–December) season Y Sadhuram∗ and K Maneesha CSIR–National Institute of Oceanography, 176, Lawsons Bay Colony, Visakhapatnam 530 017, India...

  14. The Tsunami Geology of the Bay of Bengal Shores and the Predecessors of the 2004 Indian Ocean Event

    Science.gov (United States)

    Rajendran, C.; Rajendran, K.; Seshachalam, S.; Andrade, V.

    2010-12-01

    The 2004 Aceh-Andaman earthquake exceeded the known Indian Ocean precedents by its 1,300-km long fault rupture and the height and reach of its tsunami. Literature of the ancient Chola dynasty (AD 9-11 centuries) of south India and the archeological excavations allude to a sea flood that crippled the historic port at Kaveripattinam, a trading hub for Southeast Asia. Here, we combine a variety of data from the rupture zone as well as the distant shores to build a tsunami history of the Bay of Bengal. A compelling set of geological proxies of possible tsunami inundation include boulder beds of Car Nicobar Island in the south and the East Island in the northernmost Andaman, a subsided fossil mangrove forest near Port Blair and a washover sedimentation identified in the Kaveripattinam coast of Tamil Nadu, south India. We have developed an extensive chronology for these geological proxies, and we analyze them in conjunction with the historical information culled from different sources for major sea surges along the Bay of Bengal shores. The age data and the depositional characteristics of these geological proxies suggest four major tsunamis in the last 2000 years in the Bay of Bengal, including the 1881 Car Nicobar tsunami. Among these, the evidence for the event of 800-1200 cal yr BP is fairly well represented on both sides of the Bay of Bengal shores. Thus, we surmise that the 800-1000-year old tsunami mimics the transoceanic reach of the 2004 Indian Ocean and the age constraints also agree with the sea surge during the Chola period. We also obtained clues for a possible medieval tsunami from the islands occurred probably a few hundred years after the Chola tsunami, but its size cannot constrained, nor its source. The convergence of ages and the multiplicity of sites would suggest at least one full size predecessor of the 2004 event 1000-800 years ago.

  15. PARTIAL PURIFICATION AND IMMUNE-BIOCHEMICAL CHARACTERIZATION OF ROYAL BENGAL TIGER ( PANTHERA TIGRIS TIGRIS SERUM IMMUNOGLOBULIN G

    Directory of Open Access Journals (Sweden)

    Ekantika Mandal

    2013-12-01

    Full Text Available In the present study Immunoglobulin G was purified from serum of Royal Bengal Tiger by gel filtration chromatography on Sephacryl S-200. SDS-PAGE analysis showed the molecular weight of purified tiger IgG was 170.52 kDa. The purified Immunoglobulin has been found to be immunereactive by DID test and Western Blot analysis when treated against hyperimmune sera which was raised in rabbit.

  16. Environmentally-related seasonal variation in symbiotic associations of heterotrophic dinoflagellates with cyanobacteria in the western Bay of Bengal

    Digital Repository Service at National Institute of Oceanography (India)

    Jyothibabu, R.; Madhu, N.V.; Maheswaran, P.A.; Devi, C.R.A.; Balasubramanian, T.; Nair, K.K.C.; Achuthankutty, C.T.

    significance in oligotrophic environments where high oxygen tension is normally antagonistic to nitrogenase activity. During the summer and winter monsoon periods, the low occurrence of symbiotic associations may be due to two reasons: (a) the presence... temperature, centrifuged and the absorbance of the supernatant was measured using spectrophotometer (Strickland and Parsons, 1972). 3. Results and Discussion In the western Bay of Bengal, low surface salinity along with high solar radiation play an important...

  17. Biomonitoring of Heavy metals using the bivalve molluscs in sunderban mangrove wetland, Northeast Coast of Bay of bengal (india): possible risks to Human health

    Energy Technology Data Exchange (ETDEWEB)

    Cabral, Henrique; Cardoso, Ines [Departamento de Biologia Animal/Instituto de Oceanografia, Campo Grande, Lisboa (Portugal); Chatterjee, Mousumi; Kumar Bhattacharya, Asok; Aftab Alam, Mohammad [Department of Marine Science, University of Calcutta, Calcutta (India); Kanta Satpathy, Kamala [Indira Gandhi Centre for Atomic Research, Environmental and Industrial Safety Section, Safety Group, Kalpakkam, Tamil Nadu (India); Kumar Sarkar, Santosh

    2008-02-15

    The suitability of using four bivalve molluscs (Sanguinolaria acuminata, Anadara granosa, Meretrix meretrix, and Pelecyora trigona) in biomonitoring of heavy metals (Cu, Pb, Cd, Zn, and Hg) collected from intertidal regions of the Sunderban mangrove wetland, northeastern part of the Bay of Bengal, were evaluated. Both speciesdependent variability and temporal variations were pronounced. A high degree of organ specificity was evident in the bivalves where gill and mantle exhibited higher metal accumulation due to ion exchange property of the mucous layer covering these organs while shells represent very poor accumulation. Elevated values of Zn and Cu reflect high potential for biomagnification through marine food chain. Metal concentrations in different body size groups of the bivalves do not follow uniform trend. Correlation coefficient between different metal couplings as tested statistically revealed significant coupling for Pb-Zn, Pb-Cu, Zn-Cu, and Hg-Cu. Concentrations of all the metals in specific organs (visceral mass, mantle and gill) of the bivalves exceeded the safe levels according to the international standards for metals compiled by Food and Agricultural Organization of the United Nations and would be of great risk for human consumption. It is concluded that the mussel and clam are suitable biomonitors to employ in programs designed to assess changes in metal pollution in the Sunderban mangrove wetland. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  18. Characterization of degenerative changes in the temporomandibular joint of the bengal tiger (Panthera tigris tigris) and siberian tiger (Panthera tigris altaica).

    Science.gov (United States)

    Murphy, M K; Arzi, B; Vapniarsky-Arzi, N; Athanasiou, K A

    2013-11-01

    The articulation of the temporomandibular joint (TMJ) is composed of the temporal bone dorsally, the mandibular condyle ventrally and a fibrous articular disc. The TMJ disc plays an essential role in distributing load between the two articular surfaces. Degeneration of the disc in the presence of joint pathology has been shown in man; however, TMJ pathology has not been documented previously in tigers (Panthera tigris). The mandibular condyle and TMJ disc of a Bengal tiger (P. tigris tigris) and a Siberian tiger (P. tigris altaica) were evaluated grossly and the TMJ disc was characterized biochemically and mechanically. Characterization of the TMJ disc verified region- and direction-dependent biochemical and mechanical properties, reflective of the functional demands on the joint. Degenerative joint disease was observed in both cases and this was more severe in the Siberian tiger. Simultaneous evaluation of joint pathology, biochemical composition and mechanical properties of the TMJ disc revealed a loss in functional properties (tensile anisotropy) of the disc as joint pathology advanced from moderate to severe. TMJ degeneration may compromise the ability of the animal to eat and thrive and may be a factor contributing to the endangered status of these species. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Chemical evolution in the high arsenic groundwater of the Huhhot basin (Inner Mongolia, PR China) and its difference from the western Bengal basin (India)

    International Nuclear Information System (INIS)

    Mukherjee, Abhijit; Bhattacharya, Prosun; Shi, Fei; Fryar, Alan E.; Mukherjee, Arun B.; Xie, Zheng M.; Jacks, Gunnar; Bundschuh, Jochen

    2009-01-01

    Elevated As concentrations in groundwater of the Huhhot basin (HB), Inner Mongolia, China, and the western Bengal basin (WBB), India, have been known for decades. However, few studies have been performed to comprehend the processes controlling overall groundwater chemistry in the HB. In this study, the controls on solute chemistry in the HB have been interpreted and compared with the well-studied WBB, which has a very different climate, physiography, lithology, and aquifer characteristics than the HB. In general, there are marked differences in solute chemistry between HB and WBB groundwaters. Stable isotopic signatures indicate meteoric recharge in the HB in a colder climate, distant from the source of moisture, in comparison to the warm, humid WBB. The major-ion composition of the moderately reducing HB groundwater is dominated by a mixed-ion (Ca-Na-HCO 3 -Cl) hydrochemical facies with an evolutionary trend along the regional hydraulic gradient. Molar ratios and thermodynamic calculations show that HB groundwater has not been affected by cation exchange, but is dominated by weathering of feldspars (allitization) and equilibrium with gibbsite and anorthite. Mineral weathering and mobilization of As could occur as recharging water flows through fractured, argillaceous, metamorphic or volcanic rocks in the adjoining mountain-front areas, and deposits solutes near the center of the basin. In contrast, WBB groundwater is Ca-HCO 3 -dominated, indicative of calcite weathering, with some cation exchange and silicate weathering (monosiallitization).

  20. A study of clinical profile of vitamin B 12 deficiency with special reference to dermatologic manifestations in a Tertiary Care Hospital in sub-Himalayan Bengal

    Directory of Open Access Journals (Sweden)

    Kaushik Sen

    2015-01-01

    Full Text Available Background: Vitamin B 12 deficiency is thought to be uncommon in the eastern parts of India including Bengal and the eastern states as compared to the northern and southern parts of India. The importance of cutaneous features in relation to vitamin B 12 deficiency is not well described in literature. Aim: To know the clinical profile of vitamin B 12 deficiency in this region and to find out if there is any relationship between dermatologic manifestations with vitamin B 12 deficiency. Materials and Methods: All symptomatic patients of anemia requiring blood transfusions who had either raised mean corpuscular volume (MCV or bicytopenia/pancytopenia on complete blood count or were symptomatic in the form of skin hyperpigmentation were screened for vitamin B 12 deficiency. Results: Twenty-five patients were tested for vitamin B 12 deficiency. Of them 19 patients were found to be having vitamin B 12 deficiency. Conclusions: Vitamin B 12 deficiency is not uncommon in the eastern parts of India, contrasting the previous thoughts that it was uncommon in this area, though larger studies are required to know it better. This study included only those requiring blood transfusions, thus a much higher prevalence is expected in this area. Patients with vitamin B 12 deficiency do present with severe anemia requiring blood transfusions and often have skin hyperpigmentation.