WorldWideScience

Sample records for bedbug cimex lectularius

  1. Two different lineages of bedbug (Cimex lectularius) reflected in host specificity.

    Science.gov (United States)

    Wawrocka, Kamila; Bartonička, Tomáš

    2013-11-01

    Co-speciation between host-parasite species is generally thought to result in mirror-image congruent phylogenies. For the last several centuries, many bat species have been turning synanthropic, especially those that are hosted by bedbugs in Europe. There is evidence of only limited gene flow from the population of people to the population of bats. This study was focused on comparison of survival, development, and the reproduction rate based on cross-feeding experiments. In our research, we used two bedbugs groups of Cimex lectularius-bat- and human-associated and respectively as specific/non-specific host bat and commercial human blood. Both lineages show different behavior according to their host preferences. During the bat blood experiment, we found significant differences between both human- and bat-associated bedbugs (Log rank test fourth χ(2) = 9.93, p > 0.05; fifth χ(2) = 11.33, p < 0.05), while no differences occurred with the human blood experiment between the survival levels. In molting, differences between both groups were significant particularly in the case of the bat blood experiment (fourth χ(2)  = 5.91, p < 0.05). In the case of the bat blood experiment, we found a higher probability of molting in bat-associated groups than in human-associated groups. In the case of the human blood experiment, molting probability was stable in both specific and non-specific, showing similar pattern in both cases for all stages. Our results indicate an occurrence of two ecotypes within the one species C. lectularius. These findings support earlier data about morphological and mitochondrial DNA differences. The differentiation of both lineages fits the concept of specific host choice. PMID:23982311

  2. Characterization of Cimex lectularius (bedbug) defensin peptide and its antimicrobial activity against human skin microflora.

    Science.gov (United States)

    Kaushal, Akanksha; Gupta, Kajal; van Hoek, Monique L

    2016-02-19

    Antimicrobial peptides are components of both vertebrate and invertebrate innate immune systems that are expressed in response to exposure to bacterial antigens. Naturally occurring antimicrobial peptides from evolutionarily ancient species have been extensively studied and are being developed as potential therapeutics against antibiotic resistant microorganisms. In this study, a putative Cimex lectularius (bedbug, CL) defensin is characterized for its effectiveness against human skin flora including Gram-negative and Gram-positive bacteria. The bedbug defensin (CL-defensin), belonging to family of insect defensins, is predicted to have a characteristic N-terminal loop, an α-helix, and an antiparallel β-sheet, which was supported by circular dichroism spectroscopy. The defensin was shown to be antimicrobial against Gram-positive bacteria commonly found on human skin (Micrococcus luteus, Corynebacterium renale, Staphylococcus aureus and Staphylococcus epidermidis); however, it was ineffective against common skin Gram-negative bacteria (Pseudomonas aeruginosa and Acinetobacter baumannii) under low-salt conditions. CL-defensin was also effective against M. luteus and C. renale in high-salt (MIC) conditions. Our studies indicate that CL-defensin functions by depolarization and pore-formation in the bacterial cytoplasmic membrane. PMID:26802465

  3. Infection of the common bedbug (Cimex lectularius L) with hepatitis B virus in South Africa.

    Science.gov (United States)

    Jupp, P G; Prozesky, O W; McElligott, S E; Van Wyk, L A

    1978-04-15

    A total of 1 368 bedbugs of the species Cimex lectularius L were collected mainly from huts in villages or on farms at 6 localities in the northern Transvaal. They were tested in pools of 10 for the presence of hepatitis B surface antigen (HBsAg). None of 20 pools from Pietersburg was HBsAg-positive, but 32 out of 120 pools from the 5 other localities were HBsAg-positive. Estimated infection rates per 1 000 bugs were 17,1 (Messina), 24,9 (Waterpoort), 28,4 (Letaba), 54,5 (Potgietersrus) and 67,0 (Louis Trichardt), with an overall rate of 30,6. Seventeen out of 57 pools of the engorged bugs (infection rate 34,8) and 14 out of 62 pools of the unengorged bugs (infection rate 25,3) were HBsAg-positive. These very high infection rates, even in unengorged bugs, suggest that C. lectularius could be a vector of hepatitis B virus in the Transvaal, and that the varying degrees of infestation could explain the markedly different HBsAg-positive frequencies previously shown in sera collected from different population groups in that province. PMID:675426

  4. Male mating rate is constrained by seminal fluid availability in bedbugs, Cimex lectularius.

    Directory of Open Access Journals (Sweden)

    Klaus Reinhardt

    Full Text Available Sexual selection, differences in reproductive success between individuals, continues beyond acquiring a mating partner and affects ejaculate size and composition (sperm competition. Sperm and seminal fluid have very different roles in sperm competition but both components encompass production costs for the male. Theoretical models predict that males should spend ejaculate components prudently and differently for sperm and seminal fluid but empirical evidence for independent variation of sperm number and seminal fluid volume is scarce. It is also largely unknown how sperm and seminal fluid variation affect future mating rate. In bedbugs we developed a protocol to examine the role of seminal fluids in ejaculate allocation and its effect on future male mating rate. Using age-related changes in sperm and seminal fluid volume we estimated the lowest capacity at which mating activity started. We then showed that sexually active males allocate 12% of their sperm and 19% of their seminal fluid volume per mating and predicted that males would be depleted of seminal fluid but not of sperm. We tested (and confirmed this prediction empirically. Finally, the slightly faster replenishment of seminal fluid compared to sperm did not outweigh the faster decrease during mating. Our results suggest that male mating rate can be constrained by the availability of seminal fluids. Our protocol might be applicable to a range of other organisms. We discuss the idea that economic considerations in sexual conflict research might benefit from distinguishing between costs and benefits that are ejaculate dose-dependent and those that are frequency-dependent on the mating rate per se.

  5. A QSAR Study of the Repellency of some Terpenoids to the Bedbug Cimex lectularius L.%萜类臭虫(Cimex lectularius L.)驱避化合物的定量构效关系研究

    Institute of Scientific and Technical Information of China (English)

    宋杰; 王宗德; 韩招久; 陈金珠; 姜志宽; 郑卫青; 商士斌

    2012-01-01

    测定了一系列六元环萜类化合物对臭虫(Cimex lectularius L.)的驱避活性,利用Codessa Pro程序计算了这些化合物的结构描述符,再利用Codessa Pro程序中的最优线性回归方法计算了驱避活性与这些化合物结构描述符之间的定量构效关系.所得到的最优定量构效关系计算模型的R2为0.924,模型所包含的4个参数分别是:FNSA3 fractional PNSA、Min n-n repulsion for bond H-C、YZ Shadow/YZ rectangle、Max electrophilic reactivity index for atom C.通过对模型的分析讨论了臭虫化学感受器与驱避剂之间可能存在的相互作用.%The quantitative structure-activity relationship (QSAR) between the repellency against bedbug,Cimex lectularius L.(Hemiptera:Cimicidae) and the molecular structural descriptors of a series of terpenoid compounds with six-member-ring was correlated by best multilinear regression (BMLR) method.The descriptors and the multilinear regression were all calculated by Codessa Pro.The optimum multilinear model with R2 value of 0.924 and 4 descriptors,i.e.the fractional atomic charge weighted partial megative surface area (FNSA3) fractional the atomic charge weighted partial negative charge molecular surface area (PNSA),Min n-n repulsion for bond H-C,YZ Shadow/YZ rectangle and Max electrophilic reactivity index for atom C was validated and presented.The probable interaction between the chemoreceptor of bedbug and the repellent was also discussed according to the optimum model and its descriptors.

  6. Transcriptomics of the bed bug (Cimex lectularius.

    Directory of Open Access Journals (Sweden)

    Xiaodong Bai

    Full Text Available BACKGROUND: Bed bugs (Cimex lectularius are blood-feeding insects poised to become one of the major pests in households throughout the United States. Resistance of C. lectularius to insecticides/pesticides is one factor thought to be involved in its sudden resurgence. Despite its high-impact status, scant knowledge exists at the genomic level for C. lectularius. Hence, we subjected the C. lectularius transcriptome to 454 pyrosequencing in order to identify potential genes involved in pesticide resistance. METHODOLOGY AND PRINCIPAL FINDINGS: Using 454 pyrosequencing, we obtained a total of 216,419 reads with 79,596,412 bp, which were assembled into 35,646 expressed sequence tags (3902 contigs and 31744 singletons. Nearly 85.9% of the C. lectularius sequences showed similarity to insect sequences, but 44.8% of the deduced proteins of C. lectularius did not show similarity with sequences in the GenBank non-redundant database. KEGG analysis revealed putative members of several detoxification pathways involved in pesticide resistance. Lamprin domains, Protein Kinase domains, Protein Tyrosine Kinase domains and cytochrome P450 domains were among the top Pfam domains predicted for the C. lectularius sequences. An initial assessment of putative defense genes, including a cytochrome P450 and a glutathione-S-transferase (GST, revealed high transcript levels for the cytochrome P450 (CYP9 in pesticide-exposed versus pesticide-susceptible C. lectularius populations. A significant number of single nucleotide polymorphisms (296 and microsatellite loci (370 were predicted in the C. lectularius sequences. Furthermore, 59 putative sequences of Wolbachia were retrieved from the database. CONCLUSIONS: To our knowledge this is the first study to elucidate the genetic makeup of C. lectularius. This pyrosequencing effort provides clues to the identification of potential detoxification genes involved in pesticide resistance of C. lectularius and lays the foundation for

  7. Bedbugs and Infectious Diseases

    OpenAIRE

    Delaunay, Pascal; Blanc, Véronique; Del Giudice, Pascal; Levy-Bencheton, Anna; Chosidow, Olivier; Marty, Pierre; Brouqui, Philippe

    2011-01-01

    Bedbugs are brown and flat hematophagous insects. The 2 cosmopolite species, Cimex lectularius and Cimex hemipterus, feed on humans and/or domestic animals, and recent outbreaks have been reported in occidental countries. Site assessment for bedbug eradication is complex but can be assured, despite emerging insecticide resistance, by hiring a pest-control manager. The common dermatological presentation of bites is an itchy maculopapular wheal. Urticarial reactions and anaphylaxis can also occ...

  8. Bedbugs

    Science.gov (United States)

    ... Getting bedbugs has nothing to do with good hygiene and housekeeping. How do you get bedbugs? People ... for the following signs near places where you sleep. Signs of bedbugs : This step is important. If ...

  9. Cases of bed bug (Cimex lectularius infestations in Northwest Italy

    Directory of Open Access Journals (Sweden)

    Federica Giorda

    2013-12-01

    Full Text Available Bed bugs (Cimex lectularius have been a common problem for humans for at least 3,500 years and in Europe their presence was endemic until the end of World War II, when infestations began to decrease. However, since the beginning of the 21st century new cases of infestations have been reported in developed countries. Many theories have been put forward to explain this change of direction, but none has been scientifically proven. The aim of this study is to provide some reports of bed bug infestations in Northern Italy (Liguria, Piedmont and Aosta valley regions and a brief summary about their identification, clinical significance, bioecology and control. From 2008 to date, 17 bed bug infestations were identified in Northwest Italy. Knowledge about the presence and distribution of bed bugs in Italy is scanty, prior to this work only 2 studies reported the comeback of these arthropods in the Italian territory; further investigations would be necessary to better understand the current situation.

  10. Extensive fragmentation of the X chromosome in the bed bug Cimex lectularius Linnaeus, 1758 (Heteroptera, Cimicidae): a survey across Europe

    Czech Academy of Sciences Publication Activity Database

    Sadílek, D.; Šťáhlavský, F.; Vilímová, J.; Zima, Jan

    2013-01-01

    Roč. 7, č. 4 (2013), s. 253-269. ISSN 1993-0771 Institutional support: RVO:68081766 Keywords : Cimex lectularius * Cimex pipistrelli * cytogenetics * chromosome number variation * X chromosome Subject RIV: EG - Zoology Impact factor: 1.211, year: 2013

  11. The Odorant Receptor Co-Receptor from the Bed Bug, Cimex lectularius L

    OpenAIRE

    Hansen, Immo A.; Rodriguez, Stacy D.; Drake, Lisa L.; Price, David P.; Blakely, Brittny N.; Hammond, John I; Tsujimoto, Hitoshi; Monroy, Erika Y.; Maio, William A.; Romero, Alvaro

    2014-01-01

    Recently, the bed bug, Cimex lectularius L. has re-emerged as a serious and growing problem in many parts of the world. Presence of resistant bed bugs and the difficulty to eliminate them has renewed interest in alternative control tactics. Similar to other haematophagous arthropods, bed bugs rely on their olfactory system to detect semiochemicals in the environment. Previous studies have morphologically characterized olfactory organs of bed bugs’ antenna and have physiologically evaluated th...

  12. Identification of the airborne aggregation pheromone of the common bed bug, Cimex lectularius.

    Science.gov (United States)

    Siljander, Eric; Gries, Regine; Khaskin, Grigori; Gries, Gerhard

    2008-06-01

    Adults and juveniles of the common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae), return to and aggregate in harborages after foraging for hosts. We tested the hypothesis that the aggregation is mediated, in part, by an airborne aggregation pheromone. Volatiles from experimental C. lectularius harborages were captured on Porapak Q, fractionated by liquid chromatography, and bioassayed in dual-choice, still-air olfactometer experiments. Of 14 compounds with >100 pg abundance in gas chromatography-mass spectrometry analyses of two bioactive fractions, 10 compounds [nonanal, decanal, (E)-2-hexenal, (E)-2-octenal, (2E,4E)-octadienal, benzaldehyde, (+)- and (-)-limonene, sulcatone, benzyl alcohol] proved to be essential components of the C. lectularius airborne aggregation pheromone. PMID:18470566

  13. Molecular characterization of Wolbachia infection in bed bugs (Cimex lectularius collected from several localities in France

    Directory of Open Access Journals (Sweden)

    Akhoundi Mohammad

    2016-01-01

    Full Text Available Wolbachia symbionts are maternally inherited intracellular bacteria that have been detected in numerous insects including bed bugs. The objective of this study, the first epidemiological study in Europe, was to screen Wolbachia infection among Cimex lectularius collected in the field, using PCR targeting the surface protein gene (wsp, and to compare obtained Wolbachia strains with those reported from laboratory colonies of C. lectularius as well as other Wolbachia groups. For this purpose, 284 bed bug specimens were caught and studied from eight different regions of France including the suburbs of Paris, Bouches-du-Rhône, Lot-et-Garonne, and five localities in Alpes-Maritimes. Among the samples, 166 were adults and the remaining 118 were considered nymphs. In all, 47 out of 118 nymphs (40% and 61 out of 166 adults (37% were found positive on wsp screening. Among the positive cases, 10 samples were selected randomly for sequencing. The sequences had 100% homology with wsp sequences belonging to the F-supergroup strains of Wolbachia. Therefore, we confirm the similarity of Wolbachia strains detected in this epidemiological study to Wolbachia spp. reported from laboratory colonies of C. lectularius.

  14. Effects of gamma radiation on the adult stage of bed bug Cimex lectularius L. (Hemiptera, cimicidae)

    International Nuclear Information System (INIS)

    The effects of gamma radiation doses ranging between 1 and 30 krad on the adult stage of Cimex lectularius L., were studied. The effects of irradiation on the different biological aspects of C. lectularius L., were taken in consideration. Adult irradiation affected clearly the egg production, fertility and longevity of both sexes at different mating combinations. Females were more sensitive to the sterilizing effects of gamma radiation than males, the complete sterility of both sexes in parent generation (P1) being achieved at 20 and 30 krad, respectively. The nymphal duration of first generation (F1) nymphs was greatly prolonged at all employed dosages. Our results indicated that the percent emergence of adults were reduced progressively at the dose was increased in F1 generation. The results of matings between F1 generation and individuals that had no history of radiation showed that in C. lectularius L., the genetic damage transmitted to F1 generation resulted in a greater incidence of sterility and in a reduction in the average number of eggs laid per females. (author)

  15. The Influence of Roughness and Pyrethroid Formulations on Bed Bug (Cimex lectularius L. Resting Preferences

    Directory of Open Access Journals (Sweden)

    Benjamin A. Hottel

    2015-05-01

    Full Text Available Two-choice tests were conducted to examine the effect of surface roughness on the resting preference of bed bugs, Cimex lectularius L., on copper, basswood, and acrylic materials. The influence of pyrethroid formulation applications on resting preferences was also evaluated. Bed bugs were given the choice of resting between two sanded halves of each material tested. One half was sanded with a P60 grit sandpaper and the other with a less rough P600 grit sandpaper. A significantly higher proportion of bed bugs chose to rest on the rougher P60 grit sanded half of all materials tested. Pyrethroid applications were made to either the P60 grit half or both halves of acrylic arenas and resting preferences were again assessed. Behavioral responses of bed bugs to pyrethroid formulation applications varied depending on the bed bug strain used and the formulation applied. Bed bugs would still rest on the P60 grit half when Suspend SC formulation (0.06% deltamethrin was applied; however, an avoidance response was observed from a bed bug strain susceptible to D-Force aerosol formulations (0.06% deltamethrin. The avoidance behavior is likely attributed to one, more than one, or even an interaction of multiple spray constituents and not the active ingredient.

  16. Evaluation of Blood Regimen on the Survival of Cimex lectularius L. Using Life Table Parameters

    Directory of Open Access Journals (Sweden)

    Edwin G. Rajotte

    2013-06-01

    Full Text Available Knowledge of bed bug development under varying conditions can lead to more sophisticated management techniques. Development rate, age and stage-specific life tables were compared for a laboratory strain (HS and field strain (ECL-05 of bed bug Cimex lectularius L. (Hemiptera: Heteroptera reared on two blood regimens: human or rabbit blood. Harlan and ECL-05 bed bugs reared on human blood had a life expectancy of 207 and 208 days respectively from the egg stage. Egg to adult development of HS bed bugs reared on human blood (~35 days was significantly longer than that of the ECL-05 strain (~33 days in the third, fourth, and fifth instars. The HS and ECL-05 bed bugs reared on rabbit blood had a life expectancy of 149 and 174 days respectively. Egg to adult development time of HS on rabbit blood (~52 days was significantly longer than ECL-05 (~37 days in every instar, and HS total life span was significantly shorter compared to ECL-05. Developmental differences based on strain and blood regimen suggest rabbit blood is an inferior blood source for colony maintenance, and strain has variable effects on bed bug development. Findings suggest that blood regimen should strongly be considered in bed bug colony maintenance.

  17. Chemically Mediated Arrestment of the Bed Bug, Cimex lectularius, by Volatiles Associated with Exuviae of Conspecifics

    Science.gov (United States)

    Choe, Dong-Hwan; Park, Hoeun; Vo, Claudia; Knyshov, Alexander

    2016-01-01

    Extracts of the exuviae (cast skins) of nymphal bed bugs (Cimex lectularius) were analyzed for volatile compounds that might contribute to arrestment of adult bed bugs. Four volatile aldehydes, (E)-2-hexenal, 4-oxo-(E)-2-hexenal, (E)-2-octenal, and 4-oxo-(E)-2-octenal were consistently detected in the headspace of freshly shed exuviae regardless of the developmental stages from which the exuviae were obtained. Quantification of the aldehydes in the solvent extracts of homogenized fresh, 45- or 99-d aged 5th instar exuviae indicated that the aldehydes are present in the exuviae and dissipate over time, through evaporation or degradation. Microscopic observation of the fifth instar exuviae indicated that the dorsal abdominal glands on the exuviae maintained their pocket-like structures with gland reservoirs, within which the aldehydes might be retained. Two-choice olfactometer studies with the volatiles from exuviae or a synthetic blend mimicking the volatiles indicated that adult bed bugs tend to settle close to sources of the aldehydes. Our results imply that the presence and accumulation of bed bug exuviae and the aldehydes volatilizing from the exuviae might mediate bed bugs’ interaction with their microhabitats. PMID:27434044

  18. Toxicity and potential utility of ivermectin and moxidectin as xenointoxicants against the common bed bug, Cimex lectularius L.

    Science.gov (United States)

    Sheele, Johnathan M; Ridge, Gale E

    2016-08-01

    The recent resurgence of the common bed bug Cimex lectularius L. throughout western industrialized nations has been facilitated in part by the insect becoming pesticide-resistant. Novel control strategies, including xenointoxication, should be considered to combat C. lectularius. Ivermectin, a U.S. Food and Drug Administration (FDA)-approved treatment for several human parasites, and the antiparasitic drug moxidectin, currently being explored in human clinical trials, were evaluated for efficacy against C. lectularius. Results showed that C. lectularius fed on ivermectin or moxidectin blood concentrations of >25 ng/mL and had significantly higher mortality (50-100 %) than controls (0-6 %) by day 13. Bed bugs that survived a blood meal containing >2.5 ng/mL of ivermectin suffered long-term sequelae including reduced fecundity, feeding difficulty, and incomplete ecdysis. Some insects that survived a blood meal containing ≤75 ng/mL moxidectin were able to feed and reproduce. PMID:27090120

  19. Nymphs of the common bed bug (Cimex lectularius produce anti-aphrodisiac defence against conspecific males

    Directory of Open Access Journals (Sweden)

    Harraca Vincent

    2010-09-01

    Full Text Available Abstract Background Abdominal wounding by traumatic insemination and the lack of a long distance attraction pheromone set the scene for unusual sexual signalling systems. Male bed bugs (Cimex lectularius mount any large, newly fed individual in an attempt to mate. Last instar nymphs overlap in size with mature females, which make them a potential target for interested males. However, nymphs lack the female's specific mating adaptations and may be severely injured by the abdominal wounding. We, therefore, hypothesized that nymphs emit chemical deterrents that act as an honest status signal, which prevents nymph sexual harassment and indirectly reduces energy costs for males. Results Behavioural mating assays showed that males mount nymphs significantly shorter time compared to females, although initial mounting preference was the same. In support of our hypothesis, nymphs experienced the same percentage of mating with sperm transfer as females if they were unable to emit (E-2-hexenal, (E-2-octenal 4-oxo-(E-2-hexenal and 4-oxo-(E-2-octenal, from their dorsal abdominal glands. We report that the aldehydes and 4-oxo-(E-2-hexenal are detected by olfactory receptor neurons housed in smooth and grooved peg sensilla, respectively, on the adult antennae, at biologically relevant concentrations. Behavioural experiments showed that application of 4-oxo-(E-2-hexenal or the two aldehydes at a nymph-emitted ratio, to a male/female pair during mounting initiation, decreased mating frequency to a rate comparable to that of a male/nymph pair. Conclusions By combining behavioural and sensory studies, we show that the nymph-specific alarm pheromone plays an important role in intra-specific communication in the common bed bug. Alarm pheromones are commonly looked upon as a system in predator/prey communication, but here we show that alarm pheromones may be used as multipurpose signals such as decreasing the risk of nymphal mating by males. See commentary: http

  20. Human-facilitated metapopulation dynamics in an emerging pest species, Cimex lectularius.

    Science.gov (United States)

    Fountain, Toby; Duvaux, Ludovic; Horsburgh, Gavin; Reinhardt, Klaus; Butlin, Roger K

    2014-03-01

    The number and demographic history of colonists can have dramatic consequences for the way in which genetic diversity is distributed and maintained in a metapopulation. The bed bug (Cimex lectularius) is a re-emerging pest species whose close association with humans has led to frequent local extinction and colonization, that is, to metapopulation dynamics. Pest control limits the lifespan of subpopulations, causing frequent local extinctions, and human-facilitated dispersal allows the colonization of empty patches. Founder events often result in drastic reductions in diversity and an increased influence of genetic drift. Coupled with restricted migration, this can lead to rapid population differentiation. We therefore predicted strong population structuring. Here, using 21 newly characterized microsatellite markers and approximate Bayesian computation (ABC), we investigate simplified versions of two classical models of metapopulation dynamics, in a coalescent framework, to estimate the number and genetic composition of founders in the common bed bug. We found very limited diversity within infestations but high degrees of structuring across the city of London, with extreme levels of genetic differentiation between infestations (FST  = 0.59). ABC results suggest a common origin of all founders of a given subpopulation and that the numbers of colonists were low, implying that even a single mated female is enough to found a new infestation successfully. These patterns of colonization are close to the predictions of the propagule pool model, where all founders originate from the same parental infestation. These results show that aspects of metapopulation dynamics can be captured in simple models and provide insights that are valuable for the future targeted control of bed bug infestations. PMID:24446663

  1. Effects of Starvation on Deltamethrin Tolerance in Bed Bugs, Cimex lectularius L. (Hemiptera: Cimicidae

    Directory of Open Access Journals (Sweden)

    Zachary C. DeVries

    2015-01-01

    Full Text Available Bed bugs, Cimex lectularius L., are a major pest in the urban environment. Their presence often results in physical, psychological, and financial distress of homeowners and apartment dwellers. Although many insecticide bioassays have been performed on this pest, little attention has been paid to bed bug feeding status, which is closely linked to metabolism, molting, and mass. Therefore, we evaluated the toxicity of topically applied deltamethrin on insecticide susceptible adult male bed bugs fed 2 d, 9 d, and 21 d prior to testing. When toxicity was evaluated on a “per-bug” basis, there was no difference between 2 d [LD50 = 0.498 (0.316 − 0.692 ng·bug−1] and 9 d [LD50 = 0.572 (0.436 − 0.724 ng·bug−1] starved bugs, while 21 d starved bugs had a significantly lower LD50 [0.221 (0.075 − 0.386 ng·bug−1]. When toxicity was evaluated in terms of body mass, 9 d starved bugs had the highest LD50 values [0.138 (0.102 − 0.176 ng·mg−1], followed by 2 d starved bugs [0.095 (0.060 − 0.134 ng·mg−1], and then 21 d starved bugs [0.058 (0.019–0.102 ng·mg−1]; the LD50 values of 2 d and 9 d starved bugs were significantly different from 21 d starved bugs. These results indicate that feeding status plays an important role in the toxicity of deltamethrin. In addition, the lack of differences between 2 d and 9 d starved bugs indicate that the blood meal itself has little impact on tolerance, but rather it is some physiological change following feeding that confers increased tolerance to bed bugs.

  2. Efficacy of an Essential Oil-Based Pesticide for Controlling Bed Bug (Cimex lectularius Infestations in Apartment Buildings

    Directory of Open Access Journals (Sweden)

    Changlu Wang

    2014-11-01

    Full Text Available Bed bugs (Cimex lectularius L. and Cimex hemipterus F. are among the most difficult urban pests to manage. Many essential oil-based bed bug control products that are considered reduced risk to mammals compared to synthetic insect neurotoxins have become commercially available, but their effectiveness as a stand-alone control method is unknown. This study assessed the field efficacy of an essential oil-based bed bug control product (EcoRaider; a.i. 1% geraniol + 1% cedar oil + 2% sodium lauryl sulfate compared to a pyrethroid and neonicotinoid mixture spray (0.075% Temprid SC; a.i. beta-cyfluthrin + imidacloprid. After 12 weeks, the three treatments—EcoRaider, Temprid SC, and EcoRaider + Temprid SC caused 92.5 ± 2.7, 92.9 ± 3.0, and 91.7% ± 2.7% bed bug count reduction, respectively. No significant differences existed in the bed bug reduction among the treatments. Bed bugs were eliminated from only 22% of the treated apartments. Among those still with bed bugs, 76% of the residents did not know bed bugs were present. We documented the residents’ self-control practices and discussed the potential of using essential oil-based insecticides in bed bug management programs to minimize the health risks to building occupants and pets and to slow down the development of insecticide resistance.

  3. Efficacy of an Essential Oil-Based Pesticide for Controlling Bed Bug (Cimex lectularius) Infestations in Apartment Buildings.

    Science.gov (United States)

    Wang, Changlu; Singh, Narinderpal; Cooper, Richard

    2014-01-01

    Bed bugs (Cimex lectularius L. and Cimex hemipterus F.) are among the most difficult urban pests to manage. Many essential oil-based bed bug control products that are considered reduced risk to mammals compared to synthetic insect neurotoxins have become commercially available, but their effectiveness as a stand-alone control method is unknown. This study assessed the field efficacy of an essential oil-based bed bug control product (EcoRaider; a.i. 1% geraniol + 1% cedar oil + 2% sodium lauryl sulfate) compared to a pyrethroid and neonicotinoid mixture spray (0.075% Temprid SC; a.i. beta-cyfluthrin + imidacloprid). After 12 weeks, the three treatments-EcoRaider, Temprid SC, and EcoRaider + Temprid SC caused 92.5 ± 2.7, 92.9 ± 3.0, and 91.7% ± 2.7% bed bug count reduction, respectively. No significant differences existed in the bed bug reduction among the treatments. Bed bugs were eliminated from only 22% of the treated apartments. Among those still with bed bugs, 76% of the residents did not know bed bugs were present. We documented the residents' self-control practices and discussed the potential of using essential oil-based insecticides in bed bug management programs to minimize the health risks to building occupants and pets and to slow down the development of insecticide resistance. PMID:26462944

  4. Horizontal transfer of diatomaceous earth and botanical insecticides in the common bed bug, Cimex lectularius L.; hemiptera: cimicidae.

    Directory of Open Access Journals (Sweden)

    Yasmin Akhtar

    Full Text Available BACKGROUND: Horizontal transfer of insecticide occurs when insects contact or ingest an insecticide, return to an aggregation or a nest, and transfer the insecticide to other conspecific insects through contact. This phenomenon has been reported in a number of insects including social insects, however it has not been reported in bed bugs. Since horizontal transfer can facilitate the spread of insecticide into hard to reach spaces, it could contribute greatly to the management of these public health pests. METHODOLOGY/RESULTS: To demonstrate horizontal transfer of diatomaceous earth and botanical insecticides in C. lectularius, an exposed (donor bed bug, following a 10-minute acquisition period, was placed with unexposed (recipient bed bugs. Mortality data clearly demonstrates that diatomaceous earth (DE 51 was actively transferred from a single exposed bug to unexposed bugs in a concentration dependent manner. LC50 values varied from 24.4 mg at 48 h to 5.1 mg at 216 h when a single exposed bed bug was placed with 5 unexposed bed bugs. LT50 values also exhibited a concentration response. LT50 values varied from 1.8 days to 8.4 days when a 'donor' bug exposed to 20 and 5 mg of dust respectively was placed with 5 'recipient' bugs. Dust was also actively transferred from adult bed bugs to the nymphs. In addition we observed horizontal transfer of botanical insecticides including neem, ryania, and rotenone to varying degrees. CONCLUSION/SIGNIFICANCE: Our data clearly demonstrate horizontal transfer of diatomaceous earth and botanical insecticides in the common bed bug, C. lectularius. Use of a fluorescent dust provided visual confirmation that contaminated bed bugs transfer dust to untreated bed bugs in harborage. This result is important because bedbugs live in hard-to-reach places and interaction between conspecifics can be exploited for delivery and dissemination of management products directed at this public health pest.

  5. Stress Tolerance of Bed Bugs: A Review of Factors That Cause Trauma to Cimex lectularius and C. Hemipterus

    Directory of Open Access Journals (Sweden)

    Joshua B. Benoit

    2011-04-01

    Full Text Available Recent emergence of bed bugs (Cimex spp. has prompted a significant expansion of research devoted to this pest. The ability to survive and recover from stress has significant implications on the distribution and survival of insects, and bed bugs are no exception. Research on bed bug stress tolerance has shown considerable progress and necessitates a review on this topic. Bed bugs have an extraordinary ability to resist dehydration between bloodmeals, and this represents a critical factor allowing their prolonged survival when no host is available. High relative humidities are detrimental to bed bugs, leading to reduced survival in comparison to those held at lower relative humidities. Continual exposure of bed bugs, eggs and mobile stages, to temperatures below freezing and short term exposure (=1 h to temperatures below −16 to −18 °C results in mortality. The upper thermal limit for short term exposure of eggs, nymphs and adults is between 40–45 °C for the common (Cimex lectularius and tropical (C. hemipterus bed bugs. Long-term exposure to temperatures above 35 °C results in significant reduction in survival of mobile bed bugs. Eggs for C. lectularius and C. hemipterus are no longer viable when held below 10 °C or above 37 °C throughout embryogenesis. Blood feeding, although necessary for survival and reproduction, is discussed as a stress due to thermal and osmotic fluctuations that result from ingesting a warm bloodmeal from a vertebrate host. Cold, heat, water stress and blood feeding prompted the expression of heat shock proteins (Hsps. Pesticide application is a common human-induced stress for urban pests, and recent studies have documented pesticide resistance in many bed bug populations. High levels of traumatic insemination (mating of bed bugs has been linked to reduced survival and fecundity along with possibly exposing individuals to microbial infections after cuticular penetration by the paramere (=male reproductive organ

  6. Bedbug infestation and its control practices in Gbajimba: a rural settlement in Benue state, Nigeri

    Directory of Open Access Journals (Sweden)

    E.A. Omudu , C.N. Kus

    2010-12-01

    Full Text Available Background & objectives: The common bedbug Cimex lectularius Linnaeus 1758 (Hemiptera:Cimicidae is a globally re-emerging pest of serious public health concern. We investigated bedbuginfestation in randomly selected apartments in Gbajimba community in Guma Local Governmentarea in Benue state, Nigeria.Methods: Beddings and furniture (bed frames, pillows, mattresses, cushion chairs, mats, mosquitonets and bamboo beds were thoroughly inspected for bedbug infestation using the hand-pickingtechnique. Data were analysed using chi-square analysis for differences in the infestation levels inharbourages and sampling locations.Results: Only 16% of the apartments investigated showed no evidence of bedbug infestation asegg cases and faecal marks were sighted in 62.2% of apartments surveyed. The highest infestationrate was observed in Angwan Jukun area and infestation here was higher compared to other studylocations within the town though the difference was not statistically significant (2 = 7.92, df = 6,p >0.05. Bamboo beds harboured the highest number of bedbugs collected, accounting for 35.8%,while other harbourages like iron bed frames and sleeping mats had 23 and 22.7% infestationrates respectively. The infestation rates in these household items were significantly higher thanother items inspected (2 = 11.8, df = 4, p > 0.05.Interpretation & conclusion: This study demonstrates the urgent need for identification of evidencesof infestation and bedbug management involving community participation in inspection, detectionand education, including physical removal and exclusion as well as pesticide application.

  7. A Survey of Bedbug (Cimex lectularius Infestation in Some Homes and Hostels in Gboko, Benue State, Nigeria

    Directory of Open Access Journals (Sweden)

    Onah Isegbe Emmanuel

    2014-01-01

    Full Text Available A Survey of bed bug infestation in some homes and hostels, in Gboko, Benue State, Nigeria, was conducted from January to April, 2011. Bed frames, bunks, mattresses, pillows, chairs, and clothes were inspected. A total of 2,642 bed bugs were collected. 73.3% were from hostels while 26.7% were from homes. There was a significant difference between in the number of homes infested and those not infested (χ2=61.44, df=4, P<0.05. Nymphs were the most populated, with 292 (41.4%, followed by males 223 (31.6%, and females 190 (27.0%. There was no significant difference in the number of infested hostels and those not infested (χ2=0.8, df=4, P<0.05. The nymphs being the most populated with 901 (64.1%, followed by males 538 (36.1%, and then females 496 (35.3%. The greater number of infestation recorded in the hostels was as a result of poor hygiene, lack of adequate knowledge of the best control practices and the high population density. In homes, lack of the awareness of the resurgence of the emerging pest and lack of proper health education is responsible for the high infestation. Proactive approach should be taken towards public health education against bed bug infestation. Government and NGOs should take critical steps in preventing spread and stigma.

  8. Induction of skin papillomas in the rabbit, Oryctologus cuniculus, by bites of a blood-sucking insect, Cimex lectularius, irradiated by gamma rays

    International Nuclear Information System (INIS)

    Bed bugs, Cimex lectularius, irradiated with gamma rays were allowed to suck blood from shaved areas of the skin of rabbits, Oryctolagus cuniculus, 2 times/week for 5 months and then once weekly for another 5 months. This significantly induced the formation of skin papillomas and sweat gland hyperplasia in five out of nine experimental animals. It is speculated that the saliva of the irradiated bugs was activated by gamma rays and was responsible for the induction of skin papillomas. Because bed bugs play a significant role in the transmission of virus, it is also speculated that there is a virus in the saliva of bugs; this virus may be activated by gamma radiation and causes the development of papillomas in the skin

  9. Stress Tolerance of Bed Bugs: A Review of Factors That Cause Trauma to Cimex lectularius and C. Hemipterus

    OpenAIRE

    Benoit, Joshua B.

    2011-01-01

    Recent emergence of bed bugs (Cimex spp.) has prompted a significant expansion of research devoted to this pest. The ability to survive and recover from stress has significant implications on the distribution and survival of insects, and bed bugs are no exception. Research on bed bug stress tolerance has shown considerable progress and necessitates a review on this topic. Bed bugs have an extraordinary ability to resist dehydration between bloodmeals, and this represents a critical factor all...

  10. A 454 survey reveals the community composition and core microbiome of the common bed bug (Cimex lectularius across an Urban Landscape.

    Directory of Open Access Journals (Sweden)

    Matthew Meriweather

    Full Text Available Elucidating the spatial dynamic and core constituents of the microbial communities found in association with arthropod hosts is of crucial importance for insects that may vector human or agricultural pathogens. The hematophagous Cimex lectularius (Hemiptera: Cimicidae, known as the human bed bug, has made a recent resurgence in North America, as well as worldwide, potentially owing to increased travel, climate change and resistance to insecticides. A comprehensive survey of the bed bug microbiome has not been performed to date, nor has an assessment of the spatial dynamics of its microbiome. Here we present a survey of internal and external bed bug microbial communities by amplifying the V4-V6 hypervariable region of the 16S rDNA gene region followed by 454 Titanium sequencing using 31 individuals from eight distinct collection locations obtained from residences in Cincinnati, OH. Across all samples, 97% of the microbial community is made up of two dominant OTUs, previously identified as the α-proteobacterium Wolbachia and an unnamed γ-proteobacterium from the Enterobacteriaceae. Microbial communities varied among host locations for measures of community diversity and exhibited structure according to collection location. This broad survey represents the most in-depth assessment, to date, of the microbes that associate with bed bugs.

  11. New Introductions, Spread of Existing Matrilines, and High Rates of Pyrethroid Resistance Result in Chronic Infestations of Bed Bugs (Cimex lectularius L. in Lower-Income Housing.

    Directory of Open Access Journals (Sweden)

    Ronald W Raab

    Full Text Available Infestations of the common bed bug (Cimex lectularius L. have increased substantially in the United States in the past 10-15 years. The housing authority in Harrisonburg, Virginia, conducts heat-treatments after bed bugs are detected in a lower-income housing complex, by treating each infested unit at 60°C for 4-6 hours. However, a high frequency of recurrent infestations called into question the efficacy of this strategy. Genetic analysis using Bayesian clustering of polymorphic microsatellite loci from 123 bed bugs collected from 23 units from May 2012 to April 2013 in one building indicated that (a 16/21 (73% infestations were genetically similar, suggesting ineffective heat-treatments or reintroductions from within the building or from a common external source, followed by local spread of existing populations; and (b up to 5 of the infestations represented new genotypes, indicating that 5 new populations were introduced into this building in one year, assuming they were not missed in earlier screens. There was little to no gene flow among the 8 genetic clusters identified in the building. Bed bugs in the U.S. often possess one or both point mutations in the voltage-gated sodium channel, termed knockdown resistance (kdr, from valine to leucine (V419L and leucine to isoleucine (L925I that confer target-site resistance against pyrethroid insecticides. We found that 48/121 (40% bed bugs were homozygous for both kdr mutations (L419/I925, and a further 59% possessed at least one of the kdr mutations. We conclude that ineffective heat treatments, new introductions, reintroductions and local spread, and an exceptionally high frequency of pyrethroid resistance are responsible for chronic infestations in lower-income housing. Because heat treatments fail to protect from reintroductions, and pesticide use has not decreased the frequency of infestations, preventing new introductions and early detection are the most effective strategies to avoid bed bug

  12. Uninvited Guests: Traditional Insect Repellents in Estonia used Against the Clothes Moth Tineola bisselliella, Human Flea Pulex irritons and Bedbug Cimex lectularius

    OpenAIRE

    Sõukand, Renata; Kalle, Raivo; Svanberg, Ingvar

    2010-01-01

    Extensive folklore records from pre-modern Estonia give us an excellent opportunity to study a variety of local plant knowledge and plant use among the peasantry in various parts of the country. One important biocultural domain where plant knowledge has been crucial was in the various methods of combating different ectoparasites that cohabited and coexisted with humans and their domestic animals. Some of these methods were widely known (world-wide, Eurasia, Europe, Baltic Rim), while others w...

  13. Database Description - ClEST | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ClEST Database... Description General information of database Database name ClEST Alternative name Cimex lectul...6812 (ext.222-36812) Fax: +81-29-861-6812 E-mail: Database classification Nucleotide Sequence Database...s Organism Taxonomy Name: Cimex lectularius Taxonomy ID: 79782 Database description Exp...ressed sequence tags (EST) database of unique organs and whole bodies of the bedbug, Cimex lectularius Featu

  14. Cuticular hydrocarbons from the bed bug Cimex lectularius L.

    Science.gov (United States)

    Pentane extracts of male and female bed bugs were analyzed by gas chromatography and mass spectrometry in an effort to identify cuticular hydrocarbons. Seventeen hydrocarbons accounting for nearly 99% of the compounds eluting in the cuticular hydrocarbon region were identified. The sample contained ...

  15. Alarm pheromones and chemical communication in nymphs of the tropical bed bug Cimex hemipterus (Hemiptera: Cimicidae.

    Directory of Open Access Journals (Sweden)

    H Christoph Liedtke

    Full Text Available The recent resurge of bed bug infestations (Cimex spp.; Cimicidae and their resistance to commonly used pesticides calls for alternative methods of control. Pheromones play an important role in environmentally sustainable methods for the management of many pest insects and may therefore be applicable for the control of bed bugs. The tropical bed bug, Cimex hemipterus, is a temporary ectoparasite on humans and causes severe discomfort. Compared to the common bed bug, Cimex lectularius, little is known about the chemical signalling and pheromone-based behaviour of the tropical species. Here, we show that the antennal morphology and volatile emission of C. hemipterus closely resembles those of C. lectularius and we test their behavioural responses to conspecific odour emissions. Two major volatiles are emitted by male, female and nymph C. hemipterus under stress, (E-2-hexenal and (E-2-octenal. Notably, nymph emissions show contrasting ratios of these compounds to adults and are further characterized by the addition of 4-oxo-(E-2-hexenal and 4-oxo-(E-2-octenal. The discovery of this nymph pheromone in C. hemipterus is potentially the cause of a repellent effect observed in the bio-tests, where nymph odours induce a significantly stronger repellent reaction in conspecifics than adult odours. Our results suggest that pheromone-based pest control methods developed for C. lectularius could be applicable to C. hemipterus, with the unique nymph blend showing promising practical properties.

  16. Bed Bug (Cimex lectularius L. Population Composition as Determined by Baited Traps

    Directory of Open Access Journals (Sweden)

    Elizabeth J. Schaafsma

    2012-04-01

    Full Text Available Two established field populations of bed bugs were sampled using host-mimicking traps baited with a combination of CO2, heat and a synthetic kairomone. The proportion of first instar nymphs (between 52% and 78% of all captured insects was significantly higher than reported in previous studies, which had employed different sampling methods. The proportion of adults was correspondingly much lower than previously reported, between 5% and 7% of total capture. As many as 120 bed bugs were captured in a single trap in one night; the variation in catches between sampling locations within the same room and between days at the same location indicates that multiple nights of trapping may be required to obtain an accurate representation of population structure.

  17. Estimating the critical thermal maximum (CTmax) of bed bugs, Cimex lectularius: Comparing thermolimit respirometry with traditional visual methods.

    Science.gov (United States)

    DeVries, Zachary C; Kells, Stephen A; Appel, Arthur G

    2016-07-01

    Evaluating the critical thermal maximum (CTmax) in insects has provided a number of challenges. Visual observations of endpoints (onset of spasms, loss of righting response, etc.) can be difficult to measure consistently, especially with smaller insects. To resolve this problem, Lighton and Turner (2004) developed a new technique: thermolimit respirometry (TLR). TLR combines real time measurements of both metabolism (V·CO2) and activity to provide two independent, objective measures of CTmax. However, several questions still remain regarding the precision of TLR and how accurate it is in relation to traditional methods. Therefore, we evaluated CTmax of bed bugs using both traditional (visual) methods and TLR at three important metabolic periods following feeding (1d, 9d, and 21d). Both methods provided similar estimates of CTmax, although traditional methods produced consistently lower values (0.7-1°C lower than TLR). Despite similar levels of precision, TLR provided a more complete profile of thermal tolerance, describing changes in metabolism and activity leading up to the CTmax, not available through traditional methods. In addition, feeding status had a significant effect on bed bug CTmax, with bed bugs starved 9d (45.19[±0.20]°C) having the greatest thermal tolerance, followed by bed bugs starved 1d (44.64[±0.28]°C), and finally bed bugs starved 21d (44.12[±0.28]°C). Accuracy of traditional visual methods in relation to TLR is highly dependent on the selected endpoint; however, when performed correctly, both methods provide precise, accurate, and reliable estimations of CTmax. PMID:26970580

  18. THE BEDBUG “XAMUIS” (THASUS GIGAS), A NEW TREATMENT FOR DIABETES OR NUTRIMENTAL CULTURE

    OpenAIRE

    Echavarría Flores Montserrat; García Torres María Elena; Calderón Ordoñez Marisela Belem; Olvera Luna Alba Grisel; Ruvalcaba Ledezma Jesús Carlos

    2013-01-01

    The diabetes type II is a disease in which the organism cannot produce or use insulin properly. The insulin is a hormone that transforms the sugar, starch and food in energy so that it can make use of it. Although the genetic and physical factors, such as obesity and the lack of exercise affect the health of a person, the real cause of diabetes is unknown. The objective of this study was determining the benefits that people, who suffer from diabetes type II, obtain by eating the bedbugs “Xohu...

  19. Field Study of the Comparative Efficacy of Three Pyrethroid/Neonicotinoid Mixture Products for the Control of the Common Bed Bug, Cimex lectularius

    Directory of Open Access Journals (Sweden)

    Changlu Wang

    2015-03-01

    Full Text Available Three insecticide mixtures that contain two classes of insecticides (pyrethroid and neonicotinoid were recently developed to control bed bugs. We evaluated three integrated bed bug management strategies in apartments, each using the same non-chemical control methods and one of the three insecticide mixture products: Tandem (lambda-cyhalothrin + thiamethoxam, Temprid SC (beta-cyfluthrin + imidacloprid, and Transport Mikron (bifenthrin + acetamiprid. No insecticides were applied in the Control apartments. In all apartments, we installed vinyl mattress encasements (if not already present and applied steam to beds and other infested upholstered furniture. Insecticide sprays were applied in the three treatments. Each treatment and the Control included 8–10 occupied apartments. Re-treatment was conducted during biweekly inspections if necessary. After eight weeks, the mean (± SEM bed bug count reduction in the Tandem, Temprid SC, Transport Mikron, and Control was 89 ± 9, 87 ± 6, 98 ± 1, and 23 ± 54%, respectively. Only Tandem and Transport Mikron treatments resulted in significantly higher population reduction than the Control at eight weeks. There were no significant differences in mean percent reduction among the three treatments (Tandem, Temprid SC, Transport Mikron at eight weeks. Tandem spray caused significantly faster bed bug reduction than Temprid SC spray and Transport Mikron spray.

  20. Krüppel homolog 1 and E93 mediate Juvenile hormone regulation of metamorphosis in the common bed bug, Cimex lectularius.

    Science.gov (United States)

    Gujar, Hemant; Palli, Subba Reddy

    2016-01-01

    The common bed bug is an obligate hematophagous parasite of humans. We studied the regulation of molting and metamorphosis in bed bugs with a goal to identify key players involved. qRT-PCR studies on the expression of genes known to be involved in molting and metamorphosis showed high levels of Krüppel homolog 1 [Kr-h1, a transcription factor that plays key roles in juvenile hormone (JH) action] mRNA in the penultimate nymphal stage (N4). However, low levels of Kr-h1 mRNA were detected in the fifth and last nymphal stage (N5). Knockdown of Kr-h1 in N4 resulted in a precocious development of adult structures. Kr-h1 maintains the immature stage by suppressing E93 (early ecdysone response gene) in N4. E93 expression increases during the N5 in the absence of Kr-h1 and promotes the development of adult structures. Knockdown of E93 in N5 results in the formation of supernumerary nymphs. The role of JH in the suppression of adult structures through interaction with Kr-h1 and E93 was also studied by the topical application of JH analog, methoprene, to N5. Methoprene induced Kr-h1 and suppressed E93 and induced formation of the supernumerary nymph. These data show interactions between Kr-h1, E93 and JH in the regulation of metamorphosis in the bed bugs. PMID:27185064

  1. THE BEDBUG “XAMUIS” (THASUS GIGAS, A NEW TREATMENT FOR DIABETES OR NUTRIMENTAL CULTURE

    Directory of Open Access Journals (Sweden)

    Echavarría Flores Montserrat

    2013-12-01

    Full Text Available The diabetes type II is a disease in which the organism cannot produce or use insulin properly. The insulin is a hormone that transforms the sugar, starch and food in energy so that it can make use of it. Although the genetic and physical factors, such as obesity and the lack of exercise affect the health of a person, the real cause of diabetes is unknown. The objective of this study was determining the benefits that people, who suffer from diabetes type II, obtain by eating the bedbugs “Xohues” or “shamues” (Thasus gigas. In addition, this project intended to diagnose how this food intake affects medical treatments. An exploratory study was carried out based on a survey conducted among the residents of Actopan, Hidalgo who suffer from diabetes mellitus type II in order to investigate the intake of “xohues” or “shamues” and their adherence to medical treatment. The initial average glucose was 184 mg/dl in the interviewed people with a minimum of 33 mg/dl and a maximum of 394 mg/dl The people had pointed out to feel better with the intake of these insects, although most of the population did not continue with the medical treatment afterwards, 5 % detachment had their medical treatment, this represents an imminent risk for the population. Insects are an important source of alimentation and a natural alternative for the treatment of diabetes mellitus type II.

  2. Evolución de la Gestión del Conocimiento en el Grupo Empresarial CIMEX (Evolution of Knowledge Management in CIMEX Corporation)

    OpenAIRE

    Alina Simón Cuevas; Maité Torres Sánchez; Lucina García Hernández; Raudel Ravelo Suárez

    2015-01-01

    Spanish abstract. En la actualidad los sistemas para la toma de decisiones son necesarios en la conducción de cualquier organización. El Grupo Empresarial CIMEX, una de las empresas comercializadoras cubanas, tiene una amplia experiencia en el desarrollo de soluciones computacionales que en el transcurso de los años han evolucionado dando respuesta a los requerimientos informacionales de los analistas y directivos. Diferentes áreas de negocio –comercial, económica y recursos humanos– se han m...

  3. ClEST cluster :Cl_singleton2103 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2103 brain ... protein 44 Cimex lectularius nuclear gene 353 CACCAAGAAAATTACAAGTTTCTGCAG ... ATTCCGAAGAACGTGTTTATGTGCTTTGTGAACCTATCAA mb13004 1 brain ... protein 44 [Culex quinquefasciatus] XP_001847023 8 ...

  4. ClEST cluster :Cl_singleton0405 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0405 isoform a Cimex lectularius nuclear gene 310 CACCGACGCCACTCAGAGAGGGAGAGCTAAGCAG ... GAAGATTCAAGACTCTGTACCGCTGCTAAAAGGCCGCCAG fb20013 1 brain ... peptide IDL-like protein [Tribolium castaneum] EFA ...

  5. ClEST cluster :Cl_singleton0355 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0355 acyl- synthetase long- isoform b Cimex lectularius nuclear gene 19...GGAAGGTGCATTGGGAGCAATAAAAGCGATCGCATTTGTCTGTGATATCATCACTTATCCAGTGTACCTTATTCTACAACGGCCATGGG fb18010 1 acyl-CoA synthetase [Gl

  6. ClEST cluster :Cl_singleton0763 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0763 aldo-keto reductase Cimex lectularius nuclear gene 591 CACCGGGTAGG...GTGAATAAAGGCTTAGTTAGGTCAATCGGACTATCCAATTTCAACAAAAGACAGATCGAAGATGTTT fs09012 1 aldo-keto reductase [Gl

  7. Evolución de la Gestión del Conocimiento en el Grupo Empresarial CIMEX (Evolution of Knowledge Management in CIMEX Corporation

    Directory of Open Access Journals (Sweden)

    Alina Simón Cuevas

    2015-12-01

    Full Text Available Spanish abstract. En la actualidad los sistemas para la toma de decisiones son necesarios en la conducción de cualquier organización. El Grupo Empresarial CIMEX, una de las empresas comercializadoras cubanas, tiene una amplia experiencia en el desarrollo de soluciones computacionales que en el transcurso de los años han evolucionado dando respuesta a los requerimientos informacionales de los analistas y directivos. Diferentes áreas de negocio –comercial, económica y recursos humanos– se han manejado históricamente mediante aplicaciones independientes, dificultándose la conciliación entre los resultados particulares y el análisis integral de la información. En el presente trabajo se reseña los hitos principales de la progresión de la gestión del conocimiento en la Corporación desde una perspectiva computacional y se expone la solución actual basada en la extensión y el enriquecimiento del almacén de datos existente. Las funcionalidades analíticas incorporadas se han implementado sobre el modelo tabular, ofrecido por Microsoft SQ Server, que se sustenta en las tecnologías de almacenamiento columnar y las bases de datos en memoria. Además, se brinda la versión propia para controlar el desempeño empresarial sustentado en el análisis de los principales indicadores claves de éxito, lo que posibilita la creación de cuadros de mando ajustados a cada una de las empresas con vista a la proyección, ejecución y control de sus planes tácticos y estratégicos. Finalmente se presenta una primera aproximación del proceso de minería de datos para la predicción de indicadores gerenciales. Abstract: Nowadays, decision support systems are essential in the management of any organization. CIMEX Corporation, one of the Cuban trading enterprises, has a wide experience in the development of computer solutions that over the years has evolved in response to experts and managers informational requirements. Different business areas

  8. Bedbugs and Bug Bites

    Science.gov (United States)

    ... I help my teen age son cope with acne 6 comment(s) View top rated View top commented | View forums Recent Blog Posts Get your fats right for psoriasis 6/22/16 Sprinkling seeds on your breakfast,... 10 Simple Diet Swaps to Improve Your P... 5/27/16 ...

  9. Cimidíase (dermatose por percevejo: uma causa de prurigo a ser lembrada Bedbugs (Heteroptera, Cimicidae: an etiology of pruritus to be remembered

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-02-01

    Full Text Available Descrevemos uma doente de 19 anos que nos procurou com quadro de intenso prurido há 2 semanas e demonstrando lesões eritêmato-pápulo-urticadas mais intensamente distribuídas nos membros superiores e inferiores. A anamnese detalhada excluiu causas internas e medicamentos como uma possível causa do prurigo. Após orientações quanto a dedetização do domicílio a doente retornou no consultório após 3 semanas sem lesões cutâneas e trazendo em um pote de vidro vários percevejos coletados após a dedetização.This report describes a 19-year old female patient, who sought medical attention for severe itching of two weeks' duration. Erythematous papules and wheals were found, principally on her upper and lower limbs. Careful anamnesis excluded other etiologies of the pruritus, including those related to internal diseases and medication. Following counseling regarding the need to contract a domestic pest control company, the patient returned to the clinic three weeks later with no skin lesions and bearing a glass jar containing several bedbugs collected following pest control treatment.

  10. Population dynamics of Drepanotrema cimex (Moricand, 1839 (Mollusca: Basommatophora: Planorbidae in Barigüi Park, Curitiba City, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Marta Luciane Fischer

    2005-11-01

    Full Text Available The ecology of the freshwater snail Drepanotrema cimex (Moricand, 1839, an intermediate host of trematode larvae, is little known in Brazil. We analyzed the population dynamics of D. cimex in Barigüi Park, Curitiba, Brazil. Collections for the survey were realized at three sites that were at different distances from the Barigüi River and had distinct water plant species. In total, 278 snails were collected, and the highest sampling rate was where Paspalum sp. and Alternanthera philoxeroides (Mart. Griseb. occurred. A higher occurrence of D. cimex in the autumn suggested that the adult stage culminates in this season, resulting from the previous rainy period that seems to support the reproduction of snails in the summer. However, the water temperature had no correlation with the total quantity of snails. The mean shell diameter did not show any correlation either with the water temperature or with the seasons. We recorded intraspecific variations in the color of the shells among the collections from the different sites.

  11. ClEST cluster :Cl_singleton1875 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1875 beta-carotene -monooxygenase Cimex lectularius nuclear gene 443 CAGACGAAGACATGT ... CGCTTTATGGAAGTACAGATACAAGTGTGAAG mb05043 1 Retinal pigment ... epithelium-specific protein b [Danio rerio] AAH921 ...

  12. ClEST cluster :Cl_contig0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0243 barrier-to-autointegration factor Cimex lectularius nuclear gene 428 ...TAATAAATACAGTATGATGTGCG fb29038 fs25084 mb23031 3 barrier to autointegration factor [Rhodnius prolixus] AEL79235 5.9E-56 GO:0003677 ...

  13. ClEST cluster :Cl_singleton0811 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0811 nuclear ... transcription factor gamma Cimex lectularius nuclear ... gene 506 GATGGTTGG ... GGGTACATACTGAGGATAACAAACGTCGAACTTTACAGCG fs11035 1 nuclear ... transcription factor Y gamma isoform 1 [Nasonia vi ...

  14. ClEST cluster :Cl_singleton1046 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1046 u2 small nuclear ... ribonucleoprotein a Cimex lectularius nuclear ... gene 633 TTGTTTG ... CGCTCACGAGC fs21006 1 PREDICTED: probable U2 small nuclear ... ribonucleoprotein A'-like [Bombus terrestris] XP_0 ...

  15. ClEST cluster :Cl_singleton1703 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1703 p8 nuclear ... protein Cimex lectularius nuclear ... gene 541 AGTCGTTCGACAACGTTCAAACAAT ... AACGGTTAAGCATTTGTACTTACGTTAT fw21041 1 DNA-binding nuclear ... protein p8 [Triatoma infestans] ABR27869 2.01616E- ...

  16. ClEST cluster :Cl_singleton2134 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2134 rna-binding region ... rnp-1 domain-containing protein Cimex lectularius nuclear ge ... GTGTACCTTGCAAAAGTGATTTATCATC mb16086 1 RNA-binding region ... RNP-1 domain-containing protein [Dictyostelium dis ...

  17. ClEST cluster :Cl_singleton1569 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1569 b-cell ... receptor-associated protein 31-like Cimex lectularius nuclear gene 410 C ... CTCTGTTCCTCTCCATTGTGATTCGACGATTCGTGTCT fw16029 1 B-cell ... receptor-associated protein 31-like [Acyrthosiphon ...

  18. ClEST cluster :Cl_singleton2269 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2269 germ cell -less protein Cimex lectularius nuclear gene 466 CACACACGCGCTTCATAAAAA ... TCAATATTCTTGA mb21032 1 PREDICTED: similar to germ cell -less protein [Tribolium castaneum] XP_967783 3.440 ...

  19. ClEST cluster :Cl_singleton0908 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0908 bone marrow stromal cell -derived ubiquitin-like protein Cimex lectularius nucle ... s15049 1 PREDICTED: similar to bone marrow stromal cell -derived ubiquitin-like protein [Tribolium castaneu ...

  20. ClEST cluster :Cl_singleton0360 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0360 cell ... cycle control protein 50a-like isoform 1 Cimex lectularius nuclear gene 41 ... ACAAAATGCATGAATGCCTTGTCACCAAC fb18030 1 PREDICTED: cell ... cycle control protein 50A-like isoform 2 [Nasonia ...

  1. ClEST cluster :Cl_contig0436 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0436 lethal essential for life ... l2efl Cimex lectularius nuclear gene 432 TAAGAATCTCTCCCG ... GACGTTATT fs18066 fw18019 2 lethal(2)essential for life ... protein-like protein [Maconellicoccus hirsutus] AB ...

  2. ClEST cluster :Cl_singleton1657 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1657 pumilio ... 2 Cimex lectularius nuclear gene 590 TGATGATGAAAGATCAGTACGCCAATTATGTCGT ... ATATGATACATCAAATAAATTATTTGAGA fw20025 1 PREDICTED: pumilio ... homolog 2-like isoform 1 [Acyrthosiphon pisum] XP_ ...

  3. ClEST cluster :Cl_singleton2448 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2448 probable gdp-fucose ... transporter-like Cimex lectularius nuclear gene 314 ACGAATT ... AAAGTTTTCCCTGTCA mb31096 1 PREDICTED: probable GDP-fucose ... transporter-like [Acyrthosiphon pisum] XP_00194993 ...

  4. ClEST cluster :Cl_singleton1765 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1765 rab11 family -interacting protein 4a-like Cimex lectularius nuclear gene 578 GGT ... GGCGAGGGTTTTGATGCTTGAAG fw23061 1 PREDICTED: rab11 family -interacting protein 4A-like isoform 1 [Acyrthosiph ...

  5. ClEST cluster :Cl_singleton0942 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0942 tbc1 domain family ... member 4-like Cimex lectularius nuclear gene 488 GCATTCGTATT ... CCACCATAAAGGAGCAA fs16074 1 PREDICTED: TBC1 domain family ... member 4-like [Acyrthosiphon pisum] XP_001947975 6 ...

  6. ClEST cluster :Cl_contig0251 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0251 member ras oncogene family ... Cimex lectularius nuclear gene 413 GAGTGTGTAAACTTAAAATA ... 3 PREDICTED: similar to RAB18 member RAS oncogene family ... [Tribolium castaneum] XP_970378 2.6E-29 ...

  7. ClEST cluster :Cl_singleton0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0243 solute carrier family ... 35 member f5-like Cimex lectularius nuclear gene 403 GAAA ... AATAAAACTCCCAA fb12090 1 PREDICTED: solute carrier family ... 35 member F5-like [Nasonia vitripennis] XP_0016016 ...

  8. ClEST cluster :Cl_singleton0344 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0344 l antigen family ... member 3 Cimex lectularius nuclear gene 461 CCAAGTAAAAATTTAAAT ... AGGGCAAATTATGGCTTCGCCCTCTATCTG fb17054 1 L antigen family ... member 3 isoform 1 [Nasonia vitripennis] NP_001155 ...

  9. ClEST cluster :Cl_singleton1438 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1438 sodium pump ... alpha subunit Cimex lectularius nuclear gene 282 GAGTCTGGTTCCAGTGCT ... ACTGGACTCACACACGCCAAAGCT fw09093 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 1.10687E ...

  10. ClEST cluster :Cl_singleton0353 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0353 sodium pump ... alpha subunit Cimex lectularius nuclear gene 155 GGCTGTCGGACCTCCACC ... CATAAAATATCTGTAGAAGAACTA fb18007 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 2.28502E ...

  11. ClEST cluster :Cl_singleton1521 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1521 Histone-lysine ... N-methyltransferase SETMAR Cimex lectularius nuclear gene 357 CT ... TTCATAAAGATATTTGAAAGTTTCGTTCAACT fw14041 1 Histone-lysine ... N-methyltransferase SETMAR [Harpegnathos saltator] ...

  12. ClEST cluster :Cl_contig0318 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0318 histone-lysine ... n-methyltransferase setmar Cimex lectularius nuclear gene 571 TTTGA ... AATTTTCGAGTTTTTTCACTTTTC fw04055 mb08029 2 histone-lysine ... N-methyltransferase SETMAR [Bos taurus] NP_0010771 ...

  13. ClEST cluster :Cl_singleton1580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1580 histone-lysine ... n-methyltransferase setmar-like Cimex lectularius nuclear gene 3 ... AGTACATTAACTCATCTTTTC fw17018 1 PREDICTED: histone-lysine ... N-methyltransferase SETMAR-like [Bombus terrestris ...

  14. ClEST cluster :Cl_singleton1396 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1396 dna ... repair and recombination protein rad54b-like Cimex lectularius nuclear gene ... ACGATTACTATTTTTTTCCTTCGAGCCTT fw08090 1 PREDICTED: DNA ... repair and recombination protein RAD54B-like [Acyr ...

  15. ClEST cluster :Cl_singleton0669 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0669 n -adenine-specific dna ... methyltransferase 2-like Cimex lectularius nuclear gene ... GATGATAAAACTGTAAAAA fs03050 1 N-6 adenine-specific DNA ... methyltransferase 2 [Nasonia vitripennis] NP_00112 ...

  16. ClEST cluster :Cl_singleton1305 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1305 dna -directed rna polymerase ii kda polypeptide Cimex lectularius nuclear gene 4 ... TGAAGAAAGATTCAAAGAGGCGATCAAGGACAGGAAGGAA fw05060 1 DNA -directed RNA polymerase II 13.3 kda polypeptide [T ...

  17. ClEST cluster :Cl_singleton0185 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0185 dna -directed rna polymerases and iii subunit rpabc1-like Cimex lectularius nucl ... CTTCTGCTAAGCAATCACTCGTGGACATG fb10023 1 PREDICTED: DNA -directed RNA polymerases I II and III subunit RPAB ...

  18. ClEST cluster :Cl_singleton0563 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0563 dna -directed rna polymerases i and iii subunit rpac1 Cimex lectularius nuclear ... GTGAAATGCACTAAAAACCCACACTGCCG fb27031 1 PREDICTED: DNA -directed RNA polymerases I and III subunit RPAC1 [ ...

  19. ClEST cluster :Cl_singleton0423 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0423 dna ... replication licensing factor mcm9-like Cimex lectularius nuclear gene 423 C ... CAAAGAAAGAGTGAGGCGTTAAATGCATC fb20074 1 PREDICTED: DNA ... replication licensing factor MCM9-like [Bos taurus ...

  20. ClEST cluster :Cl_singleton2256 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2256 aminopeptidase -like Cimex lectularius nuclear gene 480 GTACACACTACACAGCACTGAGT ... TCACGTTTTCCCAAGACAAAGCTTG mb20082 1 PREDICTED: LOW QUALITY ... PROTEIN: putative aminopeptidase W07G4.4-like [Bom ...

  1. ClEST cluster :Cl_singleton0131 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0131 hemicentin 1 Cimex lectularius nuclear gene 552 TATCAGCACCAATTCCTTCAATTCCTGAAGA ... TACATGTGTCAGGGGAGCAACAAAG fb07055 1 PREDICTED: LOW QUALITY ... PROTEIN: hemicentin-1-like [Meleagris gallopavo] X ...

  2. ClEST cluster :Cl_singleton0484 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0484 protein polybromo-1 Cimex lectularius nuclear gene 500 GGGAGTCGTGAAGATGGTCGTGAA ... TAAGACTGACGAGTATGATGATATA fb23037 1 PREDICTED: LOW QUALITY ... PROTEIN: protein polybromo-1-like [Bombus terrestr ...

  3. ClEST cluster :Cl_singleton0415 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0415 ctp synthase Cimex lectularius nuclear gene 485 CGGTGAAACGTACGTTCTTGATGATGGAGGG ... CTTTCACCAGACCTCATTGTTTGCC fb20048 1 PREDICTED: LOW QUALITY ... PROTEIN: CTP synthase-like [Bombus impatiens] XP_0 ...

  4. ClEST cluster :Cl_contig0368 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0368 astakine variant 1 Cimex lectularius nuclear gene 522 GAACAGTTTCAGTCGGCGACTGGTTGAC ... CAGTAAATAACTGTGAT fb05079 mb05073 2 PREDICTED: LOW QUALITY ... PROTEIN: astakine-like [Bombus terrestris] XP_0034 ...

  5. ClEST cluster :Cl_singleton0904 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0904 male -specific lethal 3 homolog Cimex lectularius nuclear gene 394 CTCGCAGGTTGAG ... GAATTCGACTTGGGATAGATTCGTTACCG fs15038 1 PREDICTED: male -specific lethal 3 homolog [Acyrthosiphon pisum] XP ...

  6. ClEST cluster :Cl_singleton1087 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1087 calreticulin Cimex lectularius nuclear gene 333 CGAAACCCAGCTCGAGACGATGAGGGCTCTT ... calreticulin [Rhodnius prolixus] ACI23246 4.17952E-42 ... GO:0006457 GO:0005783 GO:0051082 GO:0005509 ...

  7. ClEST cluster :Cl_contig0178 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0178 transposase-like Cimex lectularius nuclear gene 625 AACTTCGTCAGAAAATAAAACTCTCTTCCA ... asGA2_TC010512 [Tribolium castaneum] EFA01186 1.5E-42 ... GO:0004803 GO:0015074 GO:0006313 GO:0003677 ...

  8. ClEST cluster :Cl_contig0085 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0085 leucine aminopeptidase Cimex lectularius nuclear gene 650 ACTACTCAAAATTTTTGTTTCTGG ... 1 5 GJ21638 [Drosophila virilis] XP_002049525 2.0E-42 ... GO:0008238 GO:0007498 ...

  9. ClEST cluster :Cl_singleton2379 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2379 tubulin polymerization ... promoting protein Cimex lectularius nuclear gene 406 AAA ... TTGCGGATTACAACAAATTCCTCGAGGATCTG mb25089 1 tubulin polymerization ... promoting protein [Triatoma matogrossensis] ADN299 ...

  10. ClEST cluster :Cl_singleton0582 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0582 stress -induced-phosphoprotein 1 Cimex lectularius nuclear gene 592 GGAAAAGGTTAT ... AAGGCACGAGAAATTATTCCCACCGATATTACATTTTACA fb28049 1 Stress -induced-phosphoprotein 1 [Acromyrmex echinatior] E ...

  11. ClEST cluster :Cl_singleton0472 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

  12. ClEST cluster :Cl_singleton1313 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1313 27 kda hemolymph ... Cimex lectularius nuclear gene 441 CCATTACGGCCGGGGAGAGTGGAATGA ... GAGGTGTTGATGAAAGAAATAA fw05075 1 PREDICTED: 27 kDa hemolymph ... protein-like [Acyrthosiphon pisum] XP_001947666 2. ...

  13. ClEST cluster :Cl_contig0283 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0283 bladder cancer -associated Cimex lectularius nuclear gene 641 AGAGTCAGGATTGACTGTTTC ... TTAAAATATAAGC fb02042 fs13007 2 PREDICTED: bladder cancer -associated protein-like [Nasonia vitripennis] XP_0 ...

  14. ClEST cluster :Cl_contig0334 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0334 1-acyl-sn-glycerol-3-phosphate ... acyltransferase Cimex lectularius nuclear gene 551 ... fw03026 fw07037 2 PREDICTED: 1-acyl-sn-glycerol-3-phosphate ... acyltransferase alpha-like isoform 2 [Acyrthosipho ...

  15. ClEST cluster :Cl_singleton0136 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0136 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 573 GTACG ... TTTTTCAGCTCTGGCTGACAT fb07076 1 Putative inorganic phosphate ... cotransporter [Harpegnathos saltator] EFN85104 8.7 ...

  16. ClEST cluster :Cl_singleton1944 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1944 deoxyribose-phosphate ... aldolase Cimex lectularius nuclear gene 535 GATATCTGAAATG ... TG mb07072 1 PREDICTED: similar to 2-deoxyribose-5-phosphate ... aldolase homolog [Tribolium castaneum] XP_972358 7 ...

  17. ClEST cluster :Cl_singleton2005 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2005 glycerol-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 411 ATCGAGCTC ... GTATTGCTGATCTTGTCACCACTTGTTAC mb09081 1 glycerol-3-phosphate ... dehydrogenase [Drosophila ficusphila] BAB39756 2.6 ...

  18. ClEST cluster :Cl_singleton0341 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0341 ribose-phosphate ... pyrophosphokinase Cimex lectularius nuclear gene 379 TTCTATGTG ... TGCTGTTATTCCATATTTGCCCTATAGCAAGCA fb17043 1 ribose-phosphate ... pyrophosphokinase 1 2 [Culex quinquefasciatus] XP_ ...

  19. ClEST cluster :Cl_contig0206 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0206 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 554 TCTAGTCG ... 8 mb18034 3 PREDICTED: similar to sodium-dependent phosphate ... transporter [Tribolium castaneum] XP_001809051 9.4 ...

  20. ClEST cluster :Cl_singleton0167 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0167 sugar phosphate ... exchanger 2-like isoform 2 Cimex lectularius nuclear gene 506 C ... TATTCGCATACGCTGCATCAATG fb09027 1 PREDICTED: sugar phosphate ... exchanger 2-like isoform 2 [Apis mellifera] XP_397 ...

  1. ClEST cluster :Clmt_contig0050 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Clmt_contig0050 mitochondrial phosphate ... carrier protein mitochondrial gene 433 GATTGAACATGTGATTG ... AACCCGGCGAAGTACAAG mb18014 mb24073 2 mitochondrial phosphate ... carrier protein [Cimex lectularius] ACY69956 8.5E- ...

  2. ClEST cluster :Cl_singleton1124 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1124 glyceraldehyde-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 609 CTC ... TTTGAATTGTTA fs25045 1 PREDICTED: glyceraldehyde-3-phosphate ... dehydrogenase-like [Acyrthosiphon pisum] XP_001943 ...

  3. ClEST cluster :Clmt_contig0015 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Clmt_contig0015 mitochondrial phosphate ... carrier protein mitochondrial gene 578 CGAGGGACGAACGAGGC ... 35 fb19062 fb22014 fw19072 mb21088 6 mitochondrial phosphate ... carrier protein [Cimex lectularius] ACY69956 1.5E- ...

  4. ClEST cluster :Cl_singleton0888 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0888 mannose-6-phosphate ... isomerase Cimex lectularius nuclear gene 314 GTTGGCTTGTGTGG ... AAGGAGTTGGCTGCTGTAC fs14088 1 PREDICTED: mannose-6-phosphate ... isomerase-like [Bombus impatiens] XP_003491147 1.3 ...

  5. ClEST cluster :Cl_singleton1290 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1290 glucose-6-phosphate ... 1-epimerase-like Cimex lectularius nuclear gene 605 AGAGGAA ... CGAATGTGGTCTCAGGAAG fw05014 1 PREDICTED: glucose-6-phosphate ... 1-epimerase-like [Apis mellifera] XP_003251860 4.4 ...

  6. ClEST cluster :Cl_singleton1771 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1771 inorganic phosphate ... cotransporter Cimex lectularius nuclear gene 540 GGTTTTAAAA ... AGGTCCGATT fw23080 1 PREDICTED: putative inorganic phosphate ... cotransporter-like isoform 2 [Acyrthosiphon pisum] ...

  7. ClEST cluster :Cl_singleton1772 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1772 myosin heavy chain Cimex lectularius nuclear gene 539 GAGTCAGACTCGCTCCAGCTCCCTC ... AACAAAGAAA fw23081 1 PREDICTED: myosin heavy chain muscle ... isoform 1 [Acyrthosiphon pisum] XP_001952092 5.076 ...

  8. ClEST cluster :Cl_contig0096 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0096 muscle ... lim protein Cimex lectularius nuclear gene 588 AACTTGTTAGTGTGATAAAACCGTCGGC ... TCTGAATA fw01077 fw02081 fw16071 fw23005 fw24093 5 muscle ... LIM protein isoform 2 [Bombyx mori] NP_001037398 6 ...

  9. ClEST cluster :Cl_contig0487 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0487 synaptic glycoprotein sc2 Cimex lectularius nuclear gene 366 GTTGTTTTATCTGATTCGGAG ... PREDICTED: steroid Alpha ReducTase family member (art -1)-like [Saccoglossus kowalevskii] XP_002732370 2. ...

  10. ClEST cluster :Cl_singleton0302 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0302 150 kda oxygen-regulated protein Cimex lectularius nuclear gene 290 CGATCGAGACT ... AAAGAGAAGGGGACAGTGGAGCTCCCAAG fb15026 1 PREDICTED: hypoxia ... up-regulated protein 1-like isoform 4 [Nasonia vit ...

  11. ClEST cluster :Cl_singleton0264 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0264 dnaj homolog subfamily a member 2 Cimex lectularius nuclear gene 633 GGACTTTTGA ... TGGCAGTAGAATGGCCAAAGAGATCAGGACAATGTGTAGT fb13059 1 molecular ... chaperone [Rhodnius prolixus] AEL79216 3.81379E-61 ...

  12. ClEST cluster :Cl_singleton0071 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0071 nucleosome-remodeling factor subunit nurf301 Cimex lectularius nuclear gene 605 ... GGCACCGTCATC fb05014 1 PREDICTED: similar to fetal alzheimer ... antigen falz [Tribolium castaneum] XP_001811424 2. ...

  13. ClEST cluster :Cl_singleton1298 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1298 nadh dehydrogenase Cimex lectularius nuclear gene 236 GAGTTCTAAGTCGTCTGGTCCTGAA ... TTTGAAAA fw05041 1 NADH dehydrogenase [ubiquinone] iron -sulfur protein 5 [Acyrthosiphon pisum] NP_00115530 ...

  14. ClEST cluster :Cl_contig0235 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0235 tyrosine tryptophan ... Cimex lectularius nuclear gene 453 CGACCCTGATGGACGGTGGAAATTACA ... GACATTGCCT fb16033 fw14092 mb16034 3 phenylalanine-tryptophan ... hydroxylase [Gryllus bimaculatus] BAJ83477 2.8E-78 ...

  15. ClEST cluster :Cl_singleton0416 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0416 ornithine aminotransferase Cimex lectularius nuclear gene 438 TATC...CAGTTTGCCGAGTATATCACCCGTTATTT fb20049 1 PREDICTED: probable ornithine aminotransferase-like [Glycine max] XP_003531161 4.30167E-26 GO:0008483 ...

  16. ClEST cluster :Cl_singleton2093 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2093 selenoprotein t Cimex lectularius nuclear gene 435 GAGAAGGAGATTCCG...GAGACGGGAAGAATA mb12059 1 selenoprotein T [Glossina morsitans morsitans] ADD19835 7.29481E-59 GO:0045454 GO:0008430 GO:0005575 ...

  17. ClEST cluster :Cl_contig0079 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0079 death -associated protein Cimex lectularius nuclear gene 811 GAGTGATCATAGTGAGAACGGT ... ATTCTGTA fb07073 fb13017 fs15001 fw07030 mb18092 5 death -associated protein-like protein [Maconellicoccus h ...

  18. ClEST cluster :Cl_singleton1627 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1627 death -associated protein kinase 1 Cimex lectularius nuclear gene 571 TCCCAATGGG ... CCTACAGCGGAGT fw19023 1 PREDICTED: similar to DAP (Death -Associated Protein) Kinase homolog family member ( ...

  19. ClEST cluster :Cl_singleton0883 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0883 dehydrogenase domain protein Cimex lectularius nuclear gene 257 TCGATTACAACTGAA ... AAAAGGCTACTGACG fs14067 1 unnamed protein product [Azospirillum ... lipoferum 4B] YP_005037771 4.11457E-19 GO:0016616 ...

  20. ClEST cluster :Cl_singleton0781 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0781 membrane magnesium ... transporter 1-like Cimex lectularius nuclear gene 546 TCTAAA ... TACATGAATTGTTTAGTTTAATTATCTCTGT fs09088 1 Membrane magnesium ... transporter 1-B [Acromyrmex echinatior] EGI59871 6 ...

  1. Encasing mattresses in black plastic will not provide thermal control of bed bugs, Cimex spp. (Hemiptera: Cimicidae).

    Science.gov (United States)

    Doggett, Stephen L; Geary, Merilyn J; Russell, Richard C

    2006-12-01

    The suggestion that bed bug (Cimex spp.; Hemiptera: Cimicidae)-infested mattresses wrapped in black plastic and exposed to sunlight will be heated sufficiently to kill the bed bugs was tested. Two types of mattresses were tested: a thin mattress of solid foam rubber and a thick multilayered inner spring mattress. Temperature probes were placed on both upper and lower sides of the mattresses, which were wrapped in black plastic and placed outside on a summer day for >9 h wherein the ambient temperature peaked at 36.5 degrees C. The maximum recorded temperature on the upper (sun-exposed) sides was 85 degrees C for both mattresses, whereas lower side temperatures for the thick mattress never exceeded 35 degreesC, and some areas of the thin mattress failed to exceed 36.50C. Therefore, with published thermal death points of 40-45 degrees C depending on exposure time, and opportunities for bed bugs to avoid lethal temperatures by retreating from hot zones, this technique seems to be not suitable for bed bug management. PMID:17195683

  2. Ectoparasites from feral pigeons affecting humans.

    Science.gov (United States)

    Haag-Wackernagel, Daniel; Bircher, Andreas J

    2010-01-01

    Feral pigeons pose a considerable health risk to the human population. They are vectors of infectious diseases and source of antigens causing allergic diseases. Breeding and roosting sites of pigeons harbor parasites that may infest humans. In the present article, a concomitant parasitization of a young female with 3 different ectoparasites, the bedbug Cimex lectularius, the pigeon tick Argas reflexus and the red mite Dermanyssus gallinae, is reported. The parasites invaded the apartment from a balcony used as roost by feral pigeons and infested the patient continuously over a period of more than 2 months. To our knowledge this case presents the first record of a coincidental infestation of a single patient with several ectoparasite species deriving from feral pigeons. Additionally we report general symptoms in the patient probably caused by the high number of stings. Dermatologists should be aware of the possibility of an infestation with ectoparasites deriving from feral pigeons. In a review we give an overview on the most important ectoparasites transmitted from feral pigeons to humans and their importance for the dermatologist. PMID:20016127

  3. DESARROLLO Y PERSPECTIVAS DE LA GESTIÓN EMPRESARIAL EN CUBA. EL EJEMPLO DE LA CORPORACIÓN CIMEX

    Directory of Open Access Journals (Sweden)

    Carlos M García Rodríguez

    2008-06-01

    Full Text Available

    A nivel internacional las transformaciones de las concepciones gerenciales empresariales han provocado un debate muy intenso y de gran amplitud, no solamente en los marcos de la academia, sino también en la propia vida empresarial. Sin embargo, durante muchos años en nuestro país ese debate no estuvo presente. En el artículo se aborda la gestación en el mundo y en Cuba de una nueva empresa denominada Emergente, consecuencia del entorno de los negocios, caracterizados fundamentalmente por la globalización e internacionalización del mercado. Se explica y es de mucha actualidad, la evolución de las normativas cubanas para fortalecer el sistema hasta las de más reciente emisión, es decir, el Decreto Ley 252 del 7 de agosto del 2007 "Sobre la continuidad y el fortalecimiento del sistema de Dirección y Gestión Empresarial Cubano", emitido por el Consejo de Estado de la República de Cuba; y el Decreto 281 "Reglamento para la implantación y consolidación del Sistema de Dirección y Gestión Empresarial Estatal", emitido por el Comité Ejecutivo del Consejo de Ministros el pasado 16 de agosto del 2007.  El artículo aborda también la evolución de la empresa cubana hasta nuestros días y su desenvolvimiento en el marco de estas normativas del Perfeccionamiento Empresarial, divulgándose regulaciones de mucha importancia que aparecen en esta documentación orientadora. Se analiza finalmente cuál es la situación de este proceso de perfeccionamiento en el Grupo Empresarial CIMEX S.A., explicándose la perspectiva para los próximos años. Finalmente el artículo concluye desarrollando importantes reflexiones sobre el lugar y el papel del Sistema de Perfeccionamiento Empresarial para el impulso de la recuperación económica de nuestro país.

  4. Traveler's encounter with nymphs in a hotel bed.

    Science.gov (United States)

    Sandlund, Johanna; Banaei, Niaz

    2014-01-01

    This case illustrates skin lesions in a traveler staying in a hotel bed infested with tics. Although infestation of hotels with bedbugs belonging to the Cimex genus is a growing problem worldwide, tick infestation has never been reported before. PMID:26839772

  5. ClEST cluster :Cl_singleton1421 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1421 atp-binding sub-family ... a member 4 Cimex lectularius nuclear gene 647 CTTGTATTTG ... AGAATGACTATGACG fw09043 1 ATP-binding cassette sub-family ... A (ABC1) member 4 [Bos taurus] DAA31386 ...

  6. ClEST cluster :Cl_contig0172 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0172 solute carrier family ... 25 member 38-like Cimex lectularius nuclear gene 712 GCATTAA ... 028 fw22041 3 PREDICTED: similar to solute carrier family ... 25 member 38 [Tribolium castaneum] XP_973832 3.3E- ...

  7. ClEST cluster :Cl_singleton1312 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleto n1312 1-o -acylceramide synthase Cimex lectularius nuclear gene 643 GAGATGCAAACACAAGCT ... GTGAGAGTTAATATTTTGTAAATGAAA fw05074 1 PREDICTED: gro up XV pho spho lipase A2-like iso fo rm 1 [Acyrtho sipho ... n pisum] XP_001951433 1.03386E-80 GO :0008415 ...

  8. ClEST cluster :Cl_contig0274 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_co ntig0274 apo lipo pro tein o -like Cimex lectularius nuclear gene 708 TCAAGCAAGGAGTCGGGTAATAGGA ... ACTCCTTTACACCACTGCAGGCGGTTCTG fs20086 mb19060 2 hypo thetical pro tein SINV_00148 [So leno psis invicta] EF ... Z14864 9.0E-17 N:GO :0035556 GO :0005834 GO :0004871 GO :0007186 ...

  9. ClEST cluster :Cl_singleton2087 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleto n2087 3-hydro xyiso butyrate dehydro genase Cimex lectularius nuclear gene 440 GAGTTTAGC ... TGAGTACAATCGATCCATCAGTTTCAAAAGAACT mb12038 1 3-hydro xyiso butyrate dehydro genase [Vibrio ... vulnificus MO 6- ... 24/O ] YP_004191179 1.0524E-25 GO :0005488 GO :0044281 GO : ... 0044237 GO :0016616 ...

  10. ClEST cluster :Cl_contig0030 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_co ntig0030 farneso ic acid o -methyl transferase Cimex lectularius nuclear gene 558 GCCAGTTAAGT ... 07060 fw08004 fw10082 fw14025 10 uncharacterized pro tein LO C100164577 [Acyrtho sipho n pisum] NP_00123309 ... 2 3.0E-48 GO :0016740 ...

  11. ClEST cluster :Cl_contig0422 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig042 2 dead box atp-dependent rna Cimex lectularius nuclear gene 448 CATTTTAGCTGGAGTTTCAC ... AACATATCTTGCAACTTACAACCAAGTGTTCGAGAG fb07086 fw20024 2 ... DEAD box ATP-dependent RNA helicase putative [Ixo ... des scapularis] XP_002407896 4.7E-42 ...

  12. ClEST cluster :Cl_singleton0812 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0812 s-phase kinase-associated protein 1 Cimex lectularius nuclear gene 430 GGCCTCTT ... kinase-associated protein [Danaus plexippus] EHJ6542 9 6.56821E-42 ... GO:0016301 GO:0016310 GO:0006511 GO:0 ...

  13. ClEST cluster :Cl_singleton1538 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1538 dead (asp-glu-ala-asp) box polypeptide 5 Cimex lectularius nuclear...fw14079 1 similar to DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase 68kDa) [Xenopus laevis] NP_001079703 6.59566E-23 ...

  14. Bed bugs evolved unique adaptive strategy to resist pyrethroid insecticides

    OpenAIRE

    Fang Zhu; Hemant Gujar; Jennifer R. Gordon; Haynes, Kenneth F; Michael F. Potter; Palli, Subba R.

    2013-01-01

    Recent advances in genomic and post-genomic technologies have facilitated a genome-wide analysis of the insecticide resistance-associated genes in insects. Through bed bug, Cimex lectularius transcriptome analysis, we identified 14 molecular markers associated with pyrethroid resistance. Our studies revealed that most of the resistance-associated genes functioning in diverse mechanisms are expressed in the epidermal layer of the integument, which could prevent or slow down the toxin from reac...

  15. Bed bugs reproductive life cycle in the clothes of a patient suffering from Alzheimer’s disease results in iron deficiency anemia

    OpenAIRE

    Sabou, Marcela; Gallo Imperiale, Delphine; Andrès, Emmanuel; Abou-Bacar, Ahmed; Foeglé, Jacinthe; Lavigne, Thierry; Kaltenbach, Georges; Candolfi, Ermanno

    2013-01-01

    We report the case of an 82-year-old patient, hospitalized for malaise. Her clothes were infested by numerous insects and the entomological analysis identified them as being Cimex lectularius (bed bugs). The history of the patient highlighted severe cognitive impairment. The biological assessment initially showed a profound microcytic, aregenerative, iron deficiency anemia. A vitamin B12 deficiency due to pernicious anemia (positive intrinsic factor antibodies) was also highlighted, but this ...

  16. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome

    Science.gov (United States)

    Benoit, Joshua B.; Adelman, Zach N.; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C.; Szuter, Elise M.; Hagan, Richard W.; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M.; Nelson, David R.; Rosendale, Andrew J.; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M.; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R.; Ioannidis, Panagiotis; Waterhouse, Robert M.; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J. Spencer; Gondhalekar, Ameya D.; Scharf, Michael E.; Peterson, Brittany F.; Raje, Kapil R.; Hottel, Benjamin A.; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S. T.; Duncan, Elizabeth J.; Murali, Shwetha C.; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L.; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C.; Muzny, Donna M.; Wheeler, David; Panfilio, Kristen A.; Vargas Jentzsch, Iris M.; Vargo, Edward L.; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T.; Anderson, Michelle A. E.; Jones, Jeffery W.; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D.; Attardo, Geoffrey M.; Robertson, Hugh M.; Zdobnov, Evgeny M.; Ribeiro, Jose M. C.; Gibbs, Richard A.; Werren, John H.; Palli, Subba R.; Schal, Coby; Richards, Stephen

    2016-01-01

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host–symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human–bed bug and symbiont–bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite. PMID:26836814

  17. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome.

    Science.gov (United States)

    Benoit, Joshua B; Adelman, Zach N; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C; Szuter, Elise M; Hagan, Richard W; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M; Nelson, David R; Rosendale, Andrew J; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R; Ioannidis, Panagiotis; Waterhouse, Robert M; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J Spencer; Gondhalekar, Ameya D; Scharf, Michael E; Peterson, Brittany F; Raje, Kapil R; Hottel, Benjamin A; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S T; Duncan, Elizabeth J; Murali, Shwetha C; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C; Muzny, Donna M; Wheeler, David; Panfilio, Kristen A; Vargas Jentzsch, Iris M; Vargo, Edward L; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T; Anderson, Michelle A E; Jones, Jeffery W; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D; Attardo, Geoffrey M; Robertson, Hugh M; Zdobnov, Evgeny M; Ribeiro, Jose M C; Gibbs, Richard A; Werren, John H; Palli, Subba R; Schal, Coby; Richards, Stephen

    2016-01-01

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host-symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human-bed bug and symbiont-bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite. PMID:26836814

  18. Metabolic Resistance in Bed Bugs

    Directory of Open Access Journals (Sweden)

    Omprakash Mittapalli

    2011-03-01

    Full Text Available Blood-feeding insects have evolved resistance to various insecticides (organochlorines, pyrethroids, carbamates, etc. through gene mutations and increased metabolism. Bed bugs (Cimex lectularius are hematophagous ectoparasites that are poised to become one of the major pests in households throughout the United States. Currently, C. lectularius has attained a high global impact status due to its sudden and rampant resurgence. Resistance to pesticides is one factor implicated in this phenomenon. Although much emphasis has been placed on target sensitivity, little to no knowledge is available on the role of key metabolic players (e.g., cytochrome P450s and glutathione S-transferases towards pesticide resistance in C. lectularius. In this review, we discuss different modes of resistance (target sensitivity, penetration resistance, behavioral resistance, and metabolic resistance with more emphasis on metabolic resistance.

  19. Bed bugs reproductive life cycle in the clothes of a patient suffering from Alzheimer's disease results in iron deficiency anemia.

    Science.gov (United States)

    Sabou, Marcela; Imperiale, Delphine Gallo; Andrès, Emmanuel; Abou-Bacar, Ahmed; Foeglé, Jacinthe; Lavigne, Thierry; Kaltenbach, Georges; Candolfi, Ermanno

    2013-01-01

    We report the case of an 82-year-old patient, hospitalized for malaise. Her clothes were infested by numerous insects and the entomological analysis identified them as being Cimex lectularius (bed bugs). The history of the patient highlighted severe cognitive impairment. The biological assessment initially showed a profound microcytic, aregenerative, iron deficiency anemia. A vitamin B12 deficiency due to pernicious anemia (positive intrinsic factor antibodies) was also highlighted, but this was not enough to explain the anemia without macrocytosis. Laboratory tests, endoscopy and a CT scan eliminated a tumor etiology responsible for occult bleeding. The patient had a mild itchy rash which was linked to the massive colonization by the bed bugs. The C. lectularius bite is most often considered benign because it is not a vector of infectious agents. Far from trivial, a massive human colonization by bed bugs may cause such a hematic depletion that severe microcytic anemia may result. PMID:23673315

  20. Encounters with fierce dogs and itchy bedbugs: why my first field work failed.

    Science.gov (United States)

    Svanberg, Ingvar

    2014-01-01

    This essay, which is the fifth in the series "Recollections, Reflections, and Revelations: Personal Experiences in Ethnobiology", is a personal reminiscence by the researcher on his first field experience in Turkey in the late 1970s, which was a failure from an ethnobiological point of view but a success for a social scientist pursuing Turkic studies. The author later returned to ethnobiology during subsequent fieldwork on the Faroes. PMID:24885471

  1. RNA-Seq and molecular docking reveal multi-level pesticide resistance in the bed bug

    Directory of Open Access Journals (Sweden)

    Mamidala Praveen

    2012-01-01

    Full Text Available Abstract Background Bed bugs (Cimex lectularius are hematophagous nocturnal parasites of humans that have attained high impact status due to their worldwide resurgence. The sudden and rampant resurgence of C. lectularius has been attributed to numerous factors including frequent international travel, narrower pest management practices, and insecticide resistance. Results We performed a next-generation RNA sequencing (RNA-Seq experiment to find differentially expressed genes between pesticide-resistant (PR and pesticide-susceptible (PS strains of C. lectularius. A reference transcriptome database of 51,492 expressed sequence tags (ESTs was created by combining the databases derived from de novo assembled mRNA-Seq tags (30,404 ESTs and our previous 454 pyrosequenced database (21,088 ESTs. The two-way GLMseq analysis revealed ~15,000 highly significant differentially expressed ESTs between the PR and PS strains. Among the top 5,000 differentially expressed ESTs, 109 putative defense genes (cuticular proteins, cytochrome P450s, antioxidant genes, ABC transporters, glutathione S-transferases, carboxylesterases and acetyl cholinesterase involved in penetration resistance and metabolic resistance were identified. Tissue and development-specific expression of P450 CYP3 clan members showed high mRNA levels in the cuticle, Malpighian tubules, and midgut; and in early instar nymphs, respectively. Lastly, molecular modeling and docking of a candidate cytochrome P450 (CYP397A1V2 revealed the flexibility of the deduced protein to metabolize a broad range of insecticide substrates including DDT, deltamethrin, permethrin, and imidacloprid. Conclusions We developed significant molecular resources for C. lectularius putatively involved in metabolic resistance as well as those participating in other modes of insecticide resistance. RNA-Seq profiles of PR strains combined with tissue-specific profiles and molecular docking revealed multi-level insecticide

  2. Bed bugs and possible transmission of human pathogens: a systematic review.

    Science.gov (United States)

    Lai, Olivia; Ho, Derek; Glick, Sharon; Jagdeo, Jared

    2016-10-01

    The global population of bed bugs (Cimex lectularius and Cimex hemipterus, family Cimicidae) has undergone a significant resurgence since the late 1990s. This is likely due to an increase in global travel, trade, and the number of insecticide-resistant bed bugs. The global bed bug population is estimated to be increasing by 100-500 % annually. The worldwide spread of bed bugs is concerning, because they are a significant socioeconomic burden and a major concern to public health. According to the United States Environmental Protection Agency, bed bugs are "a pest of significant health importance." Additionally, 68 % of U.S. pest professionals reported that bed bugs are the most challenging pest to treat. Upwards of 45 disease pathogens have been reported in bed bugs. Recent studies report that bed bugs may be competent vectors for pathogens, such as Bartonella quintana and Trypanosoma cruzi. However, public health reports have thus far failed to produce evidence that major infectious disease outbreaks have been associated with bed bugs. Since many disease pathogens have previously been reported in bed bugs and the worldwide bed bug population is now drastically increasing, it stands to reason to wonder if bed bugs might transmit human pathogens. This review includes a literature search on recently published clinical and laboratory studies (1990-2016) investigating bed bugs as potential vectors of infectious disease, and reports the significant findings and limitations of the reviewed studies. To date, no published study has demonstrated a causal relationship between bed bugs and infectious disease transmission in humans. Also, we present and propose to expand on previous hypotheses as to why bed bugs do not transmit human pathogens. Bed bugs may contain "neutralizing factors" that attenuate pathogen virulence and, thereby, decrease the ability of bed bugs to transmit infectious disease. PMID:27295087

  3. Potential of Essential Oil-Based Pesticides and Detergents for Bed Bug Control.

    Science.gov (United States)

    Singh, Narinderpal; Wang, Changlu; Cooper, Richard

    2014-12-01

    The bed bug, (Cimex lectularius L.), is a difficult pest to control. Prevalence of insecticide resistance among bed bug populations and concerns over human-insecticide exposure has stimulated the development of alternative bed bug control materials. Many essential oil-based pesticides and detergent insecticides targeting bed bugs have been developed in recent years. We evaluated the efficacy of nine essential oil-based products and two detergents using direct spray and residual contact bioassays in the laboratory. Two conventional insecticides, Temprid SC (imidacloprid and β-cyfluthrin) and Demand CS (λ-cyhalothrin), were used for comparison. Among the 11 nonsynthetic insecticides tested, only EcoRaider (1% geraniol, 1% cedar extract, and 2% sodium lauryl sulfate) and Bed Bug Patrol (0.003% clove oil, 1% peppermint oil, and 1.3% sodium lauryl sulfate) caused >90% mortality of nymphs in direct spray and forced exposure residual assays. However, the efficacy of EcoRaider and Bed Bug Patrol was significantly lower than that of Temprid SC and Demand CS in choice exposure residual bioassay. Direct spray of EcoRaider caused 87% egg mortality, whereas the other nonsynthetic insecticides had little effect on bed bug eggs. EcoRaider and Bed Bug Patrol did not exhibit detectable repellency against bed bugs in the presence of a carbon dioxide source. These findings suggest that EcoRaider and Bed Bug Patrol are potentially useful pesticides for controlling bed bug infestations, but further testing in naturally infested environments is needed. PMID:26470082

  4. Behavioral Responses of the Bed Bug to Permethrin-Impregnated ActiveGuard™ Fabric

    Directory of Open Access Journals (Sweden)

    Scott A. Harrison

    2013-06-01

    Full Text Available ActiveGuard™ Mattress Liners have been used to control house dust mites, and they also are commercially available as an integrated pest management tool for use against bed bugs (Cimex lectularius. The aim of our study was to evaluate responses of numerous populations of the bed bug to the permethrin-impregnated fabric, with particular regard to contact toxicity, repellency, and feeding inhibition. Continuous exposure to ActiveGuard fabric resulted in rapid intoxication for three of four populations, with 87 to 100% of moderately pyrethroid-resistant and susceptible bed bugs succumbing by 1 d. In comparison, a highly resistant population reached 22% mortality at 10 d. Video data revealed that bed bugs readily traversed ActiveGuard fabric and spent a considerable amount of time moving about and resting on it during a 12-h period. ActiveGuard fabric was non-repellent to bed bugs from five tested populations. Furthermore, significantly fewer bed bugs successfully fed to repletion through ActiveGuard fabric than through blank fabric for the five populations. With just 30 min of feeding exposure, mortality ranged from 4% to 83%, depending upon the bed bug strain. These laboratory studies indicate that ActiveGuard liners adversely affected bed bugs from diverse populations.

  5. Ability of bed bug-detecting canines to locate live bed bugs and viable bed bug eggs.

    Science.gov (United States)

    Pfiester, Margie; Koehler, Philip G; Pereira, Roberto M

    2008-08-01

    The bed bug, Cimex lectularius L., like other bed bug species, is difficult to visually locate because it is cryptic. Detector dogs are useful for locating bed bugs because they use olfaction rather than vision. Dogs were trained to detect the bed bug (as few as one adult male or female) and viable bed bug eggs (five, collected 5-6 d after feeding) by using a modified food and verbal reward system. Their efficacy was tested with bed bugs and viable bed bug eggs placed in vented polyvinyl chloride containers. Dogs were able to discriminate bed bugs from Camponotus floridanus Buckley, Blattella germanica (L.), and Reticulitermes flavipes (Kollar), with a 97.5% positive indication rate (correct indication of bed bugs when present) and 0% false positives (incorrect indication of bed bugs when not present). Dogs also were able to discriminate live bed bugs and viable bed bug eggs from dead bed bugs, cast skins, and feces, with a 95% positive indication rate and a 3% false positive rate on bed bug feces. In a controlled experiment in hotel rooms, dogs were 98% accurate in locating live bed bugs. A pseudoscent prepared from pentane extraction of bed bugs was recognized by trained dogs as bed bug scent (100% indication). The pseudoscent could be used to facilitate detector dog training and quality assurance programs. If trained properly, dogs can be used effectively to locate live bed bugs and viable bed bug eggs. PMID:18767752

  6. Accuracy of Trained Canines for Detecting Bed Bugs (Hemiptera: Cimicidae).

    Science.gov (United States)

    Cooper, Richard; Wang, Changlu; Singh, Narinderpal

    2014-12-01

    Detection of low-level bed bug, Cimex lectularius L. (Hemiptera: Cimicidae), infestations is essential for early intervention, confirming eradication of infestations, and reducing the spread of bed bugs. Despite the importance of detection, few effective tools and methods exist for detecting low numbers of bed bugs. Scent dogs were developed as a tool for detecting bed bugs in recent years. However, there are no data demonstrating the reliability of trained canines under natural field conditions. We evaluated the accuracy of 11 canine detection teams in naturally infested apartments. All handlers believed their dogs could detect infestations at a very high rate (≥95%). In three separate experiments, the mean (min, max) detection rate was 44 (10-100)% and mean false-positive rate was 15 (0-57)%. The false-positive rate was positively correlated with the detection rate. The probability of a bed bug infestation being detected by trained canines was not associated with the level of bed bug infestations. Four canine detection teams evaluated on multiple days were inconsistent in their ability to detect bed bugs and exhibited significant variance in accuracy of detection between inspections on different days. There was no significant relationship between the team's experience or certification status of teams and the detection rates. These data suggest that more research is needed to understand factors affecting the accuracy of canine teams for bed bug detection in naturally infested apartments. PMID:26470083

  7. IDENTIFICATION OF BAT ECTOPARASITE LEPTOCIMEX INORDINATUS FROM BAT-DWELLING CAVE, KANCHANABURI PROVINCE, THAILAND.

    Science.gov (United States)

    Potiwat, Rutcharin; Sungvornyothin, Sungsit; Samung, Yudthana; Payakkapol, Anon; Apiwathnasorn, Chamnarn

    2016-01-01

    Bat bugs are blood-feeding insects of bats or warm blooded animals and humans. Since 2011, Leptocimex spp (Heteroptera: Cimicidae) has been reported in Thailand. However, microscopic examination of Leptocimex spp is complicated, especially when the entire body of the specimen is not available. To confirm the phenotypic identification of L. inordinatus from a limestone bat cave in Thailand, partial fragments of mitochondrial cytochrome c oxidase subunit 1 (COI) gene and 16S mitochondrial ribosomal DNA were PCR amplified and sequenced, which revealed 97% sequence identity with Cimicidae family members, being most similar to Cacodminae gen. sp. and C. vicinus, both bat bugs. Phylogenetic tree construction showed that L. inordinatus has a separate genetic lineage from that of with human bed bugs (Cimex hemipterus or C. lectularius), swallow bugs and other tick species. The presence of L. inordinatus in a bat-dwelling cave frequented by humans presents a potential public health problem requiring attention in particular regarding the possibility of zoonotic transmission of pathogens. PMID:27086421

  8. Cloning, expression, and functional characterization of a Ca(2+)-dependent endoplasmic reticulum nucleoside diphosphatase.

    Science.gov (United States)

    Failer, Bernd U; Braun, Norbert; Zimmermann, Herbert

    2002-10-01

    We have isolated and characterized the cDNA encoding a Ca(2+)-dependent nucleoside diphosphatase (EC ) related to two secreted ATP- and ADP-hydrolyzing apyrases of the bloodsucking insects, Cimex lectularius and Phlebotomus papatasi. The rat brain-derived cDNA has an open reading frame of 1209 bp encoding a protein of 403 amino acids and a calculated molecular mass of 45.7 kDa. The mRNA was expressed in all tissues investigated, revealing two major transcripts with varying preponderance. The immunohistochemical analysis of the Myc-His-tagged enzyme expressed in Chinese hamster ovary cells revealed its association with the endoplasmic reticulum and also with pre-Golgi intermediates. Ca(2+)-dependent nucleoside diphosphatase is a membrane protein with its catalytic site facing the organelle lumen. It hydrolyzes nucleoside 5'-diphosphates in the order UDP >GDP = IDP >CDP but not ADP. Nucleoside 5'-triphosphates were hydrolyzed to a minor extent, and no hydrolysis of nucleoside 5'-monophosphates was observed. The enzyme was strongly activated by Ca(2+), insensitive to Mg(2+), and had a K(m) for UDP of 216 microm. Ca(2+)-dependent nucleoside diphosphatase may support glycosylation reactions related to quality control in the endoplasmic reticulum. PMID:12167635

  9. Larvicidal, insecticidal, brine shrimp cytotoxicity and anti-oxidant activities of Diospyros kaki (L.) reported from Pakistan.

    Science.gov (United States)

    Nisar, Mohammad; Shah, Syed Muhammad Mukarram; Khan, Imran; Sheema; Sadiq, Abdul; Khan, Shahzeb; Shah, Syed Muhammad Hassan

    2015-07-01

    Diospyros kaki is cultivated in different agro-ecological zones of Pakistan, especially in Malakand division. The current study was designed to investigate the hide potential of the vulnerable species of the plant. Aqueous extracts of Diospyros kaki leaves were screened for larvicidal, insecticidal cytotoxic and antioxidant activities. The extract exhibited moderate to outstanding larvicidal activity (100 to 28%) at 100, 80, 70, 50, 40, 30, 20 and 10% concentrations respectively after 24 hours, showing 42% LC₅₀. Permitrin displayed 100% lethality at 0.3%. The extract demonstrated outstanding cytotoxic action against brain shrimps nauplii (Artemia salina), showing 10 ppm LC50 which is closed to the LC50 (9.8μg/ml) of standard drug Etoposide. Similarly profound insecticidal potential (100%) was recorded after 15 min against Cimex lectularius. In DPPH scavenging activity the extract demonstrated moderate 30.22%, while Quercetin, Gallic acid and Acetic acid showed 98, 96 and 97% activity respectively at 100 ppm. Thus on the basis of our finding it could be concluded that the decoction of the leaves of D. kaki is a good natural alternative for the control of insects and neoplasia. PMID:26142513

  10. Climbing Ability of the Common Bed Bug (Hemiptera: Cimicidae).

    Science.gov (United States)

    Hottel, B A; Pereira, R M; Gezan, S A; Qing, R; Sigmund, W M; Koehler, P G

    2015-05-01

    Little is known about what factors influence the climbing ability of bed bugs, Cimex lectularius L. (Hemiptera: Cimicidae), in relation to the various surfaces they encounter. We examined how sex, time since last fed, and what surfaces the bed bugs were in contact with affected their climbing performance. The effects of sex and time since fed were tested by counting the number of bed bugs able to climb a 45° slope. The pulling force was recorded using an analytical balance technique that captured the sequential vertical pulling force output of bed bugs attached to various surfaces. Recently fed female bed bugs were found to have the most difficulty in climbing smooth surfaces in comparison with males. This difference can be explained by the larger weight gained from bloodmeals by female bed bugs. A variety of vertical pulling forces were observed on surfaces ranging from sandpaper to talc powder-covered glass. For surfaces not treated with talc powder, bed bugs generated the least amount of vertical pulling force from synthetically created 0.6-µm plastron surfaces. This vast range in the ability of bed bugs to grip onto various surfaces may have implications on limiting bed bugs dispersal and hitchhiking behaviors. PMID:26334801

  11. Optimización de la gestión de inventarios en la sucursal CIMEX de Las Tunas

    OpenAIRE

    Omar Nápoles Peña

    2009-01-01

    La gestión de los inventarios constituye un aspecto fundamental en la gestión empresarial, dentro de la tendencia general de reducción de costos que caracteriza a la empresa moderna para ser cada día más competitiva. La presente investigación titulada “Optimización de la gestión de inventarios en la Sucursal Cemex de Las Tunas” tiene como objetivo, diseñar y aplicar un procedimiento sobre la base de técnicas e instrumentos estadísticos matemáticos que posibiliten el perfeccionamiento de la ge...

  12. Sexual dimorphism of bed bug (Cimex lectularis) attraction and aggregation responses to cuticular extracts from nymph exuviae

    Science.gov (United States)

    A large variety of releaser pheromones are used by insects to attract or disperse conspecifics, while group cohesion is often influenced by primer pheromones that induce behavioral or physiological changes. Differentiating the roles of such pheromones in insect taxa displaying intermediate levels of...

  13. DESARROLLO Y PERSPECTIVAS DE LA GESTIÓN EMPRESARIAL EN CUBA. EL EJEMPLO DE LA CORPORACIÓN CIMEX

    OpenAIRE

    Carlos M García Rodríguez; José A. Macías Mesa; Jesús Ramos Díaz

    2008-01-01

    A nivel internacional las transformaciones de las concepciones gerenciales empresariales han provocado un debate muy intenso y de gran amplitud, no solamente en los marcos de la academia, sino también en la propia vida empresarial. Sin embargo, durante muchos años en nuestro país ese debate no estuvo presente. En el artículo se aborda la gestación en el mundo y en Cuba de una nueva e...

  14. Bed Bug Infestations and Control Practices in China: Implications for Fighting the Global Bed Bug Resurgence

    Directory of Open Access Journals (Sweden)

    Changlu Wang

    2011-04-01

    Full Text Available The bed bug resurgence in North America, Europe, and Australia has elicited interest in investigating the causes of the widespread and increasing infestations and in developing more effective control strategies. In order to extend global perspectives on bed bug management, we reviewed bed bug literature in China by searching five Chinese language electronic databases. We also conducted telephone interviews of 68 pest control firms in two cities during March 2011. In addition, we conducted telephone interviews to 68 pest control companies within two cities in March 2011. Two species of bed bugs (Cimex lectularius L. and Cimex hemipterus (F. are known to occur in China. These were common urban pests before the early1980s. Nationwide “Four-Pest Elimination” campaigns (bed bugs being one of the targeted pests were implemented in China from 1960 to the early 1980s. These campaigns succeeded in the elimination of bed bug infestations in most communities. Commonly used bed bug control methods included applications of hot water, sealing of bed bug harborages, physical removal, and applications of residual insecticides (mainly organophosphate sprays or dusts. Although international and domestic travel has increased rapidly in China over the past decade (2000–2010, there have only been sporadic new infestations reported in recent years. During 1999–2009, all documented bed bug infestations were found in group living facilities (military dormitories, worker dormitories, and prisons, hotels, or trains. One city (Shenzhen city near Hong Kong experienced significantly higher number of bed bug infestations. This city is characterized by a high concentration of migratory factory workers. Current bed bug control practices include educating residents, washing, reducing clutter, putting items under the hot sun in summer, and applying insecticides (pyrethroids or organophosphates. There have not been any studies or reports on bed bug insecticide

  15. Survey of Bartonella spp. in U.S. bed bugs detects Burkholderia multivorans but not Bartonella.

    Directory of Open Access Journals (Sweden)

    Virna L Saenz

    Full Text Available Bed bugs (Cimex lectularius L. have resurged in the United States and globally. Bed bugs are hematophagous ectoparasites of humans and other animals, including domestic pets, chickens, and bats, and their blood feeding habits contribute to their potential as disease vectors. Several species of Bartonella are re-emergent bacterial pathogens that also affect humans, domestic pets, bats and a number of other wildlife species. Because reports of both bed bugs and Bartonella have been increasing in the U.S., and because their host ranges can overlap, we investigated whether the resurgences of these medically important pathogens and their potential vector might be linked, by screening for Bartonella spp. in bed bugs collected from geographic areas where these pathogens are prevalent and from bed bugs that have been in culture in the laboratory for several years. We screened a total of 331 bed bugs: 316 bed bugs from 36 unique collections in 29 geographic locations in 13 states, 10 bed bugs from two colonies maintained in the laboratory for 3 yr, and 5 bed bugs from a colony that has been in culture since before the recent resurgence of bed bugs. Bartonella spp. DNA was screened using a polymerase chain reaction assay targeting the 16S-23S rRNA intergenic transcribed spacer region. Bartonella DNA was not amplified from any bed bug, but five bed bugs from four different apartments of an elderly housing building in North Carolina contained DNA sequences that corresponded to Burkholderia multivorans, an important pathogen in nosocomial infections that was not previously linked to an arthropod vector.

  16. Comparison of Three Bed Bug Management Strategies in a Low-Income Apartment Building

    Directory of Open Access Journals (Sweden)

    Changlu Wang

    2012-04-01

    Full Text Available Bed bug (Cimex lectularius L. infestations are currently controlled by a variety of non-chemical and chemical methods. There have been few studies on the comparative effectiveness of these control techniques. We evaluated three bed bug management strategies in an apartment building: (1 non-chemical methods only (n = 9; (2 insecticides only (n = 6; and (3 integrated pest management including both non-chemical methods and insecticides (n = 9. The apartments were one-bedroom units occupied by seniors or people with disabilities. Bed bug numbers in each apartment were determined by visual inspection and/or installing intercepting devices under bed and sofa legs. The median (min, max bed bug counts in the non-chemical methods only, insecticides only, and integrated pest management (IPM treatment were: 4 (1, 57, 19 (1, 250, and 14 (1, 219, respectively prior to the treatments. The apartments were retreated if found necessary during biweekly to monthly inspections. After 10 weeks, bed bugs were found to be eliminated from 67, 33, and 44% of the apartments in the three treatment groups, respectively. The final (after 10 weeks median (min, max bed bug counts in the non-chemical methods only, insecticides only, and IPM treatment were: 0 (0, 134, 11.5 (0, 58, and 1 (0, 38, respectively. There were no significant differences in the speed of bed bug count reduction or the final bed bug counts. Lack of resident cooperation partially contributed to the failure in eliminating bed bugs from some of the apartments. Results of this study suggest that non-chemical methods can effectively eliminate bed bugs in lightly infested apartments.

  17. Effectiveness of a Reduced-Risk Insecticide Based Bed Bug Management Program in Low-Income Housing

    Directory of Open Access Journals (Sweden)

    Narinderpal Singh

    2013-11-01

    Full Text Available Bed bug (Cimex lectularius L. infestations are becoming increasingly common in low-income communities. Once they are introduced, elimination is very difficult. As part of the efforts to develop effective and safe bed bug management programs, we conducted a laboratory study evaluating the efficacy of a reduced-risk insecticide—Alpine aerosol (0.5% dinotefuran. We then conducted a field evaluation of a reduced-risk insecticide based integrated pest management (IPM program in low-income family apartments with young children. In laboratory evaluations, direct spray and 5 min exposure to dry Alpine aerosol residue caused 100.0 ± 0.0 and 91.7 ± 8.3% mortality to bed bug nymphs, respectively. Direct Alpine aerosol spray killed 91.3 ± 4.3% of the eggs. The IPM program included education, steam, bagging infested linens, placing intercepting devices under furniture legs and corners of rooms, applying Alpine aerosol and Alpine dust (0.25% dinotefuran, 95% diatomaceous earth dust, and regularly scheduled monitoring and re-treatment. Nine apartments ranging from 1–1,428 (median: 29 bed bugs based on visual inspection and Climbup interceptor counts were included. Over a 6-month period, an average 172 g insecticide (Alpine aerosol + Alpine dust was used in each apartment, a 96% reduction in pesticide usage compared to chemical only treatment reported in a similar environment. The IPM program resulted in an average of 96.8 ± 2.2% reduction in the number of bed bugs. However, elimination of bed bugs was only achieved in three lightly infested apartments (<30 bed bugs at the beginning. Elimination success was closely correlated with the level of bed bug populations.

  18. 热力技术杀灭旅客列车卧铺臭虫及虫卵的研究%Studies on thermal technology to kill bedbugs and their eggs inside the sleeping berth

    Institute of Scientific and Technical Information of China (English)

    戚剑雄; 朱建晖; 范洪亮; 姚文勇; 何杰能; 黄彦春

    2014-01-01

    目的 研究密闭热力仓杀灭列车卧铺臭虫及虫卵的过程与效果.方法 现场试验.结果 设置热力仓65℃,升温4h,热力作用列车卧铺深部,达到致死水平(>50℃)可达3h,并100%杀灭列车卧铺中的臭虫及虫卵.结论 热力技术杀灭列车卧铺臭虫及虫卵安全、高效、操作简单,是列车臭虫防治工作中的极佳选择,值得推广应用.

  19. ClEST cluster :Cl_singleton0551 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0551 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... CTATCTATCCCGTCTG fb26037 1 PREDICTED: RNA-directed DNA ... polymerase from mobile element jockey-like [Acyrth ...

  20. ClEST cluster :Cl_singleton0580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0580 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... ACCTTTATTAATCACATTCCGAGCCTA fb28040 1 RNA-directed DNA ... polymerase from mobile element jockey [Harpegnatho ...

  1. ClEST cluster :Cl_singleton0993 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0993 low quality ... protein: wd repeat and fyve domain-containing protein 3-like Cimex ... GTGTTTCGCACGCCGCAGTGGTGGC fs18057 1 PREDICTED: LOW QUALITY ... PROTEIN: WD repeat and FYVE domain-containing prot ...

  2. Applicator Training Manual for: Industrial, Institutional, Structural and Health-Related Pest Control.

    Science.gov (United States)

    Christensen, Christian M.; Scheibner, R. A.

    This manual gives descriptions and diagrams for identification of the following types of pests: four species of cockroach; ants; bees and wasps; parasitic pests of man such as bedbugs, fleas, and ticks; occasional invaders such as flies and millipedes; silverfish and firebrats; beetles; termites; moths; fungi; and vertebrates including rodents,…

  3. Public Health Pest Control Category Manual.

    Science.gov (United States)

    Bowman, James S.; Turmel, Jon P.

    This manual provides information needed to meet the standards for pesticide applicator certification. It presents pest control guidelines for those organisms of public health significance. Fact sheets with line drawings discuss pests such as cockroaches, bedbugs, lice, ants, beetles, bats, birds, and rodents. (CS)

  4. Top Ten Bed Bug Tips

    Science.gov (United States)

    ... have bed bugs, not fleas, ticks or other insects. You can compare your insect to the pictures on our Identifying bed bugs ... bedbugs Bed Bugs Home Learn about Bed Bugs — Characteristics of Bed Bugs — Finding Bed Bugs Protecting Your ...

  5. Counter-attack on virol hepatitis

    International Nuclear Information System (INIS)

    The most highly developed radioimmunoassay test system in medical virology is proving of exceptional value in research aimed at controlling and eventually eradicating the scourge of human hepatitis. The use of radioimmunoassay in detecting hepatitis A (HAV) and hepatitis B (HBV) viruses is discussed. The hepatitis A virus is an enterovirus which infects the gastrointestinal tract and is usually transmitted by contaminated food, milk or water. Hepatitis B spreads mainly by the parenteral rate. Bedbugs and ticks are considered as possible transmitters of HBV. Another important contribution of radioimmunoassay is the ability to monitor the immune response of persons at risk who are vaccinated against hepatitis B

  6. Counter-attack on viral hepatitis. [Hepatitis A; Hepatitis B

    Energy Technology Data Exchange (ETDEWEB)

    Prozesky, O.W. (Pretoria Univ. (South Africa). Dept. of Medical Virology); Jupp, P.G.; Joubert, J.J.; Taylor, M.B.; Grabow, W.O.K.

    1985-07-01

    The most highly developed radioimmunoassay test system in medical virology is proving of exceptional value in research aimed at controlling and eventually eradicating the scourge of human hepatitis. The use of radioimmunoassay in detecting hepatitis A (HAV) and hepatitis B (HBV) viruses is discussed. The hepatitis A virus is an enterovirus which infects the gastrointestinal tract and is usually transmitted by contaminated food, milk or water. Hepatitis B spreads mainly by the parenteral rate. Bedbugs and ticks are considered as possible transmitters of HBV. Another important contribution of radioimmunoassay is the ability to monitor the immune response of persons at risk who are vaccinated against hepatitis B.

  7. Eficiência da Armadilha “R. Bianco” para Captura do Percevejo Leptoglossus zonatus Dallas (Hemiptera: Coreidae, na Cultura do Milho

    Directory of Open Access Journals (Sweden)

    Marliton Barreto

    2016-08-01

    Abstract. Maize is the cereal with the highest consumption in both industrialized as fresh nowadays. It is the grain with higher volume production, Brazil is the third largest producer, need special attention focused on the monitoring and control of invaders who risk their productivity. Among the pests that can affect the productivity highlight the insects (Hemiptera: Heteroptera, more specifically the bedbugs corn (Leptoglossus zonatus Dallas, which has been an important pest for corn crops. Thus, this study aimed to evaluate the effectiveness of homemade traps R. Bianco in control of this insect. The experiments were conducted in Sitio Nossa Senhora Aparecida, in the municipality of Sinop, MT. Traps were divided into 10 open and 10 closed which were evaluated with and without baits by 20 days. The design was completely randomized (DIC in a 2x2x2 factorial with eight treatments and five repetitions. Traps without baits showed greater efficiency, with an average higher in catching the bugs regarding the traps with bait. The trap closed as compared with the open, demonstrated greater efficacy in retaining the insect. The effect of edge was little representative in this experiment. Therefore, the presence of bait did not influence the insect attraction and treatments submitted to the bait without test showed higher quantities and more efficient insect capture. Leading us to believe the attraction effect of salt by bedbug and the location of each trap had little influence in the capture of insects.

  8. Bed bug dermatitis, description of two cases in Rio de Janeiro, Brazil *

    OpenAIRE

    Bernardes, Fred; Quaresma, Maria Victória; Avelleira, João Carlos Regazzi; Azulay, David Rubem; Azulay-Abulafia, Luna; Bastos, Amanda Queiroz; Gonçalves, Teresa Cristina Monte

    2015-01-01

    Bed bugs are hematophagous insects which due to their morphological and biological characteristics are able to easily adapt themselves to human households. The authors describe two cases of dermatitis caused by bed bug bites in the city of Rio de Janeiro, Brazil. Patients presented linear lesions in the usual "breakfast, lunch and dinner" arrangement, suggesting this diagnosis. A visit to their dwellings showed infestation of insects identified as Cimex hemipterus. The knowledge of these inse...

  9. Bed bug outbreak in a neonatal unit.

    Science.gov (United States)

    Bandyopadhyay, T; Kumar, A; Saili, A

    2015-10-01

    There has been a worldwide increase in bed bug infestations over the last 10-15 years. A major stigma is placed upon the institutions found to be infested. We report our experience with an outbreak of the tropical bed bug, Cimex hemipterus, in a neonatal unit. The outbreak not only affected the admitted newborns and mothers by causing a wide variety of rashes and inducing sleeplessness, but also impinged upon the health professionals and their families by producing similar symptomology. It is important for healthcare providers to be aware of, and for each healthcare facility to have, bed bug prevention and control policies. PMID:25591490

  10. Bed bug dermatitis, description of two cases in Rio de Janeiro, Brazil.

    Science.gov (United States)

    Bernardes Filho, Fred; Quaresma, Maria Victória; Avelleira, João Carlos Regazzi; Azulay, David Rubem; Azulay-Abulafia, Luna; Bastos, Amanda Queiroz; Gonçalves, Teresa Cristina Monte

    2015-01-01

    Bed bugs are hematophagous insects which due to their morphological and biological characteristics are able to easily adapt themselves to human households. The authors describe two cases of dermatitis caused by bed bug bites in the city of Rio de Janeiro, Brazil. Patients presented linear lesions in the usual "breakfast, lunch and dinner" arrangement, suggesting this diagnosis. A visit to their dwellings showed infestation of insects identified as Cimex hemipterus. The knowledge of these insects by the dermatological community will contribute to an accurate diagnosis as well as subsidize the dissemination of information aiming for prevention. PMID:25830996

  11. Bed bug dermatitis, description of two cases in Rio de Janeiro, Brazil*

    Science.gov (United States)

    Bernardes, Fred; Quaresma, Maria Victória; Avelleira, João Carlos Regazzi; Azulay, David Rubem; Azulay-Abulafia, Luna; Bastos, Amanda Queiroz; Gonçalves, Teresa Cristina Monte

    2015-01-01

    Bed bugs are hematophagous insects which due to their morphological and biological characteristics are able to easily adapt themselves to human households. The authors describe two cases of dermatitis caused by bed bug bites in the city of Rio de Janeiro, Brazil. Patients presented linear lesions in the usual "breakfast, lunch and dinner" arrangement, suggesting this diagnosis. A visit to their dwellings showed infestation of insects identified as Cimex hemipterus. The knowledge of these insects by the dermatological community will contribute to an accurate diagnosis as well as subsidize the dissemination of information aiming for prevention. PMID:25830996

  12. Levantamento malacológico da Bacia Hidrográfica do Lago Soledade, Ouro Branco, (Minas Gerais, Brasil Malacological survey at the Soledade Lake, in Ouro Branco (Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Roney Elias da Silva

    1994-10-01

    Full Text Available Em estudo malacológico realizado na Bacia Hidrográfica do Lago Soledade, Ouro Branco, MG, no período de setembro de 1986 a março de 1991, foram coletados 46.579 moluscos, representados por 07 espécies de 05 famílias. Foram coletados 39.176 exemplares de Biomphalaria tenagophila, 1.296 de B. glabrata, sete exemplares de Drepanotrema cimex, 2.527 de Physa sp, 417 de Lymnaea sp, 92 de Pomacea haustrum e, a partir de março/1990, 3.064 exemplares de Melanoides tuberculata (Melanniidae = Thiaridae. Dos moluscos que apresentaram positividade para diversas larvas de trematódeos, quatro exemplares de B. tenagophila estavam positivos para S. mansoni.A malacological survey was carried out at the Soledade Lake, in Ouro Branco, State of Minas Gerais, for the period 1986-1991. A total amount of 46,579 mollusks was collected, and among them seven species corresponding to five families could be found, as follows: 39,176 specimens of Biomphalaria tenagophila; 1,296 B. glabrata; 7 Drepanotrema cimex; 2,527 Physa sp; 417 Lymnaea sp; 92 Pomacea hastrum, and 3,064 specimens of Melanoides tuberculata (Melanniidae=Thiaridae were collected from March/1990 onwards. Four specimens of B. tenagophila were found to be positive for Schistosoma mansoni.

  13. Título: Complejo Bellamar. Análisis conceptual y propuesta de integración

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Fariñas González

    2006-01-01

    Full Text Available La siguiente propuesta estudia de manera integral la creación de un centro polifuncional en las parcelas aledañas al Servicentro Bellamar, el cual está ubicado en el Reparto Playa de la Ciudad de Matanzas. Ésta incluye también, el inmueble existente que da servicio de combustible, tienda y cafetería, así como el nuevo diseño de las calles que seccionan el área y la revalorización de su expresión arquitectónica. Para lograr una nueva imagen donde se toman en cuenta los factores de tipo histórico, culturales y comerciales son analizadas las potencialidades que ofrece el lugar, las necesidades de la ciudad y las expectativas de la Corporación Cimex, inversionista principal.

  14. La parasitología y la entomología en la narrativa latinoamericana del siglo XX Parasitology and entomology in the 20th century Latin American narrative

    Directory of Open Access Journals (Sweden)

    Hugo Schenone

    2000-07-01

    Full Text Available In the present reviev of twelve pieces produced by distinguished 20th century Latin American writers Jorge Luis Borges from Argentina, Jorge Amado and João Ubaldo Ribeiro from Brazil, José Donoso from Chile, Gabriel García Márquez from Colombia, Alejo Carpentier from Cuba, Miguel Angel Asturias from Guatemala, Octavio Paz from Mexico, Mario Vargas Llosa from Perú, Horacio Quiroga and Mario Benedetti from Uruguay and Arturo Uslar-Pietri from Venezuela ­ paragraphs or parts of paragraphs in which parasitological or entomological situations of the most varied hues are referred to or described, have been extracted in a selective form. Sometimes in these descriptions appear, local or regional expressions, without ignoring colorful folkloric representations. For a easier interpretation these or part of these paragraph sentences have been arranged by thematic similarities. In a varied and kaleidoscopic vision, it will be possible to find protozooses (malaria, Chagas disease, leishmaniasis, amibiasis, helminthiases (ascariasis, hydatidosis, trichinosis, schistosomiasis, cysticercosis, onchocerciasis, parasitoses produced by arthropods (pediculosis, scabies, tungiasis, myiasis, passing progressivelly to hemaphagous arthropods (mosquitoes, gnats, horse flies, bedbugs, ticks, venomous arthropods (Latrodectus spiders, scorpions, wasps, bees, mechanical vectors (flies and cockroaches, culminating with a conjuction of bucolic arthropods (butterflies, crickets, grasshoppers cicadas, ants, centipedes, beetles, glowworms, dragonflies.

  15. Ectoparasites in an urban population of big brown bats (Eptesicus fuscus) in Colorado

    Science.gov (United States)

    Pearce, R.D.; O'Shea, T.J.

    2007-01-01

    Ectoparasites of an urban population of big brown bats (Eptesicus fuscus) in Fort Collins, Colorado, were investigated during summers 2002, 2003, and 2004. Eleven species of ectoparasites were found (the macronyssid mite Steatonyssus occidentalis, the wing mite Spinturnix bakeri, the myobiid mites Acanthophthirius caudata and Pteracarus aculeus, the chirodiscid mite Alabidocarpus eptesicus, the demodicid mite Demodex sp., the chigger Leptotrombidium myotis, the soft tick Carios kelleyi, the batfly Basilia forcipata, the batbug Cimex pilosellus, and the flea Myodopsylla borealis). Five species were analyzed by prevalence and intensity (C. pilosellus, M. borealis, L. myotis, S. bakeri, and S. occidentalis) based on 2,161 counts of 1,702 marked individual bats over the 3 summer study periods. We investigated 4 factors potentially influencing prevalence and intensity: age class of the host, reproductive status of adult female hosts, roosts in which the hosts were found, and abiotic conditions during the year sampled. The macronyssid mite, S. occidentalis, was the most prevalent and abundant ectoparasite. Adult big brown bats had more ectoparasites than volant juveniles for most of the species analyzed. In a sample of known age bats at 1 large colony, bats of 4 yr of age or greater had higher ectoparasite loads of S. occidentalis and S. bakeri when compared with younger bats. Lactating female bats had the highest prevalence and intensities of most ectoparasites. Annual differences in ectoparasite prevalence and intensity were related to temperature and humidity, which can affect the nidicolous species of ectoparasites. Residents of 2 buildings sprayed insecticides in response to Cimex sp., and this appeared to reduce ectoparasitism of S. occidentalis and C. pilosellus present at these buildings. Intensity of S. occidentalis had no influence on annual survival of big brown bats. ?? American Society of Parasitologists 2007.

  16. Biomphalaria glabrata no Estado do Piauí Biomphalaria glabrata in the State of Piaui

    Directory of Open Access Journals (Sweden)

    W. Lobato Paraense

    1984-09-01

    Full Text Available É registrado o primeiro encontro do molusco planorbideo Biomphalaria glabrata, hospedeiro intermediário do Schistosoma mansoni, no Estado do Piauí, coletado em vários criadouros na cidade de Parnaíba. O exame de 694 exemplares revelou a presença de formas evolutivas de algumas espécies de trematodeos, mas não de Schistosomatidea. Nenhum caso autoctone de xistosomose foi até agora identificado na população humana da cidade. A presença da B. glabrata em Parnaíba amplia em 20 km para leste a área de sua distribuição na Região Litoral Norte da Grande Região Nordeste do Brasil onde era conhecida até em Avaioses no extremo leste da parte maranhense da referida Região. Outros moluscos também coletados nos mesmos criadouros foram Biomphalaria straminea, Drepanotrema lucidum. D. cimex, D. depressissimum, Physidae e Ampullarriidae.The occurrence of Biomphalaria glabrata is recorded for the first time in the state of Piauí, where it was collected from several breeding places in the city of Parnaíba. Examination of 694 specimens showed that a part of them were infected with trematodes other than Schistosomatidae. So far no autochthonous cases of schistosomiasis have been identified in the city. The presence of B. glabrata in Parnaíba extends by 20 Km eastward its range on the Northern Coastal region of the Great Northeastern region of Brazil, where it had been found as far as Araioses, on the eastern extreme of the state of Maranhão. Other snail species collected from the same breeding places were Biomphalaria straminea, Drepanotrema lucidum, D. cimex, D. depressissimum, Physidae and Ampullariidae.

  17. Risky health environments: women sex workers' struggles to find safe, secure and non-exploitative housing in Canada's poorest postal code.

    Science.gov (United States)

    Lazarus, L; Chettiar, J; Deering, K; Nabess, R; Shannon, K

    2011-12-01

    This study explored low-income and transitional housing environments of women sex workers and their role in shaping agency and power in negotiating safety and sexual risk reduction in Vancouver, Canada. A series of 12 focus group discussions were conducted with 73 women currently involved in street-based sex work. These women were purposively sampled for a range of experiences living in low-income housing environments, including homeless shelters, transitional housing, and co-ed and women-only single-room occupancy (SRO) hotels. Drawing on the risk environment framework and theoretical constructs of gender, agency and power, analyses demonstrate that women continue to be vulnerable to violence and sexual and economic exploitation and have reduced ability to negotiate risk reduction resulting from the physical, structural and social environments of current dominant male-centred housing models. Within the physical environment, women described inhabitable housing conditions in SROs with infestations of bedbugs and rats, leading women to even more transitional housing options such as shelters and couch-surfing. In many cases, this resulted in their economic exploitation and increased sexual risk. Within the structural environment, enforcement of curfews and guest policies forced women to accept risky clients to meet curfew, or work outdoors where their ability to negotiate safety and condom use were limited. Certain policies promoted women's agency and mitigated their ability to reduce risks when selling sex. These included flexible curfews and being able to bring clients home. The social environments of co-ed single-room occupancy hotels resulted in repeated violence by male residents and discrimination by male building staff. Women-only shelters and SROs facilitated 'enabling environments' where women developed support systems with other working women that resulted in safer work practices. The narratives expressed in this study reveal the critical need for public

  18. Hypoxylon pulicicidum sp. nov. (Ascomycota, Xylariales, a pantropical insecticide-producing endophyte.

    Directory of Open Access Journals (Sweden)

    Gerald F Bills

    Full Text Available BACKGROUND: Nodulisporic acids (NAs are indole diterpene fungal metabolites exhibiting potent systemic efficacy against blood-feeding arthropods, e.g., bedbugs, fleas and ticks, via binding to arthropod specific glutamate-gated chloride channels. Intensive medicinal chemistry efforts employing a nodulisporic acid A template have led to the development of N-tert-butyl nodulisporamide as a product candidate for a once monthly treatment of fleas and ticks on companion animals. The source of the NAs is a monophyletic lineage of asexual endophytic fungal strains that is widely distributed in the tropics, tentatively identified as a Nodulisporium species and hypothesized to be the asexual state of a Hypoxylon species. METHODS AND RESULTS: Inferences from GenBank sequences indicated that multiple researchers have encountered similar Nodulisporium endophytes in tropical plants and in air samples. Ascomata-derived cultures from a wood-inhabiting fungus, from Martinique and closely resembling Hypoxylon investiens, belonged to the same monophyletic clade as the NAs-producing endophytes. The hypothesis that the Martinique Hypoxylon collections were the sexual state of the NAs-producing endophytes was tested by mass spectrometric analysis of NAs, multi-gene phylogenetic analysis, and phenotypic comparisons of the conidial states. We established that the Martinique Hypoxylon strains produced an ample spectrum of NAs and were conspecific with the pantropical Nodulisporium endophytes, yet were distinct from H. investiens. A new species, H. pulicicidum, is proposed to accommodate this widespread organism. CONCLUSIONS AND SIGNIFICANCE: Knowledge of the life cycle of H. pulicicidum will facilitate an understanding of the role of insecticidal compounds produced by the fungus, the significance of its infections in living plants and how it colonizes dead wood. The case of H. pulicicidum exemplifies how life cycle studies can consolidate disparate observations of a

  19. A Study on 36 Examples of the Reptile, Fish and Invertebrate Names in the Ancient Chinese Language%古代虫鱼爬行动物名所指考36例

    Institute of Scientific and Technical Information of China (English)

    李海霞

    2014-01-01

    Ancient Chinese animal name 瓦剌 was today’s crocodile. 螣蛇 was flying head snake. 纳鼈 was big-headed turtle.锯鲨 was needle tooth shark. 狮刀 was dorab. 含光 was yellow fish. 哲绿鱼 was taimen. 花魿 was some of spotfishes. 松鱼was sea catfish. 赤鬃 was genuine porgy and yellow porgy. 火烧鳊 was suckerfish. 青蚨 was giant water bug. 茭虱 was bedbug.蜭was a worm eating dry meat and furs. 蟛蚏 was fiddler crab. 空豸was pholad. 假猪螺 was trumpet shell whelk. 土笋 was sipunculida. 桃花鱼 was a kind of jelly fish, and so on.%古籍中的动物名瓦剌是鳄鱼。螣蛇是金花蛇。纳鼈是平胸龟。锯鲨是尖齿锯鳐。狮刀鱼是宝刀鱼。含光是黄鱼。哲绿鱼是哲罗鲑。花魿是几种鲾。松鱼是海鲇。赤鬃是黄鲷、真鲷。火烧鳊是胭脂鱼。青蚨是大型昆虫田鳖。茭虱是臭虫。蜭是蠹食毛皮干肉的虫。蟛蚏是招潮蟹。空豸是双壳类的海笋。假猪螺是管角螺。土笋是星虫。桃花鱼是桃花水母。

  20. Biological characterization, habits, naturals enemy and populational fluctuation of Aconophora elongatiformis Dietrich in Tecoma Stans (L.) Juss. Ex Hbk

    International Nuclear Information System (INIS)

    The ornamental trees complete a very important environmental function for the quality of the inhabitants' life in the urban areas, when offering momentous benefits as the subduing of the climate, regulation of CO2 in the atmosphere and the scenic beauty. Thanks to the interest of the District Administration, in Bogota, in the last four years, the urban plantation of trees acquired a preponderant paper that became apparent during the biggest plantation of trees program and maintenance of green areas that it has been carried out in the history of the capital; day by day they get more importance, and they are recognized by the citizenship like fundamental values of its environment. Previously to this program, the attention received were minimum or were remembered soon after the surprising devastating consequences of phyto sanitary problems: the grooved cochineal of the acacia, the louse plant of the cypress and the bedbug of the Urapan in whose cases the ignorance of basic aspects of the biology, natural control and the harmful populations' behavior, it has forced to generally apply measured of chemical type to try to reduce the high levels population. The importance that have, the green areas in the city, it favors a continuous pursuit that allows to deepen in the knowledge of the main risk factors, current problems and potentials of the species, types and consequences of the damages and the intra and inter relationships of the arthropofauna of the urban vegetation, their relationship with the plants, as well as the incidence of biotic and abiotic in the tree phonologic behavior and in the fluctuation of the populations of this individuals in order to coming closer to the understanding of the dynamics of the populations of arthropods harmful, in such a way that is possible to design kind handling strategies with the environment, having in consideration in integrated form the conditions under the attack of arthropods harmful

  1. Freshwater snails and schistosomiasis mansoni in the State of Rio de Janeiro, Brazil: I - metropolitan mesoregion

    Directory of Open Access Journals (Sweden)

    Thiengo Silvana C

    2001-01-01

    Full Text Available In order to elaborate a planorbid chart of the State of Rio de Janeiro a survey of freshwater gastropods in the Metropolitan Mesoregion of this State was performed and revealed the occurrence of 20 species: Antillorbis nordestensis (Lucena, 1954; Biomphalaria glabrata (Say, 1818; Biomphalaria schrammi (Crosse, 1864; Biomphalaria straminea (Dunker, 1848; Biomphalaria tenagophila (Orbigny, 1835; Burnupia sp.; Drepanotrema anatinum (Orbigny, 1835; Drepanotrema cimex (Moricand, 1839; Drepanotrema lucidum (Pfeiffer, 1839; Ferrissia sp.; Gundlachia ticaga (Marcus & Marcus, 1962; Heleobia davisi Silva & Thomé, 1985; Lymnaea columella Say, 1817; Melanoides tuberculatus (Müller, 1774; Physa cubensis Pfeiffer, 1839; Physa marmorata Guilding, 1828; Pomacea sp.; Pomacea canaliculata (Lamarck, 1822; Pomacea lineata (Spix, 1827 and Pomacea sordida (Swainson, 1823. Among the planorbid species B. tenagophila was the most frequent, occurring in all municipalities surveyed. The present study extends the distribution of B. straminea in the State of Rio de Janeiro and reports new records for A. nordestensis, B. schrammi, G. ticaga, H. davisi and the genera Burnupia and Ferrissia. An account about the current transmission areas of schistosomiasis mansoni in this Mesoregion is presented as well.

  2. Estimación de los costos de calidad y evaluación de la calidad de la gestión en un Centro de Elaboración de Productos Alimenticios. Estimating the costs of quality and evaluation of the quality of management in a Center for Food Processing

    Directory of Open Access Journals (Sweden)

    Franciso David Ramírez Betancourt

    2013-05-01

    Full Text Available En las organizaciones los costos de calidad permiten no solo identificar sus problemas principales, sino también, definir estrategias de mejora para elevar la eficacia y la eficiencia de las mismas. Teniendo en cuenta esto, la presente investigación tiene como objetivo aplicar un procedimiento que permita la estimación de los costos de calidad en los procesos de elaboración, almacenaje y distribución de productos alimenticios y la evaluación de la calidad de la gestión en el Centro de Elaboración de la Sucursal CIMEX Matanzas, constituyendo la guía del programa de mejora. Para ello se emplearon diferentes técnicas y herramientas como son: tormenta de ideas, entrevista, diagrama de Paretto y diagrama Causa – Efecto. En la misma se obtuvieron resultados significativos como: la estimación de los costos de calidad para los procesos estudiados, la identificación de las partidas que más influyen en el monto total del costo de calidad y la evaluación de la calidad de la gestión en la empresa objeto de estudio.

  3. Ectoparasite associations of bats from central Pennsylvania.

    Science.gov (United States)

    Dick, Carl W; Gannon, Michael R; Little, Wendy E; Patrick, Michael J

    2003-11-01

    Between April and October 1997, 689 bats representing seven species were captured at Pennsylvania's Canoe Creek State Park. Each bat was sampled for ectoparasitic arthropods, and four species were collected from 13.2% of the host individuals. Ectoparasites include the bat flea Myodopsylla insignis (Rothschild), the wing mite Spinturnix americanus (Banks), the bed bug Cimex adjunctus Barber, and the soft tick Ornithodoros kelleyi Cooley & Kohls. Prevalence, relative density, and mean intensity were calculated for ectoparasites of Myotis lucifugus (Le Conte), which harbored all four ectoparasite species and was the most commonly captured host. Patterns of ectoparasite associations were examined with respect to host sex and habitat (roost characteristics). Female M. lucifugus hosted higher densities of ectoparasites than did males. Moreover, relative densities of ectoparasites from M. lucifugus were dependent on the proximate roost; hosts captured near Bat Church were more heavily parasitized than those captured near Hartman Mine. Two other bat species were infested with at least one ectoparasite, but sample sizes were too small to analyze statistically. These bat species included Myotis septentrionalis (Trouessart), harboring M. insignis, S. americanus, and O. kelleyi, and Eptesicus fuscus (Beauvois), which harbored M. insignis and O. kelleyi. PMID:14765658

  4. Surveillance study of vector species on board passenger ships, Risk factors related to infestations

    Directory of Open Access Journals (Sweden)

    Hatzoglou Chrissi

    2008-03-01

    Full Text Available Abstract Background Passenger ships provide conditions suitable for the survival and growth of pest populations. Arthropods and rodents can gain access directly from the ships' open spaces, can be carried in shiploads, or can be found on humans or animals as ectoparasites. Vectors on board ships may contaminate stored foods, transmit illness on board, or, introduce diseases in new areas. Pest species, ship areas facilitating infestations, and different risk factors related to infestations were identified in 21 ferries. Methods 486 traps for insects and rodents were placed in 21 ferries. Archives of Public Health Authorities were reviewed to identify complaints regarding the presence of pest species on board ferries from 1994 to 2004. A detail questionnaire was used to collect data on ship characteristics and pest control practices. Results Eighteen ferries were infested with flies (85.7%, 11 with cockroaches (52.3%, three with bedbugs, and one with fleas. Other species had been found on board were ants, spiders, butterflies, beetles, and a lizard. A total of 431 Blattella germanica species were captured in 28 (9.96% traps, and 84.2% of them were nymphs. One ship was highly infested. Cockroach infestation was negatively associated with ferries in which Hazard Analysis Critical Control Point system was applied to ensure food safety on board (Relative Risk, RR = 0.23, p = 0.03, and positively associated with ferries in which cockroaches were observed by crew (RR = 4.09, p = 0.007, no cockroach monitoring log was kept (RR = 5.00, p = 0.02, and pesticide sprays for domestic use were applied by crew (RR = 4.00, p = 0.05. Cockroach infested ships had higher age (p = 0.03. Neither rats nor mice were found on any ship, but three ferries had been infested with a rodent in the past. Conclusion Integrated pest control programs should include continuing monitoring for a variety of pest species in different ship locations; pest control measures should be more

  5. Investigation and analysis on vector infestation status of 10 five-star hotels in Huangpu district before the CICA-Summit in Shanghai%上海市中心城区亚信峰会前期五星级宾馆病媒侵害状况调查及问题分析

    Institute of Scientific and Technical Information of China (English)

    高强; 曹晖; 丁志伟; 徐康; 梁必匀; 冷培恩

    2015-01-01

    cockroach control failure rate was 40.00% and 50.00%, respectively, the positive rate also decreased significantly after the first round feedback (1.87%vs. 0.74%,χ2=3.942, P=0.047). The positive mosquito breeding sites was found in individual underground garage wells. No obvious fly and bedbug infestations were found in the two rounds of survey. Conclusion Five⁃star hotels vector infestation were found mainly in the kitchen, food storage and processing rooms, laundry rooms and other non⁃public areas, mice and cockroaches were the predominant vector for infestation, which may be attributed to the hotels’ complex environment and management deficiencies. Appropriate pest proof measures, specific supervision, modifications and improvement in the star hotel standards were advisable.

  6. ENFOQUE ESTRATÉGICO PARA LA INTEGRACIÓN DEL SISTEMA DE DIRECCIÓN EN UNA EMPRESA DE SERVICIOS INGENIEROS

    Directory of Open Access Journals (Sweden)

    Yasier Zaldívar Llanes

    2010-11-01

    ="false" Priority="21" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis" />

    Este artículo resume  la investigación realizada en el diseño del enfoque estratégico  para la integración del sistema de dirección de la empresa “Inversiones CIMEX S.A”, y se exponen los resultados obtenidos en su implementación durante dos años de trabajo.

     

    This article sums up the research