Multi-Modal Imaging in a Mouse Model of Orthotopic Lung Cancer

OpenAIRE

Patel, Priya; Kato, Tatsuya; Ujiie, Hideki; Wada, Hironobu; Lee, Daiyoon; Hu, Hsin-pei; Hirohashi, Kentaro; Ahn, Jin Young; Zheng, Jinzi; Yasufuku, Kazuhiro

2016-01-01

Background Investigation of CF800, a novel PEGylated nano-liposomal imaging agent containing indocyanine green (ICG) and iohexol, for real-time near infrared (NIR) fluorescence and computed tomography (CT) image-guided surgery in an orthotopic lung cancer model in nude mice. Methods CF800 was intravenously administered into 13 mice bearing the H460 orthotopic human lung cancer. At 48 h post-injection (peak imaging agent accumulation time point), ex vivo NIR and CT imaging was performed. A cli...

Synthesis, characterization, and in vivo efficacy evaluation of PGG–docetaxel conjugate for potential cancer chemotherapy

Directory of Open Access Journals (Sweden)

Jiang X

2012-02-01

-dependent manner. However, PGG–DTX showed better antitumor activity in NCI-H460 lung cancer-bearing mice with minimal weight loss compared to that of free DTX.Conclusion: The PGG–DTX conjugate may be considered as an attractive and promising polymeric DTX conjugate for non-small cell lung cancer treatment.Keywords: polymer drug delivery, nanotechnology, nanotherapeutics, drug delivery, nanomedicine, pharmaceutics

Inhibition of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus

Directory of Open Access Journals (Sweden)

Chang HB

2015-08-01

Full Text Available Hong-Bin Chang,1 Bing-Huei Chen1,21Department of Food Science, 2Graduate Institute of Medicine, Fu Jen Catholic University, Taipei, TaiwanAbstract: The objectives of this study were to explore the inhibition mechanism of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus. In addition, human bronchus epithelial cell line BEAS-2B (normal cell was selected for comparison. A high-performance liquid chromatography (HPLC method was developed to separate and quantify the various curcuminoids in C. longa extract, including curcumin (1,714.5 µg/mL, demethoxycurcumin (1,147.4 µg/mL, and bisdemethoxycurcumin (190.2 µg/mL. A high-stability nanoemulsion composed of Tween 80, water, and curcuminoid extract was prepared, with mean particle size being 12.6 nm. The cell cycle was retarded at G2/M for both the curcuminoid extract and nanoemulsion treatments; however, the inhibition pathway may be different. H460 cells were more susceptible to apoptosis than A549 cells for both curcuminoid extract and nanoemulsion treatments. Growth of BEAS-2B remained unaffected for both the curcuminoid extract and nanoemulsion treatments, with a concentration range from 1 to 4 µg/mL. Also, the activities of caspase-3, caspase-8, and caspase-9 followed a dose-dependent increase for both A549 and H460 cells for both the treatments, accompanied by a dose-dependent increase in cytochrome C expression and a dose-dependent decrease in CDK1 expression. Interestingly, a dose-dependent increase in cyclin B expression was shown for A549 cells for both the treatments, while a reversed trend was found for H460 cells. Both mitochondria and death receptor pathways may be responsible for apoptosis of both A549 and H460 cells.Keywords: curcuminoid extract, curcuminoid nanoemulsion, Curcuma longa Linnaeus, lung cancer cell, cell cycle, apoptosis mechanism

The fibronectin III-1 domain activates a PI3-Kinase/Akt signaling pathway leading to αvβ5 integrin activation and TRAIL resistance in human lung cancer cells

International Nuclear Information System (INIS)

Cho, Christina; Horzempa, Carol; Jones, David; McKeown-Longo, Paula J.

2016-01-01

Fibronectin is a mechanically sensitive protein which is organized in the extracellular matrix as a network of interacting fibrils. The lung tumor stroma is enriched for fibronectin which is thought to contribute to metastasis and drug resistance. Fibronectin is an elastic, multi-modular protein made up of individually folded domains, some of which can stretch in response to increased mechanical tension. Very little is known about the relationship of fibronectin’s unfolded domains to lung cancer resistance to chemotherapy. In the present study, we evaluated the impact of unfolding the first Type III domain of fibronectin (FnIII-1c) on TNF-related apoptosis inducing ligand (TRAIL) resistance. NCI-H460 non-small cell lung cancer cells were treated with FnIII-1c then assessed for TRAIL-induced apoptosis. Subsequent analysis of FnIII-1c-mediated signaling pathways was also completed. Human non-small cell lung cancer tissue sections were assessed for the expression of vitronectin by immunohistochemistry. FnIII-1c inhibited TRAIL-induced activation of caspase 8 and subsequent apoptosis in NCI-H460 lung cancer cells. FnIII-1c treatment was associated with the activation of the phosphatidylinositol-3-kinase/alpha serine/threonine kinase (PI3K/Akt) pathway and the αvβ5 integrin receptor for vitronectin, both of which were required for TRAIL resistance. Immunohistochemical staining of sections from non-small cell lung cancers showed that vitronectin was localized around blood vessels and in the tumor-stroma interface. Unfolding of Type III domains within the fibronectin matrix may promote TRAIL resistance through the activation of a PI3K/Akt/αvβ5 signaling axis and point to a novel mechanism by which changes in secondary structure of fibronectin contribute to cancer cell resistance to apoptosis

Analysis of 125I-[Tyr3] octreotide receptors of NCI-H466 cell line

International Nuclear Information System (INIS)

Sun Junjie; Fan Wo; Xu Yujie; Zhang Youjiu; Zhu Ran

2002-01-01

Objective: To study the affinity of small cell lung carcinoma to [Tyr 3 ] octreotide (TOC). Methods: Taking 125 I-[Tyr 3 ] octreotide (labeled by chloramine-T method), as the ligand, small cell lung carcinoma NCI-H466 cell line was inspected for the receptor-binding points and affinity constant. Results: The radio-chemical purity of 125 I-TOC purified through sephadex G-10 was higher than 95%. Receptor analysis study showed that the expression of somatostatin receptors on NCI-H446 cells was numerous (Bmax = 1.17 x 10 5 /cell) with strong affinity to 125 I-TOC (Kd = 0.56 nM). Conclusion: Labeled TOC could be used for small cell lung carcinoma receptor imaging and radio-pharmaceutical therapy

Trehalose Liposomes Suppress the Growth of Tumors on Human Lung Carcinoma-bearing Mice by Induction of Apoptosis In Vivo.

Science.gov (United States)

Ichihara, Hideaki; Kuwabara, Keiji; Matsumoto, Yoko

2017-11-01

Previous evidence demonstrates that trehalose liposomes (DMTreC14) composed of L-α-dimyristoylphosphatidylcholine (DMPC) and α-D-glycopyranosyl-α-D-glucopyranoside monomyristate (TreC14) inhibit proliferation and invasion on lung carcinoma (A549 cells) in vitro. Here, we aimed to investigate suppressive effects of DMTreC14 on the growth of tumor on human lung carcinoma bearing mice. DMTreC14 composed of 30 mol% DMPC and 70 mol% TreC14 were prepared by the sonication method. Anti-tumor activities of DMTreC14 using the subcutaneous and orthotopic graft-bearing mice of A549 cells were investigated in vivo. The remarkable reduction of volume and weight in subcutaneous tumors on subcutaneous lung carcinoma-bearing mice topically administrated with DMTreC14 were obtained. Apoptotic-positive cells in the subcutaneous tumor slice of subcutaneous lung carcinoma-bearing mice topically administrated with DMTreC14 were observed using TUNEL staining. Lung weights on the orthotopic graft-bearing mice of lung carcinoma intravenously administrated with DMTreC14 were markedly decreased compared to those of the control group. Remarkable decrease in dimensions of tumor area of lung on the orthotopic graft-bearing mice of lung carcinoma intravenously administrated with DMTreC14 was obtained in histological analysis using the hematoxylin and eosin staining. Remarkably high anti-tumor activities of DMTreC14 for the subcutaneous and orthotopic graft-bearing mice of lung carcinoma accompanied with apoptosis were revealed for the first time in vivo. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Inhibition of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus.

Science.gov (United States)

Chang, Hong-Bin; Chen, Bing-Huei

2015-01-01

The objectives of this study were to explore the inhibition mechanism of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus. In addition, human bronchus epithelial cell line BEAS-2B (normal cell) was selected for comparison. A high-performance liquid chromatography (HPLC) method was developed to separate and quantify the various curcuminoids in C. longa extract, including curcumin (1,714.5 μg/mL), demethoxycurcumin (1,147.4 μg/mL), and bisdemethoxycurcumin (190.2 μg/mL). A high-stability nanoemulsion composed of Tween 80, water, and curcuminoid extract was prepared, with mean particle size being 12.6 nm. The cell cycle was retarded at G2/M for both the curcuminoid extract and nanoemulsion treatments; however, the inhibition pathway may be different. H460 cells were more susceptible to apoptosis than A549 cells for both curcuminoid extract and nanoemulsion treatments. Growth of BEAS-2B remained unaffected for both the curcuminoid extract and nanoemulsion treatments, with a concentration range from 1 to 4 μg/mL. Also, the activities of caspase-3, caspase-8, and caspase-9 followed a dose-dependent increase for both A549 and H460 cells for both the treatments, accompanied by a dose-dependent increase in cytochrome C expression and a dose-dependent decrease in CDK1 expression. Interestingly, a dose-dependent increase in cyclin B expression was shown for A549 cells for both the treatments, while a reversed trend was found for H460 cells. Both mitochondria and death receptor pathways may be responsible for apoptosis of both A549 and H460 cells.

The In Vitro Anti-Tumor Activity of Phycocyanin against Non-Small Cell Lung Cancer Cells

Directory of Open Access Journals (Sweden)

Shuai Hao

2018-05-01

Full Text Available Phycocyanin, a type of functional food colorant, is shown to have a potent anti-cancer property. Non-small cell lung cancer (NSCLC is one of the most aggressive form of cancers with few effective therapeutic options. Previous studies have demonstrated that phycocyanin exerts a growth inhibitory effect on NSCLC A549 cells. However, its biological function and underlying regulatory mechanism on other cells still remain unknown. Here, we investigated the in vitro function of phycocyanin on three typical NSCLC cell lines, NCI-H1299, NCI-H460, and LTEP-A2, for the first time. The results showed that phycocyanin could significantly induce apoptosis, cell cycle arrest, as well as suppress cell migration, proliferation, and the colony formation ability of NSCLC cells through regulating multiple key genes. Strikingly, phycocyanin was discovered to affect the cell phenotype through regulating the NF-κB signaling of NSCLC cells. Our findings demonstrated the anti-neoplastic function of phycocyanin and provided valuable information for the regulation of phycocyanin in NSCLC cells.

The anti-lung cancer activity of SEP is mediated by the activation and cytotoxicity of NK cells via TLR2/4 in vivo.

Science.gov (United States)

Ke, Mengyun; Wang, Hui; Zhang, Min; Tian, Yuwei; Wang, Yizhou; Li, Bing; Yu, Jie; Dou, Jie; Xi, Tao; Zhou, Changlin

2014-05-01

Strongylocentrotus nudus egg polysaccharide (SEP) has been reported to display antitumor activity. However, the effects of SEP and its underlying mechanism in the treatment of lung cancer remain unclear, particularly with an immunodeficient mouse model of human non-small cell lung cancer (NSCLC). In the present study, we investigated the anti-lung cancer effects of SEP and its underlying mechanism of action in both Lewis lung cancer (LLC)-bearing C57/BL6J mice and human NSCLC H460-bearing nude mice. Although SEP showed no inhibitory effects on tumor cells in vitro, it markedly stimulated the percentage of CD3-NK1.1(+) cells and natural killer (NK) cell cytotoxicity in the spleens of nude mice and C57/BL6J mice. In LLC-bearing mice, SEP not only inhibited tumor growth but also promoted NK-mediated cytotoxicity, the NK1.1(+) cell population, and IL-2 and IFN-γ secretion. SEP significantly suppressed H460 growth in nude mice, which was abrogated by the selective depletion of NK cells via the intraperitoneal injection of anti-asialo GM-1 antibodies. Furthermore, anti-TLR2/4 antibodies blocked both SEP and NK cell binding and SEP-induced perforin secretion. SEP-induced proliferation and IFN-γ secretion by NK cells in wild type mice were partially impaired in TLR2 or TLR4 knockout mice. These results suggest that SEP-promoted NK cytotoxicity, which was partially mediated via TLR2 and TLR4, was the main contributing factor to lung cancer inhibition in vivo and that SEP may be a potential immunotherapy candidate for the treatment of lung cancer. Copyright © 2014 Elsevier Inc. All rights reserved.

Hexamethoxylated Monocarbonyl Analogues of Curcumin Cause G2/M Cell Cycle Arrest in NCI-H460 Cells via Michael Acceptor-Dependent Redox Intervention.

Science.gov (United States)

Li, Yan; Zhang, Li-Ping; Dai, Fang; Yan, Wen-Jing; Wang, Hai-Bo; Tu, Zhi-Shan; Zhou, Bo

2015-09-09

Curcumin, derived from the dietary spice turmeric, holds promise for cancer prevention. This prompts much interest in investigating the action mechanisms of curcumin and its analogues. Two symmetrical hexamethoxy-diarylpentadienones (1 and 2) as cucumin analogues were reported to possess significantly enhanced cytotoxicity compared with the parent molecule. However, the detailed mechanisms remain unclear. In this study, compounds 1 and 2 were identified as the G2/M cell cycle arrest agents to mediate the cytotoxicity toward NCI-H460 cells via Michael acceptor-dependent redox intervention. Compared with curcumin, they could more easily induce a burst of reactive oxygen species (ROS) and collapse of the redox buffering system. One possible reason is that they could more effectively target intracellular TrxR to convert this antioxidant enzyme into a ROS promoter. Additionally, they caused up-regulation of p53 and p21 and down-regulation of redox-sensitive Cdc25C along with cyclin B1/Cdk1 in a Michael acceptor- and ROS-dependent fashion. Interestingly, in comparison with compound 2, compound 1 displayed a relatively weak ability to generate ROS but increased cell cycle arrest activity and cytotoxicity probably due to its Michael acceptor-dependent microtubule-destabilizing effect and greater GST-inhibitory activity, as well as its enhanced cellular uptake. This work provides useful information for understanding Michael acceptor-dependent and redox-mediated cytotoxic mechanisms of curcumin and its active analogues.

Anti-tumor effect of 131I labeled 17-allylamino-17-demethoxygeldanamycin on human non-small cell lung cancer in xenograft-bearing nude mice

International Nuclear Information System (INIS)

Sun Jin; Liu Lu; Zhu Xiaoli; Chen Daozhen; Gao Wen; Jiang Xinyu; Huang Ying

2008-01-01

Objective: 17-allylamino-17-demethoxygeldanamycin (17-AAG) has been developed as a novel heat shock protein 90 (HSP90) inhibitor being used in clinical trials. HSP90 is known as a molecular target for tumor therapy. The goal of this study was to investigate the inhibitive effects of 131 I labeled 17-AAG on human non-small cell lung cancer in xenograft-bearing nude mice. Methods: 17-AAG was labeled with 131 I. Twenty-eight BALB/c nude mice bearing H460 human non-small cell lung carcinoma tumor xenograft were randomly divided into seven groups, one control group and six treatment groups according to the route of administration (via tail vein injection or intratumoral injection) and the doses of injected radio-activity (5.5 MBq x 2 with 8 d interval, 11.0 MBq and 5.5 MBq). Two additional mice were treated with intratumoral injection of Na 131 I solution that was served as seintigraphic imaging controls. In each group two mice underwent scintigraphy at 2 h, 6 h, 24 h, 2 d, 3 d, 7 d, 10 d and 16 d. After 16 d the tumor inhibition rate was calculated. Then all of the mice were sacrificed and the tumor tissues were obtained for histological examination and immunohistochemical assay. Results: Persistent accumulation of 131 I-17-AAG in the tumors was seen on seintigraphic images. Tumor inhibiting effect was demonstrated in all treatment groups with varying degrees. The highest tumor inhibition rate (86.77 ± 4.57)% was shown in the group with interval intratumoral injection (5.5 MBq x 2). There was no significant difference of tumor inhibition rates between 5.5 MBq x 2 group (via tail vein injection) and 11.0 MBq group( via tail vein injection, q=1.67, P>0.05). While among the other treatment groups, there was significant difference in tumor inhibition rates( q=3.16-24.34, all P 131 I-17-AAG may effectively inhibit the tumor growth and expression of HSP90α antigen expression in non-small cell lung cancer bearing nude mice. The more prominent anti-tumor effect may be

Lung Cancer Precision Medicine Trials

Science.gov (United States)

Patients with lung cancer are benefiting from the boom in targeted and immune-based therapies. With a series of precision medicine trials, NCI is keeping pace with the rapidly changing treatment landscape for lung cancer.

76 FR 22108 - Proposed Collection; Comment Request; Prostate, Lung, Colorectal and Ovarian Cancer Screening...

Science.gov (United States)

2011-04-20

... (prostate, lung, colorectal, and ovary). In addition, cancer incidence, stage shift, and case survival are... Request; Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial (PLCO) (NCI) SUMMARY: In compliance... for public comment on proposed data collection projects, the National Cancer Institute (NCI), the...

Antiproliferative Activity and Chemical Constituents of Hypericum dyeri. Rehder

International Nuclear Information System (INIS)

Ali, M.; Arfan, M.; Zaman, K.

2013-01-01

The antiproliferative activity of hexane (F1), ethyl acetate (F2), butanol (F3) and water (F4) extracts of Hypericum dyeri were tested in vitro for their anti- proliferative (anticancer) activity on the cell lines: HT-29 human colon adenocarcinoma, NCI-H460 human non-small cell lung carcinoma, MCF-7 human breast cancer, OVCAR-3 human ovarian adenocarcinoma and RXF-393 human renal cell carcinoma with etoposide as positive control. Among the various extracts the F1 showed relatively potent anti-proliferative activity (IC50, 17.20 +- 4.80 micro g/mL) on NCI-H460 human non-small cell lung carcinoma cell growth. Six compounds were also isolated for the first time from this source. These phytochemicals were identified as 1-Octatriacontanol (1), Hexacosyl tetracosanoate (2), Geddic acid (3), Octacosanoic acid (4), Ceric acid (5) and Sitosterol (6) on the basis of spectroscopic studies such as 1H NMR ,13C NMR, 2D NMR and Mass spectroscopy as well as established with help of reported literature. (author)

[Overexpression of liver kinase B1 inhibits the proliferation of lung cancer cells].

Science.gov (United States)

Li, Yang; Zhang, Libin; Wang, Ping

2017-01-01

Objective To explore the effect of overexpressed liver kinase B1(LKB1) on the proliferation of lung cancer cell lines. Methods The expression levels of LKB1 and PTEN in A549, NCI-H23, NCI-H157, XWLC-05, NCI-H446 lung cancer cells were detected by immunocytochemistry (ICC) and Western blotting. Plasmid pcDNA3.1 + -LKB1 and empty vector pcDNA3.1 + -null were separately transfected into the above five cell lines, and then the expression of LKB1 mRNA and protein were determined by quantitative real-time PCR and Western blotting, respectively. Finally, CCK-8 assay was used to analyze the proliferation ability of the transfected cells. Results LKB1 and PTEN were positive in NCI-H23 cells; LKB1 was negative while PTEN was positive in A549 and NCI-H446 cells; both LKB1 and PTEN were negative in NCI-H157 and XWLC-05 cells. Quantitative real-time PCR and Western blotting showed that the expression level of LKB1 significantly increased in the above cell lines transfected with plasmid pcDNA3.1 + -LKB1 compared with the ones with empty vector pcDNA3.1 + -null. Besides, CCK-8 assay showed that the overexpression of LKB1 in the lung cancer cells transfected with pcDNA3.1 + -LKB1 had an obvious inhibitory effect on cell proliferation. Conclusion The expression of LKB1 is down-regulated in most of the lung cell lines to different extent and the over-expression of LKB1 can remarkably inhibit the proliferation ability of lung cancer cell lines.

Testing lung cancer drugs and therapies in mice

Science.gov (United States)

National Cancer Institute (NCI) investigators have designed a genetically engineered mouse for use in the study of human lung squamous cell carcinoma (SCC). SCC is a type of non-small cell lung carcinoma, one of the most common types of lung cancer, with

Relative Apoptosis-inducing Potential of Homeopa-thic Condurango 6C and 30C in H460 Lung Cancer Cells In vitro

Directory of Open Access Journals (Sweden)

Sikdar Sourav

2014-03-01

Full Text Available Objectives: In homeopathy, it is claimed that more homeopathically-diluted potencies render more protective/curative effects against any disease condition. Potentized forms of Condurango are used successfully to treat digestive problems, as well as esophageal and stomach cancers. However, the comparative efficacies of Condurango 6C and 30C, one diluted below and one above Avogadro’s limit (lacking original drug molecule, respectively, have not been critically analyzed for their cell-killing (apoptosis efficacy against lung cancer cells in vitro, and signalling cascades have not been studied. Hence, the present study was undertaken. Methods: 3-(4,5-dimethylthiazol-2-yl-2,5-diphenylte- trazolium bromide (MTT assays were conducted on H460-non-small-cell lung cancer (NSCLC cells by using a succussed ethyl alcohol vehicle (placebo as a control. Studies on cellular morphology, cell cycle regulation, generation of reactive oxygen species (ROS, changes in mitochondrial membrane potential (MMP, and DNA-damage were made, and expressions of related signaling markers were studied. The observations were done in a “blinded” manner. Results: Both Condurango 6C and 30C induced apoptosis via cell cycle arrest at subG0/G1 and altered expressions of certain apoptotic markers significantly in H460 cells. The drugs induced oxidative stress through ROS elevation and MMP depolarization at 18-24 hours. These events presumably activated a caspase-3-mediated signalling cascade, as evidenced by reverse transcriptase- polymerase chain reaction (RT-PCR, western blot and immunofluorescence studies at a late phase (48 hours in which cells were pushed towards apoptosis. Conclusion: Condurango 30C had greater apoptotic effect than Condurango 6C as claimed in the homeopathic doctrine.

Data Sets from Major NCI Initiaves

Science.gov (United States)

The NCI Data Catalog includes links to data collections produced by major NCI initiatives and other widely used data sets, including animal models, human tumor cell lines, epidemiology data sets, genomics data sets from TCGA, TARGET, COSMIC, GSK, NCI60.

Ternary copper(II) complex: NCI60 screening, toxicity studies, and evaluation of efficacy in xenograft models of nasopharyngeal carcinoma

Science.gov (United States)

Chu, Tai-Lin; Abdul Aziz, Norazlin; Mohd Kornain, Noor-Kaslina; Samiulla, D. S.; Lo, Kwok-Wai; Ng, Chew-Hee

2018-01-01

Copper(II) ternary complex, [Cu(phen)(C-dmg)(H2O)]NO3 was evaluated against a panel of cell lines, tested for in vivo efficacy in nasopharyngeal carcinoma xenograft models as well as for toxicity in NOD scid gamma mice. The Cu(II) complex displayed broad spectrum cytotoxicity against multiple cancer types, including lung, colon, central nervous system, melanoma, ovarian, and prostate cancer cell lines in the NCI-60 panel. The Cu(II) complex did not cause significant induction of cytochrome P450 (CYP) 3A and 1A enzymes but moderately inhibited CYP isoforms 1A2, 2C9, 2C19, 2D6, 2B6, 2C8 and 3A4. The complex significantly inhibited tumor growth in nasopharyngeal carcinoma xenograft bearing mice models at doses which were well tolerated without causing significant or permanent toxic side effects. However, higher doses which resulted in better inhibition of tumor growth also resulted in toxicity. PMID:29329342

Cancer Cell Growth Inhibitory Effect of Bee Venom via Increase of Death Receptor 3 Expression and Inactivation of NF-kappa B in NSCLC Cells

Directory of Open Access Journals (Sweden)

Kyung Eun Choi

2014-07-01

Full Text Available Our previous findings have demonstrated that bee venom (BV has anti-cancer activity in several cancer cells. However, the effects of BV on lung cancer cell growth have not been reported. Cell viability was determined with trypan blue uptake, soft agar formation as well as DAPI and TUNEL assay. Cell death related protein expression was determined with Western blotting. An EMSA was used for nuclear factor kappaB (NF-κB activity assay. BV (1–5 μg/mL inhibited growth of lung cancer cells by induction of apoptosis in a dose dependent manner in lung cancer cell lines A549 and NCI-H460. Consistent with apoptotic cell death, expression of DR3 and DR6 was significantly increased. However, deletion of DRs by small interfering RNA significantly reversed BV induced cell growth inhibitory effects. Expression of pro-apoptotic proteins (caspase-3 and Bax was concomitantly increased, but the NF-κB activity and expression of Bcl-2 were inhibited. A combination treatment of tumor necrosis factor (TNF-like weak inducer of apoptosis, TNF-related apoptosis-inducing ligand, docetaxel and cisplatin, with BV synergistically inhibited both A549 and NCI-H460 lung cancer cell growth with further down regulation of NF-κB activity. These results show that BV induces apoptotic cell death in lung cancer cells through the enhancement of DR3 expression and inhibition of NF-κB pathway.

Icotinib antagonizes ABCG2-mediated multidrug resistance, but not the pemetrexed resistance mediated by thymidylate synthase and ABCG2.

Science.gov (United States)

Wang, De-Shen; Patel, Atish; Shukla, Suneet; Zhang, Yun-Kai; Wang, Yi-Jun; Kathawala, Rishil J; Robey, Robert W; Zhang, Li; Yang, Dong-Hua; Talele, Tanaji T; Bates, Susan E; Ambudkar, Suresh V; Xu, Rui-Hua; Chen, Zhe-Sheng

2014-06-30

ABCG2 is a potential biomarker causing multidrug resistance (MDR) in Non-Small Cell Lung Cancer (NSCLC). We conducted this study to investigate whether Icotinib, a small-molecule inhibitor of EGFR tyrosine kinase, could interact with ABCG2 transporter in NSCLC. Our results showed that Icotinib reversed ABCG2-mediated MDR by antagonizing the drug efflux function of ABCG2. Icotinib stimulated the ATPase activity in a concentration-dependent manner and inhibited the photolabeling of ABCG2 with [125I]-Iodoarylazidoprazosin, demonstrating that it interacts at the drug-binding pocket. Homology modeling predicted the binding conformation of Icotinib at Asn629 centroid-based grid of ABCG2. However, Icotinib at reversal concentration did not affect the expression levels of AKT and ABCG2. Furthermore, a combination of Icotinib and topotecan exhibited significant synergistic anticancer activity against NCI-H460/MX20 tumor xenografts. However, the inhibition of transport activity of ABCG2 was insufficient to overcome pemetrexed resistance in NCI-H460/MX20 cells, which was due to the co-upregulated thymidylate synthase (TS) and ABCG2 expression. This is the first report to show that the up-regulation of TS in ABCG2-overexpressing cell line NCI-H460/MX20 may play a role of resistance to pemetrexate. Our findings suggested different possible strategies of overcoming the resistance of topotecan and pemetrexed in the NSCLC patients.

A nanobody targeting carcinoembryonic antigen as a promising molecular probe for non-small cell lung cancer.

Science.gov (United States)

Wang, Hao; Meng, Ai-Min; Li, Sheng-Hua; Zhou, Xiao-Liang

2017-07-01

Carcinoembryonic antigen (CEA) is a biomarker and therapy target for non‑small cell lung cancer (NSCLC), which is the most common type of lung cancer. Nanobodies with high target specificity are promising candidates to function as anti‑CEA probes. In the present study, the targeting effects of an anti‑CEA nanobody obtained from phage display were investigated using technetium‑99 m (99mTc) and fluorescence labeling. In vitro binding and immunofluorescent staining assays, as well as in vivo blood clearance and biodistribution assays were performed. High specificity and affinity of the nanobody for CEA‑positive H460 cells was observed in vitro. The pharmacokinetics assay of the 99mTc‑nanobody in Wistar rats demonstrated that the nanobody had appropriate T1/2α and T1/2β, which were 20.2 and 143.5 min, respectively. The biodistribution assay using H460 xenograft‑bearing nude mice demonstrated a high ratio of signal in tumor compared with background, which confirmed that the nanobody may be useful as a molecular probe for CEA‑positive cancer, particularly in NSCLC.

Curcumin reduces trabecular and cortical bone in naive and Lewis lung carcinoma-bearing mice

Science.gov (United States)

The present study investigated the effects of dietary supplementation with curcumin on bone microstructural changes in female C57BL/6 mice in the presence or absence of Lewis lung carcinoma. Morphometric analysis showed that in tumor-bearing mice curcumin at 2% and 4% dietary levels (w/w) significa...

In-vivo counting of 241Am in human lungs and tracheobronchial lymph nodes

International Nuclear Information System (INIS)

Northcutt, A.R.; Binney, S.E.; Palmer, H.E.

1988-01-01

A study was conducted of a human male who had inhaled a mixture of 241 Am and Pu. To distinguish 241 Am deposited in the subject's lungs from translocated activity deposited in the tracheobronchial lymph nodes (TBLN), two intrinsic Ge detectors were collimated with 0.3-cm Pb sheeting. A tissue-equivalent phantom containing either 22.9 kBq (620 nCi) of 241 Am in the lungs or a 81.4 kBq (2200 nCi) 241 Am point source in the TBLN was measured. Calibration curves observed from lateral differential scans on the phantom were compared to data obtained by the same detection system for a human male with a measured lung deposition of 89 Bq (2.4 nCi) of 241 Am. Comparison of the human data to the calibration curves indicated the activity was restricted primarily to the lungs. The calibration curves demonstrate that this method is useful in determining the distribution of inhaled radioactivity between the lungs and TBLN. The measured activity from the male subject generally supported the ICRP Publication 30 model translocation prediction for class Y compounds

Biochemical effects of inhaled 239PuO2 on lung lipids

International Nuclear Information System (INIS)

Tombropoulos, E.G.; Hadley, J.G.; Thomas, J.M.; Craig, D.K.

1977-01-01

Results of experiments carried out to assess the effect of 239 Pu α irradiation on lung lipid biosynthesis and to determine the lungs ability to incorporate palmitate into lavage lecithin and its turnover are reported. The experiments were carried out on rats which had inhaled 239 PuO 2 particles. The study of palmitate incorporation into lipids shows conclusively that for medium (23 to 42 nCi) or high (more than 100 nCi) lung depositions the incorporation by isolated mitochondria is significantly (P 239 PuO 2 were positive, with respect to controls in 8 of 10 instances, when measured following the label of palmitate in lung lavage lecithin. The interpretation of the significant result (P < 0.05) is that: (1) initial and/or final lecithin pool sizes were different, (2) transfer rates were affected between blood and lung, or (3) rates of degradation of lung lavage lecithin were affected. (U.K.)

In vitro growth inhibition and cytotoxicity of Euphorbia caducifolia against four human cancer cell lines and its phytochemical characterisation.

Science.gov (United States)

Bano, Shaista; Siddiqui, Bina Shaheen; Farooq, Ahsana Dar; Begum, Sabira; Siddiqui, Faheema; Kashif, Muhammad; Azhar, Mudassar

2017-12-01

Several Euphorbia species have been used in folklore as cancer remedies, however, scientific studies on the cytotoxicity (in vitro studies) of Euphorbia caducifolia are lacking. In present study, anticancer potential of E. caducifolia aerial parts ethanol extract and its fractions were evaluated against human lung (NCI-H460), breast (MCF-7), prostate (PC-3) and cervical (HeLa) cancer cell lines, using sulphorhodamine-B in vitro cytotoxicity (in vitro studies) assay. The ethanol extract demonstrated growth inhibitory effect against all aforementioned cancer cell lines with IC 50 , 19-135 μg/mL and LC 50 , ~220 μg/mL, and its petroleum ether fraction obtained on bioactivity guided fraction showed highest activity with IC 50 , 28-70 μg/mL and LC 50 , 71 μg/mL against NCI-H460 and MCF-7 cell lines. Its phytochemicals were analysed by gas chromatography-mass spectrometry (GC-MS). The present study provides scientific justification for its traditional use against cancer.

Expression of P-gp, MRP, LRP, GST-π and TopoIIα and intrinsic resistance in human lung cancer cell lines.

Science.gov (United States)

Wang, Jiarui; Zhang, Jinhui; Zhang, Lichuan; Zhao, Long; Fan, Sufang; Yang, Zhonghai; Gao, Fei; Kong, Ying; Xiao, Gary Guishan; Wang, Qi

2011-11-01

This study aimed to determine the relationship between the endogenous levels of P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP), lung resistance-related protein (LRP), glutathione-s-transferase-π (GST‑π) and topoisomerase IIα (TopoIIα) and intrinsic drug resistance in four human lung cancer cell lines, SK-MES-1, SPCA-1, NCI-H-460 and NCI-H-446, of different histological types. The expression of P-gp, MRP, LRP, GST-π and TopoIIα was measured by immunofluorescence, Western blotting and RT-PCR. Drug resistance to cisplatin, doxorubicin and VP-16 was determined using MTT assays. The correlation between expression of the resistance-related proteins and their roles in the resistance to drugs in these cancer cell lines was analyzed. We found that the endogenous levels of P-gp, MRP, LRP, GST-π and TopoIIα in the four cell lines varied. The level of GST-π in the SK-MES-1 cells was the highest, whereas the level of P-gp in the SPCA-1 cells was the lowest. The chemoresistance to cisplatin, doxorubicin and VP-16 in the four cell lines was different. The SPCA-1 cell line was most resistance to cisplatin; SK-MES-1 was most resistance to VP-16; whereas SK-MES-1 was most sensitive to doxorubicin. There was a positive correlation between GST-π expression and resistance to cisplatin, between TopoIIα expression and resistance to VP-16; and a negative correlation was noted between TopoIIα expression and resistance to doxorubicin. In summary, the endogenous expression of P-gp, MRP, LRP, GST-π and TopoIIα was different in the four human lung cancer cell lines of different histological types, and this variance may be associated with the variation in chemosensitivity to cisplatin, doxorubicin and VP-16. Among the related proteins, GST-π may be useful for the prediction of the intrinsic resistance to cisplatin, whereas TopoIIα may be useful to predict resistance to doxorubicin and VP-16 in human lung cancer cell lines.

Proteasome inhibitors block DNA repair and radiosensitize non-small cell lung cancer.

Directory of Open Access Journals (Sweden)

Kyle R Cron

Full Text Available Despite optimal radiation therapy (RT, chemotherapy and/or surgery, a majority of patients with locally advanced non-small cell lung cancer (NSCLC fail treatment. To identify novel gene targets for improved tumor control, we performed whole genome RNAi screens to identify knockdowns that most reproducibly increase NSCLC cytotoxicity. These screens identified several proteasome subunits among top hits, including the topmost hit PSMA1, a component of the core 20 S proteasome. Radiation and proteasome inhibition showed synergistic effects. Proteasome inhibition resulted in an 80-90% decrease in homologous recombination (HR, a 50% decrease in expression of NF-κB-inducible HR genes BRCA1 and FANCD2, and a reduction of BRCA1, FANCD2 and RAD51 ionizing radiation-induced foci. IκBα RNAi knockdown rescued NSCLC radioresistance. Irradiation of mice with NCI-H460 xenografts after inducible PSMA1 shRNA knockdown markedly increased murine survival compared to either treatment alone. Proteasome inhibition is a promising strategy for NSCLC radiosensitization via inhibition of NF-κB-mediated expression of Fanconi Anemia/HR DNA repair genes.

Which risk models perform best in selecting ever-smokers for lung cancer screening?

Science.gov (United States)

A new analysis by scientists at NCI evaluates nine different individualized lung cancer risk prediction models based on their selections of ever-smokers for computed tomography (CT) lung cancer screening.

42 CFR 460.82 - Marketing.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Marketing. 460.82 Section 460.82 Public Health... Administrative Requirements § 460.82 Marketing. (a) Information that a PACE organization must include in its marketing materials. (1) A PACE organization must inform the public about its program and give prospective...

Lung cancer radiosensitization by CMNa in vitro and in vivo

International Nuclear Information System (INIS)

Zhang Xia; Ouyang Xienong; Ji Hongbing; Chen Zhonghua; Yang Rujun

2005-01-01

Objective: To probe into the radiosensitization effect of CMNa on lung tumor cell lines after γ-irradiation combined with γ-knife to treat patients suffering from lung cancer. Methods: 1. Cells of small cell lung cancer cell line NCI-H446 and non-small cell lung cancer cell line NCI-H596 irradiated with 60 Co γ-rays combined with or without CMNa were counted using trypan blue exclusion methods, and cell survival rate curves were depicted. 2. Patients suffering from lung cancer at different clinical stages were treated using γ-knife combined with or without CMNa, and the curative effect was evaluated 6 weeks after one cycle of treatment. Results: CMNa could significantly increase the sensitivity of lung cancer cell lines to γ-irradiation. Curative effect increased significantly by γ-knife treatment combined with CMNa i. e., the CR+PR rates for these two groups were 47.22% and 37.67% separately (P 0.05). Conclusion: CMNa could significantly increase the radiation sensitivity of lung cancer cell line cells in vitro and tumors in vivo, therefore, it could be used as a radiosensitization agent in clinical treatment of lung cancer. (authors)

Fractional energy absorption from beta-emitting particles in the rat lung

International Nuclear Information System (INIS)

Snipes, M.B.

1977-01-01

Forty-four male, Fischer-344 rats were exposed nose-only to an aerosol of 144 Ce in fused aluminosilicate particles to obtain a relatively insoluble lung burden of this material. Twenty-eight rats, ages 12 to 25 weeks with body weights of 183 to 337 grams were analyzed seven to nine days after exposure; lung burdens were 13 to 82 nCi. An additional group of 16 rats was exposed when 12 weeks old and maintained for six months prior to analysis; body weights and lung burdens at six months after exposure ranged from 276 to 368 grams and 16 to 46 nCi, respectively. Lungs were analyzed, inflated and deflated in a 4π beta spectrometer to determine fractional energy absorption for 144 Ce. Over the relatively narrow range of sizes, 0.88 to 1.66 grams, for lungs in this study the average fractional energy absorption and its standard deviation was 0.23 +- 0.078 for the inflated lung and 0.40 +- 0.087 for the deflated lung

Down-regulation of GRP78 is associated with the sensitivity of chemotherapy to VP-16 in small cell lung cancer NCI-H446 cells

International Nuclear Information System (INIS)

Wang, Yingyan; Wang, Wei; Wang, Siyan; Wang, Jiarui; Shao, Shujuan; Wang, Qi

2008-01-01

Chemotherapy resistance remains a major obstacle for the treatment of small cell lung cancer (SCLC). Glucose-regulated protein 78 (GRP78), an endoplasmic reticulum chaperone, plays a critical role in chemotherapy resistance in some cancers. However, whether the suppression of the chaperone can enhance the sensitivity of chemotherapy in SCLC is still unclear. The SCLC NCI-H446 cells were divided into three groups: BAPTA-AM→A23187-treated group, A23187-treated group and control-group. Immunofluorescence, western blot and RT-PCR were used to assess the expression of GRP78 at both protein and mRNA levels. Cell apoptosis and the cell cycle distributions of the cells were analyzed by flow cytometry in order to evaluate the therapeutic sensitivity to VP-16. The expression of GRP78 at both protein and mRNA levels in the BAPTA-AM→A23187-treated cells dramatically decreased as compared to that in both A23187-treated and control groups. After treatment by VP-16, the percentage of apoptotic cells in BAPTA-AM→A23187-treated cells were: 33.4 ± 1.01%, 48.2 ± 1.77%, 53.0 ± 1.43%, 56.5 ± 2.13%, respectively, corresponding to the concentrations of BAPTA-AM 10, 15, 25, 40 μM, which was statistically significant high in comparison with the A23187-treated group and untreated-group (7.18 ± 1.03% and 27.8 ± 1.45%, respectively, p < 0.05). The results from analysis of cell cycle distribution showed that there was a significantly decreased in G 1 phase and a dramatically increased in S phase for the BAPTA-AM→A23187-treated cells as compared with the untreated cells. BAPTA-AM is a strong inhibitor of GRP78 in the NCI-H446 cell line, the down-regulation of GRP78 can significantly increase the sensitivity to VP-16. The suppression of GRP78 may offer a new surrogated therapeutic approach to the clinical management of lung cancer

Nicotine transport in lung and non-lung epithelial cells.

Science.gov (United States)

Takano, Mikihisa; Kamei, Hidetaka; Nagahiro, Machi; Kawami, Masashi; Yumoto, Ryoko

2017-11-01

Nicotine is rapidly absorbed from the lung alveoli into systemic circulation during cigarette smoking. However, mechanism underlying nicotine transport in alveolar epithelial cells is not well understood to date. In the present study, we characterized nicotine uptake in lung epithelial cell lines A549 and NCI-H441 and in non-lung epithelial cell lines HepG2 and MCF-7. Characteristics of [ 3 H]nicotine uptake was studied using these cell lines. Nicotine uptake in A549 cells occurred in a time- and temperature-dependent manner and showed saturation kinetics, with a Km value of 0.31mM. Treatment with some organic cations such as diphenhydramine and pyrilamine inhibited nicotine uptake, whereas treatment with organic cations such as carnitine and tetraethylammonium did not affect nicotine uptake. Extracellular pH markedly affected nicotine uptake, with high nicotine uptake being observed at high pH up to 11.0. Modulation of intracellular pH with ammonium chloride also affected nicotine uptake. Treatment with valinomycin, a potassium ionophore, did not significantly affect nicotine uptake, indicating that nicotine uptake is an electroneutral process. For comparison, we assessed the characteristics of nicotine uptake in another lung epithelial cell line NCI-H441 and in non-lung epithelial cell lines HepG2 and MCF-7. Interestingly, these cell lines showed similar characteristics of nicotine uptake with respect to pH dependency and inhibition by various organic cations. The present findings suggest that a similar or the same pH-dependent transport system is involved in nicotine uptake in these cell lines. A novel molecular mechanism of nicotine transport is proposed. Copyright © 2017 Elsevier Inc. All rights reserved.

Dicty_cDB: SLC460 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

21 CFR 558.460 - Penicillin.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin. 558.460 Section 558.460 Food and Drugs... Animal Feeds § 558.460 Penicillin. (a) Specifications. As penicillin procaine G or feed grade penicillin.... (1) It is used as follows: Penicillin in grams per ton Combination in grams per ton Indications for...

NCI Alliance for Nanotechnology in Cancer

Science.gov (United States)

The NCI Alliance for Nanotechnology in Cancer funds the Cancer Nanotechnology Training Centers collectively with the NCI Cancer Training Center. Find out about the funded Centers, to date, that train our next generation of scientists in the field of Canc

P120-catenin isoforms 1A and 3A differently affect invasion and proliferation of lung cancer cells

International Nuclear Information System (INIS)

Liu Yang; Dong Qianze; Zhao Yue; Dong Xinjun; Miao Yuan; Dai Shundong; Yang Zhiqiang; Zhang Di; Wang Yan; Li Qingchang; Zhao Chen; Wang Enhua

2009-01-01

Different isoforms of p120-catenin (p120ctn), a member of the Armadillo gene family, are variably expressed in different tissues as a result of alternative splicing and the use of multiple translation initiation codons. When expressed in cancer cells, these isoforms may confer different properties with respect to cell adhesion and invasion. We have previously reported that the p120ctn isoforms 1 and 3 were the most highly expressed isoforms in normal lung tissues, and their expression level was reduced in lung tumor cells. To precisely define their biological roles, we transfected p120ctn isoforms 1A and 3A into the lung cancer cell lines A549 and NCI-H460. Enhanced expression of p120ctn isoform 1A not only upregulated E-cadherin and β-catenin, but also downregulated the Rac1 activity, and as a result, inhibited the ability of cells to invade. In contrast, overexpression of p120ctn isoform 3A led to the inactivation of Cdc42 and the activation of RhoA, and had a smaller influence on invasion. However, we found that isoform 3A had a greater ability than isoform 1A in both inhibiting the cell cycle and reducing tumor cell proliferation. The present study revealed that p120ctn isoforms 1A and 3A differently regulated the adhesive, proliferative, and invasive properties of lung cancer cells through distinct mechanisms

Imaging and biodistribution of Her2/neu expression in non-small cell lung cancer xenografts with 64Cu-labeled trastuzumab PET

International Nuclear Information System (INIS)

Paudyal, P.; Paudyal, B.; Hanaoka, Hirofumi

2010-01-01

Non-small cell lung carcinomas (NSCLC) overexpress the Her2/neu gene in approximately 59% of cases. Trastuzumab, a humanized monoclonal antibody, interferes with Her2 signaling and is approved for the treatment of Her2/neu overexpressing breast cancer. However, its therapeutic use in Her2/neu overexpressing NSCLC remains obscure. The present study aimed to determine the role of 64 Cu-labeled trastuzumab positron emission tomography (PET) for non-invasive imaging of Her2/neu expression in NSCLC. Trastuzumab was conjugated with the bifunctional chelator 1, 4, 7, 10-tetraazacyclododecane-1, 4, 7, 10-tetraacetic acid (DOTA) and radiolabeled with 64 Cu. The molecular specificity of DOTA-trastuzumab was determined in NSCLC cell lines with Her2/neu overexpression (NCI-H2170) and negative expression (NCI-H520). Imaging of Her2/neu expression was performed in NCI-H2170 tumor-bearing mice with 64 Cu-DOTA-trastuzumab PET and 64 Cu-DOTA-immunoglobulin G (IgG). In vitro studies revealed specific binding of DOTA-trastuzumab in the Her2/neu positive NCI-H2170 cells, while no binding was seen in the Her2/neu negative NCI-H520 cell line. Biodistribution and PET studies revealed a significantly high accumulation of 64 Cu-DOTA-trastuzumab in the Her2/neu overexpressing NCI-H2170 tumor at 24 and 48 h post-injection (21.4±1.4% and 23.2±5.1% injection dose/gram (% ID/g), respectively). PET imaging of Her2/neu negative NCI-H520 tumors showed much less uptake of 64 Cu-DOTA-trastuzumab (4.0% ID/g). The NCI-H2170 tumor uptake of 64 Cu-DOTA-trastuzumab was significantly higher than that of 64 Cu-DOTA-IgG (P 64 Cu-DOTA-trastuzumab showed a very clear image of a Her2/neu positive tumor and appeared to be effective as a PET tracer for imaging of Her2/neu gene expression in NSCLC, suggesting its potential clinical use for identifying patients that might benefit from trastuzumab-based therapy. (author)

NCI Holds on to Defelice Cup | Poster

Science.gov (United States)

NCI kept the Defelice Cup trophy this year after beating Leidos Biomedical Research, 15 to 9, at the 10th annual Ronald H. Defelice Golf Tournament held on Columbus Day. Sixteen players on each team battled it out at the yearly contractor vs. government tournament held at Rattlewood Golf Course in Mount Airy, Md. NCI leads the series 6–4. “The score was the highest NCI margin

Dicty_cDB: SSF460 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SS (Link to library) SSF460 (Link to dictyBase) - - - Contig-U03803-1 SSF460Z (Link... to Original site) - - SSF460Z 453 - - - - Show SSF460 Library SS (Link to library) Clone ID SSF460 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSF4-C/SSF460Q.Seq.d/ Representative seq. ID SSF46...0Z (Link to Original site) Representative DNA sequence >SSF460 (SSF460Q) /CSM/SS/SSF4-C/SSF460Q.Seq.d/ XXXXX...s) Value SSM309 (SSM309Q) /CSM/SS/SSM3-A/SSM309Q.Seq.d/ 424 e-118 SSH196 (SSH196Q) /CSM/SS/SSH1-D/SSH196Q.Seq.d/ 424 e-118 SSF4

License Agreements | NCI Technology Transfer Center | TTC

Science.gov (United States)

NCI Technology Transfer Center (TTC) licenses the discoveries of NCI and nine other NIH Institutes so new technologies can be developed and commercialized, to convert them into public health benefits.

NCI & Division Obligations

Science.gov (United States)

Displays obligations for grants, contracts, training fellowships, intramural research, and management and support, including the number of grant awards, funding amounts, and percent of the total NCI budget.

The catabolism of radioiodinated anti-lung-cancer monoclonal antibodies in tumor-bearing nude mice

International Nuclear Information System (INIS)

Shi Xubao

1991-01-01

Nude mice bearing humor lung cancer xenografts were injected intravenously or intraperitoneally with a mixture of radioiodinated anti-lung-cancer monoclonal antibodies, 2E3 and 6D1. The blood radioactivity versus time curve was fitted to a two-compartment open model with a 3.4 day blood radioactivity clearance half-life and a 636 ml/kg apparent distribution volume. Radioiodinated 2E3 and 6D1 given intraperitoneally were rapidly absorbed, with a 2.08 absorption half-life and 89% bioavailability. The highest radioactivity levels were found in the tumor, blood, liver and spleen 1-3 days after injection; next came the lung, kidney, stomach and intestine. The relative radioactivity increased in the tumor as levels in blood and normal tissues decreased. The in vivo deiodination of radioiodinated 2E3 and 6D1 was about 18.6% and free radioiodine was excreted in the urine

42 CFR 460.76 - Transportation services.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Transportation services. 460.76 Section 460.76... ELDERLY (PACE) PACE Administrative Requirements § 460.76 Transportation services. (a) Safety, accessibility, and equipment. A PACE organization's transportation services must be safe, accessible, and...

42 CFR 460.208 - Financial statements.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Financial statements. 460.208 Section 460.208... ELDERLY (PACE) Data Collection, Record Maintenance, and Reporting § 460.208 Financial statements. (a... must submit a certified financial statement that includes appropriate footnotes. (2) The financial...

Lung Cancer, Questions to Ask Your Health Professional | NIH MedlinePlus the Magazine

Science.gov (United States)

... of this page please turn Javascript on. Feature: Lung Cancer Questions to Ask Your Health Professional Past Issues / ... answer questions about cancer at 1-800-4-CANCER. The NCI Lung Cancer Home Page provides up-to-date information ...

38 CFR 3.460 - Death pension.

Science.gov (United States)

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Death pension. 3.460 Section 3.460 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Apportionments § 3.460 Death pension. Death pension...

42 CFR 460.72 - Physical environment.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Physical environment. 460.72 Section 460.72 Public...) PACE Administrative Requirements § 460.72 Physical environment. (a) Space and equipment—(1) Safe design..., sanitary, functional, accessible, and comfortable environment for the delivery of services that protects...

42 CFR 460.74 - Infection control.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Infection control. 460.74 Section 460.74 Public...) PACE Administrative Requirements § 460.74 Infection control. (a) Standard procedures. The PACE organization must follow accepted policies and standard procedures with respect to infection control, including...

Colon cancer proliferating desulfosinigrin in wasabi (Wasabia japonica).

Science.gov (United States)

Weil, Marvin J; Zhang, Yanjun; Nair, Muraleedharan G

2004-01-01

A reduced incidence of different types of cancer has been linked to consumption of Brassica vegetables, and there is evidence that glucosinolates (GSLs) and their hydrolysis products play a role in reducing cancer risk. Wasabi (Wasabia japonica) and horseradish (Armoracia rusticana), both Brassica vegetables, are widely used condiments both in Japanese cuisine and in the United States. Desulfosinigrin (DSS) (1) was isolated from a commercially available wasabi powder and from fresh wasabi roots. Sinigrin (2) was isolated from horseradish roots. DSS and sinigrin were evaluated for their inhibitory effects on cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) enzymes, on lipid peroxidation, and on the proliferation of human colon (HCT-116), breast (MCF-7), lung (NCIH460), and central nervous system (CNS, SF-268) cancer cell lines. DSS did not inhibit COX enzymes or lipid peroxidation at 250 microg/ml. Sinigrin inhibited lipid peroxidation by 71% at 250 microg/ml. However, DSS promoted the growth of HCT-116 (colon) and NCI H460 (lung) human cancer cells as determined by the MTT assay in a concentration-dependent manner. At 3.72 microg/ml, a 27% increase in the number of viable human HCT-116 colon cancer cells was observed; the corresponding increases at 7.50 and 15 microg/ml were 42 and 69%, respectively. At 60 microg/ml, DSS doubled the number of HCT-16 colon cancer cells. For NCI H460 human lung cancer cells, DSS at 60 microg/ml increased the cell number by 20%. Sinigrin showed no proliferating effect on the tumor cells tested. This is the first report of the tumor cell-proliferating activity by a desulfoglucosinolate, the biosynthetic precursor of GSLs found in Brassica spp.

42 CFR 460.182 - Medicaid payment.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Medicaid payment. 460.182 Section 460.182 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...) Payment § 460.182 Medicaid payment. (a) Under a PACE program agreement, the State administering agency...

42 CFR 460.152 - Enrollment process.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Enrollment process. 460.152 Section 460.152 Public...) Participant Enrollment and Disenrollment § 460.152 Enrollment process. (a) Intake process. Intake is an intensive process during which PACE staff members make one or more visits to a potential participant's place...

NCI collaborates with Multiple Myeloma Research Foundation

Science.gov (United States)

The National Cancer Institute (NCI) announced a collaboration with the Multiple Myeloma Research Foundation (MMRF) to incorporate MMRF's wealth of genomic and clinical data on the disease into the NCI Genomic Data Commons (GDC), a publicly available datab

42 CFR 460.100 - Emergency care.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Emergency care. 460.100 Section 460.100 Public...) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PACE Services § 460.100 Emergency care. (a) Written plan. A PACE organization must establish and...

42 CFR 460.62 - Governing body.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Governing body. 460.62 Section 460.62 Public Health... Administrative Requirements § 460.62 Governing body. (a) Governing body. A PACE organization must be operating under the control of an identifiable governing body (for example, a board of directors) or a designated...

16 CFR 460.22 - Tax claims.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Tax claims. 460.22 Section 460.22 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.22 Tax claims. Do not say or imply that your product qualifies for a tax benefit unless it is true. ...

Attenuation of the DNA Damage Response by Transforming Growth Factor-Beta Inhibitors Enhances Radiation Sensitivity of Non–Small-Cell Lung Cancer Cells In Vitro and In Vivo

Energy Technology Data Exchange (ETDEWEB)

Du, Shisuo; Bouquet, Sophie; Lo, Chen-Hao; Pellicciotta, Ilenia; Bolourchi, Shiva [Department of Radiation Oncology, New York University School of Medicine, New York, New York (United States); Parry, Renate [Varian Medical Systems, Palo Alto, California (United States); Barcellos-Hoff, Mary Helen, E-mail: mhbarcellos-hoff@nyumc.org [Department of Radiation Oncology, New York University School of Medicine, New York, New York (United States)

2015-01-01

Purpose: To determine whether transforming growth factor (TGF)-β inhibition increases the response to radiation therapy in human and mouse non–small-cell lung carcinoma (NSCLC) cells in vitro and in vivo. Methods and Materials: TGF-β–mediated growth response and pathway activation were examined in human NSCLC NCI-H1299, NCI-H292, and A549 cell lines and murine Lewis lung cancer (LLC) cells. Cells were treated in vitro with LY364947, a small-molecule inhibitor of the TGF-β type 1 receptor kinase, or with the pan-isoform TGF-β neutralizing monoclonal antibody 1D11 before radiation exposure. The DNA damage response was assessed by ataxia telangiectasia mutated (ATM) or Trp53 protein phosphorylation, γH2AX foci formation, or comet assay in irradiated cells. Radiation sensitivity was determined by clonogenic assay. Mice bearing syngeneic subcutaneous LLC tumors were treated with 5 fractions of 6 Gy and/or neutralizing or control antibody. Results: The NCI-H1299, A549, and LLC NSCLC cell lines pretreated with LY364947 before radiation exposure exhibited compromised DNA damage response, indicated by decreased ATM and p53 phosphorylation, reduced γH2AX foci, and increased radiosensitivity. The NCI-H292 cells were unresponsive. Transforming growth factor-β signaling inhibition in irradiated LLC cells resulted in unresolved DNA damage. Subcutaneous LLC tumors in mice treated with TGF-β neutralizing antibody exhibited fewer γH2AX foci after irradiation and significantly greater tumor growth delay in combination with fractionated radiation. Conclusions: Inhibition of TGF-β before radiation attenuated DNA damage recognition and increased radiosensitivity in most NSCLC cells in vitro and promoted radiation-induced tumor control in vivo. These data support the rationale for concurrent TGF-β inhibition and RT to provide therapeutic benefit in NSCLC.

Layer-by-layer nanoparticles co-loading gemcitabine and platinum (IV prodrugs for synergistic combination therapy of lung cancer

Directory of Open Access Journals (Sweden)

Zhang R

2017-09-01

Full Text Available Rongrong Zhang, Yun Ru, Yiping Gao, Jinyin Li, Shilong Mao Department of Pharmacy, Shanghai Xuhui District Central Hospital, Zhongshan Hospital Affiliated to Fudan University Xuhui Hospital, Shanghai, People’s Republic of China Purpose: Cisplatin plus gemcitabine (GEM is a standard regimen for the first-line treatment of advanced non-small cell lung cancer. The aim of this study was to prepare biocompatible and biodegradable polymeric prodrugs and construct nanoparticles (NPs with layer-by-layer (LbL technique. Methods: Platinum (Pt (IV complex with a carboxyl group was conjugated to the amino group of chitosan (CH, resulting in a CH-Pt conjugation with positive charge. GEM with amino group was conjugated to the carboxyl group of hyaluronic acid (HA, resulting in a HA-GEM conjugation with negative charge. Novel LbL NPs consisting of the CH-Pt core and the HA-GEM layer, named as HA-GEM/CH-Pt NPs, were constructed. The physicochemical properties of the HA-GEM/CH-Pt NPs were investigated. In vitro cytotoxicity against human non-small lung cancer cells (NCl-H460 cells was investigated, and in vivo antitumor efficiency was evaluated on mice bearing NCl-H460 cells xenografts. Results: HA-GEM/CH-Pt NPs have a size of about 187 nm, a zeta potential value of -21 mV and high drug encapsulation efficiency of 90%. The drug release of HA-GEM/CH-Pt NPs exhibited a sustained behavior. HA-GEM/CH-Pt NPs could significantly enhance in vitro cytotoxicity and in vivo antitumor effect against lung cancer animal model compared to the single-drug-loaded NPs and free drug solutions. Conclusion: The results demonstrated that the HA-GEM/CH-Pt NPs might be a promising system for the synergetic treatment of lung carcinoma. Keywords: lung cancer, combination chemotherapy, cisplatin, gemcitabine, layer-by-layer technology

14 CFR 460.53 - Security.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Security. 460.53 Section 460.53 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF....53 Security. An operator must implement security requirements to prevent any space flight participant...

Antiproliferative Activity of Flavonoids from Croton sphaerogynus Baill. (Euphorbiaceae

Directory of Open Access Journals (Sweden)

Kátia Pereira dos Santos

2015-01-01

Full Text Available Croton sphaerogynus is a shrub from the Atlantic Rain Forest in southeastern Brazil. A lyophilized crude EtOH extract from leaves of C. sphaerogynus, obtained by maceration at room temperature (seven days, was suspended in methanol and partitioned with hexane. The purified MeOH phase was fractionated over Sephadex LH-20 yielding five fractions (F1–F5 containing flavonoids, as characterized by HPLC-DAD and HPLC-MS analyses. The antiproliferative activity of the crude EtOH extract, MeOH and hexane phases, and fractions F1–F5 was evaluated on in vitro cell lines NCI-H460 (nonsmall cell lung, MCF-7 (breast cancer, and U251 (glioma. The MeOH phase showed activity (mean log GI50 0.54 higher than the hexane phase and EtOH extract (mean log GI50 1.13 and 1.19, resp.. F1 exhibited activity against NCI-H460 (nonsmall cell lung (GI50 1.2 μg/mL, which could be accounted for the presence of flavonoids and/or diterpenes. F4 showed moderate activity (mean log GI50 1.05, while F5 showed weak activity (mean log GI50 1.36. It is suggested that the antiproliferative activity of the crude EtOH extract and MeOH phase is accounted for a synergistic combination of flavonoids and diterpenes.

Conceptual design report, plutonium stabilization and handling,project W-460

Energy Technology Data Exchange (ETDEWEB)

Weiss, E.V.

1997-03-06

Project W-460, Plutonium Stabilization and Handling, encompasses procurement and installation of a Stabilization and Packaging System (SPS) to oxidize and package for long term storage remaining plutonium-bearing special nuclear materials currently in inventory at the Plutonium Finishing Plant (PFP), and modification of vault equipment to allow storage of resulting packages of stabilized SNM for up to fifty years. This Conceptual Design Report (CDR) provides conceptual design details for the vault modification, site preparation and site interface with the purchased SPS. Two concepts are described for vault configuration; acceleration of this phase of the project did not allow completion of analysis which would clearly identify a preferred approach.

CRADA Payment Options | NCI Technology Transfer Center | TTC

Science.gov (United States)

NCI TTC CRADA PAYMENT OPTIONS: Electronic Payments by Wire Transfer via Fedwire, Mail a check to the Institute or Center, or Automated Clearing House (ACH)/Electronic Funds Transfer (ETF) payments via Pay.gov (NCI ONLY).

Dicty_cDB: AFA460 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available AF (Link to library) AFA460 (Link to dictyBase) - - - Contig-U15574-1 AFA460Z (Link... to Original site) - - AFA460Z 170 - - - - Show AFA460 Library AF (Link to library) Clone ID AFA460 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15574-1 Original site URL http://dict...date 2001. 6. 2 Translated Amino Acid sequence ---QIHQTIQVVKITLSSASSSSSSSSSSILNKTRICTYINSNSTHSLXXNIYKYKLPK T...it* Frame B: ---QIHQTIQVVKITLSSASSSSSSSSSSILNKTRICTYINSNSTHSLXXNIYKYKLPK Frame C:

Anticancer effects of saponin and saponin–phospholipid complex of Panax notoginseng grown in Vietnam

OpenAIRE

Thu Dang Kim; Hai Nguyen Thanh; Duong Nguyen Thuy; Loi Vu Duc; Thu Vu Thi; Hung Vu Manh; Patcharee Boonsiri; Tung Bui Thanh

2016-01-01

Objective: To evaluate the antitumor activity both in vitro and in vivo of saponin–phospholipid complex of Panax notoginseng. Methods: The in vitro cytotoxic effect of saponins extract and saponin–phospholipid complex against human lung cancer NCI-H460 and breast cancer cell lines BT474 was examined using MTS assay. For in vivo evaluation of antitumor potential, saponin and saponin–phospholipid complex were administered orally in rats induced mammary carcinogenesis by 7,12-dimethylbenz(a)a...

NCI Visuals Online

Science.gov (United States)

NCI Visuals Online contains images from the collections of the National Cancer Institute's Office of Communications and Public Liaison, including general biomedical and science-related images, cancer-specific scientific and patient care-related images, and portraits of directors and staff of the National Cancer Institute.

42 CFR 460.46 - Civil money penalties.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Civil money penalties. 460.46 Section 460.46 Public...) Sanctions, Enforcement Actions, and Termination § 460.46 Civil money penalties. (a) CMS may impose civil money penalties up to the following maximum amounts: (1) For each violation regarding enrollment or...

42 CFR 460.60 - PACE organizational structure.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false PACE organizational structure. 460.60 Section 460... ELDERLY (PACE) PACE Administrative Requirements § 460.60 PACE organizational structure. (a) A PACE organization must be, or be a distinct part of, one of the following: (1) An entity of city, county, State, or...

46 CFR 153.460 - Fire protection systems.

Science.gov (United States)

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Fire protection systems. 153.460 Section 153.460... Requirements for Flammable Or Combustible Cargoes § 153.460 Fire protection systems. Each self-propelled ship... protection system listed beside the cargo in Table 1 and described in the footnotes to Table 1. (b) The...

β-Sitosterol targets Trx/Trx1 reductase to induce apoptosis in A549 cells via ROS mediated mitochondrial dysregulation and p53 activation.

Science.gov (United States)

Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi

2018-02-01

β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.

42 CFR 460.106 - Plan of care.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Plan of care. 460.106 Section 460.106 Public Health... ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PACE Services § 460.106 Plan of care. (a) Basic requirement. The interdisciplinary team must promptly develop a...

16 CFR 460.8 - R-value tolerances.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false R-value tolerances. 460.8 Section 460.8... INSULATION § 460.8 R-value tolerances. If you are a manufacturer of home insulation, no individual specimen of the insulation you sell can have an R-value more than 10% below the R-value shown in a label, fact...

16 CFR 460.12 - Labels.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Labels. 460.12 Section 460.12 Commercial....12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must... chart. Labels for these products must state the minimum net weight of the insulation in the package. You...

International Fellows of NCI at Frederick | Poster

Science.gov (United States)

Each year, the Employee Diversity Team (EDT) acknowledges members of the NCI at Frederick Community for their achievements and contributions towards the mission of facility.  Historically, the team has profiled the “Women of NCI at Frederick,” but this year, the team decided to instead shed light on the diverse and successful individuals who make up the international fellows community.

NCI at Frederick Ebola Response Team | Poster

Science.gov (United States)

Editor’s note: This article was adapted from the Employee Diversity Team’s display case exhibit “Recognizing the NCI at Frederick Ebola Response Team,” in the lobby of Building 549. The Poster staff recognizes that this article does not include everyone who was involved in the response to the Ebola crisis, both at NCI at Frederick and in Africa. When the Ebola crisis broke out

IJUE. Tema 3. Les competències de la Unió Europea

OpenAIRE

Torres Pérez, María

2018-01-01

PowerPoint del Tema 3 de la asignatura "Institucions Jurídiques de la Unió Europea". Curso académico 2017-2018. Tema 3. Les competències de la Unió Europea. 1. L’atribució de competències a la Unió Europea. 2. La delimitació de les competències a la Unió Europea. 3. Els principis que regeixen l’exercici de les competències. 4. L’exercici de les competències de la Unió per “alguns Estats membres”.

Multi-Modal Imaging in a Mouse Model of Orthotopic Lung Cancer.

Science.gov (United States)

Patel, Priya; Kato, Tatsuya; Ujiie, Hideki; Wada, Hironobu; Lee, Daiyoon; Hu, Hsin-Pei; Hirohashi, Kentaro; Ahn, Jin Young; Zheng, Jinzi; Yasufuku, Kazuhiro

2016-01-01

Investigation of CF800, a novel PEGylated nano-liposomal imaging agent containing indocyanine green (ICG) and iohexol, for real-time near infrared (NIR) fluorescence and computed tomography (CT) image-guided surgery in an orthotopic lung cancer model in nude mice. CF800 was intravenously administered into 13 mice bearing the H460 orthotopic human lung cancer. At 48 h post-injection (peak imaging agent accumulation time point), ex vivo NIR and CT imaging was performed. A clinical NIR imaging system (SPY®, Novadaq) was used to measure fluorescence intensity of tumor and lung. Tumor-to-background-ratios (TBR) were calculated in inflated and deflated states. The mean Hounsfield unit (HU) of lung tumor was quantified using the CT data set and a semi-automated threshold-based method. Histological evaluation using H&E, the macrophage marker F4/80 and the endothelial cell marker CD31, was performed, and compared to the liposomal fluorescence signal obtained from adjacent tissue sections. The fluorescence TBR measured when the lung is in the inflated state (2.0 ± 0.58) was significantly greater than in the deflated state (1.42 ± 0.380 (n = 7, p<0.003). Mean fluorescent signal in tumor was highly variable across samples, (49.0 ± 18.8 AU). CT image analysis revealed greater contrast enhancement in lung tumors (a mean increase of 110 ± 57 HU) when CF800 is administered compared to the no contrast enhanced tumors (p = 0.0002). Preliminary data suggests that the high fluorescence TBR and CT tumor contrast enhancement provided by CF800 may have clinical utility in localization of lung cancer during CT and NIR image-guided surgery.

Exploring the role of CHI3L1 in pre-metastatic lungs of mammary tumor-bearing mice

Directory of Open Access Journals (Sweden)

Stephania eLibreros

2013-12-01

Full Text Available Elevated levels of chitinase-3-like-1 (CHI3L1 are associated with poor prognosis, shorter recurrence-free intervals and low survival in breast cancer patients. Breast cancer often metastasizes to the lung. We hypothesized that molecules expressed in the pre-metastatic lung microenvironment could support the newly immigrant tumor cells by providing growth and angiogenic factors. Macrophages are known to play an important role in tumor growth by releasing pro-angiogenic molecules. Using mouse mammary tumor models, we have previously shown that during neoplastic progression both the mammary tumor cells and splenic macrophages from tumor-bearing mice express higher levels of CHI3L1 compared to normal control mice. However, the role of CHI3L1 in inducing angiogenesis by macrophages at the pulmonary microenvironment to support newly arriving breast cancer cells is not yet known. In this study, we determined the expression of CHI3L1 in bronchoalveolar lavage macrophages and interstitial macrophages in regulating angiogenesis that could support the growth of newly immigrant mammary tumor cells into the lung. Here we show that in vitro treatment of pulmonary macrophages with recombinant murine CHI3L1 resulted in enhanced expression of pro-angiogenic molecules including CCL2, CXCL2 and MMP-9. We and others have previously shown that inhibition of CHI3L1 decreases the production of angiogenic molecules. In this study, we explored if in vivo administration of chitin microparticles has an effect on the expression of CHI3L1 and pro-angiogenic molecules in the lungs of mammary tumor-bearing mice. We show that treatment with chitin microparticles decreases the expression of CHI3L1 and pro-angiogenic molecules in the metastatic lung. These studies suggest that targeting CHI3L1 may serve as a potential therapeutic agent to inhibit angiogenesis and thus possibly tumor growth and metastasis.

76 FR 41805 - Submission for OMB Review; Comment Request; Prostate, Lung, Colorectal and Ovarian Cancer...

Science.gov (United States)

2011-07-15

... mortality for each of the four cancer sites (prostate, lung, colorectal, and ovary). In addition, cancer...; Comment Request; Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial (PLCO) (NCI) SUMMARY: Under the provisions of Section 3507(a)(1)(D) of the Paperwork Reduction Act of 1995, the National Cancer...

An NCI perspective on creating sustainable biospecimen resources.

Science.gov (United States)

Vaught, Jimmie; Rogers, Joyce; Myers, Kimberly; Lim, Mark David; Lockhart, Nicole; Moore, Helen; Sawyer, Sherilyn; Furman, Jeffrey L; Compton, Carolyn

2011-01-01

High-quality biospecimens with appropriate clinical annotation are critical in the era of personalized medicine. It is now widely recognized that biospecimen resources need to be developed and operated under established scientific, technical, business, and ethical/legal standards. To date, such standards have not been widely practiced, resulting in variable biospecimen quality that may compromise research efforts. The National Cancer Institute (NCI) Office of Biorepositories and Biospecimen Research (OBBR) was established in 2005 to coordinate NCI's biospecimen resource activities and address those issues that affect access to the high-quality specimens and data necessary for its research enterprises as well as the broader translational research field. OBBR and the NCI Biorepository Coordinating Committee developed NCI's "Best Practices for Biospecimen Resources" after consultation with a broad array of experts. A Biospecimen Research Network was established to fund research to develop additional evidence-based practices. Although these initiatives will improve the overall availability of high-quality specimens and data for cancer research, OBBR has been authorized to implement a national biobanking effort, cancer HUman Biobank (caHUB). caHUB will address systematically the gaps in knowledge needed to improve the state-of-the-science and strengthen the standards for human biobanking. This commentary outlines the progressive efforts by NCI in technical, governance, and economic considerations that will be important as the new caHUB enterprise is undertaken.

13 CFR 130.460 - Budget justification.

Science.gov (United States)

2010-01-01

... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Budget justification. 130.460 Section 130.460 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION SMALL BUSINESS DEVELOPMENT...) Cost principles. Principles for determining allowable costs are contained in OMB Circulars A-21 (cost...

Validity of clinical outcome measures to evaluate ankle range of motion during the weight-bearing lunge test.

Science.gov (United States)

Hall, Emily A; Docherty, Carrie L

2017-07-01

To determine the concurrent validity of standard clinical outcome measures compared to laboratory outcome measure while performing the weight-bearing lunge test (WBLT). Cross-sectional study. Fifty participants performed the WBLT to determine dorsiflexion ROM using four different measurement techniques: dorsiflexion angle with digital inclinometer at 15cm distal to the tibial tuberosity (°), dorsiflexion angle with inclinometer at tibial tuberosity (°), maximum lunge distance (cm), and dorsiflexion angle using a 2D motion capture system (°). Outcome measures were recorded concurrently during each trial. To establish concurrent validity, Pearson product-moment correlation coefficients (r) were conducted, comparing each dependent variable to the 2D motion capture analysis (identified as the reference standard). A higher correlation indicates strong concurrent validity. There was a high correlation between each measurement technique and the reference standard. Specifically the correlation between the inclinometer placement at 15cm below the tibial tuberosity (44.9°±5.5°) and the motion capture angle (27.0°±6.0°) was r=0.76 (p=0.001), between the inclinometer placement at the tibial tuberosity angle (39.0°±4.6°) and the motion capture angle was r=0.71 (p=0.001), and between the distance from the wall clinical measure (10.3±3.0cm) to the motion capture angle was r=0.74 (p=0.001). This study determined that the clinical measures used during the WBLT have a high correlation with the reference standard for assessing dorsiflexion range of motion. Therefore, obtaining maximum lunge distance and inclinometer angles are both valid assessments during the weight-bearing lunge test. Copyright © 2016 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

42 CFR 460.98 - Service delivery.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Service delivery. 460.98 Section 460.98 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED..., national origin, religion, sex, age, sexual orientation, mental or physical disability, or source of...

42 CFR 460.18 - CMS evaluation of applications.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false CMS evaluation of applications. 460.18 Section 460... ELDERLY (PACE) PACE Organization Application and Waiver Process § 460.18 CMS evaluation of applications. CMS evaluates an application for approval as a PACE organization on the basis of the following...

Bystander effects of exposure to low-dose-rate 125I seeds on human lung cancers cells in vitro

International Nuclear Information System (INIS)

Jia Rongfei; Chen Honghong; Yu Lei; Zhao Meijia; Shao Chunlin; Cheng Wenying

2007-01-01

The bystander effects induced by continuous low-dose-rate (LDR) 125 I seeds radiation on damage of human lung cancer cells were investigated. Human adenocarcinoma cell line A549 and human small cell lung cancer cell line NCI-H446, which have different sensitivities to high-dose rate (HDR) external irradiation, were exposed directly to 125 I seeds in vitro and co-cultured with unirradiated cells for 24 h. Using cytokinesis-blocking micronucleus method and γ H2AX fluorescence immunoassay, bystander effects induced by 2Gy and 4Gy 125 I seed irradiation on micronucleus formation and DNA double-strand breaks (DSBs) of human lung cancer cells were detected and evaluated. The results showed that irradiation with 125 I seeds can induce medium-mediated bystander effects in A549 cells and NCI-H446 cells, exhibiting that both micronuclei formation and γ H2AX focus formation in bystander cells were increased significantly compared with non-irradiated cells. The extent of DNA damage induced by bystander effects was correlated with accumulated radiation dose and radiosensitive of tumor cells. NCI-H446 cells that were sensitive to HDR γ irradiation were more sensitive to continuous LDR irradiation and bystander effects than A549. However, a comparison between the bystander effects and direct effects elicits the intensity of bystander responses of A549 cells was higher than that of NCI-H446 cells. A dose-related reduction in bystander responses was observed both in A549 cells and NCI-H446 cells, suggesting that the signaling factors involved in the bystander signaling pathways may decrease with the increase of cell damages. (authors)

Gigantol Inhibits Epithelial to Mesenchymal Process in Human Lung Cancer Cells

Directory of Open Access Journals (Sweden)

Thitita Unahabhokha

2016-01-01

Full Text Available Lung cancer remains a leading public health problem as evidenced by its increasing death rate. The main cause of death in lung cancer patients is cancer metastasis. The metastatic behavior of lung cancer cells becomes enhanced when cancer cells undergo epithelial to mesenchymal transition (EMT. Gigantol, a bibenzyl compound extracted from the Thai orchid, Dendrobium draconis, has been shown to have promising therapeutic potential against cancer cells, which leads to the hypothesis that gigantol may be able to inhibit the fundamental EMT process in cancer cells. This study has demonstrated for the first time that gigantol possesses the ability to suppress EMT in non-small cell lung cancer H460 cells. Western blot analysis has revealed that gigantol attenuates the activity of ATP-dependent tyrosine kinase (AKT, thereby inhibiting the expression of the major EMT transcription factor, Slug, by both decreasing its transcription and increasing its degradation. The inhibitory effects of gigantol on EMT result in a decrease in the level of migration in H460 lung cancer cells. The results of this study emphasize the potential of gigantol for further development against lung cancer metastasis.

42 CFR 460.20 - Notice of CMS determination.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Notice of CMS determination. 460.20 Section 460.20... ELDERLY (PACE) PACE Organization Application and Waiver Process § 460.20 Notice of CMS determination. (a... application to CMS, CMS takes one of the following actions: (1) Approves the application. (2) Denies the...

The primary study of the radiosensitive effect on the H460 cell line by human lactotransferrin high expression in vitro

International Nuclear Information System (INIS)

Wang Yong; Wang Yan; Du Liqing; Yang Qingshan; Wang Yueying; Fan Feiyue

2009-01-01

Objective: To investigate the possible radiosensitive effect of human Lactotransferrin (hLF) high expression in lung cancer cell, we hereby constructed and transfected a recombinant vector pBC1 containing exogenous hLF gene. Methods: Firstly the recombinant plasmid pBC1-hLF was transferred into H460 and the hLF expression was evaluated by western blotting. Then we test the cell viability, apoptosis and clone formation after radiation along with the standard hLF treatment control. Results: The results showed that the hLF gene had been successfully transfect into H460 cells and hLF high expression can reduce the clone formation after radiation (P<0.01), and inhibit the cell proliferation with induced apoptosis (P<0.01). And the sensitization ratio of hLF treated and pBC1-hLF transfected were 1.29, 1.59. Conclusion: Our primary data shows that hLF high expression can radio sensitize the H460 cell in vitro. (authors)

21 CFR 522.460 - Cloprostenol sodium.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Cloprostenol sodium. 522.460 Section 522.460 Food... Cloprostenol sodium. (a)(1) Specifications. Each milliliter of the aqueous solution contains 263 micrograms of cloprostenol sodium (equivalent to 250 micrograms of cloprostenol) in a sodium citrate, anhydrous citric acid...

TRX is up-regulated by fibroblast growth factor-2 in lung carcinoma.

Science.gov (United States)

Deng, Zheng-Hao; Cao, Hui-Qiu; Hu, Yong-Bin; Wen, Ji-Fang; Zhou, Jian-Hua

2011-01-01

We have previously shown that exogenous fibroblast growth factor-2 (FGF-2) inhibits apoptosis of the small-cell lung cancer (SCLC) cell line NCI-H446, but the underlying mechanism remains unknown. In this study, the protein profiles of FGF-2-treated and untreated NCI-H446 cells were determined by 2-D gel electrophoresis combined with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and bioinformatics. Differential expression analysis of the protein profiles after FGF-2 treatment identified a total of 24 protein spots, of which nine were up-regulated and 15 were down-regulated. Four proteins were identified by MALDI-TOF-MS: thioredoxin (TRX), visfatin, ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) and Cu/Zn superoxide dismutase (CuZn-SOD). Western blotting revealed that TRX was up-regulated in NCI-H446 and A549 cells treated with FGF-2. Furthermore, immunohistochemical staining confirmed that both FGF-2 and TRX were overexpressed in lung cancer tissues and could be correlated with both lymph node metastasis and clinical stage. These data indicate that TRX may be involved in the FGF-2 signaling pathway. © 2010 The Authors. APMIS © 2010 APMIS.

16 CFR 460.11 - Rounding off R-values.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Rounding off R-values. 460.11 Section 460.11... INSULATION § 460.11 Rounding off R-values. R-values shown in labels, fact sheets, ads, or other promotional materials must be rounded to the nearest tenth. However, R-values of 10 or more may be rounded to the...

DNA fingerprinting of the NCI-60 cell line panel.

Science.gov (United States)

Lorenzi, Philip L; Reinhold, William C; Varma, Sudhir; Hutchinson, Amy A; Pommier, Yves; Chanock, Stephen J; Weinstein, John N

2009-04-01

The National Cancer Institute's NCI-60 cell line panel, the most extensively characterized set of cells in existence and a public resource, is frequently used as a screening tool for drug discovery. Because many laboratories around the world rely on data from the NCI-60 cells, confirmation of their genetic identities represents an essential step in validating results from them. Given the consequences of cell line contamination or misidentification, quality control measures should routinely include DNA fingerprinting. We have, therefore, used standard DNA microsatellite short tandem repeats to profile the NCI-60, and the resulting DNA fingerprints are provided here as a reference. Consistent with previous reports, the fingerprints suggest that several NCI-60 lines have common origins: the melanoma lines MDA-MB-435, MDA-N, and M14; the central nervous system lines U251 and SNB-19; the ovarian lines OVCAR-8 and OVCAR-8/ADR (also called NCI/ADR); and the prostate lines DU-145, DU-145 (ATCC), and RC0.1. Those lines also show that the ability to connect two fingerprints to the same origin is not affected by stable transfection or by the development of multidrug resistance. As expected, DNA fingerprints were not able to distinguish different tissues-of-origin. The fingerprints serve principally as a barcodes.

Expression and Activity of Breast Cancer Resistance Protein (BCRP/ABCG2) in Human Distal Lung Epithelial Cells In Vitro.

Science.gov (United States)

Nickel, Sabrina; Selo, Mohammed Ali; Fallack, Juliane; Clerkin, Caoimhe G; Huwer, Hanno; Schneider-Daum, Nicole; Lehr, Claus-Michael; Ehrhardt, Carsten

2017-12-01

Breast cancer resistance protein (BCRP/ABCG2) has previously been identified with high expression levels in human lung. The subcellular localisation and functional activity of the transporter in lung epithelia, however, remains poorly investigated. The aim of this project was to study BCRP expression and activity in freshly isolated human alveolar epithelial type 2 (AT2) and type 1-like (AT1-like) cells in primary culture, and to compare these findings with data obtained from the NCI-H441 cell line. BCRP expression levels in AT2 and AT1-like cells and in different passages of NCI-H441 cells were determined using q-PCR and immunoblot. Transporter localisation was confirmed by confocal laser scanning microscopy. Efflux and transport studies using the BCRP substrate BODIPY FL prazosin and the inhibitor Ko143 were carried out to assess BCRP activity in the different cell models. BCRP expression decreased during transdifferentiation from AT2 to AT1-like phenotype. Culturing NCI-H441 cells at an air-liquid interface or submersed did not change BCRP abundance, however, BCRP levels increased with passage number. BCRP was localised to the apical membrane and cytosol in NCI-H441 cells. In primary cells, the protein was found predominantly in the nucleus. Functional studies were consistent with expression data. BCRP is differently expressed in AT2 and AT1-like cells with lower abundance and activity in the latter ones. Nuclear BCRP might play a transcriptional role in distal lung epithelium. In NCI-H441 cells, BCRP is expressed in apical cell membranes and its activity is consistent with the localisation pattern.

NCI Pediatric Preclinical Testing Consortium

Science.gov (United States)

NCI has awarded grants to five research teams to participate in its Pediatric Preclinical Testing Consortium, which is intended to help to prioritize which agents to pursue in pediatric clinical trials.

The solubility of thorium and uranium from respirable monazite bearing dust in simulated lung and gut fluids

International Nuclear Information System (INIS)

Twining, J.; McGlinn, P.; Hart, K.

1993-01-01

The accurate assessment of the radiological dose to workers in the mineral sands industry requires information on the human bio-availability of thorium and uranium from monazite bearing respirable dust. The results of a short-term test to determine some of the solubility characteristics of these radionuclides are presented, together with a discussion on the optimum methods which may be applied to longer term studies. The solubility of thorium and uranium were found to be generally less than that of the parent monazite bearing dust in simulated lung and gut fluids over the one month extraction period. In particular, thorium was up to two orders of magnitude less soluble than its host mineral matrix. Assuming that the conservative nature of these radioactive constituents can be extrapolated to longer term exposures, these results imply that radiological dose estimates to the lung should be increased. Solubility of both elements was proportional to particle size. An exponential increase in solubility with decreasing diameter was observed, which implies a time variable solubility. There was also some indication of preferential solubility of radium progeny in both decay series. These factors may have to be accounted for in model estimates of committed dose. 16 refs., 4 tabs., 2 figs

Low-Dose Radiation Induces Cell Proliferation in Human Embryonic Lung Fibroblasts but not in Lung Cancer Cells

Directory of Open Access Journals (Sweden)

Xinyue Liang

2016-01-01

Full Text Available Hormesis and adaptive responses are 2 important biological effects of low-dose ionizing radiation (LDR. In normal tissue, LDR induces hormesis as evinced by increased cell proliferation; however, whether LDR also increases tumor cell proliferation needs to be investigated. In this study, cell proliferation was assayed by total cell numbers and the Cell Counting Kit 8 assay. Mitogen-activated protein kinases (MAPK/extracellular signal-regulated kinase (ERK and phosphatidylinositol 3′ -kinase(PI3K-Akt (PI3K/AKT phosphorylation were determined by Western blot analysis. Human embryonic lung fibroblast 2BS and lung cancer NCI-H446 cell lines were irradiated with LDR at different doses (20-100 mGy. In response to 20 to 75 mGy X-rays, cell proliferation was significantly increased in 2BS but not in NCI-H446 cells. In 2BS cells, LDR at 20 to 75 mGy also stimulated phosphorylation of MAPK/ERK pathway proteins including ERK, MEK, and Raf and of the PI3K/AKT pathway protein AKT. To test whether ERK1/2 and AKT pathway activation was involved in the stimulation of cell proliferation in 2BS cells, the MAPK/ERK and PI3K/AKT pathways were inhibited using their specific inhibitors, U0126 and LY294002. U0126 decreased the phosphorylation of ERK1/2, and LY294002 decreased the phosphorylation of AKT; each could significantly inhibit LDR-induced 2BS cell proliferation. However, LDR did not stimulate these kinases, and kinase inhibitors also did not affect cell proliferation in the NCI-H446 cells. These results suggest that LDR stimulates cell proliferation via the activation of both MAPK/ERK and PI3K/AKT signaling pathways in 2BS but not in NCI-H446 cells. This finding implies the potential for applying LDR to protect normal tissues from radiotherapy without diminishing the efficacy of tumor therapy.

Study finds stronger nicotine dependency associated with higher risk of lung cancer

Science.gov (United States)

NCI headed study finds people who are highly addicted to nicotine -- those who smoke their first cigarette within five minutes after awakening -- are at higher risk of developing lung cancer than those who wait for an hour or more to smoke.

Small interfering RNA against transcription factor STAT6 leads to increased cholesterol synthesis in lung cancer cell lines.

Directory of Open Access Journals (Sweden)

Richa Dubey

Full Text Available STAT6 transcription factor has become a potential molecule for therapeutic intervention because it regulates broad range of cellular processes in a large variety of cell types. Although some target genes and interacting partners of STAT6 have been identified, its exact mechanism of action needs to be elucidated. In this study, we sought to further characterize the molecular interactions, networks, and functions of STAT6 by profiling the mRNA expression of STAT6 silenced human lung cells (NCI-H460 using microarrays. Our analysis revealed 273 differentially expressed genes after STAT6 silencing. Analysis of the gene expression data with Ingenuity Pathway Analysis (IPA software revealed Gene expression, Cell death, Lipid metabolism as the functions associated with highest rated network. Cholesterol biosynthesis was among the most enriched pathways in IPA as well as in PANTHER analysis. These results have been validated by real-time PCR and cholesterol assay using scrambled siRNA as a negative control. Similar findings were also observed with human type II pulmonary alveolar epithelial cells, A549. In the present study we have, for the first time, shown the inverse relationship of STAT6 with the cholesterol biosynthesis in lung cancer cells. The present findings are potentially significant to advance the understanding and design of therapeutics for the pathological conditions where both STAT6 and cholesterol biosynthesis are implicated viz. asthma, atherosclerosis etc.

NCI's Role in Immunotherapy Research

Science.gov (United States)

... Reporting & Auditing Grant Transfer Grant Closeout Contracts & Small Business Training Cancer Training at NCI (Intramural) Resources for ... promising immunotherapies to the clinic more efficiently and cost effectively. For ... of the checkpoint inhibitor pembrolizumab in patients with ...

Local Control of Lung Derived Tumors by Diffusing Alpha-Emitting Atoms Released From Intratumoral Wires Loaded With Radium-224

International Nuclear Information System (INIS)

Cooks, Tomer; Schmidt, Michael; Bittan, Hadas; Lazarov, Elinor; Arazi, Lior; Kelson, Itzhak; Keisari, Yona

2009-01-01

Purpose: Diffusing alpha-emitters radiation therapy (DART) is a new form of brachytherapy enabling the treatment of solid tumors with alpha radiation. The present study examines the antitumoral effects resulting from the release of alpha emitting radioisotopes into solid lung carcinoma (LL2, A427, and NCI-H520). Methods and Materials: An in vitro setup tested the dose-dependent killing of tumor cells exposed to alpha particles. In in vivo studies, radioactive wires (0.3 mm diameter, 5 mm long) with 224 Ra activities in the range of 21-38 kBq were inserted into LL/2 tumors in C57BL/6 mice and into human-derived A427 or NCI-H520 tumors in athymic mice. The efficacy of the short-lived daughters of 224 Ra to produce tumor growth retardation and prolong life was assessed, and the spread of radioisotopes inside tumors was measured using autoradiography. Results: The insertion of a single DART wire into the center of 6- to 7-mm tumors had a pronounced retardation effect on tumor growth, leading to a significant inhibition of 49% (LL2) and 93% (A427) in tumor development and prolongations of 48% (LL2) in life expectancy. In the human model, more than 80% of the treated tumors disappeared or shrunk. Autoradiographic analysis of the treated sectioned tissue revealed the intratumoral distribution of the radioisotopes, and histological analysis showed corresponding areas of necrosis. In vitro experiments demonstrated a dose-dependent killing of tumors cells exposed to alpha particles. Conclusions: Short-lived diffusing alpha-emitters produced tumor growth retardation and increased survival in mice bearing lung tumor implants. These results justify further investigations with improved dose distributions.

NCI-MATCH Trial Links Targeted Drugs to Mutations

Science.gov (United States)

Investigators for the nationwide trial, NCI-MATCH: Molecular Analysis for Therapy Choice, announced that the trial will seek to determine whether targeted therapies for people whose tumors have specific gene mutations will be effective regardless of their cancer type. NCI-MATCH will incorporate more than 20 different study drugs or drug combinations, each targeting a specific gene mutation, in order to match each patient in the trial with a therapy that targets a molecular abnormality in their tumor.

Caveolin-1 sensitizes cisplatin-induced lung cancer cell apoptosis via superoxide anion-dependent mechanism.

Science.gov (United States)

Pongjit, Kanittha; Chanvorachote, Pithi

2011-12-01

Caveolin-1 (Cav-1) expression frequently found in lung cancer was linked with disease prognosis and progression. This study reveals for the first time that Cav-1 sensitizes cisplatin-induced lung carcinoma cell death by the mechanism involving oxidative stress modulation. We established stable Cav-1 overexpressed (H460/Cav-1) cells and investigated their cisplatin susceptibility in comparison with control-transfected cells and found that Cav-1 expression significantly enhanced cisplatin-mediated cell death. Results indicated that the different response to cisplatin between these cells was resulted from different level of superoxide anion induced by cisplatin. Inhibitory study revealed that superoxide anion inhibitor MnTBAP could inhibit cisplatin-mediated toxicity only in H460/Cav-1 cells while had no effect on H460 cells. Further, superoxide anion detected by DHE probe indicated that H460/Cav-1 cells generated significantly higher superoxide anion level in response to cisplatin than that of control cells. The role of Cav-1 in regulating cisplatin sensitivity was confirmed in shRNA-mediated Cav-1 down-regulated (H460/shCav-1) cells and the cells exhibited decreased cisplatin susceptibility and superoxide generation. In summary, these findings reveal novel aspects regarding role of Cav-1 in modulating oxidative stress induced by cisplatin, possibly providing new insights for cancer biology and cisplatin-based chemotherapy.

Diagnostic imaging of lung cancer with In-111-MDEGD

International Nuclear Information System (INIS)

Nakajima, Susumu; Hayashi, Hideo; Maeda, Tomio

1987-01-01

Indium-111-mono DTPA-ethyleneglycol Ga deuterporphyrin (In-111-MDEGD) is a new tumor imaging agent in lung cancer. The agent has been studied with golden hamsters bearing adenocarcinoma, C57 black mice bearing Lewis lung adenocarcinoma, and nude mice bearing human lung adenocarcinoma xerografts. It has been revealed that the tumor-to-lung, tumor-to-kidney, and tumor-to-blood ratios are higher for In-111-MDEGD than for Ga-67 citrate widely used in imaging tumors, and that the agent is not accumulated in inflammatory lesions. The results were encouraging enough to start clinical diagnostic trials in lung cancer. In this paper, an overview of In-111-MDEGD, along with its preliminary data, is given. (Namekawa, K.)

26 CFR 1.460-0 - Outline of regulations under section 460.

Science.gov (United States)

2010-04-01

... Step One. (i) Hypothetical reallocation of income among prior tax years. (ii) Treatment of estimated... tax liability that generated a subsequent refund. (d) Simplified marginal impact method. (1...) INCOME TAX (CONTINUED) INCOME TAXES Taxable Year for Which Items of Gross Income Included § 1.460-0...

NCI Takes Back the Defelice Cup at Ninth Annual Golf Tournament | Poster

Science.gov (United States)

By Ashley DeVine, Staff Writer After being down by a point in the morning, NCI reclaimed the Defelice Cup trophy from Leidos Biomedical Research, with a final score of 12 ½ to 11 ½, at the ninth annual Ronald H. Defelice Golf Tournament, held Oct. 13. “The tightest matches in the nine-year history of this cup competition resulted in a narrow victory for NCI and allowed NCI to

Find an NCI-Designated Cancer Center

Science.gov (United States)

Find the locations of NCI-designated cancer centers by area, region, state, or name that includes contact information to help health care providers and cancer patients with referrals to clinical trials.

Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells

International Nuclear Information System (INIS)

Sun Yunguang; Zheng Siyuan; Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J.; Carbone, David P.; Zhao Zhongming; Lu Bo

2012-01-01

Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non–small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.

Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells

Energy Technology Data Exchange (ETDEWEB)

Sun Yunguang [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Zheng Siyuan [Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN (United States); Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J. [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Carbone, David P. [Department of Hematology and Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Zhao Zhongming, E-mail: zhongming.zhao@vanderbilt.edu [Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN (United States); Lu Bo, E-mail: bo.lu@vanderbilt.edu [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States)

2012-03-01

Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non-small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.

Synthesis of Novel Heterocyclic Compounds Incorporate 4,5,6,7-Tetrahydrobenzo[b]thiophene Together with Their Cytotoxic Evaluations.

Science.gov (United States)

Abdallah, Amira Elsayed Mahmoud; Mohareb, Rafat Milad; Khalil, Eid Metwally; Elshamy, Menna Alla Mohamed Abd Elaleem

2017-01-01

The 2-amino-3-cyano-4,5,6,7-tetrahydrobenzo[b]thiophene was the key starting compound used to synthesize new thiazole, pyrimidine, pyran, pyridine and thiazine derivatives. The cytotoxicity of the synthesized compounds was studied towards the three cancer cell lines namely MCF-7 (breast adenocarcinoma), NCI-H460 (non-small cell lung cancer) and SF-268 (central nervous system (CNS) cancer) in addition to the normal cell line (WI-38) using doxorubicin as the reference drug. The study showed that compounds 5, 9a, 15b, 17c, 18 and 21b were the most potent compounds.

Usefulness of pulmonary scintigraphy in primary lung cancer patients treated by radiotherapy

International Nuclear Information System (INIS)

Mitomo, Osamu

1994-01-01

To assess the pulmonary function of lung cancer patients treated by radiotherapy, we tried qualitative and semiquantitative analysis of pulmonary scintigrams using 133 Xe and 99m Tc-MAA. Individual scores for ventilation, perfusion and the ventilation-perfusion ratio of tumor-bearing lungs were calculated on the basis of healthy control cases in order to analyze whether, and to what degree, the tumor-bearing lung was functionally impaired. The score was proportional to the severity of impairment, and when the ventilation and perfusion of tumor-bearing lungs had a score of one or greater than one, the tumor-bearing lung was functionally defined as an 'impaired lung'. Impaired lungs were demonstrated in 68% of tumor-bearing lungs. Hilar and left hilar-type cancers, clinically more advanced cancers, patients whose tumors were confirmed by bronchofiberscopy, small-cell and epidermoid cancers, etc., had higher rates of impairment and more severe impairment. Many patients with impaired lungs had a worse prognosis, but patients in whom scintigraphy showed improvement after radiotherapy had a better prognosis. It can be concluded that pulmonary scintigraphy scoring is capable of semiquantitatively indicating the degree of pulmonary impairment and is useful in deciding on a radiotherapeutic plan and predicting the outcome in pre- and post-radiotherapy lung cancer patients. (author)

NCI's Transdisciplinary High Performance Scientific Data Platform

Science.gov (United States)

Evans, Ben; Antony, Joseph; Bastrakova, Irina; Car, Nicholas; Cox, Simon; Druken, Kelsey; Evans, Bradley; Fraser, Ryan; Ip, Alex; Kemp, Carina; King, Edward; Minchin, Stuart; Larraondo, Pablo; Pugh, Tim; Richards, Clare; Santana, Fabiana; Smillie, Jon; Trenham, Claire; Wang, Jingbo; Wyborn, Lesley

2016-04-01

The Australian National Computational Infrastructure (NCI) manages Earth Systems data collections sourced from several domains and organisations onto a single High Performance Data (HPD) Node to further Australia's national priority research and innovation agenda. The NCI HPD Node has rapidly established its value, currently managing over 10 PBytes of datasets from collections that span a wide range of disciplines including climate, weather, environment, geoscience, geophysics, water resources and social sciences. Importantly, in order to facilitate broad user uptake, maximise reuse and enable transdisciplinary access through software and standardised interfaces, the datasets, associated information systems and processes have been incorporated into the design and operation of a unified platform that NCI has called, the National Environmental Research Data Interoperability Platform (NERDIP). The key goal of the NERDIP is to regularise data access so that it is easily discoverable, interoperable for different domains and enabled for high performance methods. It adopts and implements international standards and data conventions, and promotes scientific integrity within a high performance computing and data analysis environment. NCI has established a rich and flexible computing environment to access to this data, through the NCI supercomputer; a private cloud that supports both domain focused virtual laboratories and in-common interactive analysis interfaces; as well as remotely through scalable data services. Data collections of this importance must be managed with careful consideration of both their current use and the needs of the end-communities, as well as its future potential use, such as transitioning to more advanced software and improved methods. It is therefore critical that the data platform is both well-managed and trusted for stable production use (including transparency and reproducibility), agile enough to incorporate new technological advances and

The action of microsecond-pulsed plasma-activated media on the inactivation of human lung cancer cells

International Nuclear Information System (INIS)

Kumar, Naresh; Park, Ji Hoon; Jeon, Su Nam; Park, Bong Sang; Choi, Eun Ha; Attri, Pankaj

2016-01-01

In the present work, we have generated reactive species (RS) through microsecond-pulsed plasma (MPP) in the cell culture media using a Marx generator with point–point electrodes of approximately 0.06 J discharge energy/pulse. RS generated in culture media through MPP have a selective action between growth of the H460 lung cancer cells and L132 normal lung cells. We observed that MPP-activated media (MPP-AM) induced apoptosis on H460 lung cancer cells through an oxidative DNA damage cascade. Additionally, we studied the apoptosis-related mRNA expression, DNA oxidation and polymerase-1 (PARP-1) cleaved analysis from treated cancer cells. The result proves that radicals generated through MPP play a pivotal role in the activation of media that induces the selective killing effect. (paper)

76 FR 28439 - Submission for OMB Review; Comment Request; NCI Cancer Genetics Services Directory Web-Based...

Science.gov (United States)

2011-05-17

...; Comment Request; NCI Cancer Genetics Services Directory Web-Based Application Form and Update Mailer... currently valid OMB control number. Proposed Collection: Title: NCI Cancer Genetics Services Directory Web... included in the NCI Cancer Genetics Services Directory on NCI's Cancer.gov Web site. The information...

Gene Therapy for Human Lung Adenocarcinoma Using a Suicide Gene Driven by a Lung-Specific Promoter Delivered by JC Virus-Like Particles.

Directory of Open Access Journals (Sweden)

Chun-Nun Chao

Full Text Available Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV infection. Therefore, we designed that the JCPyV virus-like particle (VLP packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp or thymidine kinase gene (pSPB-tk under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549 and large cell carcinoma (H460 cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV, a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.

Gene Therapy for Human Lung Adenocarcinoma Using a Suicide Gene Driven by a Lung-Specific Promoter Delivered by JC Virus-Like Particles.

Science.gov (United States)

Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin

2016-01-01

Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.

42 CFR 460.90 - PACE benefits under Medicare and Medicaid.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false PACE benefits under Medicare and Medicaid. 460.90 Section 460.90 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN... FOR THE ELDERLY (PACE) PACE Services § 460.90 PACE benefits under Medicare and Medicaid. If a Medicare...

DISSENYAR EXPERIÈNCIES AMB VALOR TURÍSTIC: PAISATGES URBANS

Directory of Open Access Journals (Sweden)

Francesc Fusté

2015-10-01

Full Text Available Aquest article tracta sobre les possibilitats que la creació d’experiències té en relació al desenvolupament empresarial i regional, gràcies a la tematització del sector turístic i la modificació intencional de l’entorn, tant cultural com natural. El paisatge caracteritza els espais en funció de la seva configuració territorial i també arquitectònica i urbana. Les estructures arquitectòniques, els esdeveniments i les activitats que impliquen la participació activa dels usuaris són la clau de l’èxit del disseny de les experiències amb un valor afegit, on les noves tecnologies ajuden a emfatitzar-ne l’impacte. Sigui com sigui, convertir els llocs en experiències tant pels residents com pels visitants.

Discrepancy of biologic behavior influenced by bone marrow derived cells in lung cancer.

Science.gov (United States)

Zhang, Jie; Niu, Xiao-Min; Liao, Mei-Lin; Liu, Yun; Sha, Hui-Fang; Zhao, Yi; Yu, Yong-Feng; Tan, Qiang; Xiang, Jia-Qing; Fang, Jing; Lv, Dan-Dan; Li, Xue-Bing; Lu, Shun; Chen, Hai-Quan

2010-11-01

Disseminated cancer cells may initially require local nutrients and growth factors to thrive and survive in bone marrow. However, data on the influence of bone marrow derived cells (BMDC, also called bone stromal cells in some publications) on lung cancer cells is largely unexplored. This study explored the mechanism of how bone stromal factors contribute to the bone tropism in lung cancer. The difference among lung cancer cell lines in their abilities to metastasize to bone was found using the SCID animal model. Supernatant of bone marrow aspiration (BM) and condition medium from human bone stromal cells (BSC) were used to study the activity of bone stromal factors. We found bone stromal factors significantly increased the proliferation, invasion, adhesion and expression of angiogenosis-related factors, and inhibited the apoptosis for high bone metastasis H460 lung cancer cells. These biologic effects were not seen in SPC-A1 or A549 cells, which are low bone metastasis lung cancer cells. Adhesion of H460 cells to surface coated with bone stromal cells can activate some signal transduction pathways, and alter the expression of adhesion associated factors, including integrin β 3 and ADAMTS-1, two potential targets related with bone metastasis. We concluded that bone marrow derived cells had a profound effect on biological behavior of lung cancers, therefore favoring the growth of lung cancer cells in bone.

NCI Scientists Awarded National Medal of Technology and Innovation by President Obama | Poster

Science.gov (United States)

Two NCI scientists received the National Medal of Technology and Innovation, the nation’s highest honor for technological achievement. The award was announced by President Obama in October. The honorees, John Schiller, Ph.D., Laboratory of Cellular Oncology (LCO), Center for Cancer Research, NCI, and Douglas Lowy, M.D., also from LCO and NCI deputy director, received their medals at a White House ceremony on Nov. 20.

Expression of G-protein inwardly rectifying potassium channels (GIRKs in lung cancer cell lines

Directory of Open Access Journals (Sweden)

Schuller Hildegard M

2005-08-01

Full Text Available Abstract Background Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. Methods GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU assay. Results GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2 was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4 mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4 mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein

Selected Publications by the NCI Director

Science.gov (United States)

Dr. Norman Sharpless's written work on cancer research appears in many leading scientific journals, as well as a variety of other publications. This page lists some of the articles published by Dr. Sharpless since becoming NCI director.

14 CFR 460.9 - Informing crew of risk.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Informing crew of risk. 460.9 Section 460.9 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... risk. An operator must inform in writing any individual serving as crew that the United States...

Novel electrospun gelatin/oxycellulose nanofibers as a suitable platform for lung disease modeling

Energy Technology Data Exchange (ETDEWEB)

Švachová, Veronika, E-mail: xcsvachova@fch.vutbr.cz [Institute of Materials Chemistry, Brno University of Technology (Czech Republic); Vojtová, Lucy [CEITEC – Central European Institute of Technology, Brno University of Technology (Czech Republic); SCITEG, a.s., Brno (Czech Republic); Pavliňák, David [Department of Physical Electronics, Masaryk University (Czech Republic); Vojtek, Libor [Institute of Experimental Biology, Masaryk University (Czech Republic); Sedláková, Veronika [Department of Histology and Embryology, Masaryk University (Czech Republic); International Clinical Research, St. Anne' s University Hospital, Brno (Czech Republic); Hyršl, Pavel [Institute of Experimental Biology, Masaryk University (Czech Republic); Alberti, Milan [Department of Physical Electronics, Masaryk University (Czech Republic); Jaroš, Josef; Hampl, Aleš [Department of Histology and Embryology, Masaryk University (Czech Republic); International Clinical Research, St. Anne' s University Hospital, Brno (Czech Republic); Jančář, Josef [Institute of Materials Chemistry, Brno University of Technology (Czech Republic); CEITEC – Central European Institute of Technology, Brno University of Technology (Czech Republic); SCITEG, a.s., Brno (Czech Republic)

2016-10-01

Novel hydrolytically stable gelatin nanofibers modified with sodium or calcium salt of oxycellulose were prepared by electrospinning method. The unique inhibitory effect of these nanofibers against Escherichia coli bacteria was examined by luminometric method. Biocompatibility of these gelatin/oxycellulose nanofibers with eukaryotic cells was tested using human lung adenocarcinoma cell line NCI-H441. Cells firmly adhered to nanofiber surface, as determined by scanning electron microscopy, and no signs of cell dying were detected by fluorescent live/dead assay. We propose that the newly developed gelatin/oxycellulose nanofibers could be used as promising scaffold for lung disease modeling and anti-cancer drug testing. - Highlights: • Novel hydrolytically stable gelatin nanofibers modified with oxycellulose were prepared by electrospinning. • ATR–FTIR spectroscopy and EDX confirmed the presence of oxycellulose in the nanofibers. • Nanofibers modified with calcium salt of oxycellulose exhibited significant antibacterial properties. • Nanofibers modified with sodium salt of oxycellulose revealed excellent biocompatibility with cell line NCI-H441.

16 CFR 460.2 - What is home insulation.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false What is home insulation. 460.2 Section 460.2 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME..., semirigid, flexible, or loose-fill form. Home insulation is for use in old or new homes, condominiums...

Achillea millefolium L. hydroethanolic extract inhibits growth of human tumor cell lines by interfering with cell cycle and inducing apoptosis.

Science.gov (United States)

Pereira, Joana M; Peixoto, Vanessa; Teixeira, Alexandra; Sousa, Diana; Barros, Lillian; Ferreira, Isabel C F R; Vasconcelos, M Helena

2018-06-05

The cell growth inhibitory activity of the hydroethanolic extract of Achillea millefolium was studied in human tumor cell lines (NCI-H460 and HCT-15) and its mechanism of action was investigated. The GI 50 concentration was determined with the sulforhodamine B assay and cell cycle and apoptosis were analyzed by flow cytometry following incubation with PI or Annexin V FITC/PI, respectively. The expression levels of proteins involved in cell cycle and apoptosis were analyzed by Western blot. The extracts were characterized regarding their phenolic composition by LC-DAD-ESI/MS. 3,5-O-Dicaffeoylquinic acid, followed by 5-O-caffeoylquinic acid, were the main phenolic acids, while, luteolin-O-acetylhexoside and apigenin-O-acetylhexoside were the main flavonoids. This extract decreased the growth of the tested cell lines, being more potent in HCT-15 and then in NCI-H460 cells. Two different concentrations of the extract (75 and 100 μg/mL) caused alterations in cell cycle profile and increased apoptosis levels in HCT-15 and NCI-H460 cells. Moreover, the extract caused an increase in p53 and p21 expression in NCI-H460 cells (which have wt p53), and reduced XIAP levels in HCT-15 cells (with mutant p53). This work enhances the importance of A. millefolium as source of bioactive phenolic compounds, particularly of XIAP inhibitors. Copyright © 2018 Elsevier Ltd. All rights reserved.

Antitumor activity of erlotinib (OSI-774, Tarceva) alone or in combination in human non-small cell lung cancer tumor xenograft models.

Science.gov (United States)

Higgins, Brian; Kolinsky, Kenneth; Smith, Melissa; Beck, Gordon; Rashed, Mohammad; Adames, Violeta; Linn, Michael; Wheeldon, Eric; Gand, Laurent; Birnboeck, Herbert; Hoffmann, Gerhard

2004-06-01

Our objective was the preclinical assessment of the pharmacokinetics, monotherapy and combined antitumor activity of the epidermal growth factor receptor (HER1/EGFR) tyrosine kinase inhibitor erlotinib in athymic nude mice bearing non-small cell lung cancer (NSCLC) xenograft models. Immunohistochemistry determined the HER1/EGFR status of the NSCLC tumor models. Pharmacokinetic studies assessed plasma drug concentrations of erlotinib in tumor- and non-tumor-bearing athymic nude mice. These were followed by maximum tolerated dose (MTD) studies for erlotinib and each chemotherapy. Erlotinib was then assessed alone and in combination with these chemotherapies in the NSCLC xenograft models. Complete necropsies were performed on most of the animals in each study to further assess antitumor or toxic effects. Erlotinib monotherapy dose-dependently inhibited tumor growth in the H460a tumor model, correlating with circulating levels of drug. There was antitumor activity at the MTD with each agent tested in both the H460a and A549 tumor models (erlotinib 100 mg/kg: 71 and 93% tumor growth inhibition; gemcitabine 120 mg/kg: 93 and 75% tumor growth inhibition; cisplatin 6 mg/kg: 81 and 88% tumor growth inhibition). When each compound was given at a fraction of the MTD, tumor growth inhibition was suboptimal. Combinations of gemcitabine or cisplatin with erlotinib were assessed at 25% of the MTD to determine efficacy. In both NSCLC models, doses of gemcitabine (30 mg/kg) or cisplatin (1.5 mg/kg) with erlotinib (25 mg/kg) at 25% of the MTD were well tolerated. For the slow growing A549 tumor, there was significant tumor growth inhibition in the gemcitabine/erlotinib and cisplatin/erlotinib combinations (above 100 and 98%, respectively), with partial regressions. For the faster growing H460a tumor, there was significant but less remarkable tumor growth inhibition in these same combinations (86 and 53% respectively). These results show that in NSCLC xenograft tumors with similar

Irradiation of the lung with static plutonium microemboli

International Nuclear Information System (INIS)

Holland, L.M.; Prine, J.R.; Smith, D.M.; Anderson, E.C.

1975-01-01

Syrian hamsters are exposed to selected lung burdens of plutonium-239 contained in 10-μm diameter microspheres of ZrO 2 ceramic. After injection into the jugular vein, the microspheres lodge in the lung capillaries and remain immobile throughout the lifetime of the animal. The specific activity of the microspheres is varied from 0.22 to 59 pCi/sphere, and the lung burdens achieved vary from 0.44 to 354 nCi. The distribution in the lung is essentially random except in the groups receiving high numbers of spheres. Since entrapment in the lung approaches 100 percent, there is essentially none of the involvement of other organs seen with inhalation methods. Hamsters are also exposed intratracheally to 210 Po to compare the results from an experiment in which other organs are involved and in which a high tumor yield may be anticipated. Tumor production in the microemboli experiment has been quite low, and the overall damage to the lung has been minimal in comparison to the intratracheal experiments with 210 Po or with published data from aerosol experiments. (auth)

Radioimmunoimaging of nude mice bearing human lung adenocarcinoma xenografts after injecting 131I-McAbs

International Nuclear Information System (INIS)

Liu Liang

1992-01-01

Monoclonal antibodies (Lc86a-C5, Lc86a-H8) directed against human lung adenocarcinoma cell line LTEP-a-2 and normal BALB/c IgG were labelled with iodine-131 by chloramine T. The 131 I-McAbs and 131 I-IgG were respectively injected into the peritoneal cavities of nude mice bearing transplanted human lung adenocarcinoma cell line LTEP-a-2. After 72 h, the tumor tissue in nude mice injected with 131 I-McAbs was distinguishable from normal tissues as a very clear image obtained during gamma scintigraphy. No difference was found between tumor and normal tissues in the nude mice injected with 131 I-IgG. The tumor: blood ration was 3.1:1 in nude injected with 131 I McAb(H8) and 0.9:1 in nude mice injected with 131 I-IgG respectively. This indicates that the tumor tissue image was the result of specific binding of the 131 I-McAbs, which have high specificity and affinity both in vitro and in vivo, to tumor cells, and these monoclonal antibodies may serve as potential agents in tumor diagnosis and treatment

Invention Development Program Helps Nurture NCI at Frederick Technologies | Poster

Science.gov (United States)

The Invention Development Fund (IDF) was piloted by the Technology Transfer Center (TTC) in 2014 to facilitate the commercial development of NCI technologies. The IDF received a second round of funding from the NCI Office of the Director and the Office of Budget and Management to establish the Invention Development Program (IDP) for fiscal year 2016. The IDP is using these funds to help advance a second set of inventions.

The sweet lung: Chewing gummi bear aspiration.

Science.gov (United States)

Tavladaki, Theonimfi; Fitrolaki, Michaela-Diana; Spanaki, Anna-Maria; Ilia, Staurula; Geromarkaki, Elissabet; Briassoulis, George

2012-07-01

Inhalation of foreign bodies, a leading cause of accidental death, is most common in preschool children. In this article we report our experience with a 5-year-old Greek girl who presented with a 24-hour history of sore throat, chest pain, and shortness of breath. Emergency bronchoscopy was performed and multiple small chewing gummi bear (HARIBO) particles impacted in the orifices of the right main bronchus and right lobar and segmentalinic bronchi were successfully removed and aspirated. Aspiration of gummi bears, which is for the first time reported, may cause a silent choking episode leading to life-threatening bronchi obstruction at multiple sites, even in children older than 4 years.

Characterization of the effects of cyclooxygenase-2 inhibition in the regulation of apoptosis in human small and non-small cell lung cancer cell lines.

LENUS (Irish Health Repository)

Alam, Mahmood

2012-02-03

BACKGROUND: Cyclooxygenase-2 enzyme (COX-2) is overexpressed in human non-small cell lung cancer (NSCLC) but is not expressed in small cell lung cancer. Selective COX-2 inhibitors have been shown to induce apoptosis in NSCLC cells, an effect which is associated with the regulation of intracellular MAP kinase (MAPK) signal pathways. Our aims were to characterize the effects of COX-2 inhibition by rofecoxib on apoptosis in human NSCLC and small cell lung cancer cell lines. METHODS: The human NSCLC cell line NCI-H2126 and small cell lung cancer cell line DMS-79 were used. Constitutive COX-2 protein levels were first determined by Western blot test. Levels of apoptosis were evaluated by using propidium iodide staining on FACScan analysis after incubation of NCI-H2126 and DMS-79 with p38 MAPK inhibitor SB202190 (25 ?microM), NF-kappaB inhibitor SN50 (75 microg\\/mL), and rofecoxib at 100 and 250 microM. All statistical analysis was performed by analysis of variance. RESULTS: Western blot test confirmed the presence of COX-2 enzyme in NCI-H2126 and absence in DMS-79. Interestingly, rofecoxib treatment demonstrated a dose-dependent increase in apoptosis in both cell lines. Given this finding, the effect of rofecoxib on NF-kappaB and p38 MAPK pathways was also examined. Apoptosis in both cell lines was unaltered by SN50, either alone or in combination with rofecoxib. A similar phenomenon was observed in NCI-H2126 cells treated with SB202190, either alone or in combination with rofecoxib. In contrast, p38 MAPK inhibition greatly upregulated DMS-79 apoptosis in a manner that was unaltered by the addition of rofecoxib. CONCLUSIONS: Rofecoxib led to a dose-dependent increase in apoptosis in both tumor cell lines. This effect occurred independently of COX-2, NF-kappaB, and p38 MAPK pathways in DMS-79 cells. As such, rofecoxib must act on alternative pathways to regulate apoptosis in human small cell lung cancer cells.

About TTC | NCI Technology Transfer Center | TTC

Science.gov (United States)

The TTC facilitates licensing and co-development partnerships between biomedical industry, academia, and government agencies and the research laboratories of the NCI and nine other institutes and centers of NIH.

Life Outside NCI | Cancer Prevention Fellowship Program

Science.gov (United States)

The CPFP Office is located at the NCI facilities in Rockville, Maryland, near the Nation’s Capital. With the convenient Metro subway reaching throughout the metropolitan area, transportation is within easy reach.

At NCI, Supporting the Best Science

Science.gov (United States)

Yesterday, at the AACR annual meeting, Dr. Doug Lowy spoke directly to the research community about his goals as NCI Acting Director. Dr. Lowy said that he plans to continue many of the programs launched by his predecessor, Dr. Harold Varmus, and to sharp

Effect of Flavopiridol on Radiation-induced Apoptosis of Human Laryngeal and Lung Cancer Cells

International Nuclear Information System (INIS)

Kim, Suzy; Kwon, Eun Kyung; Lee, B. S.; Lee, Seung Hee; Park, B. S.; Wu, Hong Gyun

2007-01-01

Purpose: To investigate the flavopiridol effect on radiation-induced apoptosis and expression of apoptosisrelated genes of human laryngeal and lung cancer cells. Materials and Methods: A human laryngeal cancer cell line, AMC-HN3 and a human lung cancer cell line, NCI-H460, were used in the study. The cells were divided into four groups according to the type of treatment: 1) control groups; 2) cells that were only irradiated; 3) cells treated only with flavopiridol; 4) cells treated with flavopiridol and radiation simultaneously. The cells were irradiated with 10 Gy of X-rays using a 4 MV linear accelerator. Flavopiridol was administered to the media at a concentration of 100 nM for 24 hours. We compared the fraction of apoptotic cells of each group 24 hours after the initiation of treatment. The fraction of apoptotic cells was detected by measurement of the sub-G1 fractions from a flow cytometric analysis. The expression of apoptosis-regulating genes, including cleaved caspase-3, cleaved PARP (poly (ADP-ribose) polymerase), p53, p21, cyclin D1, and phosphorylated Akt (protein kinase B) were analyzed by Western blotting. Results: The sub-G1 fraction of cells was significantly increased in the combination treatment group, as compared to cells exposed to radiation alone or flavopiridol alone. Western blotting also showed an increased expression of cleaved caspase-3 and cleaved PARP expression in cells of the combination treatment group, as compared with cells exposed to radiation alone or flavopiridol alone. Treatment with flavopiridol down regulated cyclin D1 expression of both cell lines but its effect on p53 and p21 expression was different according to each individual cell line. Flavopiridol did not affect the expression of phophorylated Akt in both cell lines. Conclusion: Treatment with flavopiridol increased radiation-induced apoptosis of both the human laryngeal and lung cancer cell lines. Flavopiridol effects on p53 and p21 expression were different according

42 CFR 460.40 - Violations for which CMS may impose sanctions.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Violations for which CMS may impose sanctions. 460... for which CMS may impose sanctions. In addition to other remedies authorized by law, CMS may impose any of the sanctions specified in §§ 460.42 and 460.46 if CMS determines that a PACE organization...

Robert Wiltrout Says Goodbye to NCI in 2015 | Poster

Science.gov (United States)

After 34 years at NCI, Robert Wiltrout, Ph.D., said he is looking forward to trading his I-270 commute for another type of commute: exploring the waterways of Maryland, Alaska, and Wyoming to fulfill his love of fishing. Wiltrout officially retired as director of the NCI Center for Cancer Research (CCR) on July 2 of last year. Throughout his college academic career, Wiltrout had an interest in science, but it was not until he was working on a research project for his master’s degree that he considered a career in scientific research.

NCI and the Precision Medicine Initiative®

Science.gov (United States)

NCI's activities related to precision medicine focuses on new and expanded precision medicine clinical trials; mechanisms to overcome drug resistance to cancer treatments; and developing a shared digital repository of precision medicine trials data.

Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study

OpenAIRE

Feng, Yuan; Zhou, Jihong; Li, Zhanhua; Jiang, Ying; Zhou, Ying

2016-01-01

Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines) and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis act...

16 CFR 460.7 - Which test version to use.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Which test version to use. 460.7 Section 460.7 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF... automatically replace the old one in these rules 90 days after ASTM first publishes the change. However, the...

Human Monoclonal Antibodies Targeting Glypican-2 in Neuroblastoma | NCI Technology Transfer Center | TTC

Science.gov (United States)

Researchers at the National Cancer Institute’s Laboratory of Molecular Biology (NCI LMB) have developed and isolated several single domain monoclonal human antibodies against GPC2. NCI seeks parties interested in licensing or co-developing GPC2 antibodies and/or conjugates.

Dithiolethione modified valproate and diclofenac increase E-cadherin expression and decrease proliferation of non-small cell lung cancer cells

OpenAIRE

Moody, Terry W.; Switzer, Christopher; Santana-Flores, Wilmarie; Ridnour, Lisa A.; Berna, Marc; Thill, Michelle; Jensen, Robert T.; Sparatore, Anna; Del Soldato, Piero; Yeh, Grace C; Roberts, David D.; Giaccone, Giuseppe; Wink, David A.

2009-01-01

The effects of dithiolethione-modified valproate, diclofenac and sulindac on non-small cell lung cancer (NSCLC) cells were investigated. Sulfur(S)-valproate and S-diclofenac at 1 μg/ml concentrations significantly reduced prostaglandin (PG)E2 levels in NSCLC cell lines A549 and NCI-H1299 as did the COX-2 inhibitor DuP-697. In vitro, S-valproate, S-diclofenac and S-sulindac half-maximally inhibited the clonal growth of NCI-H1299 cells at 6, 6 and 15 μg/ml, respectively. Using the MTT assay, 10...

Les competències. La doctrina del Tribunal sobre la definició de les competències. Les competències exclusives, les compartides i les executives. - Las competencias. La doctrina del Tribunal sobre la definición de las competencias. Competencias exclusivas, compartidas y ejecutivas.

Directory of Open Access Journals (Sweden)

Ramon Riu

2010-07-01

Full Text Available La doctrina de la Sentència 31/2010 sobre la definició estatutària de les categories competencials (251-257 Mercè Barceló i SerramaleraLa doctrina del Tribunal Constitucional sobre la definició de competències. Les competències exclusives, les compartides i les executives (258-261Antoni Bayona RocamoraLa doctrina de la Sentència 31/2010 sobre les competències executives (Xavier Bernadí GilLa doctrina del Tribunal sobre la definició de les competències. Les ompetències exclusives, les compartides i les executives (270-276Marc Carrillo LópezEls efectes de la Sentència sobre la definició estatutària de les competències: la «devaluació» jurídica dels estatuts d’autonomia (277-281Mercè Corretja TorrensLes categories funcionals de competències a l’Estatut d’autonomia de Catalunya. Comentaris a la Sentència 31/2010 (282-287Ramon Riu FortunyTipologia de les competències. El seu abast funcional: els articles 110 a 112 (288-294Joaquín Tornos Massostenella e no enmendalla (262-269 La doctrina de la Sentencia 31/2010 sobre la definición estatutaria de las categorías competenciales (251-257Mercè Barceló i SerramaleraLa doctrina del Tribunal Constitucional sobre la definición de competencias. Las competencias exclusivas, las compartidas y las ejecutivas (258-261Antoni Bayona RocamoraLa doctrina de la Sentencia 31/2010 sobre las competencias ejecutivas (sostenella e no enmendalla (262-270 Xavier Bernadí GilLa doctrina del Tribunal sobre la definición de las competencias. Las competencias exclusivas, las compartidas y las ejecutivas (271-277Marc Carrillo LópezLos efectos de la Sentencia sobre la definición estatutaria de las competencias:la «devaluación» jurídica de los estatutos de autonomía (278-283Mercè Corretja TorrensLas categorías funcionales de competencias en el Estatuto de Autonomía de Cataluña. Comentarios a la Sentencia 31/2010 (284-289Ramon Riu FortunyTipología de las competencias. Su alcance

The TiltMeter app is a novel and accurate measurement tool for the weight bearing lunge test.

Science.gov (United States)

Williams, Cylie M; Caserta, Antoni J; Haines, Terry P

2013-09-01

The weight bearing lunge test is increasing being used by health care clinicians who treat lower limb and foot pathology. This measure is commonly established accurately and reliably with the use of expensive equipment. This study aims to compare the digital inclinometer with a free app, TiltMeter on an Apple iPhone. This was an intra-rater and inter-rater reliability study. Two raters (novice and experienced) conducted the measurements in both a bent knee and straight leg position to determine the intra-rater and inter-rater reliability. Concurrent validity was also established. Allied health practitioners were recruited as participants from the workplace. A preconditioning stretch was conducted and the ankle range of motion was established with the weight bearing lunge test position with firstly the leg straight and secondly with the knee bent. The measurement device and each participant were randomised during measurement. The intra-rater reliability and inter-rater reliability for the devices and in both positions were all over ICC 0.8 except for one intra-rater measure (Digital inclinometer, novice, ICC 0.65). The inter-rater reliability between the digital inclinometer and the tilmeter was near perfect, ICC 0.96 (CI: 0.898-0.983); Concurrent validity ICC between the two devices was 0.83 (CI: -0.740 to 0.445). The use of the Tiltmeter app on the iPhone is a reliable and inexpensive tool to measure the available ankle range of motion. Health practitioners should use caution in applying these findings to other smart phone equipment if surface areas are not comparable. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

45 CFR 170.460 - Good standing as an ONC-ATCB.

Science.gov (United States)

2010-10-01

....460 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Temporary Certification Program for HIT § 170.460 Good standing...

NIH and NCI grant-related changes during fiscal years 2014 and 2015

Science.gov (United States)

Wong, Rosemary S. L.

2015-03-01

The 2014 fiscal year (FY) continued to be a challenging one for all federal agencies despite the many Congressional strategies proposed to address the U.S. budget deficit. The Bipartisan Budget Act of 2013 passed by the House and Senate in December 2013 approved a two-year spending bill which cancelled the FY2014 and FY2015 required sequestration cuts (i.e., 4-5% National Institute of Health (NIH)/National Cancer Institute (NCI) budget reduction initiated on March 1, 2013), but extended the sequestration period through FY2023. This bill passage helped minimize any further budget reductions and resulted in a final FY2014 NIH budget of 29.9 billion and a NCI budget of 4.9 billion. Both NIH and NCI worked hard to maintain awarding the same number of NIH/NCI investigator-initiated R01 and exploratory R21 grants funded in FY2014 and similar to the level seen in FY2013 and previous years (see Tables 1 and 2). Since Congress only recently passed the 2015 spending bill in December 16, 2014, the final NIH and NCI budget appropriations for FY2015 remains unknown at this time and most likely will be similar to the FY2014 budget level. The NCI overall success and funding rates for unsolicited investigator-initiated R01 applications remained at 15%, while the success rate for exploratory R21 applications was 12% in FY2014 with similar rates seen in FY2013 (see Tables 1 and 2). The success rate for biomedical research applications in the Photodynamic Therapy and laser research field will be provided for the past few years. NIH provides numerous resources to help inform the extramural biomedical research community of new and current grant applicants about new grant policy changes and the grant submission and review processes.

NCI International EBV-Gastric Cancer Consortium

Science.gov (United States)

A collaboration among NCI and extramural investigators, established by DCEG in 2006, that utilizes data and biospecimens from completed and ongoing case series and observational studies of gastric cancer to replicate and extend findings from previous studies hindered by small numbers of EBV-positive cases, and to stimulate multidisciplinary research in this area.

Growth inhibitory effects of miR-221 and miR-222 in non-small cell lung cancer cells

International Nuclear Information System (INIS)

Yamashita, Ryo; Sato, Mitsuo; Kakumu, Tomohiko; Hase, Tetsunari; Yogo, Naoyuki; Maruyama, Eiichi; Sekido, Yoshitaka; Kondo, Masashi; Hasegawa, Yoshinori

2015-01-01

Both pro- and anti-oncogenic roles of miR-221 and miR-222 microRNAs are reported in several types of human cancers. A previous study suggested their oncogenic role in invasiveness in lung cancer, albeit only one cell line (H460) was used. To further evaluate involvement of miR-221 and miR-222 in lung cancer, we investigated the effects of miR-221 and miR-222 overexpression on six lung cancer cell lines, including H460, as well as one immortalized normal human bronchial epithelial cell line, HBEC4. miR-221 and miR-222 induced epithelial-to-mesenchymal transition (EMT)-like changes in a minority of HBEC4 cells but, unexpectedly, both the microRNAs rather suppressed their invasiveness. Consistent with the prior report, miR-221 and miR-222 promoted growth in H460; however, miR-221 suppressed growth in four other cell lines with no effects in one, and miR-222 suppressed growth in three cell lines but promoted growth in two. These are the first results to show tumor-suppressive effects of miR-221 and miR-222 in lung cancer cells, and we focused on clarifying the mechanisms. Cell cycle and apoptosis analyses revealed that growth suppression by miR-221 and miR-222 occurred through intra-S-phase arrest and/or apoptosis. Finally, lung cancer cell lines transfected with miR-221 or miR-222 became more sensitive to the S-phase targeting drugs, possibly due to an increased S-phase population. In conclusion, our data are the first to show tumor-suppressive effects of miR-221 and miR-222 on lung cancer, warranting testing their potential as therapeutics for the disease

Preparation of oligonucleotide microarray for radiation-associated gene expression detection and its application in lung cancer cell lines

International Nuclear Information System (INIS)

Guo Wanfeng; Lin Ruxian; Huang Jian; Guo Guozhen; Wang Shengqi

2005-01-01

Objective: The response of tumor cell to radiation is accompanied by complex change in patterns of gene expression. It is highly probable that a better understanding of molecular and genetic changes can help to sensitize the radioresistant tumor cells. Methods: Oligonucleotide microarray provides a powerful tool for high-throughput identifying a wider range of genes involved in the radioresistance. Therefore, the authors designed one oligonucleotide microarray according to the biological effect of IR. By using different radiosensitive lung cancer cell lines, the authors identified genes showing altered expression in lung cancer cell lines. To provide independent confirmation of microarray data, semi-quantitative RT-PCR was performed on a selection of genes. Results: In radioresistant A549 cell lines, a total of 18 genes were selected as having significant fold-changes compared to NCI-H446, 8 genes were up-regulated and 10 genes were down-regulated. Subsequently, A549 and NCI-H446 cells were delivered by ionizing radiation. In A549 cell line, we found 22 (19 up-regulated and 3 down-regulated) and 26 (8 up-regulated and 18 down-regulated) differentially expressed genes at 6h and 24h after ionizing radiation. In NCI-H446 cell line, we identified 17 (9 up-regulated and 8 down-regulated) and 18 (6 up-regulated and 12 down-regulated) differentially expressed genes at 6 h and 24 h after ionizing radiation. The authors tested seven genes (MDM2, p53, XRCC5, Bcl-2, PIM2, NFKBIA and Cyclin B1) for RT-PCR, and found that the results were in good agreement with those from the microarray data except for NFKBIA gene, even though the value for each mRNA level might be different between the two measurements. In present study, the authors identified some genes with cell proliferation and anti-apoptosis, such as MdM2, BCL-2, PKCz and PIM2 expression levels increased in A549 cells and decreased in NCI-H446 cells after radiation, and other genes with DNA repair, such as XRCC5, ERCC5

Spatial patterns of FUS-immunoreactive neuronal cytoplasmic inclusions (NCI) in neuronal intermediate filament inclusion disease (NIFID).

Science.gov (United States)

Armstrong, Richard A; Gearing, Marla; Bigio, Eileen H; Cruz-Sanchez, Felix F; Duyckaerts, Charles; Mackenzie, Ian R A; Perry, Robert H; Skullerud, Kari; Yokoo, Hideaki; Cairns, Nigel J

2011-11-01

Neuronal intermediate filament inclusion disease (NIFID), a rare form of frontotemporal lobar degeneration (FTLD), is characterized neuropathologically by focal atrophy of the frontal and temporal lobes, neuronal loss, gliosis, and neuronal cytoplasmic inclusions (NCI) containing epitopes of ubiquitin and neuronal intermediate filament (IF) proteins. Recently, the 'fused in sarcoma' (FUS) protein (encoded by the FUS gene) has been shown to be a component of the inclusions of NIFID. To further characterize FUS proteinopathy in NIFID, we studied the spatial patterns of the FUS-immunoreactive NCI in frontal and temporal cortex of 10 cases. In the cerebral cortex, sectors CA1/2 of the hippocampus, and the dentate gyrus (DG), the FUS-immunoreactive NCI were frequently clustered and the clusters were regularly distributed parallel to the tissue boundary. In a proportion of cortical gyri, cluster size of the NCI approximated to those of the columns of cells was associated with the cortico-cortical projections. There were no significant differences in the frequency of different types of spatial patterns with disease duration or disease stage. Clusters of NCI in the upper and lower cortex were significantly larger using FUS compared with phosphorylated, neurofilament heavy polypeptide (NEFH) or α-internexin (INA) immunohistochemistry (IHC). We concluded: (1) FUS-immunoreactive NCI exhibit similar spatial patterns to analogous inclusions in the tauopathies and synucleinopathies, (2) clusters of FUS-immunoreactive NCI are larger than those revealed by NEFH or ΙΝΑ, and (3) the spatial patterns of the FUS-immunoreactive NCI suggest the degeneration of the cortico-cortical projections in NIFID.

Development of superconducting magnetic bearing using superconducting coil and bulk superconductor

Energy Technology Data Exchange (ETDEWEB)

Seino, H; Nagashima, K; Arai, Y [Railway Technical Research Institute, Hikari-cho 2-8-38, Kokubunji-shi, Tokyo (Japan)], E-mail: seino@rtri.or.jp

2008-02-01

The authors conducted a study on superconducting magnetic bearing, which consists of superconducting rotor and stator to apply the flywheel energy-storage system for railways. In this study, high temperature bulk superconductor (HTS bulk) was combined with superconducting coils to increase the load capacity of the bearing. In the first step of the study, the thrust rolling bearing was selected for application by using liquid nitrogen cooled HTS bulk. 60mm-diameter HTS bulks and superconducting coil which generated a high gradient of magnetic field by cusp field were adopted as a rotor and a stator for superconducting magnetic bearing, respectively. The results of the static load test and the rotation test, creep of the electromagnetic forces caused by static flux penetration and AC loss due to eccentric rotation were decreased to the level without any problems in substantial use by using two HTS bulks. In the result of verification of static load capacity, levitation force (thrust load) of 8900N or more was supportable, and stable static load capacity was obtainable when weight of 460kg was levitated.

Development of superconducting magnetic bearing using superconducting coil and bulk superconductor

International Nuclear Information System (INIS)

Seino, H; Nagashima, K; Arai, Y

2008-01-01

The authors conducted a study on superconducting magnetic bearing, which consists of superconducting rotor and stator to apply the flywheel energy-storage system for railways. In this study, high temperature bulk superconductor (HTS bulk) was combined with superconducting coils to increase the load capacity of the bearing. In the first step of the study, the thrust rolling bearing was selected for application by using liquid nitrogen cooled HTS bulk. 60mm-diameter HTS bulks and superconducting coil which generated a high gradient of magnetic field by cusp field were adopted as a rotor and a stator for superconducting magnetic bearing, respectively. The results of the static load test and the rotation test, creep of the electromagnetic forces caused by static flux penetration and AC loss due to eccentric rotation were decreased to the level without any problems in substantial use by using two HTS bulks. In the result of verification of static load capacity, levitation force (thrust load) of 8900N or more was supportable, and stable static load capacity was obtainable when weight of 460kg was levitated

Effects of the single and combined treatment with dopamine agonist, somatostatin analog and mTOR inhibitors in a human lung carcinoid cell line: an in vitro study.

Science.gov (United States)

Pivonello, Claudia; Rousaki, Panagoula; Negri, Mariarosaria; Sarnataro, Maddalena; Napolitano, Maria; Marino, Federica Zito; Patalano, Roberta; De Martino, Maria Cristina; Sciammarella, Concetta; Faggiano, Antongiulio; Rocco, Gaetano; Franco, Renato; Kaltsas, Gregory A; Colao, Annamaria; Pivonello, Rosario

2017-06-01

Somatostatin analogues and mTOR inhibitors have been used as medical therapy in lung carcinoids with variable results. No data are available on dopamine agonists as treatment for lung carcinoids. The main aim of the current study was to evaluate the effect of the combined treatment of somatostatin analogue octreotide and the dopamine agonist cabergoline with mTOR inhibitors in an in vitro model of typical lung carcinoids: the NCI-H727 cell line. In NCI-H727 cell line, reverse transcriptase-quantitative polymerase chain reaction and immunofluorescence were assessed to characterize the expression of the somatostatin receptor 2 and 5, dopamine receptor 2 and mTOR pathway components. Fifteen typical lung carcinoids tissue samples have been used for somatostatin receptor 2, dopamine receptor 2, and the main mTOR pathway component p70S6K expression and localization by immunohistochemistry. Cell viability, fluorescence-activated cell sorting analysis and western blot have been assessed to test the pharmacological effects of octreotide, cabergoline and mTOR inhibitors, and to evaluate the activation of specific cell signaling pathways in NCI-H727 cell line. NCI-H727 cell line expressed somatostatin receptor 2, somatostatin receptor 5 and dopamine receptor 2 and all mTOR pathway components at messenger and protein levels. Somatostatin receptor 2, dopamine receptor 2, and p70S6K (non phosphorylated and phosphorylated) proteins were expressed in most typical lung carcinoids tissue samples. Octreotide and cabergoline did not reduce cell viability as single agents but, when combined with mTOR inhibitors, they potentiate mTOR inhibitors effect after long-term exposure, reducing Akt and ERK phosphorylation, mTOR escape mechanisms, and increasing the expression DNA-damage-inducible transcript 4, an mTOR suppressor. In conclusion, the single use of octreotide and cabergoline is not sufficient to block cell viability but the combined approach of these agents with mTOR inhibitors

College Graduate with NCI Internship Gains Experience, Carries Chemistry into Medicine | Poster

Science.gov (United States)

For Jennifer Marshall, the skills learned through an internship at the National Cancer Institute (NCI) at Frederick have prepared her for the next step of her life—medical school. Marshall, who will be attending the West Virginia University School of Medicine in the fall, spent three summers in NCI at Frederick’s Summer Internship Program expanding her love and passion for

Breviscapine suppresses the growth of non-small cell lung cancer

Indian Academy of Sciences (India)

Breviscapine (BVP) has previously been shown to inhibit the proliferation of hepatocellular carcinoma cells.However, little is known about the effects of BVP on non-small cell lung cancer (NSCLC) growth. Here, we aimedto study the effects of BVP on human NSCLC growth. We employed A549, NCL-H460 and A549 cells ...

Combined Use of α‐Difluoromethylornithine and an Inhibitor of S‐Adenosylmethionine Decarboxylase in Mice Bearing P388 Leukemia or Lewis Lung Carcinoma

Science.gov (United States)

Nakaike, Shiro; Kashiwagi, Keiko; Terao, Kiyoshi; Iio, Kokoro

1988-01-01

The antitumor and antimetastatic effects of α‐difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, combined with an inhibitor of S‐adenosylmethionine decarboxylase, either methylglyoxal bis(guanylhydrazone) (MGBG) or ethylglyoxal bis(guanylhydrazone) (EGBG), were studied in mice bearing P388 leukemia or Lewis lung carcinoma. Although EGBG is a more specific inhibitor of polyamine biosynthesis than the widely used MGBG, the antitumor effect of the DFMO‐EGBG combination on P388 leukemia‐bearing mice was less than that of the DFMO‐MGBG combination. The prolongation of survival time by the DFMOC1000 mg/kg)‐MGBG(25 mg/kg) combination was 2.65‐fold, while that of the DFMO(1000 mg/kg)‐EGBG(50 mg/kg) combination was 1.34‐fold. When mice were fed a polyamine‐deficient diet, stronger antitumor effects were exerted; the prolongation of survival time by the DFMO‐MGBG and the DFMO‐EGBG combinations was 2.89‐fold and 2.03‐fold, respectively. The antitumor effect of combined use of the two polyamine antimetabolites with mice on normal and polyamine‐deficient diets correlated with a decrease of polyamine charge contents in the tumor cells. The above in vivo results were confirmed clearly in the KB cell culture system. The antimetastatic activity of DFMO on Lewis lung carcinoma‐bearing mice was strengthened by the addition of MGBG or EGBG. The antimetastatic activity of the DFMO‐MGBG or DFMO‐EGBG combination did not parallel the polyamine charge contents in the primary tumor and blood. PMID:3133338

Vaccine for BK Polyomavirus-associated Infections in Transplant Recipients | NCI Technology Transfer Center | TTC

Science.gov (United States)

NCI researches identified a BK polyomavirus (BKV) virulent strain that causes chronic urinary tract infections, and the development of vaccine and therapeutic methods that would block BKV pathogenesis. The NCI Laboratory of Cellular Oncology, seek parties to license or co-develop this technology.

The NCI Digital Divide Pilot Projects: implications for cancer education.

Science.gov (United States)

Kreps, Gary L; Gustafson, David; Salovey, Peter; Perocchia, Rosemarie Slevin; Wilbright, Wayne; Bright, Mary Anne; Muha, Cathy

2007-01-01

The National Cancer Institute (NCI) supported four innovative demonstration research projects, "The Digital Divide Pilot Projects," to test new strategies for disseminating health information via computer to vulnerable consumers. These projects involved active research collaborations between the NCI's Cancer Information Service (CIS) and regional cancer control researchers to field test new approaches for enhancing cancer communication in vulnerable communities. The projects were able to use computers to successfully disseminate relevant cancer information to vulnerable populations. These demonstration research projects suggested effective new strategies for using communication technologies to educate underserved populations about cancer prevention, control, and care.

Published Research - NCI Alliance for Nanotechnology in Cancer

Science.gov (United States)

The NCI Alliance for Nanotechnology in Cancer has published much exciting and impactful research over the years. Find here a list of all of these listed in PubMed and others across the field of Cancer Nanotechnology.

27 CFR 4.60 - Application.

Science.gov (United States)

2010-04-01

... THE TREASURY LIQUORS LABELING AND ADVERTISING OF WINE Advertising of Wine § 4.60 Application. No... disseminated by radio or television broadcast, or in any newspaper, periodical, or any publication, by any sign... advertising is in, or is calculated to induce sale in, interstate or foreign commerce, or is disseminated by...

Effects of Monoclonal Antibody Cetuximab on Proliferation of Non-small Cell Lung Cancer Cell lines

Directory of Open Access Journals (Sweden)

Zhen CHEN

2010-08-01

Full Text Available Background and objective The epidermal growth factor receptor (EGFR monoclonal antibody cetuximab has been used widely in non-small cell lung cancer patients. The aim of this study is to explore the effect of lung cancer cells (A549, H460, H1299, SPC-A-1 which were treated by cetuximab in vitro. Methods We studied the effects of increasing concentrations of cetuximab (1 nmol/L-625 nmol/L in four human lung cancer cell lines (A549, SPC-A-1, H460, H1229. CCK8 measured the inhibition of cell proliferation in each group. A549, SPC-A-1 were marked by PI and the statuses of apoptosis were observed. Western blot were used to detect the proliferation-related signaling protein and apoptosis-related protein in A549. Results The treatment with cetuximab resulted in the effect on cell proliferation and apoptosis in a time- and dosedependent manner. The expression of activated key enzymes (p-AKT, p-EGFR, p-MAPK in EGFR signaling transduction pathway were down-regulated more obviously. Conclusion Cetuximab is an effective targeted drug in the treatment of lung cancer cell lines, tissues, most likely to contribute to the inhibition of key enzymes in EGFR signaling transduction pathway.

20 CFR 655.460 - Non-applicability of the Equal Access to Justice Act.

Science.gov (United States)

2010-04-01

... Justice Act. 655.460 Section 655.460 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION... Attestations § 655.460 Non-applicability of the Equal Access to Justice Act. A proceeding under subpart D or E of this part is not subject to the Equal Access to Justice Act, as amended, 5 U.S.C. 504. In such a...

NCI intramural research highlighted at 2014 AACR meeting

Science.gov (United States)

This year’s American Association for Cancer Research meeting featured plenary talks by two NCI scientists, Steven Rosenberg, M.D., and Louis Staudt, M.D., Ph.D., that highlighted the challenges in developing varied and potentially synergistic treatments f

42 CFR 460.136 - Internal quality assessment and performance improvement activities.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Internal quality assessment and performance improvement activities. 460.136 Section 460.136 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES....136 Internal quality assessment and performance improvement activities. (a) Quality assessment and...

Use of bactec 460 TB system in the diagnosis of tuberculosis

Directory of Open Access Journals (Sweden)

Rodrigues C

2007-01-01

Full Text Available Purpose : To evaluate, the efficacy of BACTEC 460 TB system for the diagnosis of tuberculosis in a tertiary care hospital in Mumbai, India. Methods : We compared 12,726 clinical specimens using BACTEC 460 TB system and conventional method for detection of Mycobacterium tuberculosis over a period of six years. Result: The overall recovery rate was 39% by BACTEC technique and 29% using Lowenstein-Jensen (LJ medium. An average detection time for B actec0 460 TB system was found to be 13.3 days and 15.3 days as against 31.2 days and 35.3 days by LJ method for respiratory and nonrespiratory specimens respectively. The average reporting time for drug susceptibility results ranged from 6-10 days for the BACTEC 460 TB system. Conclusions: The BACTEC system is a good system for level II laboratories, especially in the diagnosis of extrapulmonary and smear negative tuberculosis.

NCI Core Open House Shines Spotlight on Supportive Science and Basic Research | Poster

Science.gov (United States)

The lobby of Building 549 at NCI at Frederick bustled with activity for two hours on Tuesday, May 1, as several dozen scientists and staff gathered for the NCI Core Open House. The event aimed to encourage discussion and educate visitors about the capabilities of the cores, laboratories, and facilities that offer support to NCI’s Center for Cancer Research.

Global Proteome Analysis of the NCI-60 Cell Line Panel

Directory of Open Access Journals (Sweden)

Amin Moghaddas Gholami

2013-08-01

Full Text Available The NCI-60 cell line collection is a very widely used panel for the study of cellular mechanisms of cancer in general and in vitro drug action in particular. It is a model system for the tissue types and genetic diversity of human cancers and has been extensively molecularly characterized. Here, we present a quantitative proteome and kinome profile of the NCI-60 panel covering, in total, 10,350 proteins (including 375 protein kinases and including a core cancer proteome of 5,578 proteins that were consistently quantified across all tissue types. Bioinformatic analysis revealed strong cell line clusters according to tissue type and disclosed hundreds of differentially regulated proteins representing potential biomarkers for numerous tumor properties. Integration with public transcriptome data showed considerable similarity between mRNA and protein expression. Modeling of proteome and drug-response profiles for 108 FDA-approved drugs identified known and potential protein markers for drug sensitivity and resistance. To enable community access to this unique resource, we incorporated it into a public database for comparative and integrative analysis (http://wzw.tum.de/proteomics/nci60.

42 CFR 460.168 - Reinstatement in other Medicare and Medicaid programs.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Reinstatement in other Medicare and Medicaid programs. 460.168 Section 460.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF... Reinstatement in other Medicare and Medicaid programs. To facilitate a participant's reinstatement in other...

The evaluation of the degree of impairment of pulmonary perfusion in lung cancer patients treated by radiotherapy by the quantification of nonuniform distribution of lung perfusion scintigraphy SPECT

International Nuclear Information System (INIS)

Mitomo, Osamu; Tsunoda, Takashi; Kuwabara, Hidemasa

2004-01-01

patients was 26.4±1.4, which was almost equal to that of the pulmonary group including the chronic obstructive pulmonary diseases, and significantly higher than that of cardiac or non-cardiopulmonary group. The irradiated lung cancer patients with complications of pulmonary or cardiopulmonary diseases showed a significantly increased D index, compared with patients without complications. Distribution index of tumor-bearing lung (D r/l index) was significantly higher than that of non-tumor-bearing lung. The D r/l index of tumor-bearing lung of small cell carcinoma patients significantly increased, compared with that of adenocarcinoma patients, and significantly increased according to whether or not the primary tumor occupied the hilar region and degree of extension of tumor invasion especially in the hilum as well as the mediastinum. In the follow-up irradiated lung cancer patients, the D index and D r/l index of non-tumor-bearing lung post-radiotherapy significantly increased, compared with pre-radiotherapy. It is considered that the distribution index quantifying nonuniform distribution in the SPECT enables evaluation of the degree of impairment of lung as a whole, tumor-bearing lung, and non-tumor-bearing lung in lung cancer patients, and results in presenting a useful indicator for radiotherapeutic planning and following up respiratory function after radiotherapy. (author)

Project Execution Plan Project 98L-EWW-460 Plutonium Stabilization and Handling DOE 98-D-453

International Nuclear Information System (INIS)

MCGRATH, G.M.

2000-01-01

This Project Execution Plan (PEP) describes the management methods and responsibilities of the project participants. Project W-460 is sufficiently large to warrant a stand alone PEP. This project specific PEP describes the relationships and responsibilities of the project team and identifies the technical, schedule, and cost baselines that have been established for the project. The Department of Energy (DOE), Hanford Works (Hanford), at Richland, Wa. currently does not have a system capable of stabilizing or packaging large quantities of plutonium-bearing solids to meet DOE technical standard DOE-STD-3013-99. This project will allow Hanford to meet this standard by installing stabilization and packaging equipment (SPE). The SPE is capable of stabilizing and packaging the current inventory of greater than 30 percent plutonium-bearing materials currently stored in the Plutonium Finishing Plant's (PFP) vaults into 3013 storage containers. The scope of this project is to procure and install the SPE via a Hanford contract and coordination with the Savannah River Site. In addition, the project will modify PFP vaults and upgrade the PFP Laboratory measurement systems. The Facility infrastructure will be modified to support the new SPE system and the new standardized storage container configuration

Project Execution Plan Project 98L-EWW-460 Plutonium Stabilization and Handling DOE 98-D-453

Energy Technology Data Exchange (ETDEWEB)

HOLSTEIN, W.A.

1999-08-01

This Project Execution Plan (PEP) describes the management methods and responsibilities of the project participants. Project W-460 is sufficiently large to warrant a stand alone PEP. This project specific PEP describes the relationships and responsibilities of the project team and identifies the technical, schedule, and cost baselines that have been established for the project. The Department of Energy (DOE), Hanford Works (Hanford), at Richland Wa. currently does not have a system capable of stabilizing or packaging large quantities of plutonium-bearing solids to meet DOE technical standard DOE-STD-3013-96. This project will allow Hanford to meet this standard by installing stabilization and packaging equipment (SPE). The SPE is capable of stabilizing and packaging the current inventory of greater than 50 percent plutonium-bearing materials currently stored in the Plutonium Finishing Plant's (PFP) vaults into 3013 storage containers. The scope of this project is to procure and install the SPE via a Hanford contract and coordination with the Savannah River Site. In addition, the project will modify PFP vaults and upgrade the PFP Laboratory measurement systems. The Facility infrastructure will be modified to support the new SPE system and the new standardized storage container configuration.

Project Execution Plan Project 98L-EWW-460 Plutonium Stabilization and Handling DOE 98-D-453

Energy Technology Data Exchange (ETDEWEB)

MCGRATH, G.M.

2000-06-21

This Project Execution Plan (PEP) describes the management methods and responsibilities of the project participants. Project W-460 is sufficiently large to warrant a stand alone PEP. This project specific PEP describes the relationships and responsibilities of the project team and identifies the technical, schedule, and cost baselines that have been established for the project. The Department of Energy (DOE), Hanford Works (Hanford), at Richland, Wa. currently does not have a system capable of stabilizing or packaging large quantities of plutonium-bearing solids to meet DOE technical standard DOE-STD-3013-99. This project will allow Hanford to meet this standard by installing stabilization and packaging equipment (SPE). The SPE is capable of stabilizing and packaging the current inventory of greater than 30 percent plutonium-bearing materials currently stored in the Plutonium Finishing Plant's (PFP) vaults into 3013 storage containers. The scope of this project is to procure and install the SPE via a Hanford contract and coordination with the Savannah River Site. In addition, the project will modify PFP vaults and upgrade the PFP Laboratory measurement systems. The Facility infrastructure will be modified to support the new SPE system and the new standardized storage container configuration.

42 CFR 460.102 - Interdisciplinary team.

Science.gov (United States)

2010-10-01

... ELDERLY (PACE) PACE Services § 460.102 Interdisciplinary team. (a) Basic requirement. A PACE organization... the following: (i) Managing a participant's medical situations. (ii) Overseeing a participant's use of.... (iii) Documenting changes of a participant's condition in the participant's medical record consistent...

Abscess of residual lobe after pulmonary resection for lung cancer.

Science.gov (United States)

Ligabue, Tommaso; Voltolini, Luca; Ghiribelli, Claudia; Luzzi, Luca; Rapicetta, Cristian; Gotti, Giuseppe

2008-04-01

Abscess of the residual lobe after lobectomy is a rare but potentially lethal complication. Between January 1975 and December 2006, 1,460 patients underwent elective pulmonary lobectomy for non-small-cell lung cancer at our institution. Abscess of the residual lung parenchyma occurred in 5 (0.3%) cases (4 bilobectomies and 1 lobectomy). Postoperative chest radiography showed incomplete expansion and consolidation of residual lung parenchyma. Flexible bronchoscopy revealed persistent bronchial occlusion from purulent secretions and/or bronchial collapse. Computed tomography in 3 patients demonstrated lung abscess foci. Surgical treatment included completion right pneumonectomy in 3 patients and a middle lobectomy in one. Complications after repeat thoracotomy comprised contralateral pneumonia and sepsis in 1 patient. Residual lobar abscess after lobectomy should be suspected in patients presenting with fever, leukocytosis, bronchial obstruction and lung consolidation despite antibiotic therapy, physiotherapy and bronchoscopy. Computed tomography is mandatory for early diagnosis. Surgical resection of the affected lobe is recommended.

42 CFR 460.124 - Additional appeal rights under Medicare or Medicaid.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Additional appeal rights under Medicare or Medicaid. 460.124 Section 460.124 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH... or Medicaid. A PACE organization must inform a participant in writing of his or her appeal rights...

Antitumor activity and systemic effects of PVM/MA-shelled selol nanocapsules in lung adenocarcinoma-bearing mice

International Nuclear Information System (INIS)

De Souza, Ludmilla Regina; Muehlmann, Luis Alexandre; Matos, Lívia Carneiro; Lacava, Zulmira Guerreiro Marques; Báo, Sônia Nair; Azevedo, Ricardo Bentes; Simón-Vázquez, Rosana; González-Fernández, África; De-Paula, Alfredo Maurício Batista; Mosiniewicz-Szablewska, Ewa; Suchocki, Piotr; Morais, Paulo César

2015-01-01

Selol is a semi-synthetic compound containing selenite that is effective against cancerous cells and safer for clinical applications in comparison with other inorganic forms of selenite. Recently, we have developed a formulation of poly(methyl vinyl ether-co-maleic anhydride)-shelled selol nanocapsules (SPN), which reduced the proliferative activity of lung adenocarcinoma cells and presented little deleterious effects on normal cells in in vitro studies. In this study, we report on the antitumor activity and systemic effects induced by this formulation in chemically induced lung adenocarcinoma-bearing mice. The in vivo antitumor activity of the SPN was verified by macroscopic quantification, immunohistochemistry and morphological analyses. Toxicity analyses were performed by evaluations of the kidney, liver, and spleen; analyses of hemogram and plasma levels of alanine aminotransferase, aspartate transaminase, urea, and creatinine; and DNA fragmentation and cell cycle activity of the bone marrow cells. Furthermore, we investigated the potential of the SPN formulation to cause hemolysis, activate the complement system, provoke an inflammatory response and change the conformation of the plasma proteins. Our results showed that the SPN reduced the area of the surface tumor nodules but not the total number of tumor nodules. The biochemical and hematological findings were suggestive of the low systemic toxicity of the SPN formulation. The surface properties of the selol nanocapsules point to characteristics that are consistent with the treatment of the tumors in vivo: low hemolytic activity, weak inflammatory reaction with no activation of the complement system, and mild or absent conformational changes of the plasma proteins. In conclusion, this report suggests that the SPN formulation investigated herein exhibits anti-tumoral effects against lung adenocarcinoma in vivo and is associated with low systemic toxicity and high biocompatibility. (paper)

NCI investment in nanotechnology: achievements and challenges for the future.

Science.gov (United States)

Dickherber, Anthony; Morris, Stephanie A; Grodzinski, Piotr

2015-01-01

Nanotechnology offers an exceptional and unique opportunity for developing a new generation of tools addressing persistent challenges to progress in cancer research and clinical care. The National Cancer Institute (NCI) recognizes this potential, which is why it invests roughly $150 M per year in nanobiotechnology training, research and development. By exploiting the various capacities of nanomaterials, the range of nanoscale vectors and probes potentially available suggests much is possible for precisely investigating, manipulating, and targeting the mechanisms of cancer across the full spectrum of research and clinical care. NCI has played a key role among federal R&D agencies in recognizing early the value of nanobiotechnology in medicine and committing to its development as well as providing training support for new investigators in the field. These investments have allowed many in the research community to pursue breakthrough capabilities that have already yielded broad benefits. Presented here is an overview of how NCI has made these investments with some consideration of how it will continue to work with this research community to pursue paradigm-changing innovations that offer relief from the burdens of cancer. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

42 CFR 460.42 - Suspension of enrollment or payment by CMS.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Suspension of enrollment or payment by CMS. 460.42... enrollment or payment by CMS. (a) Enrollment. If a PACE organization commits one or more violations specified in § 460.40, CMS may suspend enrollment of Medicare beneficiaries after the date CMS notifies the...

Capillary blood flow in the lungs of patients with chronic laryngo- and tracheostenosis

International Nuclear Information System (INIS)

Obukhov, N.V.; Folomeev, V.N.

1991-01-01

Altogether 19 patients with chronic laryngo- and tracheostenosis of different etiology with different time of canulla bearing. The patients were examined with 99m Tc-human serum albumin particles. Major disorders in the capillary blood supply of both lungs were detected. These changes were focaldiffuse. Lung abnormalities increased depending on the time of canulla bearing

Pharmacologically directed strategies in academic anticancer drug discovery based on the European NCI compounds initiative.

Science.gov (United States)

Hendriks, Hans R; Govaerts, Anne-Sophie; Fichtner, Iduna; Burtles, Sally; Westwell, Andrew D; Peters, Godefridus J

2017-07-11

The European NCI compounds programme, a joint initiative of the EORTC Research Branch, Cancer Research Campaign and the US National Cancer Institute, was initiated in 1993. The objective was to help the NCI in reducing the backlog of in vivo testing of potential anticancer compounds, synthesised in Europe that emerged from the NCI in vitro 60-cell screen. Over a period of more than twenty years the EORTC-Cancer Research Campaign panel reviewed ∼2000 compounds of which 95 were selected for further evaluation. Selected compounds were stepwise developed with clear go/no go decision points using a pharmacologically directed programme. This approach eliminated quickly compounds with unsuitable pharmacological properties. A few compounds went into Phase I clinical evaluation. The lessons learned and many of the principles outlined in the paper can easily be applied to current and future drug discovery and development programmes. Changes in the review panel, restrictions regarding numbers and types of compounds tested in the NCI in vitro screen and the appearance of targeted agents led to the discontinuation of the European NCI programme in 2017 and its transformation into an academic platform of excellence for anticancer drug discovery and development within the EORTC-PAMM group. This group remains open for advice and collaboration with interested parties in the field of cancer pharmacology.

42 CFR 460.70 - Contracted services.

Science.gov (United States)

2010-10-01

...: (1) Name of contractor. (2) Services furnished (including work schedule if appropriate). (3) Payment... authorized by the PACE interdisciplinary team. (ii) Accept payment from the PACE organization as payment in... sound as defined in § 460.80(a) of this part and has demonstrated competence with the PACE model as...

Reversal of cisplatin resistance in non-small cell lung cancer stem cells by Taxus chinensis var.

Science.gov (United States)

Jiang, Y Q; Xu, X P; Guo, Q M; Xu, X C; Liu, Q Y; An, S H; Xu, J L; Su, F; Tai, J B

2016-09-02

Drug resistance in cells is a major impedance to successful treatment of lung cancer. Taxus chinensis var. inhibits the growth of tumor cells and promotes the synthesis of interleukins 1 and 2 and tumor necrosis factor, enhancing immune function. In this study, T. chinensis var.-induced cell death was analyzed in lung cancer cells (H460) enriched for stem cell growth in a defined serum-free medium. Taxus-treated stem cells were also analyzed for Rhodamine 123 (Rh-123) expression by flow cytometry, and used as a standard functional indicator of MDR. The molecular basis of T. chinensis var.-mediated drug resistance was established by real-time PCR analysis of ABCC1, ABCB1, and lung resistance-related protein (LRP) mRNA, and western blot analysis of MRP1, MDR1, and LRP. Our results revealed that stem cells treated with higher doses of T. chinensis var. showed significantly lower growth inhibition rates than did H460 cells (P var. and cisplatin was also significantly inhibited (P var. (P var.-treated stem cells showed significant downregulation of the ABCC1, ABCB1, and LRP mRNA and MRP1, MDR1, and LRP (P var.-mediated downregulation of MRP1, MDR1, and LRP might contribute to the reversal of drug resistance in non-small cell lung cancer stem cells.

UNC Cancer Center Director to Lead NCI.

Science.gov (United States)

2017-08-01

President Donald Trump has selected Norman "Ned" Sharpless, MD, director of the University of North Carolina Lineberger Comprehensive Cancer Center, to lead the NCI. The news was met with widespread approval among cancer researchers, who view Sharpless as a strong communicator who can ably represent the needs of the cancer community in the face of proposed funding cuts. ©2017 American Association for Cancer Research.

Creating Start-up Companies around NCI Inventions | Poster

Science.gov (United States)

By Karen Surabian, Thomas Stackhouse, and Rose Freel, Contributing Writers, and Rosemarie Truman, Guest Writer The National Cancer Institute (NCI), led by the Technology Transfer Center (TTC),  the Avon Foundation, and The Center for Advancing Innovation have partnered to create a “first-of-a-kind” Breast Cancer Start-up Challenge.

21 CFR 111.460 - What requirements apply to holding in-process material?

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false What requirements apply to holding in-process material? 111.460 Section 111.460 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CURRENT GOOD MANUFACTURING PRACTICE IN...

46 CFR 154.460 - Design criteria.

Science.gov (United States)

2010-10-01

... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... Barrier § 154.460 Design criteria. At static angles of heel up through 30°, a secondary barrier must (a) If a complete secondary barrier is required in § 154.459, hold all of the liquid cargo in the cargo...

Analysis of resveratrol and radiation effects in lung cancer cells by micronucleus assay

Energy Technology Data Exchange (ETDEWEB)

Moreno, Carolina S.; Santos, Dymes R.A.; Vieira, Daniel P.; Rogero, Sizue O.; Rogero, Jose R., E-mail: carolina_sm@hotmail.com [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Sakuraba, Roberto K.; Weltman, Eduardo [Hospital Israelita Albert Einstein, Sao Paulo, SP (Brazil); Cruz, Aurea S.; Santos, Rezolina P. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil)

2015-07-01

Mucoepidermoid lung carcinoma is frequently manifested by obstructive trachea symptoms. Radiation and drugs combinations are commonly used in the lung cancer treatment. Currently there is a strong tendency to develop therapeutic strategies focused at the administration of high potential compounds to improve the ionizing radiation treatments, so as to increase the radiation effects on tumor cell while minimizing these effects to surrounding normal tissues. Resveratrol is a polyphenolic phytoalexin compound present in wines and several plants. This compound has a broad spectrum of biological activities such as antioxidant, anticarcinogenic, and induction of cell cycle arrest effects. Analysis of biological effects of ionizing radiation in the presence of resveratrol in different cell cultures has been the subject of many studies. To verify the genotoxic effects in cells exposed to ionizing radiation many methods have been proposed. The cytokinesis-block micronucleus technique is one of the preferred methods. The main of this study was to detect and quantify radioinduced DNA damage in mucoepidermoid lung carcinoma cells (NCI-H292) by cytokinesis-block micronucleus technique using cytocalasin-B. The cell culture was irradiated at a single fraction from a TrueBeam® linear accelerator (0, 0.8, 5, and 10 Gy), in the absence or presence of different resveratrol concentrations (0, 15, 30, and 60 μM). The results showed that resveratrol (15 and μM) induced significant increase frequency (p<0.05) of micronucleus formation in NCI-H292 cell culture non-irradiated and exposed at 5 Gy dose. Moreover, resveratrol (30 μM) induced micronucleus formation at 0.8 Gy dose. (author)

Analysis of resveratrol and radiation effects in lung cancer cells by micronucleus assay

International Nuclear Information System (INIS)

Moreno, Carolina S.; Santos, Dymes R.A.; Vieira, Daniel P.; Rogero, Sizue O.; Rogero, Jose R.; Sakuraba, Roberto K.; Weltman, Eduardo; Cruz, Aurea S.; Santos, Rezolina P.

2015-01-01

Mucoepidermoid lung carcinoma is frequently manifested by obstructive trachea symptoms. Radiation and drugs combinations are commonly used in the lung cancer treatment. Currently there is a strong tendency to develop therapeutic strategies focused at the administration of high potential compounds to improve the ionizing radiation treatments, so as to increase the radiation effects on tumor cell while minimizing these effects to surrounding normal tissues. Resveratrol is a polyphenolic phytoalexin compound present in wines and several plants. This compound has a broad spectrum of biological activities such as antioxidant, anticarcinogenic, and induction of cell cycle arrest effects. Analysis of biological effects of ionizing radiation in the presence of resveratrol in different cell cultures has been the subject of many studies. To verify the genotoxic effects in cells exposed to ionizing radiation many methods have been proposed. The cytokinesis-block micronucleus technique is one of the preferred methods. The main of this study was to detect and quantify radioinduced DNA damage in mucoepidermoid lung carcinoma cells (NCI-H292) by cytokinesis-block micronucleus technique using cytocalasin-B. The cell culture was irradiated at a single fraction from a TrueBeam® linear accelerator (0, 0.8, 5, and 10 Gy), in the absence or presence of different resveratrol concentrations (0, 15, 30, and 60 μM). The results showed that resveratrol (15 and μM) induced significant increase frequency (p<0.05) of micronucleus formation in NCI-H292 cell culture non-irradiated and exposed at 5 Gy dose. Moreover, resveratrol (30 μM) induced micronucleus formation at 0.8 Gy dose. (author)

Inactivated Tianjin strain, a novel genotype of Sendai virus, induces apoptosis in HeLa, NCI-H446 and Hep3B cells.

Science.gov (United States)

Chen, Jun; Han, Han; Wang, Bin; Shi, Liying

2016-07-01

The Sendai virus strain Tianjin is a novel genotype of the Sendai virus. In previous studies, ultraviolet-inactivated Sendai virus strain Tianjin (UV-Tianjin) demonstrated antitumor effects on human breast cancer cells. The aim of the present study was to investigate the in vitro antitumor effects of UV-Tianjin on the human cervical carcinoma HeLa, human small cell lung cancer NCI-H446 and human hepatocellular carcinoma Hep 3B cell lines, and the possible underlying mechanisms of these antitumor effects. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay revealed that UV-Tianjin treatment inhibited the proliferation of HeLa, NCI-H446 and Hep 3B cells in a dose- and time-dependent manner. Hoechst and Annexin V-fluorescein isothiocyanate/propidium iodide double staining indicated that UV-Tianjin induced dose-dependent apoptosis in all three cell lines with the most significant effect observed in the HeLa cell line. In the HeLa cell line, UV-Tianjin-induced apoptosis was further confirmed by the disruption of the mitochondria membrane potential and the activation of caspases, as demonstrated by fluorescent cationic dye and colorimetric assays, respectively. In addition, western blot analysis revealed that UV-Tianjin treatment resulted in significant upregulation of cytochrome c , apoptosis protease activating factor-1, Fas, Fas ligand and Fas-associated protein with death domain, and activated caspase-9, -8 and -3 in HeLa cells. Based on these results, it is hypothesized that UV-Tianjin exhibits anticancer activity in HeLa, NCI-H446 and Hep 3B cell lines via the induction of apoptosis. In conclusion, the results of the present study indicate that in the HeLa cell line, intrinsic and extrinsic apoptotic pathways may be involved in UV-Tianjin-induced apoptosis.

16 CFR 460.18 - Insulation ads.

Science.gov (United States)

2010-01-01

... Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.18 Insulation ads. (a) If your ad gives an R-value, you must give the type of insulation and... your ad gives a price, you must give the type of insulation, the R-value at a specific thickness, the...

16 CFR 460.13 - Fact sheets.

Science.gov (United States)

2010-01-01

... INSULATION § 460.13 Fact sheets. If you are a manufacturer, you must give retailers and installers fact... uses. (b) A heading: “This is ____ insulation.” Fill in the blank with the type and form of your... compressed during installation.” (e) After the chart and any statement dealing with the specific type of...

Experimental study of 99Tcm-HL91 and 99Tcm-MIBI in mice bearing Lewis lung cancer

International Nuclear Information System (INIS)

Han Chunqi; Li Yaming; Ren Yangang; Yi Lijie

2000-01-01

Objective: To evaluate the ability of detecting lung cancer by 99 Tc m -HL91 and 99 Tc m -MIBI in mice bearing Lewis lung cancer. Methods: Four model mice underwent whole body planar imaging at 2 h, 4 h after injection of 99 Tc m -MIBI; four mice underwent whole body planar imaging at 2 h and 4 h after injection of 99 Tc m -HL91, and the mice of the 99 Tc m -HL91 group were then killed, the tumor, blood and organs were removed, weighted and the radioactivity was measured. ROIs were drawn around the tumor, head and chest in whole body planar images, and radioactivity ratios of tumor to head (T/H), chest (T/C) and contralateral limbs (T/L) were calculated. Results: No significant tumor radioactivity in 2 h and 4 h images of 99 Tc m -MIBI mice (T/C: 0.20 +- 0.08 and 0.14 +- 0.07) was found; increased tumor radioactivity was identified in images of 99 Tc m -HL91 mice (T/C: 3.25 +- 1.25 and 2.44 +- 1.07), and there was significant difference (t = 4.8 - 7.5, P 99 Tc m -HL91 in tumor tissue of mice is higher and clearance rate is slower. 99 Tc m -HL91 is a valuable tumor imaging agent for clinical diagnosis for the cancer

Help NCI at Frederick “Knock Out Hunger” | Poster

Science.gov (United States)

NCI at Frederick is once again participating in the Feds Feed Families initiative, an annual food drive that addresses severe shortages of non-perishable items in food banks across D.C., Maryland, and Virginia during the summer months, when giving is at its lowest.

77 FR 2734 - Proposed Collection; Comment Request: Solar Cell: A Mobile UV Manager for Smart Phones (NCI)

Science.gov (United States)

2012-01-19

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Proposed Collection; Comment Request: Solar Cell: A Mobile UV Manager for Smart Phones (NCI) SUMMARY: In compliance with the... Manager for Smart Phones (NCI). Type of Information Collection Request: New. Need and Use of Information...

The generalizability of NCI-sponsored clinical trials accrual among women with gynecologic malignancies.

Science.gov (United States)

Mishkin, Grace; Minasian, Lori M; Kohn, Elise C; Noone, Anne-Michelle; Temkin, Sarah M

2016-12-01

Enrollment of a representative population to cancer clinical trials ensures scientific reliability and generalizability of results. This study evaluated the similarity of patients enrolled in NCI-supported group gynecologic cancer trials to the incident US population. Accrual to NCI-sponsored ovarian, uterine, and cervical cancer treatment trials between 2003 and 2012 were examined. Race, ethnicity, age, and insurance status were compared to the analogous US patient population estimated using adjusted SEER incidence data. There were 18,913 accruals to 156 NCI-sponsored gynecologic cancer treatment trials, ovarian (56%), uterine (32%), and cervical cancers (12%). Ovarian cancer trials included the least racial, ethnic and age diversity. Black women were notably underrepresented in ovarian trials (4% versus 11%). Hispanic patients were underrepresented in ovarian and uterine trials (4% and 5% versus 18% and 19%, respectively), but not in cervical cancer trials (14 versus 11%). Elderly patients were underrepresented in each disease area, with the greatest underrepresentation seen in ovarian cancer patients over the age of 75 (7% versus 29%). Privately insured women were overrepresented among accrued ovarian cancer patients (87% versus 76%), and the uninsured were overrepresented among women with uterine or cervical cancers. These patterns did not change over time. Several notable differences were observed between the patients accrued to NCI funded trials and the incident population. Improving representation of racial and ethnic minorities and elderly patients on cancer clinical trials continues to be a challenge and priority. Copyright © 2016 Elsevier Inc. All rights reserved.

Phenotype abnormality: 460 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 460 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u964i pale green whole plant in environment... of low light intensity regimen in environment of low light intensity regimen http://m

Regular paths in SparQL: querying the NCI Thesaurus.

Science.gov (United States)

Detwiler, Landon T; Suciu, Dan; Brinkley, James F

2008-11-06

OWL, the Web Ontology Language, provides syntax and semantics for representing knowledge for the semantic web. Many of the constructs of OWL have a basis in the field of description logics. While the formal underpinnings of description logics have lead to a highly computable language, it has come at a cognitive cost. OWL ontologies are often unintuitive to readers lacking a strong logic background. In this work we describe GLEEN, a regular path expression library, which extends the RDF query language SparQL to support complex path expressions over OWL and other RDF-based ontologies. We illustrate the utility of GLEEN by showing how it can be used in a query-based approach to defining simpler, more intuitive views of OWL ontologies. In particular we show how relatively simple GLEEN-enhanced SparQL queries can create views of the OWL version of the NCI Thesaurus that match the views generated by the web-based NCI browser.

Gardasil® and Cervarix® | NCI Technology Transfer Center | TTC

Science.gov (United States)

Vaccine for human papilloma virus (HPV) to protect from cancers Key elements of the technology for Gardasil® and Cervarix originated from the HPV research of the laboratory of Drs. Douglas Lowy and John Schiller of the NCI.

Anti-tumor effect of bisphosphonate (YM529 on non-small cell lung cancer cell lines

Directory of Open Access Journals (Sweden)

Date Hiroshi

2007-01-01

Full Text Available Abstract Background YM529 is a newly developed nitrogen-containing bisphosphonate (BP classified as a third-generation BP that shows a 100-fold greater potency against bone resorption than pamidronate, a second-generation BP. This agent is, therefore expected to be extremely useful clinically for the treatment of osteoporosis and hypercalcemia. Recently, YM529 as well as other third-generation BPs have also been shown to exert anti-tumor effects against various types of cancer cells both in vitro or/and in vivo. In this study, we investigate the anti-tumor effect of YM529 on non-small cell lung cancer (NSCLC. Methods Direct anti-tumor effect of YM529 against 8 NSCLC cell lines (adenocarcinoma: H23, H1299, NCI-H1819, NCI-H2009, H44, A549, adenosquamous cell carcinoma: NCI-H125, squamous cell carcinoma: NCI-H157 were measured by MTS assay and calculated inhibition concentration 50 % (IC50 values. YM529 induced apoptosis of NCI-H1819 was examined by DNA fragmentation of 2 % agarose gel electrophoresis and flowcytometric analysis (sub-G1 method. We examined where YM529 given effect to apoptosis of NSCLC cells in signaling pathway of the mevalonate pathway by western blotting analysis. Results We found that there was direct anti-tumor effect of YM529 on 8 NSCLC cell lines in a dose-dependent manner and their IC50 values were 2.1 to 7.9 μM and YM529 induced apoptosis and G1 arrest cell cycle with dose-dependent manner and YM529 caused down regulation of phospholyration of ERK1/2 in signaling pathways of NSCLC cell line (NCI-H1819. Conclusion Our study demonstrate that YM529 showed direct anti-tumor effect on NSCLC cell lines in vitro, which supports the possibility that third-generation BPs including YM529 can be one of therapeutic options for NSCLC.

Bystander Effects Induced by Continuous Low-Dose-Rate 125I Seeds Potentiate the Killing Action of Irradiation on Human Lung Cancer Cells In Vitro

International Nuclear Information System (INIS)

Chen, H.H.; Jia, R.F.; Yu, L.; Zhao, M.J.; Shao, C.L.; Cheng, W.Y.

2008-01-01

Purpose: To investigate bystander effects of low-dose-rate (LDR) 125 I seed irradiation on human lung cancer cells in vitro. Methods and Materials: A549 and NCI-H446 cell lines of differing radiosensitivity were directly exposed to LDR 125 I seeds irradiation for 2 or 4 Gy and then cocultured with nonirradiated cells for 24 hours. Induction of micronucleus (MN), γH2AX foci, and apoptosis were assayed. Results: After 2 and 4 Gy irradiation, micronucleus formation rate (MFR) and apoptotic rate of A549 and NCI-H446 cells were increased, and the MFR and apoptotic rate of NCI-H446 cells was 2.1-2.8 times higher than that of A549 cells. After coculturing nonirradiated bystander cells with 125 I seed irradiated cells for 24 hours, MFR and the mean number of γH2AX foci/cells of bystander A549 and NCI-H446 cells were similar and significantly higher than those of control (p 125 I seeds could induce bystander effects, which potentiate the killing action on tumor cells and compensate for the influence of nonuniform distribution of radiation dosage on therapeutic outcomes

Anti-cancer activity of tectona hamiltoniana-an endemic plant of Myanmar

International Nuclear Information System (INIS)

Mya, K.M.; Shyaula, S.L.

2012-01-01

Summary: The ethanolic extracts of barks and leaves of Tectona hamiltoniana (Verbenaceae) were tested for anti-cancer activity against MCF-7 (Human breast cancer) and NCI-H460 (Lung cancer) cell lines employing sulpho rhodamine B (SRB) bioassay. These extracts demonstrated cytotoxicity with GI/sub 50/ values ranging between 24-33 macro g/mL against both cell lines. Upon further fractionation, dichloromethane fraction appeared to be most active against the MCF-7 cell line (GI/sub 50/ value of 3.4+-0.9 macro g/mL) leading to the isolation of lupane type triterpenoids, betulinic acid (1), betulin aldehyde ( 2 ) and betulin (3). Compound 2 and 3, both showed significant cytotoxic effect against both cancerous cell lines (GI/sub 50/ value range 6-11 macro M). (author)

The NCI Alliance for Nanotechnology in Cancer: achievement and path forward.

Science.gov (United States)

Ptak, Krzysztof; Farrell, Dorothy; Panaro, Nicholas J; Grodzinski, Piotr; Barker, Anna D

2010-01-01

Nanotechnology is a 'disruptive technology', which can lead to a generation of new diagnostic and therapeutic products, resulting in dramatically improved cancer outcomes. The National Cancer Institute (NCI) of National Institutes of Health explores innovative approaches to multidisciplinary research allowing for a convergence of molecular biology, oncology, physics, chemistry, and engineering and leading to the development of clinically worthy technological approaches. These initiatives include programmatic efforts to enable nanotechnology as a driver of advances in clinical oncology and cancer research, known collectively as the NCI Alliance for Nanotechnology in Cancer (ANC). Over the last 5 years, ANC has demonstrated that multidisciplinary approach catalyzes scientific developments and advances clinical translation in cancer nanotechnology. The research conducted by ANC members has improved diagnostic assays and imaging agents, leading to the development of point-of-care diagnostics, identification and validation of numerous biomarkers for novel diagnostic assays, and the development of multifunctional agents for imaging and therapy. Numerous nanotechnology-based technologies developed by ANC researchers are entering clinical trials. NCI has re-issued ANC program for next 5 years signaling that it continues to have high expectations for cancer nanotechnology's impact on clinical practice. The goals of the next phase will be to broaden access to cancer nanotechnology research through greater clinical translation and outreach to the patient and clinical communities and to support development of entirely new models of cancer care.

Correlation between 11C-choline or 18F-FDG uptake and tumor proliferation: a rabbit bearing lung cancer model study

International Nuclear Information System (INIS)

Li Yajun; Bai Renju; Gao Shuo; Li Yansheng; Liu Lei; Jia Wei; Cai Li; Xing Xiling

2009-01-01

Objective: Tumor proliferative activity has been recognized as an indicator of malignant degree in lung cancer and related to prognosis. The purpose of this study was to evaluate the feasibility of assessing proliferative activity with 11 C-choline and 18 F-fluorodeoxyglucose (FDG) PET on a rabbit bearing lung VX2 tumor model. Methods: About 0.5 ml of viable VX2 tumor cell suspension was slowly injected into the right lungs of 54 New Zealand white rabbits through a transthoracical needle insertion. 11 C-choline and 18 F-FDG PET scan were performed 10-11 d after tumor implantation. One ear vein was cannulated for administration of the tracers, 11 C-choline PET scan (with Discovery LS PET/CT scanner, GE) was performed 5 rain after intravenously injection of 37 MBq 11 C-choline. Then 18.7 MBq 18 F-FDG was infused at 60 min after 11 C-choline administration and 18 F-FDG PET scan was performed at 60 min after 18 F-FDG administration. The maximal standardized uptake value of tumor was calculated. The animals were euthanized after examination. Histochemical stain with proliferating cell nuclear antigen (PCNA) was performed and PCNA index was obtained to assess tumor proliferation. The difference of 11 C-choline and 18 F-FDG was analyzed using paired student t-test. The correlation of 11 C-choline 18 F-FDG and tumor cell density and PCNA index was analyzed using Pearson linear regression. Results: Of the 54 rabbits, 36 had a solitary pulmonary tumor. The rate of successful generation of a solitary VX2 tumor was 66.7% (36/54). Only 33 rabbits underwent both 11 C-choline and 18 F-FDG PET, and enrolled in this study. The mean cellular density was (547.36 ± 64.78) cells/field and the mean PCNA index was (42.34 ± 15.26)%. 18 F-FDG was higher than 11 C-choline (5.70 ± 3.45 vs 4.02 ± 3.07, t=-3.188, P=0.003). 11 C-choline significantly and positively correlated with PCNA index (r=0.786, P 11 C-choline and tumor cellular density (r=-0.176, P=0.327). 18 F-FDG significantly and

34 CFR 460.1 - What is the purpose of the Adult Education Act?

Science.gov (United States)

2010-07-01

... sufficient basic education to enable them to benefit from job training and retraining programs and obtain and... 34 Education 3 2010-07-01 2010-07-01 false What is the purpose of the Adult Education Act? 460.1 Section 460.1 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF...

How You Can Partner with NIH | NCI Technology Transfer Center | TTC

Science.gov (United States)

NCI Technology Transfer Center (TTC) provides an array of agreements to support the National Cancer Institute's partnering. Deciding which type of agreement to use can be a challenge: CRADA, MTA, collaboration, agreement, CTA, Materials-CRADA

Low-level 239PuO2 lifespan studies

International Nuclear Information System (INIS)

Sanders, C.L.

1985-01-01

This project will produce data to generate a dose-response curve (and to evaluate other statistical methods that also incorporate survival time) for lung-tumor incidence in Wistar rats following inhalation of 239 PuO 2 at levels producing lifetime radiation doses to the lung of 2000 rad. The lung clearance of 239 Pu is best represented by a two-exponential equation, with 78% of the initial alveolar depositions (IAD) cleared with a half-time of 19 days and 22% cleared with a half-time of 180 days. A total of 593 of 2134 exposed and 242 of 1058 sham-exposed rats have died. Among the dead rats, the percent with primary lung tumors was 71% for the 150-nCi group, 70% for the 82-nCi group, and 23% for the 32-nCi group. No lung tumors have been found in controls, and only three have been found at an IAD of < 7.5 nCi. 1 figure, 3 tables

History of the Diet History Questionnaire (DHQ) | EGRP/DCCPS/NCI/NIH

Science.gov (United States)

Learn about the evolution of the Diet History Questionnaire (DHQ), developed by the National Cancer Institute (NCI) initially in 2001, to the DHQ II in 2010, up to the present version, DHQ III, launched in 2018.

Cooperative regulation of non-small cell lung carcinoma by nicotinic and beta-adrenergic receptors: a novel target for intervention.

Directory of Open Access Journals (Sweden)

Hussein A N Al-Wadei

Full Text Available Lung cancer is the leading cause of cancer death; 80-85% of lung cancer cases are non-small cell lung cancer (NSCLC. Smoking is a documented risk factor for the development of this cancer. Although nicotine does not have the ability to initiate carcinogenic events, recent studies have implicated nicotine in growth stimulation of NSCLC. Using three NSCLC cell lines (NCI-H322, NCI-H441 and NCI-H1299, we identified the cooperation of nicotinic acetylcholine receptors (nAChRs and β-adrenergic receptors (β-ARs as principal regulators of these effects. Proliferation was measured by thymidine incorporation and MTT assays, and Western blots were used to monitor the upregulation of the nAChRs and activation of signaling molecules. Noradrenaline and GABA were measured by immunoassays. Nicotine-treated NSCLC cells showed significant induction of the α7nAChR and α4nAChR, along with significant inductions of p-CREB and p-ERK1/2 accompanied by increases in the stress neurotransmitter noradrenaline, which in turn led to the observed increase in DNA synthesis and cell proliferation. Effects on cell proliferation and signaling proteins were reversed by the α7nAChR antagonist α-BTX or the β-blocker propranolol. Nicotine treatment also down-regulated expression of the GABA synthesizing enzyme GAD 65 and the level of endogenous GABA, while treatment of NSCLC cells with GABA inhibited cell proliferation. Interestingly, GABA acts by reducing β-adrenergic activated cAMP signaling. Our findings suggest that nicotine-induced activation of this autocrine noradrenaline-initiated signaling cascade and concomitant deficiency in inhibitory GABA, similar to modulation of these neurotransmitters in the nicotine-addicted brain, may contribute to the development of NSCLC in smokers. Our data suggest that exposure to nicotine either by tobacco smoke or nicotine supplements facilitates growth and progression of NSCLC and that pharmacological intervention by β blocker may

Russian delegation visits NIH and NCI to discuss research collaboration

Science.gov (United States)

The NCI Center for Global Health hosted a delegation from the Russian Foundation for Basic Research to discuss ongoing and future collaborations in cancer research. The delegation was accompanied by representatives from the US Embassy in Moscow and the Embassy of the Russian Federation in Washington DC.

NIH Employee Invention Report (EIR) | NCI Technology Transfer Center | TTC

Science.gov (United States)

NIH researchers must immediately contact their Laboratory or Branch Chief and inform him or her of a possible invention, and then consult with your NCI TTC Technology Transfer Manager about submitting an Employee Invention Report (EIR) Form. | [google6f4cd5334ac394ab.html

Respiratory tract tumors in Syrian hamsters following inhalation of Pu--ZrO2 particles

International Nuclear Information System (INIS)

Thomas, R.G.; Smith, D.M.

1979-01-01

Inhalation of radionuclide-bearing particles remains one of the most intensely pursued problems concerning the nuclear industry. This route of entry is generally accepted as the most probable, in case of human exposure, with ingestion being the other prominent source of concern. Many laboratory investigations, such as those reported here, continue to evaluate the possible consequences that may present health problems to the public domain. Syrian hamsters of both sexes received either inhaled (INH) PuO 2 /ZrO 2 particles, intravenous (IV) PuO 2 /ZrO 2 microspheres, a combination of INH PuO 2 /ZrO 2 particles and injected PuO 2 /ZrO 2 microspheres, or no radionuclides (controls). The INH particles and IV microspheres were tagged with γ-emitting 57 Co to facilitate whole body counting and establishment of retention curves. Total lung burdens ranged from 8 nCi to 143 nCi. Significant numbers of primary lung tumors (5 to 50% per group) were induced in those animals that received INH exposures. Additional α radiation administered via Pu-laden IV microspheres had little or no effect on tumor production or nonneoplastic, degenerative changes in the respiratory tract

Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

International Nuclear Information System (INIS)

Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

2005-01-01

The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

78 FR 76189 - Supplemental Environmental Impact Statement for the Route 460 Location Study, Prince George...

Science.gov (United States)

2013-12-16

... DEPARTMENT OF TRANSPORTATION Federal Highway Administration Supplemental Environmental Impact Statement for the Route 460 Location Study, Prince George County to Suffolk, Virginia AGENCY: Federal... roughly parallel to the existing Route 460 corridor between Interstate 295 in Prince George County and...

41 CFR 102-36.460 - Do we report excess medical shelf-life items held for national emergency purposes?

Science.gov (United States)

2010-07-01

... medical shelf-life items held for national emergency purposes? 102-36.460 Section 102-36.460 Public... Disposal Requires Special Handling Shelf-Life Items § 102-36.460 Do we report excess medical shelf-life items held for national emergency purposes? When the remaining shelf life of any medical materials or...

Reliability of up-to-date risk factor between residential radon and lung cancer

International Nuclear Information System (INIS)

Tokonami, Shinji; Ishikawa, Tetsuo; Sorimachi, Atsuyuki; Kobayashi, Yosuke; Yoshinaga, Shinji; Quanfu, Sun; Akiba, Suminori

2008-01-01

Full text: The WHO launched an international radon project in January, 2005 because two major scientific articles on the residential-radon-and-lung-cancer risk have been published. Furthermore, the ICRP has just issued a new recommendation (Publ. 103). In the publication, radon issues have been mentioned using these references. They show that there is a significant correlation between radon exposures and lung cancer risks even with a somewhat lower radon concentration than an internationally recommended level (200 Bq m -3 ). In most cases, residential radon concentrations were measured by passive integrating radon monitors based on the alpha track detection techniques in their studies. We examined detection responses for the presence of thoron with some typical alpha track detectors (Kf K: Germany, Radtrak: USA and NRPB: UK), which were widely used in many epidemiological studies. In addition, we measured indoor radon and thoron concentrations in cave dwellings in Gansu Province, China, in which the National Cancer Institute (NCI) conducted a large-scale epidemiological study. The NCI concluded that there was also a significant correlation between the two aforementioned parameters, which was a similar value to recently acceptable one. However, our results on radon concentrations were obviously different from them because there was much thoron in that area. The present study demonstrates whether these risk factors are really correct throughout our data or not. Tokonami (2005) has pointed out that some of popular alpha track detectors are sensitive to thoron ( 220 Rn). This finding implies that radon readings will be overestimated and consequently may lead to biased estimates of lung cancer risk. The present study describes thoron interference on accurate radon measurements from the viewpoint of both experimental studies and field experiences. (author)

Project Execution Plan Project 98L-EWW-460 Plutonium Stabilization and Handling DOE No. 98-D-453

International Nuclear Information System (INIS)

HOLSTEIN, W.A.

1999-01-01

This Project Execution Plan (PEP) describes the management methods and responsibilities of the project participants. Project W-460 is sufficiently large to warrant a stand alone PEP. This project specific PEP describes the relationships and responsibilities of the project team and identifies the technical, schedule, and cost baselines that have been established for the project. The Department of Energy (DOE), Hanford Works (Hanford), at Richland, WA., currently does not have a system capable of stabilizing or packaging large quantities of plutonium-bearing solids to meet DOE technical standard DOE-STD-3013-96. This project will allow Hanford to meet this standard by installing stabilization and packaging equipment (SPE). The SPE is capable of stabilizing and packaging the current inventory of greater than 50 percent plutonium-bearing materials currently stored in the Plutonium Finishing Plant's (PFP) vaults into 3013 storage containers. The scope of this project is to procure and install the SPE via a Hanford contract and coordination with the Savannah River Site. In addition, the project will modify PFP vaults and upgrade the PFP Laboratory measurement systems. The Facility infrastructure will be modified to support the new SPE system and the new standardized storage container configuration. Use of this document is described in the Project Hanford Policy and Procedure System under HNF-PRO-1999, Construction Program Conceptual Phase

Respiratory tract carcinogenesis induced by radionuclides in the Syrian hamister

International Nuclear Information System (INIS)

Smith, D.M.; Thomas, R.G.; Anderson, E.C.

1979-01-01

Syrian hamsters were exposed to lung irradiation by various modalities that differed in degree of localization and the fraction of lung exposed. The animals were given alpha emitters under several exposure conditions: intratracheal (IT) instillation of 210 Po and 239 PuO 2 -ZrO 2 microspheres; inhalation (INH) of 238 239 PuO 2 -ZrO 2 particles; and/or intravenous (IV) injection of 238 239 PuO 2 -ZrO 2 microspheres. Beta-emitting 147 Pm was also administered; the radionuclide was incorporated into 10 μm diameter ZrO 2 microspheres and deposited in the lungs via the jugular vein. These microspheres lodge quantitatively in the pulmonary capillary bed for the duration of the animal's life span. Total IV Pu microsphere lung burdens have ranged from 0.14 nCi to 484 nCi and the number of spheres from 1500 to 880 000. Pu burdens from inhalation have ranged from 8 nCi to 101 nCi, IT Po burdens from 25 to 122 nCi, and Pm-laden microsphere burdens from 427 to 15 750 nCi. Intratracheal instillation of 210 Po solution gave nearly uniform alpha irradiation of the entire lung, intravenous injection of large numbers of ZrO 2 microspheres laden with 147 Pm gave whole lung exposures to low LET radiation, and IV injection of Pu-microspheres provided a gradation of focal alpha exposures. The Po and Pm exposures were highly tumorigenic, whereas the Pu microspheres produced tumors only when a large fraction of the lung was exposed to large radiation doses. However, Pu-ZrO 2 administered via inhalation was very carcinogenic and resulted in tumor incidences of 50% in some experiments. The IT instillation of Fe 2 O 3 following IV or IT Pu-ZrO 2 microsphere administration dramatically enhanced lung tumor induction

CellMiner: a relational database and query tool for the NCI-60 cancer cell lines

Directory of Open Access Journals (Sweden)

Reinhold William C

2009-06-01

Full Text Available Abstract Background Advances in the high-throughput omic technologies have made it possible to profile cells in a large number of ways at the DNA, RNA, protein, chromosomal, functional, and pharmacological levels. A persistent problem is that some classes of molecular data are labeled with gene identifiers, others with transcript or protein identifiers, and still others with chromosomal locations. What has lagged behind is the ability to integrate the resulting data to uncover complex relationships and patterns. Those issues are reflected in full form by molecular profile data on the panel of 60 diverse human cancer cell lines (the NCI-60 used since 1990 by the U.S. National Cancer Institute to screen compounds for anticancer activity. To our knowledge, CellMiner is the first online database resource for integration of the diverse molecular types of NCI-60 and related meta data. Description CellMiner enables scientists to perform advanced querying of molecular information on NCI-60 (and additional types through a single web interface. CellMiner is a freely available tool that organizes and stores raw and normalized data that represent multiple types of molecular characterizations at the DNA, RNA, protein, and pharmacological levels. Annotations for each project, along with associated metadata on the samples and datasets, are stored in a MySQL database and linked to the molecular profile data. Data can be queried and downloaded along with comprehensive information on experimental and analytic methods for each data set. A Data Intersection tool allows selection of a list of genes (proteins in common between two or more data sets and outputs the data for those genes (proteins in the respective sets. In addition to its role as an integrative resource for the NCI-60, the CellMiner package also serves as a shell for incorporation of molecular profile data on other cell or tissue sample types. Conclusion CellMiner is a relational database tool for

33 CFR 157.460 - Additional operational requirements for tank barges.

Science.gov (United States)

2010-07-01

... OF HOMELAND SECURITY (CONTINUED) POLLUTION RULES FOR THE PROTECTION OF THE MARINE ENVIRONMENT... Hulls Carrying Petroleum Oils § 157.460 Additional operational requirements for tank barges. (a...

In vitro culture and characterization of human lung cancer circulating tumor cells isolated by size exclusion from an orthotopic nude-mouse model expressing fluorescent protein.

Science.gov (United States)

Kolostova, Katarina; Zhang, Yong; Hoffman, Robert M; Bobek, Vladimir

2014-09-01

In the present study, we demonstrate an animal model and recently introduced size-based exclusion method for circulating tumor cells (CTCs) isolation. The methodology enables subsequent in vitro CTC-culture and characterization. Human lung cancer cell line H460, expressing red fluorescent protein (H460-RFP), was orthotopically implanted in nude mice. CTCs were isolated by a size-based filtration method and successfully cultured in vitro on the separating membrane (MetaCell®), analyzed by means of time-lapse imaging. The cultured CTCs were heterogeneous in size and morphology even though they originated from a single tumor. The outer CTC-membranes were blebbing in general. Abnormal mitosis resulting in three daughter cells was frequently observed. The expression of RFP ensured that the CTCs originated from lung tumor. These readily isolatable, identifiable and cultivable CTCs can be used to characterize individual patient cancers and for screening of more effective treatment.

Like a Good Neighbor, NCI-Frederick Is There | Poster

Science.gov (United States)

The main campus of the National Cancer Institute at Frederick is an island of sorts: 68 acres of land that was once part of Fort Detrick. Accessing NCI property means passing through the Fort Detrick gates and crossing the post. While the campus is surrounded by the military installation, is protected by NIH police, and doesn’t allow the use of tobacco products, it is not a

26 CFR 1.460-6 - Look-back method.

Science.gov (United States)

2010-04-01

...) for the redetermination year, as adjusted for past applications of the look-back method and taking... the year in question with respect to other contracts. Notwithstanding the look-back method, the...) INCOME TAXES Taxable Year for Which Items of Gross Income Included § 1.460-6 Look-back method. (a) In...

NCI designated cancer center funding not influenced by organizational structure.

Science.gov (United States)

Wolfe, Margaret E; Yagoda, Daniel; Thurman, Paul W; Luna, Jorge M; Figg, William Douglas

2009-05-01

National Cancer Institutes (NCI) designated cancer centers use one of three organizational structures. The hypothesis of this study is that there are differences in the amount of annual NCI funding per faculty member based on a cancer center's organizational structure. The study also considers the impact of secondary factors (i.e., the existence of a clinical program, the region and the size of the city in which the cancer center is located) on funding and the number of Howard Hughes Medical Institute (HHMI) investigators at each cancer center. Of the 63 cancer centers, 44 use a matrix structure, 16 have a freestanding structure, and three have a Department of Oncology structure. Kruskal-Wallis tests reveal no statistically significant differences in the amount of funding per faculty member or the number of HHMI investigators between centers with a matrix, freestanding or Department of Oncology structure. Online research and telephone interviews with each cancer center were used to gather information, including: organizational structure, the presence of a clinical program, the number of faculty members, and the number of Howard Hughes Medical Institute investigators. Statistical tests were used to assess the impact which organizational structure has on the amount of funding per faculty member and number of HHMI investigators. While the results seem to suggest that the organizational structure of a given cancer center does not impact the amount of NCI funding or number of HHMI investigators which it attracts, the existence of this relationship is likely masked by the small sample size in this study. Further studies may be appropriate to examine the effect organizational structure has on other measurements which are relevant to cancer centers, such as quality and quantity of research produced.

Investigation of internalization and cytotoxicity of 125I-[Tyr3]-octreotide in NCI-H446 cell line

International Nuclear Information System (INIS)

Sun Junjie; Fan Wo; Xu Yujie; Zhang Youjiu; Zhu Ran; Hu Mingjiang

2004-01-01

Objective: To investigate the [Tyr 3 ]-octreotide (TOC) internalizing capacity of NCI-H446 cell line, and the cytotoxicity of 125 I-TOC in NCI-H446 cell line. To assess the therapeutic radiopharmaceutical potentiality of 125 I-TOC for the somatostatin receptor (SSTR) positive tumor. Methods: NCI-H446 cells were incubated together with 125 I-TOC for different periods of time, the amount of internalized 125 I-TOC and the 125 I-TOC bound on the cellular nucleus were detected with γ counter, respectively. The viability of the cells was analyzed by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay at different time points with various doses of 125 I-TOC, free 125 I and TOC. Results: 125 I-TOC was internalized into the nucleus and bound on the nucleus in a time-dependent manner. 125 I-TOC bound on the nucleus increased to the highest level at 24 h, the amount of nucleus bound 125 I-TOC at 24 h was 7 times higher than that at 0.5 h. Cytotoxicity of 125 I-TOC in SSTR positive NCI-H446 cells was also dose- and time-dependent. The supreme effect of cytotoxicity was found at 96 h with 74 kBq 125 I-TOC, the survival ratio of cells was reduced to (44.8 ± 7.2)%. Conclusions: 125 I-TOC can be internalized into SSTR positive cells mediated by SSTR. The NCI-H446 cells can be killed by Auger electron emitting from 125 I-TOC. Effect of cytotoxicity showed dose- and time-dependent

In-111-oxine-labeled negative liposomes in tumor-bearing mice

International Nuclear Information System (INIS)

Chatal, J.F.; Guihard, D.; Bardy, A.; Pasqualini, R.

1983-01-01

The distribution of In-111-oxine-labelled liposomes in C 57 Bl 6 mice bearing a Lewis lung tumor and the variations contingent on modification of certain parameters have been studied. The distribution has been compared with that of Ga-67 citrate which is known for its affinity for lung tumors. In conclusion, it may be said that In-111-labeled negatively charged liposomes handled in oxygen-free conditions and having a size smaller than 80 nm make it possible to visualize a murine tumor as well, and even better, than does Ga-67 citrate

Best Performers Announced for the NCI-CPTAC DREAM Proteogenomics Computational Challenge | Office of Cancer Clinical Proteomics Research

Science.gov (United States)

The National Cancer Institute (NCI) Clinical Proteomic Tumor Analysis Consortium (CPTAC) is pleased to announce that teams led by Jaewoo Kang (Korea University), and Yuanfang Guan with Hongyang Li (University of Michigan) as the best performers of the NCI-CPTAC DREAM Proteogenomics Computational Challenge. Over 500 participants from 20 countries registered for the Challenge, which offered $25,000 in cash awards contributed by the NVIDIA Foundation through its Compute the Cure initiative.

Direct cortical hemodynamic mapping of somatotopy of pig nostril sensation by functional near-infrared cortical imaging (fNCI).

Science.gov (United States)

Uga, Minako; Saito, Toshiyuki; Sano, Toshifumi; Yokota, Hidenori; Oguro, Keiji; Rizki, Edmi Edison; Mizutani, Tsutomu; Katura, Takusige; Dan, Ippeita; Watanabe, Eiju

2014-05-01

Functional near-infrared spectroscopy (fNIRS) is a neuroimaging technique for the noninvasive monitoring of human brain activation states utilizing the coupling between neural activity and regional cerebral hemodynamics. Illuminators and detectors, together constituting optodes, are placed on the scalp, but due to the presence of head tissues, an inter-optode distance of more than 2.5cm is necessary to detect cortical signals. Although direct cortical monitoring with fNIRS has been pursued, a high-resolution visualization of hemodynamic changes associated with sensory, motor and cognitive neural responses directly from the cortical surface has yet to be realized. To acquire robust information on the hemodynamics of the cortex, devoid of signal complications in transcranial measurement, we devised a functional near-infrared cortical imaging (fNCI) technique. Here we demonstrate the first direct functional measurement of temporal and spatial patterns of cortical hemodynamics using the fNCI technique. For fNCI, inter-optode distance was set at 5mm, and light leakage from illuminators was prevented by a special optode holder made of a light-shielding rubber sheet. fNCI successfully detected the somatotopy of pig nostril sensation, as assessed in comparison with concurrent and sequential somatosensory-evoked potential (SEP) measurements on the same stimulation sites. Accordingly, the fNCI system realized a direct cortical hemodynamic measurement with a spatial resolution comparable to that of SEP mapping on the rostral region of the pig brain. This study provides an important initial step toward realizing functional cortical hemodynamic monitoring during neurosurgery of human brains. Copyright © 2014. Published by Elsevier Inc.

NCI and the Chinese Academy of Medical Sciences Sign Statement of Intent

Science.gov (United States)

Today the National Cancer Institute (NCI) and the Cancer Institute/Hospital of the Chinese Academy of Medical Sciences (CICAMS) signed a statement of intent to share an interest in fostering collaborative biomedical research in oncology and a common goal

42 CFR 460.204 - Financial recordkeeping and reporting requirements.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Financial recordkeeping and reporting requirements...-INCLUSIVE CARE FOR THE ELDERLY (PACE) Data Collection, Record Maintenance, and Reporting § 460.204 Financial... financial statements. (c) Accepted reporting practices. Except as specified under Medicare principles of...

NCI's national environmental research data collection: metadata management built on standards and preparing for the semantic web

Science.gov (United States)

Wang, Jingbo; Bastrakova, Irina; Evans, Ben; Gohar, Kashif; Santana, Fabiana; Wyborn, Lesley

2015-04-01

National Computational Infrastructure (NCI) manages national environmental research data collections (10+ PB) as part of its specialized high performance data node of the Research Data Storage Infrastructure (RDSI) program. We manage 40+ data collections using NCI's Data Management Plan (DMP), which is compatible with the ISO 19100 metadata standards. We utilize ISO standards to make sure our metadata is transferable and interoperable for sharing and harvesting. The DMP is used along with metadata from the data itself, to create a hierarchy of data collection, dataset and time series catalogues that is then exposed through GeoNetwork for standard discoverability. This hierarchy catalogues are linked using a parent-child relationship. The hierarchical infrastructure of our GeoNetwork catalogues system aims to address both discoverability and in-house administrative use-cases. At NCI, we are currently improving the metadata interoperability in our catalogue by linking with standardized community vocabulary services. These emerging vocabulary services are being established to help harmonise data from different national and international scientific communities. One such vocabulary service is currently being established by the Australian National Data Services (ANDS). Data citation is another important aspect of the NCI data infrastructure, which allows tracking of data usage and infrastructure investment, encourage data sharing, and increasing trust in research that is reliant on these data collections. We incorporate the standard vocabularies into the data citation metadata so that the data citation become machine readable and semantically friendly for web-search purpose as well. By standardizing our metadata structure across our entire data corpus, we are laying the foundation to enable the application of appropriate semantic mechanisms to enhance discovery and analysis of NCI's national environmental research data information. We expect that this will further

Ressonàncies en plasmons sobre grafè

OpenAIRE

Alcaraz Iranzo, David

2014-01-01

Treball final de màster oficial fet en col·laboració amb Universitat Autònoma de Barcelona (UAB), Universitat de Barcelona (UB) i Institut de Ciències Fotòniques (ICFO) [ANGLÈS] Graphene is used as a novel, versatile plasmonic material. The most common way to implement resonant light-plasmon coupling is to etch graphene into periodic nanostructures, which is invasive. Here, we study a non-invasive way to engineer graphene plasmon resonances, based on periodic doping profiles. The plasmon r...

Craig Reynolds, Ph.D., to Retire as NCI Associate Director for Frederick | Poster

Science.gov (United States)

On December 2, Craig Reynolds, Ph.D., director, Office of Scientific Operations, and NCI associate director for Frederick, will put the finishing touches on a 37-year career with the National Cancer Institute.

New Phone System Coming to NCI Campus at Frederick | Poster

Science.gov (United States)

By Travis Fouche and Trent McKee, Guest Writers Beginning in September, phones at the NCI Campus at Frederick will begin to be replaced, as the project to upgrade the current phone system ramps up. Over the next 16 months, the Information Systems Program (ISP) will be working with Facilities Maintenance and Engineering and Computer & Statistical Services to replace the current

Impact of Toxicity Grade and Scoring System on the Relationship Between Mean Lung Dose and Risk of Radiation Pneumonitis in a Large Cohort of Patients With Non-Small Cell Lung Cancer

International Nuclear Information System (INIS)

Tucker, Susan L.; Jin Hekun; Wei Xiong

2010-01-01

Purpose: To compute the risk of radiation pneumonitis (RP) as a function of mean lung dose (MLD), with RP scored using three grading systems and analyzed at four threshold levels of toxicity in a large cohort of patients with non-small cell lung cancer (NSCLC) treated with definitive radiotherapy (RT). Methods and Materials: On the basis of medical records and radiographic images, RP was scored retrospectively in 442 patients with NSCLC who had ≥6 months of follow-up after the end of RT. The severity of RP was scored for each patient using the National Cancer Institute (NCI) Common Toxicity Criteria, version 2.0 (CTC2.0); the NCI Common Terminology Criteria for Adverse Events, version 3.0 (CTCAE3.0); and the grading system of the Radiation Therapy Oncology Group (RTOG). For each grading system and for each of four levels of toxicity (Grade ≥1, ≥2, ≥3, ≥4), the Lyman, logistic, and log-logistic normal tissue complication probability (NTCP) models were fitted to the data as functions of MLD. The parameter estimates from the model fits are listed in table form, and the RP risk estimates are presented graphically for the Lyman and log-logistic NTCP models. Results: The results presented here illustrate the impact of scoring system and level of toxicity on the relationship between MLD and RP risk. Conclusions: These results facilitate quantitative comparisons between our data and studies of RP risk reported by others, and several examples of such comparisons are provided.

20 CFR 670.460 - What restrictions are there on the assignment of eligible applicants for nonresidential...

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What restrictions are there on the assignment of eligible applicants for nonresidential enrollment in Job Corps? 670.460 Section 670.460 Employees... WORKFORCE INVESTMENT ACT Recruitment, Eligibility, Screening, Selection and Assignment, and Enrollment § 670...

Flavonoid Composition and Antitumor Activity of Bee Bread Collected in Northeast Portugal

Directory of Open Access Journals (Sweden)

Filipa Sobral

2017-02-01

Full Text Available Bee bread (BB is a fermented mixture of plant pollen, honey, and bee saliva that worker bees use as food for larvae, and for young bees to produce royal jelly. In the present study, five BB samples, collected from Apis mellifera iberiensis hives located in different apiaries near Bragança, in the northeast region of Portugal, and one BB commercial sample were characterized by high-performance liquid chromatography coupled to a diode array detector and electrospray mass spectrometry (HPLC-DAD-ESI/MS in terms of phenolic compounds, such as flavonoid glycoside derivatives. Furthermore, the samples were screened, using in vitro assays, against different human tumor cell lines, MCF-7 (breast adenocarcinoma, NCI-H460 (non-small cell lung cancer, HeLa (cervical carcinoma and HepG2 (hepatocellular carcinoma, and also against non-tumor liver cells (porcine liver cells, PLP2. The main phenolic compounds found were flavonol derivatives, mainly quercetin, kaempferol, myricetin, isorhamnetin and herbacetrin glycoside derivatives. Thirty-two compounds were identified in the six BB samples, presenting BB1 and BB3 with the highest contents (6802 and 6480 µg/g extract, respectively and the highest number of identified compounds. Two isorhamnetin glycoside derivatives, isrohamnetin-O-hexosyl-O-rutinoside and isorhamnetin-O-pentosyl-hexoside, were the most abundant compounds present in BB1; on the other hand, quercetin-3-O-rhamnoside was the most abundant flavonol in BB3. However, it was not possible to establish a correlation between the flavonoids and the observed low to moderate cytotoxicity (ranging from >400 to 68 µg/mL, in which HeLa and NCI-H460 cell lines were the most susceptible to the inhibition. To the authors’ knowledge, this is the first report characterizing glycosidic flavonoids in BB samples, contributing to the chemical knowledge of this less explored bee product.

Hedgehog Pathway Inhibitor HhAntag691 Is a Potent Inhibitor of ABCG2/BCRP and ABCB1/Pgp

Directory of Open Access Journals (Sweden)

Yimao Zhang

2009-01-01

Full Text Available HhAntag691 (GDC-0449, a low-molecular weight inhibitor of the tumor-promoting hedgehog (Hh signaling pathway, has been used to treat medulloblastoma in animal models and has recently entered clinical trials for a variety of solid tumors. Here, we show that HhAntag691 inhibits multiple ATP-binding cassette (ABC transporters. ATP-binding cassette transporters are within a family of membrane proteins, the overexpression of which is associated with multidrug resistance, a major impediment to successful cancer treatment. HhAntag691 is a potent inhibitor of two ABC transporters, ABCG2/BCRP and ABCB1/Pgp, and is a mild inhibitor of ABCC1/MRP1. In ABCG2-overexpressing HEK293 cells, HhAntag691 increased retention of the fluorescent ABCG2 substrate BODIPY-prazosin and resensitized these cells to mitoxantrone, an antineoplastic ABCG2 substrate. In Madin-Darby canine kidney II cells engineered to overexpress Pgp or MRP1, HhAntag691 increased the retention of calcein-AM and resensitized them to colchicine. HhAntag691 also resensitized human non-small cell lung carcinoma cells NCI-H460/par and NCI-H460/MX20, which overexpress ABCG2 in response to mitoxantrone, to mitoxantrone, and to topotecan or SN-38. The IC50 values of HhAntag691 for inhibition of ABCG2 and Pgp were ∼1.4 and ∼3.0 µM, respectively. Because ABC transporters are highly expressed at the blood-brain barrier and on many tumor cells, they contribute significantly to treatment failure of many types of cancer, particularly of those within the neuraxis. In addition to its effect on Hh signaling, the ability of HhAntag691 and related compounds to inhibit two key ABC transporters could contribute to their effectiveness in treating malignancies.

Effects of inhaled insoluble 239PuO2 on immune responses following lung immunization

International Nuclear Information System (INIS)

Bice, D.E.; Harris, D.L.; Brooks, A.L.; Mewhinney, J.A.

1978-01-01

To determine if inhaled 239 PuO 2 suppresses immunity in lung-associated lymph nodes, Chinese hamsters were exposed to a polydisperse aerosol of 239 PuO 2 produced at 1150 0 C. The mean lung burden of these animals was estimated to be 10 nCi at 8 days after exposure. At 128, 256 and 400 days after exposure, sham exposed controls and experimental animals were immunized by intratracheal instillation of 1 x 10 8 sheep red blood cells (SRBC). Six days later, they were sacrificed and the number of antibody forming cells (AFC) in lung-associated lymph nodes, spleen and cervical lymph nodes was evaluated. Results of these studies indicated that the number of AFC in lung-associated lymph modes was significantly lower in animals exposed to 239 PuO 2 . Only a few AFC were found in spleen and cervical lymph nodes after intratracheal immunization and the number in exposed animals was not significantly different than in the controls. These data indicate that even though the 239 PuO 2 exposure had suppressed immune responses in lung-associated lymph nodes, their filtering capacity was unaffected and antigen did not translocate to the spleen. We conclude that, at the sacrifice intervals evaluated, the immune function of lung-associated lymph nodes was suppressed and that distant lymphoid tissue (e.g., spleen and cervical lymph nodes) did not replace the immune function of the lung-associated lymph nodes

A Gene-Based Prognostic for Hepatocellular Carcinoma Patient Response to Adjuvant Transcatheter Arterial Chemoembolization | NCI Technology Transfer Center | TTC

Science.gov (United States)

The gold standard of care for hepatocellular carcinoma patients with intermediate- to locally advanced tumors is transcatheter arterial chemoembolization (TACE), a procedure whereby the tumor is targeted both with local chemotherapy and restriction of local blood supply. NCI scientists have identified a 14-gene signature predictive of response to TACE, and NCI seeks licensees or co-development partners to develop the technology toward commercialization.

46 CFR 182.460 - Ventilation of spaces containing machinery powered by, or fuel tanks for, gasoline.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Ventilation of spaces containing machinery powered by, or fuel tanks for, gasoline. 182.460 Section 182.460 Shipping COAST GUARD, DEPARTMENT OF HOMELAND..., gasoline. (a) A space containing machinery powered by, or fuel tanks for, gasoline must have a ventilation...

It’s Easy to Recycle at NCI at Frederick | Poster

Science.gov (United States)

From 2013 through the first quarter of 2018, NCI at Frederick has recycled over 1,667 tons of material, while incinerating or landfilling over 4,273 tons of trash. This earns us a recycling rate close to 28 percent, which is below the national average of 32 percent, according to the Environmental Protection Agency, and well below our goal of 50 percent. (These numbers only

Interim report on intrathoracic radiotherapy of human small-cell lung carcinoma in nude mice with Re-188-RC-160, a radiolabeled somatostatin analogue

International Nuclear Information System (INIS)

Zamora, P.O.; Bender, H.; Biersack, H.J.; Knapp, F.F. Jr.

1995-01-01

The purpose of this study was to evaluate the therapeutic efficacy of Re-188-RC-160 in experimental models of human small cell lung carcinomas which mimic the clinical presentation. In the experimental model, cells from the human small cell lung carcinoma cell line NCI-H69 cells were inoculated into the thoracic cavity of athymic mice and rats. Subsequently, the biodistribution of Re-188-RC-160 after injection into the pleural cavity, a radiolabeled somatostatin analogue, was monitored as was the effect on the subsequent growth of tumors. The results presented here, and which are a part of a larger series of studies, suggest that Re-188-RC-160 can be effectively used in this animal model to restrict the growth of small cell lung carcinoma in the thoracic cavity

26 CFR 1.460-2 - Long-term manufacturing contracts.

Science.gov (United States)

2010-04-01

... time normally required to design and manufacture the first unit of an item for which the taxpayer... manufacture a new type of industrial equipment. C reasonably expects the normal production period for this... 26 Internal Revenue 6 2010-04-01 2010-04-01 false Long-term manufacturing contracts. 1.460-2...

Preparation of Rhodium(III) complexes with 2(1H)-quinolinone derivatives and evaluation of their in vitro and in vivo antitumor activity.

Science.gov (United States)

Lu, Xing; Wu, Yi-Ming; Yang, Jing-Mei; Ma, Feng-E; Li, Liang-Ping; Chen, Sheng; Zhang, Ye; Ni, Qing-Ling; Pan, Ying-Ming; Hong, Xue; Peng, Yan

2018-05-10

A series of 2(1H)-quinolinone derivatives and their rhodium (III) complexes were designed and synthesized. All the rhodium (III) complexes exhibited higher in vitro cytotoxicity for Hep G2, HeLa 229, MGC80-3, and NCI-H460 human tumor cell lines than their ligands and cisplatin, and among them complex 9 was found to be selectively cytotoxic to tumor cells. Further investigation revealed that complex 9 caused cell cycle arrest at the G2/M phase and induced apoptosis, and inhibited the proliferation of Hep G2 cells by impeding the phosphorylation of epidermal growth factor receptor (EGFR) and its downstream enzymes. Complex 9 also up-regulated the proapoptotic proteins Bak, Bax, and Bim, which altogether activated caspase-3/9 to initiate cell apoptosis. Notably, complex 9 effectively inhibited tumor growth in the NCI-H460 xenograft mouse model with less adverse effect than cisplatin. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Total Hip Arthroplasty Bearing Surface Trends in the United States From 2007 to 2014: The Rise of Ceramic on Polyethylene.

Science.gov (United States)

Heckmann, Nathanael D; Sivasundaram, Lakshmanan; Stefl, Michael D; Kang, Hyunwoo Paco; Basler, Eric T; Lieberman, Jay R

2018-06-01

Wear of the bearing surface is a critical element in determining the longevity of a total hip arthroplasty (THA). Over the past decade, concerns related to modern metal-on-metal (MoM) bearings and corrosion at the femoral head-neck interface have influenced surgeon selection of bearing surfaces. The purpose of this study is to analyze trends in THA bearing surface selection from 2007 through 2014 using a large national database. The Nationwide Inpatient Sample database was used to extract bearing surface data from patients who underwent a primary THA between 2007 and 2014. Patients were grouped by bearing surface type: metal-on-polyethylene (MoP), ceramic-on-polyethylene (CoP), MoM, and ceramic-on-ceramic (CoC) bearings. Descriptive statistics were employed to describe trends. Univariate and multivariate analyses were performed to identify differences between bearing surface groups. During the study period, 2,460,640 THA discharges were identified, of which 1,059,825 (43.1%) had bearing surface data. A total of 496,713 (46.9%) MoP, 307,907 (29.1%) CoP, 210,381 (19.9%) MoM, and 44,823 (4.2%) CoC cases were identified. MoM utilization peaked in 2008 representing 40.1% of THAs implanted that year and steadily declined to 4.0% in 2014. From 2007 to 2014, the use of CoP bearing surfaces increased from 11.1% of cases in 2007 to 50.8% of cases in 2014. In 2014, CoP utilization surpassed MoP which represented 42.1% of bearing surfaces that year. During the study period, MoM bearing surfaces decreased precipitously, while CoP surpassed MoP as the most popular bearing surface used in a THA. Copyright © 2018 Elsevier Inc. All rights reserved.

Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study.

Science.gov (United States)

Feng, Yuan; Zhou, Jihong; Li, Zhanhua; Jiang, Ying; Zhou, Ying

2016-01-01

Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines) and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis activation in lung cancer cells, which was evidenced by TRAIL/death receptor-5 (DR5) induction and caspase-8 activation. The caspase-8 inhibitor or TRAIL/DR5 siRNA knockdown alleviated ONC201's cytotoxicity against lung cancer cells. Molecularly, ONC201 in-activated Akt-S6K1 and Erk signalings in lung cancer cells, causing Foxo3a nuclear translocation. For the in vivo studies, intraperitoneal injection of ONC201 at well-tolerated doses significantly inhibited xenografted A549 tumor growth in severe combined immunodeficient (SCID) mice. Further, ONC201 administration induced TRAIL/DR5 expression, yet inactivated Akt-S6K1 and Erk in tumor tissues. These results of the study demonstrates the potent anti-lung cancer activity by ONC201.

Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study.

Directory of Open Access Journals (Sweden)

Yuan Feng

Full Text Available Tumor necrosis factor (TNF-related apoptosis-inducing ligand (TRAIL selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis activation in lung cancer cells, which was evidenced by TRAIL/death receptor-5 (DR5 induction and caspase-8 activation. The caspase-8 inhibitor or TRAIL/DR5 siRNA knockdown alleviated ONC201's cytotoxicity against lung cancer cells. Molecularly, ONC201 in-activated Akt-S6K1 and Erk signalings in lung cancer cells, causing Foxo3a nuclear translocation. For the in vivo studies, intraperitoneal injection of ONC201 at well-tolerated doses significantly inhibited xenografted A549 tumor growth in severe combined immunodeficient (SCID mice. Further, ONC201 administration induced TRAIL/DR5 expression, yet inactivated Akt-S6K1 and Erk in tumor tissues. These results of the study demonstrates the potent anti-lung cancer activity by ONC201.

16 CFR 460.15 - How installers must handle fact sheets.

Science.gov (United States)

2010-01-01

... ADVERTISING OF HOME INSULATION § 460.15 How installers must handle fact sheets. If you are an installer, you... from you, you must show them the fact sheet(s) for the type(s) of insulation they want. You can decide...

Tendències en el disseny metodològic de recerca sobre l’avaluació de competències a l’educació superior

Directory of Open Access Journals (Sweden)

Karina Angélica Villegas Sandoval

2017-01-01

Full Text Available L’article té com a finalitat descriure i analitzar les metodologies d'investigació utilitzades per estudis recents que aborden el tema de l’avaluació per competències a l’educació superior i la formació docent, per tal de detectar les tendències en el disseny metodològic i orientar futurs projectes d'investigació sobre aquest tema. El mètode de treball que s'ha seguit per dur a terme aquest estudi és l’anàlisi de contingut de 22 documents trobats a Dialnet. Els resultats mostren que les investigacions que tracten el tema assenyalat han anat en augment en els últims tretze anys, i es destaca el canvi de metodologia utilitzada, amb dissenys majoritàriament descriptius i avaluatius. Al seu torn, però, crida l'atenció que un gran nombre d'estudis no expliquen ni el mètode ni el disseny d'investigació que han aplicat. Es conclou que és important que les investigacions presentin un apartat que al·ludeixi al disseny metodològic a fi d’afavorir la comprensió del lector dels processos d'indagació que s'han dut a terme.

Quality Assurance program plan - plutonium stabilization and handling project W-460

International Nuclear Information System (INIS)

SCHULTZ, J.W.

1999-01-01

This Quality Assurance Program Plan (QAPP) identifies Project Quality Assurance (QA) program requirements for all parties participating in the design, procurement, demolition, construction, installation, inspection and testing for Project W-460

Discovery and Synthesis of Caracolamide A, an Ion Channel Modulating Dichlorovinylidene Containing Phenethylamide from a Panamanian Marine Cyanobacterium cf. Symploca Species.

Science.gov (United States)

Naman, C Benjamin; Almaliti, Jehad; Armstrong, Lorene; Caro-Díaz, Eduardo J; Pierce, Marsha L; Glukhov, Evgenia; Fenner, Amanda; Spadafora, Carmenza; Debonsi, Hosana M; Dorrestein, Pieter C; Murray, Thomas F; Gerwick, William H

2017-08-25

A recent untargeted metabolomics investigation into the chemical profile of 10 organic extracts from cf. Symploca spp. revealed several interesting chemical leads for further natural product drug discovery. Subsequent target-directed isolation efforts with one of these, a Panamanian marine cyanobacterium cf. Symploca sp., yielded a phenethylamide metabolite that terminates in a relatively rare gem-dichlorovinylidene moiety, caracolamide A (1), along with a known isotactic polymethoxy-1-alkene (2). Detailed NMR and HRESIMS analyses were used to determine the structures of these molecules, and compound 1 was confirmed by a three-step synthesis. Pure compound 1 was shown to have in vitro calcium influx and calcium channel oscillation modulatory activity when tested as low as 10 pM using cultured murine cortical neurons, but was not cytotoxic to NCI-H460 human non-small-cell lung cancer cells in vitro (IC 50 > 10 μM).

Jizanpeptins, Cyanobacterial Protease Inhibitors from a Symploca sp. Cyanobacterium Collected in the Red Sea.

Science.gov (United States)

Gallegos, David A; Saurí, Josep; Cohen, Ryan D; Wan, Xuemei; Videau, Patrick; Vallota-Eastman, Alec O; Shaala, Lamiaa A; Youssef, Diaa T A; Williamson, R Thomas; Martin, Gary E; Philmus, Benjamin; Sikora, Aleksandra E; Ishmael, Jane E; McPhail, Kerry L

2018-05-29

Jizanpeptins A-E (1-5) are micropeptin depsipeptides isolated from a Red Sea specimen of a Symploca sp. cyanobacterium. The planar structures of the jizanpeptins were established using NMR spectroscopy and mass spectrometry and contain 3-amino-6-hydroxy-2-piperidone (Ahp) as one of eight residues in a typical micropeptin motif, as well as a side chain terminal glyceric acid sulfate moiety. The absolute configurations of the jizanpeptins were assigned using a combination of Marfey's methodology and chiral-phase HPLC analysis of hydrolysis products compared to commercial and synthesized standards. Jizanpeptins A-E showed specific inhibition of the serine protease trypsin (IC 50 = 72 nM to 1 μM) compared to chymotrypsin (IC 50 = 1.4 to >10 μM) in vitro and were not overtly cytotoxic to HeLa cervical or NCI-H460 lung cancer cell lines at micromolar concentrations.

Cisplatin-mediated radiosensitization of non-small cell lung cancer cells is stimulated by ATM inhibition

International Nuclear Information System (INIS)

Toulany, Mahmoud; Mihatsch, Julia; Holler, Marina; Chaachouay, Hassan; Rodemann, H. Peter

2014-01-01

Background and purpose: Cisplatin activates ataxia-telangiectasia-mutated (ATM), a protein with roles in DNA repair, cell cycle progression and autophagy. We investigated the radiosensitizing effect of cisplatin with respect to its effect on ATM pathway activation. Material and methods: Non-small cell lung cancer cells (NSCLC) cell lines (A549, H460) and human fibroblast (ATM-deficient AT5, ATM-proficient 1BR3) cells were used. The effects of cisplatin combined with irradiation on ATM pathway activity, clonogenicity, DNA double-strand break (DNA-DSB) repair and cell cycle progression were analyzed with Western blotting, colony formation and γ-H2AX foci assays as well as FACS analysis, respectively. Results: Cisplatin radiosensitized H460 cells, but not A549 cells. Radiosensitization of H460 cells was not due to impaired DNA-DSB repair, increased apoptosis or cell cycle dysregulation. The lack of radiosensitization demonstrated for A549 cells was associated with cisplatin-mediated stimulation of ATM (S1981) and AMPKα (T172) phosphorylation and autophagy. However, in both cell lines inhibition of ATM and autophagy by KU-55933 and chloroquine diphosphate (CQ) respectively resulted in a significant radiosensitization. Combined treatment with the AMPK inhibitor compound-C led to radiosensitization of A549 but not of H460 cells. As compared to the treatment with KU-55933 alone, radiosensitivity of A549 cells was markedly stimulated by the combination of KU-55933 and cisplatin. However, the combination of CQ and cisplatin did not modulate the pattern of radiation sensitivity of A549 or H460 cells. In accordance with the results that cisplatin via stimulation of ATM activity can abrogate its radiosensitizing effect, ATM deficient cells were significantly sensitized to ionizing radiation by cisplatin. Conclusion: The results obtained indicate that ATM targeting can potentiate cisplatin-induced radiosensitization

Program Spotlight: Ground Broken for NCI-supported Cancer Treatment Center in Puerto Rico

Science.gov (United States)

Dr. Sanya A. Springfield represented NCI at the groundbreaking ceremonies for the University of Puerto Rico (UPR) cancer hospital. In her remarks, she acknowledged the driving force behind this development is the UPR and the MD Anderson Cancer Center partnership.

Softball Games Bring NCI and Leidos Biomed Employees Together | Poster

Science.gov (United States)

NCI and Leidos Biomed employees took to the fields at Nallin Pond for the third annual slow-pitch softball games on August 26. The series attracted 54 employees who were divided into four teams, Red, Blue, Gray, and White, and they were cheered on by about 40 enthusiastic spectators. In the first set of games, the Gray team defeated the Blue team, 15–8, and the White team

Deterioration of mechanical properties of high strength structural steel S460N under transient state fire condition

International Nuclear Information System (INIS)

Qiang, Xuhong; Bijlaard, Frans S.K.; Kolstein, Henk

2012-01-01

Highlights: ► Mechanical properties of S460N under transient state fire condition are obtained. ► Elevated-temperature mechanical properties of steels are dependent on steel grades. ► No design standard is applicable to HSS S460N under transient state fire condition. ► Specific statements on various HSS in fire should be proposed in design standards. ► Research results offer accurate material property for structural design engineers. -- Abstract: 911 World Trade Centre Tragedy put fire safety of constructional steel structures into question. Since then, more and more research attention has been paid to the elevated-temperature mechanical properties of structural steels, which is a critical basis of evaluating the fire performance of steel structures. In the literature the available mechanical properties of structural steels under fire conditions were mainly obtained from steady state test method, as steady state test method is easier to perform than transient state test method and offers stress–strain curves directly. However, the transient state fire condition is considered to be more realistic to represent the real condition when constructions are exposed to fire. In order to reveal the deterioration of mechanical properties of the commonly used high strength structural steel S460N under transient state fire condition, tensile tests were conducted under various constant stress levels up to 800 MPa. The reduction factors of elastic modulus, yield and ultimate strengths of S460N under transient state fire condition were obtained and compared with current leading design standards and available literature. The application of such accurate elevated-temperature mechanical properties reduction factors of S460N can ensure a safe fire-resistance design and evaluation of steel structures with high strength steel S460N under transient state fire condition. This experimental study also supports other relative research on fire performance of steel structures with

Health effects research and regulation of diesel exhaust: an historical overview focused on lung cancer risk.

Science.gov (United States)

Hesterberg, Thomas W; Long, Christopher M; Bunn, William B; Lapin, Charles A; McClellan, Roger O; Valberg, Peter A

2012-06-01

The mutagenicity of organic solvent extracts from diesel exhaust particulate (DEP), first noted more than 55 years ago, initiated an avalanche of diesel exhaust (DE) health effects research that now totals more than 6000 published studies. Despite an extensive body of results, scientific debate continues regarding the nature of the lung cancer risk posed by inhalation of occupational and environmental DE, with much of the debate focused on DEP. Decades of scientific scrutiny and increasingly stringent regulation have resulted in major advances in diesel engine technologies. The changed particulate matter (PM) emissions in "New Technology Diesel Exhaust (NTDE)" from today's modern low-emission, advanced-technology on-road heavy-duty diesel engines now resemble the PM emissions in contemporary gasoline engine exhaust (GEE) and compressed natural gas engine exhaust more than those in the "traditional diesel exhaust" (TDE) characteristic of older diesel engines. Even with the continued publication of epidemiologic analyses of TDE-exposed populations, this database remains characterized by findings of small increased lung cancer risks and inconsistent evidence of exposure-response trends, both within occupational cohorts and across occupational groups considered to have markedly different exposures (e.g. truckers versus railroad shopworkers versus underground miners). The recently published National Institute for Occupational Safety and Health (NIOSH)-National Cancer Institute (NCI) epidemiologic studies of miners provide some of the strongest findings to date regarding a DE-lung cancer association, but some inconsistent exposure-response findings and possible effects of bias and exposure misclassification raise questions regarding their interpretation. Laboratory animal studies are negative for lung tumors in all species, except for rats under lifetime TDE-exposure conditions with durations and concentrations that lead to "lung overload." The species specificity of the

Health effects research and regulation of diesel exhaust: an historical overview focused on lung cancer risk

Science.gov (United States)

Hesterberg, Thomas W.; Long, Christopher M.; Bunn, William B.; Lapin, Charles A.; McClellan, Roger O.; Valberg, Peter A.

2012-01-01

The mutagenicity of organic solvent extracts from diesel exhaust particulate (DEP), first noted more than 55 years ago, initiated an avalanche of diesel exhaust (DE) health effects research that now totals more than 6000 published studies. Despite an extensive body of results, scientific debate continues regarding the nature of the lung cancer risk posed by inhalation of occupational and environmental DE, with much of the debate focused on DEP. Decades of scientific scrutiny and increasingly stringent regulation have resulted in major advances in diesel engine technologies. The changed particulate matter (PM) emissions in “New Technology Diesel Exhaust (NTDE)” from today's modern low-emission, advanced-technology on-road heavy-duty diesel engines now resemble the PM emissions in contemporary gasoline engine exhaust (GEE) and compressed natural gas engine exhaust more than those in the “traditional diesel exhaust” (TDE) characteristic of older diesel engines. Even with the continued publication of epidemiologic analyses of TDE-exposed populations, this database remains characterized by findings of small increased lung cancer risks and inconsistent evidence of exposure-response trends, both within occupational cohorts and across occupational groups considered to have markedly different exposures (e.g. truckers versus railroad shopworkers versus underground miners). The recently published National Institute for Occupational Safety and Health (NIOSH)-National Cancer Institute (NCI) epidemiologic studies of miners provide some of the strongest findings to date regarding a DE-lung cancer association, but some inconsistent exposure-response findings and possible effects of bias and exposure misclassification raise questions regarding their interpretation. Laboratory animal studies are negative for lung tumors in all species, except for rats under lifetime TDE-exposure conditions with durations and concentrations that lead to'lung overload."The species specificity

Vaccines for HIV | NCI Technology Transfer Center | TTC

Science.gov (United States)

The development of an effective HIV vaccine has been an ongoing area of research. The high variability in HIV-1 virus strains has represented a major challenge in successful development. Ideally, an effective candidate vaccine would provide protection against the majority of clades of HIV. Two major hurdles to overcome are immunodominance and sequence diversity. This vaccine utilizes a strategy for overcoming these two issues by identifying the conserved regions of the virus and exploiting them for use in a targeted therapy. NCI seeks licensees and/or research collaborators to commercialize this technology, which has been validated in macaque models.

Radiation response of human lung cancer cells with inherent and acquired resistance to cisplatin

International Nuclear Information System (INIS)

Twentyman, P.R.; Wright, K.A.; Rhodes, T.

1991-01-01

We have derived sublines of three human lung cancer cell lines with acquired resistance to cisplatin. The cisplatin resistant sublines of NCI-H69 (small cell), COR-L23 (large cell), and MOR (adenocarcinoma) show 5.3 fold, 3.1 fold, and 3.8 fold resistance, respectively, determined in a 6-day MTT assay. Although the parent lines show a wide range of glutathione content per cell, the sublines each show similar values to their corresponding parent line. Radiation response curves have been obtained using a soft agar clonogenic assay. Values obtained for the parent lines (95% CL in parentheses) were: NCI-H69: Do = 0.99 Gy (0.87-1.16), n = 2.9 (1.6-5.2), GSH = 14 ng/10(4) cells; COR-L23: Do = 1.23 Gy (1.05-1.49), n = 1.3 (0.7-2.2), GSH = 47 ng/10(4) cells; MOR: Do = 1.66 Gy (1.48-1.88), n = 3.0 (1.9-4.8), GSH = 86 ng/10(4) cells. The cisplatin resistant variants of NCI-H69 and COR-L23 showed 31% and 63% increases, respectively, in Do compared to their parent lines, whereas no change in radiation response was seen in MOR. In this panel of lines, therefore, although there is a correlation between glutathione content and radiosensitivity of the parent cell lines, acquired resistance to cisplatin is not accompanied by increased glutathione content. However, two of the three cisplatin resistant lines do show a significantly reduced radiosensitivity

NCI's High Performance Computing (HPC) and High Performance Data (HPD) Computing Platform for Environmental and Earth System Data Science

Science.gov (United States)

Evans, Ben; Allen, Chris; Antony, Joseph; Bastrakova, Irina; Gohar, Kashif; Porter, David; Pugh, Tim; Santana, Fabiana; Smillie, Jon; Trenham, Claire; Wang, Jingbo; Wyborn, Lesley

2015-04-01

The National Computational Infrastructure (NCI) has established a powerful and flexible in-situ petascale computational environment to enable both high performance computing and Data-intensive Science across a wide spectrum of national environmental and earth science data collections - in particular climate, observational data and geoscientific assets. This paper examines 1) the computational environments that supports the modelling and data processing pipelines, 2) the analysis environments and methods to support data analysis, and 3) the progress so far to harmonise the underlying data collections for future interdisciplinary research across these large volume data collections. NCI has established 10+ PBytes of major national and international data collections from both the government and research sectors based on six themes: 1) weather, climate, and earth system science model simulations, 2) marine and earth observations, 3) geosciences, 4) terrestrial ecosystems, 5) water and hydrology, and 6) astronomy, social and biosciences. Collectively they span the lithosphere, crust, biosphere, hydrosphere, troposphere, and stratosphere. The data is largely sourced from NCI's partners (which include the custodians of many of the major Australian national-scale scientific collections), leading research communities, and collaborating overseas organisations. New infrastructures created at NCI mean the data collections are now accessible within an integrated High Performance Computing and Data (HPC-HPD) environment - a 1.2 PFlop supercomputer (Raijin), a HPC class 3000 core OpenStack cloud system and several highly connected large-scale high-bandwidth Lustre filesystems. The hardware was designed at inception to ensure that it would allow the layered software environment to flexibly accommodate the advancement of future data science. New approaches to software technology and data models have also had to be developed to enable access to these large and exponentially

Selective and sensitive fluorescent sensor for Pd2+ using coumarin 460 for real-time and biological applications.

Science.gov (United States)

Ashwin, Bosco Christin Maria Arputham; Sivaraman, Gandhi; Stalin, Thambusamy; Yuvakkumar, Rathinam; Muthu Mareeswaran, Paulpandian

2018-05-03

The efficient fluorescent property of coumarin 460 (C460) is utilized to sense the Pd 2+ selectively and sensitively. Fabrication of a sensor strip using commercial adhesive tape is achieved and the detection of Pd 2+ is attempted using a handy UV torch. The naked eye detection in solution state using UV chamber is also attempted. The calculated high binding constant values support the strong stable complex formation of Pd 2+ with C460. The detection limit up to 2.5 × 10 -7  M is achieved using fluorescence spectrometer, which is considerably low from the WHO's recommendation. The response of coumarin 460 with various cations also studied. The quenching is further studied by the lifetime measurements. The binding mechanism is clearly explained by the 1 H NMR titration. The sensing mechanism is established as ICT. C460 strip's Pd 2+ quenching detection is further confirmed by solid-state PL study. The in-vitro response of Pd 2+ in a living cell is also studied using fluorescent imaging studies by means of HeLa cell lines and this probe is very compatible with biological environments. It could be applicable to sense trace amounts of a Pd 2+ ion from various industries. Compared with previous reports, this one is very cheap, sensitive, selective and suitable for biological systems. Copyright © 2018 Elsevier B.V. All rights reserved.

Study on the Relationship between the Inhalable Fine Particulate Matter of Xuanwei Coal Combustion and Lung Cancer

Directory of Open Access Journals (Sweden)

Jiapeng YANG

2015-07-01

Full Text Available Background and objective The high incidence of lung cancer in Xuanwei, China, has become an important restricting factor for livelihood development, thus exerting local social and economic impacts. Coal is the main fuel of the local community and also the main source of indoor pollution. This study aims to explore the coal combustion inhalable fine particulate matter (PM2.5 and its component output differences in different areas of Xuanwei, Yunnan. Moreover, the aim of this study is to investigate the relationship between inhalation of fine particles and high incidence of local lung cancer. Methods For combustion test, coal mines designated as C1, K7 and M30 were collected from LaoLin Colliery of Laibing Town, Huchang Colliery of Baoshan Town, and Taiping Colliery of Wenxing Town in Xuanwei, respectively. PM2.5 of indoor air was weighed, analyzed for elemental composition, and morphologically compared. The pathological specimen of lung cancer patients in Xuanwei who underwent operation was observed through electron microscope. Results The PM2.5 concentrations in indoor air were (8.244 ±1.460 mg/m3 (C1, (5.066±0.984 mg/m3 (K7, and (5.071±1.460 mg/m3 (M30. The differences among pairwise comparisons were statistically significant (P=0.029. The filter impurities of C1 coal seam primarily include Si- and O-enriched compounds. Moreover, three membranes that comprised other elements, including C, S, and Si, were observed. These membranes were evident from the aggregation of silica and a Ca-Al membrane. Compared with that of other coal seams, C1 coal generated a mass of impurities, in which several particles have irregular shape. We found nanoscale fine particles in some specimens of Xuanwei lung cancer patients. Conclusion The produced combustion of C1 coal was different from that of K7 and M30 coal. PM2.5 composition may be associated with the high local incidence of lung cancer.

NCI and the Chinese National Cancer Center pursue new collaborations in cancer research

Science.gov (United States)

CGH Director, Dr. Ted Trimble, and East Asia Program Director, Dr. Ann Chao, traveled to Beijing with Mr. Matthew Brown from the Department of Health and Human Services Office of Global Affairs to attend the Joint Meeting of the NCC and the U.S. NCI.

Inactivation and changes in metabolic profile of selected foodborne bacteria by 460 nm LED illumination.

Science.gov (United States)

Kumar, Amit; Ghate, Vinayak; Kim, Min-Jeong; Zhou, Weibiao; Khoo, Gek Hoon; Yuk, Hyun-Gyun

2017-05-01

The objective of this study was to investigate the effect of 460 nm light-emitting diode (LED) on the inactivation of foodborne bacteria. Additionally, the change in the endogenous metabolic profile of LED illuminated cells was analyzed to understand the bacterial response to the LED illumination. Six different species of bacteria (Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Pseudomonas aeruginosa and Salmonella Typhimurium) were illuminated with 460 nm LED to a maximum dose of 4080 J/cm 2 at 4, 10 and 25 °C. Inactivation curves were modeled using Hom model. Metabolic profiling of the non-illuminated and illuminated cells was performed using a Liquid chromatography-mass spectrometry system. Results indicate that the 460 nm LED significantly (p illuminated cells indicated that several metabolites e.g. 11-deoxycortisol, actinonin, coformycin, tyramine, chitobiose etc. were regulated during LED illumination. These results elucidate the effectiveness of 460 nm LED against foodborne bacteria and hence, its suitability as a novel antimicrobial control method to ensure food safety. Copyright © 2016 Elsevier Ltd. All rights reserved.

Ratio Based Biomarkers for the Prediction of Cancer Survival | NCI Technology Transfer Center | TTC

Science.gov (United States)

The NCI seeks licensees or co-development partners for this technology, which describes compositions, methods and kits for identifying, characterizing biomolecules expressed in a sample that are associated with the presence, the development, or progression of cancer.

Differential Serum Cytokine Levels and Risk of Lung Cancer between African and European Americans

Science.gov (United States)

Pine, Sharon R.; Mechanic, Leah E.; Enewold, Lindsey; Bowman, Elise D.; Ryan, Bríd M.; Cote, Michele L.; Wenzlaff, Angela S.; Loffredo, Christopher A.; Olivo-Marston, Susan; Chaturvedi, Anil; Caporaso, Neil E.; Schwartz, Ann G.; Harris, Curtis C.

2015-01-01

Background African Americans have a higher risk of developing lung cancer than European Americans. Previous studies suggested that certain circulating cytokines were associated with lung cancer. We hypothesized that variations in serum cytokine levels exist between African Americans and European Americans, and increased circulating cytokine levels contribute to lung cancer differently in the two races. Methods Differences in ten serum cytokine levels, interleukin (IL)-1β, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, granulocyte macrophage colony-stimulating factor (GMCSF), interferon (IFN)-γ and tumor necrosis factor (TNF)-α between 170 African-American and 296 European-American controls from the National Cancer Institute-Maryland (NCI-MD) case-control study were assessed. Associations of the serum cytokine levels with lung cancer were analyzed. Statistically significant results were replicated in the prospective Prostate, Lung, Colorectal, and Ovarian (PLCO) Cancer Screening Trial and the Wayne State University (WSU) Karmanos Cancer Institute case-control study. Results Six cytokines: IL-4, IL-5, IL-8, IL-10, IFNγ, and TNFα, were significantly higher among European-American as compared to African-American controls. Elevated IL-6 and IL-8 levels were associated with lung cancer among both races in all three studies. Elevated IL-1β, IL-10 and TNFα levels were associated with lung cancer only among African Americans. The association between elevated TNFα levels and lung cancer among European Americans was significant after adjustment for additional factors. Conclusions Serum cytokine levels vary by race and might contribute to lung cancer differently between African Americans and European Americans. Impact Future work examining risk prediction models of lung cancer can measure circulating cytokines to accurately characterize risk within racial groups. PMID:26711330

Anàlisi forense d'evidències digitals

OpenAIRE

Bonachera López, Esteban

2014-01-01

L'objectiu principal d'aquest projecte consisteix en la realització de l'anàlisi forense del disc dur i de la memòria RAM d'un ordinador personal, en concret un Netbook, vinculat a una possible conducta delictiva. També s'inclou en l'anàlisi una base de dades del conegut programari WhatsApp extreta d'un smartphone. Per realitzar aquesta tasca s'utilitzaran eines específiques per localitzar les evidències digitals que puguin demostrar els presumptes delictes. El objetivo principal de este p...

Mission & Role | NCI Technology Transfer Center | TTC

Science.gov (United States)

The NCI TTC serves as the focal point for implementing the Federal Technology Transfer Act to utilize patents as incentive for commercial development of technologies and to establish research collaborations and licensing among academia, federal laboratories, non-profit organizations, and industry. The TTC supports technology development activities for the National Cancer Institute and nine other NIH Institutes and Centers. TTC staff negotiate co-development agreements and licenses with universities, non-profit organizations, and pharmaceutical and biotechnology companies to ensure compliance with Federal statutes, regulations and the policies of the National Institutes of Health. TTC also reviews employee invention reports and makes recommendations concerning filing of domestic and foreign patent applications. | [google6f4cd5334ac394ab.html

A novel portable system for detecting and measuring tritium

International Nuclear Information System (INIS)

Barillari, Domenico

2007-01-01

A novel tritium detector configuration is described based on the anthracene scintillation method. Tritium-bearing samples are applied to a plate-bearing finely sublimed anthracene crystals and viewed in a field-able PMT-based reader against a standard plate. A microprocessor-based control and signal analysis system delivers a reading with a sensitivity of better than 5 nCi 3 H in approximately 3 min, and 2.3 nCi in 10 min of counting

Multigene deletions in lung adenocarcinomas from irradiated and control mice

International Nuclear Information System (INIS)

Zhang, Y.; Woloschak, G.E.

1996-01-01

K-ras codon 12 point mutations mRb and p53 gene deletions were examined in tissues from 120 normal lungs and lung adenocarcinomas that were Formalin-treated and paraffin-embedded 25 years ago. The results showed that 12 of 60 (20%) lung adenocarcinomas had mRb deletions. All lung adenocarcinomas that were initially found bearing deleted mRb had p53 deletions (15 of 15; 100%). A significantly higher mutation frequency for K-ras codon 12 point mutations was also found in the lung adenocarcinomas from mice exposed to 24 once-weekly neutron irradiation (10 of 10; 100%) compared with those exposed to 24 or 60 once-weekly γ-ray doses (5 of 10; 50%). The data suggested that p53 and K-ras gene alterations were two contributory factors responsible for the increased incidence of lung adenocarcinoma in B6CF 1 male mice exposed to protracted neutron radiation

NCI at Frederick Employees Receive Awards at the Spring Research Festival | Poster

Science.gov (United States)

NCI and Frederick National Laboratory staff members were among those honored at the Spring Research Festival Awards Ceremony on May 28. The ceremony was the culmination of the festival, which was sponsored by the National Interagency Confederation for Biological Research (NICBR), May 4–7. Maj. Gen. Brian Lein, commanding general, U.S. Army Medical Research and Materiel Command

Furano diterpenes from Pterodon pubescens Benth with selective in vitro anticancer activity for prostate cell line

International Nuclear Information System (INIS)

Spindola, Humberto M.; Carvalho, Joao E. de; Ruiz, Ana Lucia T.G.; Rodrigues, Rodney A. F.; Denny, Carina; Sousa, Ilza M. de Oliveira; Foglio, Mary Ann; Tamashiro, Jorge Y.

2009-01-01

Activity guided fractionation of Pterodon pubescens Benth. methylene chloride-soluble fraction afforded novel 6α-acetoxi 7β-hydroxy-vouacapan 1 and four known diterpene furans 2, 3, 4, 5. The compounds were evaluated for in vitro cytotoxic activities against human normal cells and tumour cell lines UACC-62 (melanoma), MCF-7 (breast), NCI-H460 (lung, non-small cells), OVCAR-03 (ovarian), PC-3 (prostate), HT-29 (colon), 786-0 (renal), K562 (leukemia) and NCI-ADR/RES (ovarian expressing phenotype multiple drugs resistance). Results were expressed by three concentration dependent parameters GI 50 (concentration that produces 50% growth inhibition), TGI (concentration that produces total growth inhibition or cytostatic effect) and LC 50 (concentration that produces .50% growth, a cytotoxicity parameter). Also, in vitro cytotoxicity was evaluated against 3T3 cell line (mouse embryonic fibroblasts). Antiproliferative properties of compounds 1, 4 and 5 are herein reported for the first time. These compounds showed selectivity in a concentration-dependent way against human PC-3. Compound 1 demonstrated selectivity 26 fold more potent than the positive control, doxorubicin, for PC-3 (prostrate) cell line based on GI 50 values, causing cytostatic effect (TGI value) at a concentration fifteen times less than positive control. Moreover comparison of 50% lethal concentration (LC 50 value) with positive control (doxorubicin) suggested that compound 1 was less toxic. (author)

Silica-Coated Nanodiamonds for Imaging and Delivery of Therapeutic Agents | NCI Technology Transfer Center | TTC

Science.gov (United States)

The NCI Radiation Oncology Branch and the NHLBI Laboratory of Single Molecule Biophysics seek parties to co-develop fluorescent nanodiamonds for use as in vivo and in vitro optical tracking probes toward commercialization.

76 FR 14034 - Proposed Collection; Comment Request; NCI Cancer Genetics Services Directory Web-Based...

Science.gov (United States)

2011-03-15

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Proposed Collection; Comment Request; NCI Cancer Genetics Services Directory Web-Based Application Form and Update Mailer Summary: In... Cancer Genetics Services Directory Web-based Application Form and Update Mailer. [[Page 14035

Interaction between the Gly460Trp alpha-adducin gene variant and diuretics on the risk of myocardial infarction

NARCIS (Netherlands)

van Wieren-de Wijer, Diane B M A; Maitland-van der Zee, Anke-Hilse; de Boer, Anthonius; Kroon, Abraham A; de Leeuw, Peter W; Schiffers, Paul; Janssen, Rob G J H; Psaty, Bruce M; van Duijn, Cornelia M; Stricker, Bruno H Ch; Klungel, Olaf H

INTRODUCTION: The Gly460Trp variant of the alpha-adducin gene has been associated with the salt-sensitive and diuretic responsive form of hypertension. OBJECTIVE: The aim of the study was to determine whether the alpha-adducin 460Trp variant allele modifies the risk-lowering effect of diuretics on

Esculetin exerts anti-proliferative effects against non-small-cell lung carcinoma by suppressing specificity protein 1 in vitro.

Science.gov (United States)

Lee, Ra H; Jeon, Young-Joo; Cho, Jin H; Jang, Jeong-Yun; Kong, Il-Keun; Kim, Seok-Ho; Kim, MinSeok S; Chung, Hak-Jae; Oh, Keon B; Park, Seon-Min; Shin, Jae-Cheon; Seo, Jae-Min; Ko, Sungho; Shim, Jung-Hyun; Chae, Jung-Il

2017-01-01

Esculetin, a coumarin derivative, is a phenolic compound isolated from Artemisia capillaris, Citrus limonia, and Euphorbia lathyris. Although it has been reported to have anti-inflammatory, anti-oxidant, and anti-proliferative activities in several human cancers, its anti-proliferative activity against non-small-cell lung carcinoma (NSCLC) and the molecular mechanisms involved have not been adequately elucidated. In this study, we used two NSCLC cell lines (NCI-H358 and NCI-H1299) to investigate the anti-proliferative activity and apoptotic effect of esculetin. Our data showed that esculetin-treated cells exhibited reduced proliferation and apoptotic cell morphologies. Intriguingly, the transcription factor specificity protein 1 (Sp1) was significantly suppressed by esculetin in a dose- and time-dependent manner. Furthermore, the levels of p27 and p21, two key regulators of the cell cycle, were up-regulated by the esculetin-mediated down-regulation of Sp1; the level of a third cell-cycle regulator, survivin, was decreased, resulting in caspase-dependent apoptosis. Therefore, we conclude that esculetin could be a potent anti-proliferative agent in patients with NSCLC.

Upright Cone CT of the hindfoot: Comparison of the non-weight-bearing with the upright weight-bearing position

Energy Technology Data Exchange (ETDEWEB)

Hirschmann, Anna; Pfirrmann, Christian W.A.; Buck, Florian M. [University of Zurich, Department of Radiology, Orthopaedic University Hospital Balgrist, Zurich (Switzerland); Klammer, Georg; Espinosa, Norman [University of Zurich, Department of Orthopedic Surgery, Orthopaedic University Hospital Balgrist, Zurich (Switzerland)

2014-03-15

To prospectively compare computed tomography (CT) of the hindfoot in the supine non-weight-bearing position (NWBCT) with upright weight-bearing position (WBCT). Institutional review board approval and informed consent of all patients were obtained. NWBCT and WBCT scans of the ankle were obtained in 22 patients (mean age, 46.0 ± 17.1 years; range 19-75 years) using a conventional 64-row CT for NWBCT and a novel cone-beam CT for WBCT. Two musculoskeletal radiologists independently performed the following measurements: the hindfoot alignment angle, fibulocalcaneal and tibiocalcaneal distances, lateral talocalcaneal joint space width, talocalcaneal overlap and naviculocalcaneal distance. Significant changes between NWBCT and WBCT were sought using Wilcoxon signed-rank test. P values <0.05 were considered statistically significant. Significant differences were found for all measurements except the hindfoot alignment angle and tibiocalcaneal distance. Significant measurement results were as follows (NWBCT/WBCT reader 1; NWBCT/WBCT reader 2, mean ± standard deviation): fibulocalcaneal distance 3.6 mm ± 5.2/0.3 mm ± 6.0 (P = 0.006); 1.4 mm ± 6.3/-1.1 mm ± 6.3 (P = 0.002), lateral talocalcaneal joint space width 2.9 mm ± 1.7/2.2 mm ± 1.1 (P = 0.005); 3.4 mm ± 1.9/2.4 mm ± 1.3 (P = 0.001), talocalcaneal overlap 4.1 mm ± 3.9/1.4 mm ± 3.9 (P = 0.001); 4.5 mm ± 4.3/1.4 mm ± 3.7 (P < 0.001) and naviculocalcaneal distance 13.5 mm ± 4.0/15.3 mm ± 4.7 (P = 0.037); 14.0 mm ± 4.4/15.7 mm ± 6.2 (P = 0.100). Interreader agreement was good to excellent (ICC 0.48-0.94). Alignment of the hindfoot significantly changes in the upright weight-bearing CT position. Differences can be visualised and measured using WBCT. (orig.)

THE NCI STUDIES ON RADIATION DOSES AND CANCER RISKS IN THE MARSHALL ISLANDS ASSOCIATED WITH EXPOSURE TO RADIOACTIVE FALLOUT

OpenAIRE

Simon, Steven L.

2012-01-01

The U.S. National Cancer Institute (NCI, National Institutes of Health) was requested by the U.S. Congress in 2004 to assess the number of radiation-related illnesses to be expected among the people of the Marshall Islands from nuclear tests conducted there during 1946-1958. A thorough analysis conducted by the NCI concluded that 20 of the 66 nuclear devices tested in or near the Marshall Islands resulted in measurable fallout deposition on one or more of the inhabited atolls of the Marshall ...

16 CFR 460.17 - What installers must tell their customers.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false What installers must tell their customers... AND ADVERTISING OF HOME INSULATION § 460.17 What installers must tell their customers. If you are an installer, you must give your customers a contract or receipt for the insulation you install. For all...

NCI Requests Targets for Monoclonal Antibody Production and Characterization | Office of Cancer Clinical Proteomics Research

Science.gov (United States)

In an effort to provide well-characterized monoclonal antibodies to the scientific community, NCI's Antibody Characterization Program requests cancer-related protein targets for affinity production and distribution. Submissions will be accepted through July 9, 2012.

New Approaches for the Synthesis, Cytotoxicity and Toxicity of Heterocyclic Compounds Derived from 2-Cyanomethylbenzo[c]imidazole.

Science.gov (United States)

Mohareb, Rafat M; Mohamed, Abeer A; Abdallah, Amira E M

2016-01-01

The reaction of ethyl cyanoacetate with o-phenylenediamine gave the 2-cyanomethylbenzo[c]imidazole (1). The latter compound was used as the key starting material to synthesise biologically active heterocyclic derivatives. Thus, the reaction of 1 with cyclohexanone and either of benzaldehyde, 4-methoxybenzaldehyde or 4-chlorobenzaldehyde gave the annulated derivatives 2a-c, respectively. The antitumor evaluations of the newly synthesized products against the three cancer cell lines MCF-7 (breast adeno-carcinoma), NCI-H460 (non-small cell lung cancer) and SF-268 (CNS cancer) showed that compounds 2b, 6, 11b, 11c, 12b, 16a, 16b and 18a exhibited optimal cytotoxic effect against cancer cell lines, with IC50 values in the nM range. Bioactive compounds are often toxic to shrimp larvae. Thus, in order to monitor these chemicals in vivo lethality to shrimp larvae (Artemia salina), Brine-Shrimp Lethality Assay was used. Compounds 11b, 12b and 16b showed no toxicity against the tested organisms.

Differential effects of drugs targeting cancer stem cell (CSC and non-CSC populations on lung primary tumors and metastasis.

Directory of Open Access Journals (Sweden)

Leyre Larzabal

Full Text Available Cancer stem cells (CSCs are thought to be responsible for tumor initiation and recurrence after chemotherapy. Targeting CSCs and non-CSCs with specific compounds may be an effective approach to reduce lung cancer growth and metastasis. The aim of this study was to investigate the effect of salinomycin, a selective inhibitor of CSCs, with or without combination with paclitaxel, in a metastatic model. To evaluate the effect of these drugs in metastasis and tumor microenvironment we took advantage of the immunocompetent and highly metastatic LLC mouse model. Aldefluor assays were used to analyze the ALDH+/- populations in murine LLC and human H460 and H1299 lung cancer cells. Salinomycin reduced the proportion of ALDH+ CSCs in LLC cells, whereas paclitaxel increased such population. The same effect was observed for the H460 and H1299 cell lines. Salinomycin reduced the tumorsphere formation capacity of LLC by more than 7-fold, but paclitaxel showed no effect. In in vivo experiments, paclitaxel reduced primary tumor volume but increased the number of metastatic nodules (p<0.05, whereas salinomycin had no effect on primary tumors but reduced lung metastasis (p<0.05. Combination of both drugs did not improve the effect of single therapies. ALDH1A1, SOX2, CXCR4 and SDF-1 mRNA levels were higher in metastatic lesions than in primary tumors, and were significantly elevated in both locations by paclitaxel treatment. On the contrary, such levels were reduced (or in some cases did not change when mice were administered with salinomycin. The number of F4/80+ and CD11b+ cells was also reduced upon administration of both drugs, but particularly in metastasis. These results show that salinomycin targets ALDH+ lung CSCs, which has important therapeutic effects in vivo by reducing metastatic lesions. In contrast, paclitaxel (although reducing primary tumor growth promotes the selection of ALDH+ cells that likely modify the lung microenvironment to foster

Microsoft Office 365 Deployment Continues through June at NCI at Frederick | Poster

Science.gov (United States)

The latest Microsoft suite, Office 365 (O365), is being deployed to all NCI at Frederick computers during the months of May and June to comply with federal mandates. The suite includes the latest versions of Word, Excel, Outlook, PowerPoint, and Skype for Business, along with cloud-based capabilities. These cloud-based capabilities will help meet the federal mandates that

Lentivirus-mediated knockdown of NLK inhibits small-cell lung cancer growth and metastasis

Directory of Open Access Journals (Sweden)

Lv MT

2016-11-01

Full Text Available Mutian Lv,1 Yaming Li,1 Xin Tian,2 Shundong Dai,3,4 Jing Sun,5 Guojiang Jin,6 Shenyi Jiang7 1Department of Nuclear Medicine, 2Molecular Oncology Laboratory of Cancer Research Institute, The First Affiliated Hospital of China Medical University, 3Department of Pathology, The First Affiliated Hospital, College of Basic Medical Sciences of China Medical University, 4Department of Pathology, Institute of Pathology and Pathophysiology, 5Department of Immunology and Biotherapy, Liaoning Cancer Hospital and Institute, 6Department of Laboratory Medicine, 7Department of Rheumatology, The First Affiliated Hospital of China Medical University, Shenyang, People’s Republic of China Abstract: Nemo-like kinase (NLK, an evolutionarily conserved serine/threonine kinase, has been recognized as a critical regulator of various cancers. In this study, we investigated the role of NLK in human small-cell lung cancer (SCLC, which is the most aggressive form of lung cancer. NLK expression was evaluated by quantitative real-time polymerase chain reaction in 20 paired fresh SCLC tissue samples and found to be noticeably elevated in tumor tissues. Lentivirus-mediated RNAi efficiently suppressed NLK expression in NCI-H446 cells, resulting in a significant reduction in cell viability and proliferation in vitro. Moreover, knockdown of NLK led to cell cycle arrest at the S-phase via suppression of Cyclin A, CDK2, and CDC25A, which could contribute to cell growth inhibition. Furthermore, knockdown of NLK decreased the migration of NCI-H446 cells and downregulated matrix metalloproteinase 9. Treatment with NLK short hairpin RNA significantly reduced SCLC tumor growth in vivo. In conclusion, this study suggests that NLK plays an important role in the growth and metastasis of SCLC and may serve as a potential therapeutic target for the treatment of SCLC. Keywords: NLK, SCLC, RNAi, proliferation, migration

Gamma-aminobutyric acid, a potential tumor suppressor for small airway-derived lung adenocarcinoma.

Science.gov (United States)

Schuller, Hildegard M; Al-Wadei, Hussein A N; Majidi, Mourad

2008-10-01

Pulmonary adenocarcinoma (PAC) is the leading type of lung cancer in smokers and non-smokers that arises in most cases from small airway epithelial cells. PAC has a high mortality due to its aggressive behavior and resistance to cancer therapeutics. We have shown previously that the proliferation of human PAC cells NCI-H322 and immortalized human small airway epithelial cells HPL1D is stimulated by cyclic adenosine monophosphate (cAMP)/protein kinase A-dependent phosphorylation of cyclic adenosine monophosphate response element-binding (CREB) protein and transactivation of the epidermal growth factor receptor and that this pathway is activated by beta-1-adrenoreceptors (beta(1)-ARs) and the non-genomic estrogen receptor beta. Our current in vitro studies with HPL1D and NCI-H322 cells showed that signaling via the gamma-amino butyric acid receptor (GABA(B)R) strongly inhibited base level and isoproterenol-induced cAMP, p-CREB, cyclic adenosine monophosphate response element-luciferase activity and p-extracellular regulated kinase-1 (ERK1)/2 and effectively blocked DNA synthesis and cell migration. The inhibitory effects of gamma-amino butyric acid (GABA) were disinhibited by the GABA(B)R antagonist CGP-35348 or GABA(B)R knockdown. Immunohistochemical investigation of hamster lungs showed significant underexpression of GABA in animals with small airway-derived PACs induced by the nicotine-derived carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK). These findings suggest that GABA may have tumor suppressor function in small airway epithelia and the PACs derived from them and that downregulation of GABA by NNK may contribute to the development of this cancer in smokers. Our findings suggest that marker-guided treatment with GABA or a GABA(B)R agonist of individuals with downregulated pulmonary GABA may provide a novel targeted approach for the prevention of PAC in smokers.

MO-E-BRF-01: Research Opportunities in Technology for Innovation in Radiation Oncology (Highlight of ASTRO NCI 2013 Workshop)

International Nuclear Information System (INIS)

Hahn, S; Jaffray, D; Chetty, I; Benedict, S

2014-01-01

Radiotherapy is one of the most effective treatments for solid tumors, in large part due to significant technological advances associated with, for instance, the ability to target tumors to very high levels of accuracy (within millimeters). Technological advances have played a central role in the success of radiation therapy as an oncologic treatment option for patients. ASTRO, AAPM and NCI sponsored a workshop “Technology for Innovation in Radiation Oncology” at the NCI campus in Bethesda, MD on June 13–14, 2013. The purpose of this workshop was to bring together expert clinicians and scientists to discuss the role of disruptive technologies in radiation oncology, in particular with regard to how they are being developed and translated to clinical practice in the face of current and future challenges and opportunities. The technologies discussed encompassed imaging and delivery aspects, along with methods to enable/facilitate application of them in the clinic. Measures for assessment of the performance of these technologies, such as techniques to validate quantitative imaging, were reviewed. Novel delivery technologies, incorporating efficient and safe delivery mechanisms enabled by development of tools for process automation and the associated field of oncology informatics formed one of the central themes of the workshop. The discussion on disruptive technologies was grounded in the need for evidence of efficacy. Scientists in the areas of technology assessment and bioinformatics provided expert views on different approaches toward evaluation of technology efficacy. Clinicians well versed in clinical trials incorporating disruptive technologies (e.g. SBRT for early stage lung cancer) discussed the important role of these technologies in significantly improving local tumor control and survival for these cohorts of patients. Recommendations summary focused on the opportunities associated with translating the technologies into the clinic and assessing their

MO-E-BRF-01: Research Opportunities in Technology for Innovation in Radiation Oncology (Highlight of ASTRO NCI 2013 Workshop)

Energy Technology Data Exchange (ETDEWEB)

Hahn, S [University of Pennsylvania, Philadelphia, PA (United States); Jaffray, D [Princess Margaret Hospital, Toronto, ON (Canada); Chetty, I [Henry Ford Health System, Detroit, MI (United States); Benedict, S [UC Davis Cancer Center, Sacramento, CA (United States)

2014-06-15

Radiotherapy is one of the most effective treatments for solid tumors, in large part due to significant technological advances associated with, for instance, the ability to target tumors to very high levels of accuracy (within millimeters). Technological advances have played a central role in the success of radiation therapy as an oncologic treatment option for patients. ASTRO, AAPM and NCI sponsored a workshop “Technology for Innovation in Radiation Oncology” at the NCI campus in Bethesda, MD on June 13–14, 2013. The purpose of this workshop was to bring together expert clinicians and scientists to discuss the role of disruptive technologies in radiation oncology, in particular with regard to how they are being developed and translated to clinical practice in the face of current and future challenges and opportunities. The technologies discussed encompassed imaging and delivery aspects, along with methods to enable/facilitate application of them in the clinic. Measures for assessment of the performance of these technologies, such as techniques to validate quantitative imaging, were reviewed. Novel delivery technologies, incorporating efficient and safe delivery mechanisms enabled by development of tools for process automation and the associated field of oncology informatics formed one of the central themes of the workshop. The discussion on disruptive technologies was grounded in the need for evidence of efficacy. Scientists in the areas of technology assessment and bioinformatics provided expert views on different approaches toward evaluation of technology efficacy. Clinicians well versed in clinical trials incorporating disruptive technologies (e.g. SBRT for early stage lung cancer) discussed the important role of these technologies in significantly improving local tumor control and survival for these cohorts of patients. Recommendations summary focused on the opportunities associated with translating the technologies into the clinic and assessing their

Puerto Rico NCI Community Oncology Research Program Minority/Underserved | Division of Cancer Prevention

Science.gov (United States)

The Puerto Rico NCI Community Oncology Research Program (PRNCORP) will be the principal organization in the island that promotes cancer prevention, control and screening/post-treatment surveillance clinical trials. It will conduct cancer care delivery research and will provide access to treatment and imaging clinical trials conducted under the reorganization of the National

Tumor production in Syrian hamsters following inhalation of PuO2--ZrO2 aerosol

International Nuclear Information System (INIS)

Thomas, R.G.; Smith, D.M.

1978-01-01

Syrian golden hamsters of both sexes were exposed to aerosols of ZrO 2 containing PuO 2 . The starting material in the aerosol generator also had a small amount of 57 Co added as a tracer. The mixture of all three constituents was nebulized and the droplets passed through a heating column at 1000 0 C. Aerosol sampling was accomplished with a cascade impactor and electrostatic precipitator. The median aerodynamic diameters in all inhalation runs were approximately 2 μm with a geometric standard deviation of 2. One exposed group of 60 hamsters had 6-day lung burdens averaging 100 nCi. This group had a lung tumor incidence of 44% with an even distribution of adenomas and carcinomas. Two other groups had average 6-day lung burdens of 80 to 90 nCi plus 55 nCi of intravenously injected spheres localized in the lung. These animals had tumor incidences of approximately 30%

Evaluation of a curcumin analog as an anti-cancer agent inducing ER stress-mediated apoptosis in non-small cell lung cancer cells

International Nuclear Information System (INIS)

Liu, Zhiguo; Wang, Yi; Sun, Yusheng; Ren, Luqing; Huang, Yi; Cai, Yuepiao; Weng, Qiaoyou; Shen, Xueqian; Li, Xiaokun; Liang, Guang

2013-01-01

Recent advances have highlighted the importance of the endoplasmic reticulum (ER) in cell death processes. Pharmacological interventions that effectively enhance tumor cell death through activating ER stress have attracted a great deal of attention for anti-cancer therapy. A bio-evaluation on 113 curcumin analogs against four cancer cell lines was performed through MTT assay. Furthermore, real time cell assay and flow cytometer were used to evaluate the apoptotic induction of (1E,4E)-1,5-bis(5-bromo-2-ethoxyphenyl)penta-1,4-dien-3-one (B82). Western blot, RT-qPCR, and siRNA were then utilized to confirm whether B82-induced apoptosis is mediated through activating ER stress pathway. Finally, the in vivo anti-tumor effect of B82 was evaluated. B82 exhibited strong anti-tumor activity in non-small cell lung cancer (NSCLC) H460 cells. Treatment with B82 significantly induced apoptosis in H460 cells in vitro and inhibited H460 tumor growth in vivo. Further studies demonstrated that the B82-induced apoptosis is mediated by activating ER stress both in vitro and in vivo. A new monocarbonyl analog of curcumin, B82, exhibited anti-tumor effects on H460 cells via an ER stress-mediated mechanism. B82 could be further explored as a potential anticancer agent for the treatment of NSCLC

Inhibition of Calcium-Activated Chloride Channel ANO1/TMEM16A Suppresses Tumor Growth and Invasion in Human Lung Cancer.

Directory of Open Access Journals (Sweden)

Linghan Jia

Full Text Available Lung cancer or pulmonary carcinoma is primarily derived from epithelial cells that are thin and line on the alveolar surfaces of the lung for gas exchange. ANO1/TMEM16A, initially identified from airway epithelial cells, is a member of Ca2+-activated Cl- channels (CaCCs that function to regulate epithelial secretion and cell volume for maintenance of ion and tissue homeostasis. ANO1/TMEM16A has recently been shown to be highly expressed in several epithelium originated carcinomas. However, the role of ANO1 in lung cancer remains unknown. In this study, we show that inhibition of calcium-activated chloride channel ANO1/TMEM16A suppresses tumor growth and invasion in human lung cancer. ANO1 is upregulated in different human lung cancer cell lines. Knocking-down ANO1 by small hairpin RNAs inhibited proliferation, migration and invasion of GLC82 and NCI-H520 cancel cells evaluated by CCK-8, would-healing, transwell and 3D soft agar assays. ANO1 protein is overexpressed in 77.3% cases of human lung adenocarcinoma tissues detected by immunohistochemistry. Furthermore, the tumor growth in nude mice implanted with GLC82 cells was significantly suppressed by ANO1 silencing. Taken together, our findings provide evidence that ANO1 overexpression contributes to tumor growth and invasion of lung cancer; and suppressing ANO1 overexpression may have therapeutic potential in lung cancer therapy.

Procoagulant, tissue factor-bearing microparticles in bronchoalveolar lavage of interstitial lung disease patients: an observational study.

Directory of Open Access Journals (Sweden)

Federica Novelli

Full Text Available Coagulation factor Xa appears involved in the pathogenesis of pulmonary fibrosis. Through its interaction with protease activated receptor-1, this protease signals myofibroblast differentiation in lung fibroblasts. Although fibrogenic stimuli induce factor X synthesis by alveolar cells, the mechanisms of local posttranslational factor X activation are not fully understood. Cell-derived microparticles are submicron vesicles involved in different physiological processes, including blood coagulation; they potentially activate factor X due to the exposure on their outer membrane of both phosphatidylserine and tissue factor. We postulated a role for procoagulant microparticles in the pathogenesis of interstitial lung diseases. Nineteen patients with interstitial lung diseases and 11 controls were studied. All subjects underwent bronchoalveolar lavage; interstitial lung disease patients also underwent pulmonary function tests and high resolution CT scan. Microparticles were enumerated in the bronchoalveolar lavage fluid with a solid-phase assay based on thrombin generation. Microparticles were also tested for tissue factor activity. In vitro shedding of microparticles upon incubation with H₂O₂ was assessed in the human alveolar cell line, A549 and in normal bronchial epithelial cells. Tissue factor synthesis was quantitated by real-time PCR. Total microparticle number and microparticle-associated tissue factor activity were increased in interstitial lung disease patients compared to controls (84±8 vs. 39±3 nM phosphatidylserine; 293±37 vs. 105±21 arbitrary units of tissue factor activity; mean±SEM; p<.05 for both comparisons. Microparticle-bound tissue factor activity was inversely correlated with lung function as assessed by both diffusion capacity and forced vital capacity (r² = .27 and .31, respectively; p<.05 for both correlations. Exposure of lung epithelial cells to H₂O₂ caused an increase in microparticle-bound tissue factor

Lung cancer, intracellular signaling pathways, and preclinical models

International Nuclear Information System (INIS)

Mordant, P.

2012-01-01

Non-small cell lung cancer (NSCLC) is the leading cause of cancer-related mortality worldwide. Activation of phosphatidylinositol-3-kinase (PI3K)-AKT and Kirsten rat sarcoma viral oncogene homologue (KRAS) can induce cellular immortalization, proliferation, and resistance to anticancer therapeutics such as epidermal growth factor receptor inhibitors or chemotherapy. This study assessed the consequences of inhibiting these two pathways in tumor cells with activation of KRAS, PI3K-AKT, or both. We investigated whether the combination of a novel RAF/vascular endothelial growth factor receptor inhibitor, RAF265, with a mammalian target of rapamycin (mTOR) inhibitor, RAD001 (everolimus), could lead to enhanced anti-tumoral effects in vitro and in vivo. To address this question, we used cell lines with different status regarding KRAS, PIK3CA, and BRAF mutations, using immunoblotting to evaluate the inhibitors, and MTT and clonogenic assays for effects on cell viability and proliferation. Subcutaneous xenografts were used to assess the activity of the combination in vivo. RAD001 inhibited mTOR downstream signaling in all cell lines, whereas RAF265 inhibited RAF downstream signaling only in BRAF mutant cells. In vitro, addition of RAF265 to RAD001 led to decreased AKT, S6, and Eukaryotic translation initiation factor 4E binding protein 1 phosphorylation in HCT116 cells. In vitro and in vivo, RAD001 addition enhanced the anti-tumoral effect of RAF265 in HCT116 and H460 cells (both KRAS mut, PIK3CA mut); in contrast, the combination of RAF265 and RAD001 yielded no additional activity in A549 and MDAMB231 cells. The combination of RAF and mTOR inhibitors is effective for enhancing anti-tumoral effects in cells with deregulation of both RAS-RAF and PI3K, possibly through the cross-inhibition of 4E binding protein 1 and S6 protein. We then focus on animal models. Preclinical models of NSCLC require better clinical relevance to study disease mechanisms and innovative

Lung tissue mechanics as an emergent phenomenon.

Science.gov (United States)

Suki, Béla; Bates, Jason H T

2011-04-01

The mechanical properties of lung parenchymal tissue are both elastic and dissipative, as well as being highly nonlinear. These properties cannot be fully understood, however, in terms of the individual constituents of the tissue. Rather, the mechanical behavior of lung tissue emerges as a macroscopic phenomenon from the interactions of its microscopic components in a way that is neither intuitive nor easily understood. In this review, we first consider the quasi-static mechanical behavior of lung tissue and discuss computational models that show how smooth nonlinear stress-strain behavior can arise through a percolation-like process in which the sequential recruitment of collagen fibers with increasing strain causes them to progressively take over the load-bearing role from elastin. We also show how the concept of percolation can be used to link the pathologic progression of parenchymal disease at the micro scale to physiological symptoms at the macro scale. We then examine the dynamic mechanical behavior of lung tissue, which invokes the notion of tissue resistance. Although usually modeled phenomenologically in terms of collections of springs and dashpots, lung tissue viscoelasticity again can be seen to reflect various types of complex dynamic interactions at the molecular level. Finally, we discuss the inevitability of why lung tissue mechanics need to be complex.

75 FR 46945 - Proposed Collection; Comment Request; the Drug Accountability Record (Form NIH 2564) (NCI)

Science.gov (United States)

2010-08-04

... Request; the Drug Accountability Record (Form NIH 2564) (NCI) SUMMARY: In compliance with the requirement... Management and Budget (OMB) for review and approval. Proposed Collection Title: The Drug Accountability... agent accountability. In order to fulfill these requirements, a standard Investigational Drug...

Butyrate Inhibits Cancerous HCT116 Colon Cell Proliferation but to a Lesser Extent in Noncancerous NCM460 Colon Cells.

Science.gov (United States)

Zeng, Huawei; Taussig, David P; Cheng, Wen-Hsing; Johnson, LuAnn K; Hakkak, Reza

2017-01-01

Butyrate, an intestinal microbiota metabolite of dietary fiber, exhibits chemoprevention effects on colon cancer development. However, the mechanistic action of butyrate remains to be determined. We hypothesize that butyrate inhibits cancerous cell proliferation but to a lesser extent in noncancerous cells through regulating apoptosis and cellular-signaling pathways. We tested this hypothesis by exposing cancerous HCT116 or non-cancerous NCM460 colon cells to physiologically relevant doses of butyrate. Cellular responses to butyrate were characterized by Western analysis, fluorescent microscopy, acetylation, and DNA fragmentation analyses. Butyrate inhibited cell proliferation, and led to an induction of apoptosis, genomic DNA fragmentation in HCT116 cells, but to a lesser extent in NCM460 cells. Although butyrate increased H3 histone deacetylation and p21 tumor suppressor expression in both cell types, p21 protein level was greater with intense expression around the nuclei in HCT116 cells when compared with that in NCM460 cells. Furthermore, butyrate treatment increased the phosphorylation of extracellular-regulated kinase 1/2 (p-ERK1/2), a survival signal, in NCM460 cells while it decreased p-ERK1/2 in HCT116 cells. Taken together, the activation of survival signaling in NCM460 cells and apoptotic potential in HCT116 cells may confer the increased sensitivity of cancerous colon cells to butyrate in comparison with noncancerous colon cells.

Autophagy influences the low-dose hyper-radiosensitivity of human lung adenocarcinoma cells by regulating MLH1.

Science.gov (United States)

Wang, Qiong; Xiao, Zhuya; Lin, Zhenyu; Zhou, Jie; Chen, Weihong; Jie, Wuyun; Cao, Xing; Yin, Zhongyuan; Cheng, Jing

2017-06-01

To investigate the impact of autophagy on the low-dose hyper-radiosensitivity (HRS) of human lung adenocarcinoma cells via MLH1 regulation. Immunofluorescent staining, Western blotting, and electron microscopy were utilized to detect autophagy in A549 and H460 cells. shRNA was used to silence MLH1 expression. The levels of MLH1, mTOR, p-mTOR, BNIP3, and Beclin-1 were measured by real-time polymerase chain reaction (PCR) and Western blotting. A549 cells, which have low levels of MLH1 expression, displayed HRS/induced radioresistance (IRR). Conversely, the radiosensitivity of H460 cells, which express high levels of MLH1, conformed to the linear-quadratic (LQ) model. After down-regulating MLH1 expression, A549 cells showed increased HRS and inhibition of autophagy, whereas H460 cells exhibited HRS/IRR. The levels of mTOR, p-mTOR, and BNIP3 were reduced in cells harboring MLH1 shRNA, and the changes in the mTOR/p-mTOR ratio mirrored those in MLH1 expression. Low MLH1-expressing A549 cells may exhibit HRS. Both the mTOR/p-mTOR and BNIP3/Beclin-1 signaling pathways were found to be related to HRS, but only mTOR/p-mTOR is involved in the regulation of HRS via MLH1 and autophagy.

Bearing system

Science.gov (United States)

Kapich, Davorin D.

1987-01-01

A bearing system includes backup bearings for supporting a rotating shaft upon failure of primary bearings. In the preferred embodiment, the backup bearings are rolling element bearings having their rolling elements disposed out of contact with their associated respective inner races during normal functioning of the primary bearings. Displacement detection sensors are provided for detecting displacement of the shaft upon failure of the primary bearings. Upon detection of the failure of the primary bearings, the rolling elements and inner races of the backup bearings are brought into mutual contact by axial displacement of the shaft.

Pulmonary carcinogenesis from plutonium-containing particles

International Nuclear Information System (INIS)

Thomas, R.G.; Smith, D.M.; Anderson, E.C.

1980-01-01

Induction of lung tumors by various types of radiation is of paramount concern to the nuclear industry. The data presented were obtained by exposing the pulmonary system of Syrian hamsters to particles of zirconium oxide containing various amounts of either plutonium-238 or -239 as the alpha radiation source. These particles were injected intravenously and lodged permanently in the capillary bed of the lung. When less than 20% of the lung tissue was irradiated, simulating the ''hot particle'' mode, tumors were not evident with lung burdens up to 500 nCi plutonium. More diffuse irradiation significantly increased the tumor incidence, with lung burdens of 50 to 150 nCi. When plutonium-laden microspheres were administered intratracheally, tumor production was considerably increased and the addition of 3 mg of iron oxide intratracheally further increased the incidence. Using the zirconium oxide matrix for the carrier of plutonium in aerosol particles produced tumor incidences of up to 50% in Syrian hamsters exposed by inhalation. Initial pulmonary (alveolar) burdens reached 100 nCi of plutonium. Similar inhalation studies using plutonium dioxide alone (no matrix) failed to produce any increase in lung tumorigenesis. The results are discussed in terms of possible mechanisms necessary for lung carcinogenesis. (H.K.)

Time, Concentration, and pH-Dependent Transport and Uptake of Anthocyanins in a Human Gastric Epithelial (NCI-N87 Cell Line

Directory of Open Access Journals (Sweden)

Allison A. Atnip

2017-02-01

Full Text Available Anthocyanins are the largest class of water soluble plant pigments and a common part of the human diet. They may have many potential health benefits, including antioxidant, anti-inflammatory, anti-cancer, and cardioprotective activities. However, anthocyanin metabolism is not well understood. Studies suggest that anthocyanins absorption may occur in the stomach, in which the acidic pH favors anthocyanin stability. A gastric epithelial cell line (NCI-N87 has been used to study the behavior of anthocyanins at a pH range of 3.0–7.4. This work examines the effects of time (0–3 h, concentration (50–1500 µM, and pH (3.0, 5.0, 7.4 on the transport and uptake of anthocyanins using NCI-N87 cells. Anthocyanins were transported from the apical to basolateral side of NCI-N87 cells in time and dose dependent manners. Over the treatment time of 3 h the rate of transport increased, especially with higher anthocyanin concentrations. The non-linear rate of transport may suggest an active mechanism for the transport of anthocyanins across the NCI-N87 monolayer. At apical pH 3.0, higher anthocyanin transport was observed compared to pH 5.0 and 7.4. Reduced transport of anthocyanins was found to occur at apical pH 5.0.

78 FR 2678 - Proposed Collection; Comment Request (60-Day FRN): The National Cancer Institute (NCI...

Science.gov (United States)

2013-01-14

... Request (60-Day FRN): The National Cancer Institute (NCI) SmokefreeTXT (Text Message) Program Evaluation..., Behavioral Scientist/ Health Science Administrator, Division of Cancer Control and Population Sciences, 6130... text message smoking cessation intervention designed for young adult smokers ages 18-29. The Smokefree...

Liposome as nanocarrier: Site targeted delivery in lung cancer

Directory of Open Access Journals (Sweden)

Najeeb Ullah

2017-08-01

Full Text Available Lung cancer is fatal and spreading rapidly worldwide. Different clinical strategies are applied to stop this cancer. As the lung is a delicate organ, special clinical applications must be used and nanodrugs delivery systems are the most important applications of all. This review discusses the lung problems such as lung cancer, lung inflammation and bronchi constrictions followed by repetitive intake of some drugs. The objective of this review is to study how nanodrug delivery systems were synthesized and used in lung disorder treatment especially in lung cancer. The authors studied some articles from 1989 to 2015. Liposome encapsulation was done in various ways for the delivery of different drugs such as metaproterenol into liposomes caused bronchodilation, immunoliposomes bearing antibodies for doxorubicin reduced 50% inhibitory effects, radioliposomes with high penetrating ability to peripheral airways, aerosol delivery systems with deep pulmonary deposition, polymeric drug delivery having potential to improve beneficial index of drug, solid lipid liposomes, liposomal gentamicin with altered different clinical susceptibilities of resistance, transferrin conjugated liposomes to deliver cytostatic drugs to site of lungs, anti-inflammatory drugs with mannosylated liposomes, liposomal suspensions with single stranded RNAs and peptide encapsulation of liposomes. This review indicates that many animals perished with intravenous administration of drugs but survived in liposomal targeting groups.

A Human Antibody That Binds to the Sixth Ig-Like Domain of VCAM-1 Blocks Lung Cancer Cell Migration In Vitro

Directory of Open Access Journals (Sweden)

Mi Ra Kim

2017-03-01

Full Text Available Vascular cell adhesion molecule-1 (VCAM-1 is closely associated with tumor progression and metastasis. However, the relevance and role of VCAM-1 in lung cancer have not been clearly elucidated. In this study, we found that VCAM-1 was highly overexpressed in lung cancer tissue compared with that of normal lung tissue, and high VCAM-1 expression correlated with poor survival in lung cancer patients. VCAM-1 knockdown reduced migration of A549 human lung cancer cells into Matrigel, and competitive blocking experiments targeting the Ig-like domain 6 of VCAM-1 (VCAM-1-D6 demonstrated that the VCAM-1-D6 domain was critical for VCAM-1 mediated A549 cell migration into Matrigel. Next, we developed a human monoclonal antibody specific to human and mouse VCAM-1-D6 (VCAM-1-D6 huMab, which was isolated from a human synthetic antibody library using phage display technology. Finally, we showed that VCAM-1-D6 huMab had a nanomolar affinity for VCAM-1-D6 and that it potently suppressed the migration of A549 and NCI-H1299 lung cancer cell lines into Matrigel. Taken together, these results suggest that VCAM-1-D6 is a key domain for regulating VCAM-1-mediated lung cancer invasion and that our newly developed VCAM-1-D6 huMab will be a useful tool for inhibiting VCAM-1-expressing lung cancer cell invasion.

Improved antiangiogenic and antitumour activity of the combination of the natural flavonoid fisetin and cyclophosphamide in Lewis lung carcinoma-bearing mice

Science.gov (United States)

Touil, Yasmine S.; Seguin, Johanne; Scherman, Daniel; Chabot, Guy G.

2011-01-01

Purpose The natural flavonoid fisetin was recently identified as a lead compound that stabilizes endothelial cell microtubules. In this study we investigated the antiproliferative and antiangiogenic properties of fisetin in vitro and in vivo. Methods Fisetin cytotoxicity was evaluated using Lewis lung carcinoma cells (LLC), endothelial cells and NIH 3T3 cells. Endothelial cell (EC) migration and capillary-like structure formation were evaluated using EAhy 926 cells. In vivo tumour growth inhibition studies were performed using LLC bearing mice treated with fisetin and/or cyclophosphamide (CPA). Results The fisetin IC50 was 59 μM for LLC and 77 μM for EC cells, compared to 210 μM for normal NIH 3T3 cells (24 h). Fisetin inhibited EC migration and capillary-like structure formation at non-cytotoxic concentrations (22–44 μM). In mice, fisetin inhibited angiogenesis assessed using the Matrigel plug assay. In LLC bearing mice, fisetin produced a 67% tumour growth inhibition (223 mg/kg, intraperitoneal), similar to the 66% produced by low dose CPA (30 mg/kg, subcutaneous). When fisetin and CPA were combined, however, a marked improvement in antitumour activity was observed (92% tumour growth inhibition), with low systemic toxicity. Tumour histology showed decreased microvessel density with either fisetin or CPA alone, and a dramatic decrease after the fisetin/CPA combination. Conclusions We have shown that fisetin not only displays in vitro and in vivo antiangiogenic properties, but that it can also markedly improve the in vivo antitumour effect of CPA. We propose that this drug combination associating a non-toxic dietary flavonoid with a cytotoxic agent could advantageously be used in the treatment of solid tumours. PMID:21069336

NCI Requests Cancer Targets for Monoclonal Antibody Production and Characterization | Office of Cancer Clinical Proteomics Research

Science.gov (United States)

In an effort to provide well-characterized monoclonal antibodies to the scientific community, NCI's Antibody Characterization Program requests cancer-related protein targets for affinity production and distribution. Submissions will be accepted through July 11, 2014.

Experiències de realitat augmentada en biblioteques : estat de la qüestió

Directory of Open Access Journals (Sweden)

Arroyo Vázquez, Natalia

2016-06-01

Full Text Available Objectiu: donar a conèixer les experiències més significatives d'ús de la realitat augmentada en biblioteques, amb una especial atenció als resultats obtinguts, les aportacions i les limitacions que s'han de tenir en compte. -- Metodologia: revisió bibliogràfica, selecció i anàlisi d'experiències sobre l'ús de realitat augmentada en biblioteques. -- Resultats: tot i ser una tecnologia recent, són diversos els exemples d'ús de la realitat augmentada en biblioteques. No obstant això, es fa necessari donar a conèixer els resultats d'aquestes experiències, de manera que puguin servir no solament com a model, sinó també per conèixer què és el que funciona. Es presenta als professionals un catàleg d'usos de la realitat augmentada en biblioteques, dels quals s'analitzen de forma crítica els possibles beneficis i limitacions, i s'agrupen en set apartats segons la utilitat: geolocalització, contextualització històrica, exposicions i altres activitats, publicacions, enriquiment dels espais físics, alfabetització i ludificació i, finalment, usos professionals.Objetivo: dar a conocer las experiencias más significativas de uso de la realidad aumentada en bibliotecas, con una especial atención a los resultados obtenidos, las aportaciones y las limitaciones que se deben tener en cuenta. -- Metodología: revisión bibliográfica, selección y análisis de experiencias sobre el uso de realidad aumentada en bibliotecas. -- Resultados: a pesar de ser una tecnología reciente, son varios los ejemplos de uso de la realidad aumentada en bibliotecas. Sin embargo, se hace necesario dar a conocer los resultados de dichas experiencias, de forma que puedan servir no solo como modelo, sino también para conocer qué es lo que funciona. Se presenta a los profesionales un catálogo de usos de la realidad aumentada en bibliotecas, analizados de forma crítica sus posibles beneficios y limitaciones, agrupados en siete apartados según la utilidad

Experiències de realitat augmentada en biblioteques : estat de la qüestió

Directory of Open Access Journals (Sweden)

Arroyo Vázquez, Natalia

2016-06-01

Full Text Available Objectiu: donar a conèixer les experiències més significatives d'ús de la realitat augmentada en biblioteques, fent una especial atenció als resultats obtinguts, les aportacions i les limitacions que s'han de tenir en compte. -- Metodologia: revisió bibliogràfica, selecció i anàlisi d'experiències sobre l'ús de la realitat augmentada en biblioteques. -- Resultats: malgrat ser una tecnologia recent, els exemples d'ús de la realitat augmentada en biblioteques són diversos. No obstant això, es fa necessari donar a conèixer els resultats d'aquestes experiències, de manera que puguin servir no solament com a model, sinó també per conèixer què és el que funciona. Es presenta als professionals un catàleg d'usos de la realitat augmentada en biblioteques, dels quals s'analitzen de forma crítica els possibles beneficis i limitacions, i s'agrupen en set apartats segons la utilitat: geolocalització, contextualització històrica, exposicions i altres activitats, publicacions, enriquiment dels espais físics, alfabetització i ludificació i, finalment, usos professionals.Objetivo: dar a conocer las experiencias más significativas de uso de la realidad aumentada en bibliotecas, con una especial atención a los resultados obtenidos, las aportaciones y las limitaciones que se deben tener en cuenta. -- Metodología: revisión bibliográfica, selección y análisis de experiencias sobre el uso de la realidad aumentada en bibliotecas. -- Resultados: a pesar de ser una tecnología reciente, son varios los ejemplos de uso de la realidad aumentada en bibliotecas. Sin embargo, se hace necesario dar a conocer los resultados de dichas experiencias, de forma que puedan servir no solo como modelo, sino también para conocer qué es lo que funciona. Se presenta a los profesionales un catálogo de usos de la realidad aumentada en bibliotecas, analizados de forma crítica sus posibles beneficios y limitaciones, agrupados en siete apartados según la

42 CFR 460.28 - Notice of CMS determination on waiver requests.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Notice of CMS determination on waiver requests. 460... CMS determination on waiver requests. (a) Time limit for notification of determination. Within 90 days after receipt of a waiver request, CMS takes one of the following actions: (1) Approves the request. (2...

42 CFR 460.48 - Additional actions by CMS or the State.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Additional actions by CMS or the State. 460.48... CMS or the State. After consultation with the State administering agency, if CMS determines that the PACE organization is not in substantial compliance with requirements in this part, CMS or the State...

33 CFR 334.460 - Cooper River and tributaries at Charleston, SC.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Cooper River and tributaries at... ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.460 Cooper River and tributaries at Charleston, SC. (a) The areas: (1) That portion of the Cooper River beginning on the west shore...

Reliability and smallest real difference of the ankle lunge test post ankle fracture.

Science.gov (United States)

Simondson, David; Brock, Kim; Cotton, Susan

2012-02-01

This study aimed to determine the reliability and the smallest real difference of the Ankle Lunge test in an ankle fracture patient population. In the post immobilisation stage of ankle fracture, ankle dorsiflexion is an important measure of progress and outcome. The Ankle Lunge test measures weight bearing dorsiflexion, resulting in negative scores (knee to wall distance) and positive scores (toe to wall distance), for which the latter has proven reliability in normal subjects only. A consecutive sample of ankle fracture patients with permission to commence weight bearing, were recruited to the study. Three measurements of the Ankle Lunge Test were performed each by two raters, one senior and one junior physiotherapist. These occurred prior to therapy sessions in the second week after plaster removal. A standardised testing station was utilised and allowed for both knee to wall distance and toe to wall distance measurement. Data was collected from 10 individuals with ankle fracture, with an average age of 36 years (SD 14.8). Seventy seven percent of observations were negative. Intra and inter-rater reliability yielded intra class correlations at or above 0.97, p Ankle Lunge test is a practical and reliable tool for measuring weightbearing dorsiflexion post ankle fracture. Copyright © 2011 Elsevier Ltd. All rights reserved.

78 FR 53763 - Proposed Collection; 60-day Comment Request Cancer Trials Support Unit (CTSU) (NCI)

Science.gov (United States)

2013-08-30

... proposed data collection projects, the National Cancer Institute (NCI), National Institutes of Health (NIH), will publish periodic summaries of proposed projects to be submitted to the Office of Management and... proposed collection of information, including the validity of the methodology and assumptions used; (3...

Alpha-adducin Gly460Trp polymorphism and renal hemodynamics in essential hypertension

NARCIS (Netherlands)

Beeks, Esther; van der Klauw, Melanie M; Kroon, Abraham A; Spiering, Wilko; Fuss-Lejeune, Monique J M J; de Leeuw, Peter W

2004-01-01

Previous studies have shown an association between the alpha-adducin Gly460Trp polymorphism and salt-sensitive hypertension. Not much is known about the effects of the variants of this polymorphism on renal hemodynamics and function. Therefore, we performed the present study to investigate the

Highlights of recent developments and trends in cancer nanotechnology research--view from NCI Alliance for Nanotechnology in Cancer.

Science.gov (United States)

Hull, L C; Farrell, D; Grodzinski, P

2014-01-01

Although the incidence of cancer and cancer related deaths in the United States has decreased over the past two decades due to improvements in early detection and treatment, cancer still is responsible for a quarter of the deaths in this country. There is much room for improvement on the standard treatments currently available and the National Cancer Institute (NCI) has recognized the potential for nanotechnology and nanomaterials in this area. The NCI Alliance for Nanotechnology in Cancer was formed in 2004 to support multidisciplinary researchers in the application of nanotechnology to cancer diagnosis and treatment. The researchers in the Alliance have been productive in generating innovative solutions to some of the central issues of cancer treatment including how to detect tumors earlier, how to target cancer cells specifically, and how to improve the therapeutic index of existing chemotherapies and radiotherapy treatments. Highly creative ideas are being pursued where novelty in nanomaterial development enables new modalities of detection or therapy. This review highlights some of the innovative materials approaches being pursued by researchers funded by the NCI Alliance. Their discoveries to improve the functionality of nanoparticles for medical applications includes the generation of new platforms, improvements in the manufacturing of nanoparticles and determining the underlying reasons for the movement of nanoparticles in the blood. © 2013.

Acetyl-CoA Carboxylase-α Inhibitor TOFA Induces Human Cancer Cell Apoptosis

Science.gov (United States)

Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-fang; Cao, Deliang

2009-01-01

Acetyl-CoA carboxylase-α (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC50 at approximately 5.0, 5.0, and 4.5 μg/ml, respectively. TOFA at 1.0–20.0 μg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 μM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis. PMID:19450551

Acetyl-CoA carboxylase-alpha inhibitor TOFA induces human cancer cell apoptosis.

Science.gov (United States)

Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-Fang; Cao, Deliang

2009-07-31

Acetyl-CoA carboxylase-alpha (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC(50) at approximately 5.0, 5.0, and 4.5 microg/ml, respectively. TOFA at 1.0-20.0 microg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 microM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis.

Quantitative Secretomic Analysis Identifies Extracellular Protein Factors That Modulate the Metastatic Phenotype of Non-Small Cell Lung Cancer.

Science.gov (United States)

Hu, Rongkuan; Huffman, Kenneth E; Chu, Michael; Zhang, Yajie; Minna, John D; Yu, Yonghao

2016-02-05

Lung cancer is the leading cause of cancer-related deaths for men and women in the United States, with non-small cell lung cancer (NSCLC) representing 85% of all diagnoses. Late stage detection, metastatic disease and lack of actionable biomarkers contribute to the high mortality rate. Proteins in the extracellular space are known to be critically involved in regulating every stage of the pathogenesis of lung cancer. To investigate the mechanism by which secreted proteins contribute to the pathogenesis of NSCLC, we performed quantitative secretomic analysis of two isogenic NSCLC cell lines (NCI-H1993 and NCI-H2073) and an immortalized human bronchial epithelial cell line (HBEC3-KT) as control. H1993 was derived from a chemo-naïve metastatic tumor, while H2073 was derived from the primary tumor after etoposide/cisplatin therapy. From the conditioned media of these three cell lines, we identified and quantified 2713 proteins, including a series of proteins involved in regulating inflammatory response, programmed cell death and cell motion. Gene Ontology (GO) analysis indicates that a number of proteins overexpressed in H1993 media are involved in biological processes related to cancer metastasis, including cell motion, cell-cell adhesion and cell migration. RNA interference (RNAi)-mediated knock down of a number of these proteins, including SULT2B1, CEACAM5, SPRR3, AGR2, S100P, and S100A14, leads to dramatically reduced migration of these cells. In addition, meta-analysis of survival data indicates NSCLC patients whose tumors express higher levels of several of these secreted proteins, including SULT2B1, CEACAM5, SPRR3, S100P, and S100A14, have a worse prognosis. Collectively, our results provide a potential molecular link between deregulated secretome and NSCLC cell migration/metastasis. In addition, the identification of these aberrantly secreted proteins might facilitate the development of biomarkers for early detection of this devastating disease.

Journal bearing

Science.gov (United States)

Menke, John R.; Boeker, Gilbert F.

1976-05-11

1. An improved journal bearing comprising in combination a non-rotatable cylindrical bearing member having a first bearing surface, a rotatable cylindrical bearing member having a confronting second bearing surface having a plurality of bearing elements, a source of lubricant adjacent said bearing elements for supplying lubricant thereto, each bearing element consisting of a pair of elongated relatively shallowly depressed surfaces lying in a cylindrical surface co-axial with the non-depressed surface and diverging from one another in the direction of rotation and obliquely arranged with respect to the axis of rotation of said rotatable member to cause a flow of lubricant longitudinally along said depressed surfaces from their distal ends toward their proximal ends as said bearing members are rotated relative to one another, each depressed surface subtending a radial angle of less than 360.degree., and means for rotating said rotatable bearing member to cause the lubricant to flow across and along said depressed surfaces, the flow of lubricant being impeded by the non-depressed portions of said second bearing surface to cause an increase in the lubricant pressure.

NCI Think Tank Concerning the Identifiability of Biospecimens and “-Omic” Data

OpenAIRE

Weil, Carol J.; Mechanic, Leah E.; Green, Tiffany; Kinsinger, Christopher; Lockhart, Nicole C.; Nelson, Stefanie A.; Rodriguez, Laura L.; Buccini, Laura D.

2013-01-01

On June 11 and 12, 2012, the National Cancer Institute (NCI) hosted a think tank concerning the identifiability of biospecimens and “omic” Data in order to explore challenges surrounding this complex and multifaceted topic. The think tank brought together forty-six leaders from several fields, including cancer genomics, bioinformatics, human subject protection, patient advocacy, and commercial genetics. The first day involved presentations regarding the state of the science of re-identificati...

Camshaft bearing arrangement

Energy Technology Data Exchange (ETDEWEB)

Aoi, K.; Ozawa, T.

1986-06-10

A bearing arrangement is described for the camshaft of an internal combustion engine or the like which camshaft is formed along its length in axial order with a first bearing surface, a first cam lobe, a second bearing surface, a second cam lobe, a third bearing surface, a third cam lobe and a fourth bearing surface, the improvement comprising first bearing means extending around substantially the full circumference of the first bearing surface and journaling the first bearing surface, second bearing means extending around substantially less than the circumference of the second bearing surface and journaling the second bearing surface, third bearing means extending around substantially less than the circumference of the third bearing surface and journaling the third bearing surface, and fourth bearing means extending around substantially the full circumference of the fourth bearing surface and journaling the first bearing surface.

A new in vitro screening system for anticancer drugs for the treatment of non-small cell lung cancer

International Nuclear Information System (INIS)

Hanauske, U.; Hanauske, A.R.; Clark, G.M.; Tsen, D.; Buchok, J.; Hoff, D.D. von

1989-01-01

We have evaluated a semiautomated radiometric assay (BACTEC 460 system) for screening of activity of anticancer drugs against human non-small cell lung cancer cell lines. Cells from seven cell lines were exposed to standard antineoplastic agents at four different concentrations using a 1-h incubation. Alpha 2-interferon was tested using a continuous incubation. In vitro drug activity was analyzed as a function of the clinically achievable serum concentration. Our results indicate that two cell lines (CALU-3, SK-MES-1) exhibit in vitro drug sensitivity patterns closest to those observed in clinical studies. These two cell lines might therefore be most useful for screening new anticancer compounds for activity against non-small cell lung cancer. The radiometric assay is a semiautomated system which has advantages over other, more time-consuming screening systems

75 FR 61763 - Submission of OMB Review; Comment Request; Drug Accountability Record (Form NIH 2564) (NCI)

Science.gov (United States)

2010-10-06

...; Comment Request; Drug Accountability Record (Form NIH 2564) (NCI) SUMMARY: In compliance with the..., 2011, unless it displays a valid OMB control number. Proposed Collection: Title: Drug Accountability... accountability. In order to fulfill these requirements, a standard Investigational Drug Accountability Report...

Photoactivatable Lipid-based Nanoparticles as a Vehicle for Dual Agent Delivery | NCI Technology Transfer Center | TTC

Science.gov (United States)

Researchers at the National Cancer Institute (NCI) RNA Biology Laboratory have developed nanoparticles that can deliver an agent (i.e., therapeutic or imaging) and release the agent upon targeted photoactivation allowing for controlled temporal and localized release of the agent.

Dithiolethione modified valproate and diclofenac increase E-cadherin expression and decrease proliferation of non-small cell lung cancer cells.

Science.gov (United States)

Moody, Terry W; Switzer, Christopher; Santana-Flores, Wilmarie; Ridnour, Lisa A; Berna, Marc; Thill, Michelle; Jensen, Robert T; Sparatore, Anna; Del Soldato, Piero; Yeh, Grace C; Roberts, David D; Giaccone, Giuseppe; Wink, David A

2010-05-01

The effects of dithiolethione modified valproate, diclofenac and sulindac on non-small cell lung cancer (NSCLC) cells were investigated. Sulfur(S)-valproate and S-diclofenac at 1 microg/ml concentrations significantly reduced prostaglandin (PG)E(2) levels in NSCLC cell lines A549 and NCI-H1299 as did the COX-2 inhibitor DuP-697. In vitro, S-valproate, S-diclofenac and S-sulindac half-maximally inhibited the clonal growth of NCI-H1299 cells at 6, 6 and 15 microg/ml, respectively. Using the MTT assay, 10 microg/ml S-valproate, NO-aspirin and Cay10404, a selective COX-2 inhibitor, but not SC-560, a selective COX-1 inhibitor, inhibited the growth of A549 cells. In vivo, 18mg/kg i.p. of S-valproate and S-diclofenac, but not S-sulindac, significantly inhibited A549 or NCI-H1299 xenograft proliferation in nude mice, but had no effect on the nude mouse body weight. The mechanism by which S-valproate and S-diclofenac inhibited the growth of NSCLC cells was investigated. Nitric oxide-aspirin but not S-valproate caused apoptosis of NSCLC cells. By Western blot, S-valproate and S-diclofenac increased E-cadherin but reduced vimentin and ZEB1 (a transcriptional suppressor of E-cadherin) protein expression in NSCLC cells. Because S-valproate and S-diclofenac inhibit the growth of NSCLC cells and reduce PGE(2) levels, they may prove beneficial in the chemoprevention and/or therapy of NSCLC. Published by Elsevier Ireland Ltd.

Test de visualitat: les preferències del bon disseny

Directory of Open Access Journals (Sweden)

Quim Merino

2014-07-01

Full Text Available Aquest article pretén donar notícia de la investigació dirigida pel Grup de Recerca en Publicitat i Relacions Públiques (en endavant, GRP de la Universitat Autònoma de Barcelona duta a terme pels autors d'aquesta ressenya. El treball s'emmarca en una activitat de l'assignatura de Disseny en Publicitat i Relacions Públiques del Grau en Publicitat i Relacions Públiques de la UAB. L'objectiu del treball és constatar les preferències del consumidor davant diferents estímuls formals del disseny gràfic en publicitat

Reducing Friction: An Update on the NCIP Open Development Initiative - NCI BioMedical Informatics Blog

Science.gov (United States)

NCIP has migrated 132 repositories from the NCI subversion repository to our public NCIP GitHub channel with the goal of facilitating third party contributions to the existing code base. Within the GitHub environment, we are advocating use of the GitHub “fork and pull” model.

TGF-β of lung cancer microenvironment upregulates B7H1 and GITRL expression in dendritic cells and is associated with regulatory T cell generation.

Science.gov (United States)

Ni, Xiao Yan; Sui, Hua Xiu; Liu, Yao; Ke, Shi Zhong; Wang, Yi Nan; Gao, Feng Guang

2012-08-01

The effects of TGF-β on dendritic cells (DCs) on the tumor microenvironment are not well understood. We report, here, the establishment of an in vitro lung cancer microenvironment by co-incubation of seminaphtharhodafluor (SNARF) labeled Lewis lung cancer (LLC) cells, carboxyfluorescein succinimidyl ester (CFSE) labeled fibroblasts and 4-chloromethyl-7-hydroxycoumarin (CMHC) labeled DCs. Raw 264.7, EL4 and NCI-H446 cells were able to synthesize TGF-β which was determined by flow cyto-metry and western blotting, respectively. Furthermore, TGF-β efficiently increased regulatory T-cell (Treg) expansion and upregulated DC B7H1 and GITRL expression. TGF-β and the co-incubation of LLC cells, fibroblasts with DCs could augment the expression of B7H1 and GITRL molecules of DCs. The data presented here indicate that the B7H1 and GITRL molecules may play an important role in TGF-β-induced Treg expansion of lung cancer microenvironment.

Readability of Online Patient Educational Resources Found on NCI-Designated Cancer Center Web Sites.

Science.gov (United States)

Rosenberg, Stephen A; Francis, David; Hullett, Craig R; Morris, Zachary S; Fisher, Michael M; Brower, Jeffrey V; Bradley, Kristin A; Anderson, Bethany M; Bassetti, Michael F; Kimple, Randall J

2016-06-01

The NIH and Department of Health & Human Services recommend online patient information (OPI) be written at a sixth grade level. We used a panel of readability analyses to assess OPI from NCI-Designated Cancer Center (NCIDCC) Web sites. Cancer.gov was used to identify 68 NCIDCC Web sites from which we collected both general OPI and OPI specific to breast, prostate, lung, and colon cancers. This text was analyzed by 10 commonly used readability tests: the New Dale-Chall Readability Formula, Flesch Reading Ease scale, Flesch-Kinaid Grade Level, FORCAST scale, Fry Readability Graph, Simple Measure of Gobbledygook test, Gunning Frequency of Gobbledygook index, New Fog Count, Raygor Readability Estimate Graph, and Coleman-Liau Index. We tested the hypothesis that the readability of NCIDCC OPI was written at the sixth grade level. Secondary analyses were performed to compare readability of OPI between comprehensive and noncomprehensive centers, by region, and to OPI produced by the American Cancer Society (ACS). A mean of 30,507 words from 40 comprehensive and 18 noncomprehensive NCIDCCs was analyzed (7 nonclinical and 3 without appropriate OPI were excluded). Using a composite grade level score, the mean readability score of 12.46 (ie, college level: 95% CI, 12.13-12.79) was significantly greater than the target grade level of 6 (middle-school: Preadability metrics (P<.05). ACS OPI provides easier language, at the seventh to ninth grade level, across all tests (P<.01). OPI from NCIDCC Web sites is more complex than recommended for the average patient. Copyright © 2016 by the National Comprehensive Cancer Network.

77 FR 4334 - Proposed Collection; Comment Request; Solar Cell: A Mobile UV Manager for Smart Phones (NCI)

Science.gov (United States)

2012-01-27

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Proposed Collection; Comment Request; Solar Cell: A Mobile UV Manager for Smart Phones (NCI) SUMMARY: In compliance with the... Manager for Smart Phones [[Page 4335

Induction of reactive oxygen species-stimulated distinctive autophagy by chelerythrine in non-small cell lung cancer cells.

Science.gov (United States)

Tang, Zheng-Hai; Cao, Wen-Xiang; Wang, Zhao-Yu; Lu, Jia-Hong; Liu, Bo; Chen, Xiuping; Lu, Jin-Jian

2017-08-01

Chelerythrine (CHE), a natural benzo[c]phenanthridine alkaloid, shows anti-cancer effect through a number of mechanisms. Herein, the effect and mechanism of the CHE-induced autophagy, a type II programmed cell death, in non-small cell lung cancer (NSCLC) cells were studied for the first time. CHE induced cell viability decrease, colony formation inhibition, and apoptosis in a concentration-dependent manner in NSCLC A549 and NCI-H1299 cells. In addition, CHE triggered the expression of phosphatidylethanolamine-modified microtubule-associated protein light-chain 3 (LC3-II). The CHE-induced expression of LC3-II was further increased in the combination treatment with chloroquine (CQ), an autophagy inhibitor, and large amounts of red-puncta were observed in the CHE-treated A549 cells with stable expression of mRFP-EGFP-LC3, indicating that CHE induces autophagy flux. Silence of beclin 1 reversed the CHE-induced expression of LC3-II. Inhibition of autophagy remarkably reversed the CHE-induced cell viability decrease and apoptosis in NCI-H1299 cells but not in A549 cells. Furthermore, CHE triggered reactive oxygen species (ROS) generation in both cell lines. A decreased level of ROS through pretreatment with N-acetyl-L-cysteine reversed the CHE-induced cell viability decrease, apoptosis, and autophagy. Taken together, CHE induced distinctive autophagy in A549 (accompanied autophagy) and NCI-H1299 (pro-death autophagy) cells and a decreased level of ROS reversed the effect of CHE in NSCLC cells in terms of cell viability, apoptosis, and autophagy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Improving global data infrastructures for more effective and scalable analysis of Earth and environmental data: the Australian NCI NERDIP Approach

Science.gov (United States)

Evans, Ben; Wyborn, Lesley; Druken, Kelsey; Richards, Clare; Trenham, Claire; Wang, Jingbo; Rozas Larraondo, Pablo; Steer, Adam; Smillie, Jon

2017-04-01

The National Computational Infrastructure (NCI) facility hosts one of Australia's largest repositories (10+ PBytes) of research data collections spanning datasets from climate, coasts, oceans, and geophysics through to astronomy, bioinformatics, and the social sciences domains. The data are obtained from national and international sources, spanning a wide range of gridded and ungridded (i.e., line surveys, point clouds) data, and raster imagery, as well as diverse coordinate reference projections and resolutions. Rather than managing these data assets as a digital library, whereby users can discover and download files to personal servers (similar to borrowing 'books' from a 'library'), NCI has built an extensive and well-integrated research data platform, the National Environmental Research Data Interoperability Platform (NERDIP, http://nci.org.au/data-collections/nerdip/). The NERDIP architecture enables programmatic access to data via standards-compliant services for high performance data analysis, and provides a flexible cloud-based environment to facilitate the next generation of transdisciplinary scientific research across all data domains. To improve use of modern scalable data infrastructures that are focused on efficient data analysis, the data organisation needs to be carefully managed including performance evaluations of projections and coordinate systems, data encoding standards and formats. A complication is that we have often found multiple domain vocabularies and ontologies are associated with equivalent datasets. It is not practical for individual dataset managers to determine which standards are best to apply to their dataset as this could impact accessibility and interoperability. Instead, they need to work with data custodians across interrelated communities and, in partnership with the data repository, the international scientific community to determine the most useful approach. For the data repository, this approach is essential to enable

Inhalation treatment of lung cancer: the influence of composition, size and shape of nanocarriers on their lung accumulation and retention

International Nuclear Information System (INIS)

Garbuzenko, Olga B.; Mainelis, Gediminas; Taratula, Oleh; Minko, Tamara

2014-01-01

Various nanoparticles have been designed and tested in order to select optimal carriers for the inhalation delivery of anticancer drugs to the lungs. The following nanocarriers were studied: micelles, liposomes, mesoporous silica nanoparticles (MSNs), poly propyleneimine (PPI) dendrimer-siRNA complexes nanoparticles, quantum dots (QDs), and poly (ethylene glycol) polymers. All particles were characterized using the following methods: dynamic light scattering, zeta potential, atomic force microscopy, in vitro cyto- and genotoxicity. In vivo organ distribution of all nanoparticles, retention in the lungs, and anticancer effects of liposomes loaded with doxorubicin were examined in nude mice after the pulmonary or intravenous delivery. Significant differences in lung uptake were found after the inhalation delivery of lipid-based and non-lipid-based nanoparticles. The accumulation of liposomes and micelles in lungs remained relatively high even 24 h after inhalation when compared with MSNs, QDs, and PPI dendrimers. There were notable differences between nanoparticle accumulation in the lungs and other organs 1 and 3 h after inhalation or intravenous administrations, but 24 h after intravenous injection all nanoparticles were mainly accumulated in the liver, kidneys, and spleen. Inhalation delivery of doxorubicin by liposomes significantly enhanced its anticancer effect and prevented severe adverse side effects of the treatment in mice bearing the orthotopic model of lung cancer. The results of the study demonstrate that lipid-based nanocarriers had considerably higher accumulation and longer retention time in the lungs when compared with non-lipid-based carriers after the inhalation delivery. These particles are most suitable for effective inhalation treatment of lung cancer

Stimulatory effect of low dose radiation on the immune function in tumor-bearing mice

International Nuclear Information System (INIS)

Zhang Ying; Li Xiujuan; Li Xiuyi; Liu Shuzheng

1999-01-01

Objective: The author aims at investigating the effect of whole body irradiation (WBI) with low dose radiation on immune function in tumor-bearing mice. Methods: C57BL/6J mine implanted with Lewis lung carcinoma cells in the right thighs were used as an experimental animal model. WBI with 75 mGy X-rays was given at the 10 th day after implantation and immunological parameters were detected 18 hours after irradiation. The immunological parameters included the spontaneous incorporation of 3 H-TdR into thymocytes, the number of splenocytes, the reaction of splenocytes to ConA and LPS, the splenic production of IL-2, the cytotoxic activities of natural killer (NK) and lymphokine activated killer cells (LAK) as well as specific cytotoxic T lymphocytes (CTL). Results: The immunological parameters of irradiated tumor-bearing mice were significantly increased compared with those of sham-irradiated tumor-bearing mice (P<0.05∼0.01). Conclusion: Low dose radiation could significantly increase the immune function of tumor-bearing mice, and this stimulatory effect may be of some potential significance in tumor therapy

Role of household exposure, dietary habits and glutathione S-Transferases M1, T1 polymorphisms in susceptibility to lung cancer among women in Mizoram India.

Science.gov (United States)

Phukan, Rup Kumar; Saikia, Bhaskar Jyoti; Borah, Prasanta Kumar; Zomawia, Eric; Sekhon, Gaganpreet Singh; Mahanta, Jagadish

2014-01-01

A case-control study was conducted to evaluate the effect of household exposure, dietary habits, smoking and Glutathione S-Transferases M1, T1 polymorphisms on lung cancer among women in Mizoram, India. We selected 230 newly diagnosed primary lung cases and 460 controls from women in Mizoram. Multivariate logistic regression analysis was performed to estimate adjusted odds ratio (OR). Exposure of cooking oil fumes (pkitchen inside living room (p=0.001), improper ventilated house (p=0.003), roasting of soda in kitchen (p=0.001), current smokers of tobacco (p=0.043), intake of smoked fish (p=0.006), smoked meat (p=0.001), Soda (poil emission and wood smoke, intake of smoked meat, smoked fish and soda (an alkali preparation used as food additives in Mizoram) and tobacco consumption for increase risk of lung cancer among Women in Mizoram.

Knockdown of human serine/threonine kinase 33 suppresses human small cell lung carcinoma by blocking RPS6/BAD signaling transduction.

Science.gov (United States)

Sun, E L; Liu, C X; Ma, Z X; Mou, X Y; Mu, X A; Ni, Y H; Li, X L; Zhang, D; Ju, Y R

2017-01-01

Small cell lung cancer (SCLC) is characterized by rapid growth rate and a tendency to metastasize to distinct sites of patients' bodies. The human serine/threonine kinase 33 (STK33) gene has shown its potency as a therapeutic target for prevention of lung carcinomas including non-small cell lung cancer (NSCLC), but its function in the oncogenesis and development of SCLC remains unrevealed. In the current study, it was hypothesized that STK33 played a key role in the proliferation, survival, and invasion of SCLC cells. The expression of STK33 in human SCLC cell lines NCI-H466 and DMS153 was inhibited by specific shRNA. The cell proliferation, cell apoptosis, and cell invasion of the cells were assessed with a series of in vitro assays. To explore the mechanism through which STK33 gene exerted its function in the carcinogenesis of SCLC cells, the effect of STK33 knockdown on the activity of S6K1/RPS6/BAD signaling was detected. Then the results were further confirmed with STK33 inhibitor ML281 and in vivo assays. The results demonstrated that inhibition of STK33 in SCLC cells suppressed the cell proliferation and invasion while induced cell apoptosis. Associated with the change in the phenotypic features, knockdown of STK33 also decreased the phosphorylation of RPS6 and BAD while increased the expression of cleaved caspase 9, indicating that apoptosis induced by STK33 suppression was mediated via mitochondrial pathway. Similar to the results of STK33 knockdown, incubating NCI-H466 cells with STK33 inhibitor also reduced the cell viability by suppressing RPS6/BAD pathways. Additionally, STK33 knockdown also inhibited tumor growth and RPS6/BAD activity in mice models. Findings outlined in our study were different from that in NSCLC to some extent: knockdown of STK33 in SCLC cells induced the apoptosis through mitochondrial pathway but independent of S6K1 function, inferring that the function of STK33 might be cancer type specific.

The national cancer institute (NCI) and cancer biology in a 'post genome world'

International Nuclear Information System (INIS)

Klausner, Richard D.

1996-01-01

The National Cancer Institute (NCI) exists to reduce the burden of all cancers through research and discovery. Extensive restructuring of the NCI over the past year has been aimed at assuring that the institution functions in all ways to promote opportunities for discovery in the laboratory, in the clinic, and in the community. To do this well requires the difficult and almost paradoxical problem of planning for scientific discovery which, in turn is based on the freedom to pursue the unanticipated. The intellectual and structural landscape of science is changing and it places new challenges, new demands and new opportunities for facilitating discovery. The nature of cancer as a disease of genomic instability and of accumulated genetic change, coupled with a possibility of the development of new technologies for reading, utilizing, interpreting and manipulating the genome of single cells, provides unprecedented opportunities for a new type of high through-put biology that will change the nature of discovery, cancer detection, diagnosis, prognosis, therapeutic decision-making and therapeutic discovery. To capture these new opportunities will require attention to be paid to integrate the development of technology and new scientific discoveries with the ability to apply advances rapidly and efficiently through clinical trials

Grizzly bear

Science.gov (United States)

Schwartz, C.C.; Miller, S.D.; Haroldson, M.A.; Feldhamer, G.; Thompson, B.; Chapman, J.

2003-01-01

The grizzly bear inspires fear, awe, and respect in humans to a degree unmatched by any other North American wild mammal. Like other bear species, it can inflict serious injury and death on humans and sometimes does. Unlike the polar bear (Ursus maritimus) of the sparsely inhabited northern arctic, however, grizzly bears still live in areas visited by crowds of people, where presence of the grizzly remains physically real and emotionally dominant. A hike in the wilderness that includes grizzly bears is different from a stroll in a forest from which grizzly bears have been purged; nighttime conversations around the campfire and dreams in the tent reflect the presence of the great bear. Contributing to the aura of the grizzly bear is the mixture of myth and reality about its ferocity. unpredictable disposition, large size, strength, huge canines, long claws, keen senses, swiftness, and playfulness. They share characteristics with humans such as generalist life history strategies. extended periods of maternal care, and omnivorous diets. These factors capture the human imagination in ways distinct from other North American mammals. Precontact Native American legends reflected the same fascination with the grizzly bear as modern stories and legends (Rockwell 1991).

NCI Workshop Report: Clinical and Computational Requirements for Correlating Imaging Phenotypes with Genomics Signatures

Directory of Open Access Journals (Sweden)

Rivka Colen

2014-10-01

Full Text Available The National Cancer Institute (NCI Cancer Imaging Program organized two related workshops on June 26–27, 2013, entitled “Correlating Imaging Phenotypes with Genomics Signatures Research” and “Scalable Computational Resources as Required for Imaging-Genomics Decision Support Systems.” The first workshop focused on clinical and scientific requirements, exploring our knowledge of phenotypic characteristics of cancer biological properties to determine whether the field is sufficiently advanced to correlate with imaging phenotypes that underpin genomics and clinical outcomes, and exploring new scientific methods to extract phenotypic features from medical images and relate them to genomics analyses. The second workshop focused on computational methods that explore informatics and computational requirements to extract phenotypic features from medical images and relate them to genomics analyses and improve the accessibility and speed of dissemination of existing NIH resources. These workshops linked clinical and scientific requirements of currently known phenotypic and genotypic cancer biology characteristics with imaging phenotypes that underpin genomics and clinical outcomes. The group generated a set of recommendations to NCI leadership and the research community that encourage and support development of the emerging radiogenomics research field to address short-and longer-term goals in cancer research.

Anticancer effect of luteolin is mediated by downregulation of TAM receptor tyrosine kinases, but not interleukin-8, in non-small cell lung cancer cells.

Science.gov (United States)

Lee, Youn Ju; Lim, Taeho; Han, Min Su; Lee, Sun-Hwa; Baek, Suk-Hwan; Nan, Hong-Yan; Lee, Chuhee

2017-02-01

TAM receptor tyrosine kinases (RTKs), Tyro3, Axl and MerTK, transduce diverse signals responsible for cell survival, growth, proliferation and anti-apoptosis. In the present study, we demonstrated the effect of luteolin, a flavonoid with antioxidant, anti-inflammatory and anticancer activities, on the expression and activation of TAM RTKs and the association with its cytotoxicity in non-small cell lung cancer (NSCLC) cells. We observed the cytotoxic effect of luteolin in parental A549 and H460 cells as well as in cisplatin-resistant A549/CisR and H460/CisR cells. Exposure of these cells to luteolin also resulted in a dose‑dependent decrease in clonogenic ability. Next, luteolin was found to decrease the protein levels of all three TAM RTKs in the A549 and A549/CisR cells in a dose‑dependent manner. In a similar manner, in H460 and H460/CisR cells, the protein levels of Axl and Tyro3 were decreased following luteolin treatment. In addition, Axl promoter activity was decreased by luteolin, indicating that luteolin suppresses Axl expression at the transcriptional level. We next found that luteolin abrogated Axl phosphorylation in response to growth arrest-specific 6 (Gas6), its ligand, implying the inhibitory effect of luteolin on Gas6-induced Axl activation. Ectopic expression of Axl was observed to attenuate the antiproliferative effect of luteolin, while knockdown of the Axl protein level using a gold nanoparticle-assisted gene delivery system increased its cytotoxicity. In contrast to the inhibitory effect of luteolin on the expression of TAM RTKs, interleukin-8 (IL-8) production was not decreased by luteolin in H460 and H460/CisR cells, while IL-8 production/cell was increased. Collectively, our data suggest that TAM RTKs, but not IL-8, are promising therapeutic targets of luteolin to abrogate cell proliferation and to overcome chemoresistance in NSCLC cells.

Heterozygosity for the Mood Disorder-Associated Variant Gln460Arg Alters P2X7 Receptor Function and Sleep Quality.

Science.gov (United States)

Metzger, Michael W; Walser, Sandra M; Dedic, Nina; Aprile-Garcia, Fernando; Jakubcakova, Vladimira; Adamczyk, Marek; Webb, Katharine J; Uhr, Manfred; Refojo, Damian; Schmidt, Mathias V; Friess, Elisabeth; Steiger, Axel; Kimura, Mayumi; Chen, Alon; Holsboer, Florian; Arzt, Eduardo; Wurst, Wolfgang; Deussing, Jan M

2017-11-29

A single nucleotide polymorphism substitution from glutamine (Gln, Q) to arginine (Arg, R) at codon 460 of the purinergic P2X7 receptor (P2X7R) has repeatedly been associated with mood disorders. The P2X7R-Gln460Arg variant per se is not compromised in its function. However, heterologous expression of P2X7R-Gln460Arg together with wild-type P2X7R has recently been demonstrated to impair receptor function. Here we show that this also applies to humanized mice coexpressing both human P2X7R variants. Primary hippocampal cells derived from heterozygous mice showed an attenuated calcium uptake upon agonist stimulation. While humanized mice were unaffected in their behavioral repertoire under basal housing conditions, mice that harbor both P2X7R variants showed alterations in their sleep quality resembling signs of a prodromal disease stage. Also healthy heterozygous human subjects showed mild changes in sleep parameters. These results indicate that heterozygosity for the wild-type P2X7R and its mood disorder-associated variant P2X7R-Gln460Arg represents a genetic risk factor, which is potentially able to convey susceptibility to mood disorders. SIGNIFICANCE STATEMENT Depression and bipolar disorder are the most common mood disorders. The P2X7 receptor (P2X7R) regulates many cellular functions. Its polymorphic variant Gln460Arg has repeatedly been associated with mood disorders. Genetically engineered mice, with human P2X7R, revealed that heterozygous mice (i.e., they coexpress the disease-associated Gln460Arg variant together with its normal version) have impaired receptor function and showed sleep disturbances. Human participants with the heterozygote genotype also had subtle alterations in their sleep profile. Our findings suggest that altered P2X7R function in heterozygote individuals disturbs sleep and might increase the risk for developing mood disorders. Copyright © 2017 the authors 0270-6474/17/3711688-13$15.00/0.

NCI-FDA Interagency Oncology Task Force Workshop Provides Guidance for Analytical Validation of Protein-based Multiplex Assays | Office of Cancer Clinical Proteomics Research

Science.gov (United States)

An NCI-FDA Interagency Oncology Task Force (IOTF) Molecular Diagnostics Workshop was held on October 30, 2008 in Cambridge, MA, to discuss requirements for analytical validation of protein-based multiplex technologies in the context of its intended use. This workshop developed through NCI's Clinical Proteomic Technologies for Cancer initiative and the FDA focused on technology-specific analytical validation processes to be addressed prior to use in clinical settings. In making this workshop unique, a case study approach was used to discuss issues related to

Effects of occupational exposures and smoking on lung function in tile factory workers.

Science.gov (United States)

Jaakkola, Maritta S; Sripaiboonkij, Penpatra; Jaakkola, Jouni J K

2011-02-01

The aims of this study were to investigate the relations of occupational exposures in tile industry to lung function and to evaluate potential interaction between smoking and tile dust exposure containing silica. A cross-sectional study of 232 workers (response rate 100%) in a tile factory and 76 office workers (response rate 73%) from four factories in Thailand was conducted in 2006-2007. Participants answered a questionnaire and performed spirometry. Factory workers had lower spirometric functions than office workers, especially those with high dust exposure. There was a dose-response relation between duration of dust exposure and FEV1 and FVC, the adjusted effect of ≥ 21 years of exposure on FEV1 being -240 ml (-100 to -380) and on FVC -300 ml (-140 to -460). The adverse effect of dust on lung function was larger in current smokers suggesting synergism between smoking and tile dust exposure. This study provides evidence that long-term exposure to dust in tile industry is related to lung function reduction. There was a suggestion of synergistic effect between dust exposure and smoking. Tile factories should consider measures to reduce dust exposure and arrange spirometry surveillance for workers with such exposure. Smoking cessation should be promoted to prevent harmful effects of occupational tile dust exposure.

Prolonged sulforaphane treatment activates survival signaling in nontumorigenic NCM460 colon cells but apoptotic signaling in tumorigenic HCT116 colon cells.

Science.gov (United States)

Zeng, Huawei; Trujillo, Olivia N; Moyer, Mary P; Botnen, James H

2011-01-01

Sulforaphane (SFN) is a naturally occurring chemopreventive agent; the induction of cell cycle arrest and apoptosis is a key mechanism by which SFN exerts its colon cancer prevention. However, little is known about the differential effects of SFN on colon cancer and normal cells. In this study, we demonstrated that SFN (15 μmol/L) exposure (72 h) inhibited cell proliferation by up to 95% in colon cancer cells (HCT116) and by 52% in normal colon mucosa-derived (NCM460) cells. Our data also showed that SFN exposure (5 and 10 μmol/L) led to the reduction of G1 phase cell distribution and an induction of apoptosis in HCT116 cells, but to a much lesser extent in NCM460 cells. Furthermore, the examination of mitogen-activated protein kinase (MAPK) signaling status revealed that SFN upregulated the phosphorylation of extracellular-regulated kinase 1/2 (ERK1/2) in NCM460 cells but not in HCT116 cells. In contrast, SFN enhanced the phosphorylation of stress-activated protein kinase (SAPK) and decreased cellular myelocytomatosis oncogene (c-Myc) expression in HCT116 cells but not NCM460 cells. Taken together, the activation of survival signaling in NCM460 cells and apoptotic signaling in HCT116 cells may play a critical role in SFN's stronger potential of inhibiting cell proliferation in colon cancer cells than in normal colon cells. Copyright © 2011, Taylor & Francis Group, LLC

NCI Statement on the U.S. Surgeon General's "Call to Action to Prevent Skin Cancer"

Science.gov (United States)

As the Federal Government's principal agency for cancer research and training, the National Cancer Institute (NCI) endorses the U.S. Surgeon General’s “Call to Action to Prevent Skin Cancer,” which provides a comprehensive evaluation of the current state of skin cancer prevention efforts in the United States and recommends actions for improvement in the future.

Correlation between atopic manifestation and lung toxicity following chest irradiation for breast cancer

International Nuclear Information System (INIS)

Hirota, Saeko; Shimizu, Tadafumi; Kubota, Satoshi

2007-01-01

The purpose of this study was to identify the impact of atopic manifestations on the occurrence of the lung toxicity following chest irradiation for breast cancer. Collection of 1,173 patients who had undergone radiotherapy on their 1,177 chest walls or postsurgical mammary glands at 9 institutions including ours. They received treatment consecutively from December 1980 through October 2005, with which we formed the basis of this analysis. Patients with any of the following medical history were defined as having atopic manifestations (n=111): asthma, allergic rhinitis, atopic dermatitis, contact dermatitis, and allergy to food or drug. Of them, patients who were observed for at least 6 months or who suffered from lung toxicity at any time, were classified as Group A (n=85). On the other hand, patients in our institute who were observed for at least 6 months or who suffered from lung toxicity at any time regardless of atopic manifestations, were classified as Group B (n=113), and patients without any atopic manifestation were classified as Group C (n=92). Grade 3 or higher lung toxicity in National Cancer Institute, Common Toxicity Criteria for Adverse Events (NCI-CTCAE) (v 3.0), occurred in 8.2%, id est (i.e.) 7 cases, of Group A, 2.7% of Group B, and 1.1% of Group C (p=0.0293 Group C against Group A). Three cases were classified as classical pneumonitis, and the other 4 sporadic pneumonitis such as Cryptogenic Organizing Pneumonia and Chronic Eosinophilic Pneumonia. Both of the histologically proven COP and CEP patients showed atopic manifestations in our institute. The detail clinical features are described in the main text. Having atopic manifestations suggests that there may be risk of lung toxicity following chest irradiation for breast cancer. (author)

Methylselenol, a selenium metabolite, plays common and different roles in cancerous colon HCT116 cell and noncancerous NCM460 colon cell proliferation.

Science.gov (United States)

Zeng, Huawei; Briske-Anderson, Mary; Wu, Min; Moyer, Mary P

2012-01-01

Methylselenol is hypothesized to be a critical selenium metabolite for anticancer action, and differential chemopreventive effects of methylselenol on cancerous and noncancerous cells may play an important role. In this study, the submicromolar concentrations of methylselenol were generated by incubating methionase with seleno-L methionine, and colon-cancer-derived HCT-116 cells and noncancerous colon NCM460 cells were exposed to methylselenol. Methylselenol exposure inhibited cell growth and led to an increase in G1 and G2 fractions with a concomitant drop in S-phase and an induction of apoptosis in HCT116, but to a much lesser extent in NCM460 colon cells. Similarly, the examination of mitogen-activated protein kinase (MAPK) and cellular myelocytomatosis oncogene (c-Myc) signaling status revealed that methylselenol inhibited the phosphorylation of extracellular-regulated kinase1/2 and p38 mitogen-activated protein kinase and the expression of c-Myc in HCT116 cells, but also to a lesser extent in NCM460 cells. The other finding is that methylselenol inhibits sarcoma kinase phosphorylation in HCT116 cells. In contrast, methylselenol upregulated the phosphorylation of sarcoma and focal adhesion kinase survival signals in the noncancerous NCM460 cells. Collectively, methylselenol's stronger potential of inhibiting cell proliferation/survival signals in the cancerous HCT116 cells when compared with that in noncancerous NCM460 cells may partly explain the potential of methylselenol's anticancer action.

L’avaluació de competències a l’Educació Superior: el cas d’un màster universitari

Directory of Open Access Journals (Sweden)

Xavier Ma. Triadó i Ivern

2013-01-01

Full Text Available La implantació de les competències és una tasca que ha anat incorporant-se paulatinament pels docents de la universitat espanyola amb l’entrada en vigor del EEES. Tot i això, encara s’està lluny d’aconseguir nivells òptims d’avaluació de les mateixes. Aquest article permet reflexionar sobre algunes bones practiques al respecte i sobre les dificultats i limitacions que apareixen en voler implementar un canvi en les metodologies docents, en el marc d’un màster universitari. Els resultats indiquen el grau en què s’han avaluat i adquirit tant les competències genèriques com especifiques en l’educació superior.

AngularJS in the Wild: A Survey with 460 Developers

OpenAIRE

Ramos, Miguel; Valente, Marco Tulio; Terra, Ricardo; Santos, Gustavo

2016-01-01

To implement modern web applications, a new family of JavaScript frameworks has emerged, using the MVC pattern. Among these frameworks, the most popular one is AngularJS, which is supported by Google. In spite of its popularity, there is not a clear knowledge on how AngularJS design and features affect the development experience of Web applications. Therefore, this paper reports the results of a survey about AngularJS, including answers from 460 developers. Our contributions include the ident...

77 FR 70423 - Black Bear Hydro Partners, LLC and Black Bear Development Holdings, LLC and Black Bear SO, LLC...

Science.gov (United States)

2012-11-26

... Bear Hydro Partners, LLC and Black Bear Development Holdings, LLC and Black Bear SO, LLC; Notice of..., 2012, Black Bear Hydro Partners, LLC, sole licensee (transferor) and Black Bear Development Holdings, LLC and Black Bear SO, LLC (transferees) filed an application for the partial the transfer of licenses...

Hypoxia-Induced Cisplatin Resistance in Non-Small Cell Lung Cancer Cells Is Mediated by HIF-1α and Mutant p53 and Can Be Overcome by Induction of Oxidative Stress.

Science.gov (United States)

Deben, Christophe; Deschoolmeester, Vanessa; De Waele, Jorrit; Jacobs, Julie; Van den Bossche, Jolien; Wouters, An; Peeters, Marc; Rolfo, Christian; Smits, Evelien; Lardon, Filip; Pauwels, Patrick

2018-04-21

The compound APR-246 (PRIMA-1 MET ) is a known reactivator of (mutant) p53 and inducer of oxidative stress which can sensitize cancer cells to platinum-based chemotherapeutics. However, the effect of a hypoxic tumor environment has been largely overlooked in this interaction. This study focusses on the role of hypoxia-inducible factor-1α (HIF-1α) and the p53 tumor suppressor protein in hypoxia-induced cisplatin resistance in non-small cell lung cancer (NSCLC) cells and the potential of APR-246 to overcome this resistance. We observed that hypoxia-induced cisplatin resistance only occurred in the p53 mutant NCI-H2228 Q331 * cell line, and not in the wild type A549 and mutant NCI-H1975 R273H cell lines. Cisplatin reduced HIF-1α protein levels in NCI-H2228 Q331 * cells, leading to a shift in expression from HIF-1α-dependent to p53-dependent transcription targets under hypoxia. APR-246 was able to overcome hypoxia-induced cisplatin resistance in NCI-H2228 Q331 * cells in a synergistic manner without affecting mutant p53 Q331 * transcriptional activity, but significantly depleting total glutathione levels more efficiently under hypoxic conditions. Synergism was dependent on the presence of mutant p53 Q331 * and the induction of reactive oxygen species, with depletion of one or the other leading to loss of synergism. Our data further support the rationale of combining APR-246 with cisplatin in NSCLC, since their synergistic interaction is retained or enforced under hypoxic conditions in the presence of mutant p53.

Hypoxia-Induced Cisplatin Resistance in Non-Small Cell Lung Cancer Cells Is Mediated by HIF-1α and Mutant p53 and Can Be Overcome by Induction of Oxidative Stress

Directory of Open Access Journals (Sweden)

Christophe Deben

2018-04-01

Full Text Available The compound APR-246 (PRIMA-1MET is a known reactivator of (mutant p53 and inducer of oxidative stress which can sensitize cancer cells to platinum-based chemotherapeutics. However, the effect of a hypoxic tumor environment has been largely overlooked in this interaction. This study focusses on the role of hypoxia-inducible factor-1α (HIF-1α and the p53 tumor suppressor protein in hypoxia-induced cisplatin resistance in non-small cell lung cancer (NSCLC cells and the potential of APR-246 to overcome this resistance. We observed that hypoxia-induced cisplatin resistance only occurred in the p53 mutant NCI-H2228Q331* cell line, and not in the wild type A549 and mutant NCI-H1975R273H cell lines. Cisplatin reduced HIF-1α protein levels in NCI-H2228Q331* cells, leading to a shift in expression from HIF-1α-dependent to p53-dependent transcription targets under hypoxia. APR-246 was able to overcome hypoxia-induced cisplatin resistance in NCI-H2228Q331* cells in a synergistic manner without affecting mutant p53Q331* transcriptional activity, but significantly depleting total glutathione levels more efficiently under hypoxic conditions. Synergism was dependent on the presence of mutant p53Q331* and the induction of reactive oxygen species, with depletion of one or the other leading to loss of synergism. Our data further support the rationale of combining APR-246 with cisplatin in NSCLC, since their synergistic interaction is retained or enforced under hypoxic conditions in the presence of mutant p53.

Relationship between ADD1 Gly460Trp gene polymorphism and essential hypertension in Madeira Island.

Science.gov (United States)

Sousa, Ana Célia; Palma Dos Reis, Roberto; Pereira, Andreia; Borges, Sofia; Freitas, Ana Isabel; Guerra, Graça; Góis, Teresa; Rodrigues, Mariana; Henriques, Eva; Freitas, Sónia; Ornelas, Ilídio; Pereira, Décio; Brehm, António; Mendonça, Maria Isabel

2017-10-01

Essential hypertension (EH) is a complex disease in which physiological, environmental, and genetic factors are involved in its genesis. The genetic variant of the alpha-adducin gene (ADD1) has been described as a risk factor for EH, but with controversial results.The objective of this study was to evaluate the association of ADD1 (Gly460Trp) gene polymorphism with the EH risk in a population from Madeira Island.A case-control study with 1614 individuals of Caucasian origin was performed, including 817 individuals with EH and 797 controls. Cases and controls were matched for sex and age, by frequency-matching method. All participants collected blood for biochemical and genotypic analysis for the Gly460Trp polymorphism. We further investigated which variables were independently associated to EH, and, consequently, analyzed their interactions.In our study, we found a significant association between the ADD1 gene polymorphism and EH (odds ratio 2.484, P = .01). This association remained statistically significant after the multivariate analysis (odds ratio 2.548, P = .02).The ADD1 Gly460Trp gene polymorphism is significantly and independently associated with EH risk in our population. The knowledge of genetic polymorphisms associated with EH is of paramount importance because it leads to a better understanding of the etiology and pathophysiology of this pathology.

Xylitol induces cell death in lung cancer A549 cells by autophagy.

Science.gov (United States)

Park, Eunjoo; Park, Mi Hee; Na, Hee Sam; Chung, Jin

2015-05-01

Xylitol is a widely used anti-caries agent that has anti-inflammatory effects. We have evaluated the potential of xylitol in cancer treatment. It's effects on cell proliferation and cytotoxicity were measured by MTT assay and LDH assay. Cell morphology and autophagy were examined by immunostaining and immunoblotting. Xylitol inhibited cell proliferation in a dose-dependent manner in these cancer cells: A549, Caki, NCI-H23, HCT-15, HL-60, K562, and SK MEL-2. The IC50 of xylitol in human gingival fibroblast cells was higher than in cancer cells, indicating that it is more specific for cancer cells. Moreover, xylitol induced autophagy in A549 cells that was inhibited by 3-methyladenine, an autophagy inhibitor. These results indicate that xylitol has potential in therapy against lung cancer by inhibiting cell proliferation and inducing autophagy of A549 cells.

Low-level inhaled-239PuO2 life-span studies in rats

International Nuclear Information System (INIS)

Sanders, C.L.; McDonald, K.E.; Killand, B.W.; Mahaffey, J.A.; Cannon, W.C.

1986-01-01

This study determined the dose-response curve for lung tumor incidence in rats after inhalation of high-fired 239 PuO 2 , which gave radiation doses to the lung of from ∼5 to >1000 rads. Exposed rats were given a single, nose-only, inhalation exposure to 169 Yb- 239 PuO 2 aerosol (AMAD, 1.6 +- 0.11 μm). The effective half-time for 169 Yb in the lung was 14 days, whereas ∼76% of 239 Pu was cleared with a half-time of 20 days and 24%, with a half-time of 180 days. Whole-body counting for 169 Yb at 14 days after exposure was an accurate method for determining 239 Pu IAD in individual rats, even at IAD's as low as 0.60 nCi of 239 Pu. The 239 Pu lung-clearance curve and an equation describing changes in lung weight with body weight and age were used to determine lung radiation doses. The IAD's of exposure groups were 0.60 +- 0.15 nCi of 239 Pu (1000 rats), 0.98 +- 0.25 (531 rats), 2.4 +- 0.69 (209 rats), 5.7 +- 1.2 (98 rats), and 7.5 +- 2.0 to 150 +- 37 nCi (300 rats); corresponding radiation doses to the lung estimated at 3 years after exposure were 8.3, 14, 33, 79, and 100 to 2100 rads, respectively. 71 refs., 5 figs., 4 tabs

Particulate deposition in the human lung under lunar habitat conditions.

Science.gov (United States)

Darquenne, Chantal; Prisk, G Kim

2013-03-01

Lunar dust may be a toxic challenge to astronauts. While deposition in reduced gravity is less than in normal gravity (1 G), reduced gravitational sedimentation causes particles to penetrate deeper in the lung, potentially causing more harm. The likely design of the lunar habitat has a reduced pressure environment and low-density gas has been shown to reduce upper airway deposition and increase peripheral deposition. Breathing air and a reduced-density gas approximating the density of the proposed lunar habitat atmosphere, five healthy subjects inhaled 1 -microm diameter aerosol boluses at penetration volumes (V(p)) of 200 ml (central airways), 500 ml, and 1000 ml (lung periphery) in microgravity during parabolic flight, and in 1 G. Deposition in the lunar habitat was significantly less than for Earth conditions (and less than in 1 G with the low-density gas) with a relative decrease in deposition of -59.1 +/- 14.0% (-46.9 +/- 11.7%), -50.7 +/- 9.2% (-45.8 +/- 11.2%), and -46.0 +/- 8.3% (-45.3 +/- 11.1%) at V(p) = 200, 500, and 1000 ml, respectively. There was no significant effect of reduced density on deposition in 1 G. While minimally affected by gas density, deposition was significantly less in microgravity than in 1 G for both gases, with a larger portion of particles depositing in the lung periphery under lunar conditions than Earth conditions. Thus, gravity, and not gas properties, mainly affects deposition in the peripheral lung, suggesting that studies of aerosol transport in the lunar habitat need not be performed at the low density proposed for the atmosphere in that environment.

Phylogeography of mitochondrial DNA variation in brown bears and polar bears.

Science.gov (United States)

Shields, G F; Adams, D; Garner, G; Labelle, M; Pietsch, J; Ramsay, M; Schwartz, C; Titus, K; Williamson, S

2000-05-01

We analyzed 286 nucleotides of the middle portion of the mitochondrial cytochrome b gene of 61 brown bears from three locations in Alaska and 55 polar bears from Arctic Canada and Arctic Siberia to test our earlier observations of paraphyly between polar bears and brown bears as well as to test the extreme uniqueness of mitochondrial DNA types of brown bears on Admiralty, Baranof, and Chichagof (ABC) islands of southeastern Alaska. We also investigated the phylogeography of brown bears of Alaska's Kenai Peninsula in relation to other Alaskan brown bears because the former are being threatened by increased human development. We predicted that: (1) mtDNA paraphyly between brown bears and polar bears would be upheld, (2) the mtDNA uniqueness of brown bears of the ABC islands would be upheld, and (3) brown bears of the Kenai Peninsula would belong to either clade II or clade III of brown bears of our earlier studies of mtDNA. All of our predictions were upheld through the analysis of these additional samples. Copyright 2000 Academic Press.

Phylogeography of mitochondrial DNA variation in brown bears and polar bears

Science.gov (United States)

Shields, Gerald F.; Adams, Deborah; Garner, Gerald W.; Labelle, Martine; Pietsch, Jacy; Ramsay, Malcolm; Schwartz, Charles; Titus, Kimberly; Williamson, Scott

2000-01-01

We analyzed 286 nucleotides of the middle portion of the mitochondrial cytochrome b gene of 61 brown bears from three locations in Alaska and 55 polar bears from Arctic Canada and Arctic Siberia to test our earlier observations of paraphyly between polar bears and brown bears as well as to test the extreme uniqueness of mitochondrial DNA types of brown bears on Admiralty, Baranof, and Chichagof (ABC) islands of southeastern Alaska. We also investigated the phylogeography of brown bears of Alaska's Kenai Peninsula in relation to other Alaskan brown bears because the former are being threatened by increased human development. We predicted that: (1) mtDNA paraphyly between brown bears and polar bears would be upheld, (2) the mtDNA uniqueness of brown bears of the ABC islands would be upheld, and (3) brown bears of the Kenai Peninsula would belong to either clade II or clade III of brown bears of our earlier studies of mtDNA. All of our predictions were upheld through the analysis of these additional samples.

Inhibition of telomerase activity preferentially targets aldehyde dehydrogenase-positive cancer stem-like cells in lung cancer

Directory of Open Access Journals (Sweden)

Iniesta Pilar

2011-08-01

Full Text Available Abstract Background Mortality rates for advanced lung cancer have not declined for decades, even with the implementation of novel chemotherapeutic regimens or the use of tyrosine kinase inhibitors. Cancer Stem Cells (CSCs are thought to be responsible for resistance to chemo/radiotherapy. Therefore, targeting CSCs with novel compounds may be an effective approach to reduce lung tumor growth and metastasis. We have isolated and characterized CSCs from non-small cell lung cancer (NSCLC cell lines and measured their telomerase activity, telomere length, and sensitivity to the novel telomerase inhibitor MST312. Results The aldehyde dehydrogenase (ALDH positive lung cancer cell fraction is enriched in markers of stemness and endowed with stem cell properties. ALDH+ CSCs display longer telomeres than the non-CSC population. Interestingly, MST312 has a strong antiproliferative effect on lung CSCs and induces p21, p27 and apoptosis in the whole tumor population. MST312 acts through activation of the ATM/pH2AX DNA damage pathway (short-term effect and through decrease in telomere length (long-term effect. Administration of this telomerase inhibitor (40 mg/kg in the H460 xenograft model results in significant tumor shrinkage (70% reduction, compared to controls. Combination therapy consisting of irradiation (10Gy plus administration of MST312 did not improve the therapeutic efficacy of the telomerase inhibitor alone. Treatment with MST312 reduces significantly the number of ALDH+ CSCs and their telomeric length in vivo. Conclusions We conclude that antitelomeric therapy using MST312 mainly targets lung CSCs and may represent a novel approach for effective treatment of lung cancer.

Immuno-enhancement in tumor-bearing mice induced by whole body X-irradiation with 75 mGy

International Nuclear Information System (INIS)

Zhang Ying; Li Xiuyi; Gong Shouliang; Liu Shuzheng

2000-01-01

Objective: In present study the authors observed the effect of whole body irradiation (WBI) with 75 mGy X-rays on the immune function of tumor-bearing mice. Methods: Lewis lung carcinoma cells were implanted into the right thigh muscle of C57BL/6J mice. Ten days after tumor implantation, the tumor-bearing mice were administrated with 75 mGy X-rays WBI, then the mice were sacrificed 18 h after irradiation to detect the immune parameters including the spontaneous proliferation of thymocytes, the proliferative response of splenocytes to ConA and LPS, the cytotoxic activities of specific cytotoxic lymphocytes (CTL) and natural killer cells (NK), as well as lymphokine activated killer cells (LAK) in spleen. The methods the authors used were 3 H-TdR incorporation or release assay. Results: the immune parameters of exposed tumor-bearing mice were much higher than those of sham-irradiated tumor-bearing mice (P<0.01). Conclusion: These results suggested that low dose radiation (LDR) could enhance the immune function of tumor-bearing mice, which might be of practical significance in the prevention and therapy of cancer

Introgressive hybridization: brown bears as vectors for polar bear alleles.

Science.gov (United States)

Hailer, Frank

2015-03-01

The dynamics and consequences of introgression can inform about numerous evolutionary processes. Biologists have therefore long been interested in hybridization. One challenge, however, lies in the identification of nonadmixed genotypes that can serve as a baseline for accurate quantification of admixture. In this issue of Molecular Ecology, Cahill et al. (2015) analyse a genomic data set of 28 polar bears, eight brown bears and one American black bear. Polar bear alleles are found to be introgressed into brown bears not only near a previously identified admixture zone on the Alaskan Admiralty, Baranof and Chichagof (ABC) Islands, but also far into the North American mainland. Elegantly contrasting admixture levels at autosomal and X chromosomal markers, Cahill and colleagues infer that male-biased dispersal has spread these introgressed alleles away from the Late Pleistocene contact zone. Compared to a previous study on the ABC Island population in which an Alaskan brown bear served as a putatively admixture-free reference, Cahill et al. (2015) utilize a newly sequenced Swedish brown bear as admixture baseline. This approach reveals that brown bears have been impacted by introgression from polar bears to a larger extent (up to 8.8% of their genome), than previously known, including the bear that had previously served as admixture baseline. No evidence for introgression of brown bear into polar bear is found, which the authors argue could be a consequence of selection. Besides adding new exciting pieces to the puzzle of polar/brown bear evolutionary history, the study by Cahill and colleagues highlights that wildlife genomics is moving from analysing single genomes towards a landscape genomics approach. © 2015 John Wiley & Sons Ltd.

Index-based dietary patterns and risk of lung cancer in the NIH-AARP diet and health study.

Science.gov (United States)

Anic, G M; Park, Y; Subar, A F; Schap, T E; Reedy, J

2016-01-01

Dietary pattern analysis considers combinations of food intake and may offer a better measure to assess diet-cancer associations than examining individual foods or nutrients. Although tobacco exposure is the major risk factor for lung cancer, few studies have examined whether dietary patterns, based on preexisting dietary guidelines, influence lung cancer risk. After controlling for smoking, we examined associations between four diet quality indices-Healthy Eating Index-2010 (HEI-2010), Alternate Healthy Eating Index-2010 (AHEI-2010), alternate Mediterranean Diet score (aMED) and Dietary Approaches to Stop Hypertension (DASH)-and lung cancer risk in the NIH-AARP (National Institutes of Health-American Association of Retired Persons) Diet and Health study. Baseline dietary intake was assessed in 460 770 participants. Over a median of 10.5 years of follow-up, 9272 incident lung cancer cases occurred. Cox proportional hazards regression was used to estimate hazard ratios (HRs) and confidence intervals (CIs). Comparing highest to lowest quintiles, HRs (95% CIs) for lung cancer were as follows: HEI-2010=0.83 (0.77-0.89), AHEI-2010=0.86 (0.80-0.92), aMED=0.85 (0.79-0.91) and DASH=0.84 (0.78-0.90). Among the individual components of the dietary indices, higher consumption of whole grains and fruits was significantly inversely associated with lung cancer risk for several of the diet indices. Total index score analyses stratified by smoking status showed inverse associations with lung cancer for former smokers; however, only HEI-2010 was inversely associated in current smokers and no index score was inversely associated among never smokers. Although smoking is the factor most strongly associated with lung cancer, this study adds to a growing body of evidence that diet may have a modest role in reducing lung cancer risk, especially among former smokers.

Effect of induced hyperglycemia on metastatic spreading in Lewis lung carcinoma

International Nuclear Information System (INIS)

Shmakova, N.L.; Fomenkova, T.E.; Fadeeva, T.A.

1991-01-01

The effect of induced hyperglycemia on the intensity of metastatic dissemination of Lewis lung carcinoma was investigated in experiments on mice. Neither long-, nor short-term hyperglycemia, induced at different phases of dissemination, influenced the intensity of metastatic spreading, primary tumor growth, the time of appearance of metastases, and the average life duration of tumor-bearing animals

Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

International Nuclear Information System (INIS)

Zhang, Y.; Woloschak, G.E.

1997-01-01

This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed

Oxidation of hydroxylamine by cytochrome P-460 of the obligate methylotroph Methylococcus capsulatus Bath.

Science.gov (United States)

Zahn, J A; Duncan, C; DiSpirito, A A

1994-01-01

An enzyme capable of the oxidation of hydroxylamine to nitrite was isolated from the obligate methylotroph Methylococcus capsulatus Bath. The absorption spectra in cell extracts, electron paramagnetic resonance spectra, molecular weight, covalent attachment of heme group to polypeptide, and enzymatic activities suggest that the enzyme is similar to cytochrome P-460, a novel iron-containing protein previously observed only in Nitrosomonas europaea. The native and subunit molecular masses of the M. capsulatus Bath protein were 38,900 and 16,390 Da, respectively; the isoelectric point was 6.98. The enzyme has approximately one iron and one copper atom per subunit. The electron paramagnetic resonance spectrum of the protein showed evidence for a high-spin ferric heme. In contrast to the enzyme from N. europaea, a 13-nm blue shift in the soret band of the ferrocytochrome (463 nm in cell extracts to 450 nm in the final sample) occurred during purification. The amino acid composition and N-terminal amino acid sequence of the enzyme from M. capsulatus Bath was similar but not identical to those of cytochrome P-460 of N. europaea. In cell extracts, the identity of the biological electron acceptor is as yet unestablished. Cytochrome c-555 is able to accept electrons from cytochrome P-460, although the purified enzyme required phenazine methosulfate for maximum hydroxylamine oxidation activity (specific activity, 366 mol of O2 per s per mol of enzyme). Hydroxylamine oxidation rates were stimulated approximately 2-fold by 1 mM cyanide and 1.5-fold by 0.1 mM 8-hydroxyquinoline. Images PMID:7928947

Enhanced Missing Proteins Detection in NCI60 Cell Lines Using an Integrative Search Engine Approach.

Science.gov (United States)

Guruceaga, Elizabeth; Garin-Muga, Alba; Prieto, Gorka; Bejarano, Bartolomé; Marcilla, Miguel; Marín-Vicente, Consuelo; Perez-Riverol, Yasset; Casal, J Ignacio; Vizcaíno, Juan Antonio; Corrales, Fernando J; Segura, Victor

2017-12-01

The Human Proteome Project (HPP) aims deciphering the complete map of the human proteome. In the past few years, significant efforts of the HPP teams have been dedicated to the experimental detection of the missing proteins, which lack reliable mass spectrometry evidence of their existence. In this endeavor, an in depth analysis of shotgun experiments might represent a valuable resource to select a biological matrix in design validation experiments. In this work, we used all the proteomic experiments from the NCI60 cell lines and applied an integrative approach based on the results obtained from Comet, Mascot, OMSSA, and X!Tandem. This workflow benefits from the complementarity of these search engines to increase the proteome coverage. Five missing proteins C-HPP guidelines compliant were identified, although further validation is needed. Moreover, 165 missing proteins were detected with only one unique peptide, and their functional analysis supported their participation in cellular pathways as was also proposed in other studies. Finally, we performed a combined analysis of the gene expression levels and the proteomic identifications from the common cell lines between the NCI60 and the CCLE project to suggest alternatives for further validation of missing protein observations.

Pentastatin-1, a collagen IV derived 20-mer peptide, suppresses tumor growth in a small cell lung cancer xenograft model.

Science.gov (United States)

Koskimaki, Jacob E; Karagiannis, Emmanouil D; Tang, Benjamin C; Hammers, Hans; Watkins, D Neil; Pili, Roberto; Popel, Aleksander S

2010-02-01

Angiogenesis is the formation of neovasculature from a pre-existing vascular network. Progression of solid tumors including lung cancer is angiogenesis-dependent. We previously introduced a bioinformatics-based methodology to identify endogenous anti-angiogenic peptide sequences, and validated these predictions in vitro in human umbilical vein endothelial cell (HUVEC) proliferation and migration assays. One family of peptides with high activity is derived from the alpha-fibrils of type IV collagen. Based on the results from the in vitro screening, we have evaluated the ability of a 20 amino acid peptide derived from the alpha5 fibril of type IV collagen, pentastatin-1, to suppress vessel growth in an angioreactor-based directed in vivo angiogenesis assay (DIVAA). In addition, pentastatin-1 suppressed tumor growth with intraperitoneal peptide administration in a small cell lung cancer (SCLC) xenograft model in nude mice using the NCI-H82 human cancer cell line. Pentastatin-1 decreased the invasion of vessels into angioreactors in vivo in a dose dependent manner. The peptide also decreased the rate of tumor growth and microvascular density in vivo in a small cell lung cancer xenograft model. The peptide treatment significantly decreased the invasion of microvessels in angioreactors and the rate of tumor growth in the xenograft model, indicating potential treatment for angiogenesis-dependent disease, and for translational development as a therapeutic agent for lung cancer.

Pentastatin-1, a collagen IV derived 20-mer peptide, suppresses tumor growth in a small cell lung cancer xenograft model

International Nuclear Information System (INIS)

Koskimaki, Jacob E; Karagiannis, Emmanouil D; Tang, Benjamin C; Hammers, Hans; Watkins, D Neil; Pili, Roberto; Popel, Aleksander S

2010-01-01

Angiogenesis is the formation of neovasculature from a pre-existing vascular network. Progression of solid tumors including lung cancer is angiogenesis-dependent. We previously introduced a bioinformatics-based methodology to identify endogenous anti-angiogenic peptide sequences, and validated these predictions in vitro in human umbilical vein endothelial cell (HUVEC) proliferation and migration assays. One family of peptides with high activity is derived from the α-fibrils of type IV collagen. Based on the results from the in vitro screening, we have evaluated the ability of a 20 amino acid peptide derived from the α5 fibril of type IV collagen, pentastatin-1, to suppress vessel growth in an angioreactor-based directed in vivo angiogenesis assay (DIVAA). In addition, pentastatin-1 suppressed tumor growth with intraperitoneal peptide administration in a small cell lung cancer (SCLC) xenograft model in nude mice using the NCI-H82 human cancer cell line. Pentastatin-1 decreased the invasion of vessels into angioreactors in vivo in a dose dependent manner. The peptide also decreased the rate of tumor growth and microvascular density in vivo in a small cell lung cancer xenograft model. The peptide treatment significantly decreased the invasion of microvessels in angioreactors and the rate of tumor growth in the xenograft model, indicating potential treatment for angiogenesis-dependent disease, and for translational development as a therapeutic agent for lung cancer

TH-E-BRF-07: Raman Spectroscopy for Radiation Treatment Response Assessment in a Lung Metastases Mouse Model

Energy Technology Data Exchange (ETDEWEB)

Devpura, S; Barton, K; Brown, S; Siddiqui, F; Chetty, I [Henry Ford Health System, Detroit, MI (United States); Sethi, S [Karmanos Cancer Center, Detroit, MI (United States); Klein, M [Children' s Hospital of Michigan, Detroit, MI (United States)

2014-06-15

Purpose: Raman spectroscopy is an optical spectroscopic method used to probe chemical information about a target tissue. Our goal was to investigate whether Raman spectroscopy is able to distinguish lung tumors from normal lung tissue and whether this technique can identify the molecular changes induced by radiation. Methods: 4T1 mouse breast cancer cells were implanted subcutaneously into the flanks of 6 Balb/C female mice. Four additional mice were used as “normal lung” controls. After 14 days, 3 mice bearing tumors received 6Gy to the left lung with 6MV photons and the other three were treated as “unirradiated tumor” controls. At a 24-hour time point, lungs were excised and the specimens were sectioned using a cryostat; alternating sections were either stained with hematoxylin and eosin (H and E) for evaluation by a pathologist or unstained for Raman measurements. 240 total Raman spectra were collected; 84 from normal lung controls; 63 from unirradiated tumors and 64 from tumors irradiated with 6Gy in a single fraction. Raman spectra were also collected from normal lung tissues of mice with unirradiated tumors. Principal component analysis (PCA) and discriminant function analysis (DFA) were performed to analyze the data. Results: Raman bands assignable to DNA/RNA showed prominent contributions in tumor tissues while Raman bands associated with hemoglobin showed strong contributions in normal lung tissue. PCA/DFA analysis identified normal lung tissue and tumor with 100% and 98.4% accuracy, respectively, relative to pathologic scoring. Additionally, normal lung tissues from unirradiated mice bearing tumors were classified as normal with 100% accuracy. In a model consisting of unirradiated and irradiated tumors identification accuracy was 79.4% and 93.8% respectively, relative to pathologic assessment. Conclusion: Initial results demonstrate the promise for Raman spectroscopy in the diagnosis normal vs. lung metastases as well as the assessment of

TH-E-BRF-07: Raman Spectroscopy for Radiation Treatment Response Assessment in a Lung Metastases Mouse Model

International Nuclear Information System (INIS)

Devpura, S; Barton, K; Brown, S; Siddiqui, F; Chetty, I; Sethi, S; Klein, M

2014-01-01

Purpose: Raman spectroscopy is an optical spectroscopic method used to probe chemical information about a target tissue. Our goal was to investigate whether Raman spectroscopy is able to distinguish lung tumors from normal lung tissue and whether this technique can identify the molecular changes induced by radiation. Methods: 4T1 mouse breast cancer cells were implanted subcutaneously into the flanks of 6 Balb/C female mice. Four additional mice were used as “normal lung” controls. After 14 days, 3 mice bearing tumors received 6Gy to the left lung with 6MV photons and the other three were treated as “unirradiated tumor” controls. At a 24-hour time point, lungs were excised and the specimens were sectioned using a cryostat; alternating sections were either stained with hematoxylin and eosin (H and E) for evaluation by a pathologist or unstained for Raman measurements. 240 total Raman spectra were collected; 84 from normal lung controls; 63 from unirradiated tumors and 64 from tumors irradiated with 6Gy in a single fraction. Raman spectra were also collected from normal lung tissues of mice with unirradiated tumors. Principal component analysis (PCA) and discriminant function analysis (DFA) were performed to analyze the data. Results: Raman bands assignable to DNA/RNA showed prominent contributions in tumor tissues while Raman bands associated with hemoglobin showed strong contributions in normal lung tissue. PCA/DFA analysis identified normal lung tissue and tumor with 100% and 98.4% accuracy, respectively, relative to pathologic scoring. Additionally, normal lung tissues from unirradiated mice bearing tumors were classified as normal with 100% accuracy. In a model consisting of unirradiated and irradiated tumors identification accuracy was 79.4% and 93.8% respectively, relative to pathologic assessment. Conclusion: Initial results demonstrate the promise for Raman spectroscopy in the diagnosis normal vs. lung metastases as well as the assessment of

Effect of inclusions modified by rare earth elements (Ce, La) on localized marine corrosion in Q460NH weathering steel

International Nuclear Information System (INIS)

Liu, Chao; Revilla, Reynier I.; Liu, Zhiyong; Zhang, Dawei; Li, Xiaogang; Terryn, Herman

2017-01-01

Highlights: •The initial stages of the pitting corrosion of Q460NH steel in a marine environment was studied. •Two different types of inclusions formed in the Q460NH steel after adding rare earth. •Both types of inclusions showed a lower Volta potential than the matrix. •Pitting corrosion was induced by the dissolution of inclusions rather than the matrix. •Inclusions containing (RE)AlO 3 dissolved completely as a result of the acidic solution formed in the pits. -- Abstract: In this work the initial stages of the pitting corrosion in Q460NH weathering steel in a marine environment was studied. To elucidate the effects of inclusions modified by rare earth (RE) elements on pitting corrosion, field emission-scanning electron microscopy-energy dispersive spectrometry (FE-SEM-EDS) analyses, scanning Kelvin probe force microscopy (SKPFM) tests, and a series of immersion tests were conducted. Two main types of inclusions were formed in the steel, and different pit morphologies were observed. The pitting corrosion was initiated by the dissolution of (RE) 2 O 2 S-(RE)xSy in both types of inclusions due to the lower potential of this phase compared to the matrix, which indicated that the inclusions in the Q460NH weathering steel had a lower pitting corrosion resistance than the matrix.

NUC041, a Prodrug of the DNA Methytransferase Inhibitor 5-aza-2′,2′-Difluorodeoxycytidine (NUC013, Leads to Tumor Regression in a Model of Non-Small Cell Lung Cancer

Directory of Open Access Journals (Sweden)

Richard Daifuku

2018-04-01

Full Text Available 5-aza-2′,2′-difluorodeoxycytidine (NUC013 has been shown to be significantly safer and more effective than decitabine in xenograft models of human leukemia and colon cancer. However, it suffers from a similar short half-life as other DNA methyltransferase inhibitors with a 5-azacytosine base, which is problematic for nucleosides that primarily target tumor cells in S phase. Because of the relative instability of 5-azanucleosides, a prodrug approach was developed to improve the pharmacology of NUC013. NUC013 was conjugated with trimethylsilanol (TMS at the 3′ and 5′ position of the sugar, rendering the molecule hydrophobic and producing 3′,5′-di-trimethylsilyl-2′,2′-difluoro-5-azadeoxycytidine (NUC041. NUC041 was designed to be formulated in a hydrophobic vehicle, protecting it from deamination and hydrolysis. In contact with blood, the TMS moieties are readily hydrolyzed to release NUC013. The half-life of NUC013 administered intravenously in mice is 20.1 min, while that of NUC013 derived from intramuscular NUC041 formulated in a pegylated-phospholipid depot is 3.4 h. In a NCI-H460 xenograft of non-small cell lung cancer, NUC013 was shown to significantly inhibit tumor growth and improve survival. Treatment with NUC041 also led to significant tumor growth inhibition. However, NUC041-treated mice had significantly more tumors ulcerate than either NUC013 treated mice or saline control mice, and such ulceration occurred at significantly lower tumor volumes. In these nude mice, tumor regression was likely mediated by the derepression of the tumor suppressor gene p53 and resultant activation of natural killer (NK cells.

Enhanced anticancer effects of Scutellaria barbata D. Don in combination with traditional Chinese medicine components on non-small cell lung cancer cells.

Science.gov (United States)

Wang, Qian; Acharya, Narayan; Liu, Zhongwei; Zhou, Xianmei; Cromie, Meghan; Zhu, Jia; Gao, Weimin

2018-05-10

Experience-based herbal medicine as a complementary to modern western medicine has triggered an array of studies in quest of novel anticancer drugs. Scutellaria barbata D. Don (SB) is commonly used to treat different types of cancers, but its molecular mechanism of action is not clearly understood. In this study, we attempted to elucidate the mode of action of a traditional Chinese medicine prescription with a total of 14 components, named Lian-Jia-San-Jie-Fang (LJSJF, in Chinese), where SB works as the "principle" against non-small cell lung cancer (NSCLC) cells. Four different NSCLC cell lines (A549, H460, H1650, and H1975) were used. Cytotoxicity, in vitro tumorigenicity, gene expression, and protein expression were analyzed by MTT assay, soft agar assay, real-time PCR, and Western blots, respectively. Among the 14 components in LJSJF, SB was the only one to possess cytotoxic effects at its pharmacologically relevant doses. Additionally, we observed synergistically dose-dependent cytotoxic effects of SB in combination with other LJSJF components. After SB or LJSJF treatment, significant reductions in colony number and/or size were observed in A549 and H460; a notable dose-dependent decrease in EGFR was observed in A549, H460, and H1650; significant downregulation in EGFR and its downstream signaling targets mTOR and p38MAPK were also observed in A549 and H460; and p53 and p21 were significantly increased while survivin, cyclin D1, and MDM2 were significantly decreased in A549. Additionally, p53, p21, and Mettl7b were decreased, but p73 was increased in H460. Neither EGFR nor p53 was changed in H1975. Therefore, SB or LJSJF may induce cytotoxic effects by regulating multiple and/or distinct apoptotic pathways in different NSCLC cells. LJSJF exerts more pronounced cytotoxic effects against NSCLC cells than SB does by synergistically regulating the underlining molecular mechanisms including EGFR and/or p53 signaling pathways. Copyright © 2018 Elsevier B.V. All

Persistent Identifier Practice for Big Data Management at NCI

Directory of Open Access Journals (Sweden)

Jingbo Wang

2017-04-01

Full Text Available The National Computational Infrastructure (NCI manages over 10 PB research data, which is co-located with the high performance computer (Raijin and an HPC class 3000 core OpenStack cloud system (Tenjin. In support of this integrated High Performance Computing/High Performance Data (HPC/HPD infrastructure, NCI’s data management practices includes building catalogues, DOI minting, data curation, data publishing, and data delivery through a variety of data services. The metadata catalogues, DOIs, THREDDS, and Vocabularies, all use different Uniform Resource Locator (URL styles. A Persistent IDentifier (PID service provides an important utility to manage URLs in a consistent, controlled and monitored manner to support the robustness of our national ‘Big Data’ infrastructure. In this paper we demonstrate NCI’s approach of utilising the NCI’s 'PID Service 'to consistently manage its persistent identifiers with various applications.

Inhibition of experimental lung metastasis by systemic lentiviral delivery of kallistatin

International Nuclear Information System (INIS)

Shiau, Ai-Li; Wu, Chao-Liang; Lee, Che-Hsin; Teo, Min-Li; Chen, Shin-Yao; Wang, Chrong-Reen; Hsieh, Jeng-Long; Chang, Meng-Ya; Chang, Chih-Jui; Chao, Julie; Chao, Lee

2010-01-01

Angiogenesis plays an important role in the development and progression of tumors. Kallistatin exerts anti-angiogenic and anti-inflammatory activities that may be effective in inhibiting tumor metastasis. We investigated the antitumor effect of lentivirus-mediated kallistatin gene transfer in a syngeneic murine tumor model. Lentiviral vector encoding kallistatin (LV-Kallistatin) was constructed. The expression of kallistatin was verified by enzyme-linked immunosorbent assay (ELISA), and the bioactivity of kallistatin was determined by using cell proliferation, migration, and invasion assays. In addition, antitumor effects of LV-Kallistatin were evaluated by the intravenous injection of virus into tumor-bearing mice. The conditioned medium from LV-Kallistatin-treated cells inhibited the migration and proliferation of endothelial cells. Meanwhile, it also reduced the migration and invasion of tumor cells. In the experimental lung metastatic model, tumor-bearing mice receiving LV-Kallistatin had lower tumor nodules and longer survival than those receiving control virus or saline. Moreover, the microvessel densities, the levels of vascular endothelial growth factor (VEGF), tumor necrosis factor (TNF)-α, and nuclear factor κB (NF-κB) transcriptional activity were reduced in the LV-Kallistatin-treated mice. Results of this study showed that systemic administration of lentiviral vectors encoding kallistatin inhibited the growth of metastatic tumor and prolonged the survival of tumor-bearing mice. These results suggest that gene therapy using lentiviruses carrying the kallistatin gene, which exerts anti-angiogenic and anti-inflammatory activities, represents a promising strategy for the treatment of lung cancer

EcoBears

DEFF Research Database (Denmark)

Nielsen, Nick; Pedersen, Sandra Bleuenn; Sørensen, Jens Ager

2015-01-01

In this paper, we introduce the EcoBears concept that aims to augment household appliances with functional and aesthetic features to promote their "use'' and "longevity of use'' to prevent their disposal. The EcoBears also aim to support the communication of environmental issues in the home setting....... We present our initial design and implementation of the EcoBears that consist of two bear modules (a mother and her cub). We also present our preliminary concept validations and lessons learned to be considered for future directions....

30 CFR 250.460 - What are the requirements for conducting a well test?

Science.gov (United States)

2010-07-01

... Other Drilling Requirements § 250.460 What are the requirements for conducting a well test? (a) If you intend to conduct a well test, you must include your projected plans for the test with your APD (form MMS...) You must give the District Manager at least 24-hours notice before starting a well test. [68 FR 8423...

16 CFR 460.16 - What new home sellers must tell new home buyers.

Science.gov (United States)

2010-01-01

... LABELING AND ADVERTISING OF HOME INSULATION § 460.16 What new home sellers must tell new home buyers. If you are a new home seller, you must put the following information in every sales contract: The type... exception to this rule. If the buyer signs a sales contract before you know what type of insulation will be...

Stable isotopes to detect food-conditioned bears and to evaluate human-bear management

Science.gov (United States)

Hopkins, John B.; Koch, Paul L.; Schwartz, Charles C.; Ferguson, Jake M.; Greenleaf, Schuyler S.; Kalinowski, Steven T.

2012-01-01

We used genetic and stable isotope analysis of hair from free-ranging black bears (Ursus americanus) in Yosemite National Park, California, USA to: 1) identify bears that consume human food, 2) estimate the diets of these bears, and 3) evaluate the Yosemite human–bear management program. Specifically, we analyzed the isotopic composition of hair from bears known a priori to be food-conditioned or non-food-conditioned and used these data to predict whether bears with an unknown management status were food-conditioned (FC) or non-food-conditioned (NFC). We used a stable isotope mixing model to estimate the proportional contribution of natural foods (plants and animals) versus human food in the diets of FC bears. We then used results from both analyses to evaluate proactive (population-level) and reactive (individual-level) human–bear management, and discussed new metrics to evaluate the overall human–bear management program in Yosemite. Our results indicated that 19 out of 145 (13%) unknown bears sampled from 2005 to 2007 were food-conditioned. The proportion of human food in the diets of known FC bears likely declined from 2001–2003 to 2005–2007, suggesting proactive management was successful in reducing the amount of human food available to bears. In contrast, reactive management was not successful in changing the management status of known FC bears to NFC bears, or in reducing the contribution of human food to the diets of FC bears. Nine known FC bears were recaptured on 14 occasions from 2001 to 2007; all bears were classified as FC during subsequent recaptures, and human–bear management did not reduce the amount of human food in the diets of FC bears. Based on our results, we suggest Yosemite continue implementing proactive human–bear management, reevaluate reactive management, and consider removing problem bears (those involved in repeated bear incidents) from the population.

State Space Formulation of Nonlinear Vibration Responses Collected from a Dynamic Rotor-Bearing System: An Extension of Bearing Diagnostics to Bearing Prognostics.

Science.gov (United States)

Tse, Peter W; Wang, Dong

2017-02-14

Bearings are widely used in various industries to support rotating shafts. Their failures accelerate failures of other adjacent components and may cause unexpected machine breakdowns. In recent years, nonlinear vibration responses collected from a dynamic rotor-bearing system have been widely analyzed for bearing diagnostics. Numerous methods have been proposed to identify different bearing faults. However, these methods are unable to predict the future health conditions of bearings. To extend bearing diagnostics to bearing prognostics, this paper reports the design of a state space formulation of nonlinear vibration responses collected from a dynamic rotor-bearing system in order to intelligently predict bearing remaining useful life (RUL). Firstly, analyses of nonlinear vibration responses were conducted to construct a bearing health indicator (BHI) so as to assess the current bearing health condition. Secondly, a state space model of the BHI was developed to mathematically track the health evolution of the BHI. Thirdly, unscented particle filtering was used to predict bearing RUL. Lastly, a new bearing acceleration life testing setup was designed to collect natural bearing degradation data, which were used to validate the effectiveness of the proposed bearing prognostic method. Results show that the prediction accuracy of the proposed bearing prognostic method is promising and the proposed bearing prognostic method is able to reflect future bearing health conditions.

State Space Formulation of Nonlinear Vibration Responses Collected from a Dynamic Rotor-Bearing System: An Extension of Bearing Diagnostics to Bearing Prognostics

Directory of Open Access Journals (Sweden)

Peter W. Tse

2017-02-01

Full Text Available Bearings are widely used in various industries to support rotating shafts. Their failures accelerate failures of other adjacent components and may cause unexpected machine breakdowns. In recent years, nonlinear vibration responses collected from a dynamic rotor-bearing system have been widely analyzed for bearing diagnostics. Numerous methods have been proposed to identify different bearing faults. However, these methods are unable to predict the future health conditions of bearings. To extend bearing diagnostics to bearing prognostics, this paper reports the design of a state space formulation of nonlinear vibration responses collected from a dynamic rotor-bearing system in order to intelligently predict bearing remaining useful life (RUL. Firstly, analyses of nonlinear vibration responses were conducted to construct a bearing health indicator (BHI so as to assess the current bearing health condition. Secondly, a state space model of the BHI was developed to mathematically track the health evolution of the BHI. Thirdly, unscented particle filtering was used to predict bearing RUL. Lastly, a new bearing acceleration life testing setup was designed to collect natural bearing degradation data, which were used to validate the effectiveness of the proposed bearing prognostic method. Results show that the prediction accuracy of the proposed bearing prognostic method is promising and the proposed bearing prognostic method is able to reflect future bearing health conditions.

Significance of Fractionated Administration of Thalidomide Combined With γ-Ray Irradiation in Terms of Local Tumor Response and Lung Metastasis

Science.gov (United States)

Masunaga, Shin-ichiro; Sanada, Yu; Moriwaki, Takahiro; Tano, Keizo; Sakurai, Yoshinori; Tanaka, Hiroki; Suzuki, Minoru; Kondo, Natsuko; Narabayashi, Masaru; Watanabe, Tsubasa; Nakagawa, Yosuke; Maruhashi, Akira; Ono, Koji

2014-01-01

Background The aim of this study was to evaluate the significance of fractionated administration of thalidomide combined with γ-ray irradiation in terms of local tumor response and lung metastatic potential, referring to the response of intratumor quiescent (Q) cells. Methods B16-BL6 melanoma tumor-bearing C57BL/6 mice were continuously given 5-bromo-2’-deoxyuridine (BrdU) to label all proliferating (P) cells. The tumor-bearing mice then received γ-ray irradiation after thalidomide treatment through a single or two consecutive daily intraperitoneal administrations up to a total dose of 400 mg/kg in combination with an acute hypoxia-releasing agent (nicotinamide) or mild temperature hyperthermia (MTH). Immediately after the irradiation, cells from some tumors were isolated and incubated with a cytokinesis blocker. The responses of the Q and total (= P + Q) cell populations were assessed based on the frequency of micronuclei using immunofluorescence staining for BrdU. In other tumor-bearing mice, 17 days after irradiation, macroscopic lung metastases were enumerated. Results Thalidomide raised the sensitivity of the total cell population more remarkably than Q cells in both single and daily administrations. Daily administration of thalidomide elevated the sensitivity of both the total and Q cell populations, but especially the total cell population, compared with single administration. Daily administration, especially combined with MTH, decreased the number of lung metastases. Conclusion Daily fractionated administration of thalidomide in combination with γ-ray irradiation was thought to be more promising than single administration because of its potential to enhance local tumor response and repress lung metastatic potential. PMID:29147396

Malalties de transmissió sexual a urgències pediàtriques

OpenAIRE

Díaz Sabogal, Diana; Curcoy Barcenilla, Ana Isabel; Trenchs Sainz de la Maza, Victoria; Giménez Roca, Clara; Luaces Cubells, Carles

2014-01-01

Determinar les característiques dels pacients diag- nosticats de malalties de transmissió sexual (MTS) a urgèn- cies i establir la freqüència en què són degudes a abús sexual. Mètode. Estudi retrospectiu fet entre el gener del 2007 i el desembre del 2011. S'inclouen els pacients menors de 18 anys diagnosticats a urgències d'MTS -infecció per Neisse- ria gonorrhoeae, Chlamydia trachomatis, Treponema palli- dum, , virus d'immunodeficiència humana (VIH), virus del pa- pil loma humà (VPH) i virus...

Comparison of Alignment Correction Angles Between Fixed-Bearing and Mobile-Bearing UKA.

Science.gov (United States)

Inoue, Atsuo; Arai, Yuji; Nakagawa, Shuji; Inoue, Hiroaki; Yamazoe, Shoichi; Kubo, Toshikazu

2016-01-01

Good outcomes have been reported with both fixed-bearing and mobile-bearing unicompartmental knee arthroplasty (UKA). However, overcorrected alignment could induce the progression of arthritis on the non-arthroplasty side. Changes of limb alignment after UKA with both types of bearings (fixed bearing: 24 knees, mobile bearing: 28 knees) were investigated. The mean difference between the preoperative standing femoral-tibial angle (FTA) and postoperative standing FTA was significantly larger in mobile bearing UKA group. In fixed-bearing UKA, there must be some laxity in MCL tension so that a 2-mm tension gauge can be inserted. In mobile-bearing UKA, appropriate MCL tension is needed to prevent bearing dislocation. This difference in MCL tension may have caused the difference in the correction angle between the groups. Copyright © 2016 Elsevier Inc. All rights reserved.

Usefulness of Daily Fractionated Administration of Wortmannin Combined With γ-Ray Irradiation in Terms of Local Tumor Response and Lung Metastasis

Science.gov (United States)

Masunaga, Shin-ichiro; Sakurai, Yoshinori; Tanaka, Hiroki; Suzuki, Minoru; Kondo, Natsuko; Narabayashi, Masaru; Tano, Keizo; Maruhashi, Akira; Ono, Koji

2013-01-01

Background To evaluate the usefulness of fractionated administration of wortmannin combined with γ-ray irradiation in terms of local tumor response and lung metastatic potential, referring to the response of intratumor quiescent (Q) cells. Methods B16-BL6 melanoma tumor-bearing C57BL/6 mice were continuously given 5-bromo-2’-deoxyuridine (BrdU) to label all proliferating (P) cells. The tumor-bearing mice then received γ-ray irradiation after wortmannin treatment through a single or 4 consecutive daily intraperitoneal administrations up to a total dose of 4 mg/kg in combination with an acute hypoxia-releasing agent (nicotinamide) or mild temperature hyperthermia (MTH). Immediately after the irradiation, cells from some tumors were isolated and incubated with a cytokinesis blocker. The responses of the Q and total (= P + Q) cell populations were assessed based on the frequency of micronuclei using immunofluorescence staining for BrdU. In other tumor-bearing mice, 17 days after irradiation, macroscopic lung metastases were enumerated. Results Wortmannin raised the sensitivity of Q cells more remarkably than the total cell population in both single and daily administrations. Daily administration of wortmannin elevated the sensitivity of both the total and Q cell populations, but especially the total cell population, compared with single administration. Daily administration, especially combined with MTH, decreased the number of lung metastases. Conclusion Daily fractionated administration of wortmannin in combination with γ-ray irradiation was thought to be more promising than single administration because of its potential to enhance local tumor response and repress lung metastatic potential. PMID:29147327

Alpha-adducin Gly460Trp polymorphism and hypertension risk: a meta-analysis of 22 studies including 14303 cases and 15961 controls.

Directory of Open Access Journals (Sweden)

Kuo Liu

Full Text Available BACKGROUND: No clear consensus has been reached on the alpha-adducin polymorphism (Gly460Trp and essential hypertension risk. We performed a meta-analysis in an effort to systematically summarize the possible association. METHODOLOGY/PRINCIPAL FINDINGS: Studies were identified by searching MEDLINE and EMBASE databases complemented with perusal of bibliographies of retrieved articles and correspondence with original authors. The fixed-effects model and the random-effects model were applied for dichotomous outcomes to combine the results of the individual studies. We selected 22 studies that met the inclusion criteria including a total of 14303 hypertensive patients and 15961 normotensive controls. Overall, the 460Trp allele showed no statistically significant association with hypertension risk compared to Gly460 allele (P = 0.69, OR = 1.02, 95% CI 0.94-1.10, P(heterogeneity<0.0001 in all subjects. Meta-analysis under other genetic contrasts still did not reveal any significant association in all subjects, Caucasians, East Asians and others. The results were similar but heterogeneity did not persist when sensitivity analyses were limited to these studies. CONCLUSIONS/SIGNIFICANCE: Our meta-analysis failed to provide evidence for the genetic association of α-adducin gene Gly460Trp polymorphism with hypertension. Further studies investigating the effect of genetic networks, environmental factors, individual biological characteristics and their mutual interactions are needed to elucidate the possible mechanism for hypertension in humans.

A review of bear farming and bear trade in Lao People's Democratic Republic

Directory of Open Access Journals (Sweden)

E. Livingstone

2018-01-01

Full Text Available This study reviews the bear farming industry in Lao PDR with the objective of documenting the current number of commercial bear facilities (i.e. captive bear facilities judged to be trading in bear bile and/or bears and bear parts and the number of bears contained within these facilities, noting changes since it was last examined between 2000 and 2012 by Livingstone and Shepherd (2014. We surveyed all known commercial bear facilities and searched for previously unrecorded facilities. We compared our records with Livingstone and Shepherd (2014 and corrected some duplicate records from their study. In 2017, we recorded seven commercial facilities; four dedicated bear farms, and three tiger farms that were reportedly also keeping bears. We found that between 2012 and 2017 the recorded number of dedicated bear farms reduced by two, and the recorded number of tiger farms also keeping bears increased by one. Within the same period, the total number of captive bears among all facilities in Lao PDR hardly changed (+one, but the number of bears within each facility did. The northern facilities, owned by ethnic Chinese, have expanded since 2012, and central and southern facilities have downsized or closed. While bear farming appears to be downsizing in Lao PDR overall, efforts to phase it out are undermined by the expansion of foreign owned facilities in the north, within Special and Specific Economic Zones that largely cater to a Chinese market, and where the Lao government's efforts to enforce laws and protect wildlife appear to be lacking. Closing the facilities in the north will require political will and decisive law enforcement. Keywords: Bear farms, Bear bile, Gall bladder, Urso-deoxycholic acid, Bear bile extraction facilities, Lao PDR, Ursus thibetanus

NCI Helps Children’s Hospital of Philadelphia to Identify and Treat New Target in Pediatric Cancer | Poster

Science.gov (United States)

There may be a new, more effective method for treating high-risk neuroblastoma, according to scientists at the Children’s Hospital of Philadelphia and collaborators in the Cancer and Inflammation Program at NCI at Frederick. Together, the groups published a study describing a previously unrecognized protein on neuroblastoma cells, called GPC2, as well as the creation of a

Molecular phylogeny and SNP variation of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) derived from genome sequences.

Science.gov (United States)

Cronin, Matthew A; Rincon, Gonzalo; Meredith, Robert W; MacNeil, Michael D; Islas-Trejo, Alma; Cánovas, Angela; Medrano, Juan F

2014-01-01

We assessed the relationships of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) with high throughput genomic sequencing data with an average coverage of 25× for each species. A total of 1.4 billion 100-bp paired-end reads were assembled using the polar bear and annotated giant panda (Ailuropoda melanoleuca) genome sequences as references. We identified 13.8 million single nucleotide polymorphisms (SNP) in the 3 species aligned to the polar bear genome. These data indicate that polar bears and brown bears share more SNP with each other than either does with black bears. Concatenation and coalescence-based analysis of consensus sequences of approximately 1 million base pairs of ultraconserved elements in the nuclear genome resulted in a phylogeny with black bears as the sister group to brown and polar bears, and all brown bears are in a separate clade from polar bears. Genotypes for 162 SNP loci of 336 bears from Alaska and Montana showed that the species are genetically differentiated and there is geographic population structure of brown and black bears but not polar bears.

Rsf-1 is overexpressed in non-small cell lung cancers and regulates cyclinD1 expression and ERK activity

International Nuclear Information System (INIS)

Li, Qingchang; Dong, Qianze; Wang, Enhua

2012-01-01

Highlights: ► Rsf-1 expression is elevated in non-small cell lung cancers. ► Rsf-1 depletion inhibits proliferation and increased apoptosis in lung cancer cells. ► Rsf-1 depletion decreases the level of cyclinD1 and phosphor-ERK expression. -- Abstract: Rsf-1 (HBXAP) was recently reported to be overexpressed in various cancers and associated with the malignant behavior of cancer cells. However, the expression of Rsf-1 in primary lung cancer and its biological roles in non-small cell lung cancer (NSCLC) have not been reported. The molecular mechanism of Rsf-1 in cancer aggressiveness remains ambiguous. In the present study, we analyzed the expression pattern of Rsf-1 in NSCLC tissues and found that Rsf-1 was overexpressed at both the mRNA and protein levels. There was a significant association between Rsf-1 overexpression and TNM stage (p = 0.0220) and poor differentiation (p = 0.0013). Furthermore, knockdown of Rsf-1 expression in H1299 and H460 cells with high endogenous Rsf-1 expression resulted in a decrease of colony formation ability and inhibition of cell cycle progression. Rsf-1 knockdown also induced apoptosis in these cell lines. Further analysis showed that Rsf-1 knockdown decreased cyclin D1 expression and phospho-ERK levels. In conclusion, Rsf-1 is overexpressed in NSCLC and contributes to malignant cell growth by cyclin D1 and ERK modulation, which makes Rsf-1 a candidate therapeutic target in lung cancer.

Teddy Bear Stories

DEFF Research Database (Denmark)

van Leeuwen, Theo; Caldas-Coulthardt, Carmen

2014-01-01

This paper presents a semiotic analysis of a key cultural artefact, the teddy bear. After introducing the iconography of the teddy bear, it analyses different kinds of stories to show how teddy bears are endowed with meaning in everyday life: stories from children's books, reminiscenses by adults...... bears have traditionally centred on interpersonal relations within the nuclear family, but have recently been institutionalized and commercialized....

Inhibition of experimental lung metastasis by systemic lentiviral delivery of kallistatin

Directory of Open Access Journals (Sweden)

Chao Julie

2010-05-01

Full Text Available Abstract Background Angiogenesis plays an important role in the development and progression of tumors. Kallistatin exerts anti-angiogenic and anti-inflammatory activities that may be effective in inhibiting tumor metastasis. We investigated the antitumor effect of lentivirus-mediated kallistatin gene transfer in a syngeneic murine tumor model. Methods Lentiviral vector encoding kallistatin (LV-Kallistatin was constructed. The expression of kallistatin was verified by enzyme-linked immunosorbent assay (ELISA, and the bioactivity of kallistatin was determined by using cell proliferation, migration, and invasion assays. In addition, antitumor effects of LV-Kallistatin were evaluated by the intravenous injection of virus into tumor-bearing mice. Results The conditioned medium from LV-Kallistatin-treated cells inhibited the migration and proliferation of endothelial cells. Meanwhile, it also reduced the migration and invasion of tumor cells. In the experimental lung metastatic model, tumor-bearing mice receiving LV-Kallistatin had lower tumor nodules and longer survival than those receiving control virus or saline. Moreover, the microvessel densities, the levels of vascular endothelial growth factor (VEGF, tumor necrosis factor (TNF-α, and nuclear factor κB (NF-κB transcriptional activity were reduced in the LV-Kallistatin-treated mice. Conclusion Results of this study showed that systemic administration of lentiviral vectors encoding kallistatin inhibited the growth of metastatic tumor and prolonged the survival of tumor-bearing mice. These results suggest that gene therapy using lentiviruses carrying the kallistatin gene, which exerts anti-angiogenic and anti-inflammatory activities, represents a promising strategy for the treatment of lung cancer.

“Bear-ly” learning: Limits of abstraction in black bear cognition

Directory of Open Access Journals (Sweden)

Jennifer Vonk

2018-02-01

Full Text Available We presented two American black bears (Ursus americanus with a serial list learning memory task, and one of the bears with a matching-to-sample task. After extended training, both bears demonstrated some success with the memory task but failed to generalize the overarching rule of the task to novel stimuli. Matching to sample proved even more difficult for our bear to learn. We conclude that, despite previous success in training bears to respond to natural categories, quantity discriminations, and other related tasks, that bears may possess a cognitive limitation with regards to learning abstract rules. Future tests using different procedures are necessary to determine whether this is a limit of bears’ cognitive capacities, or a limitation of the current tasks as presented. Future tests should present a larger number of varying stimuli. Ideally, bears of various species should be tested on these tasks to demonstrate species as well as individual differences.

GAS BEARING

Science.gov (United States)

Skarstrom, C.W.

1960-09-01

A gas lubricated bearing for a rotating shaft is described. The assembly comprises a stationary collar having an annular member resiliently supported thereon. The collar and annular member are provided with cooperating gas passages arranged for admission of pressurized gas which supports and lubricates a bearing block fixed to the rotatable shaft. The resilient means for the annular member support the latter against movement away from the bearing block when the assembly is in operation.

Experimental studies of the reimplantation of irradiated lung in dogs

Energy Technology Data Exchange (ETDEWEB)

Kondo, T; Fujimura, S; Sohara, Y; Kawakami, M; Okaniwa, G [Tohoku Univ., Sendai (Japan). Research Inst. for Tuberculosis and Cancer

1978-02-01

In order to treat the patients with lung cancer who have impaired cardiopulmonary function, a new method is designed, which includes the following steps; 1) pneumonectomy, 2) resection of tumor-bearing lobe, 3) /sup 60/Co irradiation to the remaining lobe, and 4) orthotopic reimplantation of the irradiated lung. The purpose of present study is to clarify the feasibility to use this method clinically. Using adult mongreal dogs, left lung was excised, irradiated and reimplanted. Radiation was carried out from 2,000 rad to 4,000 rad. Viability and function of reimplanted lungs were evaluated by their survival time, serial chest x-ray films, sup(99m)Tc-MAA perfusion scanning, unilateral pulmonary artery occlusion test and histologic examinations. Of 17 animals, 12 survived postoperative period and following results were obtained; 1) no dogs developed pulmonary edema, 2) only one dog was considered to die from acute radiation pneumonitis, 3) serial perfusion scanning showed a gradual decrease in flow distribution to the transplanted lung, 4) the right pulmonary occlusion test done in the dog irradiated with 2,000 rad revealed well reserved pulmonary function 2 months after the operation, and 5) histologically, most irradiated lungs revealed so-called ''late reaction'' of lung fibrosis, but there was the case with nearly normal findings after 6 months from the operation. Although many reports concerning to the radiation pneumonitis are published, there have not been any such reports as the present study. From our experiment, it may be indicated that there is a feasibility to use this new method clinically.

Phoyunnanin E inhibits migration of non-small cell lung cancer cells via suppression of epithelial-to-mesenchymal transition and integrin αv and integrin β3.

Science.gov (United States)

Petpiroon, Nareerat; Sritularak, Boonchoo; Chanvorachote, Pithi

2017-12-29

The conversion of the epithelial phenotype of cancer cells into cells with a mesenchymal phenotype-so-called epithelial-mesenchymal transition (EMT)-has been shown to enhance the capacity of the cells to disseminate throughout the body. EMT is therefore becoming a potential target for anti-cancer drug discovery. Here, we showed that phoyunnanin E, a compound isolated from Dendrobium venustum, possesses anti-migration activity and addressed its mechanism of action. The cytotoxic and proliferative effects of phoyunnanin E on human non-small cell lung cancer-derived H460, H292, and A549 cells and human keratinocyte HaCaT cells were investigated by MTT assay. The effect of phoyunnanin E on EMT was evaluated by determining the colony formation and EMT markers. The migration and invasion of H460, H292, A549 and HaCaT cells was evaluated by wound healing assay and transwell invasion assay, respectively. EMT markers, integrins and migration-associated proteins were examined by western blot analysis. Phoyunnanin E at the concentrations of 5 and 10 μM, which are non-toxic to H460, H292, A549 and HaCaT cells showed good potential to inhibit the migratory activity of three types of human lung cancer cells. The anti-migration effect of phoyunnanin E was shown to relate to the suppressed EMT phenotypes, including growth in anchorage-independent condition, cell motility, and EMT-specific protein markers (N-cadherin, vimentin, slug, and snail). In addition to EMT suppression, we found that phoyunnanin E treatment with 5 and 10 μM could decrease the cellular level of integrin αv and integrin β3, these integrins are frequently up-regulated in highly metastatic tumor cells. We further characterized the regulatory proteins in cell migration and found that the cells treated with phoyunnanin E exhibited a significantly lower level of phosphorylated focal adhesion kinase (p-FAK) and phosphorylated ATP-dependent tyrosine kinase (p-AKT), and their downstream effectors (including

Plant collecting program in Southeast Asia under the sponsorship of the United States National Cancer Institute (NCI) (1986-1991)

NARCIS (Netherlands)

Soejarto, D.D.

1992-01-01

Under the funding from the United States National Cancer Institute (NCI)¹, a program was undertaken to collect plant samples in Southeast Asia to be tested for their cancer- and AIDS-arresting properties, for the period of September 1, 1986 through August 31, 1991. The program was implemented with

Genomic evidence of geographically widespread effect of gene flow from polar bears into brown bears.

Science.gov (United States)

Cahill, James A; Stirling, Ian; Kistler, Logan; Salamzade, Rauf; Ersmark, Erik; Fulton, Tara L; Stiller, Mathias; Green, Richard E; Shapiro, Beth

2015-03-01

Polar bears are an arctic, marine adapted species that is closely related to brown bears. Genome analyses have shown that polar bears are distinct and genetically homogeneous in comparison to brown bears. However, these analyses have also revealed a remarkable episode of polar bear gene flow into the population of brown bears that colonized the Admiralty, Baranof and Chichagof islands (ABC islands) of Alaska. Here, we present an analysis of data from a large panel of polar bear and brown bear genomes that includes brown bears from the ABC islands, the Alaskan mainland and Europe. Our results provide clear evidence that gene flow between the two species had a geographically wide impact, with polar bear DNA found within the genomes of brown bears living both on the ABC islands and in the Alaskan mainland. Intriguingly, while brown bear genomes contain up to 8.8% polar bear ancestry, polar bear genomes appear to be devoid of brown bear ancestry, suggesting the presence of a barrier to gene flow in that direction. © 2014 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Enhanced Anticancer Activity of PF-04691502, a Dual PI3K/mTOR Inhibitor, in Combination With VEGF siRNA Against Non–small-cell Lung Cancer

Directory of Open Access Journals (Sweden)

Laura Espana-Serrano

2016-01-01

Full Text Available Lung cancer is the leading cause of cancer deaths in both men and women in the United States accounting for about 27% of all cancer deceases. In our effort to develop newer therapy for lung cancer, we evaluated the combinatory antitumor effect of siRNA targeting VEGF and the PI3K/mTOR dual inhibitor PF-04691502. We analyzed the anticancer effect of siRNA VEGF and PF-04691502 combination on proliferation, colony formation and migration of A549 and H460 lung cancer cells. Additionally, we assessed the combination treatment antiangiogenic effect on human umbilical vein endothelial cells. Here, we show for the first time that the antiangiogenic siRNA VEGF potentiates the PF-04691502 anticancer activity against non–small-cell lung cancer. We observed a significant (P < 0.05 decrease in cell viability, colony formation, and migration for the combination comparing with the single drug treatment. We also showed a significant (P < 0.05 enhanced effect of the combination treatment inhibiting angiogenesis progression and tube formation organization compared to the single drug treatment groups. Our findings demonstrated an enhanced synergistic anticancer effect of siRNA VEGF and PF-04691502 combination therapy by targeting two main pathways involved in lung cancer cell survival and angiogenesis which will be useful for future preclinical studies and potentially for lung cancer patient management.

Experimental study of gene expression in lung and bronchus of radon-exposed mice

International Nuclear Information System (INIS)

Guo Zhiying; Tian Mei; Liu Jianxiang; Ruan Jianlei; Piao Chunnan; Su Xu

2008-01-01

Objective: To construct and identify differentially expressed cDNA library in lung and bronchus of mice exposed to radon. Methods: 2 week old, weighing (18-22)g, male BALB/c mice were placed in a SR-NIM02 radon chamber. One group of mice was exposed to radon, which was equivalent to the accumulative dose of 30 WLM. The control group was about 0.02 WLM. To construct a subtracted cDNA library enriched with differentially expressed genes, the Super SMART technique and the suppression subtractive hybridization (SSH) were performed. The obtained forward and reverse cDNA fragments were directly inserted into pGEM-T-easy vector and transformed into E. coli DH5α. The inserts in plasmid were amplified by nested polymerase chain reaction (PCR), and some of which were sequenced. In the end these sequences were BLASTed with GeneBank. Results: 146 of 460 clones obtained randomly were positive clones contained (1000-1500)bp inserted cDNA fragments. The forward and reverse subtracted cDNA library in lung and bronchus of mice exposed to radon was constructed, and 48 up-regulation and 61 down-regulation cDNA sequences selected were homologous with GeneBank in different extent. Conclusions: The subtracted cDNA library in lung and bronchus of mice exposed to radon is successfully constructed, and genes that differentially expressed are identified. Some genes might have relation with the immunity, cell cycle and apoptosis. (authors)

EFFECT OF CLEARANCE THE BALL BEARINGS ON INCORRECT WORK OF THREE-SUPORT BEARING SHAFT

Directory of Open Access Journals (Sweden)

Jarosław KACZOR

2014-06-01

Full Text Available Durability deep groove ball bearings depends on factors (called attributes design, technological and operational. Among the design features one of the most important is play in the bearings. Polish Norm shows five groups of looseness in the bearings, in which the play range from 0 to 105 microns. Manufacturers of rolling bearings they only play group, which has a bearing data, without giving the exact value of the slack. Aim of this study is to determine how it affects the play in the bearings to work three-bearing shafts, including elasticity and resilience three-bearing shafts.

Axin gene methylation status correlates with radiosensitivity of lung cancer cells

International Nuclear Information System (INIS)

Yang, Lian-He; Stoecker, Maggie; Wang, Endi; Xu, Ke; Wang, En-Hua; Han, Yang; Li, Guang; Xu, Hong-Tao; Jiang, Gui-Yang; Miao, Yuan; Zhang, Xiu-Peng; Zhao, Huan-Yu; Xu, Zheng-Fan

2013-01-01

We previously reported that Axin1 (Axin) is down-regulated in many cases of lung cancer, and X-ray irradiation increased Axin expression and inhibited lung cancer cells. The mechanisms, however, were not clear. Four lung cancer cell lines were used to detect the methylation status of Axin with or without X-ray treatment. Real-time PCR was used to quantify the expression of Axin, and western blot analysis was applied to measure protein levels of Axin, β-catenin, Cyclin D1, MMP-7, DNMTS, MeCP2 and acetylated histones. Flow cytometric analysis, colony formation assay, transwell assay and xenograft growth experiment were used to study the biological behavior of the cells with hypermethylated or unmethylated Axin gene after X-ray treatment. Hypermethylated Axin gene was detected in 2 of 4 cell lines, and it correlated inversely with Axin expression. X-ray treatment significantly up-regulated Axin expression in H446 and H157 cells, which possess intrinsic hypermethylation of the Axin gene (P<0.01), but did not show up-regulation in LTE and H460 cells, which have unmethylated Axin gene. 2Gy X-ray significantly reduced colony formation (from 71% to 10.5%) in H157 cells, while the reduction was lower in LTE cells (from 71% to 20%). After X-ray irradiation, xenograft growth was significantly decreased in H157 cells (from 1.15 g to 0.28 g) in comparison with LTE cells (from 1.06 g to 0.65 g). Significantly decreased cell invasiveness and increased apoptosis were also observed in H157 cells treated with X-ray irradiation (P<0.01). Down-regulation of DNMTs and MeCP2 and up-regulation of acetylated histones could be detected in lung cancer cells. X-ray-induced inhibition of lung cancer cells may be mediated by enhanced expression of Axin via genomic DNA demethylation and histone acetylation. Lung cancer cells with a different methylation status of the Axin gene showed different radiosensitivity, suggesting that the methylation status of the Axin gene may be one important factor

A long liquid Cherenkov counter for 300 to 460 MeV/c pion beams

International Nuclear Information System (INIS)

Zavrtanik, D.; Sever, F.; Plesko, M.; Music, M.; Kernel, G.

1984-01-01

A long liquid Cherenkov counter has been used to measure the proportion of muons in positive and negative pion beams in the momentum range between 300 and 460 MeV/c. A nine-parameter function fits all the spectra well. The data show a smooth dependence on incident momenta and agree with calculations of pion and muon pulse heights. (orig.)

Geology and geomorphology of Bear Lake Valley and upper Bear River, Utah and Idaho

Science.gov (United States)

Reheis, M.C.; Laabs, B.J.C.; Kaufman, D.S.

2009-01-01

Bear Lake, on the Idaho-Utah border, lies in a fault-bounded valley through which the Bear River flows en route to the Great Salt Lake. Surficial deposits in the Bear Lake drainage basin provide a geologic context for interpretation of cores from Bear Lake deposits. In addition to groundwater discharge, Bear Lake received water and sediment from its own small drainage basin and sometimes from the Bear River and its glaciated headwaters. The lake basin interacts with the river in complex ways that are modulated by climatically induced lake-level changes, by the distribution of active Quaternary faults, and by the migration of the river across its fluvial fan north of the present lake. The upper Bear River flows northward for ???150 km from its headwaters in the northwestern Uinta Mountains, generally following the strike of regional Laramide and late Cenozoic structures. These structures likely also control the flow paths of groundwater that feeds Bear Lake, and groundwater-fed streams are the largest source of water when the lake is isolated from the Bear River. The present configuration of the Bear River with respect to Bear Lake Valley may not have been established until the late Pliocene. The absence of Uinta Range-derived quartzites in fluvial gravel on the crest of the Bear Lake Plateau east of Bear Lake suggests that the present headwaters were not part of the drainage basin in the late Tertiary. Newly mapped glacial deposits in the Bear River Range west of Bear Lake indicate several advances of valley glaciers that were probably coeval with glaciations in the Uinta Mountains. Much of the meltwater from these glaciers may have reached Bear Lake via groundwater pathways through infiltration in the karst terrain of the Bear River Range. At times during the Pleistocene, the Bear River flowed into Bear Lake and water level rose to the valley threshold at Nounan narrows. This threshold has been modified by aggradation, downcutting, and tectonics. Maximum lake

Bioactivity of different enriched phenolic extracts of wild fruits from Northeastern Portugal: a comparative study.

Science.gov (United States)

Guimarães, Rafaela; Barros, Lillian; Calhelha, Ricardo C; Carvalho, Ana Maria; Queiroz, Maria João R P; Ferreira, Isabel C F R

2014-03-01

Arbutus unedo, Prunus spinosa, Rosa micrantha and Rosa canina are good sources of phenolic compounds, including anthocyanins. These compounds have potent antioxidant properties, which have been related to anticancer activity. Herein, the in vitro antioxidant and antitumor properties of enriched phenolic extracts (non-anthocyanin phenolic compounds enriched extract- PE and anthocyanins enriched extract- AE) of the mentioned wild fruits were evaluated and compared. PE gave higher bioactive properties than the corresponding AE. It was observed a high capacity of A. unedo phenolic extract to inhibit lipid peroxidation in animal brain homogenates (EC50 = 7.21 μg/mL), as also a high antitumor potential against NCI-H460 human cell line (non-small lung cancer; GI50 = 37.68 μg/mL), which could be related to the presence of galloyl derivatives (exclusively found in this species). The bioactivity of the studied wild fruits proved to be more related to the phenolic compounds profile than to the amounts present in each extract, and could be considered in the design of new formulations of dietary supplements or functional foods.

Chemical composition of the essential oil from the leaves of Anaxagorea brevipes (Annonaceae) and evaluation of its bioactivity.

Science.gov (United States)

de Alencar, Danielle Cardoso; Pinheiro, Maria Lúcia Belém; Pereira, José Lamak da Silva; de Carvalho, João Ernesto; Campos, Francinete Ramos; Serain, Alessandra Freitas; Tirico, Ricardo Brunelli; Hernández-Tasco, Alvaro José; Costa, Emmanoel Vilaça; Salvador, Marcos José

2016-01-01

The essential oil obtained by hydrodistillation from leaves of Anaxagorea brevipes was analysed by gas chromatography fitted with a flame ionisation detector (GC-FID) and coupled to mass spectrometry (GC-MS). Thirty one components were identified, representing around 75.7% of total oil. The major components were β-eudesmol (13.16%), α-eudesmol (13.05%), γ-eudesmol (7.54%), guaiol (5.12%), caryophyllene oxide (4.18%) and β-bisabolene (4.10%). The essential oil showed antimicrobial activity against Gram-positive bacteria and yeast with the MIC values between 25.0 and 100 μg/mL. The highest antiproliferative activity was observed for the oil against MCF-7 (breast, TGI = 12.8 μg/mL), NCI-H460 (lung, TGI = 13.0 μg/mL) and PC-3 (prostate, TGI = 9.6 μg/mL) cell lines, while against no cancer cell line HaCat (keratinocyte) the TGI was 38.8 μg/mL. The oil exhibited a small antioxidant activity assessed through ORAC-FL assay (517 μmol TE/g). This is the first report regarding the chemical composition and bioactivity of A. brevipes essential oil.

Mandelalides A-D, cytotoxic macrolides from a new Lissoclinum species of South African tunicate.

Science.gov (United States)

Sikorska, Justyna; Hau, Andrew M; Anklin, Clemens; Parker-Nance, Shirley; Davies-Coleman, Michael T; Ishmael, Jane E; McPhail, Kerry L

2012-07-20

Mandelalides A-D are variously glycosylated, unusual polyketide macrolides isolated from a new species of Lissoclinum ascidian collected from South Africa, Algoa Bay near Port Elizabeth and the surrounding Nelson Mandela Metropole. Their planar structures were elucidated on submilligram samples by comprehensive analysis of 1D and 2D NMR data, supported by mass spectrometry. The assignment of relative configuration was accomplished by consideration of homonuclear and heteronuclear coupling constants in tandem with ROESY data. The absolute configuration was assigned for mandelalide A after chiral GC-MS analysis of the hydrolyzed monosaccharide (2-O-methyl-α-L-rhamnose) and consideration of ROESY correlations between the monosaccharide and aglycone in the intact natural product. The resultant absolute configuration of the mandelalide A macrolide was extrapolated to propose the absolute configurations of mandelalides B-D. Remarkably, mandelalide B contained the C-4' epimeric 2-O-methyl-6-dehydro-α-L-talose. Mandelalides A and B showed potent cytotoxicity to human NCI-H460 lung cancer cells (IC(50), 12 and 44 nM, respectively) and mouse Neuro-2A neuroblastoma cells (IC(50), 29 and 84 nM, respectively).

High NOTCH activity induces radiation resistance in non small cell lung cancer

International Nuclear Information System (INIS)

Theys, Jan; Yahyanejad, Sanaz; Habets, Roger; Span, Paul; Dubois, Ludwig; Paesmans, Kim; Kattenbeld, Bo; Cleutjens, Jack; Groot, Arjan J.; Schuurbiers, Olga C.J.; Lambin, Philippe; Bussink, Jan; Vooijs, Marc

2013-01-01

Background and purpose: Patients with advanced NSCLC have survival rates <15%. The NOTCH pathway plays an important role during lung development and physiology but is often deregulated in lung cancer, making it a potential therapeutic target. We investigated NOTCH signaling in NSCLC and hypothesized that high NOTCH activity contributes to radiation resistance. Materials and methods: NOTCH signaling in NSCLC patient samples was investigated using quantitative RT-PCR. H460 NSCLC cells with either high or blocked NOTCH activity were generated and their radiation sensitivity monitored using clonogenic assays. In vivo, xenograft tumors were irradiated and response assessed using growth delay. Microenvironmental parameters were analyzed by immunohistochemistry. Results: Patients with high NOTCH activity in tumors showed significantly worse disease-free survival. In vitro, NOTCH activity did not affect the proliferation or intrinsic radiosensitivity of NSCLC cells. In contrast, xenografts with blocked NOTCH activity grew slower than wild type tumors. Tumors with high NOTCH activity grew significantly faster, were more hypoxic and showed a radioresistant phenotype. Conclusions: We demonstrate an important role for NOTCH in tumor growth and correlate high NOTCH activity with poor prognosis and radioresistance. Blocking NOTCH activity in NSCLC might be a promising intervention to improve outcome after radiotherapy

Chromosome aberration frequency in blood lymphocytes of animals with 239Pu lung burdens

International Nuclear Information System (INIS)

Brooks, A.L.; LaBauve, R.J.; McClellan, R.O.; Jensen, D.A.

1976-01-01

Other investigators have suggested a causal relationship between accidental 239 Pu exposures in man and the presence of chromosome aberrations in blood lymphocytes. For experimental assessment of this relationship, 16 rhesus monkeys and 171 Chinese hamsters were exposed to 239 PuO 2 aerosols and an additional five hamsters were injected with 239 Pu citrate, and the frequency of aberrations in blood lymphocyte was determined. Hamsters with the highest lung burden had a median survival time of about 80 days. No deaths occurred in any of the other treated hamsters or monkeys by 250 days after 239 Pu inhalation. Hamsters sacrificed at 30 days showed an increase in chromosome aberration frequency with increasing dose to lungs. By 120 days after inhalation, the aberration frequency in the controls was 0.012. The frequency in animals with doses that produced significant life shortening had decreased to 0.018 and to 0.032 aberration/cell in animals with lower doses. At 380 days after injection of 2 nCi of 239 Pu citrate per gram of body weight, hamster lymphocytes had an aberration frequency of 0.048 aberration/cell. The level of chromosome damage in the 239 PuO 2 -exposed monkeys at 30 and 90 days after inhalation was not different from that observed in controls. Possible reasons for differences between the experimental animal observations and findings in man are discussed

Case-control study of lung cancer among workers at a uranium processing plant

International Nuclear Information System (INIS)

Cookfair, D.L.

1982-01-01

The purpose of this case-control study was to investigate the relationship between exposure to radiation resulting from the inhalation of uranium dust and the dust of uranium-bearing compounds and death due to lung cancer. Cases and controls were chosen from a cohort of white male workers employed at one uranium processing plant during World War II. The 330 cases consisted of all lung cancer deaths occurring in the cohort between 1943 and 1973. Level of exposure to radiation and other potential workplace carcinogens was determined for each worker using process manuals, industrial hygiene reports, air monitoring data and individual work histories. Smoking status and information regarding medical variables was determined from employee medical records. Cumulative radiation lung dose among study population members ranged from 0 to 75 rads. Data were analyzed using Mantel-Haenszel stratified analysis and logistic regression. Relative risk was found to increase with increasing level of lung dose exposure even after controlling for age, smoking status and other workplace exposures, but only for those who were over the age of 44 when first exposed. A statistically significant excess in risk was found for men in this hire age group with a cumulative lung dose of 20 rads or more. The risk associated with the overall work environment was also investigated using a summary measure of total workplace exposure called chemical rank. A similar relationship existed between chemical rank and lung cancer to that found for cumulative lung dose and lung cancer

State Space Formulation of Nonlinear Vibration Responses Collected from a Dynamic Rotor-Bearing System: An Extension of Bearing Diagnostics to Bearing Prognostics

OpenAIRE

Peter W. Tse; Dong Wang

2017-01-01

Bearings are widely used in various industries to support rotating shafts. Their failures accelerate failures of other adjacent components and may cause unexpected machine breakdowns. In recent years, nonlinear vibration responses collected from a dynamic rotor-bearing system have been widely analyzed for bearing diagnostics. Numerous methods have been proposed to identify different bearing faults. However, these methods are unable to predict the future health conditions of bearings. To exten...

Evaluation of bearing configurations using the single bearing tester in liquid nitrogen

Science.gov (United States)

Jett, T.; Hall, P.; Thom, R.

1991-01-01

Various bearing configurations were tested using the Marshall Space Flight Center single bearing tester with LN2 as the cryogenic coolant. The baseline was one Rocketdyne phase one high pressure oxidizer turbopump (HPOTP) pump end 45-mm bore bearing. The bearing configurations that were tested included a Salox/M cage configuration, a silicon nitride ball configuration, an elongated cage configuration, and a Bray 601 grease configuration.

The Lung Image Database Consortium (LIDC) and Image Database Resource Initiative (IDRI): A Completed Reference Database of Lung Nodules on CT Scans

International Nuclear Information System (INIS)

2011-01-01

Purpose: The development of computer-aided diagnostic (CAD) methods for lung nodule detection, classification, and quantitative assessment can be facilitated through a well-characterized repository of computed tomography (CT) scans. The Lung Image Database Consortium (LIDC) and Image Database Resource Initiative (IDRI) completed such a database, establishing a publicly available reference for the medical imaging research community. Initiated by the National Cancer Institute (NCI), further advanced by the Foundation for the National Institutes of Health (FNIH), and accompanied by the Food and Drug Administration (FDA) through active participation, this public-private partnership demonstrates the success of a consortium founded on a consensus-based process. Methods: Seven academic centers and eight medical imaging companies collaborated to identify, address, and resolve challenging organizational, technical, and clinical issues to provide a solid foundation for a robust database. The LIDC/IDRI Database contains 1018 cases, each of which includes images from a clinical thoracic CT scan and an associated XML file that records the results of a two-phase image annotation process performed by four experienced thoracic radiologists. In the initial blinded-read phase, each radiologist independently reviewed each CT scan and marked lesions belonging to one of three categories (''nodule≥3 mm,''''nodule<3 mm,'' and ''non-nodule≥3 mm''). In the subsequent unblinded-read phase, each radiologist independently reviewed their own marks along with the anonymized marks of the three other radiologists to render a final opinion. The goal of this process was to identify as completely as possible all lung nodules in each CT scan without requiring forced consensus. Results: The Database contains 7371 lesions marked ''nodule'' by at least one radiologist. 2669 of these lesions were marked ''nodule≥3 mm'' by at least one radiologist, of which 928 (34.7%) received such marks from all

NCI's Distributed Geospatial Data Server

Science.gov (United States)

Larraondo, P. R.; Evans, B. J. K.; Antony, J.

2016-12-01

Earth systems, environmental and geophysics datasets are an extremely valuable source of information about the state and evolution of the Earth. However, different disciplines and applications require this data to be post-processed in different ways before it can be used. For researchers experimenting with algorithms across large datasets or combining multiple data sets, the traditional approach to batch data processing and storing all the output for later analysis rapidly becomes unfeasible, and often requires additional work to publish for others to use. Recent developments on distributed computing using interactive access to significant cloud infrastructure opens the door for new ways of processing data on demand, hence alleviating the need for storage space for each individual copy of each product. The Australian National Computational Infrastructure (NCI) has developed a highly distributed geospatial data server which supports interactive processing of large geospatial data products, including satellite Earth Observation data and global model data, using flexible user-defined functions. This system dynamically and efficiently distributes the required computations among cloud nodes and thus provides a scalable analysis capability. In many cases this completely alleviates the need to preprocess and store the data as products. This system presents a standards-compliant interface, allowing ready accessibility for users of the data. Typical data wrangling problems such as handling different file formats and data types, or harmonising the coordinate projections or temporal and spatial resolutions, can now be handled automatically by this service. The geospatial data server exposes functionality for specifying how the data should be aggregated and transformed. The resulting products can be served using several standards such as the Open Geospatial Consortium's (OGC) Web Map Service (WMS) or Web Feature Service (WFS), Open Street Map tiles, or raw binary arrays under

miR-375 is highly expressed and possibly transactivated by achaete-scute complex homolog 1 in small-cell lung cancer cells

Institute of Scientific and Technical Information of China (English)

Huijie Zhao; Lei Zhu; Yujuan Jin; Hongbin Ji; Xiumin Yan; Xueliang Zhu

2012-01-01

In this study,we identified five miRNAs highly expressed in the small-cell lung cancer (SCLC) cell line NCI-H209.Among them,the expression levels of miR-375 were dramatically elevated in all SCLC cell lines examined,coincident with the expression of the transcription factor achaete-scute complex homolog 1 (ASCL1).Moreover,miR-375 was upregulated and correlated with ASCL1 in the cell lines generated from mouse SCLC-like tumors as well.Dual-luciferase assays further showed that ASCL1 activated the expression of miR-375 by binding to the three E-box elements in the miR-375 promoter.These results imply a role of ASCL1 in SCLC via the upregulation of miR-375.

Improvement of journal bearing operation at heavy misalignment using bearing flexibility and compliant liners

DEFF Research Database (Denmark)

Thomsen, Kim; Klit, Peder

2012-01-01

A flexure journal bearing design is proposed that will improve operational behaviour of a journal bearing at pronounced misalignment. Using a thermoelastohydrodynamic model, it is shown that the proposed flexure journal bearing has vastly increased the hydrodynamic performance compared to the stiff...... bearing when misaligned. The hydrodynamic performance is evaluated on lubricant film thickness, pressure and temperature. Furthermore, the influence of a compliant bearing liner is investigated and it is found that it increases the hydrodynamic performance when applied to a stiff bearing, whereas...... the liner has practically no influence on the flexure journal bearing's performance....

Multi-technology control centre to integrate 460 MW renewables

International Nuclear Information System (INIS)

2016-01-01

The new RWE Innogy Aersa Control Centre that has been certified to act as an interface with CECRE (the Renewable Energy Control Centre) since February 2015, connects RWE’s 20 renewable energy facilities with REE, the Spanish Electricity Grid. As a result, it ensures that wind farms, in addition to hydropower and solar plants, can inject the energy generated by its 460 MW installed safely and with no penalties. Green Eagle Solutions, a provider of software solutions for renewable energy companies, has collaborated with RWE in the development of this Control Centre, meeting the high standards of quality and safety required by RWE. This centre uses CompactSCADA® technology to integrate power generation facilities that need to be integrated in a Control Centre to communicate with REE’s CECRE. (Author)

Higher lung accumulation of intravenously injected organic nanotubes

Directory of Open Access Journals (Sweden)

Maitani Y

2013-01-01

Full Text Available Yoshie Maitani,1 Yuri Nakamura,1 Masao Kon,1 Emi Sanada,1 Kae Sumiyoshi,1 Natsuki Fujine,1 Masumi Asakawa,2 Masaki Kogiso,2 Toshimi Shimizu21Institute of Medicinal Chemistry, Hoshi University, Tokyo, Japan; 2Nanotube Research Center (NTRC, National Institute of Advanced Industrial Science and Technology (AIST, Tsukuba, JapanAbstract: The size and shape of intravenously injected particles can affect their biodistribution and is of importance for the development of particulated drug carrier systems. In this study, organic nanotubes (ONTs with a carboxyl group at the surface, a length of approximately 2 µm and outer diameter of 70–90 nm, were injected intravenously into tumor-bearing mice. To use ONTs as drug carriers, the biodistribution in selected organs of ONTs postinjection was examined using irinotecan, as an entrapped water-soluble marker inside ONTs, and gadolinium-chelated ONT, as an ONT marker, and compared with that of a 3 µm fluorescently labeled spherical microparticle which was similar size to the length of ONTs. It was found that for irinotecan, its active metabolite and gadolinium-chelated ONTs were highly accumulated in the lung, but to a lower level in the liver and spleen. On the other hand, microparticles deposited less in the lung and more highly in the liver. Moreover, histologic examination showed ONTs distributed more in lung tissues in part, whereas microparticles were present in blood vessels postinjection. These preliminary results support the notion of using negatively charged ONTs as intravascular carriers to maximize accumulation in the lung whilst reducing sequestration by the liver and spleen. This finding suggested that ONTs are potential carriers for lung-targeting drug delivery.Keywords: organic nanotube, lung, biodistribution, microparticle, particle shape

Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage.

Science.gov (United States)

Hailer, Frank; Kutschera, Verena E; Hallström, Björn M; Klassert, Denise; Fain, Steven R; Leonard, Jennifer A; Arnason, Ulfur; Janke, Axel

2012-04-20

Recent studies have shown that the polar bear matriline (mitochondrial DNA) evolved from a brown bear lineage since the late Pleistocene, potentially indicating rapid speciation and adaption to arctic conditions. Here, we present a high-resolution data set from multiple independent loci across the nuclear genomes of a broad sample of polar, brown, and black bears. Bayesian coalescent analyses place polar bears outside the brown bear clade and date the divergence much earlier, in the middle Pleistocene, about 600 (338 to 934) thousand years ago. This provides more time for polar bear evolution and confirms previous suggestions that polar bears carry introgressed brown bear mitochondrial DNA due to past hybridization. Our results highlight that multilocus genomic analyses are crucial for an accurate understanding of evolutionary history.

Tumor cell proliferation and cyclooxygenase inhibitory constituents in horseradish (Armoracia rusticana) and Wasabi (Wasabia japonica).

Science.gov (United States)

Weil, Marvin J; Zhang, Yanjun; Nair, Muraleedharan G

2005-03-09

Cyclooxygenase and human tumor cell growth inhibitory extracts of horseradish (Armoracia rusticana) and wasabi (Wasabia japonica) rhizomes upon purification yielded active compounds 1-3 from horseradish and 4 and 5 from wasabi rhizomes. Spectroscopic analyses confirmed the identities of these active compounds as plastoquinone-9 (1), 6-O-acyl-beta-d-glucosyl-beta-sitosterol (2), 1,2-dilinolenoyl-3-galactosylglycerol (3), linolenoyloleoyl-3-beta-galactosylglycerol (4), and 1,2-dipalmitoyl-3-beta-galactosylglycerol (5). 3-Acyl-sitosterols, sinigrin, gluconasturtiin, and phosphatidylcholines isolated from horseradish and alpha-tocopherol and ubiquinone-10 from wasabi rhizomes isolated were inactive in our assays. At a concentration of 60 microg/mL, compounds 1 and 2 selectively inhibited COX-1 enzyme by 28 and 32%, respectively. Compounds 3, 4, and 5 gave 75, 42, and 47% inhibition of COX-1 enzyme, respectively, at a concentration of 250 microg/mL. In a dose response study, compound 3 inhibited the proliferation of colon cancer cells (HCT-116) by 21.9, 42.9, 51.2, and 68.4% and lung cancer cells (NCI-H460) by 30, 39, 44, and 71% at concentrations of 7.5, 15, 30, and 60 microg/mL, respectively. At a concentration of 60 microg/mL, compound 4 inhibited the growth of colon, lung, and stomach cancer cells by 28, 17, and 44%, respectively. This is the first report of the COX-1 enzyme and cancer cell growth inhibitory monogalactosyl diacylglycerides from wasabi and horseradish rhizomes.

GM1-gangliosidosis in American black bears: clinical, pathological, biochemical and molecular genetic characterization.

Science.gov (United States)

Muthupalani, Sureshkumar; Torres, Paola A; Wang, Betty C; Zeng, Bai Jin; Eaton, Samuel; Erdelyi, Ildiko; Ducore, Rebecca; Maganti, Rajanikarath; Keating, John; Perry, Bain J; Tseng, Florina S; Waliszewski, Nicole; Pokras, Mark; Causey, Robert; Seger, Rita; March, Philip; Tidwell, Amy; Pfannl, Rolf; Seyfried, Thomas; Kolodny, Edwin H; Alroy, Joseph

2014-04-01

G(M1)-gangliosidosis is a rare progressive neurodegenerative disorder due to an autosomal recessively inherited deficiency of lysosomal β-galactosidase. We have identified seven American black bears (Ursus americanus) found in the Northeast United States suffering from G(M1)-gangliosidosis. This report describes the clinical features, brain MRI, and morphologic, biochemical and molecular genetic findings in the affected bears. Brain lipids were compared with those in the brain of a G(M1)-mouse. The bears presented at ages 10-14 months in poor clinical condition, lethargic, tremulous and ataxic. They continued to decline and were humanely euthanized. The T(2)-weighted MR images of the brain of one bear disclosed white matter hyperintensity. Morphological studies of the brain from five of the bears revealed enlarged neurons with foamy cytoplasm containing granules. Axonal spheroids were present in white matter. Electron microscopic examination revealed lamellated membrane structures within neurons. Cytoplasmic vacuoles were found in the liver, kidneys and chondrocytes and foamy macrophages within the lungs. Acid β-galactosidase activity in cultured skin fibroblasts was only 1-2% of control values. In the brain, ganglioside-bound sialic acid was increased more than 2-fold with G(M1)-ganglioside predominating. G(A1) content was also increased whereas cerebrosides and sulfatides were markedly decreased. The distribution of gangliosides was similar to that in the G(M1)-mouse brain, but the loss of myelin lipids was greater in the brain of the affected bear than in the brain of the G(M1) mouse. Isolated full-length cDNA of the black bear GLB1 gene revealed 86% homology to its human counterpart in nucleotide sequence and 82% in amino acid sequence. GLB1 cDNA from liver tissue of an affected bear contained a homozygous recessive T(1042) to C transition inducing a Tyr348 to His mutation (Y348H) within a highly conserved region of the GLB1 gene. The coincidence of several

Vibration model of rolling element bearings in a rotor-bearing system for fault diagnosis

Science.gov (United States)

Cong, Feiyun; Chen, Jin; Dong, Guangming; Pecht, Michael

2013-04-01

Rolling element bearing faults are among the main causes of breakdown in rotating machines. In this paper, a rolling bearing fault model is proposed based on the dynamic load analysis of a rotor-bearing system. The rotor impact factor is taken into consideration in the rolling bearing fault signal model. The defect load on the surface of the bearing is divided into two parts, the alternate load and the determinate load. The vibration response of the proposed fault signal model is investigated and the fault signal calculating equation is derived through dynamic and kinematic analysis. Outer race and inner race fault simulations are realized in the paper. The simulation process includes consideration of several parameters, such as the gravity of the rotor-bearing system, the imbalance of the rotor, and the location of the defect on the surface. The simulation results show that different amplitude contributions of the alternate load and determinate load will cause different envelope spectrum expressions. The rotating frequency sidebands will occur in the envelope spectrum in addition to the fault characteristic frequency. This appearance of sidebands will increase the difficulty of fault recognition in intelligent fault diagnosis. The experiments given in the paper have successfully verified the proposed signal model simulation results. The test rig design of the rotor bearing system simulated several operating conditions: (1) rotor bearing only; (2) rotor bearing with loader added; (3) rotor bearing with loader and rotor disk; and (4) bearing fault simulation without rotor influence. The results of the experiments have verified that the proposed rolling bearing signal model is important to the rolling bearing fault diagnosis of rotor-bearing systems.

Polar bears at risk

Energy Technology Data Exchange (ETDEWEB)

Norris, S.; Rosentrater, L.; Eid, P.M. [WWF International Arctic Programme, Oslo (Norway)

2002-05-01

Polar bears, the world's largest terrestrial carnivore, spend much of their lives on the arctic sea ice. This is where they hunt and move between feeding, denning, and resting areas. The world population, estimated at 22,000 bears, is made up of 20 relatively distinct populations varying in size from a few hundred to a few thousand animals. About 60 per cent of all polar bears are found in Canada. In general, the status of this species is stable, although there are pronounced differences between populations. Reductions in the extent and thickness of sea ice has lead the IUCN Polar Bear Specialist Group to describe climate change as one of the major threats facing polar bears today. Though the long-term effects of climate change will vary in different areas of the Arctic, impacts on the condition and reproductive success of polar bears and their prey are likely to be negative. Longer ice-free periods resulting from earlier break-up of sea ice in the spring and later formation in the fall is already impacting polar bears in the southern portions of their range. In Canada's Hudson Bay, for example, bears hunt on the ice through the winter and into early summer, after which the ice melts completely, forcing bears ashore to fast on stored fat until freeze-up in the fall. The time bears have on the ice to hunt and build up their body condition is cut short when the ice melts early. Studies from Hudson Bay show that for every week earlier that ice break-up occurs, bears will come ashore 10 kg lighter and in poorer condition. It is likely that populations of polar bears dividing their time between land and sea will be severely reduced and local extinctions may occur as greenhouse gas emissions continue to rise and sea ice melts. Expected changes in regional weather patterns will also impact polar bears. Rain in the late winter can cause maternity dens to collapse before females and cubs have departed, thus exposing occupants to the elements and to predators. Such

Transient Vibration Prediction for Rotors on Ball Bearings Using Load-dependent Non-linear Bearing Stiffness

Science.gov (United States)

Fleming, David P.; Poplawski, J. V.

2002-01-01

Rolling-element bearing forces vary nonlinearly with bearing deflection. Thus an accurate rotordynamic transient analysis requires bearing forces to be determined at each step of the transient solution. Analyses have been carried out to show the effect of accurate bearing transient forces (accounting for non-linear speed and load dependent bearing stiffness) as compared to conventional use of average rolling-element bearing stiffness. Bearing forces were calculated by COBRA-AHS (Computer Optimized Ball and Roller Bearing Analysis - Advanced High Speed) and supplied to the rotordynamics code ARDS (Analysis of Rotor Dynamic Systems) for accurate simulation of rotor transient behavior. COBRA-AHS is a fast-running 5 degree-of-freedom computer code able to calculate high speed rolling-element bearing load-displacement data for radial and angular contact ball bearings and also for cylindrical and tapered roller beatings. Results show that use of nonlinear bearing characteristics is essential for accurate prediction of rotordynamic behavior.

Computational Environments and Analysis methods available on the NCI High Performance Computing (HPC) and High Performance Data (HPD) Platform

Science.gov (United States)

Evans, B. J. K.; Foster, C.; Minchin, S. A.; Pugh, T.; Lewis, A.; Wyborn, L. A.; Evans, B. J.; Uhlherr, A.

2014-12-01

The National Computational Infrastructure (NCI) has established a powerful in-situ computational environment to enable both high performance computing and data-intensive science across a wide spectrum of national environmental data collections - in particular climate, observational data and geoscientific assets. This paper examines 1) the computational environments that supports the modelling and data processing pipelines, 2) the analysis environments and methods to support data analysis, and 3) the progress in addressing harmonisation of the underlying data collections for future transdisciplinary research that enable accurate climate projections. NCI makes available 10+ PB major data collections from both the government and research sectors based on six themes: 1) weather, climate, and earth system science model simulations, 2) marine and earth observations, 3) geosciences, 4) terrestrial ecosystems, 5) water and hydrology, and 6) astronomy, social and biosciences. Collectively they span the lithosphere, crust, biosphere, hydrosphere, troposphere, and stratosphere. The data is largely sourced from NCI's partners (which include the custodians of many of the national scientific records), major research communities, and collaborating overseas organisations. The data is accessible within an integrated HPC-HPD environment - a 1.2 PFlop supercomputer (Raijin), a HPC class 3000 core OpenStack cloud system and several highly connected large scale and high-bandwidth Lustre filesystems. This computational environment supports a catalogue of integrated reusable software and workflows from earth system and ecosystem modelling, weather research, satellite and other observed data processing and analysis. To enable transdisciplinary research on this scale, data needs to be harmonised so that researchers can readily apply techniques and software across the corpus of data available and not be constrained to work within artificial disciplinary boundaries. Future challenges will

Local Attitudes towards Bear Management after Illegal Feeding and Problem Bear Activity.

Science.gov (United States)

Dubois, Sara; Fraser, David

2013-09-12

The "pot bears" received international media attention in 2010 after police discovered the intentional feeding of over 20 black bears during the investigation of an alleged marijuana-growing operation in Christina Lake, British Columbia, Canada. A two-phase random digit dialing survey of the community was conducted in 2011 to understand local perspectives on bear policy and management, before and after a summer of problem bear activity and government interventions. Of the 159 households surveyed in February 2011, most had neutral or positive attitudes towards bears in general, and supported the initial decision to feed the food-conditioned bears until the autumn hibernation. In contrast to wildlife experts however, most participants supported relocating the problem bears, or allowing them to remain in the area, ahead of killing; in part this arose from notions of fairness despite the acknowledged problems of relocation. Most locals were aware of the years of feeding but did not report it, evidently failing to see it as a serious form of harm, even after many bears had been killed. This underscores the importance of preventive action on wildlife feeding and the need to narrow the gap between public and expert opinion on the likely effects of relocation versus killing.

Urinary volatile compounds as biomarkers for lung cancer: a proof of principle study using odor signatures in mouse models of lung cancer.

Directory of Open Access Journals (Sweden)

Koichi Matsumura

2010-01-01

Full Text Available A potential strategy for diagnosing lung cancer, the leading cause of cancer-related death, is to identify metabolic signatures (biomarkers of the disease. Although data supports the hypothesis that volatile compounds can be detected in the breath of lung cancer patients by the sense of smell or through bioanalytical techniques, analysis of breath samples is cumbersome and technically challenging, thus limiting its applicability. The hypothesis explored here is that variations in small molecular weight volatile organic compounds ("odorants" in urine could be used as biomarkers for lung cancer. To demonstrate the presence and chemical structures of volatile biomarkers, we studied mouse olfactory-guided behavior and metabolomics of volatile constituents of urine. Sensor mice could be trained to discriminate between odors of mice with and without experimental tumors demonstrating that volatile odorants are sufficient to identify tumor-bearing mice. Consistent with this result, chemical analyses of urinary volatiles demonstrated that the amounts of several compounds were dramatically different between tumor and control mice. Using principal component analysis and supervised machine-learning, we accurately discriminated between tumor and control groups, a result that was cross validated with novel test groups. Although there were shared differences between experimental and control animals in the two tumor models, we also found chemical differences between these models, demonstrating tumor-based specificity. The success of these studies provides a novel proof-of-principle demonstration of lung tumor diagnosis through urinary volatile odorants. This work should provide an impetus for similar searches for volatile diagnostic biomarkers in the urine of human lung cancer patients.

Functional analyses of ATM, ATR and Fanconi anemia proteins in lung carcinoma

International Nuclear Information System (INIS)

Beumer, Jan H.; Fu, Katherine Y.; Anyang, Bean N.; Siegfried, Jill M.; Bakkenist, Christopher J.

2015-01-01

ATM and ATR are kinases implicated in a myriad of DNA-damage responses. ATM kinase inhibition radiosensitizes cells and selectively kills cells with Fanconi anemia (FA) gene mutations. ATR kinase inhibition sensitizes cells to agents that induce replication stress and selectively kills cells with ATM and TP53 mutations. ATM mutations and FANCF promoter-methylation are reported in lung carcinomas. We undertook functional analyses of ATM, ATR, Chk1 and FA proteins in lung cancer cell lines. We included Calu6 that is reported to be FANCL-deficient. In addition, the cancer genome atlas (TCGA) database was interrogated for alterations in: 1) ATM, MRE11A, RAD50 and NBN; 2) ATR, ATRIP and TOPBP1; and 3) 15 FA genes. No defects in ATM, ATR or Chk1 kinase activation, or FANCD2 monoubiquitination were identified in the lung cancer cell lines examined, including Calu6, and major alterations in these pathways were not identified in the TCGA database. Cell lines were radiosensitized by ATM kinase inhibitor KU60019, but no cell killing by ATM kinase inhibitor alone was observed. While no synergy between gemcitabine or carboplatin and ATR kinase inhibitor ETP-46464 was observed, synergy between gemcitabine and Chk1 kinase inhibitor UCN-01 was observed in 54 T, 201 T and H460, and synergy between carboplatin and Chk1 kinase inhibitor was identified in 201 T and 239 T. No interactions between ATM, ATR and FA activation were observed by either ATM or ATR kinase inhibition in the lung cancer cell lines. Analyses of ATM serine 1981 and Chk1 serine 345 phosphorylation, and FANCD2 monoubiquitination revealed that ATM and ATR kinase activation and FA pathway signaling are intact in the lung cancer cell lines examined. As such, these posttranslational modifications may have utility as biomarkers for the integrity of DNA damage signaling pathways in lung cancer. Different sensitization profiles between gemcitabine and carboplatin and ATR kinase inhibitor ETP-46464 and Chk1 kinase inhibitor

NFIX as a Master Regulator for Lung Cancer Progression

Directory of Open Access Journals (Sweden)

Nor I. A. Rahman

2017-08-01

Full Text Available About 40% of lung cancer cases globally are diagnosed at the advanced stage. Lung cancer has a high mortality and overall survival in stage I disease is only 70%. This study was aimed at finding a candidate of transcription regulator that initiates the mechanism for metastasis by integrating computational and functional studies. The genes involved in lung cancer were retrieved using in silico software. 10 kb promoter sequences upstream were scanned for the master regulator. Transient transfection of shRNA NFIXs were conducted against A549 and NCI-H1299 cell lines. qRT-PCR and functional assays for cell proliferation, migration and invasion were carried out to validate the involvement of NFIX in metastasis. Genome-wide gene expression microarray using a HumanHT-12v4.0 Expression BeadChip Kit was performed to identify differentially expressed genes and construct a new regulatory network. The in silico analysis identified NFIX as a master regulator and is strongly associated with 17 genes involved in the migration and invasion pathways including IL6ST, TIMP1 and ITGB1. Silencing of NFIX showed reduced expression of IL6ST, TIMP1 and ITGB1 as well as the cellular proliferation, migration and invasion processes. The data was integrated with the in silico analyses to find the differentially expressed genes. Microarray analysis showed that 18 genes were expressed differentially in both cell lines after statistical analyses integration between t-test, LIMMA and ANOVA with Benjamini-Hochberg adjustment at p-value < 0.05. A transcriptional regulatory network was created using all 18 genes, the existing regulated genes including the new genes PTCH1, NFAT5 and GGCX that were found highly associated with NFIX, the master regulator of metastasis. This study suggests that NFIX is a promising target for therapeutic intervention that is expected to inhibit metastatic recurrence and improve survival rate.

Genetic relationships of extant brown bears (Ursus arctos) and polar bears (Ursus maritimus).

Science.gov (United States)

Cronin, Matthew A; MacNeil, Michael D

2012-01-01

Polar bears (Ursus maritimus) and brown bears (Ursus arctos) are closely related species for which extensive mitochondrial and nuclear phylogenetic comparisons have been made. We used previously published genotype data for 8 microsatellite DNA loci from 930 brown bears in 19 populations and 473 polar bears in 16 populations to compare the population genetic relationships of extant populations of the species. Genetic distances (Nei standard distance = 1.157), the proportion of private alleles (52% of alleles are not shared by the species), and Bayesian cluster analysis are consistent with morphological and life-history characteristics that distinguish polar bears and brown bears as different species with little or no gene flow among extant populations.

Intersections of lung progenitor cells, lung disease and lung cancer.

Science.gov (United States)

Kim, Carla F

2017-06-30

The use of stem cell biology approaches to study adult lung progenitor cells and lung cancer has brought a variety of new techniques to the field of lung biology and has elucidated new pathways that may be therapeutic targets in lung cancer. Recent results have begun to identify the ways in which different cell populations interact to regulate progenitor activity, and this has implications for the interventions that are possible in cancer and in a variety of lung diseases. Today's better understanding of the mechanisms that regulate lung progenitor cell self-renewal and differentiation, including understanding how multiple epigenetic factors affect lung injury repair, holds the promise for future better treatments for lung cancer and for optimising the response to therapy in lung cancer. Working between platforms in sophisticated organoid culture techniques, genetically engineered mouse models of injury and cancer, and human cell lines and specimens, lung progenitor cell studies can begin with basic biology, progress to translational research and finally lead to the beginnings of clinical trials. Copyright ©ERS 2017.

Intersections of lung progenitor cells, lung disease and lung cancer

Directory of Open Access Journals (Sweden)

Carla F. Kim

2017-06-01

Full Text Available The use of stem cell biology approaches to study adult lung progenitor cells and lung cancer has brought a variety of new techniques to the field of lung biology and has elucidated new pathways that may be therapeutic targets in lung cancer. Recent results have begun to identify the ways in which different cell populations interact to regulate progenitor activity, and this has implications for the interventions that are possible in cancer and in a variety of lung diseases. Today's better understanding of the mechanisms that regulate lung progenitor cell self-renewal and differentiation, including understanding how multiple epigenetic factors affect lung injury repair, holds the promise for future better treatments for lung cancer and for optimising the response to therapy in lung cancer. Working between platforms in sophisticated organoid culture techniques, genetically engineered mouse models of injury and cancer, and human cell lines and specimens, lung progenitor cell studies can begin with basic biology, progress to translational research and finally lead to the beginnings of clinical trials.

R+D works for the further development of high temperature reactors. (1) Captive bearing experiments for active magnetic bearings. (2) Captive bearing test for HTR blowers

International Nuclear Information System (INIS)

1991-01-01

When using active magnetic bearings as blower shaft bearings, blower motors and bearings must be protected against mechanical damage in case of faults (example: total electrical supply failure due to the supply cables breaking). So-called captive bearings are provided, in order to be able to shut the blowers down safely in such faults. These captive bearings are roller bearings which are additionally fitted in the area of the blower shaft bearings, to prevent mechanical contact between the blower rotor and stator. As there was little experience available for the given boundary conditions, such as - speed, - acceleration, - bearing load, - bearing dimensions, - ambient conditions, appropriate development and tests had to be carried out. It was important to determine suitable captive bearings and the necessary ambient conditions, which will make it possible to support the failures of the magnetic bearings to be expected in 40 years' operation of the reactor without damage and to meet the requirements of the captive bearings. (orig./GL) [de

EFFECT OF BEARING MACROGEOMETRY ON BEARING PERFORMANCE IN ELASTOHYDRODYNAMIC LUBRICATION

Directory of Open Access Journals (Sweden)

Emin GÜLLÜ

2000-01-01

Full Text Available During manufacturing, ideal dimension and mutual positioning of machine elements proposed in project desing can be achieved only within certain range of tolerances. These tolerances, being classified in two groups, related to micro and macro geometry of machine elements, don't have to effect the functioning of these elements. So, as for all machine elements, investigation of the effects of macro and micro tolerances for journal bearings is important. In this study, we have investigated the effect of macro geometric irregularities of journal bearings on performance characteristics. In this regard, we have studied the change of bearing performance in respect to deviation from ideal circle for an elliptic shaft with small ovality rolling in circular journal bearing.

Passive magnetic bearing configurations

Science.gov (United States)

Post, Richard F [Walnut Creek, CA

2011-01-25

A journal bearing provides vertical and radial stability to a rotor of a passive magnetic bearing system when the rotor is not rotating and when it is rotating. In the passive magnetic bearing system, the rotor has a vertical axis of rotation. Without the journal bearing, the rotor is vertically and radially unstable when stationary, and is vertically stable and radially unstable when rotating.

78 FR 78948 - Intent To Prepare a Supplemental Environmental Impact Statement for the Route 460 Location Study...

Science.gov (United States)

2013-12-27

... (IP) application submitted by U.S. Route 460 Mobility Partners (the Applicant) for the discharge of... Street, Suite 750, Richmond, VA 23219. FOR FURTHER INFORMATION CONTACT: Alice Allen-Grimes, email: [email protected] ; (757) 201-7219. Ed Sundra, email: [email protected] ; (804) 775-3357...

In vivo tomographic imaging of lung colonization of tumour in mouse with simultaneous fluorescence and X-ray CT.

Science.gov (United States)

Zhang, Bin; Gao, Fuping; Wang, Mengjiao; Cao, Xu; Liu, Fei; Wang, Xin; Luo, Jianwen; Wang, Guangzhi; Bai, Jing

2014-01-01

Non-invasive in vivo imaging of diffuse and wide-spread colonization within the lungs, rather than distinct solid primary tumors, is still a challenging work. In this work, a lung colonization mouse model bearing A549 human lung tumor was simultaneously scanned by a dual-modality fluorescence molecular tomography (FMT) and X-ray computed tomography (CT) system in vivo. A two steps method which incorporates CT structural information into the FMT reconstruction procedure is employed to provide concurrent anatomical and functional information. By using the target-specific fluorescence agent, the fluorescence tomographic results show elevated fluorescence intensity deep within the lungs which is colonized with diffuse and wide-spread tumors. The results were confirmed with ex vivo fluorescence reflectance imaging and histological examination of the lung tissues. With FMT reconstruction combined with the CT information, the dual-modality FMT/micro-CT system is expected to offer sensitive and noninvasive imaging of diffuse tumor colonization within the lungs in vivo. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Avaluació de competències professionalitzadores en els estudis de grau de comunicació audiovisual

Directory of Open Access Journals (Sweden)

Marina Romeo

2017-01-01

Full Text Available Els recents canvis en la formació universitària han comportat un destacable nivell de professionalització dels estudis i una constant adequació a les demandes socials. En aquest sentit, una de les necessitats per a la formació universitària a l'àrea de la comunicació audiovisual és desenvolupar en els estudiants competències professionalitzadores que els permetin trobar nínxols d'ocupació en un mercat altament competitiu i sotmès a canvis continus. Aquesta recerca té per objecte crear una rúbrica que permeti avaluar l'aprenentatge professionalitzador en els estudis de grau en comunicació audiovisual (CAV que es desenvolupen a Espanya. Per desenvolupar-la hem comptat amb ocupadors i acadèmics experts de l'àmbit de la comunicació audiovisual triats de forma intencional. La rúbrica final desenvolupada, a més de permetre avaluar el grau d'adquisició de les competències professionalitzadores en CAV, permet dibuixar un mapa clar de l'organització i adequació dels processos i metodologies docents. En aquest sentit, la rúbrica pot ser un instrument pedagògic clau per a una futura promoció d'estudiants, i es pot convertir en un instrument que afavoreixi l'avaluació formativa dels alumnes.

Potentiation of in vitro and in vivo antitumor efficacy of doxorubicin by cyclin-dependent kinase inhibitor P276-00 in human non-small cell lung cancer cells

International Nuclear Information System (INIS)

Rathos, Maggie J; Khanwalkar, Harshal; Joshi, Kavita; Manohar, Sonal M; Joshi, Kalpana S

2013-01-01

In the present study, we show that the combination of doxorubicin with the cyclin-dependent kinase inhibitor P276-00 was synergistic at suboptimal doses in the non-small cell lung carcinoma (NSCLC) cell lines and induces extensive apoptosis than either drug alone in H-460 human NSCLC cells. Synergistic effects of P276-00 and doxorubicin on growth inhibition was studied using the Propidium Iodide (PI) assay. The doses showing the best synergistic effect was determined and these doses were used for further mechanistic studies such as western blotting, cell cycle analysis and RT-PCR. The in vivo efficacy of the combination was evaluated using the H-460 xenograft model. The combination of 100 nM doxorubicin followed by 1200 nM P276-00 showed synergistic effect in the p53-positive and p53-mutated cell lines H-460 and H23 respectively as compared to the p53-null cell line H1299. Abrogation of doxorubicin-induced G2/M arrest and induction of apoptosis was observed in the combination treatment. This was associated with induction of tumor suppressor protein p53 and reduction of anti-apoptotic protein Bcl-2. Furthermore, doxorubicin alone greatly induced COX-2, a NF-κB target and Cdk-1, a target of P276-00, which was downregulated by P276-00 in the combination. Doxorubicin when combined with P276-00 in a sequence-specific manner significantly inhibited tumor growth, compared with either doxorubicin or P276-00 alone in H-460 xenograft model. These findings suggest that this combination may increase the therapeutic index over doxorubicin alone and reduce systemic toxicity of doxorubicin most likely via an inhibition of doxorubicin-induced chemoresistance involving NF-κB signaling and inhibition of Cdk-1 which is involved in cell cycle progression

Transferrin-bearing polypropylenimine dendrimer for targeted gene delivery to the brain.

Science.gov (United States)

Somani, Sukrut; Blatchford, David R; Millington, Owain; Stevenson, M Lynn; Dufès, Christine

2014-08-28

The possibility of using genes as medicines to treat brain diseases is currently limited by the lack of safe and efficacious delivery systems able to cross the blood-brain barrier, thus resulting in a failure to reach the brain after intravenous administration. On the basis that iron can effectively reach the brain by using transferrin receptors for crossing the blood-brain barrier, we propose to investigate if a transferrin-bearing generation 3-polypropylenimine dendrimer would allow the transport of plasmid DNA to the brain after intravenous administration. In vitro, the conjugation of transferrin to the polypropylenimine dendrimer increased the DNA uptake by bEnd.3 murine brain endothelioma cells overexpressing transferrin receptors, by about 1.4-fold and 2.3-fold compared to that observed with the non-targeted dendriplex and naked DNA. This DNA uptake appeared to be optimal following 2h incubation with the treatment. In vivo, the intravenous injection of transferrin-bearing dendriplex more than doubled the gene expression in the brain compared to the unmodified dendriplex, while decreasing the non-specific gene expression in the lung. Gene expression was at least 3-fold higher in the brain than in any tested peripheral organs and was at its highest 24h following the injection of the treatments. These results suggest that transferrin-bearing polypropylenimine dendrimer is a highly promising gene delivery system to the brain. Copyright © 2014 Elsevier B.V. All rights reserved.

Comparison of fixed-bearing and mobile-bearing total knee arthroplasty after high tibial osteotomy.

Science.gov (United States)

Hernigou, Philippe; Huys, Maxime; Pariat, Jacques; Roubineau, François; Flouzat Lachaniette, Charles Henri; Dubory, Arnaud

2018-02-01

There is no information comparing the results of fixed-bearing total knee replacement and mobile-bearing total knee replacement in the same patients previously treated by high tibial osteotomy. The purpose was therefore to compare fixed-bearing and mobile-bearing total knee replacements in patients treated with previous high tibial osteotomy. We compared the results of 57 patients with osteoarthritis who had received a fixed-bearing prosthesis after high tibial osteotomy with the results of 41 matched patients who had received a rotating platform after high tibial osteotomy. The match was made for length of follow-up period. The mean follow-up was 17 years (range, 15-20 years). The patients were assessed clinically and radiographically. The pre-operative knee scores had no statistically significant differences between the two groups. So was the case with the intra-operative releases, blood loss, thromboembolic complications and infection rates in either group. There was significant improvement in both groups of knees, and no significant difference was observed between the groups (i.e., fixed-bearing and mobile-bearing knees) for the mean Knee Society knee clinical score (95 and 92 points, respectively), or the Knee Society knee functional score (82 and 83 points, respectively) at the latest follow-up. However, the mean post-operative knee motion was higher for the fixed-bearing group (117° versus 110°). In the fixed-bearing group, one knee was revised because of periprosthetic fracture. In the rotating platform mobile-bearing group, one knee was revised because of aseptic loosening of the tibial component. The Kaplan-Meier survivorship for revision at ten years of follow-up was 95.2% for the fixed bearing prosthesis and 91.1% for the rotating platform mobile-bearing prosthesis. Although we did manage to detect significant differences mainly in clinical and radiographic results between the two groups, we found no superiority or inferiority of the mobile-bearing

Hydrodynamic sliding bearings vs. roller bearings. Segmented sliding bearings for higher rotational speed; Hydrodynamische Gleitlager versus Waelzlager. Segmentgleitlager fuer hoehere Drehzahlen

Energy Technology Data Exchange (ETDEWEB)

Hagenhoff, M.; Sauer, M. [Main-Metall-Giesserei Fritz Schorr GmbH und Co. KG, Altenglan (Germany)

2004-10-01

Hydrodynamic sliding bearings are considered only in cases when roller bearings reach their speed limits and there is no other solution. However, this view neglects the fact that there are modern, optimised sliding bearings which have more advantages over roller bearings than should be expected. Many producers of sliding bearings also have computer programs enabling them to offer customised solutions, i.e. optimal adaptation of the bearings to their specific operating conditions. (orig.) [German] Hydrodynamische Gleitlager werden oft erst dann in Betracht gezogen, wenn man an die Drehzahlgrenzen von Waelzlagern stoesst und keine andere sinnvolle Alternative mehr in Frage kommt. Dabei uebersieht man leicht, dass es moderne, optimierte Gleitlagerkonstruktionen gibt, die weitaus haeufiger ihre Staerken im Vergleich zu Waelzlagern ausspielen koennen als zunaechst vermutet. Viele Gleitlagerhersteller haben zudem heute Berechnungsprogramme zur Verfuegung, die eine optimale Anpassung der Lager an die speziellen Betriebsbedingungen erlauben. (orig.)

NCI Releases Video: Proteogenomics Research - On the Frontier of Precision Medicine | Office of Cancer Clinical Proteomics Research

Science.gov (United States)

The Clinical Proteomic Tumor Analysis Consortium (CPTAC) of the National Cancer Institute (NCI), part of the National Institutes of Health, announces the release of an educational video titled “Proteogenomics Research: On the Frontier of Precision Medicine."  Launched at the HUPO2017 Global Leadership Gala Dinner, catalyzed in part by the Cancer Moonshot initiative and featuring as keynote speaker the 47th Vice President of the United States of America Joseph R.

Genomic evidence of geographically widespread effect of gene flow from polar bears into brown bears

OpenAIRE

Cahill, James A; Stirling, Ian; Kistler, Logan; Salamzade, Rauf; Ersmark, Erik; Fulton, Tara L; Stiller, Mathias; Green, Richard E; Shapiro, Beth

2015-01-01

© 2014 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd. Polar bears are an arctic, marine adapted species that is closely related to brown bears. Genome analyses have shown that polar bears are distinct and genetically homogeneous in comparison to brown bears. However, these analyses have also revealed a remarkable episode of polar bear gene flow into the population of brown bears that colonized the Admiralty, Baranof and Chichagof islands (ABC islands) of Alaska. Here, we...

The role of human outdoor recreation in shaping patterns of grizzly bear-black bear co-occurrence.

Directory of Open Access Journals (Sweden)

Andrew Ladle

Full Text Available Species' distributions are influenced by a combination of landscape variables and biotic interactions with other species, including people. Grizzly bears and black bears are sympatric, competing omnivores that also share habitats with human recreationists. By adapting models for multi-species occupancy analysis, we analyzed trail camera data from 192 trail camera locations in and around Jasper National Park, Canada to estimate grizzly bear and black bear occurrence and intensity of trail use. We documented (a occurrence of grizzly bears and black bears relative to habitat variables (b occurrence and intensity of use relative to competing bear species and motorised and non-motorised recreational activity, and (c temporal overlap in activity patterns among the two bear species and recreationists. Grizzly bears were spatially separated from black bears, selecting higher elevations and locations farther from roads. Both species co-occurred with motorised and non-motorised recreation, however, grizzly bears reduced their intensity of use of sites with motorised recreation present. Black bears showed higher temporal activity overlap with recreational activity than grizzly bears, however differences in bear daily activity patterns between sites with and without motorised and non-motorised recreation were not significant. Reduced intensity of use by grizzly bears of sites where motorised recreation was present is a concern given off-road recreation is becoming increasingly popular in North America, and can negatively influence grizzly bear recovery by reducing foraging opportunities near or on trails. Camera traps and multi-species occurrence models offer non-invasive methods for identifying how habitat use by animals changes relative to sympatric species, including humans. These conclusions emphasise the need for integrated land-use planning, access management, and grizzly bear conservation efforts to consider the implications of continued access for

The role of human outdoor recreation in shaping patterns of grizzly bear-black bear co-occurrence.

Science.gov (United States)

Ladle, Andrew; Steenweg, Robin; Shepherd, Brenda; Boyce, Mark S

2018-01-01

Species' distributions are influenced by a combination of landscape variables and biotic interactions with other species, including people. Grizzly bears and black bears are sympatric, competing omnivores that also share habitats with human recreationists. By adapting models for multi-species occupancy analysis, we analyzed trail camera data from 192 trail camera locations in and around Jasper National Park, Canada to estimate grizzly bear and black bear occurrence and intensity of trail use. We documented (a) occurrence of grizzly bears and black bears relative to habitat variables (b) occurrence and intensity of use relative to competing bear species and motorised and non-motorised recreational activity, and (c) temporal overlap in activity patterns among the two bear species and recreationists. Grizzly bears were spatially separated from black bears, selecting higher elevations and locations farther from roads. Both species co-occurred with motorised and non-motorised recreation, however, grizzly bears reduced their intensity of use of sites with motorised recreation present. Black bears showed higher temporal activity overlap with recreational activity than grizzly bears, however differences in bear daily activity patterns between sites with and without motorised and non-motorised recreation were not significant. Reduced intensity of use by grizzly bears of sites where motorised recreation was present is a concern given off-road recreation is becoming increasingly popular in North America, and can negatively influence grizzly bear recovery by reducing foraging opportunities near or on trails. Camera traps and multi-species occurrence models offer non-invasive methods for identifying how habitat use by animals changes relative to sympatric species, including humans. These conclusions emphasise the need for integrated land-use planning, access management, and grizzly bear conservation efforts to consider the implications of continued access for motorised

Unbalance Response Prediction for Rotors on Ball Bearings Using Speed and Load Dependent Nonlinear Bearing Stiffness

Science.gov (United States)

Fleming, David P.; Poplawski, J. V.

2003-01-01

Rolling-element bearing forces vary nonlinearly with bearing deflection. Thus an accurate rotordynamic analysis requires that bearing forces corresponding to the actual bearing deflection be utilized. For this work bearing forces were calculated by COBRA-AHS, a recently developed rolling-element bearing analysis code. Bearing stiffness was found to be a strong function of bearing deflection, with higher deflection producing markedly higher stiffness. Curves fitted to the bearing data for a range of speeds and loads were supplied to a flexible rotor unbalance response analysis. The rotordynamic analysis showed that vibration response varied nonlinearly with the amount of rotor imbalance. Moreover, the increase in stiffness as critical speeds were approached caused a large increase in rotor and bearing vibration amplitude over part of the speed range compared to the case of constant bearing stiffness. Regions of bistable operation were possible, in which the amplitude at a given speed was much larger during rotor acceleration than during deceleration. A moderate amount of damping will eliminate the bistable region, but this damping is not inherent in ball bearings.

Incorporació de petites seqüències de cinema comercial en l’ensenyament de les drogodependències. Assaig pilot en l'assignatura de Toxicologia

Directory of Open Access Journals (Sweden)

Miguel Rodamilans-Pérez

2013-01-01

Full Text Available El Grup d'Innovació Docent Orfila, en el seu projecte per millorar la qualitat de la docència, està assajant la utilització del cinema amb finalitat didàctica. El material didàctic que hem desenvolupat en aquest projecte són petites seqüències de pel·lícules comercials de 3 a 5 minuts, per ser utilitzades com a elements il·lustratius del procés addictiu. Se seleccionen escenes de la filmografia i s'adeqüen als nostres programes docents. Es recull l'opinió dels professors participants, així com la dels alumnes, mitjançant una entrevista personal i una enquesta d'opinió, respectivament.De les entrevistes als professors i de les enquestes d'opinió dels alumnes, es dedueix un alt grau de satisfacció.

Local Attitudes towards Bear Management after Illegal Feeding and Problem Bear Activity

Directory of Open Access Journals (Sweden)

David Fraser

2013-09-01

Full Text Available The “pot bears” received international media attention in 2010 after police discovered the intentional feeding of over 20 black bears during the investigation of an alleged marijuana-growing operation in Christina Lake, British Columbia, Canada. A two-phase random digit dialing survey of the community was conducted in 2011 to understand local perspectives on bear policy and management, before and after a summer of problem bear activity and government interventions. Of the 159 households surveyed in February 2011, most had neutral or positive attitudes towards bears in general, and supported the initial decision to feed the food-conditioned bears until the autumn hibernation. In contrast to wildlife experts however, most participants supported relocating the problem bears, or allowing them to remain in the area, ahead of killing; in part this arose from notions of fairness despite the acknowledged problems of relocation. Most locals were aware of the years of feeding but did not report it, evidently failing to see it as a serious form of harm, even after many bears had been killed. This underscores the importance of preventive action on wildlife feeding and the need to narrow the gap between public and expert opinion on the likely effects of relocation versus killing.

Multi-technology control centre to integrate 460 MW renewables; Centro de control multitecnología para la integración de 460 MW renovables

Energy Technology Data Exchange (ETDEWEB)

NONE

2016-07-01

The new RWE Innogy Aersa Control Centre that has been certified to act as an interface with CECRE (the Renewable Energy Control Centre) since February 2015, connects RWE’s 20 renewable energy facilities with REE, the Spanish Electricity Grid. As a result, it ensures that wind farms, in addition to hydropower and solar plants, can inject the energy generated by its 460 MW installed safely and with no penalties. Green Eagle Solutions, a provider of software solutions for renewable energy companies, has collaborated with RWE in the development of this Control Centre, meeting the high standards of quality and safety required by RWE. This centre uses CompactSCADA® technology to integrate power generation facilities that need to be integrated in a Control Centre to communicate with REE’s CECRE. (Author)

Bearing construction for refrigeration compresssor

Science.gov (United States)

Middleton, Marc G.; Nelson, Richard T.

1988-01-01

A hermetic refrigeration compressor has a cylinder block and a crankshaft rotatable about a vertical axis to reciprocate a piston in a cylinder on the cylinder block. A separate bearing housing is secured to the central portion of the cylinder block and extends vertically along the crankshaft, where it carries a pair of roller bearings to journal the crankshaft. The crankshaft has a radially extending flange which is journaled by a thrust-type roller bearing above the bearing housing to absorb the vertical forces on the crankshaft so that all three of the roller bearings are between the crankshaft and the bearing housing to maintain and control the close tolerances required by such bearings.

A semi-analytical bearing model considering outer race flexibility for model based bearing load monitoring

Science.gov (United States)

Kerst, Stijn; Shyrokau, Barys; Holweg, Edward

2018-05-01

This paper proposes a novel semi-analytical bearing model addressing flexibility of the bearing outer race structure. It furthermore presents the application of this model in a bearing load condition monitoring approach. The bearing model is developed as current computational low cost bearing models fail to provide an accurate description of the more and more common flexible size and weight optimized bearing designs due to their assumptions of rigidity. In the proposed bearing model raceway flexibility is described by the use of static deformation shapes. The excitation of the deformation shapes is calculated based on the modelled rolling element loads and a Fourier series based compliance approximation. The resulting model is computational low cost and provides an accurate description of the rolling element loads for flexible outer raceway structures. The latter is validated by a simulation-based comparison study with a well-established bearing simulation software tool. An experimental study finally shows the potential of the proposed model in a bearing load monitoring approach.

Antitumor effect of malaria parasite infection in a murine Lewis lung cancer model through induction of innate and adaptive immunity.

Science.gov (United States)

Chen, Lili; He, Zhengxiang; Qin, Li; Li, Qinyan; Shi, Xibao; Zhao, Siting; Chen, Ling; Zhong, Nanshan; Chen, Xiaoping

2011-01-01

Lung cancer is the most common malignancy in humans and its high fatality means that no effective treatment is available. Developing new therapeutic strategies for lung cancer is urgently needed. Malaria has been reported to stimulate host immune responses, which are believed to be efficacious for combating some clinical cancers. This study is aimed to provide evidence that malaria parasite infection is therapeutic for lung cancer. Antitumor effect of malaria infection was examined in both subcutaneously and intravenously implanted murine Lewis lung cancer (LLC) model. The results showed that malaria infection inhibited LLC growth and metastasis and prolonged the survival of tumor-bearing mice. Histological analysis of tumors from mice infected with malaria revealed that angiogenesis was inhibited, which correlated with increased terminal deoxynucleotidyl transferase-mediated (TUNEL) staining and decreased Ki-67 expression in tumors. Through natural killer (NK) cell cytotoxicity activity, cytokine assays, enzyme-linked immunospot assay, lymphocyte proliferation, and flow cytometry, we demonstrated that malaria infection provided anti-tumor effects by inducing both a potent anti-tumor innate immune response, including the secretion of IFN-γ and TNF-α and the activation of NK cells as well as adaptive anti-tumor immunity with increasing tumor-specific T-cell proliferation and cytolytic activity of CD8(+) T cells. Notably, tumor-bearing mice infected with the parasite developed long-lasting and effective tumor-specific immunity. Consequently, we found that malaria parasite infection could enhance the immune response of lung cancer DNA vaccine pcDNA3.1-hMUC1 and the combination produced a synergistic antitumor effect. Malaria infection significantly suppresses LLC growth via induction of innate and adaptive antitumor responses in a mouse model. These data suggest that the malaria parasite may provide a novel strategy or therapeutic vaccine vector for anti-lung cancer

Antitumor effect of malaria parasite infection in a murine Lewis lung cancer model through induction of innate and adaptive immunity.