WorldWideScience

Sample records for beans

  1. Peppery Hot Bean Curd

    Institute of Scientific and Technical Information of China (English)

    1997-01-01

    Peppery Hot Bean Curd is a famous dish that originated in Chengdu,Sichuan Province.Dating back to the year under the reign of Emperor Tongzhi during the Qing Dynasty(1862-1875),a woman chef named Chen created this dish.In Chinese it is called Mapo Bean Curd. Ingredients:Three pieces of bean curd,100 grams lean pork,25 grams green soy beans or garlic

  2. Baked Bean Curd

    Institute of Scientific and Technical Information of China (English)

    1996-01-01

    Ingredients: Two pieces of tender bean curd, shredded shrimp, minced fat and lean pork, minced ham, minced fresh mushrooms, fried dried shrimps, mashed scallion, ginger and garlic, cooking wine, salad oil, salt, MSG and pepper powder. Directions:

  3. Faba bean in cropping systems

    DEFF Research Database (Denmark)

    Steen Jensen, Erik; Peoples, Mark B.; Hauggaard-Nielsen, Henrik

    2010-01-01

    bean may prove to be a key component of future arable cropping systems where declining supplies and high prices of fossil energy are likely to constrain the affordability and use of fertilizers. This will help address the increasing demand by consumers and governments for agriculture to reduce its...... impact on the environment and climate through new, more sustainable approaches to food production. The aims of this paper are to review the role of faba bean in global plant production systems, the requirements for optimal faba bean production and to highlight the beneficial effects of faba bean...

  4. Irradiated cocoa beans

    Energy Technology Data Exchange (ETDEWEB)

    Ashby, R.; Tesh, J.M.

    1982-11-01

    Groups of 40 male and 40 female CD rats were fed powdered rodent diet containing 25% (w/w) of either non-irradiated, irradiated or fumigated cocoa beans. The diets were supplemented with certain essential dietary constituents designed to satisfy normal nutritional requirements. An additional 40 male and 40 female rats received basal rodent diet alone (ground) and acted as an untreated control. After 70 days of treatment, 15 male and 15 female rats from each group were used to assess reproductive function of the F/sub 0/ animals and growth and development of the F/sub 1/ offspring up to weaning; the remaining animals were killed after 91 days of treatment.

  5. Effects of organic fertilizers on the growth and yield of bush bean, winged bean and yard long bean

    Directory of Open Access Journals (Sweden)

    Mohammad Aminul Islam

    Full Text Available ABSTRACT VC (20%, TC (20% and N:P:K fertilizer (farmer's practice were used to determine the growth and yield attributes of bush bean (Phaseolus vulgaris, winged bean (Psophocarpus tetragonolobus and yard long bean (Vigna unguiculata. Plants grown with VC (20% produced the highest fresh biomass for bush bean (527.55 g m-2, winged bean (1168.61 g m-2 and yard long bean (409.84 g m-2. In all the tested legumes the highest pod weight, pod number, pod dry weight and pod length were found in the VC (20% treatment. Photosynthetic rates in the three legumes peaked at pod formation stage in all treatments, with the highest photosynthetic rate observed in winged bean (56.17 µmol m-2s-1 grown with VC (20%. The highest yield for bush bean (2.98 ton ha-1, winged bean (7.28 ton ha-1 and yard long bean (2.22 ton ha-1 were also found in VC (20% treatment. Furthermore, protein content was highest in bush bean (26.50 g/100g, followed by yard long bean (24.74 g/100g and winged bean (22.04 g/100g, under VC (20% treatment. It can be concluded that legumes grown with VC (20% produced the highest yield and yield attributes.

  6. 9 CFR 319.310 - Lima beans with ham in sauce, beans with ham in sauce, beans with bacon in sauce, and similar...

    Science.gov (United States)

    2010-01-01

    ... with ham in sauce, beans with bacon in sauce, and similar products. 319.310 Section 319.310 Animals and....310 Lima beans with ham in sauce, beans with ham in sauce, beans with bacon in sauce, and similar products. “Lima Beans with Ham in Sauce,” “Beans with Ham in Sauce,” “Beans with Bacon in Sauce,”...

  7. Healthy food trends -- beans and legumes

    Science.gov (United States)

    ... B-vitamins, iron, folate, calcium, potassium, phosphorus, and zinc. Most beans are also low in fat. Legumes ... pressure, heart rate, and other heart disease and diabetes risks. Beans and legumes contain antioxidants that help ...

  8. NetBeans IDE 8 cookbook

    CERN Document Server

    Salter, David

    2014-01-01

    If you're a Java developer of any level using NetBeans and want to learn how to get the most out of NetBeans, then this book is for you. Learning how to utilize NetBeans will provide a firm foundation for your Java application development.

  9. Chlorotic mottle of bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Jayasinghe, W.U.

    1982-01-01

    For the past years there have been outbreaks of a disease of bean ( Phaseolus vulgaris L.) in Colombia called bean chlorotic mottle. The etiology of bean chlorotic mottle was not known, but the disease was generally believed to be incited by the same whitefly-transmitted virus that causes variegatio

  10. Angus McBean - Portraits

    NARCIS (Netherlands)

    Pepper, T.

    2007-01-01

    Angus McBean (1904-90) was one of the most extraordinary British photographers of the twentieth century. In a career that spanned the start of the Second World War through the birth of the 'Swinging Sixties' to the 1980s, he became the most prominent theatre photographer of his generation and, along

  11. Protein Quality of Irradiated Brazilian Beans

    Energy Technology Data Exchange (ETDEWEB)

    Delincee, Henry; Villavicencio, Anna-Lucia C.H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macacar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein ({approx}10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfestation process, without impairing the biological quality of the valuable bean protein.

  12. Protein Quality of Irradiated Brazilian Beans

    Science.gov (United States)

    Delincée, Henry; Villavicencio, Anna-Lucia C. H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macaçar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein (˜10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfection process, without impairing the biological quality of the valuable bean protein.

  13. Reflective Polyethylene Mulch Reduces Mexican Bean Beetle (Coleoptera: Coccinellidae) Densities and Damage in Snap Beans.

    Science.gov (United States)

    Nottingham, L B; Kuhar, T P

    2016-08-01

    Mexican bean beetle, Epilachna varivestis Mulsant, is a serious pest of snap beans, Phaseolus vulgaris L., in the eastern United States. These beetles are intolerant to direct sunlight, explaining why individuals are typically found on the undersides of leaves and in the lower portion of the plant canopy. We hypothesized that snap beans grown on reflective, agricultural polyethylene (plastic mulch) would have fewer Mexican bean beetles and less injury than those grown on black plastic or bare soil. In 2014 and 2015, beans were seeded into beds of metallized, white, and black plastic, and bare soil, in field plots near Blacksburg, VA. Mexican bean beetle density, feeding injury, predatory arthropods, and snap bean yield were sampled. Reflected light intensity, temperature, and humidity were monitored using data loggers. Pyranometer readings showed that reflected light intensity was highest over metallized plastic and second highest over white plastic; black plastic and bare soil were similarly low. Temperature and humidity were unaffected by treatments. Significant reductions in Mexican bean beetle densities and feeding injury were observed in both metallized and white plastic plots compared to black plastic and bare soil, with metallized plastic having the fewest Mexican bean beetle life stages and injury. Predatory arthropod densities were not reduced by reflective plastic. Metallized plots produced the highest yields, followed by white. The results of this study suggest that growing snap beans on reflective plastic mulch can suppress the incidence and damage of Mexican bean beetle, and increase yield in snap beans.

  14. Kinetics model development of cocoa bean fermentation

    Science.gov (United States)

    Kresnowati, M. T. A. P.; Gunawan, Agus Yodi; Muliyadini, Winny

    2015-12-01

    Although Indonesia is one of the biggest cocoa beans producers in the world, Indonesian cocoa beans are oftenly of low quality and thereby frequently priced low in the world market. In order to improve the quality, adequate post-harvest cocoa processing techniques are required. Fermentation is the vital stage in series of cocoa beans post harvest processing which could improve the quality of cocoa beans, in particular taste, aroma, and colours. During the fermentation process, combination of microbes grow producing metabolites that serve as the precursors for cocoa beans flavour. Microbial composition and thereby their activities will affect the fermentation performance and influence the properties of cocoa beans. The correlation could be reviewed using a kinetic model that includes unstructured microbial growth, substrate utilization and metabolic product formation. The developed kinetic model could be further used to design cocoa bean fermentation process to meet the expected quality. Further the development of kinetic model of cocoa bean fermentation also serve as a good case study of mixed culture solid state fermentation, that has rarely been studied. This paper presents the development of a kinetic model for solid-state cocoa beans fermentation using an empirical approach. Series of lab scale cocoa bean fermentations, either natural fermentations without starter addition or fermentations with mixed yeast and lactic acid bacteria starter addition, were used for model parameters estimation. The results showed that cocoa beans fermentation can be modelled mathematically and the best model included substrate utilization, microbial growth, metabolites production and its transport. Although the developed model still can not explain the dynamics in microbial population, this model can sufficiently explained the observed changes in sugar concentration as well as metabolic products in the cocoa bean pulp.

  15. Transaction costs in beans market in Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Eterno Venâncio Assunção

    2015-05-01

    Full Text Available This paper aimed to evaluate the presence of transaction costs in the beans market in Brazil. Therefore, threshold autoregressive (TAR models were used to check co-integration and the existence of transaction costs in the Brazilian beans market. The results confirmed the presence of transaction costs in the beans market, which are mainly related to the freight component of production, since the markets are often far away from the producing regions.

  16. Yeasts are essential for cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2014-03-17

    Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics.

  17. Integrating and Processing XML Documents with JavaBeans Components

    Directory of Open Access Journals (Sweden)

    Yin-Wah Chiou

    2003-02-01

    Full Text Available The eXtensible Markup Language (XML and JavaBeans component model have gained wide popularity in the Object Web computing. This paper explores how JavaBeans components can be used to integrate and process the XML documents. It covers Bean Markup Language (BML, XML BeanMaker, XML Bean Suite, and Xbeans. The most powerful JavaBeans connection language is BML, which represents an integration of XML and JavaBeans components to provide a mechanism for implementing active content. XML BeanMaker is used to generate JavaBeans from XML DTD files. XML Bean Suite is a toolkit of JavaBeans components to provide a comprehensive set of functionality to manipulate XML content. The Xbean is a powerful paradigm to process XML-based distributed applications.

  18. Mung Bean: Technological and Nutritional Potential

    NARCIS (Netherlands)

    Dahiya, P.K.; Linnemann, A.R.; Boekel, van M.A.J.S.; Khetarpaul, N.; Grewal, R.B.; Nout, M.J.R.

    2015-01-01

    Mung bean (Vigna radiata (L.) R.Wilczek) has been intensively researched; scattered data are available on various properties. Data on physical, chemical, food processing, and nutritional properties were collected for whole mung bean grains and reviewed to assess the crop’s potential as food and to s

  19. Weed management strategies for castor bean crops

    Directory of Open Access Journals (Sweden)

    Augusto Guerreiro Fontoura Costa

    2014-04-01

    Full Text Available Castor bean crops are agriculturally relevant due to the quality and versatility of their oil, both for the chemical industry and for biodiesel production. Proper weed management is important for both the cultivation and the yield of castor bean crops; therefore, the intention of the present work is to review pertinent information regarding weed management, including the studies regarding weed interference periods, chemical controls for use in different crop production systems and herbicide selectivity, for castor bean crops. Weed science research for castor bean crops is scarce. One of the main weed management challenges for castor bean crops is the absence of herbicides registered with the Ministry of Agriculture, Livestock and Food Supply (MALFS. Research for viable herbicides for weed control in castor bean crops should be directed by research and/or rural extension institutions, associations and farmers cooperatives, as well as by manufactures, for the registration of these selective herbicides, which would be primarily used to control eudicotyledons in castor bean crops. New studies involving the integration of weed control methods in castor bean also may increase the efficiency of weed management, for both small farmers using traditional crop methods in the Brazilian Northeast region, as well as for areas with the potential for large scale production, using conservation tillage systems, such as the no-tillage crop production system.

  20. Registration of ‘Samurai’ Otebo Bean

    Science.gov (United States)

    ‘Samurai’ otebo bean (Phaseolus vulgaris L.) (Reg. no. CV- , PI ), developed by Michigan State University AgBioResearch was released in 2015 as an upright, full-season cultivar with virus [caused by Bean common mosaic virus (BCMV)] resistance and high-yield potential. Samurai was developed using ped...

  1. Nutritional and health benefits of dried beans.

    Science.gov (United States)

    Messina, Virginia

    2014-07-01

    Dried beans (often referred to as grain legumes) may contribute to some of the health benefits associated with plant-based diets. Beans are rich in a number of important micronutrients, including potassium, magnesium, folate, iron, and zinc, and are important sources of protein in vegetarian diets. In particular, they are among the only plant foods that provide significant amounts of the indispensable amino acid lysine. Commonly consumed dried beans are also rich in total and soluble fiber as well as in resistant starch, all of which contribute to the low glycemic index of these foods. They also provide ample amounts of polyphenols, many of which are potent antioxidants. Intervention and prospective research suggests that diets that include beans reduce low-density lipoprotein cholesterol, favorably affect risk factors for metabolic syndrome, and reduce risk of ischemic heart disease and diabetes. The relatively low bean intakes of North Americans and northern Europeans can be attributed to a negative culinary image as well as to intestinal discomfort attributable to the oligosaccharide content of beans. Cooking practices such as sprouting beans, soaking and discarding soaking water before cooking, and cooking in water with a more alkaline pH can reduce oligosaccharide content. Promotional efforts are needed to increase bean intake.

  2. Performance of the Bean-protein Fiber

    Institute of Scientific and Technical Information of China (English)

    韩光亭; 杜宁; 孙亚宁

    2003-01-01

    The methods in testing the bean-protein fiber and the standards used were simply introduced. The fiber's mechanical and chemical performances were further analyzed. And the correlative performance of the bean-protein fibers and other natural fibers have been compared, then full knowledge of the fiber's performance was concluded.

  3. Enterprise JavaBeans 31

    CERN Document Server

    Rubinger, Andrew

    2010-01-01

    Learn how to code, package, deploy, and test functional Enterprise JavaBeans with the latest edition of this bestselling guide. Written by the developers of JBoss EJB 3.1, this book not only brings you up to speed on each component type and container service in this implementation, it also provides a workbook with several hands-on examples to help you gain immediate experience with these components. With version 3.1, EJB's server-side component model for building distributed business applications is simpler than ever. But it's still a complex technology that requires study and lots of practi

  4. 21 CFR 184.1343 - Locust (carob) bean gum.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Locust (carob) bean gum. 184.1343 Section 184.1343... Listing of Specific Substances Affirmed as GRAS § 184.1343 Locust (carob) bean gum. (a) Locust (carob) bean gum is primarily the macerated endosperm of the seed of the locust (carob) bean tree,...

  5. Key odorants in cured Madagascar vanilla beans (Vanilla planiforia) of differing bean quality.

    Science.gov (United States)

    Takahashi, Makoto; Inai, Yoko; Miyazawa, Norio; Kurobayashi, Yoshiko; Fujita, Akira

    2013-01-01

    The odor-active volatiles in Madagascar vanilla beans (Vanilla planiforia) of two grades, red whole beans as standard quality and cuts beans as substandard quality, were characterized by instrumental and sensory analyses. The higher contents of vanillin and β-damascenone in red whole beans than in cuts beans respectively contributed to significant differences in the sweet and dried fruit-like notes, while the higher contents of guaiacol and 3-phenylpropanoic acid in cuts beans than in red whole beans respectively contributed to significant differences in the phenolic and metallic notes. A sensory evaluation to compare red whole beans and their reconstituted aroma characterized both samples as being similar, while in respect of the phenolic note, the reconstituted aroma significantly differed from the reconstituted aroma with guaiacol added at the concentration ratio of vanillin and guaiacol in cuts beans. It is suggested from these results that the concentration ratio of vanillin and guaiacol could be used as an index for the quality of Madagascar vanilla beans.

  6. Market strategies for Central American dry beans.

    OpenAIRE

    Mertínez, Lourdes; Bernsten, Richard; Zamora, Miguel

    2004-01-01

    In the past few years, the dry bean sub-sector in CentralAmerica has witnessed many dynamic changes. Unless wefind ways to increase the competitiveness of the regionalbean sub-sector, Central American countries will likelyexperience significant negative social and economic impacts,especially since these countries are facing the challenge ofadjusting to new open markets, such as the Central AmericanFree Trade Agreement (CAFTA). Bean traders, retailers, andknowledgeable government official in C...

  7. Java EE 7 development with NetBeans 8

    CERN Document Server

    Heffelfinger, David R

    2015-01-01

    The book is aimed at Java developers who wish to develop Java EE applications while taking advantage of NetBeans functionality to automate repetitive tasks. Familiarity with NetBeans or Java EE is not assumed.

  8. Effect of cooking methods on selected physicochemical and nutritional properties of barlotto bean, chickpea, faba bean, and white kidney bean.

    Science.gov (United States)

    Güzel, Demet; Sayar, Sedat

    2012-02-01

    The effects of atmospheric pressure cooking (APC) and high-pressure cooking (HPC) on the physicochemical and nutritional properties of barlotto bean, chickpea, faba bean, and white kidney bean were investigated. The hardness of the legumes cooked by APC or HPC were not statistically different (P > 0.05). APC resulted in higher percentage of seed coat splits than HPC. Both cooking methods decreased Hunter "L" value significantly (P < 0.05). The "a" and "b" values of dark-colored seeds decreased after cooking, while these values tended to increase for the light-colored seeds. The total amounts of solid lost from legume seeds were higher after HPC compared with APC. Rapidly digestible starch (RDS) percentages increased considerably after both cooking methods. High pressure cooked legumes resulted in higher levels of resistant starch (RS) but lower levels of slowly digestible starch (SDS) than the atmospheric pressure cooked legumes.

  9. Blanching of green bean (Phaseolus vulgaris).

    Science.gov (United States)

    Kaack, K

    1994-12-01

    Experiments with one and two steps blanching of green beans have been carried out. Inactivation of the peroxydase requires more heating than inactivation of the enzymes which gives rise to off flavour from aldehydes. When blanching for about one minute to inactivate lipoxygenase, aldehyde formation of flavour ceases. The content of vitamin C decreases during blanching according to a first order reaction. Since considerable loss of vitamin C occurs during blanching, the treatment time should be reduced to a minimum. During preblanching at 65-75 degrees C and final blanching, chlorophyll is degraded to pheophytin and the surface colour expressed by the Hunter-values (-a/b) increases with time which means that the colour of the beans changes from green to yellow. The firmness of beans, which was measured by use of a tenderometer, decreases during blanching according to a first order reaction with 40 kcal/mole activation energy. Preblanching at 65-75 degrees C increases the firmness of the beans linearly with treatment time. This increase in firmness is stable after final blanching at 95 degrees C and even after thawing of frozen beans.

  10. Outbreaks of Chrysodeixis includens (Walker (Lepidoptera: Noctuidae in common bean and castor bean in São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    Edson Luiz Lopes Baldin

    2014-12-01

    Full Text Available Since 2009, increasing populations of Chrysodeixis includens (Walker (Lepidoptera: Noctuidae have been observed in cultivated common bean (Phaseolus vulgaris L. and castor bean (Ricinus communis L. at the Lageado Experimental Farm, belonging to the FCA/UNESP, Botucatu, São Paulo State, Brazil. Defoliations around 80% and 50% were observed in the common bean cv. Pérola and castor bean cv. IAC-2028, respectively. Samples of individuals (caterpillars and pupae were collected in the field, and kept in laboratory until adult emergence aiming to confirm the species. These are new observations for common bean in São Paulo State and, in the case of castor bean, unpublished in Brazil. It suggests that C. includens has adapted to attack other agricultural crops, demanding attention of common bean and castor bean producers.

  11. Effect of hydrocolloids on functional properties of navy bean starch

    Science.gov (United States)

    The effects of hydrocolloid replacement on the pasting properties of navy bean starch and on the properties of navy bean starch gels were studied. Navy bean starch was isolated, and blends were prepared with beta-glucan, guar gum, pectin and xanthan gum solutions. The total solids concentration was ...

  12. Effects of fermented soya bean on digestion, absorption and diarrhoea

    NARCIS (Netherlands)

    Kiers, J.L.

    2001-01-01

    For many centuries Asian people have consumed soya beans in various forms of traditional fermented soya bean foods. Major desirable aspects of fermented soya bean foods are their attractive flavour and texture, certain nutritional properties, and possible health promoting effects. This study describ

  13. 9 CFR 319.301 - Chili con carne with beans.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Chili con carne with beans. 319.301 Section 319.301 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... Dehydrated Meat Food Products § 319.301 Chili con carne with beans. Chili con carne with beans shall...

  14. 7 CFR 457.150 - Dry bean crop insurance provisions.

    Science.gov (United States)

    2010-01-01

    ...; (f) Earthquake; (g) Volcanic eruption; or (h) Failure of the irrigation water supply, if caused by an..., or that could be received, for contract seed beans under a seed bean processor contract if the... total production under contract with the seed company. Beans—Dry beans and contract seed...

  15. New bean seeds and the struggle for their dissemination

    NARCIS (Netherlands)

    Almekinders, C.J.M.; Aguilar, E.; Herrera, R.

    2007-01-01

    The northern region of Nicaragua has always been an important bean and maize producing area. But a widespread presence of the Golden Mosaic Virus made it impossible to grow beans in the last years. A Participatory Plant Breeding programme started in 1999, aiming to develop new bean varieties that wo

  16. Evaluation of the reaction oof interspecific hybrids of common bean and tepary bean to Bradyrhizobium y Rhizobium

    Science.gov (United States)

    Interspecific hybrids between common bean, Phaseolus vulgaris L., and tepary bean, Phaseolus acutifolius A. Gray, have the potential to increase bean production in regions where rainfall is limited. In 2014, an experiment was initiated using a split-plot design. The treatments included inoculation, ...

  17. 76 FR 16700 - Importation of French Beans and Runner Beans From the Republic of Kenya Into the United States

    Science.gov (United States)

    2011-03-25

    ... individual beans. We would require the beans to be inspected by the Kenyan NPPO and found to be free of..., primarily to the European Union (EU). The EU provides a well-established market and it is unlikely that there would be a large diversion of French bean exports by Kenya from this market to the United...

  18. Complete genome sequence of bean leaf crumple virus, a novel begomovirus infecting common bean in Colombia.

    Science.gov (United States)

    Carvajal-Yepes, Monica; Zambrano, Leidy; Bueno, Juan M; Raatz, Bodo; Cuellar, Wilmer J

    2017-02-10

    A copy of the complete genome of a novel bipartite begomovirus infecting common bean (Phaseolus vulgaris L.) in Colombia was obtained by rolling-circle amplification (RCA), cloned, and sequenced. The virus is associated with leaf crumple symptoms and significant yield losses in Andean and Mesoamerican beans. Such symptoms have been reported increasingly in Colombia since at least 2002, and we detected the virus in leaf material collected since 2008. Sequence analysis showed that the virus is a member of a distinct species, sharing 81% and 76% nucleotide (nt) sequence identity (in DNA-A and DNA-B, respectively) to other begomoviruses infecting common bean in the Americas. The data obtained support the taxonomic status of this virus (putatively named 'bean leaf crumple virus', BLCrV) as a member of a novel species in the genus Begomovirus.

  19. Management of the broad bean weevil (Bruchus rufimanus Boh.) in faba bean (Vicia faba L.)

    OpenAIRE

    Roubinet, Eve

    2016-01-01

    Summary Bruchus rufimanus Boh. is a common pest on faba beans (Vicia faba L.) all over Europe and worldwide. The area of faba bean production is increasing in Sweden and in Europe, partly encouraged by the CAP subsidies for legume crops and diversified crop rotations. At the same time, number of the insecticides commonly used against B. rufimanus have been removed from the market as pollinators risk to be harmed as the treatment timing corresponds to crop flowering. In Sweden, only one ins...

  20. Castor bean response to zinc fertilization

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Henrique Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Zinc is a trace element and it is absolutely essential for the normal healthy growth of plants. This element plays a part of several enzyme systems and other metabolic functions in the plants. Castor beans (Ricinus communis L.) crop is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor beans yield, few researches has been made on this issue, mainly on the use of zinc. In order to evaluate the effects of zinc on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Zn (0; 2; 4; 6 and 8 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Under conditions that the experiment was carried out the results showed that the Zn levels used, did not affect the castor bean plants growth. (author)

  1. Synthesis of a jojoba bean disaccharide.

    Science.gov (United States)

    Kornienko, A; Marnera, G; d'Alarcao, M

    1998-08-01

    A synthesis of the disaccharide recently isolated from jojoba beans, 2-O-alpha-D-galactopyranosyl-D-chiro-inositol, has been achieved. The suitably protected chiro-inositol unit was prepared by an enantiospecific synthesis from L-xylose utilizing SmI2-mediated pinacol coupling as a key step.

  2. Phenotyping common beans for adaptation to drought

    Directory of Open Access Journals (Sweden)

    Stephen eBeebe

    2013-03-01

    Full Text Available Common beans (Phaseolus vulgaris L. originated in the New World and are the grain legume of greatest production for direct human consumption. Common bean production is subject to frequent droughts in highland Mexico, in the Pacific coast of Central America, in northeast Brazil, and in eastern and southern Africa from Ethiopia to South Africa. This article reviews efforts to improve common bean for drought tolerance, referring to genetic diversity for drought response, the physiology of of drought tolerance mechanisms, and breeding strategies. Different races of common bean respond differently to drought, with race Durango of highland Mexico being a major source of genes. Sister species of P. vulgaris likewise have unique traits, especially P. acutifolius which is well adapted to dryland conditions. Diverse sources of tolerance may have different mechanisms of plant response, implying the need for different methods of phenotyping to recognize the relevant traits. Practical considerations of field management are discussed including: trial planning; water management; and field preparation.

  3. Seed coat darkening in Cowpea bean

    Science.gov (United States)

    Seed coat of cowpea bean (Vigna unguiculata L. Walp) slowly browns to a darker color during storage. High temperature and humidity during storage might contribute to this color change. Variation in browning rate among seeds in a lot leads to a mixture of seed colors creating an unacceptable product...

  4. Common bean and cowpea improvement in Angola

    Science.gov (United States)

    During 2014 and 2015, the Instituto de Investigação Agronómica (IIA) evaluated the performance of common bean (Phaselolus vulgaris L.) breeding lines and improved cowpea (Vigna unguiculata L. Walp.) varieties. The field experiments were planted in the lowlands at Mazozo and in the highlands at Chian...

  5. Zinc supplementation, production and quality of coffee beans

    Directory of Open Access Journals (Sweden)

    Herminia Emilia Prieto Martinez

    2013-04-01

    Full Text Available Besides its importance in the coffee tree nutrition, there is almost no information relating zinc nutrition and bean quality. This work evaluated the effect of zinc on the coffee yield and bean quality. The experiment was conducted with Coffea arabica L. in "Zona da Mata" region, Minas Gerais, Brazil. Twelve plots were established at random with 4 competitive plants each. Treatments included plants supplemented with zinc (eight plots and control without zinc supplementation (four plots. Plants were subjected to two treatments: zinc supplementation and control. Yield, number of defective beans, beans attacked by berry borers, bean size, cup quality, beans zinc concentration, potassium leaching, electrical conductivity, color index, total tritable acidity, pH, chlorogenic acids contents and ferric-reducing antioxidant activity of beans were evaluated. Zinc positively affected quality of coffee beans, which presented lower percentage of medium and small beans, lower berry borer incidence, lower potassium leaching and electrical conductivity, higher contents of zinc and chlorogenic acids and higher antioxidant activity in comparison with control beans.

  6. Methylxanthine and catechin content of fresh and fermented cocoa beans, dried cocoa beans, and cocoa liquor

    Directory of Open Access Journals (Sweden)

    Pedro P. Peláez

    2016-01-01

    Full Text Available The theobromine and catechin content can affect the quality of cocoa liquor and is influenced by cacao variety, production area (PA, and fermentation, as well as the method of drying beans (FDB and cocoa liquor production (CLP. This study examined variationsin methylxanthine and catechin levels in fresh and fermented cocoa beans, dried cocoa grains, and in cocoa liquor from Trinitario, Criollo, and Forastero cacao varieties. A total of 123 cocoa bean samples from three Peruvian PAs at different altitudes, Tingo María (TM, San Alejandro (SA, and Curimana (CU, were evaluated. The theobromine (Tb and caffeine (Cf contents in fresh cocoa beans were affected by both cocoa type and PA. The caffeine content was higher in Trinitario cacao than in Criollo and Forastero varieties (p ≤ 0.05. The Tb and CF contents decreased in dry cocoa grain and was affected by FDB (p ≤ 0.05 (1.449 ± 0.004 to 1.140 ± 0.010 and 0.410 ± 0.03 to 0.165 ± 0.02 g Tb and C, respectively, per 100 g dry weight. Cocoa beans from Tingo María, which has thehighest altitude, had higher Tb and CF contents than those from other PAs. The catechin (C and epicatechin (EC contents were affected by the FDB and CLP, and were highestin fresh cocoa beans from the Tingo María area (range: 0.065 ± 0.01 to 0.020 ± 0.00 g C/100 g. The C and EC contents decreased during FDB and CLP (0.001 g C/100 g of cocoa liquor. Taken together, these results show that higher concentrations of Tb, Cf, C,and EC are present in fresh cocoa beans. Moreover, the cocoa variety influenced cocoa liquor quality. Overall, cocoa from the Tingo María PA had the most desirable chemical composition.

  7. Ion beam analysis of ground coffee and roasted coffee beans

    Science.gov (United States)

    Debastiani, R.; dos Santos, C. E. I.; Yoneama, M. L.; Amaral, L.; Dias, J. F.

    2014-01-01

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans.

  8. Safety assessment of the biogenic amines in fermented soya beans and fermented bean curd.

    Science.gov (United States)

    Yang, Juan; Ding, Xiaowen; Qin, Yingrui; Zeng, Yitao

    2014-08-06

    To evaluate the safety of biogenic amines, high performance liquid chromatography (HPLC) was used to evaluate the levels of biogenic amines in fermented soya beans and fermented bean curd. In fermented soya beans, the total biogenic amines content was in a relatively safe range in many samples, although the concentration of histamine, tyramine, and β-phenethylamine was high enough in some samples to cause a possible safety threat, and 8 of the 30 samples were deemed unsafe. In fermented bean curd, the total biogenic amines content was more than 900 mg/kg in 19 white sufu amples, a level that has been determined to pose a safety hazard; putrescine was the only one detected in all samples and also had the highest concentration, which made samples a safety hazard; the content of tryptamine, β-phenethylamine, tyramine, and histamine had reached the level of threat to human health in some white and green sufu samples, and that may imply another potential safety risk; and 25 of the 33 samples were unsafe. In conclusion, the content of biogenic amines in all fermented soya bean products should be studied and appropriate limits determined to ensure the safety of eating these foods.

  9. Dynamics of Cocoa Bean Pulp Degradation during Cocoa Bean Fermentation: Effects of Yeast Starter Culture Addition

    Directory of Open Access Journals (Sweden)

    Laras Cempaka

    2014-07-01

    Full Text Available Fermentation is a crucial step in the post-harvest processing of cocoa beans. This process comprises mixed culture microbial activities on the cocoa bean pulp, producing metabolites that act as important precursors for cocoa flavour development. Variations in the microbial population dynamics during the fermentation process may induce changes in the overall process. Thus, the introduction of a specific microbial starter culture may improve the quality of the fermentation. This article discusses the effects ofthe addition of Saccharomyces cerevisae var. Chevalieri starter culture on cocoa bean fermentation. The dynamics in the yeast concentration, sugary pulp compounds and metabolic products were measured during fermentation. The alterations in the dynamic metabolite profile were significant, although only a slight difference was observed in the yeast population. A higher fermentation index was measured for the cocoa bean fermentation with yeast starter culture, 1.13 compared to 0.84. In conclusion, this method can potentially be applied to shorten the cocoa bean fermentation time.

  10. Chemical and Sensorial Evaluation of a Newly Developed Bean Jam

    OpenAIRE

    Guiné, Raquel; Figueiredo, Ana; Correia, Paula; Gonçalves, Fernando

    2015-01-01

    The purpose of the present work was to develop an innovative food product with nutritional properties as well as appealing organoleptic qualities. The product, a jam, was prepared with the beans’ cooking water combined with fresh apple or carrot, without the addition of any conservatives. Three different jams were produced: bean and carrot, bean and apple and bean, apple and cinnamon. The developed products underwent a sensorial...

  11. Bean grain hysteresis with induced mechanical damage

    Directory of Open Access Journals (Sweden)

    Renata C. Campos

    Full Text Available ABSTRACT This study aimed to evaluate the effect of mechanical damage on the hysteresis of beans with induced mechanical damage under different conditions of temperature and relative humidity. Beans (Phaseolus vulgaris L. harvested manually with 35% water content (w.b. were used. Part of this product was subjected to induced mechanical damage by Stein Breakage Tester and controlled drying (damaged and control sample, for sorption processes. The sorption isotherms of water were analyzed for different temperature conditions: 20, 30, 40 and 50 oC; and relative humidity: 0.3; 0.4; 0.5; 0.7 and 0.9 (decimal. Equilibrium moisture content data were correlated with six mathematical models, and the Modified Oswin model was the one that best fitted to the experimental data. According to the above mentioned isotherms, it was possible to observe the phenomenon of hysteresis of damaged and control samples, and this phenomenon was more pronounced in control ones.

  12. Nutritional characteristics of biofortified common beans

    Directory of Open Access Journals (Sweden)

    Priscila Brigide

    2014-09-01

    Full Text Available Iron and zinc deficiency can cause anemia and alterations in the immune response and impair work capacity. To minimize this problem, biofortification has been developed to improve and/or maintain the nutritional status of the population. Beans are an important source of carbohydrates, proteins, and minerals. The objective of this study is to characterize biofortified beans, quantify the minerals in different cultivars, and determine mineral dialysis. Grains of raw and cooked beans were analyzed for moisture, protein, lipids, fiber, minerals, and in vitro availability using four treatments and one control. The data were analyzed using ANOVA, and the Tukey test (p<0.05. The chemical composition of the raw and cooked treatments showed a moisture content ranging from 13.4 to 81.4%, protein from 22.24 to 31.59%, lipids from 1.66 to 2.22%, fiber from 16.81 to 40.63%, carbohydrates from 27.80 to 34.78%, and ash from 4.1 to 4.82%. Different varieties of beans showed statistically significant differences in iron and zinc content compared to the control cultivar (Pérola. The iron content differed significantly from that of the Pérola cultivar in the raw treatment, while in the cooked treatment, the control cultivar did not differ from the Piratã. The same behavior was observed for the zinc content in both treatments. There was no significant difference between the cultivars in the treatments in terms of the content of the dialysis of Calcium (Ca, Iron (Fe, Magnesium (Mg, and Zinc (Zn.

  13. Pb-210 in beans grown in normal background environments

    Energy Technology Data Exchange (ETDEWEB)

    Mingote, Raquel M.; Nogueira, Regina A., E-mail: mingote@cnen.gov.br, E-mail: rnogueira@cnen.gov.br [Centro Regional de Ciencias Nucleares do Centro-Oeste (CRCN-CO/CNEN-GO), Abadia de Goias, GO (Brazil)

    2013-07-01

    A survey was carried out on the activity concentration of {sup 210}Pb in common beans (Phaseolus vulgaris L.) grown in normal background environments in Brazil. The Carioca beans and the black type were analyzed, which contribute with 90% of the Brazilian market share of the common beans. To this study 18 bean samples sowing in the Middle-Western and Southern regions of Brazil during the years 2010-2011 were analyzed. The proportion per bean type was similar to the national production: most of the Carioca beans (n=13; 72%) and black beans (n=5; 28%). Other 17 values of {sup 210}Pb activity concentration in beans grown in Southeastern region available in the GEORAD, a dataset of radioactivity in Brazil, were added to the statistic analysis of the data. Considering the information contained in censored observations (60%), representative value of {sup 210}Pb activity concentration in beans was estimated by using robust ROS, a censored data analysis method. The value 0.047 Bq kg{sup -1} fresh wt. obtained here is according to {sup 210}Pb activity concentration in grains reported by UNSCEAR 0.05 Bq kg{sup -1}. (author)

  14. The Effective Design of Bean Bag as a Vibroimpact Damper

    Directory of Open Access Journals (Sweden)

    A.Q. Liu

    2000-01-01

    Full Text Available The technique of a bean bag damper has been effectively applied in many engineering fields to control the vibroimpact of a structural system. In this study, the basic parameters responsible for the design of an effective bean bag: the size of beans, the mass ratio of the bean bag to the structure to which it is attached, the clearance distance and the position of the bag, are studied by both theoretical and experimental analyses. These will provide a better understanding of the performance of the bean bag for optimisation of damper design. It was found that reducing the size of beans would increase the exchange of momentum in the system due to the increase in the effective contact areas. Within the range of mass ratios studied, the damping performance of the damper was found to improve with higher mass ratios. There was an optimum clearance for any specific damper whereby the maximum attenuation could be achieved. The position of the bag with respect to nodes and antipodes of the primary structure determined the magnitude of attenuation attainable. Furthermore, the limitations of bean bags have been identified and a general criteria for the design of a bean bag damper has been formulated based on the study undertaken. It was shown that an appropriately configured bean bag damper was capable of reducing the amplitude of vibration by 80% to 90%.

  15. Yam bean oleoresin and seed quality of common bean infested by Acanthoscelides obtectus Say.

    OpenAIRE

    Rangel-Lucio, José Antonio; Juárez-Goiz, José Mayolo; García-Moya, Edmundo; Fernández-Andrés, María Dolores; Rodríguez-Hernández, Cesáreo; Alvarado-Bárcenas, Estéfana

    2011-01-01

    The objective of this investigation was to evaluate the effect of yam bean oleoresin on common bean seed quality and bean weevil control. The oleoresin extract was obtained by the HPLC technique, the presence of rotenone was detected(15 mg/l). Three concentrations of oleoresin extract were tested (Ci, g/ml): C1 (5x10-7, 5x10-6, …5x10-2); C2 (1x10-2, 2x10-2,…6x10-2); C3 (5x10-1, 6x10-1,…9x10-1) and one control treatment per concentration, applied to recipients of 300 ml with 50 g of common bea...

  16. Populational survey of arthropods on transgenic common bean expressing the rep gene from Bean golden mosaic virus

    OpenAIRE

    Pinheiro, Patrícia V; Quintela, Eliane D; Ana Maria R. Junqueira; Aragão, Francisco JL; Faria, Josias C

    2014-01-01

    Genetically modified (GM) crops is considered the fastest adopted crop technology in the history of modern agriculture. However, possible undesirable and unintended effects must be considered during the research steps toward development of a commercial product. In this report we evaluated effects of a common bean virus resistant line on arthropod populations, considered as non-target organisms. This GM bean line (named M1/4) was modified for resistance against Bean golden mosaic virus (BGMV) ...

  17. Impact of Long Dry Season on Bean Characteristics of Robusta Coffee (Coffea canephora

    Directory of Open Access Journals (Sweden)

    Ucu Sumirat

    2008-07-01

    Full Text Available Bean characteristics in Robusta coffee (Coffea canephora should be taken into considerations in coffee breeding. Beside genetic factor, environment has been known as an important factor in the formation and change of composition of bean characteristics. This research aimed to find out the effect of long dry season on changes of bean characteristics. The population observed consisted of 277 genotypes originated from reciprocal crossings of three parental namely BP 409, BP 961 and Q 121. Observation was conducted in Kaliwining Experimental Garden of ICCRI in Jember, East Java during two years with different drought intensity i.e. 2005—2006 and 2006—2007 production years. The result showed that long dry season decreased the range value of population of normal beans, pea beans and triage beans, and followed by decreasing in the mean value except for normal beans. Long dry season also influence the change of value range of empty bean to higher proportion, and followed by increasing in the mean value. Distribution pattern of normal beans tend in to remain at high proportion, in contrast to those of pea and triage beans. In other side, long dry season tended to change distribution pattern of empty beans to at high proportion. Correlation analysis among beans characteristics showed that normal beans had negative correlations with pea beans and empty beans. Pea beans had a positive correlation with empty beans. Long dry season decreased proportion of pea bean and triage bean, in contrast to those of empty beans. Increasing proportion of empty bean was caused by failure of growth to normal bean under stress condition. Key words : Coffee canephora, bean characteristics, long dry season, variation, correlation, composition.

  18. Pretreatment of African yam bean (Sphenostylis stenocarpa): effect of soaking and blanching on the quality of African yam bean seed.

    Science.gov (United States)

    Aminigo, Ebiokpo R; Metzger, Lloyd E

    2005-12-01

    The effect of pretreatment (soaking in sodium salts and blanching) on hydration coefficient (HC), chemical composition, texture, and color of African yam bean (AYB) was investigated. Soaking in water and in salt solutions increased the HC and about 90% of final HC values were attained at 12 and 4 hr of soaking for whole and dehulled beans, respectively. Protein content was slightly increased by soaking and blanching while ash and fat contents were reduced. Generally, a combination of dehulling and wet-processing reduced firmness of the beans more than soaking or blanching of the whole beans. Antioxidant activity was lowest (3260 TE(3)100 g) in cream-colored beans and highest (16,600 TE/100 g) in brown-colored beans. The tannin contents of unprocessed cream-colored beans and dehulled wet-processed marble variety were not significantly different (p > 0.05). The levels of tannins in the marble variety were reduced by blanching for 40 min (19.2%), soaking for 12 hr (16.0%), dehulling (72.0%), dehulling and blanching (88.8%). The whiteness of bean flours was increased significantly by dehulling, slightly by wet-processing of marble variety, and reduced significantly by wet-processing of cream-colored beans.

  19. The effect of lactic acid bacteria on cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2015-07-16

    Cocoa beans (Theobroma cacao L.) are the raw material for chocolate production. Fermentation of cocoa pulp by microorganisms is crucial for developing chocolate flavor precursors. Yeasts conduct an alcoholic fermentation within the bean pulp that is essential for the production of good quality beans, giving typical chocolate characters. However, the roles of bacteria such as lactic acid bacteria and acetic acid bacteria in contributing to the quality of cocoa bean and chocolate are not fully understood. Using controlled laboratory fermentations, this study investigated the contribution of lactic acid bacteria to cocoa bean fermentation. Cocoa beans were fermented under conditions where the growth of lactic acid bacteria was restricted by the use of nisin and lysozyme. The resultant microbial ecology, chemistry and chocolate quality of beans from these fermentations were compared with those of indigenous (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii, Kluyveromyces marxianus and Saccharomyces cerevisiae, the lactic acid bacteria Lactobacillus plantarum, Lactobacillus pentosus and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in control fermentations. In fermentations with the presence of nisin and lysozyme, the same species of yeasts and acetic acid bacteria grew but the growth of lactic acid bacteria was prevented or restricted. These beans underwent characteristic alcoholic fermentation where the utilization of sugars and the production of ethanol, organic acids and volatile compounds in the bean pulp and nibs were similar for beans fermented in the presence of lactic acid bacteria. Lactic acid was produced during both fermentations but more so when lactic acid bacteria grew. Beans fermented in the presence or absence of lactic acid bacteria were fully fermented, had similar shell weights and gave acceptable chocolates with no differences

  20. Evaluation of Genetic Diversity of Castor Bean for Biodiesel Utilization

    Science.gov (United States)

    Castor bean (Ricinus communis L., 2n=20) is a cross-pollinated diploid species belonging to the family Euphorbiaceae instead of the Leguminosae. It is a native of Africa but may have originated in India. Castor bean plants grow as annual or perennial, depending on geographical locations, climate a...

  1. Antioxidant activity of black bean (Phaseolus vulgaris L.) protein hydrolysates

    Science.gov (United States)

    The objective of this work was to study the effect of enzymatic hydrolysis of black bean protein concentrate using different enzymes. Bean proteins were extracted and hydrolyzed over a period of 120 min using the enzymes pepsin or alcalase. The protein hydrolysates’ molecular weight was assayed by e...

  2. Examining growth, yield and bean quality of Ethiopian coffee trees

    NARCIS (Netherlands)

    Bote, Adugna

    2016-01-01

    Coffee (Coffeaarabica L.)bean production and quality are determined by a diversity of interacting factors (e.g. shade, nitrogen, crop traits). Bean yield increases with increase in radiation, but adequate fertilizer suppliesare needed to sustain the productivity. This thesis analysed coffee tree gro

  3. Incentives for cocoa bean production in Ghana: Does quality matter?

    NARCIS (Netherlands)

    Quarmine, W.; Haagsma, R.; Sakyi-Dawson, O.; Asante, F.; Huis, van A.; Obeng-Ofori, D.

    2012-01-01

    This paper investigates the institutional factors that constrain farmers’ incentives to enhance the quality of cocoa beans in Ghana. Data were collected at three levels of aggregation in the cocoa bean value chain: village, district, and national level. Multi-stage cluster sampling was employed to s

  4. Variability for Biological Nitrogen Fixation Capacity in Beans

    Science.gov (United States)

    As legumes, common beans have the capacity to form a symbiotic relationship with soil bacteria called rhizobia and fix nitrogen from the atmosphere. Common beans however are considered to be poor nitrogen fixers as compared to other legumes. Identification of genetic variability for N fixation capac...

  5. The composition of wax and oil in green coffee beans

    NARCIS (Netherlands)

    Folstar, P.

    1976-01-01

    Methods for the isolation of wax and oil from green coffee beans were studied and a method for the quantitative extraction of coffee oil from the beans was introduced. Coffee wax, coffee oil and wax-free coffee oil as well as the unsaponifiable matter prepared from each were fractionated by column c

  6. IRON, ZINC, AND FERRITIN ACCUMULATION IN COMMON BEANS

    DEFF Research Database (Denmark)

    Urbanski, Dorian Fabian; Sørensen, Kirsten; Jurkiewicz, Anna Malgorzata

      that the distribution of iron is dependant on the genotype. Using immunolocalization, we visualized the localization of  ferritin in mature common bean seeds.   This knowledge can contribute to the discovery of factors that affect the bioavailability of micronutrients and  can contribute to breeding common beans...

  7. Occurrence and distribution of viruses infecting the bean in Serbia

    Directory of Open Access Journals (Sweden)

    Petrović Dragana

    2010-01-01

    Full Text Available This work describes the incidence and distribution of the most important bean viruses in Serbia: Bean common mosaic virus (BCMV, Bean common mosaic necrosis virus (BCMNV, Bean yellow mosaic virus (BYMV, Cucumber mosaic virus (CMV and Alfalfa mosaic virus (AMV. The viral isolates were characterized serologically and biologically. BCMV was found in the largest number of plants (30.53%, followed by BCMNV (2.67%, CMV (5.34%, and AMV (3.41%, since BYMV was not determined. Mixed viral infections were found in several samples. The RT-PCR method was used to prove that the tested isolates belong to the BCMV, family Potyviridae and strains Russian and NL-3 D. Results obtained in this work will enable further studies of the genetic variability of bean virus isolates from Serbia. .

  8. Laser-Induced Breakdown Spectroscopy (LIBS) for spectral characterization of regular coffee beans and luwak coffee bean

    Science.gov (United States)

    Nufiqurakhmah, Nufiqurakhmah; Nasution, Aulia; Suyanto, Hery

    2016-11-01

    Luwak (civet) coffee refers to a type of coffee, where the cherries have been priorly digested and then defecated by a civet (Paradoxurus Hermaphroditus), a catlike animals typically habited in Indonesia. Luwak will only selectively select ripe cherries, and digesting them by enzymatic fermentation in its digestive system. The defecated beans is then removed and cleaned from the feces. It is regarded as the world's most expensive coffee, Traditionally the quality of the coffee is subjectively determined by a tester. This research is motivated by the needs to study and develop quantitative parameters in determining the quality of coffee bean, which are more objective to measure the quality of coffee products. LIBS technique was used to identify the elemental contents of coffee beans based on its spectral characteristics in the range 200-900 nm. Samples of green beans from variant of arabica and robusta, either regular and luwak, were collected from 5 plantations in East Java. From the recorded spectra, intensity ratio of nitrogen (N), hydrogen (H), and oxygen (O) as essential elements in coffee is applied. In general, values extracted from luwak coffee bean is higher with increases 0.03% - 79.93%. A Discriminant Function Analysis (DFA) also applied to identify marker elements that characterize the regular and luwak beans. Elements of Ca, W, Sr, Mg, and H are the ones used to differentiate the regular and luwak beans from arabica variant, while Ca and W are the ones used to differentiate the regular and luwak beans of robusta variant.

  9. Sensory analysis of beans (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Sanz-Calvo M.

    1999-01-01

    Full Text Available The methodology of sensory profiling constitutes the basis of a descriptive quantitative analysis, defining a product with the minimum number of words and with maximum efficiency, using a precise tasting sheet, which can be reproduced and is understood by all. In this work, the texture profiling for different bean varieties that are characteristic of the Spanish market was carried out. Optimum conditions for samples and a tasting card were established, and a panel was trained. The texture profile results show significant differences amongst varieties and even amongst different origins for the same variety.

  10. Proteomic analysis of common bean (Phaseolus vulgaris) by two-dimensional gel electrophoresis and mass spectrometry

    Science.gov (United States)

    The modern cultivated common bean (Phaseolus vulgaris) has evolved from wild common beans distributed in Central America, Mexico and the Andean region of South America. It has been reported that wild common bean accessions have higher levels of protein content than the domesticated dry bean cultiva...

  11. Registration of PR1146-138 yellow dry bean germplasm line

    Science.gov (United States)

    The yellow bean (Phaseolus vulgaris L.) is an important market class in Haiti. However, there have been no previous attempts to genetically improve this seed type for the Caribbean. Landrace varieties of yellow beans in Haiti are susceptible to Bean golden yellow mosaic virus (BGYMV) and bean common...

  12. Development of the yellow common bean germplasm PR1146-138

    Science.gov (United States)

    The yellow bean (Phaseolus vulgaris L.) is an important market class in Haiti. There have been, however, no previous attempts to genetically improve this seed type for the Caribbean. Landrace varieties of yellow beans in Haiti are susceptible to Bean golden yellow mosaic virus (BGYMV) and bean commo...

  13. Diversification and population structure in common beans (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Matthew W Blair

    Full Text Available Wild accessions of crops and landraces are valuable genetic resources for plant breeding and for conserving alleles and gene combinations in planta. The primary genepool of cultivated common beans includes wild accessions of Phaseolus vulgaris. These are of the same species as the domesticates and therefore are easily crossable with cultivated accessions. Molecular marker assessment of wild beans and landraces is important for the proper utilization and conservation of these important genetic resources. The goal of this research was to evaluate a collection of wild beans with fluorescent microsatellite or simple sequence repeat markers and to determine the population structure in combination with cultivated beans of all known races. Marker diversity in terms of average number of alleles per marker was high (13 for the combination of 36 markers and 104 wild genotypes that was similar to the average of 14 alleles per marker found for the 606 cultivated genotypes. Diversity in wild beans appears to be somewhat higher than in cultivated beans on a per genotype basis. Five populations or genepools were identified in structure analysis of the wild beans corresponding to segments of the geographical range, including Mesoamerican (Mexican, Guatemalan, Colombian, Ecuadorian-northern Peruvian and Andean (Argentina, Bolivia and Southern Peru. The combined analysis of wild and cultivated accessions showed that the first and last of these genepools were related to the cultivated genepools of the same names and the penultimate was found to be distinct but not ancestral to the others. The Guatemalan genepool was very novel and perhaps related to cultivars of race Guatemala, while the Colombian population was also distinct. Results suggest geographic isolation, founder effects or natural selection could have created the different semi-discrete populations of wild beans and that multiple domestications and introgression were involved in creating the diversity of

  14. Physical and chemical characteristics of common bean varieties

    Directory of Open Access Journals (Sweden)

    Marcio de Barros

    2016-04-01

    Full Text Available The common bean (Phaseolus vulgaris L. is one of the most widely consumed legumes in the world, but nevertheless different varieties vary with respect to their physical and chemical aspects. This study evaluated the physical and chemical characteristics (color, hardness after cooking, water absorption capacity, cooking time, integrity of the beans after cooking, proximate composition and mineral composition of the following varieties of the common bean: Carioca, IAPAR 81, Saracura, Juriti, Pérola, Colibri and IAPAR 31, all destined for both the internal Brazilian and external markets. The varieties studied had different proximate compositions and contents of the following minerals: K, Ca, N, Mg, S, Cu, Fe and Mn; but identical contents of P, Zn and B. The beans were classified as small in size. The Carioca variety showed the lowest values for L* (41.29 and H* (57.22, and the highest values for a* (12.17, its beans being redder and darker than the others. The Saracura variety showed the lowest degree of hydration (95.70 g/100g, cooking time (22.67 min. and whole beans after cooking (30%, while the Pérola variety showed the highest values for these same parameters, 106.77 g/100g, 43.67 min. and 82.16%, respectively. No correlation was observed between the calcium and magnesium contents of the beans and the hardness of the raw bean, degree of hydration during maceration, cooking time and integrity of the cooked beans. According to the characteristics studied, the Saracura variety is a good option for both industrial and domestic use.

  15. The Paleobiolinguistics of the Common Bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Cecil H. Brown

    2014-10-01

    Full Text Available Paleobiolinguistics is used to determine when and where the common bean (Phaseolus vulgaris L. developed significance for prehistoric groups of Native America. Dates and locations of proto-languages for which common bean terms reconstruct generally accord with crop-origin and dispersal information from plant genetics and archaeobotany. Paleobiolinguistic and other lines of evidence indicate that human interest in the common bean became significant primarily with the widespread development of a village‐farming way of life in the New World rather than earlier when squash and maize and a few other crops became important.

  16. Advances in faba bean genetics and genomics

    Directory of Open Access Journals (Sweden)

    Donal Martin O'Sullivan

    2016-08-01

    Full Text Available Vicia faba L, is a globally important grain legume whose main centres of diversity are the Fertile Crescent and Mediterranean basin. Because of its small number (six of exceptionally large and easily observed chromosomes it became a model species for plant cytogenetics the 70s and 80s. It is somewhat ironic therefore, that the emergence of more genomically tractable model plant species such as Arabidopsis and Medicago coincided with a marked decline in genome research on the formerly favoured plant cytogenetic model. Thus, as ever higher density molecular marker coverage and dense genetic and even complete genome sequence maps of key crop and model species emerged through the 1990s and early 2000s, genetic and genome knowledge of Vicia faba lagged far behind other grain legumes such as soybean, common bean and pea.However, cheap sequencing technologies have stimulated the production of deep transcriptome coverage from several tissue types and numerous distinct cultivars in recent years. This has permitted the reconstruction of the faba bean meta-transcriptome and has fuelled development of extensive sets of Simple Sequence Repeat and Single Nucleotide Polymorphism (SNP markers. Genetics of faba bean stretches back to the 1930s, but it was not until 1993 that DNA markers were used to construct genetic maps. A series of Random Amplified Polymorphic DNA-based genetic studies mainly targeted at quantitative loci underlying resistance to a series of biotic and abiotic stresses were conducted during the 1990’s and early 2000s. More recently, SNP-based genetic maps have permitted chromosome intervals of interest to be aligned to collinear segments of sequenced legume genomes such as the model legume Medicago truncatula, which in turn opens up the possibility for hypotheses on gene content, order and function to be translated from model to crop. Some examples of where knowledge of gene content and function have already been productively exploited are

  17. The introduction of the common bean (Phaseolus vulgaris L.) into Western Europe and the phenotypic variation of dry beans collected in the Netherlands.

    NARCIS (Netherlands)

    Zeven, A.C.

    1997-01-01

    The first introduction of common bean from Central/South America into Western Europe most likely took place around 1500. The attractive bean seeds and their easy transportation warranted numerous additional introductions, not only from the Americas, but also from other areas where the common bean ha

  18. Inactivation of jack bean urease by allicin.

    Science.gov (United States)

    Juszkiewicz, Adam; Zaborska, Wiesława; Sepioł, Janusz; Góra, Maciej; Zaborska, Anna

    2003-10-01

    Allicin--diallyl thiosulfinate--is the main biologically active component of freshly crushed garlic. Allicin was synthesized as described elsewhere and was tested for its inhibitory ability against jack bean urease in 20 mM phosphate buffer, pH 7.0 at 22 degrees C. The results indicate that allicin is an enzymatic inactivator. The loss of urease activity was irreversible, time- and concentration dependent and the kinetics of the inactivation was biphasic; each phase, obeyed pseudo-first-order kinetics. The rate constants for inactivation were measured for the fast and slow phases and for several concentrations of allicin. Thiol reagents, and competitive inhibitor (boric acid) protected the enzyme from loss of enzymatic activity. The studies demonstrate that urease inactivation results from the reaction between allicin and the SH-group, situated in the urease active site (Cys592).

  19. An antifungal peptide from baby lima bean.

    Science.gov (United States)

    Wang, H X; Ng, T B

    2006-12-01

    A 6-kDa antifungal peptide with inhibitory activity on mycelial growth in Fusarium oxysporum, Mycosphaerella arachidicola, and Physalospora piricola was isolated from baby lima beans. The peptide suppressed growth in M. arachidicola with an IC(50) of 0.87 muM and inhibited activity of HIV-1 reverse transcriptase with an IC(50) of 4 muM. The peptide exhibited an N-terminal amino acid sequence similar to those of leguminous defensins. The isolation procedure comprised ion exchange chromatography on diethylaminoethyl (DEAE)-cellulose, affinity chromatography on Affi-gel blue gel, ion exchange chromatography on carboxymethyl (CM)-cellulose, and gel filtration by fast protein liquid chromatography on Superdex 75. The peptide was unadsorbed on DEAE-cellulose and Affi-gel blue gel but was adsorbed on CM-cellulose.

  20. The onset of faba bean farming in the Southern Levant

    Science.gov (United States)

    Caracuta, Valentina; Barzilai, Omry; Khalaily, Hamudi; Milevski, Ianir; Paz, Yitzhak; Vardi, Jacob; Regev, Lior; Boaretto, Elisabetta

    2015-10-01

    Even though the faba bean (Vicia faba L.) is among the most ubiquitously cultivated crops, very little is known about its origins. Here, we report discoveries of charred faba beans from three adjacent Neolithic sites in the lower Galilee region, in the southern Levant, that offer new insights into the early history of this species. Biometric measurements, radiocarbon dating and stable carbon isotope analyses of the archaeological remains, supported by experiments on modern material, date the earliest farming of this crop to ~10,200 cal BP. The large quantity of faba beans found in these adjacent sites indicates intensive production of faba beans in the region that can only have been achieved by planting non-dormant seeds. Selection of mutant-non-dormant stock suggests that the domestication of the crop occurred as early as the 11th millennium cal BP. Plant domestication| Vicia faba L.| Pre-Pottery Neolithic B| radiocarbon dating| Δ13C analysis.

  1. Ethiopian soya bean and sunflower value chains : Opportunities and challenges

    NARCIS (Netherlands)

    Wijnands, J.H.M.; Dufera Gurmesa, N.; Lute, J.C.M.; Loo, van E.N.

    2011-01-01

    This report analyses the business opportunities of soya beans and sunflowers. The opportunities are addressed to firms in all levels of the value chain ranging from consumers to farmers in the Ethiopian agriculture.

  2. Caffeine content of Ethiopian Coffea arabica beans

    Directory of Open Access Journals (Sweden)

    Maria Bernadete Silvarolla

    2000-03-01

    Full Text Available The coffee germplasm bank of the Instituto Agronômico de Campinas has many Coffea arabica accessions from Ethiopia, which is considered the primary center of genetic diversity in coffee plants. An evaluation of the caffeine content of beans from 99 progenies revealed intra- and inter-progeny variability. In 68 progenies from the Kaffa region we found caffeine values in the range 0.46-2.82% (mean 1.18%, and in 22 progenies from Illubabor region these values ranged from 0.42 to 2.90% (mean 1.10%. This variability could be exploited in a breeding program aimed at producing beans with low-caffeine content.O banco de germoplasma de café do Instituto Agronômico de Campinas contém grande número de introduções de Coffea arabica provenientes da Etiópia, considerada centro de diversidade genética desta espécie. A avaliação dos teores de cafeína nas sementes de 99 progênies revelou a presença de variabilidade entre e dentro das progênies, de acordo com a região de origem das introduções. Entre as 68 progênies da região de Kaffa encontraram-se valores de cafeína entre 0.46 e 2.82% (média 1.18% e entre as 22 progênies de Illubabor obtiveram-se plantas cujos teores de cafeína variaram de 0.42 a 2.90% (média 1.10%. A variabilidade aqui relatada poderá ser explorada na produção de uma variedade de café com baixos teores de cafeína nas sementes.

  3. Insects diversity in lima bean (Phaseolus lunatus

    Directory of Open Access Journals (Sweden)

    WIWIN SETIAWATI

    2005-10-01

    Full Text Available Lima bean (Phaseolus lunatus is a vegetable which usually made as a home yard plant for Indonesian people to fulfill their daily needs. This plant has not been produced in the large number by the farmer. So it is hard to find in the market. Lima bean is light by many kind of insect. Inventory, identification and the study of insect taxon to this plant is being done to collect some information about the insect who life in the plant. The research was done in Balitsa experiment garden in the district of Lembang in Bandung regency on November 2003-February 2004, the experiment start at 4 weeks age, at the height of 1260 m over the sea level. The observation was made systematically by absolute method (D-vac macine and relative method (sweeping net. The research so that there were 26 species of phytofagous insect, 9 species of predator insect, 6 species of parasitoid insect, 4 species of pollinator and 14 species of scavenger insect. According to the research the highest species number was got in the 8th week (3rd sampling, which had 27 variety of species, so the highest diversity was also got in this with 2,113 point. Aphididae and Cicadellidae was the most insect found in roay plant. The research also had high number of species insect so the diversity of insect and evenness become high. A community will have the high stability if it is a long with the high diversity. High evenness in community that has low species dominance and high species number of insect so the high of species richness.

  4. Effects of processing on bean (Phaseolus vulgaris L.) protein quality.

    OpenAIRE

    Poel, van der, A.F.B.

    1990-01-01

    In animal production, feeding has an important impact on productivity and health of animals and feed composition is known to influence protein and energy metabolism directly. For monogastric animals complete diets are manufactured in which feed ingredients are used to supply the energy yielding and other nutrients. The common bean ( Phaseolus vulgaris L.) is such an ingredient.In common beans ( Phaseolus vulgaris L.) the supply of nutrients is often lower than is expected from its chemical an...

  5. Watershed responses to Amazon soya bean cropland expansion and intensification.

    Science.gov (United States)

    Neill, Christopher; Coe, Michael T; Riskin, Shelby H; Krusche, Alex V; Elsenbeer, Helmut; Macedo, Marcia N; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A

    2013-06-05

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compared with forest. However, the deep and highly permeable soils on the broad plateaus on which much of the soya bean cultivation has expanded buffer small soya bean watersheds against increased stormflows. Concentrations of nitrate and phosphate do not differ between forest or soya bean watersheds because fixation of phosphorus fertilizer by iron and aluminium oxides and anion exchange of nitrate in deep soils restrict nutrient movement. Despite resistance to biogeochemical change, streams in soya bean watersheds have higher temperatures caused by impoundments and reduction of bordering riparian forest. In larger rivers, increased water flow, current velocities and sediment flux following deforestation can reshape stream morphology, suggesting that cumulative impacts of deforestation in small watersheds will occur at larger scales.

  6. Variation in caffeine concentration in single coffee beans.

    Science.gov (United States)

    Fox, Glen P; Wu, Alex; Yiran, Liang; Force, Lesleigh

    2013-11-13

    Twenty-eight coffee samples from around the world were tested for caffeine levels to develop near-infrared reflectance spectroscopy (NIRS) calibrations for whole and ground coffee. Twenty-five individual beans from five of those coffees were used to develop a NIRS calibration for caffeine concentration in single beans. An international standard high-performance liquid chromatography method was used to analyze for caffeine content. Coffee is a legal stimulant and possesses a number of heath properties. However, there is variation in the level of caffeine in brewed coffee and other caffeinated beverages. Being able to sort beans on the basis of caffeine concentration will improve quality control in the level of caffeine in those beverages. The range in caffeine concentration was from 0.01 mg/g (decaffeinated coffee) to 19.9 mg/g (Italian coffee). The majority of coffees were around 10.0-12.0 mg/g. The NIRS results showed r(2) values for bulk unground and ground coffees were >0.90 with standard errors caffeine concentration of individual coffee beans. One application of this calibration could be sorting beans on caffeine concentration to provide greater quality control for high-end markets. Furthermore, bean sorting may open new markets for novel coffee products.

  7. Castor bean organelle genome sequencing and worldwide genetic diversity analysis.

    Directory of Open Access Journals (Sweden)

    Maximo Rivarola

    Full Text Available Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade.

  8. Castor bean organelle genome sequencing and worldwide genetic diversity analysis.

    Science.gov (United States)

    Rivarola, Maximo; Foster, Jeffrey T; Chan, Agnes P; Williams, Amber L; Rice, Danny W; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M J; Khouri, Hoda M; Beckstrom-Sternberg, Stephen M; Allan, Gerard J; Keim, Paul; Ravel, Jacques; Rabinowicz, Pablo D

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade.

  9. Castor Bean Organelle Genome Sequencing and Worldwide Genetic Diversity Analysis

    Science.gov (United States)

    Chan, Agnes P.; Williams, Amber L.; Rice, Danny W.; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M. J.; Khouri, Hoda M.; Beckstrom-Sternberg, Stephen M.; Allan, Gerard J.; Keim, Paul; Ravel, Jacques; Rabinowicz, Pablo D.

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade. PMID:21750729

  10. Susceptibility of pea, horse bean and bean to viruses in dependence on the age of the inoculated plants

    Directory of Open Access Journals (Sweden)

    Władysław Błaszczak

    2013-12-01

    Full Text Available Three cultivars of pea did not differ in their susceptibility to Cucumber Mosaic Virus (CMV notwithstanding the age of the inoculated plants. But their susceptibility to infection with Bean Yellow Mosaic Virus (BYMV differed. Horse bean cultivars 'Nadwiślański' and 'Major' proved to be less susceptible to Broad Bean True Mosaic Virus (BBTMV when older plants were-inoculated. Two bean cultivars 'Złota Saxa' and 'Earle' appeared to be susceptible to BBTMV only in the phase of developing primary leaves and the age-dependent resistance to infection increased faster in plants of the cv. 'Złota Saxa'. Both cultivars of bean showed also age-dependent resistance to infection by BYMV. All these viruses restricted growth and yield of plants. The decreases were greater when younger plants were inoculated. These dependences appeared most distinctly in pea cv. 'Sześciotygodniowy' infected with CMV and in two cultivars of bean infected with BYMV.

  11. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel; Ambachew; Firew; Mekbib; Asrat; Asfaw; Stephen; E.Beebe; Matthew; W.Blair

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot(BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly; iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress.In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  12. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Directory of Open Access Journals (Sweden)

    Daniel Ambachew

    2015-08-01

    Full Text Available Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM. The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i water deficit at mid-pod fill, or ii unprotected against bean fly; iii irrigated, well watered conditions, or iv bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  13. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel Ambachew; Firew Mekbib; Asrat Asfaw; Stephen E. Beebe; Matthew W. Blaird

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly;iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  14. Major proteins of yam bean tubers.

    Science.gov (United States)

    Gomes, A V; Sirju-Charran, G; Barnes, J A

    1997-09-01

    The tuberous roots of the Mexican yam bean, jicama, (Pachyrhizus erosus L. Urban) contained large quantities of two acidic glycoproteins which accounted for more than 70% of the total soluble proteins (about 3 g per 100 g of tuber on a dry weight basis). The two major proteins, tentatively named YBG1 and YBG2, had apparent M(r)s of 28,000 and 26,000, respectively, by SDS-PAGE. A third protein named YBP22 which accounted for 2-5% of the total soluble proteins had an M(r) of 22,000. YBG1 and YBG2 exhibited great similarity on the basis of their amino acid composition and had identical N-terminal amino acid sequences. The first 23 amino acids in the N-terminal region of YBG2 were DDLPDYVDWRDYGAVTRIKNQGQ which showed strong homology with the papain class of cysteine proteases. YBG1 and YBG2 were found to bind to a Concanavalin A-Sepharose column and were also stained positively by a sensitive glycoprotein stain. Both glycoproteins exhibited cysteine proteolytic activity. In contrast, YBP22 showed sequence homology with several known protease inhibitors, and a polyclonal antibody raised against this protein cross reacted with soybean trypsin inhibitor.

  15. Melhoramento do feijoeiro Breeding of dry beans

    Directory of Open Access Journals (Sweden)

    Ibrahim O. Abrahão

    1960-01-01

    Full Text Available Os ensaios de variedades e linhagens de feijão, realizados no período de 1948 a 1957 pelo Seção de Genética e resumidamente aqui apresentados, vieram indicar que as variedades e linhagens do grupo Mulatinho e Chumbinho eram as mais produtivas. A partir dêste ano agrícola, novos ensaios comparativos de produção foram realizados, a fim de verificar o comportamento das variedades e linhagens existentes com as variedades recém-introduzidas e as novas linhagens selecionadas. As variedades comerciais e suas linhagens, estudadas neste trabalho, foram classificadas em oito grupos, com base nas observações realizadas principalmente sôbre o tipo de planta e característicos dos sementes, o saber: Mulatinho, Chumbinho, Rosinha, Roxinho, Manteiga, Prêto, Bico-de-Ouro e diversos. Dos oito ensaios analisados em detalhes e realizados em Campinas, chegou-se à conclusão de que as variedades dos grupos Prêta e Rosinha são as de maior capacidade produtiva, devendo ser intensificado o aproveitamento dêsses grupos no plano de melhoramento em execução. As do grupo Roxinho apresentam-se menos produtivas. A comparação das análises dos ensaios como látice e blocos ao acaso revelou uma eficiência média de ordem de 30% para o tipo látice nos oito ensaios analisados. A fim de observar se o pêso total de plantas por ocasião da colheita mostra correlação com a produção de grãos, determinou-se, para cada grupo, o índice entre essas duas variáveis. Observou-se que êstes índices são proporcionais à produção, servindo, assim, para melhor caracterizar os diversos grupos de variedades e linhagens de feijão.In spite of the fact that dry beans (Phaseolus vulgaris are one of the main sources of protein in the State of São Paulo, Brazil, they are considered a secondary crop and grown only in small patches or intercropped with coffee, sugar cane, or corn. The development of high yielding strains resistant to the most prevailing diseases, has

  16. The fate of phosphorus fertilizer in Amazon soya bean fields.

    Science.gov (United States)

    Riskin, Shelby H; Porder, Stephen; Neill, Christopher; Figueira, Adelaine Michela e Silva; Tubbesing, Carmen; Mahowald, Natalie

    2013-06-05

    Fertilizer-intensive soya bean agriculture has recently expanded in southeastern Amazonia, and whereas intensive fertilizer use in the temperate zone has led to widespread eutrophication of freshwater ecosystems, the effects in tropical systems are less well understood. We examined the fate of fertilizer phosphorus (P) by comparing P forms and budgets across a chronosequence of soya bean fields (converted to soya beans between 2003 and 2008) and forests on an 800 km(2) soya bean farm in Mato Grosso, Brazil. Soya bean fields were fertilized with 50 kg P ha(-1) yr(-1) (30 kg P ha(-1) yr(-1) above what is removed in crops). We used modified Hedley fractionation to quantify soil P pools and found increases in less-plant-available inorganic pools and decreases in organic pools in agricultural soils compared with forest. Fertilizer P did not move below 20 cm. Measurements of P sorption capacity suggest that while fertilizer inputs quench close to half of the sorption capacity of fast-reacting pools, most added P is bound in more slowly reacting pools. Our data suggest that this agricultural system currently has a low risk of P losses to waterways and that long time-scales are required to reach critical soil thresholds that would allow continued high yields with reduced fertilizer inputs.

  17. Effect of fermented soya beans on diarrhoea and feed efficiency in weaned piglets

    NARCIS (Netherlands)

    Kiers, J.L.; Meijer, J.C.; Nout, M.J.R.; Rombouts, F.M.; Nabuurs, M.J.A.; Meulen, van der J.

    2003-01-01

    Aims: To evaluate anti-diarrhoeal and growth enhancing properties of fermented soya beans in weaned piglets. Methods and Results: In a first phase piglet diet, toasted full-fat soya beans (20%) were replaced with either cooked soya beans or Rhizopus microsporus or Bacillus subtilis fermented soya be

  18. Extraction and characterization of polysaccharides from green and roasted Coffea arabica beans.

    NARCIS (Netherlands)

    Oosterveld, A.; Harmsen, H.; Voragen, A.G.J.; Schols, H.A.

    2003-01-01

    Polysaccharides were sequentially extracted from green and roasted Coffea arabica beans with water (90 °C), EDTA, 0.05, 1, and 4 M NaOH and characterized chemically. Additionally, the beans were subjected to a single extraction with water at 170 °C. Green arabica coffee beans contained large proport

  19. Physicochemical characteristics of green coffee: comparison of graded and defective beans.

    Science.gov (United States)

    Ramalakshmi, K; Kubra, I R; Rao, L J M

    2007-06-01

    Defective (triage) coffee beans are beans rejected after separating the graded ones according to the size and color. These coffee beans represent about 15% to 20% of coffee production in India but are not utilized for beverages since these affect the quality of coffee brew. In the present study, physical characteristics such as bean density, brightness, titratable acidity, pH, moisture, and total soluble solids and also chemical composition, namely, caffeine, chlorogenic acids, lipids, sucrose, total polyphenols, and proteins, were evaluated in defective as well as in graded green coffee beans. The physical parameters such as weight, density, and brightness of defective coffee beans were low compared to the graded beans, which is due to the presence of immature, broken, bleached, and black beans. Caffeine content was low in triage beans compared to graded beans. Chlorogenic acids, one of the composition in coffee responsible for antioxidant activity, was found to be intact (marginally high in some cases) in defective coffee beans. Hence, triage coffee beans can be evaluated as a source of antioxidant or radical scavenging conserve for food systems.

  20. STORED COCOA BEANS QUALITY AFFECTED BY FERMENTATION AND EPHESTIA CAUTELLA WALKER (LEPIDOPTERA: PHYCITIDAE INFESTATION

    Directory of Open Access Journals (Sweden)

    OK.KY S. DHARMAPUTRA

    2000-01-01

    Full Text Available The effects of fermentation on Ephestia cautella population and cocoa bean s quality in terms of moisture content, fungal population, the percentage of insect-damaged and mouldy beans, lipid and free fatty acid contents during storage were investigated together with the effects of £. cautella infestation on the quality of stored cocoa beans and weight loss. Fermented and unfermented cocoa beans with initial moisture contents of 7 or 9% were placed in ventilated plastic jars (Ikg/jar and stored for 6 months under room conditions. Seven larvae of £. cautella instar IV (2 males and 5 females were introduced in each jar at the beginning of storage. Untreated jars contained only cocoa beans. Population of £. cautella on fermented cocoa beans with either initial moisture content of 7 or 9% was lower than that on unfermented beans during storage. The population either on fermented or unfermented cocoa beans with initial moisture content of 7% was lower than that of 9%, and the population of all treatments increased during storage. Moisture content of all treatments either on cocoa beans with initial moisture contents of 7 or 9% had the same pattern. The percentage of insect-damaged beans on fermented cocoa beans was lower than that on unfermented cocoa beans after 5 to 6 months of storage. The damaged beans on fermented cocoa after 6 months of storage was not different than on unfermented beans after 4 months of storage. The weig ht loss either on fermented or unfermented cocoa beans with initial moisture content of 9% was higher than that with initial moisture content of 7%. The weight loss on fermented cocoa beans either with mois ture content of 7 or 9% was lower than that on unfermented beans during storage. The weight loss either on fermented or unfermented cocoa beans increased during storage. The percentage of mouldy beans on cocoa infested with £. cautella tended to increase during storage, while on beans not infested with the insect it

  1. Volatile compounds of dry beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Oomah, B Dave; Liang, Lisa S Y; Balasubramanian, Parthiba

    2007-12-01

    Volatile compounds of uncooked dry bean (Phaseolus vulgaris L.) cultivars representing three market classes (black, dark red kidney and pinto) grown in 2005 were isolated with headspace solid phase microextraction (HS-SPME), and analyzed with gas chromatography mass spectrometry (GC-MS). A total of 62 volatiles consisting of aromatic hydrocarbons, aldehydes, alkanes, alcohols and ketones represented on average 62, 38, 21, 12, and 9 x 10(6) total area counts, respectively. Bean cultivars differed in abundance and profile of volatiles. The combination of 18 compounds comprising a common profile explained 79% of the variance among cultivars based on principal component analysis (PCA). The SPME technique proved to be a rapid and effective method for routine evaluation of dry bean volatile profile.

  2. Changes of physical properties of coffee beans during roasting

    Directory of Open Access Journals (Sweden)

    Jokanović Marija R.

    2012-01-01

    Full Text Available The effects of heating time on physical changes (weight, volume, texture and colour of coffee beans (Outspan and Guaxupe coffee were investigated. The roasting temperature of both samples was 170°C and samples for analysis were taken at the intervals of 7 minutes during 40 minutes of roasting. Total weight loss at the end of the roasting process was 14.43 % (light roasted and 17.15 % (medium to dark roasted for Outspan and Guaxupe coffee beans, respectively. Significant (P < 0.05 changes in the coffee bean breaking force values were noted between the 7th and 14th minutes, and statistically not significant (P > 0.05 between the 35th and 40th minutes of the roasting. According to the L* colour parameter as a criterion for the classification of roasted coffee colour (light, medium, dark, the Outspan sample was medium and Guaxupe sample was dark roasted.

  3. Rhizosphere acidification of faba bean, soybean and maize

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, L.L. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences, Peking Union Medical College, Beijing, 100094 (China); Cao, J. [School of Life Science, Key Laboratory of Arid and Grassland Ecology, Lanzhou University, Lanzhou 730000 (China); Zhang, F.S. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Li, L., E-mail: lilong@cau.edu.cn [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China)

    2009-07-01

    Interspecific facilitation on phosphorus uptake was observed in faba bean/maize intercropping systems in previous studies. The mechanism behind this, however, remained unknown. Under nitrate supply, the difference in rhizosphere acidification potential was studied by directly measuring pH of the solution and by visualizing and quantifying proton efflux of roots between faba bean (Vicia faba L. cv. Lincan No.5), soybean (Glycine max L. cv. Zhonghuang No. 17) and maize (Zea mays L. cv. Zhongdan No.2) in monoculture and intercrop, supplied without or with 0.2 mmol L{sup -1} P as KH{sub 2}PO{sub 4}. The pH of the nutrient solution grown faba bean was lower than initial pH of 6.0 from day 1 to day 22 under P deficiency, whereas the pH of the solution with maize was declined from day 13 after treatment. Growing soybean increased solution pH irrespective of P supply. Under P deficiency, the proton efflux of faba bean both total (315.25 nmol h{sup -1} plant{sup -1}) and specific proton efflux (0.47 nmol h{sup -1} cm{sup -1}) was greater than that those of soybean (21.80 nmol h{sup -1} plant{sup -1} and 0.05 nmol h{sup -1} cm{sup -1}, respectively). Faba bean had much more ability of rhizosphere acidification than soybean and maize. The result can explain partly why faba bean utilizes sparingly soluble P more effectively than soybean and maize do, and has an important implication in understanding the mechanism behind interspecific facilitation on P uptake by intercropped species.

  4. Low-Income US Women Under-informed of the Specific Health Benefits of Consuming Beans.

    Directory of Open Access Journals (Sweden)

    Donna M Winham

    Full Text Available Bean consumption can reduce chronic disease risk and improve nutrition status. Consumer knowledge of bean health benefits could lead to increased intakes. Low-income women have poorer health and nutrition, but their level of knowledge about bean health benefits is unknown. Beans are a familiar food of reasonable cost in most settings and are cultural staples for Hispanics and other ethnicities. Study objectives were to assess awareness of bean health benefits among low-income women, and to evaluate any differences by acculturation status for Hispanic women in the Southwestern United States.A convenience sample of 406 primarily Mexican-origin (70% low-income women completed a survey on knowledge of bean health benefits and general food behaviors. Principal components analysis of responses identified two summary scale constructs representing "bean health benefits" and "food behaviors." Acculturation level was the main independent variable in chi-square or ANOVA.The survey completion rate was 86% (406/471. Most women agreed or strongly agreed that beans improved nutrition (65% and were satiating (62%. Over 50% answered 'neutral' to statements that beans could lower LDL cholesterol (52%, control blood glucose (56% or reduce cancer risk (56%, indicating indifference or possible lack of knowledge about bean health benefits. There were significant differences by acculturation for beliefs that beans aid weight loss and intestinal health. Scores on the bean health benefits scale, but not the food behavior scale, also differed by acculturation.Limited resource women have a favorable view of the nutrition value of beans, but the majority did not agree or disagreed with statements about bean health benefits. Greater efforts to educate low-income women about bean health benefits may increase consumption and improve nutrition.

  5. Virus-induced gene silencing in soybean and common bean.

    Science.gov (United States)

    Zhang, Chunquan; Whitham, Steven A; Hill, John H

    2013-01-01

    Plant viral vectors are useful for transient gene expression as well as for downregulation of gene expression via virus-induced gene silencing (VIGS). When used in reverse genetics approaches, VIGS offers a convenient way of transforming genomic information into knowledge of gene function. Efforts to develop and improve plant viral vectors have expanded their applications and have led to substantial advances needed to facilitate gene function studies in major row crops. Here, we describe a DNA-based Bean pod mottle virus (BPMV) vector system for both gene expression and VIGS in soybean and common bean.

  6. Locust bean gum: Exploring its potential for biopharmaceutical applications.

    Science.gov (United States)

    Dionísio, Marita; Grenha, Ana

    2012-07-01

    Polysaccharides have been finding, in the last decades, very interesting and useful applications in the biomedical and, specifically, in the biopharmaceutical field. Locust bean gum is a polysaccharide belonging to the group of galactomannans, being extracted from the seeds of the carob tree (Ceratonia siliqua). This polymer displays a number of appealing characteristics for biopharmaceutical applications, among which its high gelling capacity should be highlighted. In this review, we describe critical aspects of locust bean gum, contributing for its role in biopharmaceutical applications. Physicochemical properties, as well as strong and effective synergies with other biomaterials are described. The potential for in vivo biodegradation is explored and the specific biopharmaceutical applications are discussed.

  7. Differences in the Responses to Iron Deficiency Stress between Bean and Maize

    OpenAIRE

    米谷, 力; 森次, 益三; 河﨑, 利夫

    1995-01-01

    The responses to iron deficiency stress in bean and maize were compared. The susceptibility to iron deficiency stress was smaller in bean than in maize;i.e., the tolerance to iron deficiency was greater in bean than in maize. The roots of the bean plants exposed to iron deficiency stress, developed iron reducing capacity and medium-pH lowering capacity,but not the roots of maize. The iron reducing capacity and medium-pH lowering capacity of the bean roots were inhibited by a shadowing, detopp...

  8. Biofortified red mottled beans (Phaseolus vulgaris L. in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus and an in vitro digestion/Caco-2 model

    Directory of Open Access Journals (Sweden)

    Glahn Raymond P

    2011-10-01

    Full Text Available Abstract Background Our objective was to compare the capacities of biofortified and standard colored beans to deliver iron (Fe for hemoglobin synthesis. Two isolines of large-seeded, red mottled Andean beans (Phaseolus vulgaris L., one standard ("Low Fe" and the other biofortified ("High Fe" in Fe (49 and 71 μg Fe/g, respectively were used. This commercial class of red mottled beans is the preferred varietal type for most of the Caribbean and Eastern and Southern Africa where almost three quarters of a million hectares are grown. Therefore it is important to know the affect of biofortification of these beans on diets that simulate human feeding studies. Methods Maize-based diets containing the beans were formulated to meet the nutrient requirements for broiler except for Fe (Fe concentrations in the 2 diets were 42.9 ± 1.2 and 54.6 ± 0.9 mg/kg. One day old chicks (Gallus gallus were allocated to the experimental diets (n = 12. For 4 wk, hemoglobin, feed-consumption and body-weights were measured. Results Hemoglobin maintenance efficiencies (HME (means ± SEM were different between groups on days 14 and 21 of the experiment (P In-vitro analysis showed lower iron bioavailability in cells exposed to standard ("Low Fe" bean based diet. Conclusions We conclude that the in-vivo results support the in-vitro observations; biofortified colored beans contain more bioavailable-iron than standard colored beans. In addition, biofortified beans seems to be a promising vehicle for increasing intakes of bioavailable Fe in human populations that consume these beans as a dietary staple. This justifies further work on the large-seeded Andean beans which are the staple of a large-region of Africa where iron-deficiency anemia is a primary cause of infant death and poor health status.

  9. Pinto Beans (Phaseolus vulgaris L. as a Functional Food: Implications on Human Health

    Directory of Open Access Journals (Sweden)

    Vicki Schlegel

    2013-02-01

    Full Text Available Most foods are considered functional in terms of providing nutrients and energy to sustain daily life, but dietary systems that are capable of preventing or remediating a stressed or diseased state are classified as functional foods. Dry beans (Phaseolus vulgaris L. contain high levels of chemically diverse components (phenols, resistance starch, vitamins, fructooligosaccharides that have shown to protect against such conditions as oxidative stress, cardiovascular disease, diabetes, metabolic syndrome, and many types of cancer, thereby positioning this legume as an excellent functional food. Moreover, the United States has a rich dry bean history and is currently a top producer of dry beans in the world with pinto beans accounting for the vast majority. Despite these attributes, dry bean consumption in the US remains relatively low. Therefore, the objective of this manuscript is to review dry beans as an important US agricultural crop and as functional food for the present age with an emphasis on pinto beans.

  10. Physicochemical properties and antioxidant capacity of raw, roasted and puffed cacao beans.

    Science.gov (United States)

    Hu, SuJung; Kim, Byung-Yong; Baik, Moo-Yeol

    2016-03-01

    The antioxidant capacity and attributable bioactive compounds of puffed cacao beans were investigated. Roasting was carried out at 190°C for 15min and puffing was performed at 4-7kgf/cm(2). Cacao beans puffed at 4kgf/cm(2) showed the highest total polyphenols (23.16mgGAE/gsample) and total flavonoids (10.65mgCE/gsample) (pcacao beans reflected the total polyphenols and flavonoids measured. The quantities of theobromine, catechin, epicatechin, and procyanidin B2 were higher in cacao beans puffed at 4kgf/cm(2) than in roasted cacao beans. Puffed cacao beans received a good sensory score in flavor, but sourness increased as puffing pressure increased. Thus, these results suggest that, in cacao bean processing, puffing could be an alternative to roasting, which provide a rich taste and high antioxidant capacity.

  11. Utilization of half-embryo test to identify irradiated beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Mancini-Filho, Jorge [Sao Paulo Univ., SP (Brazil). Faculdade de Ciencias Farmaceuticas; Delincee, Henry [Federal Research Centre for Nutrition - BFE, Karlsruhe (Germany)

    1996-07-01

    Germination tests were carried out in irradiated and non-irradiated bean seeds which allow to observe characteristically variations on the shoots and roots. The methodology used in this work, is based upon biological changes which occur in two Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macacar, irradiated in a {sup 60} Co source, with doses of 0,0.5, 1.0, 2.5, 5.0 and 10.0 kGy. The shoots and roots were observed during 3 days of culturing period under specified conditions. The differences observed in these two varieties were analysed immediately after irradiation and after 6 months of storage period at room temperature. Irradiated half-embryos showed markedly reduced root grow and almost totally retarded shoot elongation. Differences between irradiated and nonirradiated half-embryo could be observed after irradiation when different beans and storage time were varied. The shoots of half-embryos irradiated with more than 2.5 kGy did not undergo any elongation, whereas, the shoots of non-irradiated or those beans irradiated under 1.0 kGy elongated significantly within the 3 day test period. (author)

  12. Weed Interference Affects Dry Bean Yield and Growth

    Directory of Open Access Journals (Sweden)

    Hossein GHAMARI

    2012-08-01

    Full Text Available Dry bean is one of the most important pulse crops in Iran. Field study was conducted in 2011 to evaluate effects of weed competition from a natural flora on growth and yield of dry bean (Phaseolus vulgaris L.. The treatments consisted of weed infestation and weed removal periods (10, 20, 30, 40 and 50 days after crop emergence. Control plots kept weed-infested and weed-free throughout growing season. To assess the weed competition effect on crop characteristics, Richards, Gompertz and logistic equations were fitted to the data. The most abundant weed species were Chenopodium album and Amaranthus retroflexus. Increase in duration of weed interference decreased the stem height of dry bean. At the end of the growing season, dry bean was 20 cm taller in season-long weed-free treatment compared to the season-long weed-infested treatment. As the number of days of weed interference increased, a declining trend of LAI and number of pods was observed. The minimum number of pods was obtained in season-long weed-infested treatment (5.01 pods/plant. Weed interference during the whole growing season, caused a 60% reduction in yield. Considering 5% and 10% acceptable yield lost, the critical period of weed competition was determined from 20 to 68 and 23 to 55 days after planting (DAE, respectively.

  13. Structural features of acelated galactomannans from green Coffea arabica Beans

    NARCIS (Netherlands)

    Oosterveld, A.; Coenen, G.J.; Vermeulen, N.C.B.; Voragen, A.G.J.; Schols, H.A.

    2004-01-01

    Polysaccharides were extracted from green Coffea arabica beans with water (90 °C, 1 h). Galactomannans were isolated from the water extract using preparative anion-exchange chromatography. Almost all of the galactomannans eluted in two neutral populations, while almost all of the arabinogalactans bo

  14. Microbiological safety of kinema: a fermented soya bean food.

    NARCIS (Netherlands)

    Nout, M.J.R.; Bakshi, D.; Sarkar, P.K.

    1998-01-01

    Kinema is a fermented soya bean food of Nepal and the hilly regions of Northeastern States of India. Generally, the fermentation is dominated by Bacillus spp. that often cause alkalinity and desirable stickiness in the product. The present study was undertaken in a limited number of commercial (mark

  15. Studies on interference between newly defined bean-infecting potyviruses.

    NARCIS (Netherlands)

    Khan, J.A.

    1993-01-01

    Bean common mosaic virus (BCMV) and blackeye cowpea mosaic virus (BICMV) belonging to the genus Potyvirus of the plant virus family Potyviridae (Barnett, 1991, 1992) are of great economic importance. A large number of strains of BCMV and BlCMV are found to occur in nature, either in single or in mix

  16. Allelopathic potential of a noxious weed on mung bean

    Directory of Open Access Journals (Sweden)

    Parthapratim Maiti

    2013-10-01

    Full Text Available Eupatorium odoratum have invaded the waste lands of South West Bengal, India. A field study indicated a gradual and also significant increase in Eupatorium odoratum accompanied with significant decrease in other coexisting species. Considering the above in mind, a study was undertaken to evaluate the existence of inhibitory effect of leaf extracts and leaf leachates noxious weed Eupatorium odoratum using fully viable seeds of mung bean (Vigna radiata as the bioassay material. The study showed the reduced the percentage germination and TTC stainability along with extended T50 values of mung bean seeds. The levels of protein, DNA and RNA, activities of dehydrogenase and catalase enzymes were significantly retarded in pretreated seed samples. Amino acid and sugar levels were increased in the leachates of seeds pretreated with leaf extracts and leaf leachates. Thus, from the overall results it can be concluded that various inhibitors present in E. odoratum can impart strong inhibitory effect on mung bean. The study suggests that the leaves of E. odoratum possess phytotoxic or allelopathic chemicals which potentially rendered the inhibitory action on mung bean seeds.

  17. Detection of radiation treatment of beans using DNA comet assay

    Science.gov (United States)

    Khan, Ashfaq A.; Khan, Hasan M.; Delincée, Henry

    2002-03-01

    A simple technique of microgel electrophoresis of single cells (DNA Comet Assay) enabled a quick detection of radiation treatment of several kinds of leguminous beans (azuki, black, black eye, mung, pinto, red kidney and white beans). Each variety was exposed to radiation doses of 0.5, 1 and 5kGy covering the permissible limits for insect disinfestation. The cells or nuclei from beans were extracted in cold PBS, embedded in agarose on microscope slides, lysed between 15 and 60min in 2.5% SDS and electrophoresis was carried out at a voltage of 2V/cm for 2-2.5min. After silver staining, the slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA stretched towards the anode and the damaged cells appeared as a comet. The density of DNA in the tails increased with increasing radiation dose. However, in non-irradiated samples, the large molecules of DNA remained relatively intact and there was only minor or no migration of DNA; the cells were round or had very short tails only. Hence, the DNA comet assay provides an inexpensive, rapid and relatively simple screening method for the detection of irradiated beans.

  18. Performance Evaluation of Rotating Cylinder Type Coffee Bean Roaster

    Directory of Open Access Journals (Sweden)

    Sutarsi

    2010-04-01

    Full Text Available One strategy attempts to reduce dependence on primary commodity markets are overseas market expansion and development of secondary products. In the secondary product processing coffee beans is required of supporting equipment to facilitate these efforts. Research Center for Indonesian Coffee and Cocoa has developed coffee bean roaster. However, there are still many people who do not know about the technical aspects of roaster machine type of rotating cylinder so that more people use traditional ways to roast coffee beans. In order for the benefits of this machine is better known society it is necessary to study on the technical aspects. The purpose of this research is to evaluate the technical performance of the coffee beans roaster machine type of rotating cylinder. These include the technical aspects of work capacity of the machine, roasting technical efficiency, fuel requirements, and power requirements of using roaster machine. Research methods are including data collection, calculation and analysis. The results showed that the roaster machine type of a rotating cylinder has capacity of 12.3 kg/hour. Roasting efficiency is 80%. Fuel consumption is 0.6 kg. The calculated amount of the used power of current measurement is the average of 0.616 kW.

  19. A Nomadic Subtelomeric Disease Resistance Gene Cluster in Common Bean

    Science.gov (United States)

    The B4 resistance (R)-gene cluster, located in subtelomeric region of chromosome 4, is one of the largest clusters known in common bean (Phaseolus vulgaris, Pv). We sequenced 650 kb spanning this locus and annotated 97 genes, 26 of which correspond to Coiled-coil-Nucleotide-Binding-Site-Leucine-Rich...

  20. Texturized pinto bean protein fortification in straight dough bread formulation

    Science.gov (United States)

    Pinto beans were milled and then air-classified to obtain a raw high protein fraction (RHPF) followed by extrusion to texturize the protein fraction. The texturized high protein fraction (THPF) was then milled to obtain flour, and combined with wheat flour at 5%, 10%, and 15% levels to make bread. A...

  1. The cholesterol-raising factor from coffee beans.

    NARCIS (Netherlands)

    Urgert, R.; Katan, M.B.

    1996-01-01

    Coffee beans and some types of coffee brew - not the regular types of coffee prepared with a paper filter or with soluble coffee granules - contain the diterpenes cafestol and kahweol. Cafestol and kahweol raise the serum concentration of cholesterol and triglycerides in humans, and they also appear

  2. Evaluation of some bean lines tolerance to alkaline soil

    Directory of Open Access Journals (Sweden)

    Abeer A. Radi

    2012-01-01

    Full Text Available Introduction: In less arid climates, salts are less concentrated and sodium dominates in carbonate and bicarbonate forms, which enhance the formation of alkaline soils. The development and identification of salt-tolerant crop cultivars or lines would complement salt management programs to improve the productivity and yields of salt stressed plants.Materials and methods: This work was to study the evaluation of alkalinity tolerance of some bean lines grown under different levels of sodium carbonate (Na2CO3 to select the most alkalinity tolerant lines versus the most-sensitive ones out of 6 lines of the test plants.Results: The symptoms induced by alkalinity included reduction in root, shoot growth, and leaf area which were more severe in some bean lines. Potassium leakage was severely affected by alkalinity in some lines at all tested levels, while in some others a moderate damage was manifested only at the higher levels. The increase in Na2CO3 level was associated with a gradual fall in chlorophyll a and b biosynthesis of all the test bean lines. However, alkalinity at low and moderate levels had a favorable effect on the biosynthesis of carotenoids in all the test bean lines. The increase in Na2CO3 supply had a considerable stimulatory effect on sodium accumulation, while potassium accumulation fluctuated in organs of bean lines.Conclusion: Assiut 1104 out of all the different lines investigated was found to display the lowest sensitivity to alkalinity stress, while Assiut 12/104 was the most sensitive one.

  3. AGRICULTURAL PRACTICES, MORPHOLOGIC, PROTEINIC AND CULINARY DESCRIPTION OF THE GRAIN OF BEAN CULTIVARS SOWED IN THE REGION OF TLATZALA, GUERRERO

    Directory of Open Access Journals (Sweden)

    Fausto Solano Cervantes

    2009-08-01

    Full Text Available The research had for object describe the productive process of the of bean culture in the community of Tlatzala, Guerrero and the species diversity by means of the morphologic characteristics of the grain, protein content and the culinary quality. 30 questionnaires were applied to bean producers and 20 varieties of bean were collected from which the morphologic characters of the grain, protein content and the culinary characters were obtained. The production cycle of bean initiates in May and finishes in October. The technology used is traditional, characterized by the use of the yoke in the labors of the culture that demands workforce to realize the activities of manual form. The biological cycle of the varieties begins in June, the variation at time is determinated for the cultivated genotype. The determinate or indeterminate bush beans are predominant (65 %. The sowing systems are intercalated (50 % and associated with maize (30 % and monoculture (20 %. The varieties Rojito and Blanco have special uses, the first one has the attribute of being consumed as green-bean all the year around and the second one is used to prepare the dish called Chile-ajo. The Black beans were the most frequent (45 % followed by the Red beans (35 % and the least frequent were the Striped one (5 % and Muddy-like (5 %. The kidney shape of grain was the most abundant (85 % and the oval one was the least frequent (5 %. The grain weight changed from 14.4 up to 38.5 g. The sizes of grains founded were medium (50 % and small (50 %. The protein content registered was: White beans 24.68 %, Red bean 24.64 %, Black beans 23.5 % and Striped beans of guide 22.27 %. The Rojito Enano had the major protein content (27.6 %. The cooking times were: Red beans 73 minutes, Striped of guide bean 65.5, Blacks bean 64.6 and Whites bean 59. The Black bean Enano-1 used less time (54 minutes. The Striped of guide bean registered the major amount of solid (0.32 %, followed by the Black beans

  4. Glycemic index of split peas, rice (Binam, kidney beans, green peas, "Lavash" bread and broad bean kernels in NIDDM subjects

    Directory of Open Access Journals (Sweden)

    Darabi A

    2000-09-01

    Full Text Available Equal amounts of carbohydrates from various foodstuffs do not increase blood glucose to the same extent. This study was carried out, therefore, in 1996 at the National Nutrition and Food Technology Research institute in Tehran to determine the glycemic index of split pease, rice (Binam, kidney beans, green peas, “Lavash” bread and broad bean kernels. Diabetic subjects were studied in a clinical trial. The exact amount of cabohydrate in foodstuffs was determined using AOAC. Methods. White bread was used as the reference food. After a 12-hour overnight fast on seven separate days each subject was given the test food in an amount to provide 25 g of carbohydrate. Blood glucose was determined after 0, 60, 120 minutes using orthotouidine method. Glycemi response in each individual was calculated as the area under the 2- hour glucose individual was calculated as the area under the test food glucose curve as a percentage of the mean area under the whith bread glucose curve. Glycemic indices of the test foods were 31± 8.5 for split peas, 42.9±3 for rice, 44±9 for kidney beans, 57±7 for green peas, 69±8.5 for “Lavash” bread, and 96±14 for broad bean kernels .Legumes and rice (Binam can be used efficiently in meal planning for the diabetic subjects.

  5. Beans, Boats and Archaeobotany : A New Translation of Phasolus, or why the Romans ate neither Kidney beans nor Cow peas

    NARCIS (Netherlands)

    Heinrich, Frits; Wilkins, D.A.

    2014-01-01

    Among classicists, archaeobotanists and agricultural historians, the meaning of the word phasolus (ϕασηλος in Greek) is ambiguous. While Latin scholars have agreed that the word refers to a type of pulse or bean, there are various interpretations and subsequent identifications as to which botanical

  6. Export and Competitiveness of Indonesian Coffee Bean in International Market: Strategic Implication for the Development of Organic Coffee Bean

    Directory of Open Access Journals (Sweden)

    Bambang Drajat

    2007-07-01

    Full Text Available The performance of Indonesian coffee bean export from 1995 to 2004was not satisfactory. This implied that there were problems of the competitiveness of Indonesian coffee bean export. This study was expected to come up withsome views related with the problem. This study was aimed to analyze the competitiveness of Indonesian coffee bean export in international markets. Somepolicy implication would be derived following the conclusions. In addition,this study was aimed to deliver some arguments referring to organic coffee development as an alternative export development. Data used in this study wastime series data ranging from 1995 to 2004 supported with some primary data.The export data were analyzed descriptively and the Revealed ComparativeAdvantage (RCA Index employed to analyze the competitiveness of Indonesian coffee bean export. The results of the analysis gave some conclusions, asfollows : (1 The export of Indonesian coffee bean was product oriented notmarket oriented. (2 The Indonesian coffee bean export was characterized withlow quality with no premium price, different from that of Vietnam coffee export. (3 Besides quality, the uncompetitive Indonesian coffee export was related to market hegemony by buyers, emerging issue of Ochratoxin A. contamination and high cost economy in export. (4 The competitiveness of Indonesian coffee export was lower than those other countries, such as Columbia,Honduras, Peru, Brazil, and Vietnam. (5 Indonesia still held opportunity todevelop organic coffee for export. Some policy implications emerged from thediscussion were as follows : (1 The Government should facilitate market development through the provisions of market information and export incentives.(2 The Government should develop and applied national standard of coffeebean referring to that of international, as well as, improve processing technology equipments in the farm level for both wet and dry process. (3 Besides improving quality, the improvement

  7. Agronomic performance of naked oat (Avena nuda L. and faba bean intercropping

    Directory of Open Access Journals (Sweden)

    Agnieszka Klimek-Kopyra

    2015-06-01

    Full Text Available The most common cereals for faba bean (Vicia faba L. used in intercrops is conventional oat (Avena sativa L. An alternative to oat may be naked oat (Avena nuda L., whose oil content and quality is double. Here, intercropping of naked oat with two different faba bean cultivars (determinate-high tannin and indeterminate-low tannin was compared with sole crops of each species in 2006-2008. The treatments were: sole naked oat at 500 kernels m², indeterminate sole faba bean at 50 seeds m², determinate sole faba bean at 70 seeds m², and an additive series of 25%, 50%, and 75% of faba bean seeding rate mixed with the naked oat seeding rate. Our results demonstrated that intercropping increased the Land Equivalent Ratio by +3% to +9% over sole cropping. Raising the faba bean seeding rate in a mixture from 25% to 75% reduced oat grain yield from 630 (determinate cultivar to 760 kg ha-1 (indeterminate cultivar but increased faba bean grain yield from 760 kg ha-1. Higher yield and leaf area index (LAI and photosynthetically active radiation (PAR values show that the indeterminate cultivar of faba bean is more suitable in mixture with naked oat. The high value of competition index (CR > 1 indicates domination and aggressiveness of faba bean towards naked oat. Regardless of cultivar type, mixture of faba bean with naked oat is less productive than pure sowing.

  8. Phenotypic Variability and Diversity Analysis of Bean Traits of Some Cocoa Hybrids in Nigeria

    Directory of Open Access Journals (Sweden)

    A.V. Oyedokun

    2011-03-01

    Full Text Available It is essential to understand the economic potential and superiority among cocoa hybrids. Therefore, the present study aims at detecting variability among cocoa hybrids for bean index in Nigeria. Dried bean of fourteen genotypes of cocoa were evaluated for their bean values. Analysis of variance (ANOVA was used to understand the variability among the fourteen genotypes and Principal Component Analysis (PCA was employed to identify distinguishing traits and the grouping of the genotypes based on similarities. The fourteen cocoa genotypes were significantly (p≤0.05 different from each other with respect to weight of one bean, bean length, width, thickness, 100 bean weight, bean length to width, length to thickness and width to thickness ratio. All the studied morphometric characters exhibited high (>70% broad sense heritability. G8, the hybrid between T53/5 and N38 was the most superior genotype for bean weight and some other bean characteristics. The mass of seventy-four dried cocoa bean of G8 approximated 100 g. The first three Principal Component axes explained 91% of the total variation and the PCA grouped the fourteen genotypes into four distinct clusters. Genotypes could be selected for specific traits and improvement of traits seemed to be genetically reliable.

  9. High-throughput metabolic profiling of diverse green Coffea arabica beans identified tryptophan as a universal discrimination factor for immature beans.

    Directory of Open Access Journals (Sweden)

    Daiki Setoyama

    Full Text Available The maturity of green coffee beans is the most influential determinant of the quality and flavor of the resultant coffee beverage. However, the chemical compounds that can be used to discriminate the maturity of the beans remain uncharacterized. We herein analyzed four distinct stages of maturity (immature, semi-mature, mature and overripe of nine different varieties of green Coffea arabica beans hand-harvested from a single experimental field in Hawaii. After developing a high-throughput experimental system for sample preparation and liquid chromatography-mass spectrometry (LC-MS measurement, we applied metabolic profiling, integrated with chemometric techniques, to explore the relationship between the metabolome and maturity of the sample in a non-biased way. For the multivariate statistical analyses, a partial least square (PLS regression model was successfully created, which allowed us to accurately predict the maturity of the beans based on the metabolomic information. As a result, tryptophan was identified to be the best contributor to the regression model; the relative MS intensity of tryptophan was higher in immature beans than in those after the semi-mature stages in all arabica varieties investigated, demonstrating a universal discrimination factor for diverse arabica beans. Therefore, typtophan, either alone or together with other metabolites, may be utilized for traders as an assessment standard when purchasing qualified trading green arabica bean products. Furthermore, our results suggest that the tryptophan metabolism may be tightly linked to the development of coffee cherries and/or beans.

  10. Two Newly Described Begomoviruses of Macroptilium lathyroides and Common Bean.

    Science.gov (United States)

    Idris, A M; Hiebert, E; Bird, J; Brown, J K

    2003-07-01

    ABSTRACT Macroptilium lathyroides, a perennial weed in the Caribbean region and Central America, is a host of Macroptilium yellow mosaic Florida virus (MaYMFV) and Macroptilium mosaic Puerto Rico virus (MaMPRV). The genomes of MaYMFV and MaMPRV were cloned from M. lathyroides and/or field-infected bean and the DNA sequences were determined. Cloned A and B components for both viruses were infectious when inoculated to M. lathyroides and common bean. Comparison of the DNA sequences for cloned A and B components with well-studied begomovirus indicated that MaMPRV (bean and M. lathyroides) and MaYMFV (M. lathyroides) are unique, previously undescribed begomo-viruses from the Western Hemisphere. Phylogenetic analysis of viral A components indicated that the closest relative of MaYMFV are members of the Bean golden yellow mosaic virus (BGYMV) group, at 76 to 78% nucleotide identity, whereas the closest relative for the A component of MaMPRV was Rhynchosia golden mosaic virus at 78% nucleotide identity. In contrast, BGYMV is the closest relative for the B component of both MaYMFV and MaMPRV, with which they share approximately 68.0 and approximately 72% identity, respectively. The incongruent taxonomic placement for the bipartite components for MaMPRV indicates that they did not evolve entirely along a common path. MaYMFV and MaMPRV caused distinctive symptoms in bean and M. lathyroides and were transmissible by the whitefly vector and by grafting; however, only MaYMFV was mechanically transmissible. The experimental host range for the two viruses was similar and included species within the families Fabaceae and Malvaceae, but only MaYMFV infected Malva parviflora and soybean. These results collectively indicate that MaMPRV and MaYMFV are new, previously undescribed species of the BGYMV group, a clade previously known to contain only strains and isolates of BGYMV from the Caribbean region that infect Phaseolus spp. Both MaYMFV and MaMPRV may pose an economic threat to

  11. Developing a prebiotic yogurt enriched by red bean powder: Microbiological, physi-cochemical and sensory aspect

    Science.gov (United States)

    Setiyoningrum, Fitri; Priadi, Gunawan; Afiati, Fifi

    2017-01-01

    Red bean is widely known as a prebiotic, but addition of it into yogurt is rare. The aim of this study was to evaluate the effect of red bean powder addition on microbiological, physicochemical, and sensory of yogurt. Skim milk also added into yogurt formula to optimize the quality of yogurt. The treatment of concentrations, either red bean and skim milk, did not effect on the viability of lactic acid bacteria of yogurt (8.35 - 9.03 log cfu/ml) and the crude fiber content (0.04 - 0.08%). The increasing of red bean concentration induced the increase of protein content significantly. The increasing of level concentration, either red bean or skim milk, induced the increasing of carbohydrate content. Opposite phenomenon was occurred on the moisture content. Based on the sensory test result, the addition of 3% of skim milk and 2%of red bean into yogurt still accepted by panelist.

  12. Distinction of Ecuadorian varieties of fermented cocoa beans using Raman spectroscopy.

    Science.gov (United States)

    Vargas Jentzsch, Paul; Ciobotă, Valerian; Salinas, Wilson; Kampe, Bernd; Aponte, Pedro M; Rösch, Petra; Popp, Jürgen; Ramos, Luis A

    2016-11-15

    Cocoa (Theobroma cacao) is a crop of economic importance. In Ecuador, there are two predominant cocoa varieties: National and CCN-51. The National variety is the most demanded, since its cocoa beans are used to produce the finest chocolates. Raman measurements of fermented, dried and unpeeled cocoa beans were performed using a handheld spectrometer. Samples of the National and CCN-51 varieties were collected from different provinces and studied in this work. For each sample, 25 cocoa beans were considered and each bean was measured at 4 different spots. The most important Raman features of the spectra were assigned and discussed. The spectroscopic data were processed using chemometrics, resulting in a distinction of varieties with 91.8% of total accuracy. Differences in the average Raman spectra of cocoa beans from different sites but within the same variety can be attributed to environmental factors affecting the cocoa beans during the fermentation and drying processes.

  13. Study on Drying Edible Soya-bean Oil Using Solar Energy

    Institute of Scientific and Technical Information of China (English)

    LIU Shengyong; LIU Peng; SHEN Xiaozhen; XU Guizhuan; SU Chaojie; CAI Xianjie

    2010-01-01

    Soya-bean oil(bean dregs)was dried in a solar energy drying system.Characteristics of the process were measured and the corresponding curves were done.The practicability of this process has been discussed.The results showed that the solar drying system could completely meet technological requirements of drying soy-bean oil,and it was feasible in technology to use the solar drying system to dry the vegetable oil.

  14. CULTIVAR RELEASE-IAC-Galante and IAC-Centauro: special common bean types

    Directory of Open Access Journals (Sweden)

    Sérgio Augusto Morais Carbonell

    2008-01-01

    Full Text Available Common bean types with pinkish and light brown teguments were predominant in Brazil before 1970, until therelease of the Carioca common bean. To avoid that these common bean types sink into oblivion, the Instituto AgronômicoCampinas applied for the registration of two cultivars by the MAPA/RNC: IAC-Galante (pinkish and IAC-Centauro (lightbrown, with high yield and resistance to anthracnose and common mosaic.

  15. The Effect of Cocoa Beans Heavy and Trace Elements on Safety and Stability of Confectionery Products

    Directory of Open Access Journals (Sweden)

    Vītola Vineta

    2016-06-01

    Full Text Available The aim of the study was to evaluate cocoa beans quality produced in Cameroon, Ecuador, Nigeria and Ghana from safety position determining heavy and trace metals concentration and evaluating the oxidative stability of confectionery products prototypes (trials with analysing cocoa beans. For evaluation of oxidative stability of confectionery products, the main ingredients - butter and cocoa beans kernels were tested making trials as milk chocolate prototype.

  16. Performance of Rotary Cutter Type Breaking Machine for Breakingand Deshelling Cocoa Roasted Beans

    OpenAIRE

    2005-01-01

    Conversion of cocoa beans to chocolate product is, therefore, one of the promising alternatives to increase the value added of dried cocoa beans. On the other hand, the development of chocolate industry requires an appropriate technology that is not available yet for small or medium scale of business. Breaking and deshelling cocoa roasted beans is one important steps in cocoa processing to ascertain good chocolate quality. The aim of this research is to study performance of rotary cutter type...

  17. An effective virus-based gene silencing method for functional genomics studies in common bean

    Directory of Open Access Journals (Sweden)

    Kachroo Aardra

    2011-06-01

    Full Text Available Abstract Background Common bean (Phaseolus vulgaris L. is a crop of economic and nutritious importance in many parts of the world. The lack of genomic resources have impeded the advancement of common bean genomics and thereby crop improvement. Although concerted efforts from the "Phaseomics" consortium have resulted in the development of several genomic resources, functional studies have continued to lag due to the recalcitrance of this crop for genetic transformation. Results Here we describe the use of a bean pod mottle virus (BPMV-based vector for silencing of endogenous genes in common bean as well as for protein expression. This BPMV-based vector was originally developed for use in soybean. It has been successfully employed for both protein expression and gene silencing in this species. We tested this vector for applications in common bean by targeting common bean genes encoding nodulin 22 and stearoyl-acyl carrier protein desaturase for silencing. Our results indicate that the BPMV vector can indeed be employed for reverse genetics studies of diverse biological processes in common bean. We also used the BPMV-based vector for expressing the green fluorescent protein (GFP in common bean and demonstrate stable GFP expression in all common bean tissues where BPMV was detected. Conclusions The availability of this vector is an important advance for the common bean research community not only because it provides a rapid means for functional studies in common bean, but also because it does so without generating genetically modified plants. Here we describe the detailed methodology and provide essential guidelines for the use of this vector for both gene silencing and protein expression in common bean. The entire VIGS procedure can be completed in 4-5 weeks.

  18. BEANS - a software package for distributed Big Data analysis

    CERN Document Server

    Hypki, Arkadiusz

    2016-01-01

    BEANS software is a web based, easy to install and maintain, new tool to store and analyse data in a distributed way for a massive amount of data. It provides a clear interface for querying, filtering, aggregating, and plotting data from an arbitrary number of datasets. Its main purpose is to simplify the process of storing, examining and finding new relations in the so-called Big Data. Creation of BEANS software is an answer to the growing needs of the astronomical community to have a versatile tool to store, analyse and compare the complex astrophysical numerical simulations with observations (e.g. simulations of the Galaxy or star clusters with the Gaia archive). However, this software was built in a general form and it is ready to use in any other research field or open source software.

  19. Italian Common Bean Landraces: History, Genetic Diversity and Seed Quality

    Directory of Open Access Journals (Sweden)

    Angela R. Piergiovanni

    2010-05-01

    Full Text Available The long tradition of common bean cultivation in Italy has allowed the evolution of many landraces adapted to restricted areas. Nowadays, in response to market demands, old landraces are gradually being replaced by improved cultivars. However, landraces still survive in marginal areas of several Italian regions. Most of them appear severely endangered with risk of extinction due to the advanced age of the farmers and the socio-cultural context where they are cultivated. The present contribution is an overview of the state of the art about the knowledge of Italian common bean germplasm, describing the most important and recent progresses made in its characterization, including genetic diversity and nutritional aspects.

  20. Locust bean gum: Exploring its potential for biopharmaceutical applications

    Directory of Open Access Journals (Sweden)

    Marita Dionísio

    2012-01-01

    Full Text Available Polysaccharides have been finding, in the last decades, very interesting and useful applications in the biomedical and, specifically, in the biopharmaceutical field. Locust bean gum is a polysaccharide belonging to the group of galactomannans, being extracted from the seeds of the carob tree (Ceratonia siliqua. This polymer displays a number of appealing characteristics for biopharmaceutical applications, among which its high gelling capacity should be highlighted. In this review, we describe critical aspects of locust bean gum, contributing for its role in biopharmaceutical applications. Physicochemical properties, as well as strong and effective synergies with other biomaterials are described. The potential for in vivo biodegradation is explored and the specific biopharmaceutical applications are discussed.

  1. Trichoderma spp. decrease Fusarium root rot in common bean

    Directory of Open Access Journals (Sweden)

    Hudson Teixeira

    2012-12-01

    Full Text Available The effectiveness of six Trichoderma-based commercial products (TCP in controlling Fusarium root rot (FRR in common bean was assessed under field conditions. Three TCP, used for seed treatment or applied in the furrow, increased seedling emergence as much as the fungicide fludioxonil. FRR incidence was not affected, but all TCP and fludioxonil reduced the disease severity, compared to control. Application of Trichoderma-based products was as effective as that of fludioxonil in FRR management.

  2. Efficacy of Locust Beans Husk Char in Heavy Metal Sequestration

    OpenAIRE

    Ademola Ayodeji Ajayi-Banji; Temitayo Ewemoje; Adeniyi Ajimo

    2016-01-01

    Most solid waste management schemes minimally consider low concentration biodegradable agricultural waste management, though the environmental impact of this waste category is significant over a time frame. The column-mode study seeks to address the issue by suggesting potential utilisation of post-harvest waste for heavy metal sequestering. Locust beans husk char of 100 and 200 g was employed to inspect removal efficiency, isotherm and kinetic models of some heavy metals at 30, 60, 90, 120 a...

  3. Nodule senescence and biomass components in common bean cultivars

    OpenAIRE

    Fabián Fernández Luqueño; David Espinosa Victoria; Antonio Munive; Langen Corlay Chee; Luis M. Serrano Covarrubias

    2008-01-01

    Most legumes establish mutualistic symbiotic relationships with atmospheric nitrogen-fixing bacteria (rhizobia), giving origin to nodules. Nodules exhibit natural or induced aging which coincides with the drop in nitrogenase activity at the flowering period or at the pod filling stage. In this research, the onset of nodule senescence (NS) was evaluated under greenhouse conditions in five common bean (Phaseolus vulgaris L.) cultivars of two growth habits, determined (Type I) and indeterminate ...

  4. 力争第二的Coffee Bean

    Institute of Scientific and Technical Information of China (English)

    蔡正蓁

    2003-01-01

    一个小雨的午后,在新加坡繁华的Orchard大街上的连锁咖啡店“Coffee Bean & Tea Leaf”里,维克多·沙宣从他的座位上一跃而起,脱口而出:“下雨了,我得把屋顶打开。”短短几秒钟之内,在天井上方。

  5. A better bean. Reports from the field -- Latin America.

    Science.gov (United States)

    Powell, D

    1997-01-01

    Researchers from the Colegio de Postgraduados, in partnership with the University of Guelph in Canada, have used horizontal resistance breeding, without the aid of pesticides, to more than triple the yield of locally grown black beans. J.E. Vanderplank, a South African plant pathologist, coined the terms "vertical" and "horizontal" for the types of crop plant resistance in 1963. The former involves a single gene and breaks down when new pathogens appear; the latter involves several genes and is a more durable form of resistance to disease or to insects. Enhancing vertical resistance, which is based on classical Mendelian breeding techniques, requires crossing a wild plant that possesses the desired gene with a cultivar to create a hybrid; the hybrid offspring are then backcrossed with the cultivar parent for several generations until a hybrid is created that is identical to the cultivar, except for the wild parent's resistance gene. In horizontal resistance breeding, the best individuals from each generation are selected and bred with each other. According to Raoul Robinson, a Canadian crop scientist and member of the plant breeding team supported by IDRC, breeding to enhance vertical resistance, or under the protection of insecticides and fungicides, has caused the level of horizontal resistance to decline and plant susceptibility to parasites to increase. Dr. Robinson and Dr. Roberto Garcia Espinosa (the Mexican project manager) began their work using horizontal resistance breeding in black beans in 1991. Yields of 1500 kg/hectare were achieved in two breeding cycles (two years) without the use of pesticides. The average bean yield in the Mixteca region of Mexico is 400 kg/hectare with the use of pesticides. The 200,000 small farmers in the area cultivate over 300,000 hectares, 40,000 of which are beans. The breeding techniques used in this project can be applied to other crops and in other countries.

  6. Morphology and viability of castor bean genotypes pollen grains

    OpenAIRE

    Maria Selma Alves Silva Diamantino; Maria Angélica Pereira de Carvalho Costa; Taliane Leila Soares; Daniel Vieira Morais; Simone Alves Silva; Everton Hilo Souza

    2016-01-01

    The objective of this work was to characterize the morphology and viability of the pollen of 15 genotypes of castor bean (Ricinus communis L.) and to generate information that can assist in the selection of highly promising male parents for future use in genetic improvement programs aimed at producing seeds for oil extraction. Acetolysis and scanning electron microscopy was used to characterize the morphology of the pollen. The viability of the pollen grains was estimated by in vitro germinat...

  7. Morphology and viability of castor bean genotypes pollen grains

    OpenAIRE

    Diamantino,Maria Selma Alves Silva; Costa,Maria Angélica Pereira de Carvalho; Soares,Taliane Leila; Morais,Daniel Vieira; Silva,Simone Alves; Souza,Everton Hilo de

    2016-01-01

    ABSTRACT. The objective of this work was to characterize the morphology and viability of the pollen of 15 genotypes of castor bean (Ricinus communis L.) and to generate information that can assist in the selection of highly promising male parents for future use in genetic improvement programs aimed at producing seeds for oil extraction. Acetolysis and scanning electron microscopy was used to characterize the morphology of the pollen. The viability of the pollen grains was estimated by in vitr...

  8. Mung bean decreases plasma cholesterol by up-regulation of CYP7A1.

    Science.gov (United States)

    Yao, Yang; Hao, Liu; Shi, Zhenxing; Wang, Lixia; Cheng, Xuzhen; Wang, Suhua; Ren, Guixing

    2014-06-01

    Our results affirmed that supplementation of 1 or 2% mung bean could decrease plasma total cholesterol and triacylglycerol level. Mung bean increased mRNA 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase. Most importantly, mung bean increased not only the protein level of cholesterol-7α-hydroxylase (CYP7A1) but also mRNA CYP7A1. It was concluded that the hypocholesterolemic activity of mung bean was most probable mediated by enhancement of bile acid excretion and up-regulation of CYP7A1.

  9. Navy Bean Flour Particle Size and Protein Content Affect Cake Baking and Batter Quality(1).

    Science.gov (United States)

    Singh, Mukti; Byars, Jeffrey A; Liu, Sean X

    2015-06-01

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to 3 levels with navy bean starch. The effect of navy bean flour and its fractions at 3 levels of protein on cake batter rheology and cake quality was studied and compared with wheat flour samples. Batters prepared from navy bean flour and its fractions had higher viscosity than the cake flour. Reducing the protein content by addition of starch significantly lowered the viscosity of cake batters. The whole navy bean flour and coarse bean fraction cakes were softer than cakes made with wheat flour but had reduced springiness. Principal component analysis showed a clear discrimination of cakes according to protein. It also showed that low protein navy bean flour cakes were similar to wheat flour cakes. Navy bean flour with protein content adjusted to the level of cake (wheat) flour has potential as a healthy alternative in gluten-free cakes.

  10. Development and reproduction of Bemisia tabaci (Homoptera: Aleyrodidae) on three bean species

    Institute of Scientific and Technical Information of China (English)

    PETERD.MUSA; SHUN-XIANGREN

    2005-01-01

    The development, survivorship and reproduction of Bemisia tabaci B-biotype on three bean species were studied at 26 ± 1 ℃ in the laboratory. The developmental periods from egg to adult varied from 27.80 days on garden beans to 18.20 days on soybeans. The survivorship from egg to adult on soybeans, cowpeas and garden beans was 77.14, 70.14 and 64.28%, respectively. The average longevity of female adults ranged from 12.30 days on soybeans to 9.80 days on garden beans, and the oviposition of B. tabaci varied from 160.85 eggs on soybeans to 98.00 eggs on garden beans. Life table parameters were calculated as biological attributes for Bemisia tabaci populations fed on three bean species. The results indicated that the intrinsic rate of increase (rm), the finite rate of increase ( λ ) and net reproductive rate (R0) were high for populations fed on soybeans, with values of 0.1857,1.2041 and 82.1576, respectively. The corresponding values were less for populations fed on garden beans, with values of 0.1097, 1.1159 and 31.2661, respectively. The parametric values for cowpeas were intermediate between soybeans and garden beans but no significant difference were observed for the rm values for soybeans and cowpeas. Experimental evidence in our investigation indicated that Bemisia tabaci is best adapted and shows the greatest preference for soybean of the three bean species tested in this study.

  11. 1H NMR study of fermented cocoa (Theobroma cacao L.) beans.

    Science.gov (United States)

    Caligiani, Augusta; Acquotti, Domenico; Cirlini, Martina; Palla, Gerardo

    2010-12-08

    This study reports for the first time the metabolic profile of cocoa (Theobroma cacao L.) beans using the (1)H NMR technique applied to polar extracts of fermented cocoa beans. The simultaneous detection and quantification of amino acids, polyalcohols, organic acids, sugars, methylxanthines, catechins, and phenols were obtained by assigning the major signals of the spectra for different varieties of cocoa beans (Forastero, Criollo, and Trinitario) from different countries (Ecuador, Ghana, Grenada, and Trinidad). The data set obtained, representative of all classes of soluble compounds of cocoa, was useful to characterize the fermented cocoa beans as a function of the variety and geographic origin.

  12. COMPETITIVE ABILITY OF MAIZE IN MIXTURE WITH CLIMBING BEAN IN ORGANIC FARMING

    OpenAIRE

    Bavec, Franc; Živec, Urška; Grobelnik Mlakar, Silva; Bavec , Martina; Radics , Laszlo

    2005-01-01

    Intercropped crops represent an important production system in organic farming, especially maize/climbing bean mixture due to its high content of protein in bean seeds for human diet, and producing silage for ruminants. To test this hypothesis, the effects of maize (Zea mays L.) sown as a sole crop and maize/climbing bean (Phaseolus vulgaris L. cv. Cipro) mixtures on maize plant height, maize leaf area index, bean leaf area index and grain yield were investigated in field experiments on an o...

  13. Impact of Molecular Technologies on Faba Bean (Vicia faba L. Breeding Strategies

    Directory of Open Access Journals (Sweden)

    Tao Yang

    2012-07-01

    Full Text Available Faba bean (Vicia faba L. is a major food and feed legume because of the high nutritional value of its seeds. The main objectives of faba bean breeding are to improve yield, disease resistance, abiotic stress tolerance, seed quality and other agronomic traits. The partial cross-pollinated nature of faba bean introduces both challenges and opportunities for population development and breeding. Breeding methods that are applicable to self-pollinated crops or open-pollinated crops are not highly suitable for faba bean. However, traditional breeding methods such as recurrent mass selection have been established in faba bean and used successfully in breeding for resistance to diseases. Molecular breeding strategies that integrate the latest innovations in genetics and genomics with traditional breeding strategies have many potential applications for future faba bean cultivar development. Hence, considerable efforts have been undertaken in identifying molecular markers, enriching genetic and genomic resources using high-throughput sequencing technologies and improving genetic transformation techniques in faba bean. However, the impact of research on practical faba bean breeding and cultivar release to farmers has been limited due to disconnects between research and breeding objectives and the high costs of research and implementation. The situation with faba bean is similar to other small crops and highlights the need for coordinated, collaborative research programs that interact closely with commercially focused breeding programs to ensure that technologies are implemented effectively.

  14. [Broad beans (Vicia fava, L.) as an alternative source of protein in chick diets].

    Science.gov (United States)

    Bezares, A; Cuca, M; Avila, E; Velásquez, C

    1980-03-01

    Three experiments were conducted to study the possibility of improving the nutritive value of broad beans (Vicia faba, L.) in poultry diets. In the first experiment, raw and autoclaved (1.0 kg/cm2/15 min) beans, with and without antibiotic supplementation, were studied. The results after 21 days showed no significant differences among treatments in regard to body weight. In feed conversion, however, a significant difference was observed when diets prepared with raw beans were supplemented with 20 ppm of flavomycin. In the second experiment raw and autoclaved beans were supplemented with 0, 10, and 20 ppm of virginiamycin and 200 and 400 ppm of flavomycin to study the effect of these two antibiotics. After 28 days, the results indicated no significant differences with antibiotic supplementation in either raw or autoclaved beans. However, a significant difference (P < 0.05) in body weight was found when beans were autoclaved. In the third experiment, two levels, 31 and 76% of raw and autoclaved beans, were included in the chick diets. The results in body weight, after 28 days, did not show any significant differences between raw and autoclaved beans fed at a 31% level. With the 76% level the autoclaved treatment, however, induced a significantly higher body weight than the diets containing raw beans.

  15. Isolation and Purification of Thiamine Binding Protein from Mung Bean

    Directory of Open Access Journals (Sweden)

    MOHAMAD SADIKIN

    2013-03-01

    Full Text Available Thiamine has fundamental role in energy metabolism. The organs mostly sensitive to the lack of thiamine levels in the body are the nervous system and the heart. Thiamine deficiency causes symptoms of polyneuritis and cardiovascular diseases. Because of its importance in the metabolism of carbohydrates, we need to measure the levels of thiamine in the body fluids by using an easy and inexpensive way without compromising the sensitivity and selectivity. An option to it is thiamine measurement based on the principle of which is analogous to ELISA, in which a thiamine binding protein (TBP act by replacing antibodies. The presence of TBP in several seeds have been reported by previous researchers, but the presence of TBP in mung beans has not been studied. This study was aimed to isolate and purify TBP from mung bean. The protein was isolated from mung bean through salting out by ammonium sulphate of 40, 70, and 90% (w/v. TBP has a negative charge as shown by cellulose acetate electrophoresis. The result obtained after salting out by ammonium sulphate was further purified bymeans of DEAE-cellulose chromatography and affinity chromatography. In precipitation of 90% of salting out method, one peak protein was obtained by using affinity chromatography. The protein was analyzed by SDS PAGE electrophoresis. The result of SDS PAGE electrophoresis showed that TBP has a molecular weight of 72.63 kDa.

  16. Yeast diversity of Ghanaian cocoa bean heap fermentations.

    Science.gov (United States)

    Daniel, Heide-Marie; Vrancken, Gino; Takrama, Jemmy F; Camu, Nicholas; De Vos, Paul; De Vuyst, Luc

    2009-08-01

    The fermentation of the Theobroma cacao beans, involving yeasts, lactic acid bacteria, and acetic acid bacteria, has a major influence on the quality of the resulting cocoa. An assessment of the microbial community of cocoa bean heap fermentations in Ghana resulted in 91 yeast isolates. These were grouped by PCR-fingerprinting with the primer M13. Representative isolates were identified using the D1/D2 region of the large subunit rRNA gene, internal transcribed spacer sequences and partial actin gene sequences leading to the detection of 15 species. Properties of importance for cocoa bean fermentation, namely sucrose, glucose, and citrate assimilation capacity, pH-, ethanol-, and heat-tolerance, were examined for selected isolates. Pichia kudriavzevii (Issatchenkia orientalis), Saccharomyces cerevisiae, and Hanseniaspora opuntiae formed the major components of the yeast community. Hanseniaspora opuntiae was identified conclusively for the first time from cocoa fermentations. Among the less frequently encountered species, Candida carpophila, Candida orthopsilosis, Kodamaea ohmeri, Meyerozyma (Pichia) caribbica, Pichia manshurica, Saccharomycodes ludwigii, and Yamadazyma (Pichia) mexicana were not yet documented from this substrate. Hanseniaspora opuntiae was preferably growing during the earlier phase of fermentation, reflecting its tolerance to low pH and its citrate-negative phenotype, while no specific temporal distribution was recognized for P. kudriavzevii and S. cerevisiae.

  17. Specific pretreatments reduce curing period of vanilla (Vanilla planifolia) beans.

    Science.gov (United States)

    Sreedhar, R V; Roohie, K; Venkatachalam, L; Narayan, M S; Bhagyalakshmi, N

    2007-04-18

    With the aiming of reducing the curing period, effects of pretreatments on flavor formation in vanilla beans during accelerated curing at 38 degrees C for 40 days were studied. Moisture loss, change in texture, levels of flavoring compounds, and activities of relevant enzymes were compared among various pretreatments as well as the commercial sample. Use of naphthalene acetic acid (NAA; 5 mg/L) or Ethrel (1%) with blanching pretreatment resulted in 3-fold higher vanillin on the 10th day. Other flavoring compounds-vanillic acid, p-hydroxybenzoic acid, and p-hydroxybenzaldehyde-fluctuated greatly, showing no correlation with the pretreatments. Scarification of beans resulted in nearly 4- and 3.6-fold higher vanillin formations on the 10th day in NAA- and Ethrel-treated beans, respectively, as compared to control with a significant change in texture. When activities of major relevant enzymes were followed, addition of NAA or Ethrel helped to retain higher levels of cellulase throughout the curing period and higher levels of beta-glucosidase on the 20th day that correlated with higher vanillin content during curing and subsequent periods. Peroxidase, being highest throughout, did not correlate with the change in levels of major flavoring compounds. The pretreatment methods of the present study may find importance for realizing higher flavor formation in a shorter period because the major quality parameters were found to be comparable to those of a commercial sample.

  18. Effect of toasting field beans and of grass-clover

    DEFF Research Database (Denmark)

    Mogensen, Lisbeth; Vestergaard, Jannie Steensig; Fretté, Xavier

    2010-01-01

    The effect of toasting field beans and of grass-clover: maize silage ratio on milk production, milk composition and the sensory quality of the milk was investigated in a 2   2 factorial experiment. Toasting of field beans resulted in lower milk contents of both fat (44.2 versus 46.1 g/kg, P = 0.......02) and protein (33.5 versus 34.2 g/kg, P = 0.008), whereas milk production, urea and somatic cell contents were unaffected compared with the untreated field beans. Increasing the proportion of maize silage (from 9 to 21% of DM) in the ration decreased the content of urea in milk (P = 0.002), whereas milk...... production and milk content of fat and protein were unaffected. Milk from cows fed the high proportion of maize silage had a lower (P = 0.04) long-chain fatty acid content (≥ C18). Furthermore, milk from cows fed the high proportion of maize silage had a lower (13-26%) content of luteine (P = 0.03), 13-cis...

  19. The water budget of rainfed maize and bean intercrop

    Science.gov (United States)

    Walker, S.; Ogindo, H. O.

    Food production in the South African Development Community (SADC) region is predominantly under rainfed conditions and therefore experiences annual fluctuations due to the rainfall variability. Although the staple food of maize ( Zea mays) is commonly grown in the same field as dry beans ( Phaseolus vulgaris) little work has been done to characterize the soil water budget of this intercropping system. The evapotranspiration can theoretically be divided into transpiration from the leaves and evaporation from the soil surface. However, it is difficult to separate the components in field studies. In this paper the Ritchie model is used to estimate the soil surface evaporation using the fractional radiation interception which depends on the crop leaf area. The intercropping system has higher leaf area than the sole crops of both maize and beans in all seasons. Therefore, the soil surface is shaded and the canopy is more dense resulting in a lower soil surface evaporation. The water budget thus gives a higher value of transpiration for the intercrop during each of the four growing seasons. This appears to be due to the complimentary use of the water resources by the maize and bean plants in the intercropping system. This illustrates the ability of the intercrop to use the available soil water in a semi-arid environment more productively. Thus the experience of the small-holder farmers in the SADC region is based on sound physical principles of water use by the two crops.

  20. FTIR Spectroscopic Study of Broad Bean 3iseased Leaves

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    [Objective] The aim was to indentify diseased leaves of broad bean by vibra- tional spectroscopy. [Method] In this paper, broad bean rust, fusarium rhizome rot, broad bean zonate spot, yellow leaf curl virus and normal leaves were studied using Fourier transform infrared spectroscopy combined with chemometrics. [Result] The spectra of the samples were similar, only with minor differences in absorption inten- sity of several peaks. Second derivative analyses show that the significant difference of all samples was in the range of 1 200-700 cm2. The data in the range of 1 200- 700 cm' were selected to evaluate correlation coefficients, hierarchical cluster analy- sis (HCA) and principal component analysis (PCA). Results showed that the correla- tion coefficients are larger than 0.928 not only between the healthy leaves, but also between the same diseased leaves. The values between healthy and diseased leaves, and among diseased leaves, are all declined. HCA and PCA yielded about 73.3% and 82.2% accuracy, respectively. [Conclusion] This study demonstrated that FTIR techniques might be used to detect crop diseases.

  1. Castor bean (Ricinus communis L.) as a potential environmental bioindicator.

    Science.gov (United States)

    Mendes, M G; Santos Junior, C D; Dias, A C C; Bonetti, A M

    2015-10-21

    Biomonitoring of air quality using living organisms is a very interesting approach to environmental impact assessment. Organisms with a vast distribution, such as plants, are widely used for these purposes. The castor bean (Ricinus communis L.) is an oleaginous plant that can potentially be used as a bioindicator plant owing to its rapid growth and large leaves, which have a wide surface area of contact with the air and the pollutants therein. This study investigated the the bioindicator potential of the castor bean by performing several tests. We observed statistically significant differences in the concentrations of chlorophyll a and b in the leaves of plants in polluted areas compared to that in the control group plants, which were located in a pollution-free area. Leaves of plants in the former group had higher peroxidase activity and showed a greater buffering ability than those of plants in the control group. The pKa values obtained via buffering capacity tests, revealed the presence of aminoazobenzene (an industrial dye) in leaves of R. communis. Genotoxicity was evaluated through the comet assay technique and revealed that other than some differences in DNA fragmentation, there is no statistically significant difference in this parameter between places analyzed. Our data indicate that R. communis can be a highly useful biological indicator. Further, we hypothesized that the castor bean can be a potential candidate for phytoremediation owing its physiological buffering capacity when exposed to substantial pollution.

  2. Adzuki beans (Vigna angularis seed quality under several drying conditions

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.

  3. Evaluation of tolerance to water stress in beans

    Directory of Open Access Journals (Sweden)

    Mauricio Marini Köop

    2012-09-01

    Full Text Available The goal of this study was to evaluate the genotypes of beans, and to sort them into groups that are tolerant and sensitive to water stress, by assessing their morphological characteristics for use in blocks of crosses and the study of gene expression. We evaluated nine bean genotypes: IAPAR 14, IAPAR 81, Pérola, IPR Colibri, IPR Juriti, IPR Chopim, IPR Gralha, and IPR Tiziu IPR Uirapuru. The genotypes were subjected to two irrigation conditions: i irrigation water as needed throughout the culture cycle and ii irrigation water as needed until the appearance of the first bud, followed by no irrigation water for 15 days. The experimental design was in randomized blocks with three replications. The characteristics evaluated were: i plant height; ii stem diameter, iii number of pods per plant, iv number of grains per pod, v root length and vi root dry mass. Stem diameter should not be used to determine if bean genotypes are tolerant or susceptible to water shortages. The results for the Pérola genotype were the highest for most of the characteristics evaluated, and, for this reason, it was classified as tolerant to water stress during flowering. The genotypes IAPAR and 81 IPR Juriti had the lowest results for the most features and were classified as susceptible to water stress during flowering.

  4. Drying of green bean and okra under solar energy

    Directory of Open Access Journals (Sweden)

    İBRAHİM DOYMAZ

    2011-06-01

    Full Text Available In this study, sun drying characteristics of green bean and okra were investigated. Drying experiments were conducted in Iskenderun-Hatay, Turkey. The drying study showed that the times taken for drying of green bean and okra from the initial moisture contents of 89.5% and 88.7% (w.b. to final moisture content of around 15±0.5% (w.b. were 60 and 100 h in open sun drying, respectively. The constant rate period is absent in drying curves. The drying process took place in the falling rate period. The drying data were fitted to thirteen thin-layer drying models. The performance of these models was investigated by comparing the determination of coefficient (R2, reduced chi-square (2 and root mean square error (RMSE between the observed and predicted moisture ratios. Estimations by Approximation of diffusion (for green bean and Midilli et al. models (for okra were in good agreement with the experimental data obtained.

  5. Reduction of antiproliferative capacities, cell-based antioxidant capacities and phytochemical contents of common beans and soybeans upon thermal processing.

    Science.gov (United States)

    Xu, Baojun; Chang, Sam K C

    2011-12-01

    The effects of boiling and steaming processes on the antiproliferative and cellular antioxidant properties, as well as phytochemicals, of two types of common beans (pinto and black beans) and two types of soybeans (yellow and black) were investigated. All thermal-processing methods caused significant (pphytic acid content (PAC) values in all bean types (except for TPC values in pressure-steamed yellow soybeans) as compared to those of the raw beans. All types of uncooked raw beans exhibited cellular antioxidant activities (CAA) in dose-dependent manners. Black soybeans exhibited the greatest CAA, followed by black beans, pinto beans and yellow soybeans. The CAA of cooked beans were generally diminished or eliminated by thermal processing. The hydrophilic extracts from raw pinto beans, black beans and black soybeans exhibited antiproliferation capacities against human gastric (AGS) and colorectal (SW480) cancer cells in dose-dependent manners. The raw yellow soybeans exhibited dose-dependent antiproliferation activities against the SW480 cells. Most of the cooked beans lost their antiproliferation capacities as observed in the raw beans. These results indicate that different processing methods may have various effects on phytochemical profiles and bioactivities. Overall, thermal processing caused a significant reduction of the health-promotion effects of beans.

  6. Impact of fermentation, drying, roasting, and Dutch processing on epicatechin and catechin content of cacao beans and cocoa ingredients.

    Science.gov (United States)

    Payne, Mark J; Hurst, W Jeffrey; Miller, Kenneth B; Rank, Craig; Stuart, David A

    2010-10-13

    Low molecular weight flavan-3-ols are thought to be responsible, in part, for the cardiovascular benefits associated with cocoa powder and dark chocolate. The levels of epicatechin and catechin were determined in raw and conventionally fermented cacao beans and during conventional processing, which included drying, roasting, and Dutch (alkali) processing. Unripe cacao beans had 29% higher levels of epicatechin and the same level of catechin compared to fully ripe beans. Drying had minimal effect on the epicatechin and catechin levels. Substantial decreases (>80%) in catechin and epicatechin levels were observed in fermented versus unfermented beans. When both Ivory Coast and Papua New Guinea beans were subjected to roasting under controlled conditions, there was a distinct loss of epicatechin when bean temperatures exceeded 70 °C. When cacao beans were roasted to 120 °C, the catechin level in beans increased by 696% in unfermented beans, by 650% in Ivory Coast beans, and by 640% in Papua New Guinea fermented beans compared to the same unroasted beans. These results suggest that roasting in excess of 70 °C generates significant amounts of (-)-catechin, probably due to epimerization of (-)-epicatechin. Compared to natural cocoa powders, Dutch processing caused a loss in both epicatechin (up to 98%) and catechin (up to 80%). The epicatechin/catechin ratio is proposed as a useful and sensitive indicator for the processing history of cacao beans.

  7. Populational survey of arthropods on transgenic common bean expressing the rep gene from Bean golden mosaic virus.

    Science.gov (United States)

    Pinheiro, Patrícia V; Quintela, Eliane D; Junqueira, Ana Maria R; Aragão, Francisco J L; Faria, Josias C

    2014-01-01

    Genetically modified (GM) crops is considered the fastest adopted crop technology in the history of modern agriculture. However, possible undesirable and unintended effects must be considered during the research steps toward development of a commercial product. In this report we evaluated effects of a common bean virus resistant line on arthropod populations, considered as non-target organisms. This GM bean line (named M1/4) was modified for resistance against Bean golden mosaic virus (BGMV) by expressing a mutated REP protein, which is essential for virus replication. Biosafety studies were performed for a period of three years under field conditions. The abundance of some species was significantly higher in specific treatments in a particular year, but not consistently different in other years. A regular pattern was not observed in the distribution of insects between genetically modified and conventional treatments. Data analyses showed that minor differences observed can be attributed to random variation and were not consistent enough to conclude that the treatments were different. Therefore the present study indicates that the relative abundance of species are similar in transgenic and non-transgenic fields.

  8. Solar-Terrestrial Effects on Bean Seed Imbibition

    Science.gov (United States)

    Minorsky, P. V.

    2012-12-01

    Forty years ago, a lively debate ensued amongst biologists concerning the nature of biological rhythms. The "endogenous" school argued that biological rhythms that occur in the absence of any obvious environmental oscillation arise endogenously from within the organism itself. The "exogenous" school on the other hand proposed that subtle and pervasive exogenous factors (e.g., geomagnetic variations or cosmic radiation) underlie most biological rhythms. Much of the debate between the endogenous vs. exogenous schools focused on circadian (circa-24 h) rhythms in particular. The demonstration that circadian rhythms continue in orbiting spacecraft was widely regarded as the final nail in the coffin of the "exogenous" school, and the entire school sank into obscurity. Regrettably, the demise of the "exogenous" school also caused some interesting findings concerning non-circadian rhythms to fall into oblivion as well. Three different research groups, for example, reported that bean (Phaseolus vulgaris) seeds display rhythms in imbibition that have ~7- or ~14-day periodicities. Consistent with the idea of an exogenous synchronizer, these rhythms often occurred synchronously in bean seed populations located 1500 km apart. The present experiment was initiated with the intention of examining whether these ~7 and ~14 d oscillations in imbibition corresponded to oscillations in solar-terrestrial parameters. Three replicates of ~25 g of bean seeds (Phaseolus vulgaris cv. Provider) were weighed daily and placed into beakers containing 200 ml of distilled water at 25° C. This temperature was maintained by nesting the beakers inside larger, temperature-jacketed beakers through which water from a temperature-regulated water bath was circulated. Four hours later the experiments were terminated: the bean seeds were blotted and weighed. Experiments were conducted almost every day between 3 and 7 AM UT from Jan 18, 2007 to Feb 26, 2008. A major difference between the present study and

  9. Effect of raw soya bean particle size on productive performance and digestion of dairy cows.

    Science.gov (United States)

    Naves, A B; Freitas Júnior, J E; Barletta, R V; Gandra, J R; Calomeni, G D; Gardinal, R; Takiya, C S; Vendramini, T H A; Mingoti, R D; Rennó, F P

    2016-08-01

    Differing soya bean particle sizes may affect productive performance and ruminal fermentation due to the level of fatty acid (FA) exposure of the cotyledon in soya bean grain and because the protein in small particles is more rapidly degraded than the protein in large particles, which influence ruminal fibre digestion and the amounts of ruminally undegradable nutrients. The objective of this experiment was to investigate the effects of raw soya bean particle size on productive performance, digestion and milk FA profile of dairy cows. Twelve Holstein cows were assigned to three 4 × 4 Latin squares with 21-day periods. At the start of the experiment, cows were 121 days in milk (DIM) and yielded 30.2 kg/day of milk. Cows were fed 4 diets: (i) control diet (CO), without raw soya bean; (ii) whole raw soya bean (WRS); (iii) cracked raw soya bean in Wiley mill 4-mm screen (CS4); and (iv) cracked raw soya bean in Wiley mill 2-mm screen (CS2). The inclusion of soya beans (whole or cracked) was 200 g/kg on dry matter (DM) basis and partially replaced ground corn and soya bean meal. Uncorrected milk yield and composition were not influenced by experimental diets; however, fat-corrected milk (FCM) decreased when cows were fed soya bean treatments. Soya bean diets increased the intake of ether extract (EE) and net energy of lactation (NEL ), and decreased the intake of DM and non-fibre carbohydrate (NFC). Ruminal propionate concentration was lower in cows fed WRS than cows fed CS2 or CS4. Cows fed cracked raw soya bean presented lower nitrogen in faeces than cows fed WRS. The milk of cows fed WRS, CS2 and CS4 presented higher unsaturated FA than cows fed CO. The addition of raw soya bean in cow diets, regardless of the particle size, did not impair uncorrected milk yield and nutrient digestion, and increased the concentration of unsaturated FA in milk. Cows fed cracked raw soya bean presented similar productive performance to cows fed whole raw soya bean.

  10. Effects of dietary cooked navy bean on the fecal microbiome of healthy companion dogs.

    Directory of Open Access Journals (Sweden)

    Katherine R Kerr

    Full Text Available BACKGROUND: Cooked bean powders are a promising novel protein and fiber source for dogs, which have demonstrated potential to alter microbial composition and function for chronic disease control and prevention. This study aimed to determine the impact of cooked navy bean powder fed as a staple food ingredient on the fecal microbiome of healthy adult pet dogs. METHODOLOGY/PRINCIPAL FINDINGS: Fecal samples from healthy dogs prior to dietary control and after 4 wk of dietary treatment with macro- and micronutrient matched diets containing either 0 or 25% cooked navy beans (n = 11 and n = 10, respectively were analyzed by 454-pyrosequencing of the 16S rRNA gene. There were few differences between dogs fed the control and navy bean diets after 4 wk of treatment. These data indicate that there were no major effects of navy bean inclusion on microbial populations. However, significant differences due to dietary intervention onto both research diets were observed (i.e., microbial populations at baseline versus 4 wk of intervention with 0 or 25% navy bean diets. After 4 wk of dietary intervention on either control or navy bean diet, the Phylum Firmicutes was increased and the Phyla Actinobacteria and Fusobacteria were decreased compared to baseline. CONCLUSIONS: No negative alterations of microbial populations occurred following cooked navy bean intake in dogs, indicating that bean powders may be a viable protein and fiber source for commercial pet foods. The highly variable microbial populations observed in these healthy adult pet dogs at baseline is one potential reason for the difficulty to detect alterations in microbial populations following dietary changes. Given the potential physiological benefits of bean intake in humans and dogs, further evaluation of the impacts of cooked navy bean intake on fecal microbial populations with higher power or more sensitive methods are warranted.

  11. Evaluation of Maize (Zea mays L. and Bean (Phaseolus vulgaris L. Growth Indices in Strip Intercropping

    Directory of Open Access Journals (Sweden)

    M Nasiri Mahallati

    2015-07-01

    Full Text Available Intercropping systems are one of the best approaches in development of sustainable agriculture. Based on this purpose, the present study was conducted to evaluate effect of strip intercropping on maize and bean growth analysis and their yield during 2009. The experiment was set up in a completely randomized block with 3 replications and 6 treatments based on replacement design. The treatments were strip width, which included 2 rows bean plus 2 rows maize, 3 rows bean plus 3 rows maize, 4 rows bean plus 4 rows maize, 5 rows bean plus 5 rows maize, maize monoculture, and bean monoculture. Crop growth ratio, relative growth ratio, biological yield, economic yield, harvest index and land equivalent ratio were measured. Our results indicated that all of the measured traits were increased in the strip intercropping treatments compare to the monoculture treatments. Increasing of strip width in the central row of intercropping treatments in comparison with the two rows bean plus two rows maize treatment led to decrease crop growth rate (15.3% and 28.7%, relative growth rate (17.5% and 19.2%, biological yield (30.9% and 14%, economic yield (52.9% and 20.2%, harvest index (31.9% and 7.3% in maize and bean, respectively. With increasing of strip width, all of the measured traits decreased more in the central rows than the side rows. The highest (1.45 and the lowest (1.22 land equivalent ratio were found in the two rows bean plus two rows maize treatment and five rows bean plus five rows maize treatment, respectively. Partial of maize had more role compare to bean in terms of enhance land equivalent ratio.

  12. Effect of processing methods on nutritional, sensory, and physicochemical characteristics of biofortified bean flour.

    Science.gov (United States)

    Nkundabombi, Marie Grace; Nakimbugwe, Dorothy; Muyonga, John H

    2016-05-01

    Common beans (Phaseolus vulgaris L.) are rich nutritious and affordable by vulnerable groups, thus a good choice for biofortification to address malnutrition. However, increasing micronutrients content of beans, without improving micronutrients bioavailability will not improve the micronutrients status of consumers. Effect of different processing methods on the physicochemical characteristics of biofortified bean flour was determined. Processing methods used in this study were malting (48 h), roasting (170°C/45 min), and extrusion cooking using a twin screw extruder with three heating sections, the first set at 60°C, the second at 130°C, and the last one at 150°C. The screw was set at a speed of 35 Hz (123g) and bean flour moisture content was 15%. Mineral extractability, in vitro protein digestibility, pasting properties, and sensory acceptability of porridge and sauce from processed flour were determined. All processing methods significantly increased (P porridge or sauce from extruded biofortified bean flour and malted/roasted biofortified bean flour. Acceptability was also not affected by the bean variety used. Mineral bioavailability and in vitro protein digestibility increased more for extruded flour than for malted/roasted flours. Sauce and porridge prepared from processed biofortified bean flour had lower viscosity (extruded flour had the lowest viscosity), thus higher nutrient and energy density than those prepared from unprocessed biofortified bean flour. Estimated nutritional contribution of sauce and porridge made from processed ROBA1 flour to daily requirement of children below 5 years and women of reproductive age found to be high. These results show that processing methods enhanced nutritional value of biofortified bean flour and that processed biofortified bean flour can be used to prepare nutrient and energy-dense gruel to improve on nutritional status of children under 5 years and women of reproductive age.

  13. Mechanical weed control on small-size dry bean and its response to cross-flaming

    Energy Technology Data Exchange (ETDEWEB)

    Martelloni, L.; Frasconi, C.; Fontanelli, M.; Raffaelli, M.; Peruzzi, A.

    2016-11-01

    Dry bean (Phaseolus vulgaris L.) can be a profitable crop for farmers; however controlling weeds effectively without a decrease in yield remains a problem. An example where mechanical weed control is difficult to conduct is dry bean ‘Toscanello’, which is a small sized high-income niche product growing low to the ground. Concerning intra-row weed control, also flame weeding could be an opportunity but the dry bean heat tolerance needs to be studied. The aims of this research were to study the weed control efficacy of a spring-tine harrow and an inter-row cultivator in this bean variety, and to test the tolerance of dry bean cultivated under weed-free conditions to cross-flaming applied with different liquefied petroleum gas (LPG) doses. Flame weeding was applied at BBCH 13 and BBCH 14 bean growth stages by pairs of burners producing direct double flame acting into the intra-row space, with bean plants placed in the middle. The results suggest that the spring-tine harrow used two times at BBCH 13 and 14, respectively, lead to a yield similar to that of the weedy control. The inter-row cultivator could be an opportunity for small-sized dry bean crops producers, enabling them to obtain a similar yield compared to the hand-weeded control. Concerning the bean tolerance to cross-flaming the results showed that bean flamed at BBCH 13 stage had little tolerance to cross-flaming. Bean flamed at BBCH 14 stage was tolerant until an LPG dose of 39 kg/ha, giving yield responses similar to those observed in the non-flamed control. (Author)

  14. A new method to select the drought resistance azuki bean germplasm

    Institute of Scientific and Technical Information of China (English)

    Chen Xin; Peerasak Srinives

    2006-01-01

    120 azuki bean germplasms from different regions of China were selected for drought-resistance. Results showed that there is a significant positive correlation between drought-resistance and photooxidation-resistance. So, the detecting technique for photooxidation-resistance should be suggested as a reference method to select the drought-resistance germplasms in azuki bean.

  15. Visualization of resistance responses in Phaseolus vulgaris using reporter tagged clones of Bean common mosaic virus

    DEFF Research Database (Denmark)

    Naderpour, Masoud; Johansen, Ida Elisabeth

    2011-01-01

    Reporter tagged virus clones can provide detailed information on virus–host interactions. In Phaseolus vulgaris (bean), four recessive and one dominant gene are known to control infection by strains of the potyvirus species Bean common mosaic virus (BCMV). To study the interactions between BCMV...

  16. Evaluation of tolerance to Bacillus thuringiensis toxins among laboratory-reared western bean cutworm (Lepidoptera: Noctuidae)

    Science.gov (United States)

    The Western bean cutworm (WBC), Striacosta albicosta, is a destructive insect pest of dry beans within its native range of western Nebraska and eastern Colorado. However, starting in the early 1990s, a range expansion of S. albicosta has resulted in damage to corn crops through the Midwest and more...

  17. Iron and zinc bioavailabilities to pigs from red and white beans (Phaseolus vulgaris L.) are similar

    Science.gov (United States)

    Common beans contain relatively high concentrations of iron (Fe) and zinc (Zn) but are also high in polyphenols and phytates, factors that may inhibit Fe and Zn absorption. In vitro (Caco-2 cells) and in vivo (pigs) models were used to compare Fe and Zn bioavailabilities between red and white beans,...

  18. Evaluation of common bean (Phaseolus vulgaris L.) collection for agromorphological and seed mineral concentration

    Science.gov (United States)

    A collection of common bean comprising totally 223 genotypes of which 176 genotypes from the USDA, 37 common bean landraces and 10 commercial cultivars from Turkey, evaluated for several agromorphological plant characters and mineral concentrations in seeds. There were wide range of variations for t...

  19. Phenotype and seed production among hyacinth bean (Lablab purpureus L. Sweet) accessions rescued using hydroponic techniques

    Science.gov (United States)

    Hyacinth bean, Lablab purpureus L. (Sweet) is a legume used as a vegetable, forage, and in home gardens as an ornamental plant. Many accessions do not flower during their juvenile period in Byron, GA. Other hyacinth bean accessions produce few seed when regenerated in the field. This study was condu...

  20. Resistance of common bean breeding lines to Phaeoisariopsis griseola isolates from Honduras

    Science.gov (United States)

    Angular leaf spot (ALS) disease caused by Phaeoisariopsis griseola Sacc. Ferraris, is currently one of the most important factors limiting bean productivity in Central America. The development of breeding lines which combine resistance to ALS and Bean Golden Yellow Mosaic Virus (BGYMV) and tolerance...

  1. Characterization of a Panela cheese with added probiotics and fava bean starch

    Science.gov (United States)

    Twenty Lactobacillus spp. and eight Bifidobacterium spp. were screened for their ability to ferment fava bean starch. B. breve ATCC 15700 and L. rhamnosus GG ATCC 53103 were selected as probiotics for use in fresh style Panela cheese. Two types of fresh cheese (with and without 3% fava bean starch) ...

  2. Tannins in faba beans (Vicia faba L.) : antinutritional properties in monogastric animals

    NARCIS (Netherlands)

    Jansman, A.J.M.

    1993-01-01

    Condensed tannins are found in coloured-flowering varieties of faba beans ( Viciafaba L.). They are considered as antinutritional factors for nonruminant species. High-tannin hulls of faba beans and isolated tannins were shown to induce a rapid hypertrophy of the parotid glands in rats and increase

  3. Tannins in faba beans (Vicia Faba L.)- antinutritional properties in monogastric animals.

    NARCIS (Netherlands)

    Jansman, A.J.M.

    1993-01-01

    Condensed tannins are found in coloured-flowering varieties of faba beans ( Viciafaba L.). They are considered as antinutritional factors for nonruminant species. High-tannin hulls of faba beans and isolated tannins were shown to induce a rapid hypertrophy of the parotid glands in rats

  4. Common bean-Rhizobium symbiosis: functional genomics of legume response to abiotic stresses

    Science.gov (United States)

    Common bean (Phaseolus vulgaris) is the world's most important grain legume for direct human consumption and a main source of proteins in Latin America and Africa. Environmental factors such as nutrient deficiency, soil acidity, and metal toxicity are important constraints for bean symbiotic nitroge...

  5. Response of Andean and Mesoamerican common bean genotypes to inoculation with rhizobium strains.

    Science.gov (United States)

    In most common bean (Phaseolus vulgaris L.) production regions of Latin America, inoculants are rarely used by farmers in spite of several studies that demonstrate the importance of Rhizobium inoculation on commercial production of legume crops. This study investigated specific bean host plant-Rhizo...

  6. Evaluation of Organic Pest Management Treatments for Bean Leaf Beetle in Soybean in Iowa

    Science.gov (United States)

    Many organic soybean producers face the challenge of bean leaf beetle (Ceratoma trifurcata), which harbors bean mottle pod virus and opens infection sites for Fusarium spp., Cercospora kikuchii, and Phomopsis spp., which cause discoloration in soybeans. Stained soybean seed is less acceptable for fo...

  7. Inquiry-based Investigation in Biology Laboratories: Does Neem Provide Bioprotection against Bean Beetles?

    Science.gov (United States)

    Pearce, Amy R.; Sale, Amanda Lovelace; Srivatsan, Malathi; Beck, Christopher W.; Blumer, Lawrence S.; Grippo, Anne A.

    2013-01-01

    We developed an inquiry-based biology laboratory exercise in which undergraduate students designed experiments addressing whether material from the neem tree ("Azadirachta indica") altered bean beetle ("Callosobruchus maculatus") movements and oviposition. Students were introduced to the bean beetle life cycle, experimental…

  8. Effect of fungal infection on phenolic compounds during the storage of coffee beans

    Directory of Open Access Journals (Sweden)

    Amal, A. A.

    2013-12-01

    Full Text Available Aims: This work was undertaken to study the effect of Aspergillus infection on phenolic compounds in beans from four cultivars of the coffee plant (Coffea arabica L.. The effects of storage conditions of the coffee beans were also examined. Methodology and results: Beans from four varieties of coffee were artificially infected with three species of Aspergillus: A. niger, A. melleus and A. alliacus, and stored at 0, 8 and 25 ± 2 °C. After 3, 6 and 9 months, the contents of phenolic compounds in the beans were determined using high performance liquid chromatography (HPLC. Conclusion, significance and impact study: The results of this study showed that phenolic compounds were qualitatively and quantitatively higher in the inoculated beans as compared with the uninfected control beans, reflecting a possible induced defense mechanism in the infected beans. Increased storage periods resulted in higher levels of phenols, but the average total, bound and free phenols did not differ between the cultivars tested. Effective control of Apergillus infection in coffee beans can prevent such changes in phenolics that may affect their commercial value.

  9. Recognition of Roasted Coffee Bean Levels using Image Processing and Neural Network

    Science.gov (United States)

    Nasution, T. H.; Andayani, U.

    2017-03-01

    The coffee beans roast levels have some characteristics. However, some people cannot recognize the coffee beans roast level. In this research, we propose to design a method to recognize the coffee beans roast level of images digital by processing the image and classifying with backpropagation neural network. The steps consist of how to collect the images data with image acquisition, pre-processing, feature extraction using Gray Level Co-occurrence Matrix (GLCM) method and finally normalization of data extraction using decimal scaling features. The values of decimal scaling features become an input of classifying in backpropagation neural network. We use the method of backpropagation to recognize the coffee beans roast levels. The results showed that the proposed method is able to identify the coffee roasts beans level with an accuracy of 97.5%.

  10. Uncertainty measurement in the homogenization and sample reduction in the physical classification of rice and beans

    Directory of Open Access Journals (Sweden)

    Dieisson Pivoto

    2016-04-01

    Full Text Available ABSTRACT: The study aimed to i quantify the measurement uncertainty in the physical tests of rice and beans for a hypothetical defect, ii verify whether homogenization and sample reduction in the physical classification tests of rice and beans is effective to reduce the measurement uncertainty of the process and iii determine whether the increase in size of beans sample increases accuracy and reduces measurement uncertainty in a significant way. Hypothetical defects in rice and beans with different damage levels were simulated according to the testing methodology determined by the Normative Ruling of each product. The homogenization and sample reduction in the physical classification of rice and beans are not effective, transferring to the final test result a high measurement uncertainty. The sample size indicated by the Normative Ruling did not allow an appropriate homogenization and should be increased.

  11. Evaluation of green coffee beans quality using near infrared spectroscopy: a quantitative approach.

    Science.gov (United States)

    Santos, João Rodrigo; Sarraguça, Mafalda C; Rangel, António O S S; Lopes, João A

    2012-12-01

    Characterisation of coffee quality based on bean quality assessment is associated with the relative amount of defective beans among non-defective beans. It is therefore important to develop a methodology capable of identifying the presence of defective beans that enables a fast assessment of coffee grade and that can become an analytical tool to standardise coffee quality. In this work, a methodology for quality assessment of green coffee based on near infrared spectroscopy (NIRS) is proposed. NIRS is a green chemistry, low cost, fast response technique without the need of sample processing. The applicability of NIRS was evaluated for Arabica and Robusta varieties from different geographical locations. Partial least squares regression was used to relate the NIR spectrum to the mass fraction of defective and non-defective beans. Relative errors around 5% show that NIRS can be a valuable analytical tool to be used by coffee roasters, enabling a simple and quantitative evaluation of green coffee quality in a fast way.

  12. Effect of acetylation, oxidation and annealing on physicochemical properties of bean starch.

    Science.gov (United States)

    Simsek, Senay; Ovando-Martínez, Maribel; Whitney, Kristin; Bello-Pérez, Luis A

    2012-10-15

    Black and Pinto bean starches were physically and chemically modified to investigate the effect of modification on digestibility and physicochemical properties of bean starch. The impact of acetylation, oxidation (ozonation) and annealing on the chemical composition, syneresis, swelling volume, pasting, thermal properties and digestibility of starches was evaluated. The physicochemical and estimated glycemic index (eGI) of the Black and Pinto bean starches treated with ozone were not significantly (P>0.05) different than that of their respective control starches. Annealed starches had improved thermal and pasting properties compared to native starches. Acetylated starches presented reduced syneresis, good pasting properties and lower eGI. Also, all modified starches had increased levels of resistant starch (RS). Therefore, the digestibility and physicochemical properties of bean starch were affected by the type of modification but there were no significant (P>0.05) differences between the Black and Pinto bean starches.

  13. Effect of several germination treatments on phosphatases activities and degradation of phytate in faba bean (Vicia faba L.) and azuki bean (Vigna angularis L.).

    Science.gov (United States)

    Luo, Yuwei; Xie, Weihua; Luo, Fengxia

    2012-10-01

    Two assays were conducted to investigate the changes of faba bean (Vicia faba L.) and azuki bean (Vigna angularis L.) phosphatases (phytase [Phy] and acid phosphatase [AcPh]) and the degradation of its substrates (inositol phosphate esters) during seed germination. The 1st assay was to establish the optimal germination conditions of faba bean and azuki bean to improve the endogenous phosphatases and increase the hydrolysis of phytate and, in the second assay, to determine the different lower phosphate esters of myo-inositol produced during the germination process. In the 1st assay, seeds were soaked for 12 and 24 h and germinated for 3 and 5 d with and without the addition of gibberellic acid (GA(3) ). In the second assay, seeds were soaked for 12 h and germinated for 1, 3, and 5 d with GA(3) . Phy (up to 3625 and 1340 U/kg) and AcPh (up to 9456 and 2740 U/g) activities, and inositol hexaphosphate (IP6) (8.23 and 7.46 mg/g), inositol pentaphosphate (IP5) (0.55 and 0.82 mg/g), and inositol tetraphosphate (IP4) (0.26 and 0.01 mg/g) were detected in ungerminated faba bean and azuki bean, respectively. The germination process caused a significant increase of Phy and AcPh activities in faba bean (up to 147% and 210%) and azuki bean (up to 211% and 596%) and a reduction in the phytate phosphorus content (up to 81% and 63%, respectively). Phytate phosphorus content was affected only by soaking time in the case of faba bean. Finally, during the course of germination, IP6 and IP5 were rapidly degraded in faba bean (88% and 39%) and azuki bean (55% and 56%), and IP4 was only a short-living intermediate, which was increased during hydrolysis and degraded to inositol triphosphate. In this manner we could obtain a low-phytate, endogenous phosphatase-rich ingredient for enhancing human nutrition.

  14. Reduction of viral load in whitefly (Bemisia tabaci Gen.) feeding on RNAi-mediated bean golden mosaic virus resistant transgenic bean plants.

    Science.gov (United States)

    de Paula, Nayhanne T; de Faria, Josias C; Aragão, Francisco J L

    2015-12-02

    The RNAi concept was explored to silence the rep gene from the bean golden mosaic virus (BGMV) and a genetically modified (GM) bean immune to the virus was previously generated. We investigated if BGMV-viruliferous whiteflies would reduce viral amount after feeding on GM plants. BGMV DNA amount was significantly reduced in whiteflies feeding in GM-plants (compared with insects feeding on non-GM plants) for a period of 4 and 8 days in 52% and 84% respectively.

  15. Occurrence of ochratoxin A in cocoa beans: effect of shelling.

    Science.gov (United States)

    Amézqueta, S; González-Peñas, E; Murillo, M; de Cerain, A López

    2005-06-01

    The aim of this study was to investigate the influence of the shelling process on the presence of ochratoxin A (OTA) in cocoa samples. Twenty-two cocoa samples were analysed for the determination of OTA before (cocoa bean) and after undergoing manual shelling process (cocoa nib). In order to determine OTA contamination in cocoa samples, a validated high-performance liquid chromatography (HPLC) method with fluorescence detection was used for the quantitative analysis of ochratoxin A (OTA). In both types of samples, OTA was extracted with methanol-3% sodium hydrogen carbonate solution and then purified using immunoaffinity columns prior to HPLC analysis. Due to the fact that different recovery values were obtained for OTA from both types of samples, a revalidation of the method in the case of cocoa nibs was needed. Revalidation was based on the following criteria: Selectivity, limits of detection and quantification (0.03 and 0.1 microg kg(-1), respectively), precision (within-day and between-day variability) and recovery 84.2% (RSD = 7.1%), and uncertainty (30%). Fourteen of the twenty-two cocoa bean samples (64%) suffered a loss of OTA of more than 95% due to shelling, six samples suffered a loss of OTA in the range 65-95%, and only one sample presented a reduction of less than 50%. The principal conclusion derived from this study is that OTA contamination in cocoa beans is concentrated in the shell; therefore, improvements of the industrial shelling process could prevent OTA occurrence in cocoa final products.

  16. Ingestive behavior of finishing sheep fed detoxified castor bean meal

    Directory of Open Access Journals (Sweden)

    Daniel Cézar da Silva

    2016-06-01

    Full Text Available ABSTRACT Castor bean crops stand out in the Northeastern Brazil for oil production, producing coproducts with potential for animal diets. Thus, this work evaluated the effect on ingestive behavior when 0, 33, 67 and 100% of detoxified castor bean meal (DCBM were included to substitute soy bean meal in diets for sheep. The randomized blocks design was used with five sheep in each treatment. Dry matter intake and neutral detergent fiber intake were not affected (P > .05 by the inclusion of DCBM in the diet, with means of 1362.6 and 582.98 g/animal/day, respectively. Substitution of soybean meal by DCBM did not affect (P > .05 times of rumination, idle and total chewing, with averages of 181.33, 347.04 and 366.24 minute/12 h, respectively. A quadratic effect (P < .05 was found for feeding time, with minimum of 164.56 min/12 h, when 60% of DCBM was included in the diet. A quadratic effect (P < .05 was verified for eating efficiency with maximum of 4.43 g DM/minute and 2.08 g NDF/minute. Rumination efficiency in g DM and NDF/minute were not affected (P < .05, with means of 4.31 and 1.84, respectively. The substitution of soybean meal by DCBM decreases feeding time when 60% of it was used but does not influence the intake of DM and NDF, time spent in ruminating and idle, and total chewing time. The use of 60% of DCBM increases feeding efficiency of DM and NDF, and does not compromise the efficiency of rumination.

  17. THE OCCURRENCE OF INSECTS, FUNGI AND ORGANOLEPTIC CHARACTERISTICS IN STORED COFFEE BEANS IN LAMPUNG

    Directory of Open Access Journals (Sweden)

    OKKY s. DHARMAPUTRA

    1999-01-01

    Full Text Available A survey on postharvest handling and technology processing of coffee beans at farmer, trader and exporter levels was conducted in West Lampung a nd Tanggamus regencies of Lampung province during harvest time (July 1998. Interviews and sampling of coffee beans were carried out during the survey. The number of respondents at farmer, trader and exporter levels was 22, 20 and 4, respectively, while the number of samples collected from each level was 20. All samples were analyzed for moisture content, physical quality, insect and fungal infestation, reducing sugar content, and coffee cupping. The results of the interviews indicated that posth arvest handling and technol ogy processing became better from farmers to exporters. Moisture contents of coffee beans collected from farmers and traders were higher than the tolerable limit recommended by SNI (13%. Physical quality of coffee beans collected from exporters was higher than that collected from farmers and traders. Insects were found on coffee beans collected from farmers, traders and exporters, but the number of species and the percentage of samples infested by insects from each level were relatively low. The predominant species was Liposcelis entomophila. The number of fungal species on coffee beans collected from farmers was higher than that collected from traders and exporters. The predominant species at the three levels was Aspergillus niger, but the lowest percentage of beans infected by this fungus was found on coffee beans collected from expo rters. The lowest percentage of samples infected by all fungi was also found on coffee beans collected from exporters. Reducing sugar content of coffee beans collected from exporters was lower than that from farmers and traders. Aroma and flavor values tended to increase from farmers through traders to exporters, while the body decreased. Some off-flavors (i.e. earthy, mouldy, fermented and woody were encountered in a few coffee samples from farmers as

  18. Rheological properties of gelatin, carrageenan and locust bean gum mixtures

    OpenAIRE

    Jones, Guy Matthew John

    2004-01-01

    This thesis reports data on blends of carrageenan (0.3%w/w) and locust bean gum (0.3%w/w) in the presence of biopolymers, particularly gelatin of varying concentration. Particular attention is given to their behaviour on autoclaving since this is relevant to one of the most important applications of these materials as gelling agents in canned meat products. It was shown there is such 3% gelatin could be found in the gelling system as a result of from collagen in the meat. Gelatin at this ...

  19. Application of 1H NMR for the characterisation of cocoa beans of different geographical origins and fermentation levels.

    Science.gov (United States)

    Caligiani, Augusta; Palla, Luigi; Acquotti, Domenico; Marseglia, Angela; Palla, Gerardo

    2014-08-15

    This study reports for the first time the use of (1)H NMR technique combined with chemometrics to study the metabolic profile of cocoa (Theobroma cacao L.) beans of different varieties, origin and fermentation levels. Results of PCA applied to cocoa bean (1)H NMR dataset showed that the main factor influencing the cocoa bean metabolic profile is the fermentation level. In fact well fermented brown beans form a group clearly separated from unfermented, slaty, and underfermented, violet, beans, independently of the variety or geographical origin. Considering only well fermented beans, the metabolic profile obtained by (1)H NMR permitted to discriminate between some classes of samples. The National cocoa of Ecuador, known as Arriba, showed the most peculiar characteristics, while the samples coming from the African region showed some similar traits. The dataset obtained, representative of all the classes of soluble compounds of cocoa, was therefore useful to characterise fermented cocoa beans as a function of their origin and fermentation level.

  20. Molecular assessment of genetic diversity in mung bean germplasm

    Indian Academy of Sciences (India)

    G. Roopa Lavanya; Jyoti Srivastava; Shirish A. Ranade

    2008-04-01

    RAPD profiles were used to identify the extent of diversity among 54 accessions of mung bean that included both improved and local land races. Out of the 40 primers screened, seven primers generated 174 amplification products with an average of 24.85 bands per primer. The RAPD profiles were analysed for Jaccard’s similarity coefficients that was found to be in the range from 0 to 0.48, indicating the presence of wide range of genetic diversity at molecular level. Cluster analysis was carried out based on distances (1-similarity coefficient) using neighbour-joining method in Free Tree package. The dendrogram resolved all the accessions into two major clusters, I (with 11 accessions) and II (with 43 accessions). However, the cluster was further divided into four subclusters (II A with six, II B with nine, II C with 15 and II D with 13 accessions). The distribution of the accessions in different clusters and subclusters appeares to be related to their performance in field conditions for 10 morphological traits that were scored. This study indicated that the RAPD profiles provide an easy and simple technique for preliminary genetic diversity assessment of mung bean accessions that may reflect morphological trait differences among them.

  1. Biological treatment to bean seeds before sowing them.

    Directory of Open Access Journals (Sweden)

    Silvano Edel Castro Mayo

    2013-09-01

    Full Text Available Even in some bibliography about the bean cultivation is recommended the use of Rhizobium which association with the cultivation is very advantageous for the fixation of the atmospheric nitrogen, as well as the employment of the antagonistic mushroom Trichoderma spp., for the control of fungous illnesses of the floor and knowing that the cultivation has its fertilization demands and of the plagues control and illnesses that are in definitive the causes that limit the yields of the cultivation, these practices are not used. We proceeded to the disinfection of bean seeds with the resulting solution of the laundry of 1Kg of Trichoderma harzianum of the stock A-34 with 2 liters of water and the mixture of this fluid with 1 Kg of Rhizobium, more a package (134 grams of Gaucho PS 70 for 45.35 kg (100 pounds of t seed. The disinfection of the seed was made by hand, 12 hour before sowing them and the results were very encouraging, so much in the delay of days in appearing the illnesses and the plagues and its low attack intensity as the increase of the yields with relationship to the not treated seed.

  2. Infrared thermometry to schedule irrigation of common bean

    Directory of Open Access Journals (Sweden)

    Lobo Francisco de Almeida

    2004-01-01

    Full Text Available The objective of this work was to determine the critical irrigation time for common bean (Phaseolus vulgaris L. cv. Carioca using infrared thermometry. Five treatments were analyzed. Canopy temperature differences between plants and a well-watered control about 1, 2, 3, 4, and 5±0.5ºC were tested. Physiological variables and plant growth were analyzed to establish the best time to irrigate. There was a significant linear correlation between the index and stomatal resistance, transpiration rate, and leaf water potential. Although significant linear correlation between the index and mean values of total dry matter, absolute growth rate, and leaf area index was found, no correlation was found with other growth index like relative growth rate, net assimilation rate, and leaf area ratio. Plants irrigated when their canopy temperature was 3±0.5ºC above the control had their relative growth rate mean value increased up to 59.7%, yielding 2,260.2 kg ha-1, with a reduction of 38.0% in the amount of water used. Plants irrigated when their canopy temperature was 4±0.5ºC yielded 1,907.6 kg ha-1, although their relative growth rate mean value was 4.0% below the control. These results show that the best moment to irrigate common bean is when their canopy temperature is between 3ºC and 4±0.5ºC above the control.

  3. Effect of copper on castor bean (Ricinus communis L.) growth

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Castor beans crop (Ricinus communis L.) is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor yield, few research has been made on this issue, mainly on the use de copper. In order to evaluate the effects of copper on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Cu (0; 1; 2; 3 and 4 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Copper levels used, in general, did not affect the plant height, stem diameter and leaf area, however they influenced the leaves and shoot biomass dry mass and the quadratic trend was the best to show the behavior of these. (author)

  4. Efficacy of Locust Beans Husk Char in Heavy Metal Sequestration

    Directory of Open Access Journals (Sweden)

    Ademola Ayodeji Ajayi-Banji

    2016-03-01

    Full Text Available Most solid waste management schemes minimally consider low concentration biodegradable agricultural waste management, though the environmental impact of this waste category is significant over a time frame. The column-mode study seeks to address the issue by suggesting potential utilisation of post-harvest waste for heavy metal sequestering. Locust beans husk char of 100 and 200 g was employed to inspect removal efficiency, isotherm and kinetic models of some heavy metals at 30, 60, 90, 120 and 150 min contact time. Elemental composition of the biosorbent was investigated using the SEM-EDX machine. The results obtained depict that over 85% aluminium and nickel removal was achieved at 150 min detention time. The Freundlich isotherm well described most of the sorbates sorption (R2 ≥ 0.91. The sorption rate equally fitted into the second-order pseudo kinetic model (R2 ≥ 0.88. Ion exchange took place during the sorption. Locust beans husk has promising adsorption potential in heavy metal ions removal from fouled surface water. DOI: http://dx.doi.org/10.5755/j01.erem.71.4.13081

  5. Faba bean hulls as a potential source of pectin.

    Science.gov (United States)

    Korish, Mohamed

    2015-09-01

    This study aimed for the first time to assess the potential use of faba bean hulls as a source of pectin. The study involved extracting pectin under various conditions of pH, temperature and extraction time and determining how these conditions affected pectin yield and its characteristics. The maximum yield of extracted pectin did not coincide with the highest degree of esterification since the maximum yield (15.75 %) was recorded at pH 1.5 and at a temperature of 85 °C for an 80-min extraction period and solid to liquid (1: 25) ratio, while the highest degree of esterification (54.62 %) occurred at pH 2.5 and at temperature of 90 °C for a 60-min extraction period. The composition of the pectin varied according to the extraction conditions: the neutral sugars galactose, arabinose and rhamnose increased under milder extraction conditions while glucose, mannose and xylose sugars predominated under harsher extraction conditions. The results indicated that faba bean hulls contains adequate amount of pectin, suitable for commercial utilization.

  6. Effect of gamma irradiation on antinutritional factors in broad bean

    Energy Technology Data Exchange (ETDEWEB)

    Al-Kaisey, M.T. E-mail: istd@uruklink.net; Alwan, A.-K.H.; Mohammad, M.H.; Saeed, A.H

    2003-06-01

    The effect of gamma irradiation on the level of antinutritional factors (trypsin inhibitor (TI), phytic acid and oligosaccharides) of broad bean was investigated. The seeds were subjected to gamma irradiation at 0, 2.5, 5, 7.5 and 10 kGy, respectively using cobalt-60 gamma radiation with a dose rate 2.37 kGy/h. TI activity was reduced by 4.5%, 6.7%, 8.5% and 9.2% at 2.5, 5, 7.5 and 10 kGy, respectively. Meanwhile, irradiation at 10.2, 12.3, 15.4 and 18.2 kGy reduced the phytic acid content. The flatulence causing oligosaccharides were decreased as the radiation dose increased. The chemical composition (protein, oil, ash and total carbohydrates) of the tested seeds was determined. Gamma radiation seems to be a good procedure to improve the quality of broad bean from the nutritional point of view.

  7. Breeding common bean populations for traits using selection index

    Directory of Open Access Journals (Sweden)

    Dayane Cristina Lima

    2015-02-01

    Full Text Available A common bean (Phaseolus vulgarisL. cultivar must combine desirable genotypes for several traits in order to be accepted by producers and consumers. This study aimed to evaluate selection efficiency when segregating bean populations for traits, by means of a selection index, in order to obtain superior progenies for traits considered. A total of 16 populations from the F4 and F5generations were evaluated in 2011 and 2012, respectively. The traits evaluated were plant architecture, plant disease, grain type and yield. Using standard scores (Z, the sum of the four traits (∑Z was obtained and, based on this information, the best populations were identified. The evaluation of selection effectiveness was performed on 31 progenies from each population. The 496 progenies plus eight controls were evaluated in the F5:6and F5:7 generations for the same traits in July and November 2012, respectively. The selection, using the index based on the sum of standardized variables (∑Z, was efficient for identifying populations with superior progenies for all the traits considered.

  8. An antifungal peptide from Phaseolus vulgaris cv. brown kidney bean

    Institute of Scientific and Technical Information of China (English)

    Yau Sang Chan; Jack Ho Wong; Evandro Fei Fang; Wen Liang Pan; Tzi Bun Ng

    2012-01-01

    A 5.4-kDa antifungal peptide,with an N-terminal sequence highly homologous to defensins and inhibitory activity against Mycosphaerella arachidicola (IC5o=3 μM),Setospaeria turcica and Bipolaris maydis,was isolated from the seeds of Phaseolus vulgaris cv.brown kidney bean.The peptide was purified by employing a protocol that entailed adsorption on Affi-gel blue gel and Mono S and finally gel filtration on Superdex 75.The antifungal activity of the peptide against M.arachidicola was stable in the pH range 3-12 and in the temperature range 0℃ to 80℃.There was a slight reduction of the antifungal activity at pH 2 and 13,and the activity was indiscernible at pH 0,1,and 14.The activity at 90℃ and 100℃ was slightly diminished.Deposition of Congo red at the hyphal tips of M.arachidicola was induced by the peptide indicating inhibition of hyphal growth.The lack of antiproliferative activity of brown kidney bean antifungal peptide toward tumor cells,in contrast to the presence of such activity of other antifungal peptides,indicates that different domains are responsible for the antifungal and antiproliferative activities.

  9. An antifungal peptide from Phaseolus vulgaris cv. brown kidney bean.

    Science.gov (United States)

    Chan, Yau Sang; Wong, Jack Ho; Fang, Evandro Fei; Pan, Wen Liang; Ng, Tzi Bun

    2012-04-01

    A 5.4-kDa antifungal peptide, with an N-terminal sequence highly homologous to defensins and inhibitory activity against Mycosphaerella arachidicola (IC(50)= 3 μM), Setospaeria turcica and Bipolaris maydis, was isolated from the seeds of Phaseolus vulgaris cv. brown kidney bean. The peptide was purified by employing a protocol that entailed adsorption on Affi-gel blue gel and Mono S and finally gel filtration on Superdex 75. The antifungal activity of the peptide against M. arachidicola was stable in the pH range 3-12 and in the temperature range 0°C to 80°C. There was a slight reduction of the antifungal activity at pH 2 and 13, and the activity was indiscernible at pH 0, 1, and 14. The activity at 90°C and 100°C was slightly diminished. Deposition of Congo red at the hyphal tips of M. arachidicola was induced by the peptide indicating inhibition of hyphal growth. The lack of antiproliferative activity of brown kidney bean antifungal peptide toward tumor cells, in contrast to the presence of such activity of other antifungal peptides, indicates that different domains are responsible for the antifungal and antiproliferative activities.

  10. Prosopis pubescens (screw bean mesquite) seedlings are hyperaccumulators of copper.

    Science.gov (United States)

    Zappala, Marian N; Ellzey, Joanne T; Bader, Julia; Peralta-Videa, Jose R; Gardea-Torresdey, Jorge

    2013-08-01

    Due to health reasons, toxic metals must be removed from soils contaminated by mine tailings and smelter activities. The phytoremediation potential of Prosopis pubescens (screw bean mesquite) was examined by use of inductively-coupled plasma optical emission spectroscopy. Transmission electron microscopy was used to observe ultrastructural changes of parenchymal cells of leaves in the presence of copper. Elemental analysis was used to localize copper within leaves. A 600-ppm copper sulfate exposure to seedlings for 24 days resulted in 31,000 ppm copper in roots, 17,000 ppm in stems, 11,000 in cotyledons and 20 ppm in the true leaves. For a plant to be considered a hyperaccumulator, the plant must accumulate a leaf-to-root ratio <1. Screw bean mesquite exposed to copper had a leaf-to-root ratio of 0.355 when cotyledons were included. We showed that P. pubescens grown in soil is a hyperaccumulator of copper. We recommend that this plant should be field tested.

  11. Economic viability of common bean variety BRS Estilo

    Directory of Open Access Journals (Sweden)

    Osmira Fatima da Silva

    2015-11-01

    Full Text Available This study aims to evaluate financially BRS Estilo, a variety of common bean (Phaseolus vulgaris L., the carioca group, developed by “Embrapa Rice and Beans” and partners, estimating the regional economic benefit from the knowledge of the costs generation and transfer of technology and production system. The BRS Estilo variety was evaluated in four successive seasons: 2010/2011, 2011/2012, 2012/2013 and 2013/2014. The BRS Estilo technology contribution to the bean agribusiness in Brazil was R$ 239.431.760,83, about US$ 106 million during the period. The transfer process of the BRS Estilo to the productive sector represents 7,5% of the total cost on developing technology, which began in 2000. In addition to the economic benefit provided by the adoption of this technology, there has also been generating more jobs in its supply chain and also increasing the product offered in the market. JEL-Code | O13; Q16; R32.

  12. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. E-mail: villavic@net.ipen.br; Mancini-Filho, Jorge E-mail: jmancini@usp.br; Delincee, Henry; Greiner, Ralf E-mail: ralf.greiner@bfe.uni-karlsruhe.de

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macacar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g{sup -1} dry basis, 1.8 mg g{sup -1} dry basis and 13.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Carioca beans and 0.30 mg g{sup -1} dry basis, 0.42 mg g{sup -1} dry basis and 7.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Macacar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macacar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  13. Intake of Mung Bean Protein Isolate Reduces Plasma Triglyceride Level in Rats

    Directory of Open Access Journals (Sweden)

    Nobuhiko Tachibana

    2013-09-01

    Full Text Available ABSTRACTBackground: Mung bean is well known as a starch source, but the physiological effects of mung bean protein have received little attention. In this study, we isolated mung bean protein from de-starched mung bean solutions, and investigated its influence on lipid metabolism. Objective: The aim of this study is to clarify the influence of the lipid metabolism by consumption of mung bean protein isolate (MPIMethods: Diets containing either mung bean protein isolate (MPI or casein were fed to normal rats for 28 days.Results: Both groups ate the same amount of food, but the plasma triglyceride level, relative liver weight and liver lipid contents (cholesterol and triglyceride pool in the MPI group were significantly lower than in the casein group. In the MPI group, the expression of sterol regulatory-element binding factor 1 (SREBF1 mRNA in the liver was significantly different when compared with the casein group. The significantly lower levels of insulin and free fatty acids in the MPI-fed rats may be due to the regulation of genes related to lipid metabolism in the liver.Conclusions: These results suggest that MPI may improve the plasma lipid profile by normalizing insulin sensitivity.Keywords: mung bean, Vigna radiata L., 8S globulin, triglyceride, β-conglycinin, 7S globulin, insulin sensitivity, SREBF1

  14. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Science.gov (United States)

    Villavicencio, Anna Lucia C. H.; Mancini-Filho, Jorge; Delincée, Henry; Greiner, Ralf

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macaçar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g -1 dry basis, 1.8 mg g -1 dry basis and 13.5 μmol g -1 dry basis in the raw non-irradiated Carioca beans and 0.30 mg g -1 dry basis, 0.42 mg g -1 dry basis and 7.5 μmol g -1 dry basis in the raw non-irradiated Macaçar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macaçar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  15. Cotyledon thermal behavior and pectic solubility as related to cooking quality in common beans.

    Science.gov (United States)

    Bernal-Lugo, I; Parra, C; Portilla, M; Peña-Valdivia, C B; Moreno, E

    1997-01-01

    The characteristic of proteins, starch and pectic substances in cotyledons of two bean cultivars varying in cooking time were determined to investigate their possible contribution to bean cooking quality. Both cultivars showed the same enthalpies of starch gelatinization but different protein denaturation enthalpies. The proportion of hot water soluble pectins was higher in Michigan, the cultivar with the lower cooking time, than in Ojo de Cabra, the cultivar with the higher cooking time. These results were not due to differences in pectin methylation or in the ratio of monovalent to divalent cations in the tissue, suggesting that in fresh beans the beta-elimination reaction is not the sole or predominant route of thermal pectin degradation. Overall, this study indicates that varietal differences in bean cooking quality may be reflections of the rate of pectin loss during soaking/heating and that the thermal properties of starch and protein fractions seem to have a minor contribution. Researchers involved in this study propose that in fresh beans, the thermal pectin loss results from a two step mechanism: pectin enzymic breakdown during the bean soaking followed by thermal solubilization rather than beta-elimination during the bean heating.

  16. Molecular structure and physicochemical properties of potato and bean starches as affected by gamma-irradiation.

    Science.gov (United States)

    Chung, Hyun-Jung; Liu, Qiang

    2010-08-01

    In this study, potato and bean starches were treated by gamma-irradiation up to 50kGy. Molecular structure and physicochemical properties of irradiated potato and bean starches were investigated. Microscopic observation under scanning electron microscope (SEM) and polarized microscope showed that some of potato and bean starch granules were destroyed by gamma-irradiation and the breakage was much greater at a higher dose (50 kGy). Carboxyl content and amylose leaching increased, whereas the swelling factor and apparent amylose content decreased after irradiation in both potato and bean starches. The proportions of short (DP 6-12) and long (DP > or = 37) amylopectin chains as well as average chain length increased with increasing irradiation dose. However, the proportion of DP 13-24 decreased by irradiation. The relative crystallinity, the degree of granule surface order, and gelatinization enthalpy decreased with an increase in irradiation dose. The extent of decrease in potato starch was greater than that in bean starch. The exothermic peak around 90-110 degrees C was observed in DSC thermogram when the potato starch was irradiated at 50 kGy. The pasting viscosity significantly decreased with an increase in irradiation dose. The proportion of slowly digestible starch (SDS) decreased and resistant starch (RS) content increased by irradiation in both potato and bean starches. However, the rapidly digestible starch (RDS) of potato starch increased with increasing irradiation dose, whereas the bean starch showed the opposite trend to potato starch in RDS content.

  17. Effect of edible coating on the aromatic attributes of roasted coffee beans.

    Science.gov (United States)

    Rattan, Supriya; Parande, A K; Ramalakshmi, K; Nagaraju, V D

    2015-09-01

    Coffee is known throughout the world for its distinct aroma and flavour which results from a number of volatile compounds present in it. It is very difficult to arrest the aromatic compounds once the roasting process is complete and it becomes even more challenging to store the beans for a longer time with the retained volatiles as these compounds are easily lost during industrialized processing such as the grinding of roasted coffee beans and storage of ground coffee. Thus, an attempt was made to minimise the loss of volatile from roasted coffee beans by coating with Carboxymethyl cellulose (CMC), Hydroxypropylmethyl cellulose (HPMC) and Whey protein concentrate. Coffee volatiles were analysed by Gas chromatography and 14 major compounds were identified and compared in this study. Results showed an increase in the relative area of major volatile compounds in coated roasted coffee beans when compared with unroasted coffee beans for consecutive two months. Moreover, effect of coating on textural properties and non-volatiles were also analysed. The results have indicated that edible coatings preserve the sensory properties of roasted coffee beans for a longer shelf life and cellulose derivatives, as an edible coating, exhibited the best protecting effect on roasted coffee beans.

  18. Relative planting times on the production components in sesame/cowpea bean intercropping in organic system

    Directory of Open Access Journals (Sweden)

    Afrânio César de Araújo

    2013-12-01

    Full Text Available Aiming at better land use, small farmers usually plant sesame and cowpea bean intercropped with other crops. The aim of this work was to analyze and quantify the influence of four relative planting times of the cowpea bean in intercropping with sesame from the standpoint of their production components, plant productivity and the index of land equivalent ratio (LER. The field experiment was conducted in a randomized blocks with four treatments and four replicates. The treatments were the sesame and the cowpea bean in intercropping with the cowpea bean planted at the same time, 7, 14 and 21days after than the sesame. A greater part of the production components of both the sesame as well the cowpea bean was affected by the intercropping and significant differences were noted among the treatments in a larger part of the parameters. As the planting of the cowpea bean became more distant from that of the sesame, the yield of the Pedaliaceae increased and the yield of the Fabaceae decreased. The results for LER findings on the other hand suggest that in the sesame/cowpea bean intercropping, when the Fabaceae is planted seven days after the sesame, there is better use of the land and a largest possibility to the producer earning a profit.

  19. Ghanaian cocoa bean fermentation characterized by spectroscopic and chromatographic methods and chemometrics.

    Science.gov (United States)

    Aculey, Patrick C; Snitkjaer, Pia; Owusu, Margaret; Bassompiere, Marc; Takrama, Jemmy; Nørgaard, Lars; Petersen, Mikael A; Nielsen, Dennis S

    2010-08-01

    Export of cocoa beans is of great economic importance in Ghana and several other tropical countries. Raw cocoa has an astringent, unpleasant taste, and flavor, and has to be fermented, dried, and roasted to obtain the characteristic cocoa flavor and taste. In an attempt to obtain a deeper understanding of the changes in the cocoa beans during fermentation and investigate the possibility of future development of objective methods for assessing the degree of fermentation, a novel combination of methods including cut test, colorimetry, fluorescence spectroscopy, NIR spectroscopy, and GC-MS evaluated by chemometric methods was used to examine cocoa beans sampled at different durations of fermentation and samples representing fully fermented and dried beans from all cocoa growing regions of Ghana. Using colorimetry it was found that samples moved towards higher a* and b* values as fermentation progressed. Furthermore, the degree of fermentation could, in general, be well described by the spectroscopic methods used. In addition, it was possible to link analysis of volatile compounds with predictions of fermentation time. Fermented and dried cocoa beans from the Volta and the Western regions clustered separately in the score plots based on colorimetric, fluorescence, NIR, and GC-MS indicating regional differences in the composition of Ghanaian cocoa beans. The study demonstrates the potential of colorimetry and spectroscopic methods as valuable tools for determining the fermentation degree of cocoa beans. Using GC-MS it was possible to demonstrate the formation of several important aroma compounds such 2-phenylethyl acetate, propionic acid, and acetoin and the breakdown of others like diacetyl during fermentation. Practical Application: The present study demonstrates the potential of using colorimetry and spectroscopic methods as objective methods for determining cocoa bean quality along the processing chain. Development of objective methods for determining cocoa bean

  20. Investigation of optimum roasting conditions to obtain possible health benefit supplement, antioxidants from coffee beans.

    Science.gov (United States)

    Sulaiman, Shaida Fariza; Moon, Joon-Kwan; Shibamoto, Takayuki

    2011-09-01

    In order to investigate the role of roasting conditions in antioxidant formation, methanol and hot water extracts from Robusta coffee beans roasted for various lengths of time and at various temperatures were analyzed for total phenolic acid, chlorogenic acid, and caffeine content, as well as for their antioxidant activities using 1,1-diphenyl-2-picryhydrazyl (DPPH), thiobarbituric acid (TBA), and malonaldehyde/gas chromatography (MA/GC) assays. The amount of total phenolics in methanol extracts decreased linearly over the roasting temperature from 63.51 ± 0.77 mg chlorogenic acid equivalent (CAE)/g coffee beans (roasted at 200°C) to 42.56 ± 0.33 mg CAE/g coffee beans (roasted at 240°C). The total chlorogenic acid content decreased when the roasting time was increased from 78.33 ± 1.41 mg/g (green coffee beans) to 4.31 ± 0.23 mg/g (roasted for 16 min at 250°C). All methanol extracts from roasted coffee beans possessed over 90% antioxidant activities in the DPPH assay. The antioxidant activity of methanol extracts ranged from 41.38 ± 1.77% (roasted at 250°C for 10 min) to 98.20 ± 1.49% (roasted at 230°C for 16 min) as tested by the TBA assay. The antioxidant activity of methanol extracts of green coffee beans and roasted coffee beans ranged from 93.01% (green coffee beans) to 98.62 ± 1.32% (roasted at 250°C for 14 min) in the MA/GC assays. All hot water extracts exhibited moderate pro-oxidant activities in TBA and MA/GC assays. The results indicated that roasting conditions of coffee beans play an important role in the formation of antioxidants in brewed coffee, which can be dietary supplements having beneficial effect to human health.

  1. In vitro starch digestibility and predicted glycemic index of corn tortilla, black beans, and tortilla-bean mixture: effect of cold storage.

    Science.gov (United States)

    Sáyago-Ayerdi, S G; Tovar, Juscelino; Osorio-Díaz, P; Paredes-López, Octavio; Bello-Pérez, Luis A

    2005-02-23

    People in the rural areas of Mexico consume corn tortillas and beans as basic components of their diet. However, little is known about the nutritionally relevant features of starch present in such combined meals. The objective of the present study was to evaluate the in vitro bioavailability of starch in tortilla-bean mixtures stored at 4 degrees C for different times, as compared to that of corn tortilla and boiled black beans kept separately under the same conditions. Available starch (AS), resistant starch (RS), and retrograded resistant starch (RRS) contents were measured. The in vitro starch hydrolysis indices (HI) of freshly cooked and cold-stored samples were evaluated using a chewing/dialysis digestion protocol. HIs were used to predict glycemic indices (pGI) of the samples. AS in tortilla and beans decreased between 3 and 6% after 48-72 h, whereas values in the mixture fell by 3% after 48 h, with no further change by 72 h. Only minor rises in RS contents (1.5-1.6%) were recorded for tortilla and beans after 72 h of storage, and a lower increase (0.4%) was recorded in the mixture. Judging from RRS values, an important proportion of RS is due to starch retrogradation. The HI and pGI were higher in tortilla than in bean and the mixture. Hydrolysis rate values decreased in the stored samples, a pattern that corresponded with RS and RRS changes. The slow digestion features of common beans are largely retained by the legume-tortilla combination. Data support the perceived health beneficial properties of starch in this traditional cereal-legume food.

  2. Effects of sulphur dioxide on southern bean mosaic and maize dwarf mosaic

    Energy Technology Data Exchange (ETDEWEB)

    Laurence, J.A.; Aluisio, A.L.; Weinstein, L.H.; McCune, D.C.

    1981-01-01

    Sub-acute doses of sulphur dioxide (SO/sub 2/) (either 262 or 524 ..mu..g m/sup -3/) for 5-10 days caused small but consistent increases in the titre of southern bean mosaic virus (SBMV) in Bountiful bean and maize dwarf mosaic virus (MDMV) in maize. Exposure to SO/sub 2/ also increased infection and intensified symptoms caused by MDMV. Sulphur uptake by the host plant was not affected by either virus; however, pre- and post-inoculation exposures of bean plants to SO/sub 2/ resulted in greater than additive effects on sulphur uptake.

  3. Palm olein oil produces less lipid peroxidation products than soya bean oil.

    Science.gov (United States)

    Zaiton, Z; Merican, Z; Khalid, B A; Mohamed, J B; Baharom, S

    1997-06-01

    The soleus muscles of hyperthyroid rats were used to investigate the effect of palm olein oil and soya bean oil on the production of lipid peroxidation products. It was found that palm olein oil but not soya bean oil significantly decreased malonaldehyde and conjugated diene levels of the soleus muscles of hyperthyroid rats. These findings suggest that palm olein per se produces less lipid peroxidation products than soya bean oil. Such an assay method gives a composite net picture of the propensity of an oil to produce lipid peroxidation products.

  4. Cooking quality and starch digestibility of gluten free pasta using new bean flour.

    Science.gov (United States)

    Giuberti, Gianluca; Gallo, Antonio; Cerioli, Carla; Fortunati, Paola; Masoero, Francesco

    2015-05-15

    The use of rice/leguminous blend may be nutritionally convenient in gluten free product manufacturing. Gluten free spaghetti was prepared with rice flour and different concentrations of bean flour (included at levels of 0%, 20% and 40%, w/w) derived from a new developed white-seeded low phytic acid and lectin free (ws+lpa+lf) bean cultivar. Protein, ash and dietary fibre contents increased linearly (Presistant starch content, while decreasing quadratically (Pglycemic index. The partial replacement of rice flour with bean flour can favourably be used in gluten free spaghetti formulation.

  5. NOTE-Management system of an active genebank of common bean

    Directory of Open Access Journals (Sweden)

    Marlon Mathias Dacal Coan

    2010-01-01

    Full Text Available Genetic resources are conserved ex situ in genebanks, which are used as a source of useful alleles. Theinformation generated by the Active Common Bean Genebank (ACBG is stored in a Database Management system whichensures a quick and safe data recovery. Using Microsoft Access, a database system was developed to store and search basesof accession combinations or directly among morphological, physiological and yield descriptors of common bean. The systemcalled Common Bean Genebank (CBGB provides a graphical interface for the operation in the database, facilitating andoptimizing the search time in germplasm catalogues.

  6. Locust bean gum: processing, properties and food applications--a review.

    Science.gov (United States)

    Barak, Sheweta; Mudgil, Deepak

    2014-05-01

    Locust bean gum or carob gum is a galactomannan obtained from seed endosperm of carob tree i.e. Ceratonia siliqua. It is widely utilized as an additive in various industries such as food, pharmaceuticals, paper, textile, oil well drilling and cosmetics. Industrial applications of locust bean gum are due to its ability to form hydrogen bonding with water molecule. It is also beneficial in the control of many health problems like diabetes, bowel movements, heart disease and colon cancer due to its dietary fiber action. This article focuses on production, processing, composition, properties, food applications and health benefits of locust bean gum.

  7. MONTHLY PRICE ANALYSIS OF COWPEA (BEANS AND MAIZE IN AKWA IBOM STATE, SOUTHERN NIGERIA

    Directory of Open Access Journals (Sweden)

    Sunday Brownson Akpan

    2014-04-01

    Full Text Available The study examined the price transmission and market integration of Maize and Beans in the rural and urban markets of Akwa Ibom State, Nigeria. Average monthly prices (measured in naira per kilogram of Maize and Cowpea in rural and urban markets were used in the analysis. The data was obtained from the quarterly publications of the Akwa Ibom State Agricultural Development Programme (AKADEP. The data covered the period; January 2005 to June 2013. The trend analysis showed that, prices of Maize and Beans in the rural and urban markets had exponential growth rates that were less than unity, which suggested a possible co-movement of these prices in the study area. Also, the Pearson correlation coefficient generated for the pair of rural and urban prices of Maize and Beans revealed significant linear symmetric relationships. The result implies the existence of symmetric market information flows between the rural and urban markets for Maize and Beans in the state. The Granger causality test revealed bi-directional relationships between the rural and urban price of Maize and Beans in the study area. The co-integration test revealed the presence of co-integration between the rural and urban prices of Maize and Beans. The coefficients of the price variables in the co-integration equations for Maize and Beans markets converged to unity or law of one price which implied perfect market integration in the long run. The results of the error correction model (ECM also confirm the existence of the short run market integration between the rural and urban prices of Maize and Beans in the study area. In addition, it was discovered that, the rural price of Maize adjusted faster to the stable state in the long run than the urban price. Likewise, the urban price of Beans adjusted faster than its corresponding rural price. The index of market connection (IMC supported the high short run market integration for prices of Maize and Beans in rural and urban markets. Based

  8. Changes in differently processed soya bean (Glycine max.) and lima bean (Phaseolus lunatus) with particular reference to their chemical composition and their mineral and some inherent anti-nutritional constituents.

    Science.gov (United States)

    Aletor, V A; Ojo, O I

    1989-01-01

    The effects of 3 processing techniques: cooking, roasting and autoclaving on the proximate chemical composition, the mineral content and some inherent toxic factors of soya and lima beans were investigated. The processing techniques generally reduced the crude fibre levels and enhanced the extractable fat in the soya and lima beans. The coefficients of variability for crude fibre and ether extract due to the processing techniques of soya and lima beans were 20.9%, 16.0% and 22.3%, 38.1%, respectively. In parallel with decreased ash content in the cooked bean samples, there was a decrease in the K, Mg, Na and P levels relative to the raw bean and also relative to the other processing techniques. Mineral contents of the autoclaved bean samples were generally similar to those of the raw (unprocessed) samples. Under the processing conditions, roasting caused the highest reduction in thioglucoside content (59%) in soya bean while cooking caused the highest reduction in lima bean (78%). Trypsin inhibitor activity (TIA) ranged between 0.59 mg/g sample in the cooked soya bean and 11.6 mg/g sample in the raw bean while the corresponding values for lima bean ranged between 0.59 and 6.3 mg/g sample. Cooking and roasting caused over 90% reduction of TIA, while autoclaving caused 64-69% reduction in both bean samples. Under the assay conditions, haemagglutinating activity was not detected in the cooked and autoclaved soya and lima beans. The need to prevent both functional and nutritional damage to food proteins and other nutrients, resulting from excessive heating, was discussed.

  9. Short-Term Local Adaptation of Historical Common Bean (Phaseolus vulgaris L. Varieties and Implications for In Situ Management of Bean Diversity

    Directory of Open Access Journals (Sweden)

    Stephanie M. Klaedtke

    2017-02-01

    Full Text Available Recognizing both the stakes of traditional European common bean diversity and the role farmers’ and gardeners’ networks play in maintaining this diversity, the present study examines the role that local adaptation plays for the management of common bean diversity in situ. To the purpose, four historical bean varieties and one modern control were multiplied on two organic farms for three growing seasons. The fifteen resulting populations, the initial ones and two populations of each variety obtained after the three years of multiplication, were then grown in a common garden. Twenty-two Simple Sequence Repeat (SSR markers and 13 phenotypic traits were assessed. In total, 68.2% of tested markers were polymorphic and a total of 66 different alleles were identified. FST analysis showed that the genetic composition of two varieties multiplied in different environments changed. At the phenotypic level, differences were observed in flowering date and leaf length. Results indicate that three years of multiplication suffice for local adaptation to occur. The spatial dynamics of genetic and phenotypic bean diversity imply that the maintenance of diversity should be considered at the scale of the network, rather than individual farms and gardens. The microevolution of bean populations within networks of gardens and farms emerges as a research perspective.

  10. Review: The Potential of the Common Bean (Phaseolus vulgaris as a Vehicle for Iron Biofortification

    Directory of Open Access Journals (Sweden)

    Nicolai Petry

    2015-02-01

    Full Text Available Common beans are a staple food and the major source of iron for populations in Eastern Africa and Latin America. Bean iron concentration is high and can be further increased by biofortification. A major constraint to bean iron biofortification is low iron absorption, attributed to inhibitory compounds such as phytic acid (PA and polyphenol(s (PP. We have evaluated the usefulness of the common bean as a vehicle for iron biofortification. High iron concentrations and wide genetic variability have enabled plant breeders to develop high iron bean varieties (up to 10 mg/100 g. PA concentrations in beans are high and tend to increase with iron biofortification. Short-term human isotope studies indicate that iron absorption from beans is low, PA is the major inhibitor, and bean PP play a minor role. Multiple composite meal studies indicate that decreasing the PA level in the biofortified varieties substantially increases iron absorption. Fractional iron absorption from composite meals was 4%–7% in iron deficient women; thus the consumption of 100 g biofortified beans/day would provide about 30%–50% of their daily iron requirement. Beans are a good vehicle for iron biofortification, and regular high consumption would be expected to help combat iron deficiency (ID.

  11. Isolation and characterization of a proteinase inhibitor from marama beans.

    Science.gov (United States)

    Elfant, M; Bryant, L; Starcher, B

    1985-11-01

    A protease inhibitor was purified from the African marama bean (Tylosema esculenturm). The inhibitor is present in large amounts, representing about 10.5% of the total protein. The molecular weight is slightly larger than soybean trypsin inhibitor and was estimated at 23,000 by SDS-gel electrophoresis or 24,500 by amino acid analysis. The amino acid composition was atypical of most other plant inhibitors with a cysteine content of only one or possibly two residues/mole and a blocked amino terminus. Inhibition studies indicated virtually no inhibition of chymotrypsin activity. Elastase, however, was inhibited to the same extent as trypsin, requiring about 2 moles of inhibitor for complete inhibition of the enzyme.

  12. Copper excess impairs mobilization of storage proteins in bean cotyledons.

    Science.gov (United States)

    Karmous, Inès; El Ferjani, Ezzedine; Chaoui, Abdelilah

    2011-12-01

    Germination represents a limiting stage of plant life cycle. One of the underlying metabolic activities following imbibition of seed is the reserve mobilization. Seeds of bean (Phaseolus vulgaris L. var. soisson nain hatif) were germinated by soaking in distilled water or 200 μM CuCl(2). Storage proteins breakdown and amino acids freeing from reserve tissues were investigated. Compared to the control, Cu caused a reduction in germination rate, embryo growth, and in mobilization of cotyledonary biomass. The failure in albumin and globulin hydrolysis after the exposure to the pollutant was argued by (1) higher contents of remaining proteins than control ones, (2) persistence of some polypeptide bands resolved by polyacrylamide gel electrophoresis of albumin and globulin-rich fractions, and (3) decrease in the availability of amino acids. Nitrogen starvation in embryonic axis should be associated with the Cu-imposed delay in growth.

  13. Moisture sorption isotherms of castor beans. Part 2: Thermodynamic properties

    Directory of Open Access Journals (Sweden)

    André L. D. Goneli

    Full Text Available ABSTRACT Knowledge on the water sorption within agricultural products is extremely important for decision making during post-harvest procedures. In order to improve this knowledge, thermodynamic properties regarding water sorption provide useful data. Thermodynamic properties of castor beans, related to sorption, were determined. Static gravimetric technique under different conditions of temperature (25, 35, 45 and 55 ± 1 °C was used. Saturated salt solutions in the range of 37-87% ± 2% were utilized to create the required controlled humidity environment. After the sorption procedure, differential enthalpy, differential entropy and Gibbs free energy of this process were calculated and decreased with increased values of equilibrium moisture content.

  14. ARTICLE - Inbreeding depression in castor bean (Ricinus communis L. progenies

    Directory of Open Access Journals (Sweden)

    Milton Krieger

    2012-12-01

    Full Text Available The purpose of this study was to investigate inbreeding depression (DE in castor bean. From a population derived from the Guarani cultivar, 60 mother plants were sampled. Three types of progenies were obtained from each one: from self-pollination (AU, from crosses (CR and from open pollination (PL. Grain yield of the progenies was evaluated in two locations. There was a strong interaction of progenies x locations, which led to obtaining estimates within each location. Broad variation was observed in inbreeding depression, with mean values of 6.7% and 13.4%, comparing AU progenies with PL progenies. It was observed that the population has high potential for selecting promising inbred lines. The frequency of mother plants generating progenies with simultaneous high general combination capacity and low inbreeding depression was low. Recurrent selection will increase the occurrence of parent plants associating these two properties, which is necessary for obtaining superior synthetic varieties.

  15. Microsatellite Markers for the Yam Bean Pachyrhizus (Fabaceae

    Directory of Open Access Journals (Sweden)

    Marc Delêtre

    2013-06-01

    Full Text Available Premise of the study: Microsatellite loci were developed for the understudied root crop yam bean (Pachyrhizus spp. to investigate intraspecific diversity and interspecific relationships within the genus Pachyrhizus. Methods and Results: Seventeen nuclear simple sequence repeat (SSR markers with perfect di- and trinucleotide repeats were developed from 454 pyrosequencing of SSR-enriched genomic libraries. Loci were characterized in P. ahipa and wild and cultivated populations of four closely related species. All loci successfully cross-amplified and showed high levels of polymorphism, with number of alleles ranging from three to 12 and expected heterozygosity ranging from 0.095 to 0.831 across the genus. Conclusions: By enabling rapid assessment of genetic diversity in three native neotropical crops, P. ahipa, P. erosus, and P. tuberosus, and two wild relatives, P. ferrugineus and P. panamensis, these markers will allow exploration of the genetic diversity and evolutionary history of the genus Pachyrhizus.

  16. Confirmation of bean leaf beetle, Cerotoma trifurcata, feeding on cucurbits

    Directory of Open Access Journals (Sweden)

    R.L. Koch

    2004-02-01

    Full Text Available The objective of these studies was to assess the degree to which bean leaf beetle, Cerotoma trifurcata (Forster, will feed on cucurbits. In 2003, we documented an infestation of C. trifurcata in a commercial pumpkin field near Rosemount, MN, USA. To evaluate C. trifurcata feeding on cucurbits, we conducted laboratory no-choice and choice test feeding studies. In the laboratory, C. trifurcata fed most heavily on cotyledon-stage cucumber plants, followed by pumpkin and squash. With soybean plants present, C. trifurcata still fed on cucumber plants. However, C. trifurcata appeared to prefer soybeans until the quality of the soybean plants was diminished through feeding damage. This is the first known report of C. trifurcata feeding on cucurbits. The pest potential of C. trifurcata in cucurbit cropping systems should be further evaluated.

  17. BEAN PRODUCERS’ PERSPECTIVES OF DEVELOPMENT IN SOMBRERETE, ZACATECAS

    Directory of Open Access Journals (Sweden)

    Octaviano Ceceñas-Jacquez

    2015-07-01

    Full Text Available In this investigation production strategies, marketing, food security and development possibilities for bean producers in the municipality of Sombrerete, Zacatecas are identified. The study is approached from the perspective of the theory of rural territorial development, and surveys producers were conducted. It is concluded that the region is moving smallholdings and decrease in family income, so that agriculture becomes increasingly a subsistence activity where diversification becomes more important. Productive transformation has its limitations due to factors such as the arid climate, the largest division of the land, the high cost of credit, low level of technology and knowledge producers. Additionally, much of small producers is outside the new models of organization and government support, so cannot be considered solved the institutional framework to promote equitable development of producers.

  18. Role of xyloglucan in gravitropic bending of azuki bean epicotyl.

    Science.gov (United States)

    Ikushima, Toshimitsu; Soga, Kouichi; Hoson, Takayuki; Shimmen, Teruo

    2008-04-01

    The mechanism of the gravitropic bending was studied in azuki bean epicotyls. The cell wall extensibility of the lower side became higher than that of the upper side in the epicotyl bending upward. The contents of matrix polysaccharides of the cell wall (pectin and xyloglucan in hemicellulose-II) in the lower side became smaller than those in the upper side. The molecular mass of xyloglucans in the lower side decreased. After an epicotyl was fixed to a metal rod to prevent the bending, gravistimulation was applied. Fundamentally the same results were obtained with respect to rheological and chemical characteristics of the cell wall as those of epicotyls showing gravitropic bending. The present results suggested that the initial gravitropic bending was caused by the increase in extensibility of the lower side and the decrease in extensibility of the upper side via the change of the cell wall matrix, especially xyloglucans.

  19. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  20. Research on Development Strategy of Industry of Edible Beans in West China

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The West China is main producing region and advantageous producing region of edible beans. Developing industry of edible beans in West China has prominent regional advantage, production advantage, quality advantage, market advantage, and price advantage. We analyze the problems existing in the process of development of industry of edible beans in West China as follows: the cognition is insufficient; fund for scientific research is short; the basic research is weak; the planting is sparse; the industrialization is not sound; the information is restricted. Corresponding suggestions are put forward in this paper as follows, in order to ensure the healthy development of industry of edible beans in China: formulate preferential policies; establish high-quality edible producing bases; promote the brand effect; pay attention to post-production development; develop the idea of new agricultural planting and cultivation.

  1. Transcriptome Sequencing of Lima Bean (Phaseolus lunatus to Identify Putative Positive Selection in Phaseolus and Legumes

    Directory of Open Access Journals (Sweden)

    Fengqi Li

    2015-07-01

    Full Text Available The identification of genes under positive selection is a central goal of evolutionary biology. Many legume species, including Phaseolus vulgaris (common bean and Phaseolus lunatus (lima bean, have important ecological and economic value. In this study, we sequenced and assembled the transcriptome of one Phaseolus species, lima bean. A comparison with the genomes of six other legume species, including the common bean, Medicago, lotus, soybean, chickpea, and pigeonpea, revealed 15 and 4 orthologous groups with signatures of positive selection among the two Phaseolus species and among the seven legume species, respectively. Characterization of these positively selected genes using Non redundant (nr annotation, gene ontology (GO classification, GO term enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analyses revealed that these genes are mostly involved in thylakoids, photosynthesis and metabolism. This study identified genes that may be related to the divergence of the Phaseolus and legume species. These detected genes are particularly good candidates for subsequent functional studies.

  2. 豆渣调味酱的研制%Study on Bean Dregs Tartare Sauce

    Institute of Scientific and Technical Information of China (English)

    何欢; 黄宇; 黄莉萍; 林琳

    2009-01-01

    利用豆渣为主要原料,加入白砂糖、食盐、豆油、豆酱、酱油、白酒、味精、食品添加荆等辅料,开发出风味较好、酱香味浓郁的豆渣调味酱.研究了去除豆渣油腻味最佳的方法,通过正交试验确定了豆渣调味酱的最佳配方.%Bean dregs tartare sauce regard fresh bean dregs as main raw materials,adding such batching as sugar,sah,oil,sauce,soy sauce,liquor,MSG,food additives,etc.,to make delicious food.This experiment studied the best way of Ilemoving the bean dregs'greasy taste,and determined the best formula of bean dregs tartare sauce through orthogonal test.

  3. [Comparison of green coffee beans volatiles chemical composition of Hainan main area].

    Science.gov (United States)

    Hu, Rong-Suo; Chu, Zhong; Gu, Feng-Lin; Lu, Min-Quan; Lu, Shao-Fang; Wu, Gui-Ping; Tan, Le-He

    2013-02-01

    Chemical component of Hainan green coffee beans was analyzed with solid phase microextraction-gas chromatography-mass spectrometry, and the discrepancy between two green coffee beans was differentiated through the spectrum database retrieval and retention index of compound characterization. The experimental results show that: the chemical composition of Wanning coffee beans and Chengmai coffee beans is basically the same. The quantity of analyzed compound in Wanning area coffee is 91, and in Chengmai area coffee is 106, the quantity of the same compound is 66, and the percent of the same component is 75.52%. The same compounds accounted for 89.86% of the total content of Wanning area coffee, and accounted for 85.70% of the total content of Chengmai area coffee.

  4. The effect of bean origin and temperature on grinding roasted coffee

    Science.gov (United States)

    Uman, Erol; Colonna-Dashwood, Maxwell; Colonna-Dashwood, Lesley; Perger, Matthew; Klatt, Christian; Leighton, Stephen; Miller, Brian; Butler, Keith T.; Melot, Brent C.; Speirs, Rory W.; Hendon, Christopher H.

    2016-04-01

    Coffee is prepared by the extraction of a complex array of organic molecules from the roasted bean, which has been ground into fine particulates. The extraction depends on temperature, water chemistry and also the accessible surface area of the coffee. Here we investigate whether variations in the production processes of single origin coffee beans affects the particle size distribution upon grinding. We find that the particle size distribution is independent of the bean origin and processing method. Furthermore, we elucidate the influence of bean temperature on particle size distribution, concluding that grinding cold results in a narrower particle size distribution, and reduced mean particle size. We anticipate these results will influence the production of coffee industrially, as well as contribute to how we store and use coffee daily.

  5. Proposal: Conservation of Price's Potato Bean on Sauta Cave National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Proposal is to conduct monitoring response of Price's potato bean to overstory tree removal and understory grass control at Sauta Cave NWR.

  6. Draft genome sequence of the ricin-producing oilseed castor bean

    Science.gov (United States)

    Chan, Agnes P.; Crabtree, Jonathan; Zhao, Qi; Lorenzi, Hernan; Orvis, Joshua; Puiu, Daniela; Melake-Berhan, Admasu; Jones, Kristine M.; Redman, Julia; Chen, Grace; Cahoon, Edgar B.; Gedil, Melaku; Stanke, Mario; Haas, Brian J.; Wortman, Jennifer R.; Fraser-Liggett, Claire M.; Ravel, Jacques; Rabinowicz, Pablo D.

    2010-01-01

    Castor bean (Ricinus communis) is an oil crop that belongs to the spurge (Euphorbiaceae) family. Its seeds are the source of castor oil, used for the production of high-quality lubricants due to its high proportion of the unusual fatty acid ricinoleic acid. Castor bean seeds also produce ricin, a highly toxic ribosome inactivating protein, making castor bean relevant for biosafety. We report here the 4.6X draft genome sequence of castor bean, representing the first reported Euphorbiaceae genome sequence. Our analysis shows that most key castor oil metabolism genes are single-copy while the ricin gene family is larger than previously thought. Comparative genomics analysis suggests the presence of an ancient hexaploidization event that is conserved across the dicotyledonous lineage. PMID:20729833

  7. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos

    2008-01-01

    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles...

  8. Host preference of the bean weevil Zabrotes subfasciatus

    Institute of Scientific and Technical Information of China (English)

    Isabel Ribeiro do Valle Teixeira; Angel Roberto Barchuk; Fernando Sérgio Zucoloto

    2008-01-01

    It is largely known that the range of an insect diet is mostly determined by oviposition behavior, mainly in species with endophytic larvae such as Zabrotes subfasciatus.However, the proximate factors determining host choice and the subsequent steps leading to the expansion or reduction of the host number and occasional host shifts are largelyun known. We analyzed various factors determining host preference of Z. subfasciatus through the evaluation of: (i) oviposition preference of a wild population of Z. subfasciatus on the usual host (bean) and unusual hosts (lentil, chickpea and soy), and the performance of the offspring; (ii) artificial selection for increasing preference for hosts initially less frequently chosen; (iii) comparison of oviposition behavior between two different popula-tions (reared for~30 generations in beans or chickpeas, respectively); (iv) oviposition timing on usual and unusual hosts; and (v) identification of preference hierarchies. We found that when using unusual hosts, there is no correlation between performance and preference and that the preference hierarchy changes only slightly when the population passes through several generations on the less frequently accepted host. We also found a positive response to artificial selection for increasing oviposition on the less preferred host; however, when the host-choice experiment involved two varieties of the usual host, the response was faster than when the choice involved usual and unusual hosts. Finally, beetles reared on an unusual host (chickpea) for 26 generations showed similar good fitness on both usual and unusual hosts,indicating that the use of a new host does not necessarily result in the loss of performance on the original host. Nevertheless, this population showed lower fitness on the usual host than that of the original population, suggesting an underlying partial trade-off phenomenon which may contribute to a broadening of diet of this insect species.

  9. Genetic diversity analysis of common beans based on molecular markers.

    Science.gov (United States)

    Gill-Langarica, Homar R; Muruaga-Martínez, José S; Vargas-Vázquez, M L Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl

    2011-10-01

    A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  10. Genetic diversity analysis of common beans based on molecular markers

    Directory of Open Access Journals (Sweden)

    Homar R. Gill-Langarica

    2011-01-01

    Full Text Available A core collection of the common bean (Phaseolus vulgaris L., representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each, as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP +3/+3 primer combinations and seven simple sequence repeats (SSR loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA and molecular variance (AMOVA analyses. AFLP analysis produced 530 bands (88.5% polymorphic while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus. AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  11. Faba bean drought responsive gene identification and validation

    Directory of Open Access Journals (Sweden)

    Megahed H. Ammar

    2017-01-01

    Full Text Available This study was carried out to identify drought-responsive genes in a drought tolerant faba bean variety (Hassawi 2 using a suppressive subtraction hybridization approach (SSH. A total of 913 differentially expressed clones were sequenced from a differential cDNA library that resulted in a total of 225 differentially expressed ESTs. The genes of mitochondrial and chloroplast origin were removed, and the remaining 137 EST sequences were submitted to the gene bank EST database (LIBEST_028448. A sequence analysis identified 35 potentially drought stress-related ESTs that regulate ion channels, kinases, and energy production and utilization and transcription factors. Quantitative PCR on Hassawi 2 genotype confirmed that more than 65% of selected drought-responsive genes were drought-related. Among these induced genes, the expression levels of eight highly up-regulated unigenes were further analyzed across 38 selected faba bean genotypes that differ in their drought tolerance levels. These unigenes included ribulose 1,5-bisphosphate carboxylase (rbcL gene, non-LTR retroelement reverse related, probable cyclic nucleotide-gated ion channel, polyubiquitin, potassium channel, calcium-dependent protein kinase and putative respiratory burst oxidase-like protein C and a novel unigene. The expression patterns of these unigenes were variable across 38 genotypes however, it was found to be very high in tolerant genotype. The up-regulation of these unigenes in majority of tolerant genotypes suggests their possible role in drought tolerance. The identification of possible drought responsive candidate genes in Vicia faba reported here is an important step toward the development of drought-tolerant genotypes that can cope with arid environments.

  12. Common bean cultivars and lines interactions with environments

    Directory of Open Access Journals (Sweden)

    Carbonell Sérgio Augusto Morais

    2004-01-01

    Full Text Available The performance of bean lines brought forth in breeding programs or of cultivars in use can be affected by environmental variability. The adaptability and stability of grain yield of 18 common bean cultivars and lines in 23 environments (combinations of seasons, years and locations were evaluated in the State of São Paulo, Brazil. 'IAC-Carioca' and 'IAC-Carioca Eté' were used as standard cultivars for the carioca grain type, while 'FT-Nobre' and 'IAC-Una' represented the standard for black grains. The experiment was set up in a randomized complete block design with four replications and plots consisting of two, two central five meters rows flanked by border rows. Stability parameters were estimated by the methods Maximum Yield Deviations (MYD and by the Additive Main Effects and Multiplicative Interaction Analysis (AMMI. For the identification of the most stable cultivars, the two methods led to consistent results, although by MYD the highest stability was always associated to the highest yield. 'MAC-733327' and 'LP 9637' were the most suitable cultivars and lines for the joint seasons, while 'LP 9637' and 'FT-Nobre' were the most suitable for the dry season. The MYD method combined a simple procedure, easiness of result interpretation, uniqueness of parameters, and association between stability and yield. On the other hand, the AMMI method simplified the identification of stable cultivars by visual inspection, also providing information on the environments. However, the complex nature which combines uni-and multivariate techniques hampers its widespread use in breeding programs.

  13. Inheritance of resistance to the bean-pod weevil (Apion godmani Wagner) in common beans from Mexico.

    Science.gov (United States)

    Garza, R; Cardona, C; Singh, S P

    1996-03-01

    The bean-pod weevil (BPW), Apion godmani Wagner, often causes heavy losses in crops of common bean (Phaseolus vulgaris L.). Farmers need resistant bean cultivars to minimize losses, cut production costs, stabilize seed yield, and reduce pesticide use and consequent health hazards. To design effective breeding methods, breeders need new and better sources of resistance and increased knowledge of their modes of inheritance. We therefore: (1) compared sources of resistance to BPW, (2) studied the inheritance of resistance, and (3) determined whether the sources possess similar or different genes for BPW resistance. The following sources of resistance, originating from the Mexican highlands, were evaluated for 3 years at INIFAP-Santa Lucía de Prias, Texcoco, Mexico: 'Amarillo 153', 'Amarillo 169', 'Hidalgo 58', 'J 117', 'Pinto Texcoco', 'Pinto 168', and 'Puebla 36'. All except 'Puebla 36' were crossed with the susceptible cultivar 'Jamapa'. 'Amarillo 153' and 'Puebla 36' were crossed with another susceptible cultivar, 'Bayo Mex'. The parents, F1 hybrids, and F2 populations were evaluated for BPW damage in 1992. Backcrosses of the F1 of Jamapa/Pinto 168 to the respective susceptible and resistant parents were also evaluated in 1992. All seven resistant accessions were crossed in all possible combinations, excluding reciprocals. The resulting 21 F1 hybrids and 21 F2 populations were evaluated for BPW damage in 1994. 'J 117' had the highest level of resistance to BPW. 'Pinto Texcoco' and 'Puebla 36' had the highest mean damage score of all seven sources of resistance. The F1 hybrids between susceptible parents and resistant sources were generally intermediate. Two genes segregating independently controlled the BPW resistance in each accession. One gene, Agm, has no effect when present alone, whereas the other gene, Agr, alone conferred intermediate resistance. When both genes were present, resistance to BPW was higher. Based on mean BPW damage scores, all 21 F1 hybrids

  14. Analysis of simple sequence repeats in rice bean (Vigna umbellata) using an SSR-enriched library

    Institute of Scientific and Technical Information of China (English)

    Lixia Wang; Kyung Do Kim; Dongying Gao; Honglin Chen; Suhua Wang; SukHa Lee; Scott A. Jackson; Xuzhen Cheng

    2016-01-01

    Rice bean (Vigna umbellata Thunb.), a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%). Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7%of the total, followed by AAG/CTT (14.3%), and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2%were involved in cellular components, 24.2%were involved molecular functions, and 64.6%were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker-assisted selection in

  15. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker

  16. Tylosema esculentum (Marama) Tuber and Bean Extracts Are Strong Antiviral Agents against Rotavirus Infection

    OpenAIRE

    Walter Chingwaru; Runner T. Majinda; Sam O. Yeboah; Jackson, Jose C.; Petrina T. Kapewangolo; Martha Kandawa-Schulz; Avrelija Cencic

    2011-01-01

    Tylosema esculentum (marama) beans and tubers are used as food, and traditional medicine against diarrhoea in Southern Africa. Rotaviruses (RVs) are a major cause of diarrhoea among infants, young children, immunocompromised people, and domesticated animals. Our work is first to determine anti-RV activity of marama bean and tuber ethanol and water extracts; in this case on intestinal enterocyte cells of human infant (H4), adult pig (CLAB) and adult bovine (CIEB) origin. Marama cotyledon ethan...

  17. Physical Characteristics of Coffee Beans from Steaming Processin Single Column Reactor

    Directory of Open Access Journals (Sweden)

    Sukrisno Widyotomo

    2010-05-01

    Full Text Available One of important steps in decaffeination process is steaming. The aim of steaming is to expand coffee beans porosity in order to obtain optimal condition for decaffeination process. Steaming can be done in single column reactor using saturated water vapour as media. The objective of this research is to study physical characteristics of coffee beans after steaming process using single column reactor. Material tested was Robusta coffee with 13—14% moisture content after dry processing. Reactor capacity is 6 kg dried coffee beans and 30 l water to produce water vapour. Dried coffee beans classified in 4 grades, i.e. diameter size (d d>7,5 mm; 6,5beans expanded 8.6—9.5% in length, 12.2—13.3% in width, and 18.3—20.6% in thickness. Coffee bean volume increased 30—50%. Coffee bean moisture content increased f. Aritmatic diameter increased 8—13% while geometric diameter increased 9—18%. Sphericity not affected. Surface area increased 18—37%. True density increased 19—30% while bulk density was while. Porosity increased from 13—18% to 24—39% while coffee beans texture decreased from 323—384 g/1 mm to 212—225 g/1 mm. Color change increased from 14—20 to 38—40. The optimum steaming process was 3 hours.Key words : Coffee, steaming, single column reactor, decaffeination.

  18. Control of angular leaf spot on dry beans with fungicides and its effect on plant production

    OpenAIRE

    Deman, Luis Alfredo Raue; Maringoni, Antonio Carlos [UNESP

    2012-01-01

    The angular leaf spot of dry bean caused by the fungus Phaeoisairopsis griseola is a very important disease on dry bean crops in Brazil. In propitious weather conditions, susceptible cultivars have significant losses due to this disease. In these conditions, fungicide usage is an important step for angular leaf spot management. Since the effects of this method of control on plant physiology are not known, this study had the following objectives: a) Verify the action of fungicide in physiologi...

  19. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    Science.gov (United States)

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed.

  20. Beans (Phaseolus vulgaris) are an important part of the Costa Rican diet.

    OpenAIRE

    2004-01-01

    Nevertheless, the amount and the frequencyof its consumption has been decreasing over time, especiallyin the urban areas1 This tendency is a concern to thoseinvolved in health and nutrition since beans are a source ofprotein, non-heme iron, fiber, folic acid, thiamin, potassium,magnesium and zinc2. The nutritional contribution of beanslo the Costa Rican diet is important in spite of the reductionin consumption. Beans are important because of their nutrientcontent and the presence of phytochem...

  1. Physicochemical, morphological and rheological properties of canned bean pastes "negro Queretaro" variety (Phaseolus vulgaris L.).

    Science.gov (United States)

    Martínez-Preciado, A H; Estrada-Girón, Y; González-Álvarez, A; Fernández, V V A; Macías, E R; Soltero, J F A

    2014-09-01

    Proximate, thermal, morphological and rheological properties of canned "negro Querétaro" bean pastes, as a function of fat content (0, 2 and 3 %) and temperature (60, 70 and 85 °C), were evaluated. Raw and precooked bean pastes were characterized by scanning electron microscopy (SEM) and differential scanning calorimetry (DSC). Well-defined starch granules in the raw bean pastes were observed, whereas a gelatinized starch paste was observed for the canned bean pastes. The DSC analysis showed that the raw bean pastes had lower onset peak temperatures (79 °C, 79.1 °C) and gelatinization enthalpy (1.940 J/g), compared to that precooked bean pastes (70.4 °C, 75.7 °C and 1.314 J/g, respectively) thermal characteristics. Moreover, the dynamic rheological results showed a gel-like behavior for the canned bean pastes, where the storage modulus (G') was frequency independent and was higher than the loss modulus (G″). The non-linear rheological results exhibited a shear-thinning flow behavior, where the steady shear-viscosity was temperature and fat content dependent. For canned bean pastes, the shear-viscosity data followed a power law equation, where the power law index (n) decreased when the temperature and the fat content increased. The temperature effect on the shear-viscosity was described by an Arrhenius equation, where the activation energy (Ea) was in the range from 19.04 to 36.81 KJ/mol. This rheological behavior was caused by gelatinization of the starch during the cooking and sterilization processes, where starch-lipids and starch-proteins complex were formed.

  2. Effect of edible coating on the aromatic attributes of roasted coffee beans

    OpenAIRE

    Rattan, Supriya; Parande, A. K.; Ramalakshmi, K.; Nagaraju, V. D.

    2015-01-01

    Coffee is known throughout the world for its distinct aroma and flavour which results from a number of volatile compounds present in it. It is very difficult to arrest the aromatic compounds once the roasting process is complete and it becomes even more challenging to store the beans for a longer time with the retained volatiles as these compounds are easily lost during industrialized processing such as the grinding of roasted coffee beans and storage of ground coffee. Thus, an attempt was ma...

  3. Susceptibility of six cultivars of bean to different isolates of two species of Fusariumin greenhouse.

    Science.gov (United States)

    Faraji, M; Okhovvat, S M

    2005-01-01

    In greenhouse, susceptibility of 6 cultivars of bean (b1, green bean cv. contender, b2, Pinto b. cv. Cos-16, b3, green b. Sun Ray, b4, white b. cv. Daneshkadeh, b5, red b. cv. Naz, b6, red b. cv. Goli) evaluated to 7 isolates of 2 species of Fusarium (6 isolates of F. oxysporum and 1 isolate of F. solani from Varamin, Iran) in 4 pots (as replications) in factoriel experiment. The seedlings of each bean cultivars soaked in a suspension of the fungi (106 spores/ml.) for 5 minutes and transplanted into the pots contained sterilized soil, for control, the roots soaked in distilled water. After 35 days of inoculating and transplanting in greenhouse conditions (with 18-26 degrees C and 12 h light & 12 h dark) the percentage of necrotic roots and stems of the seedlings affected to the isolates of the fungi, also height and weight of them in different treatments datermined and calculated. The results showed that, the average of necrotic percent of the cultivars of bean seedlings grouped in 3 category (b1, b2, b3, b4 with 25.15% in group a and b5, red bean cv. Naz with 16.29% in group b and b6 red bean cv. Goli with 10.02% in group c) based on cluster analysis. But by Dunken method the infection set on 5 groups as respectively b4, 28,72% (a), b2, 25.83% (ab), b1 & b3, 23,18% & 22.84% (b), b5, 16.29% (c) and b6, 10.02% (d). So, red bean cv. Goli was more resistant and white bean cv. Daneshkadeh was more susceptible than of another cultivars, but averse the effect of the fungi on growth factors were different.

  4. Identification of bean varieties according to color features using artificial neural network

    Directory of Open Access Journals (Sweden)

    A. Nasirahmadi

    2013-07-01

    Full Text Available A machine vision and a multilayer perceptron artificial neural network (MLP-ANN were applied to identify bean varieties, based on color features. Ten varieties of beans, which were grown in Iran (Khomein1, KS21108, Khomein2, Sarab1, Khomein3, KS21409, Akhtar2, Sarab2, KS21205, and G11870 were collected. Six color features of the bean and six color features of the spots were extracted and used as input for MLP-ANN classifier. In this study, 1000 data sets were used, 70% for training, 15% for validating and 15% for testing. The results showed that the applied machine vision and neural network were able to classify bean varieties with 100% sensibility and specificity, except with Sarab1 with sensibilities of 100%, 73.3%, 60% for the training, validation and testing processes, respectively and KS21108 with specificities of 100%, 79% and 71%, respectively for the aforementioned processes. Considering total sensibilities of 100%, 97.33%, 96% and also specificities of 100%, 97.9% and 97.1% for training, validation and testing of beans, respectively, the ANN could be used as a effective tool for classification of bean varieties.

  5. Morphological characteristic of purple long yard bean cultivars and their tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    M W Lestari

    2015-01-01

    Full Text Available The cultivation of purple long yard bean which tolerance to drought stress and have high productivity can improve farming in arid area. The purpose of this study was to evaluate the mechanism of the tolerance purple long yard beans to drought stress based on morphologic characters, to get the hypothesis method of tolerance and to obtain tolerance cultivars to the drought stress. Eight cultivars of purple long yard beans, i.e. UBPHU1-41, UBPHU1-130, UBPU3-153, UBPU1-202, UBPU2-222, UBPU1-365, Brawijaya 4 and Bagong 2, were tested in two environmental conditions, 100% field capacity and 50% field capacity. The results showed that drought stress in purple long yard bean affected all morphological characters observed, except for root length and flowering time. Estimation of tolerance to drought stress using the Principles Component Analysis (PCA showed that the shoot fresh weight could be an indicator of purple pod bean tolerance to drought stress. However, the test using Stress Susceptibility Index (SSI was not able to classify the purple long yard bean tolerance to drought stress. The results of analysis using PCA followed by discriminant analysis and clustering dendrogram showed that the UBPU1-41, UBPU1-130, UBPU2-222, UBPU1-365, UB4 and Bagong 2 cultivars were medium cultivars that are tolerant to drought stress. Therefore, they can be planted in semiarid regions.

  6. GC-MS detection of chiral markers in cocoa beans of different quality and geographic origin.

    Science.gov (United States)

    Caligiani, Augusta; Cirlini, Martina; Palla, Gerardo; Ravaglia, Roberta; Arlorio, Marco

    2007-05-05

    Fermented cocoa beans (Theobroma cacao L., Sterculiaceae) from different countries of origin (Ecuador, Ghana, Trinidad) and cocoa beans roasted under defined conditions (industrial roasting; 150-220 degrees C for 20 min, dry roasting in conventional oven) were analyzed for their contents of certain chiral hydroxy acids, catechins, and amino acids. Cocoa beans are fermented, dried, and industrially transformed by roasting for the production of chocolate, cocoa powders, and other cocoa-related products. Fermentation and roasting conditions influence the contents of chiral compounds such as hydroxy acids, amino acids, and polyphenols, depending on technological procedures as well as some technical parameters. The aim of this work was to check if the content and nature of the named chiral compounds present both in fermented and roasted cocoa beans could be related to the traditional parameters used to classify the variety of seeds and the degree of fermentation. The extent of racemization of amino acids in fermented cocoa beans was low while it slowly increased during roasting, depending on the temperature applied. L-lactic acid was always higher than the D-form while citric acid was generally the most abundant hydroxy acid detected in beans. A correlation was found between polyphenol content and degree of fermentation, while epimerization of (-)-epicatechin to (+)-catechin was observed during roasting. On the whole, results showed that several chiral compounds could be considered as good quality markers for cocoa seeds and cocoa-related products of different quality and geographic origin.

  7. Use of Wild Relatives and Closely Related Species to Adapt Common Bean to Climate Change

    Directory of Open Access Journals (Sweden)

    James D. Kelly

    2013-05-01

    Full Text Available Common bean (Phaseolus vulgaris L. is an important legume crop worldwide. However, abiotic and biotic stress limits bean yields to <600 kg ha−1 in low-income countries. Current low yields result in food insecurity, while demands for increased yields to match the rate of population growth combined with the threat of climate change are significant. Novel and significant advances in genetic improvement using untapped genetic diversity available in crop wild relatives and closely related species must be further explored. A meeting was organized by the Global Crop Diversity Trust to consider strategies for common bean improvement. This review resulted from that meeting and considers our current understanding of the genetic resources available for common bean improvement and the progress that has been achieved thus far through introgression of genetic diversity from wild relatives of common bean, and from closely related species, including: P. acutifolius, P. coccineus, P. costaricensis and P. dumosus. Newly developed genomic tools and their potential applications are presented. A broad outline of research for use of these genetic resources for common bean improvement in a ten-year multi-disciplinary effort is presented.

  8. Identification of novel orosensory active molecules in cured vanilla Beans (Vanilla planifolia).

    Science.gov (United States)

    Schwarz, Bernd; Hofmann, Thomas

    2009-05-13

    Sequential application of solvent extraction, gel permeation chromatography, and HPLC in combination with taste dilution analyses, followed by LC-MS and 1D/2D NMR experiments, led to the discovery of seven velvety mouth-coating molecules in cured beans of Vanilla planifolia . Among these, 5-(4-hydroxybenzyl)vanillin, 4-(4-hydroxybenzyl)-2-methoxyphenol, 4-hydroxy-3-(4-hydroxy-3-methoxybenzyl)-5-methoxybenzaldehyde, (1-O-vanilloyl)-(6-O-feruloyl)-beta-d-glucopyranoside, americanin A, and 4',6'-dihydroxy-3',5-dimethoxy-[1,1'-biphenyl]-3-carboxaldehyde were previously not reported in vanilla beans. Sensory studies revealed human recognition thresholds for the velvety mouth-coating sensation between 1.0 and 5.0 mumol/kg (water). Interestingly, the biphenyl derivatives were found to enhance the perception of creaminess and fatty body of sweetened skim milk, among which 4',6'-dihydroxy-3',5-dimethoxy-[1,1'-biphenyl]-3-carboxaldehyde showed the lowest threshold level of 5 mumol/kg. Quantitative analysis of these compounds in cured vanilla beans from different origins as well as in noncured beans revealed that, with the exception of americanin A, all of the other taste compounds are not present in the green vanilla beans and are formed during the bean curing process.

  9. Amino Acid, Organic Acid, and Sugar Profiles of 3 Dry Bean (Phaseolus vulgaris L.) Varieties.

    Science.gov (United States)

    John, K M Maria; Luthria, Devanand

    2015-12-01

    In this study, we compared the amino acid, organic acid and sugar profiles of 3 different varieties of dry beans (black bean [BB], dark red bean [DRB], and cranberry bean [CB]). The efficiency of the 2 commonly used extraction solvents (water and methanol:chloroform:water [2.5:1:1, v/v/v/]) for cultivar differentiation based on their metabolic profile was also investigated. The results showed that the BB contained the highest concentration of amino acids followed by DRB and CB samples. Phenylalanine, a precursor for the biosynthesis of phenolic secondary metabolites was detected at low concentration in CB samples and correlated with the reduced anthocyanins content in CB extract as documented in the published literature. Comparing the extractability of 2 extraction solvents, methanol:chloroform:water (2.5:1:1, v/v/v/) showed higher recoveries of amino acids from 3 beans, whereas, sugars were extracted in higher concentration with water. Analytically, gas chromatography detected sugars (9), amino acids (11), and organic acids (3) in a single run after derivatization of the extracts. In comparison, ion chromatography detected only sugars in a single run without any derivatization step with the tested procedure. Bean samples are better differentiated by the sugar content extracted with water as compared to the aqueous organic solvent extracts using partial least-square discriminant analysis.

  10. Identity recognition in response to different levels of genetic relatedness in commercial soya bean

    Science.gov (United States)

    Van Acker, Rene; Rajcan, Istvan; Swanton, Clarence J.

    2017-01-01

    Identity recognition systems allow plants to tailor competitive phenotypes in response to the genetic relatedness of neighbours. There is limited evidence for the existence of recognition systems in crop species and whether they operate at a level that would allow for identification of different degrees of relatedness. Here, we test the responses of commercial soya bean cultivars to neighbours of varying genetic relatedness consisting of other commercial cultivars (intraspecific), its wild progenitor Glycine soja, and another leguminous species Phaseolus vulgaris (interspecific). We found, for the first time to our knowledge, that a commercial soya bean cultivar, OAC Wallace, showed identity recognition responses to neighbours at different levels of genetic relatedness. OAC Wallace showed no response when grown with other commercial soya bean cultivars (intra-specific neighbours), showed increased allocation to leaves compared with stems with wild soya beans (highly related wild progenitor species), and increased allocation to leaves compared with stems and roots with white beans (interspecific neighbours). Wild soya bean also responded to identity recognition but these responses involved changes in biomass allocation towards stems instead of leaves suggesting that identity recognition responses are species-specific and consistent with the ecology of the species. In conclusion, elucidating identity recognition in crops may provide further knowledge into mechanisms of crop competition and the relationship between crop density and yield. PMID:28280587

  11. FTIR Study of White and Green Broad Beans Based on Curve-fitting

    Institute of Scientific and Technical Information of China (English)

    Xiaohua; WANG; Gang; LIU; Quanhong; OU; Xingxiang; ZHAO; Jianming; HAO; Xiangping; ZHOU

    2013-01-01

    Fourier transform infrared(FTIR)spectroscopy was used to study two kinds of broad beans with white and green cotyledons respectively.The results show that the infrared spectra of the two kinds of broad beans are similar and mainly made up of the absorption bands of protein,and polysaccharides.The second derivative infrared spectra amplified the differences and revealed that there were some obvious differences in the range of 1 800-700 cm-1and 1 200-700 cm-1.Hierarchical cluster analysis(HCA)were used for the discrimination of the two kinds broad beans based on the second derivative spectral data in the region of 1 611-1 100 cm-1,and yielded 88.9%accuracy.The spectra in the range from 1 700 to 1 600 cm-1were used to perform Fourier self-deconvolution and curve fitting,which obtained nine peaks.The ratios of relative areas of the bands atα-helix,β-sheet,β-turn and the unordered structure of protein in white beans were 67.71%,35.6%,35.6%and 21.09%respectively,while the ratios in green beans were 8.02%,31.59%,37.12%and 23.27%respectively.The results indicate that the secondary structure of protein was different in the two kinds of broad beans.

  12. Effects of High Hydrostatic Pressure on Water Absorption of Adzuki Beans

    Directory of Open Access Journals (Sweden)

    Shigeaki Ueno

    2015-05-01

    Full Text Available The effect of high hydrostatic pressure (HHP treatment on dried soybean, adzuki bean, and kintoki kidney bean, which are low-moisture-content cellular biological materials, was investigated from the viewpoint of water absorption. The samples were vacuum-packed with distilled water and pressurized at 200 MPa and 25 °C for 10 min. After the HHP treatment, time courses of the moisture contents of the samples were measured, and the dimensionless moisture contents were estimated. Water absorption in the case of soybean could be fitted well by a simple water diffusion model. High pressures were found to have negligible effects on water absorption into the cotyledon of soybean and kintoki kidney bean. A non-linear least square method based on the Weibull equation was applied for the adzuki beans, and the effective water diffusion coefficient was found to increase significantly from 8.6 × 10−13 to 6.7 × 10−10 m2/s after HHP treatment. Approximately 30% of the testa of the adzuki bean was damaged upon HHP treatment, which was comparable to the surface area of the testa in the partially peeled adzuki bean sample. Thus, HHP was confirmed to promote mass transfer to the cotyledon of legumes with a tight testa.

  13. Drought tolerance in wild plant populations: the case of common beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Cortés, Andrés J; Monserrate, Fredy A; Ramírez-Villegas, Julián; Madriñán, Santiago; Blair, Matthew W

    2013-01-01

    Reliable estimations of drought tolerance in wild plant populations have proved to be challenging and more accessible alternatives are desirable. With that in mind, an ecological diversity study was conducted based on the geographical origin of 104 wild common bean accessions to estimate drought tolerance in their natural habitats. Our wild population sample covered a range of mesic to very dry habitats from Mexico to Argentina. Two potential evapotranspiration models that considered the effects of temperature and radiation were coupled with the precipitation regimes of the last fifty years for each collection site based on geographical information system analysis. We found that wild accessions were distributed among different precipitation regimes following a latitudinal gradient and that habitat ecological diversity of the collection sites was associated with natural sub-populations. We also detected a broader geographic distribution of wild beans across ecologies compared to cultivated common beans in a reference collection of 297 cultivars. Habitat drought stress index based on the Thornthwaite potential evapotranspiration model was equivalent to the Hamon estimator. Both ecological drought stress indexes would be useful together with population structure for the genealogical analysis of gene families in common bean, for genome-wide genetic-environmental associations, and for postulating the evolutionary history and diversification processes that have occurred for the species. Finally, we propose that wild common bean should be taken into account to exploit variation for drought tolerance in cultivated common bean which is generally considered susceptible as a crop to drought stress.

  14. Drought tolerance in wild plant populations: the case of common beans (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Andrés J Cortés

    Full Text Available Reliable estimations of drought tolerance in wild plant populations have proved to be challenging and more accessible alternatives are desirable. With that in mind, an ecological diversity study was conducted based on the geographical origin of 104 wild common bean accessions to estimate drought tolerance in their natural habitats. Our wild population sample covered a range of mesic to very dry habitats from Mexico to Argentina. Two potential evapotranspiration models that considered the effects of temperature and radiation were coupled with the precipitation regimes of the last fifty years for each collection site based on geographical information system analysis. We found that wild accessions were distributed among different precipitation regimes following a latitudinal gradient and that habitat ecological diversity of the collection sites was associated with natural sub-populations. We also detected a broader geographic distribution of wild beans across ecologies compared to cultivated common beans in a reference collection of 297 cultivars. Habitat drought stress index based on the Thornthwaite potential evapotranspiration model was equivalent to the Hamon estimator. Both ecological drought stress indexes would be useful together with population structure for the genealogical analysis of gene families in common bean, for genome-wide genetic-environmental associations, and for postulating the evolutionary history and diversification processes that have occurred for the species. Finally, we propose that wild common bean should be taken into account to exploit variation for drought tolerance in cultivated common bean which is generally considered susceptible as a crop to drought stress.

  15. Identification of 14-3-3 Family in Common Bean and Their Response to Abiotic Stress.

    Directory of Open Access Journals (Sweden)

    Ruihua Li

    Full Text Available 14-3-3s are a class of conserved regulatory proteins ubiquitously found in eukaryotes, which play important roles in a variety of cellular processes including response to diverse stresses. Although much has been learned about 14-3-3s in several plant species, it remains unknown in common bean. In this study, 9 common bean 14-3-3s (PvGF14s were identified by exhaustive data mining against the publicly available common bean genomic database. A phylogenetic analysis revealed that each predicted PvGF14 was clustered with two GmSGF14 paralogs from soybean. Both epsilon-like and non-epsilon classes of PvGF14s were found in common bean, and the PvGF14s belonging to each class exhibited similar gene structure. Among 9 PvGF14s, only 8 are transcribed in common bean. Expression patterns of PvGF14s varied depending on tissue type, developmental stage and exposure of plants to stress. A protein-protein interaction study revealed that PvGF14a forms dimer with itself and with other PvGF14 isoforms. This study provides a first comprehensive look at common bean 14-3-3 proteins, a family of proteins with diverse functions in many cellular processes, especially in response to stresses.

  16. Carcass, organ and organoleptic characteristics of broilers fed yeast treated raw soya bean and full fat soya bean

    Directory of Open Access Journals (Sweden)

    I.J. Onwumelu

    2014-02-01

    Full Text Available Carcass, Organs andOrganoleptic Characteristics of broilers fed yeast treated raw soya bean (RSBand full fat soya bean (FFSB were studied using one hundred and eighty day oldchicks. Standard poultry management techniques were applied and experimenteddiets provided ad libitum. Fifteen diets consisting of various proportions ofFFSB, RSB and yeast were formulated for the starter phase (0- 28 days andfinisher phase (29-56 days, respectively. The diets in each phase wereformulated to be isocaloric and isonitrogenous with the starter dietscontaining approximately 2900 kcal/kg ME and 23% crude protein, and thefinisher diets containing approximately 3000 kcal/kg and 20% crude protein. Thecarcass and organs studied include weights after defeathering, cut- up partswhich include thighs drumstick, shanks, wings, neck, back, breast head, andorgans such as heart, liver, spleen and gizzard. The lengths of theproventriculus, small intestine, colon and caeca were also measured. The studyshowed that RSB at the levels fed with and without yeast inclusion had nolethal effect on broiler chickens. However, higher performance may be achievedwhen RSB is fed at 25 % with 6 g/kg yeast inclusion at starter phase and at 25% without yeast or 75 % with 12 g/kg yeast inclusion. The study therefore,further maintained that inclusion of RSB with or without yeast in the diets ofbroilers can equally produce broiler with good weight comparable with feedingFFSB or conventional diets; feeding 75 % FFSB + 25 % RSB without yeastinclusion is capable of increasing the proportion of the broilers’ head andshank; RSB inclusion in broiler diets cause increase in the weight of thegizzard, pancreas as well as on the abdominal fat, and feeding FFSB and RSBwith or without east inclusion do not exert any noticeable effect on theorganoleptic ualities tenderness, flavour and in general acceptability ofbroilers. However, RSB enhances the juiciness of broilers

  17. PEMANFAATAN BIJI KERANDANG (Canavalia virosa) SEBAGAI BAHAN PENGGANTI KEDELAI DALAM PEMBUATAN TAHU Utilization of Tribal Bean (Canavalia virosa) as Soybean Substitution in Tofu Making

    OpenAIRE

    Titiek F. Djaafar; Nurdeana Nurdeana; Siti Rahayu; Erni Apriyati

    2012-01-01

    Tribal bean (Canavalia virosa) is a type of grain that can be found along the coast of Kulon Progo Regency, Yogya- karta. Tribal bean potential as an alternative food to soybeans substitution. This study aims to determine the physical and chemical quality of tribal bean tofu. Six treatments was performed namely (a) tribal bean:soybean = 50 %:50% with rice vinegar 2 % coagulant; (b) tribal bean:soybean = 25 %:75 % with rice vinegar 2 % coagulant; (c) tribal bean:soybean = 50 %:50 % with lactic...

  18. Contribution of Bacillus Isolates to the Flavor Profiles of Vanilla Beans Assessed through Aroma Analysis and Chemometrics

    OpenAIRE

    Fenglin Gu; Yonggan Chen; Yiming Fang; Guiping Wu; Lehe Tan

    2015-01-01

    Colonizing Bacillus in vanilla (Vanilla planifolia Andrews) beans is involved in glucovanillin hydrolysis and vanillin formation during conventional curing. The flavor profiles of vanilla beans under Bacillus-assisted curing were analyzed through gas chromatography-mass spectrometry, electronic nose, and quantitative sensory analysis. The flavor profiles were analytically compared among the vanilla beans under Bacillus-assisted curing, conventional curing, and non-microorganism-assisted curin...

  19. FORMULATION AND NUTRITIONAL QUALITY OF INFANT FORMULA PRODUCED FROM GERMINATED POPCORN, BAMBARA GROUNDNUT AND AFRICAN LOCUST BEAN FLOUR

    OpenAIRE

    Oluwole Steve Ijarotimi; Oluremi Olufunke Keshinro

    2012-01-01

    The aim of this present study was to produce and evaluate the nutritional quality of complementary foods from popcorn, African locust bean and Bambara groundnut. The popcorn, bambara groundnut and African locust beans were obtained locally in Akure, Nigeria. The seeds were germinated, oven dried, milled and sieved into flours. The flours were mixed as follows: GPA (70% popcorn, 30% African locust bean), GPB (70% popcorn, 30% bambara groundnut) and GPAB (70% popcorn, 20% bambara groundnut, 10%...

  20. Parameterization of almanac crop simulation model for non-irrigated dry bean in semi-arid temperate areas in Mexico

    OpenAIRE

    Alma Delia Baez-Gonzalez; James R. Kiniry; Jose Saul Padilla Ramirez; Guillermo Medina Garcia; Jose Luis Ramos Gonzalez; Esteban Salvador Osuna Ceja

    2015-01-01

    Dry bean simulation models can be used to make management decisions when properly parameterized. This study aimed to parameterize the ALMANAC (Agricultural Land Management Alternatives with Numerical Assessment Criteria) crop simulation model for dry bean in the semi-arid temperate areas of Mexico. The parameterization process was based on data from two important non-irrigated dry bean fields in Mexico. The parameters were potential heat units (PHU), leaf area index (LAI) and harvest index (H...

  1. Common bean: a legume model on the rise for unraveling responses and adaptations to iron, zinc and phosphate deficiencies.

    Directory of Open Access Journals (Sweden)

    Norma A Castro Guerrero

    2016-05-01

    Full Text Available Common bean (Phaseolus vulgaris was domesticated ~8000 years ago in the Americas and today is a staple food worldwide. Besides caloric intake, common bean is also an important source of protein and micronutrients and it is widely appreciated in developing countries for their affordability (compared to animal protein and its long storage life. As a legume, common bean also has the economic and environmental benefit of associating with nitrogen-fixing bacteria, thus reducing the use of synthetic fertilizers, which is key for sustainable agriculture. Despite significant advances in the plant nutrition field, the mechanisms underlying the adaptation of common bean to low nutrient input remains largely unknown. The recent release of the common bean genome offers, for the first time, the possibility of applying techniques and approaches that have been exclusive to model plants to study the adaptive responses of common bean to challenging environments. In this review, we discuss the hallmarks of common bean domestication and subsequent distribution around the globe. We also discuss recent advances in phosphate, iron, and zinc homeostasis, as these nutrients often limit plant growth, development and yield. In addition, iron and zinc are major targets of crop biofortification to improve human nutrition. Developing common bean varieties able to thrive under nutrient limiting conditions will have a major impact on human nutrition, particularly in countries where dry beans are the main source of carbohydrates, protein and minerals.

  2. NITROGEN BALANCE AND RUMEN MICROBIAL PROTEIN SYNTHESIS IN GOATS FED DIETS CONTAINING SOAKED AND ROASTED MUCUNA BEAN (Mucuna Pruriens

    Directory of Open Access Journals (Sweden)

    M. R. MBEWE

    2014-01-01

    Full Text Available The effect of soaking and roasting velvet beans (Mucuna pruriens on nitrogen utilization and rumen microbial protein synthesis in goats was investigated. Sixteen goats were randomly assigned to four diets in a completely randomized design. Goats were fed a basal diet of Cynodon dactylon hay plus 30% soaked (treatment 1, 30% roasted (treatment 2 and 30% untreated velvet bean (treatment 3. The control diet had 100% hay (treatment 4. Animals were given experimental diets over 14 days following a 7-day adjustment period. Feed, refusals, urine and faecal samples were collected daily from individual goats for determination of nitrogen, nitrogen intake, utilization and allantoin in faeces and urine. Microbial protein yield was estimated from the allantoin. Data were analysed using PROC General Linear Model of Statistical Analysis Software. Goats fed a diet with soaked beans had significantly higher (P0.05 from that of goats fed untreated beans. Microbial protein synthesis was highest for diets with soaked beans although this was non-significantly different (P>0.05 from diets with roasted and untreated beans. All diets containing velvet beans, processed or not, contributed to significantly higher (P<0.05 microbial protein yield than diets with hay only. In terms of nitrogen balance, soaking can be recommended as an appropriate processing method for velvet beans for goat feeding. However, for microbial protein yield, processing method was not statistically important and the bean could be used untreated producing the same results.

  3. Kidney bean: a major sensitizer among legumes in asthma and rhinitis patients from India.

    Directory of Open Access Journals (Sweden)

    Ramkrashan Kasera

    Full Text Available BACKGROUND: The prevalence of IgE mediated food allergies has increased over the last two decades. Food allergy has been reported to be fatal in highly sensitive individuals. Legumes are important food allergens but their prevalence may vary among different populations. The present study identifies sensitization to common legumes among Indian population, characterizes allergens of kidney bean and establishes its cross reactivity with other legumes. METHODOLOGY: Patients (n = 355 with history of legume allergy were skin prick tested (SPT with 10 legumes. Specific IgE (sIgE and total IgE were estimated in sera by enzyme-linked immunosorbent assay. Characterization of kidney bean allergens and their cross reactivity was investigated by immunobiochemical methods. Identification of major allergens of kidney bean was carried out by mass spectrometry. PRINCIPAL FINDINGS: Kidney bean exhibited sensitization in 78 (22.0% patients followed by chickpea 65 (18.0% and peanut 53 (15%. SPT positive patients depicted significantly elevated sIgE levels against different legumes (r = 0.85, p<0.0001. Sera from 30 kidney bean sensitive individuals exhibited basophil histamine release (16-54% which significantly correlated with their SPT (r = 0.83, p<0.0001 and sIgE (r = 0.99, p<0.0001. Kidney bean showed eight major allergens of 58, 50, 45, 42, 40, 37, 34 and 18 kDa on immunoblot and required 67.3±2.51 ng of homologous protein for 50% IgE inhibition. Inhibition assays revealed extensive cross reactivity among kidney bean, peanut, black gram and pigeon pea. nLC-MS/MS analysis identified four allergens of kidney bean showing significant matches with known proteins namely lectin (phytohemagglutinin, phaseolin, alpha-amylase inhibitor precursor and group 3 late embryogenesis abundant protein. CONCLUSION/SIGNIFICANCE: Among legumes, kidney bean followed by chick pea and peanut are the major allergic triggers in asthma and rhinitis patients in India

  4. Interference of redroot pigweed (Amaranthus retroflexus L.) in green bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Mirshekari, B; Dabbagh Mohammadi Nasab, A; Biroonara, A

    2006-01-01

    Several species of Amaranthus are known to reduce crop yields and interference with harvest throughout the Iran. In the past few years, the occurrence of some Amaranthus species including of redroot pigweed (Amaranthus retroflexus L.) increased throughout the East Azerbaijan province in Iran, supplanting all the other Amaranthus species in large areas of the region and causing concern among farmers and researchers. Green bean (Phaseolus vulgaris L.) is one of the tropical pulse crops, that C4 weeds such as redroot pigweed can cause yield loss in this crop production. In order to determine the critical period of redroot pigweed control in green bean, two experiments were conducted in Islamic Azad University of Tabriz, Iran, at 2004 and 2005. The experimental designs in both year was a randomized complete blocks with three replications. The treatments were weed-infested and weed-free in the same periods. Both year, in weed-infested experiment, redroot pigweed was seeded immediately after green bean planting and removed after 0, 2, 4, 6, 8, 10 and 14 weeks after green bean emergence (WAE). In weed-free experiment, redroot pigweed seeds were transplanted to green bean plots at 0, 2, 4, 6, 8, 10 and 14 WAE. Data were analyzed using the MSTATC software and means were compared using Duncan's Multiple Ranges Test. Regression analysis was performed to describe the relationship between green bean yield and duration of redroot pigweed interference using the REG PROCEDURE of SAS. Results indicated that the difference between years with a view to influence on all traits except stem height at the harvesting stage and pod yield at the first and second harvesting time were significant. Also, differences between treatments with a view to influence on all traits were significant. Contemporary growing of pigweed and green bean for early first month and weed interference 10 WAE had not significant effect on green bean above ground biomass. In both years, the highest green bean yield

  5. THE OCCURRENCE OF INSECTS AND MOULDS IN STORED COCOA BEANS AT SOUTH SULAWESI

    Directory of Open Access Journals (Sweden)

    OKKY S. DHARMAPUTRA

    1999-01-01

    Full Text Available Surveys on postharvest handling and technology processing of cocoa beans at farmer, trader and exporter levels in South Sulawesi were conducted together with investigations on moisture content, pest infestation (insect and mould and quality characteris tics in terms of reducing sugar, free amino acid and free fatty acid content. Surveys were conducted during dry (July 1997 and wet seasons (February 1998 in three regencies (Pinrang, Polewali-Mamasa and Luwu and Ujung Pandang, South Sulawesi province. Interviews were carried out during surveys in the dry season. Number of respondents from farmers, trailers and exporters was 38, 15 and 5, respectively. In each season, number of samples taken from farmers, traders and exporters was 9, 21 and 15, respectively. In general, farmers, traders and exporters did not carry out postharvest handling and technology processing properly. Moisture content of cocoa beans collected from farmers, traders and exporters were higher than the tolerabl e limit recommended by SNI (7.5%. Moisture content of cocoa beans collected during the wet season was higher than in the dry season. Insects were found on cocoa beans collected from traders and exporters. Species composition and the presence of each insect species were varied among the two seasons, but the predominant species was Tribolium castaneum. At trader level the percentage of insect-damaged beans during the wet season was higher than that during the dry season, while at exporter le vel it was lower. During the two seasons the percentage of mouldy beans at farmer level was lower than the tolerable limit recommended by SNI (4%, while those from some samples at trader and exporter levels were higher than 4%, but based on the direct plating method, all of the samples at trader and exporter levels were mouldy. Species composition and the percentage of beans infected by each mould species at farmer, trader and exporter levels during the two seasons were va ried. The

  6. Regulation of copper homeostasis and biotic interactions by microRNA 398b in common bean.

    Directory of Open Access Journals (Sweden)

    Loreto Naya

    Full Text Available MicroRNAs are recognized as important post-transcriptional regulators in plants. Information about the roles of miRNAs in common bean (Phaseolus vulgaris L., an agronomically important legume, is yet scant. The objective of this work was to functionally characterize the conserved miRNA: miR398b and its target Cu/Zn Superoxide Dismutase 1 (CSD1 in common bean. We experimentally validated a novel miR398 target: the stress up-regulated Nodulin 19 (Nod19. Expression analysis of miR398b and target genes -CSD1 and Nod19- in bean roots, nodules and leaves, indicated their role in copper (Cu homeostasis. In bean plants under Cu toxicity miR398b was decreased and Nod19 and CSD1, that participates in reactive oxygen species (ROS detoxification, were up-regulated. The opposite regulation was observed in Cu deficient bean plants; lower levels of CSD1 would allow Cu delivery to essential Cu-containing proteins. Composite common bean plants with transgenic roots over-expressing miR398 showed ca. 20-fold higher mature miR398b and almost negligible target transcript levels as well as increased anthocyanin content and expression of Cu-stress responsive genes, when subjected to Cu deficiency. The down-regulation of miR398b with the consequent up-regulation of its targets was observed in common bean roots during the oxidative burst resulting from short-time exposure to high Cu. A similar response occurred at early stage of bean roots inoculated with Rhizobium tropici, where an increase in ROS was observed. In addition, the miR398b down-regulation and an increase in CSD1 and Nod19 were observed in bean leaves challenged with Sclerotinia scleortiorum fungal pathogen. Transient over-expression of miR398b in Nicotiana benthamiana leaves infected with S. sclerotiorum resulted in enhanced fungal lesions. We conclude that the miR398b-mediated up-regulation of CSD and Nod19 is relevant for common bean plants to cope with oxidative stress generated in abiotic and biotic

  7. Evaluation of aminoacids in irradiated beans (Vigna unguiculata (L.) Walp) by high performance liquid chromatography (HPLC)

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Keila S. Cople; Souza, Luciana B.; Coelho, Maysa J.; Lima, Antonio L. Santos; Hernandes, Nilber K. [Instituto Militar de Engenharia (IME), Rio de Janeiro, RJ (Brazil). Secao de Engenharia Nuclear]. E-mail: keila@ime.eb.br; Godoy, Ronoel L.O. [EMBRAPA Agroindustria de Alimentos, Rio de Janeiro, RJ (Brazil)]. E-mail: ronoel@ctaa.embrapa.br

    2007-07-01

    Fradinho-bean (Vigna unguiculata (L.) Walp) is originated from Africa and is known in Brazil as 'caupi', 'corda' or 'macassar'. It is grown in the interior of Northeast Brazil (semi-arid region) and can be found in parts of the North, being one of the most important components of people's diet in those regions. The Northeast area produces around 429,375 ton of fradinho-bean per year. Leguminous plants are very important sources of proteins, vitamins, carbohydrates and minerals. This kind of bean is an excellent source of proteins (around 23- 25% of its nutritional content), being superior to regular beans (Phaseolus vulgaris). The irradiation process is an alternative to avoid post-harvesting losses, without changing the nutritional value of food. This study has the objective to evaluate the effect of different gamma irradiation doses (0.0; 0.5; 1.0; 2.5; 5.0 and 10.0 kGy) on aminoacid content of fradinho-bean by high performance liquid chromatography (HPLC) and the accompanying of the grains during storage time of 6 months. After irradiation, the bean grains went through a milling process in order to make flour for posterior extraction. A liquid chromatographer Waters, model Alliance 2695, with fluorescent detector Waters 2475, having a mobile phase with gradient elution of sodium acetate. acetonitrile and Milli-Q water, was employed. The flux used was 1 mL/min and the injection volume of 10 {mu}L. The column (C 18 150.0 x 3.9 mm) was kept at 36 deg C. The results show that gamma irradiation is a promise process for fradinho bean during conservation storage time of 6 months, until the dose of 10.0 kGy. Even the most radio-sensitive aminoacids like aromatics and basic lateral chains were preserved. (author)

  8. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin

    2012-06-01

    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  9. Comparison of Cocoa Beans from China, Indonesia and Papua New Guinea

    Directory of Open Access Journals (Sweden)

    Fenglin Gu

    2013-05-01

    Full Text Available A survey on five kinds of cocoa beans from new cocoa planting countries was conducted to analyze each kind’s basic quality. The average bean weight and butter content of Hainan cocoa beans were the lowest, at less than 1.1 g, and 39.24% to 43.44%, respectively. Cocoa beans from Indonesia where shown to be about 8.0% and 9.0% higher in average bean weight and butter content, respectively, than that of Papua New Guinea and about 20.0% and 25.0% higher in average bean weight and butter content than Chinese dried beans, respectively. The average total polyphenolic content ranged from 81.22 mg/10 g to 301.01 mg/10 g. The Hainan 2011 sample had the highest total polyphenolic content, followed by the unfermented sample from Indonesia and the Papua New Guinea sample. The polyphenolic levels found in the Hainan 2010 sample were 123.61 mg/10 g and lower than the other three samples, but the Indonesian fermented sample had the lowest total polyphenolic content of 81.22 mg/10 g. The average total amino acid content ranged from 11.58 g/100 g to 18.17 g/100 g. The total amino acid content was the highest in the Indonesian unfermented sample, followed by the Hainan 2011 sample and the Papua New Guinea sample. The levels found in the Hainan 2010 sample were lower; the Indonesian fermented sample had the lowest total amino acid content.

  10. The toxicity and invasive effects of QDs on mung bean development

    Science.gov (United States)

    Zhai, Peng; Wang, Xiaomei; Wang, Ruhua; Huang, Xuan; Feng, Gang; Lin, Guimiao; Chen, Qiang; Xu, Gaixia; Chen, Danni

    2014-09-01

    Objective: Nowadays, the nanomaterials have been applied in every aspects of our life, including cosmetics, fresh-keeping, antisepsis and medicines. However, we know little about the toxic effects of nanoparticles towards plants. In this thesis, we synthesized quantum dots (QDs), and then toxicity and invasive effects of QDs for mung beans were investigated. Methods: We synthesised red CdTe QDs in water sphase with L-Cystein stabilizers, then prepared different concentration of QDs solution to cultivate mung bean plant, the radical length of mung beans was measured after four days every day, after 7 days, the distribution of QDs in mung bean plant was recorded under the microscopic. Results: The result showed the QDs inhibited the growth of mung beans, the higher the concentration of QDs was, the greater the inhibition effect was. After 7 days, the radicle average lengths of mung beans in different concentrations of QDs solution - blank 0.1μmol/L 0.2μmol/L 0.5 μmol/L 1 μmol/L - were 19.350+/- 0.427, 14.050+/- 0.879, 10.525+/- 0.554, 7.250+/- 0.522, 7.650+/- 0.229. The QDs mostly adhered onto the root surface and hairs. Conclusion: In conclusion, the QDs synthesized with L-cystein have effects on the growth of mung beans. However, it is necessary to do more experiments to confirm the mechanism of the toxicity effect of QDs on plants.

  11. Open sun drying of green bean: influence of pretreatments on drying kinetics, colour and rehydration capacity

    Science.gov (United States)

    İsmail, Osman; Kantürk Figen, Aysel; Pişkin, Sabriye

    2016-08-01

    Green bean (Phaseolus Vulgaris L), classified under legume family, is a primary source of dietary protein in human diets especially in the agricultural countries. Green bean is susceptible to rapid deterioration because of their high moisture content and in order to prevent and present the green bean drying process is applied. In this study, effects of pretreatments on drying kinetics, colour and rehydration capacity of green bean were investigated. It was observed that the pretreatment affected the drying time. The shortest drying times were obtained from pretreated samples with blanched. Drying times were determined as 47, 41 and 29 h for natural, salted and blanch, respectively. The results showed that pretreatment and ambient temperature significantly (P = 0.05) affected the drying rate and the drying time. The effective moisture diffusivity was determined by using Fick's second law and was found to be range between 3.15 × 10-10 and 1.2 × 10-10 m2/s for the pre-treated and natural green bean samples. The rehydration values were obtained 2.75, 2.71, 2.29 (g water/g dry matter) for the blanched, salted and natural samples. The effective diffusion coefficients were calculated using the data collected during the falling rate period and the experimental data are fitted to seven thin layer drying models which found in the literature. The Logarithmic model was found to best describe the drying behavior of fresh green beans under open air sun. Rehydration time and color parameters had been determined in order to improve the quality of dried green bean. Regarding with rehydration time and colour data, the best results were obtained at blanched drying conditions.

  12. Assess suitability of hydroaeroponic culture to establish tripartite symbiosis between different AMF species, beans, and rhizobia

    Directory of Open Access Journals (Sweden)

    Jansa Jan

    2009-06-01

    Full Text Available Abstract Background Like other species of the Phaseoleae tribe, common bean (Phaseolus vulgaris L. has the potential to establish symbiosis with rhizobia and to fix the atmospheric dinitrogen (N2 for its N nutrition. Common bean has also the potential to establish symbiosis with arbuscular mycorrhizal fungi (AMF that improves the uptake of low mobile nutrients such as phosphorus, from the soil. Both rhizobial and mycorrhizal symbioses can act synergistically in benefits on plant. Results The tripartite symbiosis of common bean with rhizobia and arbuscular mycorrhizal fungi (AMF was assessed in hydroaeroponic culture with common bean (Phaseolus vulgaris L., by comparing the effects of three fungi spp. on growth, nodulation and mycorrhization of the roots under sufficient versus deficient P supplies, after transfer from initial sand culture. Although Glomus intraradices Schenck & Smith colonized intensely the roots of common bean in both sand and hydroaeroponic cultures, Gigaspora rosea Nicolson & Schenck only established well under sand culture conditions, and no root-colonization was found with Acaulospora mellea Spain & Schenck under either culture conditions. Interestingly, mycorrhization by Glomus was also obtained by contact with mycorrhized Stylosanthes guianensis (Aubl. sw in sand culture under deficient P before transfer into hydroaeroponic culture. The effect of bean genotype on both rhizobial and mycorrhizal symbioses with Glomus was subsequently assessed with the common bean recombinant inbreed line 7, 28, 83, 115 and 147, and the cultivar Flamingo. Significant differences among colonization and nodulation of the roots and growth among genotypes were found. Conclusion The hydroaeroponic culture is a valuable tool for further scrutinizing the physiological interactions and nutrient partitioning within the tripartite symbiosis.

  13. Implications of mitotic and meiotic irregularities in common beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Lima, D C; Braz, G T; Dos Reis, G B; Techio, V H; Davide, L C; de F B Abreu, A

    2016-05-23

    The common bean has great social and economic importance in Brazil and is the subject of a high number of publications, especially in the fields of genetics and breeding. Breeding programs aim to increase grain yield; however, mitosis and meiosis represent under explored research areas that have a direct impact on grain yield. Therefore, the study of cell division could be another tool available to bean geneticists and breeders. The aim of this study was to investigate irregularities occurring during the cell cycle and meiosis in common bean. The common bean cultivar used was BRSMG Talismã, which owing to its high yield and grain quality is recommended for cultivation in Brazil. We classified the interphase nuclei, estimated the mitotic and meiotic index, grain pollen viability, and percentage of abnormalities in both processes. The mitotic index was 4.1%, the interphase nucleus was non-reticulated, and 19% of dividing somatic cells showed abnormal behavior. Meiosis also presented irregularities resulting in a meiotic index of 44.6%. Viability of pollen grains was 94.3%. These results indicate that the common bean cultivar BRSMG Talismã possesses repair mechanisms that compensate for changes by producing a large number of pollen grains. Another important strategy adopted by bean plants to ensure stability is the elimination of abnormal cells by apoptosis. As the common bean cultivar BRSMG Talismã is recommended for cultivation because of its good agronomic performance, it can be concluded that mitotic and meiotic irregularities have no negative influence on its grain quality and yield.

  14. Apple Latent Spherical Virus Vector as Vaccine for the Prevention and Treatment of Mosaic Diseases in Pea, Broad Bean, and Eustoma Plants by Bean Yellow Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Nozomi Satoh

    2014-11-01

    Full Text Available We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV harboring a segment of the Bean yellow mosaic virus (BYMV genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic symptoms due to BYMV infection were observed in the challenged plants pre-inoculated with the ALSV vaccine. Simultaneous inoculation with the ALSV vaccine and BYMV also prevented mosaic symptoms in broad bean and eustoma plants, and BYMV accumulation was strongly inhibited in the upper leaves of plants treated with the ALSV vaccine. Pea and eustoma plants were pre-inoculated with BYMV followed by inoculation with the ALSV vaccine to investigate the curative effects of the ALSV vaccine. In both plant species, recovery from mosaic symptoms was observed in upper leaves and BYMV accumulation was inhibited in leaves developing post-ALSV vaccination. These results show that ALSV vaccination not only prevents mosaic diseases in pea, broad bean, and eustoma, but that it is also effective in curing these diseases.

  15. Influence of partial replacement of soya bean meal by faba beans or peas in heavy pigs diet on meat quality, residual anti-nutritional factors and phytoestrogen content.

    Science.gov (United States)

    Gatta, Domenico; Russo, Claudia; Giuliotti, Lorella; Mannari, Claudio; Picciarelli, Piero; Lombardi, Lara; Giovannini, Luca; Ceccarelli, Nello; Mariotti, Lorenzo

    2013-06-01

    The study evaluated the partial substitution of soybean meal by faba beans (18%) or peas (20%) as additional protein sources in diets destined for typical Italian heavy pig production. It compared animal performances, meat quality, the presence of residual anti-nutritional factors (ANF) and phytoestrogens in plasma and meat and the possible effects on pig health, by evaluating oxidative, inflammatory and pro-atherogenic markers. The results showed that the productive performances, expressed as body weight and feed conversion ratio, of pigs fed with faba bean and pea diets were similar to those of pigs fed only the soybean meal. Meat quality of pigs fed with the three diets was similar in colour, water-holding capacity, tenderness and chemical composition. Despite the higher levels of phytoestrogen in the plasma of pigs fed only the soybean meal, phytoestrogen concentration in the muscle was equivalent to that of animals fed diets with faba beans, whereas pigs fed a diet with peas showed a lower concentration. Inflammation and pro-atherogenic parameters did not show significant differences among the three diets. Overall, the partial substitution of soybean meal by faba beans appears more interesting than with peas, particularly in relation to the higher amount of polyphenols in the diet and the highest concentration of phytoestrogens found in the plasma and muscle of animals, while the pyrimidine anti-nutritional compounds present in the diet did not appear to accumulate and had no effect on the growth performance of animals.

  16. Apple latent spherical virus vector as vaccine for the prevention and treatment of mosaic diseases in pea, broad bean, and eustoma plants by bean yellow mosaic virus.

    Science.gov (United States)

    Satoh, Nozomi; Kon, Tatsuya; Yamagishi, Noriko; Takahashi, Tsubasa; Natsuaki, Tomohide; Yoshikawa, Nobuyuki

    2014-11-07

    We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV) harboring a segment of the Bean yellow mosaic virus (BYMV) genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic symptoms due to BYMV infection were observed in the challenged plants pre-inoculated with the ALSV vaccine. Simultaneous inoculation with the ALSV vaccine and BYMV also prevented mosaic symptoms in broad bean and eustoma plants, and BYMV accumulation was strongly inhibited in the upper leaves of plants treated with the ALSV vaccine. Pea and eustoma plants were pre-inoculated with BYMV followed by inoculation with the ALSV vaccine to investigate the curative effects of the ALSV vaccine. In both plant species, recovery from mosaic symptoms was observed in upper leaves and BYMV accumulation was inhibited in leaves developing post-ALSV vaccination. These results show that ALSV vaccination not only prevents mosaic diseases in pea, broad bean, and eustoma, but that it is also effective in curing these diseases.

  17. Effects of processing moisture on the physical properties and in vitro digestibility of starch and protein in extruded brown rice and pinto bean composite flours.

    Science.gov (United States)

    Sumargo, Franklin; Gulati, Paridhi; Weier, Steven A; Clarke, Jennifer; Rose, Devin J

    2016-11-15

    The influence of pinto bean flour and processing moisture on the physical properties and in vitro digestibility of rice-bean extrudates has been investigated. Brown rice: pinto bean flour (0%, 15%, 30%, and 45% bean flour) were extruded under 5 moisture conditions (17.2%, 18.1%, 18.3%, 19.5%, and 20.1%). Physical properties [bulk density, unit density, radial expansion, axial expansion, overall expansion, specific volume, hardness, color, water solubility index, and water absorption index] and in vitro starch and protein digestibilities were determined. Increasing bean flour and processing moisture increased density and hardness while decreasing expansion. Rapidly digestible starch decreased and resistant starch increased as bean substitution and processing moisture increased. In vitro protein digestibility increased with increasing bean flour or with decreasing processing moisture. Incorporating bean flour into extruded snacks can negatively affect physical attributes (hardness, density, and expansion) while positively affecting in vitro starch (decrease) and protein (increase) digestibilities.

  18. PHYSICO-CHEMICAL CHARACTERISTICS OF TRIBAL BEAN (Canavalia virosa AND ITS ALTERNATIVE TOFU AND TEMPEH FOOD PRODUCTS

    Directory of Open Access Journals (Sweden)

    Titiek F. Djaafar

    2013-05-01

    Full Text Available Increasing price of soybean becomes a serious problem for producers of traditional foods such as tempeh and tofu. These traditional foods are important protein sources for many Indonesian people. Tribal bean (Canavalia virosa could be used as a substitution of soybean for tempeh and tofu processing. This study aimed to determine physico-chemical characteristics of tribal bean and its products such as tofu and tempeh. Tribal bean old pods were peeled manually in the Postharvest and Agricultural Machinery Laboratory of the Yogyakarta AIAT. The peeled seeds were dried until 10% water content and their epidermis were removed mechanically by using an abrasive peeler to produce yellowish clean peeled beans. The beans were analyzed physically and chemically using the standard prosedure. Since the tribal bean seeds contained high HCN, to minimize HCN content the beans were presoaked for 48 hours in water. The beans were then mixed with soybean at a ratio of 50:50 or 25:75 and processed for making tempeh and tofu using traditional method. Physicochemical and organoleptic characteristics of the tribal bean tempe and tofu were analysed, involving organoleptic test with hedonic method, texture, as well as water, ash, protein and crude fiber contents. The results showed that tribal bean contained protein (37.30%, essential amino acids, minerals and fiber (3.1%, and a toxic substance HCN. Presoaking the beans in water for 48 hours significantly reduced HCN content by 98.51%, from 1334 ppm. Tofu made of a mixture of tribal bean and soybean at a ratio of 25:75 plus 2% rice vinegar as a coagulant has a white color and normal flavor appearances, and was accepted by panelists. The tribal bean tempeh contained 78.1% water, 1.21% ash, 8.14% protein, 3.1% crude fiber, and 44 ppm HCN. Tempeh made of a mixture of tribal bean and soybean at ratios of 50:50 and 25:75 showed good characters (flavor, taste, color, and texture and panelist acceptance, as well as nutrition

  19. Development of Selection Criteria on Bean Weight Character of Cocoa (Theobroma cacaoL. through Path Analysis Approach

    Directory of Open Access Journals (Sweden)

    Indah Anita Sari

    2013-12-01

    Full Text Available Path coefficient analysis is frequently used for development of selection criteria on various type of plants. Path analysis on this research was conducted to find the selection criteria of yield component which directly affect bean weight. In addition to the value of path analysis coefficient, genetic variation coefficient, heritability and the value of genetic progress were also studied. The study was conducted at the Indonesian Coffee and Cocoa Research Institute. The research used randomized complete block design consisting of 14 accession numbers and each consisting of three replications. Pod girth, pod length, pod weight, wet beans weight per pod, number of normal beans per pod, number of abnormal beans per pod, dry weight per normal bean, and shell content were observed. The results showed that the pod weight character had an important role in determining the dry weight of normal bean. The character had a positive genotype correlation coefficient values which was high and significantly different (r=0.46 for dry weight per normal bean, considerable direct influence (P=0.479, moderate of the genotype variation coefficient (9.6%, and high genetic progress (95.23. Character of wet bean weight per pod could also be used indirectly for the selection criteria for dry weight per normal bean based on genetic variation coefficient value (11.88%, genetic progress value (82.48, and direct effect on dry weight per normal bean had positive value (P=0.006. Key words: Selection criteria, dry weight per bean, path analysis,Theobroma cacaoL.

  20. Microbiological and toxicological effects of Perla black bean (Phaseolus vulgaris L.) extracts: in vitro and in vivo studies.

    Science.gov (United States)

    Lara-Díaz, Víctor Javier; Gaytán-Ramos, Angel A; Dávalos-Balderas, Alfredo José; Santos-Guzmán, Jesús; Mata-Cárdenas, Benito David; Vargas-Villarreal, Javier; Barbosa-Quintana, Alvaro; Sanson, Misu; López-Reyes, Alberto Gabriel; Moreno-Cuevas, Jorge E

    2009-02-01

    We investigated the microbiological and toxicological effects of three Perla black bean extracts on the growth and culture of selected pathogenic microorganisms, the toxicity over Vero cell lines and an in vivo rat model. Three different solvents were used to obtain Perla black bean extracts. All three Perla black bean extracts were tested for antibacterial and antiparasitic activity and further analysed for intrinsic cytotoxicity (IC(50)). Methanol Perla black bean extract was used for acute toxicity test in rats, with the up-and-down doping method. All Perla black bean extracts inhibited bacterial growth. Pseudomonas aeruginosa, Proteus vulgaris, Klebsiella oxytoca, Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis and Listeria monocytogenes showed inhibition, while Escherichia coli and Enterobacter aerogenes did not. Acidified water and acetic acid Perla black bean extract were tested in parasites. The best IC(50) was observed for Giardia lamblia, while higher concentrations were active against Entamoeba histolytica and Trichomonas vaginalis. The Vero cells toxicity levels (IC(50)) for methanol, acidified water and acetic acid Perla black bean extract were [mean +/- S.D. (95% CI)]: 275 +/- 6.2 (267.9-282.0), 390 +/- 4.6 (384.8-395.2) and 209 +/- 3.39 (205.6-212.4) microg/ml, respectively. In vivo acute toxicity assays did not show changes in absolute organ weights, gross and histological examinations of selected tissues or functional tests. The acetic acid and methanol Perla black bean extract proved to exhibit strong antibacterial activity and the acidified water Perla black bean extract exerted parasiticidal effects against Giardia lamblia, Entamoeba hystolitica and Trichomonas vaginalis. The three Perla black bean extracts assayed over Vero cells showed very low toxicity and the methanol Perla black bean extract in vivo did not cause toxicity.

  1. Irreversible inhibition of jack bean urease by pyrocatechol.

    Science.gov (United States)

    Kot, Mirosława; Zaborska, Wiesława

    2003-10-01

    Pyrocatechol was studied as an inhibitor of jack bean urease in 20 mM phosphate buffer, pH 7.0, 25 degrees C. The inhibition was monitored by an incubation procedure in the absence of substrate and reaction progress studies in the presence of substrate. It was found that pyrocatechol acted as a time- and concentration dependent irreversible inactivator of urease. The dependence of the residual activity of urease on the incubation time showed that the rate of inhibition increased with time until there was total loss of enzyme activity. The inactivation process followed a non-pseudo-first order reaction. The obtained reaction progress curves were found to be time-dependent. The plots showed that the rate of the enzyme reaction in the final stages reached zero. From protection experiments it appeared that thiol-compounds such as L-cysteine, 2-mercaptoethanol and dithiothreitol prevented urease from pyrocatechol inactivation as well as the substrate, urea, and the competitive inhibitor boric acid. These results proved that the urease active site was involved in the pyrocatechol inactivation.

  2. Functional properties and fatty acids profile of different beans varieties.

    Science.gov (United States)

    Lo Turco, Vincenzo; Potortì, Angela Giorgia; Rando, Rossana; Ravenda, Pietro; Dugo, Giacomo; Di Bella, Giuseppa

    2016-10-01

    Dried seeds of four varieties of Phaseolus vulgaris, three of Vigna unguiculata ssp. unguiculata and two of Vigna angularis grown and marketed in Italy, Mexico, India, Japan, Ghana and Ivory Coast were analysed for fatty acids content. In oils from seeds of P. vulgaris, the main fatty acids were linolenic (34.7-41.5%) and linoleic (30.7-40.3%), followed by palmitic (10.7-16.8%). The first three aforementioned fatty acids in the lipid fraction of V. unguiculata varieties were 28.4, 28.7 and 26.2%, respectively; while in V. angularis varieties, main fatty acids were linoleic (36.4-39.1%) and palmitic (26.9-33.3%), followed by linolenic (17.9-22.2%). Statistical analyses indicate that botanical species play a rule in bean fatty acids distribution, while the same was not verified for geographical origin. Furthermore, the atherogenic index (AI) and the thrombogenic index (TI) were investigated for health and nutritional information. The results showed that these wide spread legumes have functional features to human health.

  3. Selection of carioca common bean progenies resistant to white mold

    Directory of Open Access Journals (Sweden)

    Renato Sérgio Batista Carvalho

    2013-01-01

    Full Text Available A backcross breeding program between commercial common bean cultivars (VC3 and M20 and sources of resistance(Ex-Rico 23 and G122 was conducted with a view toward selecting carioca (beige with brown stripes progenies resistant to whitemold. Forty-eight progenies (27 F2:6 BC1 and 21 F1:5 BC2 were evaluated for yield, growth habit, grain type and pathogen responseby two methodologies for assessment (“straw test” and “oxalic acid”. The methods were effective in discriminating the progenies,showing differing results, for they may assess different resistance mechanisms. Thus, they should be used together. Simultaneousselection for yield, growth habit, grain type and white mold resistance proved to be viable. The most appropriate strategy was to uselower intensities of selection and prioritize traits such as resistance and grain type, which are essential for commercial acceptance.Two progenies proved their superiority for the breeding program for they combine the traits of resistance and favorable grain type.

  4. Antixenosis of bean genotypes to Chrysodeixis includens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Rafaela Morando

    2015-06-01

    Full Text Available The objective of this work was to evaluate bean genotypes for resistance to soybean looper (Chrysodeixis includens. Initially, free-choice tests were carried out with 59 genotypes, divided into three groups according to leaf color intensity (dark green, light green, and medium green, in order to evaluate oviposition preference. Subsequently, 12 genotypes with high potential for resistance were selected, as well as two susceptible commercial standards. With these genotypes, new tests were performed for oviposition in a greenhouse, besides tests for attractiveness and consumption under laboratory conditions (26±2ºC, 65±10% RH, and 14 h light: 10 h dark photophase. In the no-choice test with adults, in the greenhouse, the 'IAC Jabola', Arcelina 1, 'IAC Boreal', 'Flor de Mayo', and 'IAC Formoso' genotypes were the least oviposited, showing antixenosis-type resistance for oviposition. In the free-choice test with larvae, Arcelina 4, 'BRS Horizonte', 'Pérola', H96A102-1-1-1-52, 'IAC Boreal', 'IAC Harmonia', and 'IAC Formoso' were the less consumed genotypes, which indicates antixenosis to feeding. In the no-choice test, all genotypes (except for 'IAPAR 57' expressed moderate levels of antixenosis to feeding against C. includens larvae.

  5. Texturized pinto bean protein fortification in straight dough bread formulation.

    Science.gov (United States)

    Simons, Courtney W; Hunt-Schmidt, Emily; Simsek, Senay; Hall, Clifford; Biswas, Atanu

    2014-09-01

    Pinto beans were milled and then air-classified to obtain a raw high protein fraction (RHPF) followed by extrusion to texturize the protein fraction. The texturized high protein fraction (THPF) was then milled to obtain flour, and combined with wheat flour at 5, 10, and 15% levels to make bread. The air-classification process produced flour with high concentration of lipids and phytic acid in the protein-rich fraction. However, extrusion significantly reduced hexane extractable lipid and phytic acid. However, the reduction observed may simply indicate a reduction in recovery due to bind with other components. Total protein and lysine contents in composite flours increased significantly as THPF levels increased in composite flour. Bread made with 5% THPF had 48% more lysine than the 100 % wheat flour (control). The THPF helped to maintain dough strength by reducing mixing tolerance index (MTI), maintaining dough stability and increasing departure time on Farinograph. Bread loaf volume was significantly reduced above 5% THPF addition. THPF increased water absorption causing an increase in bread weights by up to 6%. Overall, loaf quality deteriorated at 10 and 15% THPF levels while bread with 5% THPF was not significantly different from the control. These results support the addition of 5% THPF as a means to enhance lysine content of white pan bread.

  6. Lipid composition of organelles from germinating castor bean endosperm

    Energy Technology Data Exchange (ETDEWEB)

    Donaldson, R.P.; Beevers, H.

    1977-02-01

    Glyoxysome, endoplasmic reticulum, mitochondria, and proplastid fractions were isolated from endosperm of castor beans (Ricinus communis) germinated for 5 days at 30 C. Samples from sucrose density gradients were diluted with 0.15 M KCl and the membranes pelleted. Lipid extracts of these membranes were analyzed for phosphoglyceride, acyl lipid, and sterol content. The endoplasmic reticulum contains 1.24 ..mu..mol of phosphoglyceride per mg of protein; the mitochondria, 0.65 ..mu..mol/mg; and the glyoxysome membranes, 0.55 ..mu..mol/mg. Phosphatidyl choline and phosphatidyl ethanolamine are the most abundant lipids in all membranes studied, accounting for 70% or more of the lipid phosphorus and 50% or more of the fatty acid. Glyoxysome membranes and endoplasmic reticulum also contain phosphatidyl inositol (respectively, 9 and 17% of the lipid phosphorus) and free fatty acids (13% of the total fatty acid in each). Compared with other organelles, mitochondrial membranes have more phosphatidyl ethanolamine relative to phosphatidyl choline and are characterized by the presence of cardiolipin, in which 80% of the fatty acid is linoleate. The relative amounts of linoleate, palmitate, oleate, stearate, and linolenate in each of the phosphotoglycerides are constant regardless of the membrane source. Stimasgasterol and ..beta..-sitosterol are present in the membranes (1 to 9 nmol each/mg protein). The data provide further evidence that glyoxysome membranes are derived from the endoplasmic reticulum but at the same time indicate some differentiation.

  7. An antifungal defensin from Phaseolus vulgaris cv. 'Cloud Bean'.

    Science.gov (United States)

    Wu, Xiangli; Sun, Jian; Zhang, Guoqing; Wang, Hexiang; Ng, Tzi Bun

    2011-01-15

    An antifungal peptide with a defensin-like sequence and exhibiting a molecular mass of 7.3kDa was purified from dried seeds of Phaseolus vulgaris 'Cloud Bean'. The isolation procedure entailed anion exchange chromatography on DEAE-cellulose, affinity chromatography an Affi-gel blue gel, cation exchange chromatography on SP-Sepharose, and gel filtration by fast protein liquid chromatography on Superdex 75. Although the antifungal peptide was unadsorbed on DEAE-cellulose, it was adsorbed on both Affi-gel blue gel and SP-Sepharose. The antifungal peptide exerted antifungal activity against Mycosphaerella arachidicola with an IC(50) value of 1.8 μM. It was also active against Fusarium oxysporum with an IC(50) value of 2.2 μM. It had no inhibitory effect on HIV-1 reverse transcriptase when tested up to 100 μM. Proliferation of L1210 mouse leukemia cells and MBL2 lymphoma cells was inhibited by the antifungal peptide with an IC(50) of 10 μM and 40 μM, respectively.

  8. Evolutionary dynamics of satellite DNA repeats from Phaseolus beans.

    Science.gov (United States)

    Ribeiro, Tiago; Dos Santos, Karla G B; Richard, Manon M S; Sévignac, Mireille; Thareau, Vincent; Geffroy, Valérie; Pedrosa-Harand, Andrea

    2017-03-01

    Common bean (Phaseolus vulgaris) subtelomeres are highly enriched for khipu, the main satellite DNA identified so far in this genome. Here, we comparatively investigate khipu genomic organization in Phaseolus species from different clades. Additionally, we identified and characterized another satellite repeat, named jumper, associated to khipu. A mixture of P. vulgaris khipu clones hybridized in situ confirmed the presence of khipu-like sequences on subterminal chromosome regions in all Phaseolus species, with differences in the number and intensity of signals between species and when species-specific clones were used. Khipu is present as multimers of ∼500 bp and sequence analyses of cloned fragments revealed close relationship among khipu repeats. The new repeat, named jumper, is a 170-bp satellite sequence present in all Phaseolus species and inserted into the nontranscribed spacer (NTS) of the 5S rDNA in the P. vulgaris genome. Nevertheless, jumper was found as a high-copy repeat at subtelomeres and/or pericentromeres in the Phaseolus microcarpus lineage only. Our data argue for khipu as an important subtelomeric satellite DNA in the genus and for a complex satellite repeat composition of P. microcarpus subtelomeres, which also contain jumper. Furthermore, the differential amplification of these repeats in subtelomeres or pericentromeres reinforces the presence of a dynamic satellite DNA library in Phaseolus.

  9. Morphology and viability of castor bean genotypes pollen grains

    Directory of Open Access Journals (Sweden)

    Maria Selma Alves Silva Diamantino

    2016-01-01

    Full Text Available The objective of this work was to characterize the morphology and viability of the pollen of 15 genotypes of castor bean (Ricinus communis L. and to generate information that can assist in the selection of highly promising male parents for future use in genetic improvement programs aimed at producing seeds for oil extraction. Acetolysis and scanning electron microscopy was used to characterize the morphology of the pollen. The viability of the pollen grains was estimated by in vitro germination and colorimetric analysis (acetocarmine 2% and 2, 3, 5-triphenyltetrazolium chloride 1%. For the in vitro germination, pollen grains were grown in 10 types of solidified culture medium consisting of different concentrations of sucrose, boric acid, calcium nitrate, magnesium sulfate and potassium nitrate. The pollen grains had the following characteristics: medium size, isopolar and subspheroidal shape, radial symmetry, circular ambit, 3-colporate, elongated endoapertures, tectate exine and granulated sexine. The acetocarmine dye overestimated pollen viability. The media M5 and M8 were the most efficient at promoting the germination of pollen grains. The studied genotypes had high levels of viability and can therefore be used as male parents in genetic improvement programs.

  10. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, E. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); He, Z.L., E-mail: zhe@ufl.edu [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Stoffella, P.J. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Mylavarapu, R.S. [University of Florida, Institute of Food and Agricultural Science, Soil and Water Science Department, Gainesville, FL 33611 (United States); Li, Y.C. [University of Florida, Institute of Food and Agricultural Science, Tropical Research and Education Center, Homestead, FL 33031 (United States); Moyano, B. [Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); Baligar, V.C. [United State Department of Agriculture, ARS, Beltsville, MD 20705 (United States)

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg{sup −1}) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg{sup −1}, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg{sup −1}. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg{sup −1}), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg{sup −1}, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil

  11. Characterization of Resistance Mechanisms in Faba Bean (Vicia faba) against Broomrape Species (Orobanche and Phelipanche spp.)

    Science.gov (United States)

    Rubiales, Diego; Rojas-Molina, Maria M.; Sillero, Josefina C.

    2016-01-01

    Faba bean (Vicia faba) production in Mediterranean and Near East agriculture is severely constrained by broomrape infection. The most widely distributed broomrape species affecting faba bean is Orobanche crenata, although O. foetida and Phelipanche aegyptiaca are of local importance. Only moderately resistant cultivars are available to farmers. Rizotrons studies allowed the dissection of resistance components in faba bean accessions against the very infective species O. crenata, O. foetida var. broteri and P. aegyptiaca, and to the inappropriate P. ramosa and O. foetida var. foetida. Results confirm that some levels of incomplete resistance are available, resulting in a reduced number of broomrape tubercles successfully formed per faba bean plant. Interestingly, the intermediate levels of resistance of cv. Baraca were operative against all broomrape populations and species studied, confirming previous reports on the stability of resistance of Baraca in field trials in different countries. Low induction of seed germination played a major role in the resistance against the inappropriate O. foetida var. foetida but not against the also inappropriate P. ramosa, neither to the infective species O. crenata, O. foetida var. broteri, or P. aegyptiaca. Negative tropism of germinated seeds with radicles growing away from faba bean roots was marked for both inappropriate species but was not observed in any of the infective species. Also, a proportion of radicles that had successfully contacted faba bean roots became necrotic, failing in starting tubercle development, particularly frequent for the two inappropriate species. Such necrosis was significant also on radicles contacting resistant faba bean accessions, being particularly relevant for Spanish O. crenata population, and lower although still significant in some accessions against Syrian O. crenata and P. aegyptiaca, suggesting that this might also be an operative mechanism to be selected and further exploited in faba

  12. Characterization resistance mechanisms in faba bean (Vicia faba against broomrape species (Orobanche and Phelipanche spp.

    Directory of Open Access Journals (Sweden)

    Diego Rubiales

    2016-11-01

    Full Text Available Faba bean (Vicia faba production in Mediterranean and Near East agriculture is severely constrained by broomrape infection. The most widely distributed broomrape species affecting faba bean is Orobanche crenata, although O. foetida and Phelipanche aegyptiaca are of local importance. Only moderately resistant cultivars are available to farmers. Rizotrons studies allowed the dissection of resistance components in faba bean accessions against the very infective species O. crenata, O. foetida var. broteri and P. aegyptiaca, and to the inappropriate P. ramosa and O. foetida var. foetida. Results confirm that some levels of incomplete resistance are available, resulting in a reduced number of broomrape tubercles successfully formed per faba bean plant. Interestingly, the intermediate levels of resistance of cv. Baraca were operative against all broomrape populations and species studied, confirming previous reports on the stability of resistance of Baraca in field trials in different countries. Low induction of seed germination played a major role in the resistance against the inappropriate O. foetida var. foetida but not against the also inappropriate P. ramosa, neither to the infective species O. crenata, O. foetida var. broteri or P. aegyptiaca. Negative tropism of germinated seeds with radicles growing away from faba bean roots was marked for both inappropriate species but was not observed in any of the infective species. Also, a proportion of radicles that had successfully contacted faba bean roots became necrotic, failing in starting tubercle development, particularly frequent for the two inappropriate species. Such necrosis was significant also on radicles contacting resistant faba bean accessions, being particularly relevant for Spanish O. crenata population, and lower although still significant in some accessions against Syrian O. crenata and P. aegytiaca, suggesting that this might also be an operative mechanism to be selected and further

  13. Genetic diversity in cultivated carioca common beans based on molecular marker analysis

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    2011-01-01

    Full Text Available A wide array of molecular markers has been used to investigate the genetic diversity among common bean species. However, the best combination of markers for studying such diversity among common bean cultivars has yet to be determined. Few reports have examined the genetic diversity of the carioca bean, commercially one of the most important common beans in Brazil. In this study, we examined the usefulness of two molecular marker systems (simple sequence repeats - SSRs and amplified fragment length polymorphisms - AFLPs for assessing the genetic diversity of carioca beans. The amount of information provided by Roger's modified genetic distance was used to analyze SSR data and Jaccards similarity coefficient was used for AFLP data. Seventy SSRs were polymorphic and 20 AFLP primer combinations produced 635 polymorphic bands. Molecular analysis showed that carioca genotypes were quite diverse. AFLPs revealed greater genetic differentiation and variation within the carioca genotypes (Gst = 98% and Fst = 0.83, respectively than SSRs and provided better resolution for clustering the carioca genotypes. SSRs and AFLPs were both suitable for assessing the genetic diversity of Brazilian carioca genotypes since the number of markers used in each system provided a low coefficient of variation. However, fingerprint profiles were generated faster with AFLPs, making them a better choice for assessing genetic diversity in the carioca germplasm.

  14. Incidence, level, and behavior of aflatoxins during coffee bean roasting and decaffeination.

    Science.gov (United States)

    Soliman, K M

    2002-12-01

    Screening for aflatoxins (Afs), isolation and identification of Aspergillus flavus, and the effect of decaffeination and roasting on the level of contamination in coffee beans are studied. The percent frequency of A. flavus ranged between 4 and 80% in green coffee beans (GCB), whereas in ground roasted coffee beans (GRCB), it ranged between 1 and 71%. Aflatoxins were detected in 76.5 and 54.6% of the infected samples with averages of 4.28 and 2.85 microg/kg of GCB and GRCB, respectively. Roasting was demonstrated to lower the concentration of Afs in GCB. The Afs levels were reduced by approximately 42.2-55.9% depending on the type and temperature of roasting. The highest yields of Afs were detected in the decaffeinated green coffee beans (24.29 microg/kg) and roasted coffee beans (16.00 microg/kg). The growth of A. flavus in liquid medium containing 1 or 2% caffeine was reduced by 50%, and the level of aflatoxin in the medium was undetectable.

  15. Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice

    Science.gov (United States)

    Song, Su Jin; Choi, Sena; Park, Taesun

    2014-01-01

    This study investigated whether decaffeinated green coffee bean extract prevents obesity and improves insulin resistance and elucidated its mechanism of action. Male C57BL/6N mice (N = 48) were divided into six dietary groups: chow diet, HFD, HFD-supplemented with 0.1%, 0.3%, and 0.9% decaffeinated green coffee bean extract, and 0.15% 5-caffeoylquinic acid. Based on the reduction in HFD-induced body weight gain and increments in plasma lipids, glucose, and insulin levels, the minimum effective dose of green coffee bean extract appears to be 0.3%. Green coffee bean extract resulted in downregulation of genes involved in WNT10b- and galanin-mediated adipogenesis and TLR4-mediated proinflammatory pathway and stimulation of GLUT4 translocation to the plasma membrane in white adipose tissue. Taken together, decaffeinated green coffee bean extract appeared to reverse HFD-induced fat accumulation and insulin resistance by downregulating the genes involved in adipogenesis and inflammation in visceral adipose tissue. PMID:24817902

  16. Analytical determination of thiamine (vitamin B1) in irradiated and stored Brazilian beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna L.C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Mancini-Filho, Jorge [Sao Paulo Univ., SP (Brazil). Faculdade de Ciencias Farmaceuticas; Delincee, Henry [Bundesforschungsanstalt fuer Ernaehrung, Karlsruhe (Germany); Bognar, A. [Bundesforschungsanstalt fuer Ernaehrung, Stuttgart (Germany)

    1997-12-01

    Thiamine (vitamin B{sub 1}) content in two varieties of Brazilian beans, Phaselus vulgaris L., var. carioca and Vigna unguiculata (L) Walp, var. macacar , irradiated with doses ranging from 0,05, 1.0, 2.5, 5.0 and 10.0 kGy was investigated. After a 6 months storage period, the optimum cooking time was established for each dose and variety. Sensorial evaluation tests were carried out by a panel of six people trained to this specific task. Our purpose to work with these beans is because conflicting results have appeared in studies about vitamin loss after low-dose irradiation. In our case, after a 6-month storage period of this two kinds of beans, in addition to the analysis of cooking time and sensory properties the vitamin B{sub 1} content was evaluated. No significant vitamin losses were observed in Macacar beans until 10.0 kGy. Carioca beans showed small losses after 2.5 kGy. (author). 23 refs., 2 figs., 5 tabs.

  17. Nutritional composition and antioxidant activity of twenty mung bean cultivars in China

    Institute of Scientific and Technical Information of China (English)

    Zhenxing Shi; Yang Yao; Yingying Zhu; Guixing Ren

    2016-01-01

    Interest in mung bean (Vigna radiata L.) as a functional food is growing;however, studies on the nutritional composition of major mung bean cultivars planted in China are limited. Twenty Chinese mung bean cultivars were collected and their nutritional compositions including starch, fat, protein, and phytochemicals were analyzed. The cultivars were found to have a high amount of resistant starch, accounting for 16.1%–22.3%of total starch, and balanced amino acid constitutions. Palmitic acid and linoleic acid were the two dominant fatty acids, accounting for respectively 32.4%and 36.1%of all of the assayed fatty acids. Four bound phenolic acids (syringic, caffeic, p-coumaric, and ferulic acids) and two free phenolic acids (caffeic and ferulic acids) were identified by HPLC. The antioxidant activity of 70%ethanol extracts from the 20 mung bean cultivars was evaluated. Their DPPH and ABTS+free-radical-scavenging capacity ranged from 28.13 ± 2.24 to 35.68 ± 0.71μmol g−1 and from 3.82 ± 0.25 to 13.44 ± 1.76μmol g−1, respectively. Significant positive correlations of ABTS+free-radical-scavenging capacity with total phenolic acids and total flavonoid contents were observed. These results suggest that Chinese mung bean cultivars are rich in balanced nutrients and that their phytochemicals should be considered as potential sources of natural antioxidants.

  18. Common Beans and Their Non-Digestible Fraction: Cancer Inhibitory Activity—An Overview

    Directory of Open Access Journals (Sweden)

    Rocio Campos-Vega

    2013-08-01

    Full Text Available The US Department of Agriculture’s MyPyramid guidelines introduced a near doubling of the dietary recommendations for vegetables including dry beans—an important food staple in many traditional diets that can improve public health and nutrition. Populations with high legume (peas, beans, lentils consumption have a low risk of cancer and chronic degenerative diseases. Common beans (Phaseolus vulgaris L. are known as a rich, reliable source of non-digested compounds like fiber, phenolics, peptides and phytochemicals that are associated with health benefits. Emerging evidence indicates that common bean consumption is associated with reduced cancer risk in human populations, inhibiting carcinogenesis in animal models and inducing cell cycle arrest and apoptosis in cell cultures. Fiber may reduce the risk of premature death from all causes, whereas the whole non-digestible fraction from common beans exhibits anti-proliferative activity and induces apoptosis in vitro and in vivo colon cancer. The mechanisms responsible for this apparently protective role may include gene-nutrient interactions and modulation of proteins’ expression. This review investigates the potential health benefits and bioactivity of beans on tumor inhibition, highlighting studies involving functional compounds, mainly non-digestible fractions that modulate genes and proteins, thereby, unraveling their preventive role against the development of cancer.

  19. Comparative analysis of volatiles in traditionally cured Bourbon and Ugandan vanilla bean ( Vanilla planifolia ) extracts.

    Science.gov (United States)

    Zhang, Suying; Mueller, Christoph

    2012-10-24

    Traditionally cured vanilla beans ( Vanilla planifolia ) from Madagascar and Uganda were extracted with organic solvents, and the volatiles were separated from the nonvolatile fraction using the solvent assisted flavor evaporation (SAFE) technique. Concentrated vanilla bean extracts were analyzed using GC-MS and GC-O. Two hundred and forty-six volatile compounds were identified using the Automated Mass Spectral Deconvolution and Identification System (AMDIS) software, of which 13 were confirmed with authentic compounds from commercial sources and the others were tentatively identified on the basis of calibrated linear retention indices and the comparison of deconvoluted mass spectra with the in-house and/or NIST spectra databases. Vanillin was the most abundant constituent followed by guaiacol. The total concentration of the volatile compounds, excluding vanillin, was 301 mg/kg for Bourbon and 398 mg/kg for Ugandan vanilla bean extracts. Analytical comparison between the two vanilla bean extracts was discussed. Seventy-eight compounds were identified as odor-active compounds in the vanilla bean extracts with 10 confirmed with authentic references. It was found that there were substantial analytical differences in the odor-active compounds of the two extracts.

  20. Symbiotic Efficiency of Native Rhizobia Nodulating Common Bean (Phaseolus vulgaris L.) in Soils of Western Kenya.

    Science.gov (United States)

    Kawaka, Fanuel; Dida, Mathews M; Opala, Peter A; Ombori, Omwoyo; Maingi, John; Osoro, Newton; Muthini, Morris; Amoding, Alice; Mukaminega, Dative; Muoma, John

    2014-01-01

    This study was conducted to determine the abundance and symbiotic efficiency of native rhizobia nodulating common bean in Kisumu and Kakamega, Kenya. Soil sampling was carried out in three farms that had been used for growing common bean for at least two seasons and one fallow land with no known history of growing common bean or inoculation. Abundance of soil rhizobia and symbiotic efficiency (SE) were determined in a greenhouse experiment. Native rhizobia populations ranged from 3.2 × 10(1) to 3.5 × 10(4) cells per gram of soil. Pure bacterial cultures isolated from fresh and healthy root nodules exhibited typical characteristics of Rhizobium sp. on yeast extract mannitol agar media supplemented with Congo red. Bean inoculation with the isolates significantly (p rhizobia were higher when compared to a reference strain, CIAT 899 (67%), and ranged from 74% to 170%. Four isolates had SE above a second reference strain, Strain 446 (110%). Our results demonstrate the presence of native rhizobia that are potentially superior to the commercial inoculants. These can be exploited to enhance bean inoculation programmes in the region.

  1. Biodiversity and biogeography of rhizobia associated with common bean (Phaseolus vulgaris L.) in Shaanxi Province.

    Science.gov (United States)

    Wang, Li; Cao, Ying; Wang, En Tao; Qiao, Ya Juan; Jiao, Shuo; Liu, Zhen Shan; Zhao, Liang; Wei, Ge Hong

    2016-05-01

    The biodiversity and biogeography of rhizobia associated with bean in Shaanxi Province were investigated. A total of 194 bacterial isolates from bean nodules collected from 13 sampling sites were characterized based on phylogenetic analyses of the 16S rRNA gene, the housekeeping genes recA, glnII and atpD, and the symbiotic genes nodC and nifH. Fifteen genospecies belonging to the genera Rhizobium, Agrobacterium, Ensifer, Bradyrhizobium and Ochrobactrum were defined among the isolates, with Rhizobium sp. II, Agrobacterium sp. II, E. fredii and R. phaseoli being the dominant groups. Four symbiotic gene lineages corresponding to Rhizobium sp. I, Rhizobium sp. II, R. phaseoli and B. liaoningense were detected in the nodC and nifH sequence analyses, indicating different origins for the symbiotic genes and their co-evolution with the chromosome of the bacteria. Moreover, the Ensifer isolates harbored symbiotic genes closely related to bean-nodulating Pararhizobium giardinii, indicating possible lateral gene transfer from Rhizobium to Ensifer. Correlation of rhizobial community composition with moisture, temperature, intercropping, soil features and nutrients were detected. All the results demonstrated a great diversity of bean rhizobia in Shaanxi that might be due to the adaptable evolution of the bean-nodulating rhizobia subjected to the diverse ecological conditions in the area.

  2. Severe Outbreak of a Yellow Mosaic Disease on the Yard Long Bean in Bogor, West Java

    Directory of Open Access Journals (Sweden)

    TRI ASMIRA DAMAYANTI

    2009-06-01

    Full Text Available During 2008 crop season, an outbreak of severe yellow mosaic disease on yard long bean (Vigna unguiculata subsp. Sesquipedalis occurred in several farmers’ fields in West Java. Yard long bean var. Parade inoculated manually with extracts from symptomatic leaves showed the symptoms indicating the presence of virus. Symptomatic leaf samples tested positive in enzyme linked immunosorbent assay (ELISA with antibodies to group specific Potyvirus and Cucumber mosaic virus (CMV. Total RNA derived from symptomatic leaves was subjected to reverse transcription-polymerase chain reaction (RT-PCR using primers specific to the cylindrical inclusion (CI protein of potyviruses and CMV coat protein (CP specific primers. Pair wise comparison of sequences obtained from cloned RT-PCR products with corresponding nucleotide sequences in the GenBank confirmed the presence of Bean common mosaic virus strain Blackeye (BCMV-BlC and CMV in the symptomatic beans. Sequences of BCMV and CMV isolates from the beans showed maximum nucleotide sequence identities (92-97% and (90%, respectively with BCMV-BIC and CMV isolates from Taiwan. Each virus isolate also clustered closely with corresponding isolates from Taiwan in a phylogenetic analyses. These results provide first evidence of the occurrence of multiple infection of BCMV-BIC and CMV in the yard long been from Bogor, West Java.

  3. Effect of carob bean on gastric emptying time in Thai infants.

    Science.gov (United States)

    Vivatvakin, Boosba; Buachum, Vacharee

    2003-01-01

    Thickening agents, such as carob bean gum or galactomannan, have been successfully administered for the treatment of gastroesophageal reflux in infants. To study the effect of carob bean gum on gastric emptying and to symptoms of regurgitation, we recruited 20 full term Thai infants (mean age=13.4+/-7 week; mean body weight=4943+/-1272gm) without pathological gastroesophageal reflux. Initially, we determined half time gastric emptying (T 1/2 GET) by Tc99m radioscintigraphy method (mean T 1/2 GET=116.1+/-72 min) in infants consuming standard infant cow's milk formula for 2 weeks. Afterwards, carob bean infant formula was given for 2-4 weeks and weight gain, vomiting symptoms, night cough, colic, flatus, defaecation character and T 1/2 GET were assessed. There were statistically significant improvements in symptoms of vomiting (a smaller quantity Pcarob bean formula. However, there was no significance difference in gastric emptying half time (GET1=116.1+72, GET2=148.5+130.9; P=0.154). In conclusion, carob bean gum, as a thickening agent, improves the clinical symptoms of regurgitating infants, but does not significantly alter the gastric emptying physiology.

  4. Naturally occurring and experimentally induced castor bean (Ricinus communis) poisoning in ducks

    Science.gov (United States)

    Jensen, W.I.; Allen, J.P.

    1981-01-01

    Castor bean (Ricinus communis) poisoning accounted for the death of several thousand ducks in the Texas panhandle in the fall and winter months of 1969-1971. Signs of intoxication resembled those of botulism, except for mucoid, blood-tinged excreta. The most common lesions were severe fatty change in the liver, widely distributed internal petechial hemorrhages or ecchymoses, and catarrhal enteritis. Nearly intact castor beans were found in the stomach of one duck during field necropsy. Fragments of seed coat resembling castor bean were found in the stomachs of 10 of 14 ducks examined in the laboratory. Clinical signs and postmortem lesions observed in wild ducks were induced experimentally in mallards (Anas platyrhynchos) by force-feeding intact castor beans. Toxicity titrations were erratic, but the LD50 appeared to be between three and four seeds. The mouse toxicity test, used to detect Clostridium botulinum toxin in the blood serum of intoxicated ducks, was negative in every case. Hemagglutination and precipitin tests generally failed to detect castor bean in extracts of excreta or intestinal contents of experimentally intoxicated ducks.

  5. The cotyledon cell wall of the common bean (phaseolus vulgaris) resists digestion in the upper intestine and thus may limit iron bioavailability

    Science.gov (United States)

    Strategies that enhance the Fe bioavailability from the bean are of keen interest to nutritionists, bean breeders and growers. In beans, the cotyledon contains 75-80% of the total seed Fe, most of which appears to be located within the cotyledon cell. The cotyledon cell wall is known to be resistan...

  6. Chemical Composition, Starch Digestibility and Antioxidant Capacity of Tortilla Made with a Blend of Quality Protein Maize and Black Bean

    Science.gov (United States)

    Grajales-García, Eva M.; Osorio-Díaz, Perla; Goñi, Isabel; Hervert-Hernández, Deisy; Guzmán-Maldonado, Salvador H.; Bello-Pérez, Luis A.

    2012-01-01

    Tortilla and beans are the basic components in the diet of people in the urban and rural areas of Mexico. Quality protein maize is suggested for tortilla preparation because it presents an increase in lysine and tryptophan levels. Beans contain important amounts of dietary fiber. The objective of this study was to prepare tortilla with bean and assesses the chemical composition, starch digestibility and antioxidant capacity using a quality protein maize variety. Tortilla with bean had higher protein, ash, dietary fiber and resistant starch content, and lower digestible starch than control tortilla. The hydrolysis rate (60 to 50%) and the predicted glycemic index (88 to 80) of tortilla decreased with the addition of bean in the blend. Extractable polyphenols and proanthocyanidins were higher in the tortilla with bean than control tortilla. This pattern produced higher antioxidant capacity of tortilla with bean (17.6 μmol Trolox eq/g) than control tortilla (7.8 μmol Trolox eq/g). The addition of bean to tortilla modified the starch digestibility and antioxidant characteristics of tortilla, obtaining a product with nutraceutical characteristics. PMID:22312252

  7. Identification of soil-borne pathogens in a common bean root rot nursery in Isabela, Puerto Rico

    Science.gov (United States)

    Limited research has been completed on the root rot complex of the common bean (Phaseolus vulgaris L.) in the Caribbean, while yield losses of over 50% due to root rot disease have been reported worldwide. In this study, the predominant root rot pathogens in a 40-year old common bean root rot nurser...

  8. Cost benefit analysis of the introduction of heat tolerant bean varieties in Atlántida, Honduras.

    Science.gov (United States)

    Rising ambient air temperatures, migration, and deforestation threaten the sustainability of hillside common bean (Phaseolus vulgaris L.) farming in Atlántida, Honduras. Farmers avoid climatic constraints to common bean production by planting at different altitudes during different seasons. In this ...

  9. Chemical composition, starch digestibility and antioxidant capacity of tortilla made with a blend of quality protein maize and black bean.

    Science.gov (United States)

    Grajales-García, Eva M; Osorio-Díaz, Perla; Goñi, Isabel; Hervert-Hernández, Deisy; Guzmán-Maldonado, Salvador H; Bello-Pérez, Luis A

    2012-01-01

    Tortilla and beans are the basic components in the diet of people in the urban and rural areas of Mexico. Quality protein maize is suggested for tortilla preparation because it presents an increase in lysine and tryptophan levels. Beans contain important amounts of dietary fiber. The objective of this study was to prepare tortilla with bean and assesses the chemical composition, starch digestibility and antioxidant capacity using a quality protein maize variety. Tortilla with bean had higher protein, ash, dietary fiber and resistant starch content, and lower digestible starch than control tortilla. The hydrolysis rate (60 to 50%) and the predicted glycemic index (88 to 80) of tortilla decreased with the addition of bean in the blend. Extractable polyphenols and proanthocyanidins were higher in the tortilla with bean than control tortilla. This pattern produced higher antioxidant capacity of tortilla with bean (17.6 μmol Trolox eq/g) than control tortilla (7.8 μmol Trolox eq/g). The addition of bean to tortilla modified the starch digestibility and antioxidant characteristics of tortilla, obtaining a product with nutraceutical characteristics.

  10. Chemical Composition, Starch Digestibility and Antioxidant Capacity of Tortilla Made with a Blend of Quality Protein Maize and Black Bean

    Directory of Open Access Journals (Sweden)

    Luis A. Bello-Pérez

    2011-12-01

    Full Text Available Tortilla and beans are the basic components in the diet of people in the urban and rural areas of Mexico. Quality protein maize is suggested for tortilla preparation because it presents an increase in lysine and tryptophan levels. Beans contain important amounts of dietary fiber. The objective of this study was to prepare tortilla with bean and assesses the chemical composition, starch digestibility and antioxidant capacity using a quality protein maize variety. Tortilla with bean had higher protein, ash, dietary fiber and resistant starch content, and lower digestible starch than control tortilla. The hydrolysis rate (60 to 50% and the predicted glycemic index (88 to 80 of tortilla decreased with the addition of bean in the blend. Extractable polyphenols and proanthocyanidins were higher in the tortilla with bean than control tortilla. This pattern produced higher antioxidant capacity of tortilla with bean (17.6 μmol Trolox eq/g than control tortilla (7.8 μmol Trolox eq/g. The addition of bean to tortilla modified the starch digestibility and antioxidant characteristics of tortilla, obtaining a product with nutraceutical characteristics.

  11. CULTIVAR RELEASE - BRSMG União: common bean cultivar with jalo grain for the state of Minas Gerais

    Directory of Open Access Journals (Sweden)

    Magno Antonio Patto Ramalho

    2012-12-01

    Full Text Available The bean cultivar BRSMG União as a new option of a bean cultivar with jalo grains for the state of Minas Gerais. The cultivar BRSMG União had an average grain yield of 9.8% above the mean of the controls (Jalo EEP 558 and BRS Radiante and was resistant to powdery-mildew.

  12. Genetic diversity of indigenous common bean (Phaseolus vulgaris L.) rhizobia from the state of Minas Gerais, Brazil

    Science.gov (United States)

    Torres, Adalgisa Ribeiro; Cursino, Luciana; Muro-Abad, Júpiter Israel; Gomes, Eliane Aparecida; de Araújo, Elza Fernandes; Hungria, Mariangela; Cassini, Sérvio Túlio Alves

    2009-01-01

    We characterized indigenous common bean rhizobia from five districts of the state of Minas Gerais, Brazil. The isolates were trapped by two common bean varieties, the Mineiro Precoce (Andean origin) and Ouro Negro (Mesoamerican origin). Analysis by BOX-PCR of selected isolates detected a high level of genetic diversity. PMID:24031433

  13. Root environment is a key determinant of fungal entomopathogen endophytism following seed treatment in the common bean, Phaseolus vulgaris

    Science.gov (United States)

    The common bean is the most important food legume in the world. We examined the potential of the fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae applied as seed treatments for their endophytic establishment in the common bean. Endophytic colonization in sterile sand:peat average...

  14. Life history parameters of Trialeurodes vaporariorum (Westwood) (Hemiptera: Aleyrodidae) at different environmental conditions on two bean cultivars

    NARCIS (Netherlands)

    Manzano, M.R.; Lenteren, van J.C.

    2009-01-01

    Life-history parameters of the greenhouse whitefly Trialeurodes vaporariorum (Westwood), an important pest of bean crops in Colombia, were determined in environmental control chambers on two dry bean (Phaseolus vulgaris) cultivars (cv.). Trialeurodes vaporariorum longevity on cv. Chocho decreased as

  15. Isolation and partial sequence of a Kunitz-type elastase specific inhibitor from marama bean (Tylosema esculentum).

    Science.gov (United States)

    Nadaraja, Deepa; Weintraub, Susan T; Hakala, Kevin W; Sherman, Nicholas E; Starcher, Barry

    2010-06-01

    An isolation procedure utilizing ammonium sulfate fractionation and affinity chromatography was used to purify an elastase inhibitor present in large amounts in marama beans (Tylosema esculentum). The protein appeared to be heterogeneous due to carbohydrate differences, demonstrating two bands on SDS gels with molecular weights of 17.8 kDa and 20 kDa. Partial sequence, derived from mass spectrometry, indicated that the protein is a Kunitz-type inhibitor distinct from other known plant serine protease inhibitors. The marama bean inhibitor is specific for elastase, with very low K(i) for both pancreatic and neutrophil elastase. The quantity of elastase inhibitor present in marama beans is many times greater than in soybean or any other bean or nut source reported to date. This raises the question of why a bean found in an arid corner of the Kalahari Desert would be so rich in a very potent elastase inhibitor.

  16. Phytochemical Evaluation of Moth Bean (Vigna aconitifolia L. Seeds and Their Divergence

    Directory of Open Access Journals (Sweden)

    Neha Gupta

    2016-01-01

    Full Text Available In the present study, phytochemical contents of 25 moth bean (Vigna aconitifolia seed accessions were evaluated. This includes protease inhibitors, phytic acid, radical scavenging activity, and tannins. The studies revealed significant variation in the contents of theses phytochemicals. Presence of photochemical composition was correlated with seed storage proteins like albumin and globulin. Qualitative identification of total seed storage protein abundance across two related moth bean accessions using two-dimensional gel electrophoresis (2D-GE was performed. Over 20 individual protein fractions were distributed over the gel as a series of spots in two moth bean accessions. Seed proteome accumulated spots of high intensity over a broad range of pI values of 3–10 in a molecular weight range of 11–170 kDa. In both seed accessions maximum protein spots are seen in the pI range of 6–8.

  17. Quality evaluation of tortilla chips made with corn meal dough and cooked bean flour

    Directory of Open Access Journals (Sweden)

    Luz Araceli Ochoa-Martínez

    2016-12-01

    Full Text Available A mixture of cornmeal dough and cooked bean flour (BF was prepared at different ratios (50/50, 60/40, and 70/30 w/w, and processed to chips. Viscosity profile, temperature of gelatinization and enthalpy, texture, protein content, and in vitro digestibility were measured. Pasting temperature tended to be lower when the flour bean concentration was lower. Maximum viscosity increased significantly in both samples (dough mixture and chips when the BF concentration was lower. In general, gelatinization temperature remains constant, while the heating enthalpy was higher with lower BF concentration. The addition of BF was correlated with greater crispiness, suggesting improved chip texture at higher BF concentrations. The final protein content in the corn-bean chips was very similar, despite the concentration of BF used. Protein digestibility in the chips was affected by the proportion of BF added, being higher when the amount of the BF was lower.

  18. COLOR CHARACTERISTICS OF COCOA BUTTER MADE FROM THE PROCESSING OF THE IVORIAN COCOA BEANS

    Directory of Open Access Journals (Sweden)

    DAVID KOFFI AKAKI

    2013-05-01

    Full Text Available Color of cocoa butters was measured using a CM-2002 Minolta Spectrocolorimeter. The results showed that the ‘’L’’ values (lightness varied from 73.11 to 84.76, the ‘’a’’ values (greenness varied from – 2.15 to – 1.08 and a redness of 4.99, and the ‘’b’’ values (yellowness varied from 28.63 to 41.11. Acidities of all typescocoa butters varied from 0.47 to 10.26. The best cocoa butters were obtained from staly and fully purple beans and cocoa beans of grades 4, 5, and 6. These butters had acidities of 0.48 and 0.56 for fully purple and staly beans and 2.41, 1.30, and 0.47 for grades 4, 5, and 6, respectively.

  19. Allelopathic potential of Hyptis suaveolens on physio-biochemical changes of mung bean seeds

    Directory of Open Access Journals (Sweden)

    Parthapratim Maiti

    2015-10-01

    Full Text Available Hyptis suaveolens is an exotic invasive weed in many areas of West Bengal, India. The allelopathic potential of leaf extracts and leachates of H. suaveolens was investigated on germination and metabolism of mung bean seeds (Vigna radiata cv. K851. The extracts and leachates reduced the germination and seed viability. The insoluble carbohydrates, proteins, and the activities of dehydrogenase and catalase enzymes were significantly reduced. Amino acid and soluble carbohydrate levels were increased in seeds pretreated with leaf extracts and leachates. The overall biochemical results indicate that various inhibitors present in H. suaveolens impart strong inhibitory effect on mung bean. The leaves of H. suaveolens possess phytotoxic chemicals, which potentially rendered the inhibitory action on mung bean seeds and provided key information for the proper management of H. suaveolens and other invasive weeds showing similar behavior.

  20. EVALUATION OF PHYSIOLOGY AND BIOCHEMISTRY THE CASTOR BEAN FUNCTION OF DOSES AND FERTILIZER IN SOIL

    Directory of Open Access Journals (Sweden)

    Fabiana Xavier Costa

    2011-04-01

    Full Text Available Aimed at with this work to investigate the physiology and biochemistry of the castor bean, after use of compost and organic castor bean. The trial began on October 3, 2005 ending on March 20, 2006, in green-house, controlled environment of the National Center of Cotton Research (CNPA / EMBRAPA, in Campina Grande , State of Paraiba. Was used to cultivate castor BRS Paraguaçu. We used a randomized block design with four replications, totaling 11 treatments, since they are derived from doses of castor-oil and organic compost (four doses of each and three witnesses, with further study of orthogonal contrasts . The castor bean showed effective results in the variables chlorophyll content (ppm in leaves and number of days to flowering of the first cluster (DIAFI. Compost organic waste not produced any significant result for both variables.

  1. Extraction of anthocyanins from black bean canning wastewater with macroporous resins.

    Science.gov (United States)

    Wang, Xiaoxi; Hansen, Conly; Allen, Karin

    2014-02-01

    This study investigated purification of anthocyanins from black bean canning wastewater by column chromatography with 5 types of macroporous resins (Diaion Hp20, Sepabeads Sp70, Sepabeads Sp207, Sepabeads Sp700, and Sepabeads Sp710). By-product of canned black beans was partially purified by filtration, in anticipation of higher performance during column chromatography. Equilibrium adsorption isotherms were measured and analyzed using Langmuir and Freundlich isotherm models. Both Langmuir (all R² ≥ 0.98) and Freundlich (all R² ≥ 0.97) models can describe the adsorption process of anthocyanins from black bean canning wastewater using the tested resins. The adsorption and desorption behaviors of anthocyanins were studied using a dynamic method on the 5 types of resins, and Sp700 presented the highest adsorption capacity (39 ± 4 mg/g; P canning wastewater.

  2. Determination of Mineral Contents in Unpolished Rice and Bean Samples by Neutron Activation Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Moon, J. H.; Kim, S. H.; Baek, S. Y.; Chung, Y. S. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    As scientists have focused their researches on the health impacts caused by mineral nutrient deficiencies and hazardous elements, public concern regarding mineral intake from dietary food is rising. In this reason, the dietary habits of Koreans have been shifted from white rice to more nutrient rice like unpolished rice and rice mixed with beans. It is known that unpolished rice and beans contain more protein, vitamin and mineral contents than white rice and are more beneficial to human health, even though they sometimes cause indigestion or allergy. The objectives of this study were to determine the mineral contents in unpolished rice and bean samples by a neutron activation analysis (NAA) and to compare the level of mineral contents between the samples

  3. Uniformity of liquid distribution in the canopy of the bean plant, using the spectrophotometric analysis

    Directory of Open Access Journals (Sweden)

    Murilo Mesquita Baesso

    2011-12-01

    Full Text Available Fungal diseases are important factors limiting common bean yield. White mold is one of the main diseases caused by soil pathogens. The objective of this study was to quantify the distribution of a fungicide solution sprayed into the canopy of bean plants by spectrophotometry, using a boom sprayer with and without air assistance. The experiment was arranged in a 2 x 2 x 2 factorial (two types of nozzles, two application rates, and air assistance on and off randomized block design with four replications. Air assistance influenced the deposition of solution on the bean plant and yield increased significantly with the increased rate of application and air assistance in the boom sprayer.

  4. The Research on the Impact of Green Beans Sports Drinks on Relieving Fatigue in Sports Training.

    Science.gov (United States)

    Qi, Li; Ying, Liu

    2015-01-01

    For researching the function of relieving fatigue of green beans sports drinks, this paper selected 60 mice as subjects. They were randomly divided into four groups (low dose group, middle dose group, high dose group and physiological saline group). Each time they were respectively feed 10g 20g/L, 40g/L, 80 g/L green beans sports drinks and 15ml/(kg.d) physiological saline. The experiment lasted for a month. We recorded weight of mice, swimming time and blood urea nitrogen indicators. The results show that green beans sports drinks can significantly prolong swimming time of mice (p sports drinks have a certain function of relieving physical fatigue.

  5. The Response Strategy of Maize, Pea and Broad Bean Plants to Different Osmotic Potential Stress

    Directory of Open Access Journals (Sweden)

    Hamdia M. Abd El-Samad

    2013-08-01

    Full Text Available This investigation was conducted to study the tolerance strategy of maize, broad bean and pea plants to salinity stress with exogenous applications of proline or phenylalanine on seed germination and seedlings growth. From the results obtained, it can be observed that osmotic stress affected adversely the rate of germination in maize, broad bean and pea plants. The excessive inhibition was more prominent at higher concentration of NaCl. The seeds and grains tested were exhibited some differential responses to salinity, in a manner that the inhibitory effect of salinity on seed germination ran in the order, maize higher than broad bean and the later was higher than pea plant. Treatment with proline or phenylalanine (100 ppm significantly increased these seed germination and seedlings growth characteristics even at lowest salinity level tested.

  6. Formation of cereulide and enterotoxins by Bacillus cereus in fermented African locust beans

    DEFF Research Database (Denmark)

    Thorsen, Line; Azokpota, Paulin; Munk Hansen, Bjarne

    2011-01-01

    genes nhe (A, B, C) were present in all 19 isolates, the hbl (A, C, D) in one (afitin), and the cytK gene in three isolates (afitin). Levels of cytotoxicity to Vero cells and NheA production in BHI-broth was within the range of known diarrheal outbreak strains. Autoclaved cooked African locust beans...... inoculated with emetic (cereulide producing) B. cereus Ba18H2/RIF supported growth at 25, 30 and 40 °C with highly different maximum cereulide productions of 6 ± 5, 97 ± 3 and 0.04 ± 0.02 μg/g beans, respectively (48 h). For non-autoclaved cooked beans inoculated with 2, 4 and 6 log10 B. cereus Ba18H2/RIF...

  7. Stress ethylene evolution of bean plants—a parameter indicating ozone pollution

    Science.gov (United States)

    Stan, Hans-Jürgen; Schicker, Sieglinde; Kassner, Helmut

    Bean plants treated with varying ozone concentrations for varying exposure times showed increased rates of ethylene production compared with controls. A standard method was worked out in which primary leaves of bean plants were encapsulated in 250 ml Erlenmeyer flasks after exposure. The amount of ethylene produced was determined by gas chromatography after about 24 h. The 'no effect level' of the bean plant was found to be 100 ppb ozone because there was no significant stress ethylene production even after 12 h fumigation. A treatment with 150 ppb ozone induced the beginning of stress ethylene production after about 8 h. With higher ozone concentrations shorter exposure times are necessary to induce a first response. Stress ethylene production correlates better with ozone concentration than with exposure time comparing the same products of concentration and time.

  8. Repeatability of adaptability and stability parameters of common bean in unpredictable environments

    Directory of Open Access Journals (Sweden)

    Lidiane Kely de Lima

    2013-09-01

    Full Text Available The objective of this work was to estimate the repeatability of adaptability and stability parameters of common bean between years, within each biennium from 2003 to 2012, in Minas Gerais state, Brazil. Grain yield data from trials of value for cultivation and use common bean were analyzed. Grain yield, ecovalence, regression coefficient, and coefficient of determination were estimated considering location and sowing season per year, within each biennium. Subsequently, a analysis of variance these estimates was carried out, and repeatability was estimated in the biennia. Repeatability estimate for grain yield in most of the biennia was relatively high, but for ecovalence and regression coefficient it was null or of small magnitude, which indicates that confidence on identification of common bean lines for recommendation is greater when using means of yield, instead of stability parameters.

  9. Hypergravity inhibits elongation growth of azuki bean epicotyls independently of the direction of stimuli

    Science.gov (United States)

    Soga, K.; Wakabayashi, K.; Kamisaka, S.; Hoson, T.

    We examined the effects of basipetal, horizontal, and acropetal hypergravity stimulation on growth and cell wall properties of azuki bean seedlings. Horizontal and acropetal hypergravity inhibited elongation growth of epicotyls by decreasing the cell wall extensibility, as did basipetal hypergravity. Hypergravity stimulation increased the thickness of cell walls and suppressed xyloglucan breakdown regardless of direction. All hypergravity treatments increased the pH in the apoplastic fluid, which is involved in the processes of the suppression of xyloglucan breakdown. Gadolinium and lanthanum, both blockers of mechanoreceptors, nullified the growth-inhibiting effects of hypergravity. These results show that growth inhibition by hypergravity is independent of its direction in azuki bean epicotyls. The findings also suggest that mechanoreceptors on the plasma membrane perceive the gravity signal independently of its direction, and affect growth of azuki bean epicotyls.

  10. AC susceptibility studies of grain-aligned superconductors by grained Bean model

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, Nobuyoshi; Akune, Tadahiro [Department of Electrical Engineering and Information Technology, Kyushu Sangyo University, 2-3-1 Matsukadai, Fukuoka (Japan); Matsumoto, Yasukuni, E-mail: saka@te.kyusan-u.ac.j [Department of Electrical Engineering, Fukuoka University, 8-19-1 Nanakuma Fukuoka (Japan)

    2009-03-01

    AC susceptibility of low-T{sub c} metallic superconductors shows smooth transition in the in-phase chi' and a peak in the out-phase chi''. High-T{sub c} oxide superconductors with anisotropic and grain-textured structures show deformed complex characteristics, such as double peaks in chi'' and shoulders in chi'. Instead of simple Bean model, a grained Bean model, where the superconducting grains is immersed in weak superconducting matrix, are proposed. The susceptibilities numerically analyzed using the grained Bean model show varied and deformed curves as observed in the high-T{sub c} superconductors. From the dependence of chi' and chi'' on temperatures T and DC magnetic fields B{sub dc} in grain-aligned Hg(Re)-1223 superconductors, textures of grains and interconnecting links and their grain-aligned nature can be estimated.

  11. AC susceptibility studies of grain-aligned superconductors by grained Bean model

    Science.gov (United States)

    Sakamoto, Nobuyoshi; Akune, Tadahiro; Matsumoto, Yasukuni

    2009-03-01

    AC susceptibility of low-Tc metallic superconductors shows smooth transition in the in-phase χ' and a peak in the out-phase χ". High-Tc oxide superconductors with anisotropic and grain-textured structures show deformed complex characteristics, such as double peaks in χ" and shoulders in χ'. Instead of simple Bean model, a grained Bean model, where the superconducting grains is immersed in weak superconducting matrix, are proposed. The susceptibilities numerically analyzed using the grained Bean model show varied and deformed curves as observed in the high-Tc superconductors. From the dependence of χ' and χ" on temperatures T and DC magnetic fields Bdc in grain-aligned Hg(Re)-1223 superconductors, textures of grains and interconnecting links and their grain-aligned nature can be estimated.

  12. Genetic control of the seed coat colour of Middle American and Andean bean seeds.

    Science.gov (United States)

    Possobom, Micheli Thaise Della Flora; Ribeiro, Nerinéia Dalfollo; Zemolin, Allan Emanoel Mezzomo; Arns, Fernanda Daltrozo

    2015-02-01

    Seed coat colour of bean seeds is decisive for acceptance of a cultivar. The objectives of this research were to determine whether there is maternal effect for "L", a* and b* colour parameters in Middle American and Andean bean seeds; to obtain estimates of heritability and gain with selection for "L", a* and b* values; and select recombinants with the seed coat colour required by the market demand. Thus, controlled crossings were carried out between the Middle American lines CNFP 10104 and CHC 01-175, and between the Andean lines Cal 96 and Hooter, for obtaining F1, F1 reciprocal, F2 and F2 reciprocal generations for each hybrid combination. Parents and generations were evaluated in two field experiments (2012 normal rainy and 2013 dry seasons) in the state of Rio Grande do Sul, Brazil. Seed coat colour was quantified with a portable colorimeter. Genetic variability for "L" (luminosity), chromaticity a* (green to red shade), and chromaticity b* (blue to yellow shade) values was observed in seeds with F2 seed coat of Middle American and Andean beans. "L", a* and b* values in bean seeds presented maternal effects. High broad-sense heritability are observed for luminosity (h(2)b: 76.66-95.07%), chromaticity a* (h(2)b: 73.08-89.31%), and chromaticity b* (h(2)b: 88.63-92.50%) values in bean seeds. From the crossings, it was possible to select bean seeds in early generation for the black group, and for carioca and cranberry types (dark or clear background) which present the colour required by the market demand.

  13. Effect of N and K doses in nutritive solution on growth, production and coffee bean size

    Directory of Open Access Journals (Sweden)

    Junia Maria Clemente

    2013-04-01

    Full Text Available An adequate supply of nutrients is essential for obtaining high yields of coffee. The objective of this study was to evaluate the effect of N, K and the N:K ratio on vegetative and reproductive growth of coffee. For this purpose, coffee plants were grown in nutrient solution containing K in the concentrations of 1.08; 2.15; 3.23 and 5.38 mmol L-1 combined with a dose of 6 mmol L-1 N, resulting in the N:K ratios (w/w: 1:0.5; 1:1; 1:1.5 and 1:2.5. The control treatment consisted of the doses 3 and 1.61 mmol L-1 of N and K respectively, resulting in the N:K ratio (w/w 1.0:1.5. The following variables were evaluated: height, stem diameter, number of nodes of the eighth plagiotrofic branch (index branch, pairs of plagiotrofic branches and number of nodes in the orthotropic branch every three weeks from the beginning of the experiment. Additionally, it was evaluated the chemical composition of processed beans and leaves between the flowering and the rapid expansion stage of the cherry beans, production of cherry beans per plant and classification of beans according to the size. N influenced mainly the characteristics of vegetative growth and K influenced mainly the reproductive growth evaluated by the production. The lowest production resulted in the highest percentages of beans retained on sieves with holes larger than 16/64", while the highest production promoted an increase in the percentage of beans retained on sieves with holes smaller than 16/64".

  14. Identification of Discriminant Factors after Exposure of Maize and Common Bean Plantlets to Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Lázaro HERNÁNDEZ

    2015-12-01

    Full Text Available Adverse environmental conditions limit crop yield and better understanding of plant response to stress will assist the development of more tolerant cultivars. Maize and common bean plantlets were evaluated under salinity, high temperature, drought and waterlogged conditions to identify biochemical markers which could be useful for rapid identification of putative stress tolerant plants. The levels of phenolics (free, cell wall-linked, total, aldehydes including malondialdehyde and chlorophylls (a, b, total were measured on stressed plantlets.  Only two indicators were statistically non-significant:  chlorophyll b in maize plantlets stressed with sodium chloride and malondialdehyde content in drought stressed maize. The most remarkable effects of abiotic stresses can be summarized as follows: (i salinity increased levels of free phenolics in maize plantlets and chlorophylls (a, b, total in common bean; (ii high temperature (40 °C elevated levels of chlorophylls (a, b, total in maize but decreased chlorophylls (a, b, total and free phenolics in common bean; (iii drought increased phenolics and decreased chlorophylls (a, b, total in maize and increased chlorophyll pigments (a, b, total in common bean; (iv waterlogging increased free phenolics and decreased chlorophylls (a, b, total in maize and increased chlorophyll (a, total in common bean. Free phenolics and chlorophylls, especially a, were the most responsive indicators to stress and can, therefore, be considered putative biochemical markers for abiotic stress tolerance in maize and common bean. The use of Fisher’s linear discriminant analysis to differentiate non-stressed and stressed plants in breeding programs is also a novel aspect of this report. Fisher’s linear discriminant functions classified correctly 100% of non-stressed or stressed originally grouped plants.

  15. Productivity of irrigated beans due to sources of stabilized nitrogen fertilizer and controlled release

    Directory of Open Access Journals (Sweden)

    Tatiely Gomes Bernardes

    2015-12-01

    Full Text Available ABSTRACT New nitrogen fertilizers are available in the market actually, however, does not have results on the efficiency of the Cerrado conditions. With that objective of this study was to evaluate the effect of urea including stabilized and controlled release urea on yield of irrigated common beans (Phaseolus vulgaris L in no-tillage system. The experiment was conducted in the winter crop, at Embrapa Arroz e Feijão, in Santo Antônio de Goiás, State of Goiás, Brazil. The experimental design was randomized blocks, with five replicates. Treatments consisted of five N sources (urea, urea + NBPT, urea + polymer, ammonium sulphate, and ammonium nitrate and a control (without N being applied 20 kg ha-1 of N at sowing and 80 kg ha-1 onf N in topdressing. We evaluated the chlorophyll content in leaves of common beans, the leaf N content and dry mass weight (MSPA in the flowering of common beans, the number of pods per plant, number of grains per pod, mass of 100 grains, grain yield and final stand of the common beans. The sources of nitrogen fertilizer did not influence, leaf N content, the mass of MSPA and the relative chlorophyll index of common beans. The use of polymerized urea and urea with urease inhibitor, did not produce increases in the number of grains per pod, number of pods per plant, mass of 100 grains and common beans yield compared to traditional sources of N, urea, ammonium sulfate and ammonium nitrate.

  16. Bean and rice meals reduce postprandial glycemic response in adults with type 2 diabetes: a cross-over study

    Directory of Open Access Journals (Sweden)

    Thompson Sharon V

    2012-04-01

    Full Text Available Abstract Background Around the world, beans and rice are commonly consumed together as a meal. With type 2 diabetes increasing, the effect of this traditional diet pattern on glycemic response has not been studied fully. Methods We evaluated the glycemic response of bean and rice traditional meals compared to rice alone in adults with type 2 diabetes. Seventeen men and women with type 2 diabetes controlled by metformin (n = 14 or diet/exercise (n = 3 aged 35–70 years participated in the randomized 4 × 4 crossover trial. The white long grain rice control, pinto beans/rice, black beans/rice, red kidney beans/rice test meals, matched for 50 grams of available carbohydrate, were consumed at breakfast after a 12 hour fast. Capillary blood glucose concentrations at baseline and at 30 minute intervals up to 180 minutes postprandial were collected. MANOVA for repeated measures established glucose differences between treatments. Paired t tests identified differences between bean types and the rice control following a significant MANOVA. Results Postprandial net glucose values were significantly lower for the three bean/rice treatments in contrast to the rice control at 90, 120 and 150 minutes. Incremental area under the curve values were significantly lower for the pinto and black bean/rice meals compared to rice alone, but not for kidney beans. Conclusions Pinto, dark red kidney and black beans with rice attenuate the glycemic response compared to rice alone. Promotion of traditional foods may provide non-pharmaceutical management of type 2 diabetes and improve dietary adherence with cultural groups. Trial registration Clinical Trials number NCT01241253

  17. Response- Surface Analysis for Evaluation of Competition in Different Densities of Sesame (Sesamum indicum and Bean (Phaseolus vulgaris Intercropping

    Directory of Open Access Journals (Sweden)

    A. Koocheki

    2014-12-01

    Full Text Available Response surface models predict crop yield based on crop density and this is an important tool for evaluation competition at different density and hence selection of optimum density based on yield. In order to study intra and inter specific competition in intercropping bean (Phaseolus vulgaris and sesame (Sesamum indicum, an experiment was conducted at the Agricultural Research Station, Ferdowsi University of Mashhad during the growing season of 2010. For this purpose a complete randomized block design with 3 replications and 16 treatments based on different densities of sesame and bean intercropping was used. The model predicted the maximum yield of an isolated plant of bean and sesame approximately 33 and 17g per plant respectively. The area associated with the maximum yield per plant in bean and sesame were 0.6 and 0.1 m2, respectively. Bean was the dominant competitor with respect to both grain and biomass, and competition coefficient was 0.35 and 0.3 for bean grain yield and bean biomass respectively. Intra-specific competition was more important than inter-specific competition for bean. Competition coefficient was 2.6 and 2.9 for sesame grain yield and biomass respectively. Intra-specific competition was much less important than Interspecific competition in sesame. The highest grain yield in bean (300 g m-2 was obtained of sole crop with density of 20 plants, and the highest sesame grain yield (195 g m-2 was obtained of sole crop with density of 40 plants, the highest land equivalent ratio (1.14 was obtained in intercropping of 20 plants of bean and 10 plants of sesame.

  18. Choice of common bean parents based on combining ability estimates

    Directory of Open Access Journals (Sweden)

    Machado Cristina de Fátima

    2002-01-01

    Full Text Available The obtention of genetically improved cultivars is the main objective of breeding programs, whose efficiency is increased by a careful choice of parents. Based on both general (GCA and specific (SCA combining abilities for grain yield, the purpose of this research was to choose the most promising populations of common beans, for line selection. GCA and SCA were measured by means of a complete diallel without reciprocals, using twelve cultivars/lines. Parents and corresponding F2 segregating populations were evaluated for grain yield by a 9 x 9 triple square lattice design. It was found that the segregating populations differed in grain yield, with predominant SCA effects, but with significant GCA effects as well. Among the populations derived from parents with positive GCA values, Aporé x CI-128, CI-128 x Pérola, PF-9029975 x Ouro Negro, and CI-128 x Ouro Negro also showed positive SCA values and high grain yields, therefore being the most promising populations for grain yield improvement. The highest values of specific combining ability were observed in populations H-4-7 x ESAL 693, CI-128 x Pérola, and A-285 Rudá x IAC Carioca Aruã, which must be the most segregating ones. Hybrid combinations with a high SCA deriving from at least one parent with high GCA were: Pérola x CI-128 and Ouro Negro x Pérola. Although line ESAL 693 presented the lowest GCA value, one of its derived populations, ESAL 693 x H-4-7, had the highest SCA and heterosis values. The high correlation between heterosis and SCA indicates that heterosis can be useful when SCA is not available.

  19. Bacillus vanillea sp. nov., Isolated from the Cured Vanilla Bean.

    Science.gov (United States)

    Chen, Yong-gan; Gu, Feng-lin; Li, Ji-hua; Xu, Fei; He, Shu-zhen; Fang, Yi-ming

    2015-02-01

    A Gram-positive bacterium, designated strain XY18(T), was isolated from a cured vanilla bean in Hainan province, China. Cells were rod-shaped, endospore producing, and peritrichous flagella. Strain XY18(T) grew at salinities of 0-8 % (w/v) NaCl (optimally 1-4 %), pH 4.0-8.0 (optimally 5.0-7.0 %) and temperature range 20-45 °C (optimally 28-35 °C). The predominant menaquinone was MK-7. The major cellular fatty acids were anteiso-C15:0, iso-C15:0, anteiso-C17:0, and iso-C17:0. Phylogenetic analysis based on 16S rRNA gene sequence indicated that strain XY18(T) was a member of the genus Bacillus, and closely related to B. amyloliquefaciens NBRC 15535(T) and B. siamensis PD-A10(T), with 99.1 and 99.2 % sequence similarity, respectively. However, the DNA-DNA hybridization value between strain XY18(T) and B. amyloliquefaciens NBRC 15535(T) was 35.7 %. The genomic DNA G+C content of strain XY18(T) was 46.4 mol%, significantly differed from B. siamensis PD-A10(T) (41.4 %), which was higher than the range of 4 % indicative of species. On the basis of polyphasic taxonomic study, including phenotypic features, chemotaxonomy, and phylogenetic analyses, strain XY18(T) represents a novel species within the genus Bacillus, for which the name Bacillus vanillea sp. nov. is proposed. The type strain is XY18(T) (=CGMCC 8629 = NCCB 100507).

  20. The BEAN experiment - An EISCAT study of ion temperature anisotropies

    Directory of Open Access Journals (Sweden)

    I. W. McCrea

    Full Text Available Results are presented from a novel EISCAT special programme, SP-UK-BEAN, intended for the direct measurement of the ion temperature anisotropy during ion frictional heating events in the high-latitude F-region. The experiment employs a geometry which provides three simultaneous estimates of the ion temperature in a single F-region observing volume at a range of aspect angles from 0° to 36°. In contrast to most previous EISCAT experiments to study ion temperature anisotropies, field-aligned observations are made using the Sodankylä radar, while the Kiruna radar measures at an aspect angle of the order of 30°. Anisotropic effects can thus be studied within a small common volume whose size and altitude range is limited by the radar beamwidth, rather than in volumes which overlap but cover different altitudes. The derivation of line-of-sight ion temperature is made more complex by the presence of an unknown percentage of atomic and molecular ions at the observing altitude and the possibility of non-Maxwellian distortion of the ion thermal velocity distribution. The first problem has been partly accounted for by insisting that a constant value of electron temperature be maintained. This enables an estimate of the ion composition to be made, and facilitates the derivation of more realistic line-of-sight ion temperatures and temperature anisotropies. The latter problem has been addressed by assuming that the thermal velocity distribution remains bi-Maxwellian. The limitations of these approaches are discussed. The ion temperature anisotropies and temperature partition coefficients during two ion heating events give values intermediate between those expected for atomic and for molecular species. This result is consistent with an analysis which indicates that significant proportions of molecular ions (up to 50% were present at the times of greatest heating.

  1. Utilisation of total solar radiation energy in the photosynthetic production of radish, red beet and bean

    Directory of Open Access Journals (Sweden)

    Wiesław Nowakowski

    2014-01-01

    Full Text Available Utilisation of total solar radiation energy in the photosynthetic production of radish, red beet and bean is expressed as per cent of solar radiation accumulated in the carbon of -the dry mass per 1 cm2 of the assimilation surface area. Utilisation of this energy ranges from 2.6 to 8.4 per cent in radish, from 1.7 to 7.5 per cent in beet and from 1.9 to 4.9 per cent in bean.

  2. CAF\\'E-BEANS: An exhaustive hunt for high-mass binaries

    CERN Document Server

    Negueruela, I; Simón-Díaz, S; Alfaro, E J; Herrero, A; Alonso, J; Barbá, R; Lorenzo, J; Marco, A; Monguió, M; Morrell, N; Pellerin, A; Sota, A; Walborn, N R

    2014-01-01

    CAF\\'E-BEANS is an on-going survey running on the 2.2 m telescope at Calar Alto. For more than two years, CAF\\'E-BEANS has been collecting high-resolution spectra of early-type stars with the aim of detecting and characterising spectroscopic binaries. The main goal of this project is a thorough characterisation of multiplicity in high-mass stars by detecting all spectroscopic and visual binaries in a large sample of Galactic O-type stars, and solving their orbits. Our final objective is eliminating all biases in the high-mass-star IMF created by undetected binaries.

  3. Laboratory invesitgations of variability of Ascochyta fabae Speg. isolates obtained from horse bean

    Directory of Open Access Journals (Sweden)

    Antoni Józef Filipowicz

    2014-08-01

    Full Text Available Fifty five isolates of Ascochyta fabae Speg. were investigated. They were selected from 1650 isolates of this fungus obtained from horse bean seeds in 1974-1976. All the isolates grew and sporulated on Potato Dextrose Agar, Malt Agar and Horse Bean Agar. The rate of their growth amounted to 1-4 mm per 24 hours. The variability of isolates in size of pycnidia and conidia and number of sepia was noticed. A few spores with untypical shapes were observed as well.

  4. Transcriptome-wide identification and characterization of microRNAs from castor bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Wei Xu

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are endogenously encoded small RNAs that post-transcriptionally regulate gene expression and play essential roles in numerous developmental and physiological processes. Currently, little information on the transcriptome and tissue-specific expression of miRNAs is available in the model non-edible oilseed crop castor bean (Ricinus communis L., one of the most important non-edible oilseed crops cultivated worldwide. Recent advances in sequencing technologies have allowed the identification of conserved and novel miRNAs in many plant species. Here, we used high-throughput sequencing technologies to identify and characterize the miRNAs in castor bean. RESULTS: Five small RNA libraries were constructed for deep sequencing from root tips, leaves, developing seeds (at the initial stage, seed1; and at the fast oil accumulation stage, seed2 and endosperms in castor bean. High-throughput sequencing generated a large number of sequence reads of small RNAs in this study. In total, 86 conserved miRNAs were identified, including 63 known and 23 newly identified. Sixteen miRNA isoform variants in length were found from the conserved miRNAs of castor bean. MiRNAs displayed diverse organ-specific expression levels among five libraries. Combined with criteria for miRNA annotation and a RT-PCR approach, 72 novel miRNAs and their potential precursors were annotated and 20 miRNAs newly identified were validated. In addition, new target candidates for miRNAs newly identified in this study were proposed. CONCLUSIONS: The current study presents the first high-throughput small RNA sequencing study performed in castor bean to identify its miRNA population. It characterizes and increases the number of miRNAs and their isoforms identified in castor bean. The miRNA expression analysis provides a foundation for understanding castor bean miRNA organ-specific expression patterns. The present study offers an expanded picture of miRNAs for castor

  5. Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice

    OpenAIRE

    2014-01-01

    This study investigated whether decaffeinated green coffee bean extract prevents obesity and improves insulin resistance and elucidated its mechanism of action. Male C57BL/6N mice (N = 48) were divided into six dietary groups: chow diet, HFD, HFD-supplemented with 0.1%, 0.3%, and 0.9% decaffeinated green coffee bean extract, and 0.15% 5-caffeoylquinic acid. Based on the reduction in HFD-induced body weight gain and increments in plasma lipids, glucose, and insulin levels, the minimum effectiv...

  6. 糟方的制作方法%The making method of white preserved bean curd

    Institute of Scientific and Technical Information of China (English)

    李学贵

    2011-01-01

    So as to promote the research and development of preserved bean curd products,the processing technology of white preserved bean curd is concluded.The raw material,ingredients and technological process are explained in detail and the operation points are g%为了促进豆腐乳新品的研究和开发,总结了糟方的制作方法,对制作糟方所需的原料、配方和工艺流程做了较为详细的介绍,并着重讨论了制作糟方的操作要点。

  7. First report of Cowpea mild mottle Carlavirus on yardlong bean (Vigna unguiculata subsp. sesquipedalis) in Venezuela.

    Science.gov (United States)

    Brito, Miriam; Fernández-Rodríguez, Thaly; Garrido, Mario José; Mejías, Alexander; Romano, Mirtha; Marys, Edgloris

    2012-12-14

    Yardlong bean (Vigna unguiculata subsp. sesquipedalis) plants with virus-like systemic mottling and leaf distortion were observed in both experimental and commercial fields in Aragua State, Venezuela. Symptomatic leaves were shown to contain carlavirus-like particles. RT-PCR analysis with carlavirus-specific primers was positive in all tested samples. Nucleotide sequences of the obtained amplicons showed 84%-74% similarity to corresponding sequences of Cowpea mild mottle virus (CPMMV) isolates deposited in the GenBank database. This is the first report of CPMMV in Venezuela and is thought to be the first report of CPMMV infecting yardlong bean.

  8. First Report of Cowpea Mild Mottle Carlavirus on Yardlong Bean (Vigna unguiculata subsp. sesquipedalis in Venezuela

    Directory of Open Access Journals (Sweden)

    Edgloris Marys

    2012-12-01

    Full Text Available Yardlong bean (Vigna unguiculata subsp. sesquipedalis plants with virus-like systemic mottling and leaf distortion were observed in both experimental and commercial fields in Aragua State, Venezuela. Symptomatic leaves were shown to contain carlavirus-like particles. RT-PCR analysis with carlavirus-specific primers was positive in all tested samples. Nucleotide sequences of the obtained amplicons showed 84%–74% similarity to corresponding sequences of Cowpea mild mottle virus (CPMMV isolates deposited in the GenBank database. This is the first report of CPMMV in Venezuela and is thought to be the first report of CPMMV infecting yardlong bean.

  9. Composição volátil dos defeitos intrínsecos do café por CG/EM-headspace Volatile composition of intrinsic defective coffee beans by GC/MS-headspace

    Directory of Open Access Journals (Sweden)

    Raquel D. C. C. Bandeira

    2009-01-01

    Full Text Available About 20% of Brazilian raw coffee production is considered inappropriate for exportation. Consequently, these beans are incorporated to good quality beans in the Brazilian market. This by-product of coffee industry is called PVA due to the presence of black (P, green (V and sour (A defective beans which are known to contribute considerably for cup quality decrease. Data on the volatile composition of Brazilian defective coffee beans are scarce. In this study, we evaluated the volatile composition of immature, black-immature, black defective beans and PVA compared to good quality beans. Potential defective beans markers were identified.

  10. Development and field evaluation of an intercropping machine for corn and bean

    Directory of Open Access Journals (Sweden)

    A Mondani

    2016-09-01

    Full Text Available Introduction Maximum efficiency of natural resources, reduced risk of production, improved fertility of soil, and increased production per area enjoyment have made intercropping a preferential practice compared with cropping. One of the fundamental problems in this kind of cropping is non-existence of suitable machines. In this research, a new intercropping machine has been designed and built for intercropping of corn and bean with precise ratios and different planting patterns. Materials and Methods The experiments were conducted at the Badjgah Research Station, Shiraz University, located in NW Shiraz, Iran. The soil texture was clay loam (16% sand, 48% silt, and 35% clay. The plot size was 9 m wide and 12 m long. The total number of the plots were 9. The basic components of intercropping machine were an adjustable frame to adjust row spacing for each unit planter about 550 mm horizontally independently (the row spacing between corn and bean planting lines was considered 375 mm, a hinged frame for adjustment of seeding depth and possible poor emergence of plants due to very deep or shallow planting, metering case frames for installing the vacuum metering disk units around which the seed drums have a row of 36 holes of 4.5 and 5.5 mm diameter for corn and bean, respectively, seed delivery tubes, a suction fan, shovel openers used for bedder planting for corn and lister planting for bean, a knife covering attachment, seed-firming wheels, interchangeable gears which are mechanical chain drives for 43 varying seeding rates driven by carrying wheel drives, two metal seed hoppers whose lower side walls’ slope can be adjust at a maximum level of 45 . A front wheel assist, Massey Ferguson tractor (MF-399 (ITM, Tabriz, Iran with a maximum engine power of 81 kW was used for field test of intercropping machine. Moldboard plow was used for primary tillage and the depth of plowing was 25 cm. Next, by an offset disk harrow, the field was disked twice for

  11. Effect of soaking and fermentation on content of phenolic compounds of soybean (Glycine max cv. Merit) and mung beans (Vigna radiata [L] Wilczek).

    Science.gov (United States)

    María Landete, José; Hernández, Teresa; Robredo, Sergio; Dueñas, Montserrat; de Las Rivas, Blanca; Estrella, Isabel; Muñoz, Rosario

    2015-03-01

    Mung beans (Vigna radiata [L] Wilczek) purchased from a Spanish company as "green soybeans", showed a different phenolic composition than yellow soybeans (Glycine max cv. Merit). Isoflavones were predominant in yellow soybeans, whereas they were completely absent in the green seeds on which flavanones were predominant. In order to enhance their health benefits, both types of bean were subjected to technological processes, such as soaking and fermentation. Soaking increased malonyl glucoside isoflavone extraction in yellow beans and produced an increase in apigenin derivatives in the green beans. Lactobacillus plantarum CECT 748 T fermentation produced an increase in the bioactivity of both beans since a conversion of glycosylated isoflavones into bioactive aglycones and an increase of the bioactive vitexin was observed in yellow and green beans, respectively. In spite of potential consumer confusion, since soybean and "green soybean" are different legumes, the health benefits of both beans were enhanced by lactic fermentation.

  12. Identification of the key odorants in Tahitian cured vanilla beans (Vanilla tahitensis) by GC-MS and an aroma extract dilution analysis.

    Science.gov (United States)

    Takahashi, Makoto; Inai, Yoko; Miyazawa, Norio; Kurobayashi, Yoshiko; Fujita, Akira

    2013-01-01

    The key odorants of Tahitian vanilla beans (Vanilla tahitensis) were characterized by a sensory evaluation, aroma extract dilution analysis (AEDA), quantification, and aroma reconstitution. Vanillin and anisaldehyde were identified in the same highest flavor dilution (FD) factor as the most characteristic odor-active compounds in Tahitian vanilla beans, followed by anisyl alcohol and anisyl acetate. Vanillin and anisyl alcohol were by far the most abundant odorants present with the highest concentration in the beans, followed by acetic acid, anisaldehyde, and anisyl acetate. A sensory evaluation of Tahitian vanilla beans and its reconstitute aroma concentrate characterized both samples as similar. These results indicated vanillin, anisaldehyde, anisyl alcohol, and anisyl acetate to be the key odorants in Tahitian vanilla beans. 3-Methylnonane-2,4-dione were identified for the first time in vanilla beans. β-Damascenone and phenylacetic acid were identified for the first time in Tahitian vanilla beans.

  13. Effects of inclusion level on nutrient digestibility and energy content of wheat middlings and soya bean meal for growing pigs.

    Science.gov (United States)

    Huang, Qiang; Piao, Xiangshu; Liu, Ling; Li, Defa

    2013-01-01

    Two experiments were conducted to determine the effects of inclusion level of wheat middlings and soya bean meal on apparent total tract digestibility (ATTD) of energy and chemical components of these ingredients in growing pigs. Furthermore, the effects of the inclusion level on their contents of digestible energy (DE) and metabolisable energy (ME) were also determined by the difference method. In Experiment 1, six diets were fed to 36 growing pigs according to a completely randomised design. The basal diet was a corn-soya bean meal diet while the other five diets contained 9.6%, 19.2%, 28.8%, 38.4% or 48.0% of wheat middlings added at the expense of corn and soya bean meal. The measured digestibility of energy and most nutrients of wheat middlings increased (p soya bean meal (22.2% and 33.6%). The content of DE in soya bean meal did not differ at 22.2% and 33.6% inclusion levels (16.2 and 16.3 MJ/kg DM, respectively), but the digestibility of dry matter (DM), organic matter and carbohydrates was increased at a higher inclusion level (p soya bean meal and wheat middlings was affected by their dietary inclusion levels. For soya bean meal, the estimated energy contents was independent of its inclusion level, but not for wheat middlings. Therefore, the inclusion level of wheat middlings has to be considered for estimating their energy value.

  14. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) and comparison with the broader species.

    Science.gov (United States)

    Xu, Pei; Wu, Xiaohua; Wang, Baogen; Liu, Yonghua; Ehlers, Jeffery D; Close, Timothy J; Roberts, Philip A; Diop, Ndeye-Ndack; Qin, Dehui; Hu, Tingting; Lu, Zhongfu; Li, Guojing

    2011-01-06

    Asparagus bean (Vigna. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea [Vigna. unguiculata (L.) Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs), with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs) identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  15. Application of different techniques to identify the effects of irradiation on Brazilian beans after six months storage

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, A.L.C.H.; Mancini-Filho, J.; Delincee, H

    1998-06-01

    Four different techniques to detect the effect of irradiation in beans were investigated. Two types of Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macacar, were irradiated using a {sup 60}Co source with doses ranging from 0, 1.0 to 10.0 kGy. After 6 months storage at ambient temperature the detection tests were carried out. Firstly, germination tests showed markedly reduced root growth and almost totally retarded shoot elongation of irradiated beans as compared to non-irradiated beans. Secondly, DNA fragmentation was studied using a microgel electrophoresis. Irradiated cells produced typical comets with DNA fragments migrating towards the anode. DNA of non-irradiated cells exhibited a limited migration. Thirdly, electron spin resonance for detection of cellulose radicals was tested, since it was expected that these free radicals are quite stable in solid and dry foods. However, only in beans irradiated with 10 kGy a small signal could be detected. Fourthly, thermoluminescence, a method to analyze mineral debris adhering to food, turned out to be a good choice to detect irradiation effects in beans, even after 6 months of storage. The results indicate that three of these four techniques proposed, can be used to detect the effect of irradiation in these two varieties of Brazilian beans at a dose level useful for insect disinfestation (1 kGy)

  16. Application of different techniques to identify the effects of irradiation on Brazilian beans after six months storage

    Science.gov (United States)

    Villavicencio, A. L. C. H.; Mancini-Filho, J.; Delincée, H.

    1998-06-01

    Four different techniques to detect the effect of irradiation in beans were investigated. Two types of Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macaçar, were irradiated using a 60Co source with doses ranging from 10.0 kGy. After 6 months storage at ambient temperature the detection tests were carried out. Firstly, germination tests showed markedly reduced root growth and almost totally retarded shoot elongation of irradiated beans as compared to non-irradiated beans. Secondly, DNA fragmentation was studied using a microgel electrophoresis. Irradiated cells produced typical comets with DNA fragments migrating towards the anode. DNA of non-irradiated cells exhibited a limited migration. Thirdly, electron spin resonance for detection of cellulose radicals was tested, since it was expected that these free radicals are quite stable in solid and dry foods. However, only in beans irradiated with 10 kGy a small signal could be detected. Fourtly, thermoluminescence, a method to analyze mineral debris adhering to food, turned out to be a good choice to detect irradiation effects in beans, even after 6 months of storage. The results indicate that three of these four techniques proposed, can be used to detect the effect of irradiation in these two varieties of Brazilian beans at a dose level useful for insect disinfestation (1 kGy).

  17. Breeding for culinary and nutritional quality of common bean (Phaseolus vulgaris L. in intercropping systems with maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Rodino A.P.

    1999-01-01

    Full Text Available Common bean (Phaseolus vulgaris L. is widely intercropped with maize (Zea mays L. in the North of Spain. Breeding beans for multiple cropping systems is important for the development of a productive and sustainable agriculture, and is mainly oriented to minimize intercrop competition and to stabilize complementarity with maize. Most agricultural research on intercropping to date has focused on the agronomic and overall yield effects of the different species, but characters related with socio-economic and food quality aspects are also important. The effect of intercropping beans with maize on food seed quality traits was studied for thirty-five bush bean varieties under different environments in Galicia (Northwestern Spain. Parameters determining Asturian (Northern Spain white bean commercial and culinary quality have also been evaluated in fifteen accessions. There are significant differences between varieties in the selected cropping systems (sole crop, intercrop with field maize and intercrop with sweet maize for dry and soaked seed weight, coat proportion, crude protein, crude fat and moisture. Different white bean accessions have been chosen according to their culinary quality. Under these environmental conditions it appears that intercropping systems with sweet maize give higher returns than sole cropping system. It is also suggested that the culinary and nutritional quality potential of some white bean accessions could be the base material in a breeding programme the objectives of which are to develop varieties giving seeds with high food quality.

  18. Folate content in faba beans (Vicia faba L.)-effects of cultivar, maturity stage, industrial processing, and bioprocessing.

    Science.gov (United States)

    Hefni, Mohammed E; Shalaby, Mohamed T; Witthöft, Cornelia M

    2015-01-01

    Faba beans are an important source of folate and commonly consumed in Egypt. This study examined the effects of Egyptian industrial food processing (e.g., canning and freezing), germination, cultivar, and maturity stages on folate content, with the aim to develop a candidate functional canned faba bean food with increased folate content. The folate content in four cultivars of green faba beans ranged from 110 to 130 μg 100 g(-1) fresh weight (535-620 μg 100 g(-1) dry matter [DM]), which was four- to sixfold higher than in dried seeds. Industrial canning of dried seeds resulted in significant folate losses of ∼20% (P = 0.004), while industrial freezing had no effect. Germination of faba beans increased the folate content by >40% (P canning process involving pregermination of dried faba beans resulted in a net folate content of 194 μg 100 g(-1) DM, which is 52% more than in conventional canned beans. The consumption of green faba beans should be recommended, providing ∼120 μg dietary folate equivalents per 100 g/portion.

  19. Spectral identifiers from roasting process of Arabica and Robusta green beans using Laser-Induced Breakdown Spectroscopy (LIBS)

    Science.gov (United States)

    Wirani, Ayu Puspa; Nasution, Aulia; Suyanto, Hery

    2016-11-01

    Coffee (Coffea spp.) is one of the most widely consumed beverages in the world. World coffee consumption is around 70% comes from Arabica, 26% from Robusta , and the rest 4% from other varieties. Coffee beverages characteristics are related to chemical compositions of its roasted beans. Usually testing of coffee quality is subjectively tasted by an experienced coffee tester. An objective quantitative technique to analyze the chemical contents of coffee beans using LIBS will be reported in this paper. Optimum experimental conditions was using of 120 mJ of laser energy and delay time 1 μs. Elements contained in coffee beans are Ca, W, Sr, Mg, Na, H, K, O, Rb, and Be. The Calcium (Ca) is the main element in the coffee beans. Roasting process will cause the emission intensity of Ca decreased by 42.45%. In addition, discriminant analysis was used to distinguish the arabica and robusta variants, either in its green and roasted coffee beans. Observed identifier elements are Ca, W, Sr, and Mg. Overall chemical composition of roasted coffee beans are affected by many factors, such as the composition of the soil, the location, the weather in the neighborhood of its plantation, and the post-harvesting process of the green coffee beans (drying, storage, fermentation, and roasting methods used).

  20. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis and comparison with the broader species.

    Directory of Open Access Journals (Sweden)

    Pei Xu

    Full Text Available Asparagus bean (Vigna. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea [Vigna. unguiculata (L. Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  1. Recognition of spectral identifier from green coffee beans of arabica and robusta varieties using laser-induced breakdown spectroscopy

    Science.gov (United States)

    Anggraeni, Karina; Nasution, Aulia; Suyanto, Hery

    2016-11-01

    Coffee is one of the world's commodity that is cultivated in more than 50 countries. Production of coffee in Indonesia is positioned of fourth rank in the world, after Brazil, Vietnam, and Colombia. There are two varieties of coffee grown in Indonesia, i.e. the arabica and robusta. The chemical compositions between arabica and robusta are different each other. A trained coffee tester can distinguish these differences from its taste, but it is very subjective. Laser-Induced Breakdown Spectroscopy (LIBS) is a spectroscopic technique based on the analysis of micro-plasma induced on the surface sample after being shot with a laser pulse. In this study, elemental spectra acquired using Laser-Induced Breakdown Spectroscopy (LIBS) technique were analysed to differentate between green coffee beans of arabica and robusta, which are collected from plantations in Malang, Bondowoso, Prigen, and Pasuruan. Results show that optimum conditions for acquiring spectra from green coffee beans using LIBS are at 120 mJ of laser energy and 1,0 μs of delay time. Green coffee beans of arabica and robusta contain some elements such as Ca, W, Sr, Mg, Be, Na, H, N, K, Rb, and O. Discriminant analysis method was then applied to distinguish the green beans of arabica and robusta coffee. Element identifiers of green coffee beans are Ca, W, Mg, Be, Na, and Sr. The abundant element in green coffee beans is Calcium (Ca), and depth-profile testing shows that Ca is homogeneous inside the beans.

  2. Genetic control on morphoagzronomic traits in snap bean

    Directory of Open Access Journals (Sweden)

    Marlon Peres da Silva

    2004-11-01

    Full Text Available Five divergent snap bean accessions from the vegetables germplasm bank at UENF and their ten diallel hybrids were evaluated to inheritance on five morphoagronomic traits using Hayman's methodology (1954. The results showed that additive effects were predominant for pod weight per plant, number of seeds per pod, height of the insertion of the first pod and number of days to flowering while non-additive effects were more important for number of pods per plant. The best strategy to be adopted was the use of these acessions in an intrapopulation breeding program aiming the obtaintion of superior segregants. For pod numbers the indicated strategy would be an interpopulational breeding procedure, to exploite the heterosis related to the non-additive effects. The analysis also revealed that dominant alleles increased the number of pods per plant, pod weight per plant and number of seeds per pod. Allelic interaction was overdominance to the number of pods per plant, while the partial dominance controled the expression of other traits.Cinco acessos divergentes de feijão-de-vagem do banco de germoplasma da UENF, Rio de Janeiro, Brasil, e seus dez híbridos dialélicos possíveis, foram avaliados quanto à herança para cinco características morfoagronômicas, utilizando a metodologia de Hayman (1954. Os resultados evidenciaram que os efeitos gênicos aditivos foram predominantes para peso de vagem por planta, número de sementes por vagem, altura da inserção da primeira vagem e número de dias para florescimento, enquanto os efeitos gênicos não aditivos foram mais importantes na expressão de número de vagens por planta. Isso demonstra que, para as quatro primeiras características, a melhor estratégia a ser adotada é o uso dos acessos em programa de melhoramento intrapopulacional, visando a obtenção de segregantes superiores. Para número de vagens, a estratégia de melhoramento interpopulacional seria mais indicada, por explorar a heterose

  3. Variability of nutritional and cooking quality in bean (Phaseolus vulgaris L) as a function of genotype.

    Science.gov (United States)

    Saha, Supradip; Singh, Gyanendra; Mahajan, V; Gupta, H S

    2009-06-01

    Screening of natural biodiversity for the better quality traits are of prime importance for quality breeding programs. The objective of this investigation was to select candidate accession of bean having high concentrations of protein as well as macro and micro minerals with good cooking quality for use as parents in breeding programme for these compounds. Thirty-five accessions of bean (Phaseolus vulgaris L) were field grown and their seeds were analyzed for their cooking quality and nutritional composition. Wide variations were observed in most of the measurements e.g. protein (18.7-26.2%), iron (79.4-137.6 ppm) and hardness after cooking (4.65-9.88 Kg) suggesting that there are considerable levels of genetic diversity. Across all accessions the concentration of potassium was negatively correlated with protein (r = -0.43, P XXX and XXXI. Bean line XIX contains high protein (24.9%) with high zinc (33.3 ppm) and highest iron (137.6 ppm), but it has high hardness after cooking (7.32 kg). Four clusters were computed by cluster analysis that explained quite a good variation in the traits. The great variability for these attributes suggests that these selected accessions may be useful as parents in hybridization programs to produce bean with value-added traits. This information was also potentially useful for pulse breeders working on the development of new varieties.

  4. Differences in common bean rhizobial populations associated with soil tillage management in southern Brazil

    NARCIS (Netherlands)

    Kaschuk, G.; Hungria, M.; Santos, J.C.P.; Berton-Junior, J.F.

    2006-01-01

    Progressive adoption of no-tillage (NT) agriculture in the tropics is finally reversing physical, chemical, and biological erosion of soil and in Brazil, an estimated 19 Mha are now devoted to NT. Common bean (Phaseolus vulgaris L.) is a main component of Brazilian agriculture, and enhancement of yi

  5. Field level risk assessment for root-knot nematodes in lima beans

    Science.gov (United States)

    Southern Root-Knot Nematode (RKN), Meloidogyne incognita, is a major yield limiting pest in lima beans (Phaseolus lunatus). RKN are not evenly distributed through fields and population dynamics are fluid making whole field management challenging. The objectives of this research were to characterize ...

  6. Modelling the change in colour in broccoli and green beans during blanching

    NARCIS (Netherlands)

    Tijskens, L.M.M.; Schijvens, E.P.H.M.; Biekman, E.S.A.

    2001-01-01

    The green colour of vegetables changes considerably during heat treatments like blanching. Green beans from two different countries and growing seasons, and the stems and florets of broccoli were heat-treated from 40 up to 96 °C. The colour was monitored with the CIE-Lab system. Expressing the green

  7. Reaction of common bean lines and aggressiveness of Sclerotinia sclerotiorum isolates.

    Science.gov (United States)

    Silva, P H; Santos, J B; Lima, I A; Lara, L A C; Alves, F C

    2014-11-07

    The aims of this study were to evaluate the reaction of common bean lines to white mold, the aggressiveness of different Sclerotinia sclerotiorum isolates from various common bean production areas in Brazil, and comparison of the diallel and GGE (genotype main effect plus genotype-by-environment interaction) biplot analysis procedures via study of the line-by-isolate interaction. Eleven common bean (Phaseolus vulgaris) lines derived from 3 backcross populations were used. Field experiments were performed in the experimental area of the Departamento de Biologia of the Universidade Federal de Lavras, Lavras, MG, Brazil, in the 2011 and 2012 dry crop season and 2011 winter crop season through a randomized block design with 3 replications. This study was also set up in a greenhouse. Inoculations were performed 28 days after sowing by means of the straw test method. The reaction of the bean lines to white mold was assessed according to a diagrammatic scale from 1 (plant without symptoms) to 9 (dead plant). Estimations of general reaction capacity (lines) and general aggressiveness capacity (isolates) indicated different horizontal levels of resistance in the lines and levels of aggressiveness in the isolates. Therefore, it was possible to select more resistant lines and foresee those crosses that are the most promising for increasing the level of resistance. It was also possible to identify the most aggressive isolates that were more efficient in distinguishing the lines. Both diallel and GGE biplot analyses were useful in identifying the genotypic values of lines and isolates.

  8. Yield and quality attributes of faba bean inbred lines grown under marginal environmental conditions of Sudan.

    Science.gov (United States)

    Gasim, Seif; Hamad, Solafa A A; Abdelmula, Awadalla; Mohamed Ahmed, Isam A

    2015-11-01

    Faba beans (Vicia faba L.) represent an essential source of food protein for many people in Sudan, especially those who cannot afford to buy animal meat. The demand for faba bean seeds is greatly increased in recent years, and consequently its production area was extended southward where the climate is marginally suitable. Therefore, this study was aimed to evaluate seed yield and nutritional quality of five faba bean inbred lines grown under marginal environmental conditions of Sudan. The inbred lines have considerable (P ≤ 0.05) variability in yield and yield components, and seed chemical composition. The mean carbohydrate content was very high (501.1 g kg(-1)) and negatively correlated with seed yield, whereas the average protein content was relatively high (253.1 g kg(-1)) and positively correlated with seed yield. Globulin was the significant fraction (613.5 g kg(-1)protein) followed by albumin (200.2 g kg(-1)protein). Biplot analysis indicates that inbred lines Hudeiba/93-S5 and Ed-damar-S5 outscore other lines in terms of seed yield and nutritional quality. This study demonstrates that Hudeiba/93-S5 and Ed-damar-S5 are useful candidates in faba bean breeding program to terminate the protein deficiency malnutrition and provide healthy and nutritious meal for people living in subtropical areas.

  9. Growth characteristics of mung beans and water convolvuluses exposed to 425-MHz electromagnetic fields.

    Science.gov (United States)

    Jinapang, Peeraya; Prakob, Panida; Wongwattananard, Pongtorn; Islam, Naz E; Kirawanich, Phumin

    2010-10-01

    Effects of high-frequency, continuous wave (CW) electromagnetic fields on mung beans (Vigna radiata L.) and water convolvuluses (Ipomoea aquatica Forssk.) were studied at different growth stages (pre-sown seed and early seedling). Specifically, the effects of the electromagnetic source's power and duration (defined as power-duration level) on the growth of the two species were studied. Mung beans and water convolvuluses were exposed to electromagnetic fields inside a specially designed chamber for optimum field absorption, and the responses of the seeds to a constant frequency at various power levels and durations of exposure were monitored. The frequency used in the experiments was 425 MHz, the field strengths were 1 mW, 100 mW, and 10 W, and the exposure durations were 1, 2, and 4 h. Results show that germination enhancement is optimum for the mung beans at 100 mW/1 h power-duration level, while for water convolvuluses the optimum germination power-duration level was 1 mW/2 h. When both seed types were exposed at the early sprouting phase with their respective optimum power-duration levels for optimum seed growth, water convolvuluses showed growth enhancement while mung bean sprouts showed no effects. Water content analysis of the seeds suggests thermal effects only at higher field strength.

  10. ‘IAC Milênio’ – Common bean cultivar with high grain quality

    Directory of Open Access Journals (Sweden)

    Sérgio Augusto Morais Carbonell

    2014-11-01

    Full Text Available The Instituto Agronômico de Campinas – IAC registered the carioca type common bean cultivar IAC Milênio. The cultivar has a mean yield of 2831 kg ha-1, high grain quality with tolerance to darkening, and resistance to Fusarium oxysporum and physiological races 81, 89, and 95 of the anthracnose pathogen (Colletotrichum lindemuthianum.

  11. Chemical composition and in vitro polysaccharide fermentation of different beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Campos-Vega, R; Reynoso-Camacho, R; Pedraza-Aboytes, G; Acosta-Gallegos, J A; Guzman-Maldonado, S H; Paredes-Lopez, O; Oomah, B D; Loarca-Piña, G

    2009-09-01

    The composition of bioactives including polysaccharide yield and resistant starch (RS) content of 4 raw and cooked bean (Phaseolus vulgaris L.) cultivars was evaluated. Polysaccharide was fermented in vitro by incubation with human gut flora under anaerobic conditions and short-chain fatty acids (SCFAs) production was compared at 6, 12, and 24 h by gas chromatography. Polysaccharide and soluble fiber contents increased upon cooking with stachyose as the major oligosaccharide. Cooked bean of cultivar Bayo Madero had the highest yield of polysaccharides (55%) and resistant starch (37%), followed by those of Negro 8025 (48% and 32%, respectively). Acetate was the most abundant SCFAs formed in all bean varieties. The concentration of SCFAs was cultivar-dependent; Bayo Madero and Negro 8025 displayed the highest concentration of butyrate (15 mmol/L), while Azufrado Higuera had the lowest and highest concentrations of acetate (39 mmol/L) and propionate (14 mmol/L), respectively. The results suggest that the common bean is an excellent source of polysaccharides that can be fermented in the colon and produce SCFAs, compounds previously reported to exert health benefits.

  12. Natural occurrence of alternariol and alternariol monomethyl ether in soya beans.

    Science.gov (United States)

    Oviedo, M S; Barros, G G; Chulze, S N; Ramirez, M L

    2012-08-01

    The natural occurrence of alternariol (AOH) and alternariol monomethyl ether (AME) in soya beans harvested in Argentina was evaluated. Both toxins were simultaneously detected by using HPLC analysis coupled with a solid phase extraction column clean-up. Characteristics of this in-house method such as accuracy, precision and detection and quantification limits were defined by means of recovery test with spiked soya bean samples. Out of 50 soya bean samples, 60% showed contamination with the mycotoxins analyzed; among them, 16% were only contaminated with AOH and 14% just with AME. Fifteen of the positive samples showed co-occurrence of both mycotoxins analyzed. AOH was detected in concentrations ranging from 25 to 211 ng/g, whereas AME was found in concentrations ranging from 62 to 1,153 ng/g. Although a limited number of samples were evaluated, this is the first report on the natural occurrence of Alternaria toxins in soya beans and is relevant from the point of view of animal public health.

  13. Characterization of a Panela cheese with added probiotics and fava bean starch.

    Science.gov (United States)

    Escobar, M C; Van Tassell, M L; Martínez-Bustos, F; Singh, M; Castaño-Tostado, E; Amaya-Llano, S L; Miller, M J

    2012-06-01

    Of 20 Lactobacillus and 8 Bifidobacterium species examined, only Bifidobacterium breve ATCC 15700 was able to ferment starch from fava beans. Bifidobacterium breve ATCC 15700 and Lactobacillus rhamnosus GG ATCC 53103 were selected as probiotics for use in fresh-style Panela cheese. Two types of fresh cheese (with and without 3% fava bean starch) were manufactured with 3 combinations of probiotics: L. rhamnosus GG only, B. breve only, or both L. rhamnosus GG and B. breve. During 4 wk of storage at 4°C, the addition of fava bean starch to the cheese was not found to cause significant differences in the viability of either probiotic strain. However, the microstructure and texture of Panela cheese were altered, resulting in a much softer product. A sensory panel showed that the presence of added fava bean starch in Panela cheese was less desirable to consumers, whereas probiotic supplementation had no effect on perceived taste or appearance. Panela cheese could be a suitable food for inclusion of probiotic bacteria.

  14. Navy bean flour particle size and protein content affect cake baking and batter quality

    Science.gov (United States)

    There is a great demand for wheat alternatives in foods, particularly baked goods, as gluten sensitivity increases. Baked goods such as cakes have wheat flour as a major ingredient, which is rich in gluten protein. Bean proteins do not have gluten, and are a good source of soluble fiber, B-vitamins,...

  15. A study on Maruca vitrata infestation of Yard-long beans (Vigna unguiculata subspecies sesquipedalis).

    Science.gov (United States)

    Jayasinghe, R C; Premachandra, W T S Dammini; Neilson, Roy

    2015-09-01

    Globally, Maruca vitrata (Geyer) is a serious yield constraint on food legumes including Yard-long bean (Vigna unguiculata subspecies sesquipedalis). However, there is a dearth of information on its damage potential, distribution and population dynamics in Yard-long beans. In the present study, the level of M. vitrata larval infestation on flowers and pods of Yard-long beans in Sri Lanka was determined with respect to three consecutive cropping seasons, Yala, Off and Maha. Results indicated that larval infestation and abundance varied with developmental stage of flowers and pods, cropping season and their combined interactive effects. Flowers of Yard-long beans were more prone to M. vitrata larval attack compared to pods. Abundance and level of infestation of M. vitrata varied with plant parts, having a ranking of flower buds (highest) > open flowers > mature pods > immature pods (lowest). Peak infestation was observed six and eight weeks after planting on flowers and pods, respectively. Among the three cropping seasons, M. vitrata infestation was found to be higher during Maha and Off seasons compared to Yala. The findings of this study contribute to the identified knowledge gap regarding the field biology of an acknowledged important pest, M. vitrata, in a previously understudied crop in Sri Lanka.

  16. Mapping of quantitative trait loci for butter content and hardness in cocoa beans (Theobroma cacao L.)

    Science.gov (United States)

    Cocoa butter is an important raw material for the chocolate, pharmaceutical, and cosmetic industries. The butter content and quality in cocoa beans are genetically controlled characteristics, and affect its commercial values and industrial applicability. In the present work, an F2 population derived...

  17. Nutrient composition of selected newly bred and established mung bean varieties

    NARCIS (Netherlands)

    Dahiya, P.K.; Linnemann, A.R.; Nout, M.J.R.; Boekel, van M.A.J.S.; Grewal, R.B.

    2013-01-01

    Seven newly bred and three established varieties of mung bean were analysed for proximate composition, minerals, anti-nutrients and in vitro mineral accessibility. They contained 18–23 g protein, 4.0–5.6 g crude fibre and 2.5–4.1 g ash per 100 g dry sample. Iron, zinc, calcium, sodium and potassium

  18. High performance liquid chromatography determination of theobromine and caffeine in cocoa beans gamma irradiated

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Anderson D.B. [Faculdade de Engenharia de Varginha, MG (Brazil); Mansur Neto, Elias [Minas Gerais Univ., Belo Horizonte, MG (Brazil)

    1997-12-01

    Irradiation is a processing technology that has been shown to be a wholesome process by many scientific studies conducted worldwide during the past 40 years, which has been approved by 37 countries. Irradiated foods have been studied so extensively, that the effects on foods are better understood than any other preservation process, including food freezing and dehydration. Cocoa beans has been commercially irradiated in countries such as Ivory Coast and Argentina. The alkaloids theobromine and caffeine are responsible for the mildly stimulating properties and bitter taste of cocoa and chocolate products. Previously fermented dried and nonfumigated cocoa beans were irradiated at doses of 0, 5.0, 10.0 and 20.0 kGy using Co-60 gamma rays. The samples were analysed for determining theobromine and caffeine contents in the cocoa beans by TIMBIE et al. (1978) high performance liquid chromatography (HPLC) method. Boiling water extracts were cooled, centrifuged and injected into the chromatograph. Theobromine and caffeine were quantitated at 273 nm and showed the tendency of decreasing as the dose of radiation increases. Theobromine and caffeine ranged from 42.3 to 37.1 mg/g and from 7.60 to 6.13 mg/g. respectively from 0 to 20.0 kGy. These results were discussed in relation to the possible acceptance of radiosterization of cocoa beans commercially up to the dose of 20.0 kGy. (author). 10 refs., 1 tab.

  19. Rapid differentiation of Ghana cocoa beans by FT-NIR spectroscopy coupled with multivariate classification

    Science.gov (United States)

    Teye, Ernest; Huang, Xingyi; Dai, Huang; Chen, Quansheng

    2013-10-01

    Quick, accurate and reliable technique for discrimination of cocoa beans according to geographical origin is essential for quality control and traceability management. This current study presents the application of Near Infrared Spectroscopy technique and multivariate classification for the differentiation of Ghana cocoa beans. A total of 194 cocoa bean samples from seven cocoa growing regions were used. Principal component analysis (PCA) was used to extract relevant information from the spectral data and this gave visible cluster trends. The performance of four multivariate classification methods: Linear discriminant analysis (LDA), K-nearest neighbors (KNN), Back propagation artificial neural network (BPANN) and Support vector machine (SVM) were compared. The performances of the models were optimized by cross validation. The results revealed that; SVM model was superior to all the mathematical methods with a discrimination rate of 100% in both the training and prediction set after preprocessing with Mean centering (MC). BPANN had a discrimination rate of 99.23% for the training set and 96.88% for prediction set. While LDA model had 96.15% and 90.63% for the training and prediction sets respectively. KNN model had 75.01% for the training set and 72.31% for prediction set. The non-linear classification methods used were superior to the linear ones. Generally, the results revealed that NIR Spectroscopy coupled with SVM model could be used successfully to discriminate cocoa beans according to their geographical origins for effective quality assurance.

  20. BRSMG Uai: common bean cultivar with carioca grain type and upright plant architecture

    Directory of Open Access Journals (Sweden)

    Magno Antonio Patto Ramalho

    2016-09-01

    Full Text Available The common bean cultivar with carioca grain type, BRSMG Uai, is recommended for cultivation in Minas Gerais and stands out for its upright plant architecture, which facilitates cultivation and mechanical harvesting. This cultivar has high yield potential and is resistant to the major races of anthracnose that occur in region.

  1. Uptake studies of environmentally hazardous {sup 51}Cr in Mung beans

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Anupam [Department of Botany, University of Calcutta, 35, Ballygunge Circular Road, Kolkata 700019 (India); Nayak, Dalia [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India); Chakrabortty, Dipanwita [Sikkim Manipal University, A 15, Paryavaran Complex, New Delhi 110030 (India); Lahiri, Susanta [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India)], E-mail: susanta.lahiri@saha.ac.in

    2008-01-15

    Attempt has been made to study the accumulation behaviour of a common plant, Mung bean (Vigna radiata) towards Cr(III) and Cr(VI) to have an insight on the migration and bio-magnification of Cr. For this purpose healthy germinated Mung bean seeds were sown in the sand in the presence of Hoagland's nutrient solution containing measured amount of K{sub 2}{sup 51}Cr{sub 2}O{sub 7} and {sup 51}Cr(NO{sub 3}){sub 3}.9H{sub 2}O. Growth rate was also studied in the presence and absence of phosphate salts in the medium. It has been found that the transfer of chromium from soil to plant is significantly low (maximum 5% for both Cr(III) and Cr(VI)). Maximum accumulation of Cr occurs in the root with respect to the total chromium accumulation by the plant. Other parts of the Mung bean plant, e.g. cotyledons, shoot and leaves, show negligible accumulation. Therefore, the chance of direct intake of Cr through food as well as through the grazing animals to human body is less. - The chance of bio-magnification of Cr(III) or Cr(VI) to human body via direct or indirect intake of Mung bean is negligible.

  2. Organic matter and soil water content influence on BRS 188 castor bean growth

    Energy Technology Data Exchange (ETDEWEB)

    Lacerda, Rogerio Dantas de; Araujo, Ester Luiz de; Nascimento, Elka Costa Santos; Barros Junior, Genival [Universidade Federal de Campina Grande (UFCG), PB (Brazil); Guerra, Hugo O. Carvallo; Chaves, Lucia Helena G. [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    The castor bean culture has been highlighted due to the several applications of its oil, which constitutes one of the best row materials for biodiesel manufacturing, and the base for several other industrial products. The objective of the present work was to study the effect of different soil water and soil organic matter on the castor bean growth. The experiment was conducted from April to August 2006 under greenhouse conditions using a randomized block 2x4 factorial design with two soil organic mater content (5.0 g.kg{sup -1} e 25.0 g.kg{sup -1}), four levels of available water (100, 90, 80 e 70% ) and three replicates. For this, 24 plastic containers, 75 kg capacity, were used on which was grown one plant 120 days after the seedling. At regular intervals the plant height was measured and the results analyzed statistically. For the qualitative treatments (with and without organic matter) the treatment means were compared through the Tukey test. For the quantitative ones (water levels) were used regressions. The castor bean cultivar height was significantly influenced by the organic matter content only after 80 days. Castor bean height increased significantly with the soil water content after 40 days of growing. (author)

  3. Apis mellifera pollination improves agronomic productivity of anemophilous castor bean (Ricinus communis).

    Science.gov (United States)

    Rizzardo, Rômulo A G; Milfont, Marcelo O; Silva, Eva M S da; Freitas, Breno M

    2012-12-01

    Castor bean (Ricinus communis L.) is cultivated mainly for biodiesel production because of its oil-rich seeds; it is assumed to be an anemophylous species. But pollination deficit can lead to low productivity often attributed to other reasons. In this paper, we investigated pollination requirements, pollination mechanism, occurrence of pollination deficit, and the role of biotic pollinators in a large commercial plantation of castor bean. Our results show that R. communis bears a mixed breeding system favoring selfing by geitonogamy, although the wind promotes mostly outcrossing. We also found that the honey bee (Apis mellifera L.) foraging on castor bean can both transfer pollen from male to female flowers within the same raceme and boost the release of airborne pollen by male flowers. Both situations increase geitonogamy rates, raising significantly fruit set and seed yield. This is the first report of an animal foraging activity increasing seed yield in an anemophilous and geitonogamous crop and elucidates the role of biotic pollinators in castor bean reproduction.

  4. Simultaneous determination of organophosphorous insecticides in bean samples by gas chromatography - flame photometric detection

    Directory of Open Access Journals (Sweden)

    Keyller Bastos Borges

    2014-02-01

    Full Text Available The indiscriminate use of organophosphorous pesticides (OPPs in crops may leave residues in food and may cause poisoning in the applicators. A method was developed for the determination of five OPPs in bean samples by Gas Chromatography-Flame Photometric Detection (GC-FPD. Validation parameters comprised linearity between 0.24 and 8.56 μg g-1 (r = 0.9985 for diazinon; 0.23 and 8.14 μg g-1 (r = 0.9959 for methyl parathion; 0.28 and 10.25 μg g-1 (r = 0.9987 for methyl pirimiphos; 0.52 and 18.87 μg g-1 (r = 0.9955 for malathion; 0.86 and 13.67 μg g-1 (r = 0.9919 for ethion. The limits of quantification (equal to those of detection were the lowest rates of ranges mentioned above for each compound. The extraction method showed approximately 95% recovery, with CV% < 15%. Although twenty-eight bean samples obtained in the southern region of the state of Minas Gerais,Brazil, were analyzed, they failed to match any of the OPPs under analysis. The absence of OPPs in the samples could be due to the degradation that occurred between the use of OPPs and bean commercialization, levels below the detection /quantification limits and the non-use of OPPs in bean cultivation.

  5. Cadmium accumulation by jack-bean and sorghum in hydroponic culture.

    Science.gov (United States)

    Francato Zancheta, Ariana Carramaschi; De Abreu, Cleide Aparecida; Zambrosi, Fernando César Bachiega; de Magalhães Erismann, Norma; Andrade Lagôa, Ana Maria Magalhães

    2015-01-01

    Among the technologies used to recuperate cadmium (Cd) contaminated soils, phytoextraction are particularly important, where the selection of suitable plants is critical to the success of the soil remediation. Thus, the objectives of this study were to evaluate the responses of jack-bean and sorghum to Cd supply and to quantify Cd accumulation by these species grown in hydroponic culture. The plants were subjected to 0, 15, 30, or 60 μmol Cd L(-1) in the nutrient solution, and gas exchange, plant growth and Cd accumulation were measured at 25 days after starting Cd treatments. The Cd supply severely reduced growth of shoots and roots in both species. In jack-bean, Cd decreased photosynthesis by 56-86%, stomatal conductance by 59-85% and transpiration by 48-80%. The concentrations and amounts of Cd accumulated in the plant tissues were proportional to the metal supply in the nutrient solution. Sorghum was more tolerant than jack-bean to Cd toxicity, but the latter showed a greater metal concentration and accumulation in the shoot. Therefore, jack-bean would be more suitable than sorghum for use in Cd phytoremediation programs based on phytoextraction.

  6. Treatment of sugar beet extraction juice stillage by natural coagulants extracted from common bean

    Directory of Open Access Journals (Sweden)

    Prodanović Jelena M.

    2015-01-01

    Full Text Available Distillery wastewaters have a great pollution potential, and pollution caused by them is one of the most critical environmental issues. This study is concerned with the coagulation efficiency of a new, environmental friendly, natural coagulant extracted from common bean seeds in the primary treatment of distillery wastewater in the bioethanol production from sugar beet juice. Active coagulation components were extracted from ground seeds of common bean with 0.5 mol/L NaCl. The obtained raw extract was used as a coagulant. The coagulation efficiency was measured by jar test at different pH values of wastewater, and a decrease in organic matter content was determined. The experiments confirmed that natural coagulant from common bean could be successfully used for the treatment of extraction juice distillery wastewater. The highest coagulation efficiencies were achieved at the pH 5.2 with a coagulant dose of 30 mL/L, and at the pH 8.5 with a coagulant dose of 5 mL/L, and they were 64.71% and 68.75% respectively. These encouraging results indicate that natural coagulant from common bean seeds is a potential alternative to conventional chemical coagulant/flocculant agents for treatment of wastewaters.[Projekat Ministarstva nauke Republike Srbije, br. III 43005

  7. Effect of roasting on the carbohydrate composition of Coffea arabica beans.

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2003-01-01

    Coffee beans (arabica) with different degrees of roast were sequentially extracted with water (90 °C, 1 h), water (170 °C, 30 min), and 0.05 M NaOH (0 °C, 1 h). The amount and composition of polysaccharides, oligosaccharides and monosaccharides in the extracts and residues were analyzed. The results

  8. Sex Is Like Jelly Beans: Educating Students on the Risks of Oral Sex

    Science.gov (United States)

    Moore, Erin; Harris, Terrance

    2014-01-01

    This study provides a description of an innovative workshop that educated college students about the risks of unprotected sexual behavior, particularly oral sex, and methods of risk reduction using a metaphor of "sharing and eating jelly beans." Intervention development was guided by the Information-Motivation-Behavioral Skills model.…

  9. Guided-Inquiry Labs Using Bean Beetles for Teaching the Scientific Method & Experimental Design

    Science.gov (United States)

    Schlueter, Mark A.; D'Costa, Allison R.

    2013-01-01

    Guided-inquiry lab activities with bean beetles ("Callosobruchus maculatus") teach students how to develop hypotheses, design experiments, identify experimental variables, collect and interpret data, and formulate conclusions. These activities provide students with real hands-on experiences and skills that reinforce their understanding of the…

  10. Design and Fabrication of a Hand Fed Motorized Oil Bean Slicing Machine

    Directory of Open Access Journals (Sweden)

    O. Oduma

    2016-09-01

    Full Text Available A hand fed African oil bean slicing machine which would be affordable, simple to operate and easy to maintain by local and/or small scale farmers and processors was designed and fabricated with locally available materials. The design was based on the engineering standard and specifications. Factors such as physical and mechanical properties of oil bean seeds, mechanical properties of construction materials, mach inability or deformability of construction materials, wear resistance, availability of power and cost of materials were considered in the fabrication of the device. 1hp electric motor powered the machine. The machine was tested for performance and it recorded an efficiency of 96.64% with minimal damage of the product. The bill of engineering measurement and evaluation revealed that the machine was fabricated at a total cost of ₦91,353.00. The device match the need of the oil bean processors and with adequate maintenance and/or management, it would ameliorate the difficulties involved in oil bean processing and, therefore boost the farmers’ production

  11. Evaluation of common bean lines for adaptation to high temperatures in Honduras

    Science.gov (United States)

    As in other regions worldwide, common bean (Phaseolus vulgaris L.) production in Central America and the Caribbean (CA/C) region is threatened by effects of climate change including increasing temperatures and drought due to variable rainfall patterns. One of the main alternatives for increasing ada...

  12. Mating disruption for control of Plodia interpunctella (Hübner) (Lepidoptera: Pyralidae) in dried beans

    Science.gov (United States)

    We compared the impact of mating disruption and aerosol space treatment using synergized pyrethrins on Indianmeal moth Plodia interpunctella in 2200 to 2900 m3 structures at a dried bean storage and processing facility in Stanislaus County, CA USA. Mating disruption was applied using a high volume a...

  13. CHEMICAL COMPOSITION OF WHOLE GRAINS IN COMMON BEANS LANDRACES AND BREEDING GENOTYPES

    Directory of Open Access Journals (Sweden)

    Gilberto Antonio Peripolli Bevilaqua

    2015-04-01

    Full Text Available The common bean has been object of breeding programs aiming the development of new cultivars adapted to varied production system and shown differentiated nutritional characteristics. Due a genetic diversity existent the landraces can be used directly for cropping, for present characteristics desirable. Little information exists about mineral content and other quality traits for those bean landraces. The aim of this paper was to verify the variability for grain nutricional caracters in breeding cultivars and landraces of bean from Rio Grande do Sul state, Brazil. The experiment was conducted in 2009/2010 in Experimental Station Cascata, of Embrapa Temperate Agriculture. In whole grain of 54 bean genotypes with black and no black coat were determined macroelements (nitrogen, phosphorus, potash, calcium, magnesium and sulfur, oligoelements (iron, manganese, zinc and cuprum, protein and ash content, insoluble fiber, digestive nutrient and antioxidant astragalina. The results shown that the landraces varieties presents nutritional composition of macro and oligoelements, fibers, protein and ash contents in whole grain similar than that of breeding lines and cultivars. The black coat grain from breeding programs showed better nutritional quality for macro and oligoelements content than coloured grain, highlighting TB 02-04 e TB 01-01. The landraces with coloured grains TB 02-26, TB 02-24 and TB 03-13 showed the high levels of astragaline.

  14. Effect of Superheated Steam Roasting on Radical Scavenging Activity and Phenolic Content of Robusta Coffee Beans

    Directory of Open Access Journals (Sweden)

    Ooi Ee Shan

    2015-04-01

    Full Text Available Robusta coffee is one of the coffee species grown in Malaysia. However, there is little research conducted on Robusta coffee beans as Arabica coffee is more popular among the consumers. Coffee is a rich source of antioxidants, therefore research on antioxidant properties of Robusta coffee beans is important to explore its market value. Nowadays, most of coffee analysis is on conventional roasted coffee which reduces their antioxidant properties. In this study, Robusta coffee beans (Coffea canephora were subjected to superheated steam roasting at 200, 220 and 240 ˚C for 20-40 min to obtain light, medium and dark roast. The effect of different roasting temperature and time on the total phenolic content (TPC and radical scavenging activity (RSA of Robusta coffee bean was investigated. Total phenolic content of coffee brews decreased with the increase of roasting degree due to the degradation of phenolic compounds. The highest phenolic content was found at 220 ˚C for 20 min. Meanwhile, brews extracted from light roasted coffee and medium roasted at 220 ˚C for 20 min showed a maximum scavenging activity than those from green coffee. Brews from dark roasted coffee showed lowest radical scavenging activity and total phenol content. Hence, based on the results from this study, the best superheated steam roasting condition is at 220 ˚C for 20 min (medium roast to achieve a maximum antioxidant activity and highest phenolic content.

  15. Dietary arsenic exposure in Brazil: The contribution of rice and beans.

    Science.gov (United States)

    Ciminelli, Virginia S T; Gasparon, Massimo; Ng, Jack C; Silva, Gabriela C; Caldeira, Claudia L

    2017-02-01

    The human health risk associated with arsenic in food in Southeast Brazil was quantified. Based on the most commonly consumed food types in the Brazilian diet, the maximum inorganic As (iAs) daily intake from food (0.255 μg kg(-1) body weight per day) is approximately 9% of the Benchmark Dose Lower Limit (BMDL0.5) of 3 μg kg(-1) body weight per day set by the World Health Organization (WHO) and Food and Agriculture Organization (FAO) Joint Expert Committee in Food Additives (JECFA). When water is included, the contribution of food to the total intake varies from 96.9% to 39.7%. Rice and beans, the main Brazilian staple food, contribute between 67 and 90% of the total As intake from food (46-79% from rice and 11-23% from beans). The substantial contribution of beans to total As food intake is reported for the first time. The broad range of As concentrations in rice and beans highlights the variable and potentially large contribution of both to As food intake in places where diet consists largely of these two food categories.

  16. Site-specific risk factors of white mould epidemics in bean (Phaseolus vulgaris) in Tasmania

    Science.gov (United States)

    In Tasmania, Australia, if more than 5% of bean pods are found to be affected by white mould (caused by Sclerotinia sclerotiorum) entire crops can be rejected by contracting processors. This strict quality standard is one of the main reasons for prophylactic application of fungicides over flowering...

  17. Green manure and its influence on bean (Phaseolus vulgaris L. in agroecological system

    Directory of Open Access Journals (Sweden)

    Marisol Rivero Herrada

    2016-07-01

    Full Text Available Green manures have been used as biomass producers and suppliers of nutrients and keep the soil productive potential in tropical regions. The objective of this study was to evaluate the production of dry biomass and nutrient concentration and accumulation in plants of green manure in two cropping systems, without associating and associated with millet and its influence on the nutritional status of the bean (Phaseolus vulgaris L. in succession in agroecological production. Four legumes (Canavalia ensiformis Adans; Cajanus cajan (L. Millsp.; Crotalaria juncea L.; Mucuna pruriens (L. DC and one grass (Pennisetum glaucum L. as association plant, were evaluated. A randomized block design was used, with eight treatments and four repetitions. The green manure plants were cut and left on the ground at 60 days after planting and bean was planted 20 days after cutting the manure plants. The evaluated variables were dried biomass production, nutrient content of green manure and nutrient content in leaves of beans in succession. The production of dry biomass of green manure was higher than 9.00 t ha-1. Mucuna stood out with the greatest tenors of N, Ca, Mg, pork beans with the highest tenors of K, Cu, Mn. The greatest accumulation of P, K and Ca nutrients was in pigeon pea. The highest values of N and Mg were obtained in mucuna. Higher C / N relation was obtained in rotalaria.

  18. Soya bean tempe extracts show antibacterial activity against Bacillus cereus cells and spores

    NARCIS (Netherlands)

    Roubos-van den Hil, P.J.; Dalmas, E.; Nout, M.J.R.; Abee, T.

    2010-01-01

    Aims: Tempe, a Rhizopus ssp.-fermented soya bean food product, was investigated for bacteriostatic and/or bactericidal effects against cells and spores of the food-borne pathogen Bacillus cereus. Methods and results: Tempe extract showed a high antibacterial activity against B. cereus ATCC 14579 bas

  19. Molybdenum supply and biological fixation of nitrogen by two Brazilian common bean cultivars

    Directory of Open Access Journals (Sweden)

    Alinne da Silva

    Full Text Available ABSTRACT The common bean has been considered to have low biological nitrogen fixation capacity; however, this process can be made more effective with molybdenum (Mo supplementation. The objective of this study was to evaluate the influence of Mo rates on the growth and biological nitrogen fixation by two Brazilian common bean cultivars using the 15N isotope dilution technique. The experiment was performed in 2014 in a completely randomized design arranged in a 5 x 3 factorial scheme, corresponding to 5 rates of Mo (control, 40, 80, 120 and 240 g ha-1, the common bean cultivars Aporé, Ouro Negro and NORH-54 (a non-nodulating common bean cultivar, and three replicates. The application of Mo and the inoculation with rhizobia strains contributed to improving nitrogen fixation and grain weight. The cultivar Ouro Negro showed a higher number and weight of nodules and a higher amount of nitrogen derived from the atmosphere than the cultivar Aporé. The biological nitrogen fixation of Aporé was more dependent on the application of Mo. These results indicated that inoculation with Rhizobium strains and Mo supply effectively contributed to biological nitrogen fixation and improving grain production.

  20. Speed of nodulation of UMR 1899 and UMR 1597 in common bean breeding lines

    Science.gov (United States)

    The speed of nodulation of Rhizobium tropici UMR 1899 syn. CIAT 899 and Rhizobium etli UMR 1597 syn. CIAT 161 were examined with thirteen different common bean (Phaseolus vulgaris) genotypes and breeding lines. Using a growth pouch assay, strains UMR 1899 and UMR 1597 were inoculated using common be...

  1. Viruses of faba bean (Vicia faba L.) in Morocco; surveying, identification, and ecological aspects.

    NARCIS (Netherlands)

    Fortass, M.

    1993-01-01

    A systematic virus survey covering the main areas where faba bean ( Viciafaba L.) is grown in Morocco was conducted in 1988 and 1990. From the 240 leaf samples collected on the basis of symptoms suggestive of virus infection from 52 fields, the following viruses were detected by means of electron mi

  2. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  3. Bioactive components of fermented soya beans effective against diarrhoea-associated bacteria

    NARCIS (Netherlands)

    Roubos-van den Hil, P.J.

    2010-01-01

    Tempe is a fermented food, obtained by fungal fermentation of soya beans. During the processing specific flavour, texture and nutritional properties are achieved. Previous research has indicated that tempe reduced the incidence and severity of diarrhoea. In this thesis the bioactive effects of tempe

  4. Shape and size of jatropha beans (Jatropha curcas L. during drying at different temperatures

    Directory of Open Access Journals (Sweden)

    Valdiney Cambuy Siqueira

    2013-12-01

    Full Text Available This study was carried out to study the physical properties of the jatropha beans over the drying under six air conditions, based on measurements of roundness, sphericity, volume, superficial area, projected area and surface/volume ratio. Jatropha beans with moisture content around 0.61 (decimal d.b. were subjected to thin-layer drying in oven with forced-air circulation under six temperature conditions (36, 45, 60, 75, 90 and 105 °C and relative humidity of 31.7; 19.6; 9.4; 4.8; 2.6 and 1.5% respectively, until reaching the moisture content of 0.11 ± 0.006 (decimal d. b.. The results showed that the necessary time for jatropha beans to reach the moisture content of 0.11 ± 0.006 (decimal d.b. were 1.5; 2.25; 3.0; 4.75; 6.75 and 12.0 h for the drying temperatures of 105, 90, 75, 60, 45 and 36 °C, respectively; and the reduction in the moisture content as well as the drying conditions promoted changes in the shape and reduced the size of the jatropha beans.

  5. High-throughput novel microsatellite marker of faba bean via next generation sequencing

    Directory of Open Access Journals (Sweden)

    Yang Tao

    2012-11-01

    Full Text Available Abstract Background Faba bean (Vicia faba L. is an important food legume crop, grown for human consumption globally including in China, Turkey, Egypt and Ethiopia. Although genetic gain has been made through conventional selection and breeding efforts, this could be substantially improved through the application of molecular methods. For this, a set of reliable molecular markers representative of the entire genome is required. Results A library with 125,559 putative SSR sequences was constructed and characterized for repeat type and length from a mixed genome of 247 spring and winter sown faba bean genotypes using 454 sequencing. A suit of 28,503 primer pair sequences were designed and 150 were randomly selected for validation. Of these, 94 produced reproducible amplicons that were polymorphic among 32 faba bean genotypes selected from diverse geographical locations. The number of alleles per locus ranged from 2 to 8, the expected heterozygocities ranged from 0.0000 to 1.0000, and the observed heterozygosities ranged from 0.0908 to 0.8410. The validation by UPGMA cluster analysis of 32 genotypes based on Nei's genetic distance, showed high quality and effectiveness of those novel SSR markers developed via next generation sequencing technology. Conclusions Large scale SSR marker development was successfully achieved using next generation sequencing of the V. faba genome. These novel markers are valuable for constructing genetic linkage maps, future QTL mapping, and marker-assisted trait selection in faba bean breeding efforts.

  6. Fungal endophytes in germinated seeds of the common bean, Phaseolus vulgaris

    Science.gov (United States)

    The common bean (Phaseolus vulgaris) is the most important food legume in the world, but its production is severely limited by several biotic and abiotic stressors. In search of a sustainable solution to this problem, we conducted a survey of fungal endophytes in 582 germinated seeds belonging to 11...

  7. Fumonisin B2 production by Aspergillus niger in Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, P.; Mahakarnchanaku, W.; Nielsen, Kristian Fog

    2009-01-01

    by black Aspergilli. No Fusarium species known to produce fumonisin were detected, but black Aspergilli had high incidences on both Arabica and Robusta Thai coffee beans. Liquid chromatography (LC) with high-resolution mass spectrometric (HRMS) detection showed that 67% of Aspergillus niger isolates from...

  8. Dynamics of a Novel Highly Repetitive CACTA Family in Common Bean (Phaseolus vulgaris).

    Science.gov (United States)

    Gao, Dongying; Zhao, Dongyan; Abernathy, Brian; Iwata-Otsubo, Aiko; Herrera-Estrella, Alfredo; Jiang, Ning; Jackson, Scott A

    2016-07-07

    Transposons are ubiquitous genomic components that play pivotal roles in plant gene and genome evolution. We analyzed two genome sequences of common bean (Phaseolus vulgaris) and identified a new CACTA transposon family named pvCACTA1. The family is extremely abundant, as more than 12,000 pvCACTA1 elements were found. To our knowledge, this is the most abundant CACTA family reported thus far. The computational and fluorescence in situ hybridization (FISH) analyses indicated that the pvCACTA1 elements were concentrated in terminal regions of chromosomes and frequently generated AT-rich 3 bp target site duplications (TSD, WWW, W is A or T). Comparative analysis of the common bean genomes from two domesticated genetic pools revealed that new insertions or excisions of pvCACTA1 elements occurred after the divergence of the two common beans, and some of the polymorphic elements likely resulted in variation in gene sequences. pvCACTA1 elements were detected in related species but not outside the Phaseolus genus. We calculated the molecular evolutionary rate of pvCACTA1 transposons using orthologous elements that indicated that most transposition events likely occurred before the divergence of the two gene pools. These results reveal unique features and evolution of this new transposon family in the common bean genome.

  9. NetBeans Mobility Pack 5.0快速入门指南

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    本文向您介绍使用NetBeans IDE 5.0创建Java Pltform Micro Edition(Java ME platform),Mobile Information Device Profile(MIDP)应用程序的基本知识。本文旨在让您快速入门。

  10. Biocontrol of seed pathogens and growth promotion of common bean seedlings by Trichoderma harzianum

    Directory of Open Access Journals (Sweden)

    Daniel Diego Costa Carvalho

    2011-08-01

    Full Text Available The objective of this work was to evaluate isolates of Trichoderma harzianum regarding biocontrol of common bean seed-borne pathogens, plant growth promotion, and rhizosphere competence. Five isolates of T. harzianum were evaluated and compared with commercial isolate (Ecotrich, Carboxin+Thiram, and an absolute control. Bean seeds of the cultivar Jalo Precoce, contaminated with Aspergillus, Cladosporium, and Sclerotinia sclerotiorum, were microbiolized with antagonists, and seed health tests were carried out. Isolates were evaluated on autoclaved substrate and in field conditions. Ten days after sowing (DAS, plant length was measured. To test rhizosphere competence, isolates were applied in boxes containing autoclaved washed sand, and root colonization was evaluated at 10 DAS, using five plants per box. The most effective isolates in the seed health tests were: CEN287 and CEN289 to control Aspergillus; the commercial isolate to control Cladosporium; and CEN287 and CEN316 to control S. sclerotiorum. Isolates CEN289 and CEN290 promoted bean growth in greenhouse and field. Seed treatment with T. harzianum reduces the incidence of Aspergillus, Cladosporium, and S. sclerotiorum in 'Jalo Precoce' common bean seeds.

  11. Population Development of Zabrotes subfasciatus (Coleoptera: Chrysomelidae) in Landrace Bean Varieties Occurring in Southwestern Amazonia.

    Science.gov (United States)

    Lopes, L M; Araújo, A E F; Santos, A C V; Santos, V B; Sousa, A H

    2016-02-01

    The common bean, Phaseolus vulgaris (L.), is one of the most important sources of protein worldwide, and Latin America is one of the recognized centers of diversity of this species. However, storage of this product after harvest is not feasible because of bruchid attacks. This study determined the accumulated normalized rate of emergence and the daily emergence rate of Zabrotes subfasciatus (Boheman) (Coleoptera: Chrysomelidae:Bruchinae) in five landrace varieties of common bean (BRL 01, SNA 01, RDR 01, RBC 01, and RBC 13) that occurin southwestern Amazonia. These varieties were selected for this study because they are well-distributed throughout the Amazonian communities. Beans of each variety were infested with 50 unsexed adults, and the insects were removed 13 d after beginning the bioassays. The adult progeny obtained from the feeding substrate were counted and removed every other day after the first emergence, until the end of the emergence period. Differences were observed in the calculated rates of development; however, the time required for development and emergence of the insects was independent. Of the five varieties of bean investigated, we observed that the RDR 01, BRL 01, and SNA 01 cultivars are resistant to Z. subfasciatus; the results indicate that the use of these three varieties can reduce problems associated with bruchid attacks and enable storage of the product after harvesting.

  12. Influence of Roasting on the Antioxidant Activity and HMF Formation of a Cocoa Bean Model Systems

    NARCIS (Netherlands)

    Oliviero, T.; Capuano, E.; Cämmerer, B.; Fogliano, V.

    2009-01-01

    During the roasting of cocoa beans chemical reactions lead to the formation of Maillard reaction (MR) products and to the degradation of catechin-containing compounds, which are very abundant in these seeds. To study the modifications occurring during thermal treatment of fat and antioxidant rich fo

  13. Fluorescence action spectra of algae and bean leaves at room and at liquid nitrogen temperatures

    NARCIS (Netherlands)

    Goedheer, J.C.

    1965-01-01

    Fluorescence action spectra were determined, both at room temperature and at liquid nitrogen temperature, with various blue-green, red and green algae, and greening bean leaves. The action spectra of algae were established with samples of low light absorption as well as dense samples. Fluorescence

  14. Multielemental Fingerprinting as a Tool for Authentication of Organic Wheat, Barley, Faba Bean, and Potato

    DEFF Research Database (Denmark)

    Laursen, Kristian Holst; Schjørring, Jan Kofod; Olesen, Jørgen E;

    2011-01-01

    The multielemental composition of organic and conventional winter wheat, spring barley, faba bean, and potato was analyzed with inductively coupled plasma−optical emission spectrometry (ICP-OES) and −mass spectrometry (ICP-MS). The crops were cultivated in two years at three geographically...

  15. Influence of bitter lupin on consumption and digestibility in organic dairy cattle soya bean free diets

    Directory of Open Access Journals (Sweden)

    R. Tocci

    2010-04-01

    Full Text Available One of the main principles of organic husbandry is that animal feed must be GMO free, and soya bean is well-known as a high risk GMO alimentary source. About 25 dry dairy cattle of the Italian Holstein breed, from the Cooperativa Emilio Sereni of Borgo S. Lorenzo (FI, were fed in two successive diets: the first with extruded soya bean (A, and the second in which bitter lupin, faba bean and proteinic pea substituted the soya bean (B. We evaluated both the consumption and the apparent digestibility (using acid insoluble ash as internal marker of the two diets, repeating the trial twice. The presence of bitter lupin did not influence either the consumption of other feed, or the faecal water content. The apparent digestibility of the organic matter resulted satisfactory in both the diets, but was significantly higher in diet (A than in diet (B (71,6% vs 67,3%. In conclusion, even though we wish the cultivation of sweet lupin would be increase in Italy, we retain that also bitter lupin (mixed with other feed to increase the palatability could be used as alternative protein source in dairy cattle diets.

  16. Micro-PIXE investigation of bean seeds to assist micronutrient biofortification

    Energy Technology Data Exchange (ETDEWEB)

    Cvitanich, Cristina, E-mail: crc@mb.au.dk [Centre for Carbohydrate Recognition and Signalling, Department of Molecular Biology Aarhus University, Aarhus (Denmark); Przybylowicz, Wojciech J.; Mesjasz-Przybylowicz, Jolanta [Materials Research Department, iThemba LABS, P.O. Box 722, Somerset West 7129 (South Africa); Blair, Matthew W.; Astudillo, Carolina [CIAT - Centro International de Agricultura Tropical, Cali (Colombia); Orlowska, Elzbieta; Jurkiewicz, Anna M.; Jensen, Erik O.; Stougaard, Jens [Centre for Carbohydrate Recognition and Signalling, Department of Molecular Biology Aarhus University, Aarhus (Denmark)

    2011-10-15

    This study compares the distribution and concentrations of micro- and macronutrients in different bean cultivars with the aim of optimizing the biofortification, a sustainable approach towards improving dietary quality. Micro-PIXE was used to reveal the distribution of Fe, Zn, Mn, Ca, P, S in seeds of common beans (Phaseolus vulgaris) and runner beans (Phaseolus coccineus). Average concentrations of elements in different tissues were obtained using ICP-AES. The highest concentrations of Zn in the studied beans were found in the embryonic axis, but an increased concentration of this element was also detected in the provascular bundles of the cotyledons. The first layer of cells surrounding provascular bundles accumulated high concentrations of Fe, while the next cell layer had an increased concentration of Mn. The analysis showed that the provascular bundles and the first cell layers surrounding them could have a significant role in the storage of important seed micronutrients - Zn, Fe, and Mn. This information has important implications for molecular biology studies aimed at seed biofortification.

  17. RESPONSE OF THE JAMAICA-BEAN-CORN POLYCULTURE CROPPING SYSTEM TO THREE TREATMENTS OF FERTILIZATION IN VILLAFLORES, CHIAPAS, MEXICO

    Directory of Open Access Journals (Sweden)

    Rosey Obet Ruiz-González

    2014-07-01

    Full Text Available The corn (Zeamays Linneo and bean (Phaseolusvulgaris Linneo are the economic basis to meet the basic needs of rural families, but these crops are no longer economically viable for various reasons and jeopardize the family livelihood and productive alternatives are needed to improve the rural economy. The research was conducted during the spring-summer cycle from 1999 to 2000 in Villaflores , Chiapas, in order to evaluate the response of polyculturejamaica-bean-corn three fertilization treatments ( 00-00-00 , 60-60-60 and 120-60-60 . The experimental design was random blocks with three fertilization treatments, seven patterns of crops, and three replications and performance in the three plant species and vegetative variables were evaluated. With the data an ANOVA was performed and the treatment means were compared with the test of Tukey (p ≤ 0.05. The best vegetative response of the jamaica was to associate it with beans and corn with 60-60 fertilization treatment - 60, getting as much of: foliage (170 hojasplanta-1, branches (31 ramasplanta-1, acorns (54 bellotasplanta-1 and increased performance of dried calyxes (698 kgha-1.The beans associated with maize without fertilizations showed increase in foliage (62 hojasplanta-1 and in monoculture with fertilization 60-60 - 60 had the best performance (1,565 kgha-1of beans. Corn had the best vegetative response (18 hojasplanta-1 associated with beans and fertilization 120 - 60-60, and the best performance was when teamed with the beans and the jamaica (7,667 kgha-1. The best equivalent land-use was 3.31 in jamaica-bean-corn crop pattern. The analysis of the results indicates that the jamaica by associating it with corn and beans represents a biological and economic production alternative to improve the economy of rural families in Mexican soils which are acidified.

  18. Modification of water absorption capacity of a plastic based on bean protein using gamma irradiated starches as additives

    Energy Technology Data Exchange (ETDEWEB)

    Koeber, E. [Facultad de Ingenieria, Grupo de Ingenieria Bioquimica, Universidad de Buenos Aires, Paseo Colon 850, 1063, Buenos Aires (Argentina); Gonzalez, M.E. [Comision Nacional Energia Atomica, Av. Del Libertador 8250, Buenos Aires (Argentina); Gavioli, N. [Facultad de Ingenieria, Grupo de Ingenieria Bioquimica, Universidad de Buenos Aires, Paseo Colon 850, 1063, Buenos Aires (Argentina); Salmoral, E.M. [Facultad de Ingenieria, Grupo de Ingenieria Bioquimica, Universidad de Buenos Aires, Paseo Colon 850, 1063, Buenos Aires (Argentina)]. E-mail: esalmor@fi.uba.ar

    2007-01-15

    Some properties of a bean protein-starch plastic were modified by irradiation of the starch. Two kinds of starch from bean and cassava were irradiated with doses until 50 kGy before their inclusion in the composite. Water absorption of the resultant product was reduced by 36% and 60% in materials containing bean and cassava starch, respectively. A large decline in the elongation is observed till 10 kGy in both materials, while tensile strength diminished by 11% in the cassava composite.

  19. The effect of various sapropel concentrations on content and fluorescence of photosynthetic pigments of bean

    Directory of Open Access Journals (Sweden)

    Irena Januškaitienė

    2017-03-01

    Full Text Available Tarosiškio lake sapropel impact on beans (Vicia faba L. photosynthesis parameters (content of chlorophylls and chlorophyll a fluorescence was investigated in this study. Plants were sown in 1 L volume pots by 5 seeds with light loamy soil and grown in growth chambers. Considering sapropel composition, 2.2; 3.1 and 4 t/ha dry sapropel concentrations were chosen for investigation. Sapropel affected plants were compared with plants grown in unfertilised and with synthetic fertiliser fertilised soils. On 14th day of experiment, when the plants reached two leaves growths stage (BBCH 12, chlorophyll a fluorescence parameters of investigated plants were measured. Then plants were grown for 4 weeks more and at stem elongation stage (BBCH 31 chlorophyll a fluorescence parameters were measured repeatedly and also the content of chlorophylls and carotenoids were investigated. The efficiency II photosystem of bean increased by increasing sapropel concentration in soil, but insignificantly (p>0.05. Photosynthesis performance index was increasing (r=0.91; p<0.05 up to 3.1 t/ha sapropel concentration increase at BBCH 12 growth stage. The same tendency was detected for electron transfer rate of bean (r=0.9; p<0.05 at this growth stage, but at later stage (BBCH 31 it slightly lowered (r=-0.02; p>0.05. At BBCH 12 stage the highest non photochemical quenching (NPQ value was measured in control beans, while at BBCH 31 stage, opposite trend was noticed (r=0.86; p <0.05. At BBCH 31 growth stage sapropel concentration increase made bean chlorophyll content to decrease, but insignificantly (r=-0.18, p>0.05, and the changes in carotenoid contents were similar to chlorophyll a+b.DOI: http://dx.doi.org/10.5755/j01.erem.72.4.16585

  20. Antioxidant activity of polyphenols of adzuki bean (Vigna angularis germinated in abiotic stress conditions

    Directory of Open Access Journals (Sweden)

    Urszula Złotek

    2015-03-01

    Full Text Available Background. Adzuki sprouts are one of more valuable but still underappreciated dietary supplements which may be considered as functional food. Sprouting reduces anti-nutritional factors and increases the bioavailability of macro and micronutrients and also affects phytochemical levels. Exposure of plants to abiotic stresses results in change in production of phytochemical compounds. The aim of this study was to assess the content and antioxidant properties of phenolic in adzuki bean seeds germinated in selected abiotic stress conditions. Material and methods. Adzuki bean seeds were germinated in different abiotic stress conditions: thermal, osmotic and oxidative. The content of phenolics in adzuki bean seeds coat extracts and antioxidant activity Fe2+ chelating ability and neutralization of the free radicals generated from DPPH and ABTS were determined. Results. All applied stress conditions (except for thermal stress have caused decrease the content of the analysed phenolic fractions. The lowest amounts of polyphenols in extracts of sprouts obtained in oxidative stress conditions were observed. The highest ability to neutralize free radicals generated with ABTS and DPPH have extracts from sprouts germinated under thermal stress 39.94 and 13.20 μmol TEAC/g d.w., respectively. The lowest – sprouts obtained in oxidative stress conditions (18.2 and 9.72 μmol TEAC/g d.w.. The highest ability to chelate Fe2+ has been shown by the extract from adzuki bean seeds coat subjected to thermal stress (7.06 % and the lowest control extract (3.08%. Conclusions. It can be concluded that only thermal stress contributes to the improvement of antioxidant activity of extracts obtained from adzuki bean seeds coat.

  1. The Potential Use of Fermented Chickpea and Faba Bean Flour as Food Ingredients.

    Science.gov (United States)

    Chandra-Hioe, Maria V; Wong, Christina H M; Arcot, Jayashree

    2016-03-01

    Apart from being a rich and inexpensive protein source, legumes provide essential vitamins, minerals and dietary fibre. Considering the nutritional benefits, legumes flour can potentially be incorporated in the development of new products. The aim of this study was to investigate whether fermentation affects the protein content, in vitro protein digestibility, trypsin inhibitor activity and the functionality of proteins in faba bean, desi and kabuli chickpea. Australian grown chickpea and faba bean were selected and initially soaked, de-hulled, dried and milled into flour. This was fermented with lyophilised yoghurt cultures in a 30 °C orbital shaker for 16 h. While protein contents in fermented desi and kabuli flour were lower than their raw counterparts (p > 0.05), it was significantly higher in fermented faba bean. A significant increase (9.5%) in in vitro protein digestibility was found in fermented desi. Trypsin inhibitor activity in fermented desi, kabuli and faba bean reduced by 2.7, 1.1 and 4.7%, respectively (p > 0.05). Overall, the in vitro protein digestibility in flour samples increased, while simultaneously reducing the trypsin inhibitor activity. The water absorption capacity of the fermented kabuli flour significantly increased by 11.3%. All fermented flour samples had significantly higher oil absorption capacity than their corresponding raw flour that was likely due to increased insoluble hydrophobic protein. Although, the foaming capacity in all fermented flour samples was significantly lower than their respective raw samples, only fermented desi and faba bean flour showed lower foaming stability (p > 0.05). The present study suggests that fermented legume flour could fulfill the demand for innovative products of higher nutritional value.

  2. Faba beans (Vicia faba in dairy cow diet: effect on milk production and quality

    Directory of Open Access Journals (Sweden)

    Rosanna Scipioni

    2010-02-01

    Full Text Available The use of alternative plant proteins in place of the soybean meal protein in diets for farmed animals aims to reduce the extra-EU soybean import and partially substitute the GMO in the food chain. Among the possible alternatives, the heat-processed (flaked faba beans appears interesting for dairy cow diet. Two consecutive experiments were carried out to test flaked faba beans as a partial substitute for soybean meal in the diet of Reggiana breed dairy cows producing milk for Parmigiano-Reggiano cheese-making. In both experiments a “Control” concentrate (12% soybean meal, no faba beans was compared with a “Faba” concentrate (7.5% soybean meal and 10% flaked faba beans. Forages fed to animals were hay (mixed grass and alfalfa plus mixed grass in experiment 1, hay only in experiment 2. Milk yield and quality and the characteristics of grab faecal samples as empirical indicators of digestibility, were similar between feeding groups. The milk urea content was slightly lower in the “Faba” group, particularly in experiment 2 (“Control” vs “Faba”: 34.6 vs 32.9 mg/dL in experiment 1, P<0.1; 27.4 vs 23.4 mg/dL in experiment 2, P<0.01; the plasma urea content in experiment 2 confirmed the trend observed in milk (3.9 vs 3.0 mmol/L, P<0.01. The inclusion of faba beans, within the allowed limit of the Parmigiano-Reggiano Consortium for diet formulation, could represent a feasible opportunity for a partial substitution of soybean meal.

  3. BIOLOGICAL CONTROL OF SPODOPTERA FRUGIPERDA EGGS USING TELENOMUS REMUS NIXON IN MAIZE-BEAN-SQUASH POLYCULTURE

    Directory of Open Access Journals (Sweden)

    Antonio GutiA©rrez-MartAnez

    2012-01-01

    Full Text Available The maize earworm, Spodoptera frugiperda (J.E. Smith (Lepidoptera: Noctuidae, is an important pest in maize. Telenomus remus Nixon (Hymenoptera: Scelionidae is an important control agent of this pest due to its capacity to invade the whole egg mass. The percentage of parasitism by Telenomus remus Nixon (Hymenoptera: Scelionidae on Spodoptera frugiperda (J.E. Smith (Lepidoptera: Noctuidae eggs was evaluated in maize-bean, maize-squash and maize-bean-squash polyculture and maize monoculture systems. Data were analyzed statistically by using a Poisson regression (log-linear model. The analysis showed highly significant differences in the percentage of parasitism of S. frugiperda eggs by T. remus in plots with jarocho crema maize in polyculture systems (91.00±1.42% compared to the yellow maize genotype (68.90±3.10%. Parasitism percentages increased in the jarocho crema maize genotype in maize-bean, maize-squash, maize-bean-squash polycultures and maize monoculture by 87.88±3.27%, 89.75±1.99, 99.50±0.19 and 86.88±2.66%, respectively and in the yellow maize genotype they dropped by 70.00±7.05, 64.50±5.63, 77.88±6.51 and 63.25±5.20%, respectively. The percentage of T. remus parasitism on S. frugiperda eggs was found to be affected by the genotype of maize, bean and squash, polyculture system, weeds, densities of the host eggs and numbers and quality of egg masses.

  4. Annotation and sequence diversity of transposable elements in common bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Scott eJackson

    2014-07-01

    Full Text Available Common bean (Phaseolus vulgaris is an important legume crop grown and consumed worldwide. With the availability of the common bean genome sequence, the next challenge is to annotate the genome and characterize functional DNA elements. Transposable elements (TEs are the most abundant component of plant genomes and can dramatically affect genome evolution and genetic variation. Thus, it is pivotal to identify TEs in the common bean genome. In this study, we performed a genome-wide transposon annotation in common bean using a combination of homology and sequence structure-based methods. We developed a 2.12-Mb transposon database which includes 791 representative transposon sequences and is available upon request or from www.phytozome.org. Of note, nearly all transposons in the database are previously unrecognized TEs. More than 5,000 transposon-related expressed sequence tags (ESTs were detected which indicates that some transposons may be transcriptionally active. Two Ty1-copia retrotransposon families were found to encode the envelope-like protein which has rarely been identified in plant genomes. Also, we identified an extra open reading frame (ORF termed ORF2 from 15 Ty3-gypsy families that was located between the ORF encoding the retrotransposase and the 3’LTR. The ORF2 was in opposite transcriptional orientation to retrotransposase. Sequence homology searches and phylogenetic analysis suggested that the ORF2 may have an ancient origin, but its function is not clear. This transposon data provides a useful resource for understanding the genome organization and evolution and may be used to identify active TEs for developing transposon-tagging system in common bean and other related genomes.

  5. Performance of Rotary Cutter Type Breaking Machine for Breakingand Deshelling Cocoa Roasted Beans

    Directory of Open Access Journals (Sweden)

    Sukrisno Widyotomo

    2005-12-01

    Full Text Available Conversion of cocoa beans to chocolate product is, therefore, one of the promising alternatives to increase the value added of dried cocoa beans. On the other hand, the development of chocolate industry requires an appropriate technology that is not available yet for small or medium scale of business. Breaking and deshelling cocoa roasted beans is one important steps in cocoa processing to ascertain good chocolate quality. The aim of this research is to study performance of rotary cutter type breaking machine for breaking and deshelling cocoa roasted beans. Indonesian Coffee and Cocoa Research Institute has designed and tested a rotary cutter type breaking machine for breaking and deshelling cocoa roasted beans. Breaker unit has rotated by ½ HP power, single phase, 110/220 V and 1440 rpm. Transmission system that use for rotating breaker unit is pulley and single V belt. Centrifugal blower as separator unit between cotyledon and shell has specification 0.5 m 3 /min air flow, 780 Pa, 370 W, and 220 V. Field tests showed that the optimum capacity of the machine was 268 kg/h with 500 rpm speed of rotary cutter, 2,8 m/s separator air flow, and power require was 833 W. Percentage product in outlet 1 and 2 were 94.5% and 5.5%. Particle distribution from outlet 1 was 92% as cotyledon, 8% as shell in cotyledon and on outlet 2 was 97% as shell, 3% as cotyledon in shell. Key words:cocoa, breaking, rotary cutter, quality.

  6. Analysis of catechins in Theobroma cacao beans by cyclodextrin-modified micellar electrokinetic chromatography.

    Science.gov (United States)

    Gotti, Roberto; Furlanetto, Sandra; Pinzauti, Sergio; Cavrini, Vanni

    2006-04-21

    A micellar electrokinetic chromatography (MEKC) method was developed for the quantitation of polyphenols (+)-catechin and (-)-epicatechin (catechin monomers) and the methylxanthine theobromine in Theobroma cacao beans. Owing to the poor stability of catechin monomers in alkaline conditions, a 50 mM Britton-Robinson buffer at a pH 2.50 was preferred as the background electrolyte. Under these conditions, the addition of hydroxypropyl-beta-cyclodextrin (HP-beta-CD) at a concentration of 12 mM to the SDS micellar solution (90 mM), resulted in a cyclodextrin-modified micellar electrokinetic chromatography (CD-MEKC) endowed with two peculiar advantages compare to the conventional MEKC: (i) strong improvement of separation of the most important phytomarkers of T. cacao and (ii) enantioselectivity toward (+/-)-catechin. In particular, separation of methylxanthines (theobromine and caffeine), procyanidin dimers B1 and B2, and catechins (epicatechin and catechin) was obtained simultaneously to the enantioseparation of racemic catechin within 10min. The enantioselectivity of the method makes it suitable in evaluation of possible epimerisation at the C-2 position of epicatechin monomer potentially occurring during heat processing and storage of T. cacao beans. The extraction procedure of the phytomarkers from the beans was approached using ultrasonic bath under mild conditions optimized by a multivariate strategy. The method was validated for robustness, selectivity, sensitivity, linearity, range, accuracy and precision and it was applied to T. cacao beans from different countries; interestingly, the native enantiomer (+)-catechin was found in the beans whereas, for the first time we reported that in chocolate, predominantly (-)-catechin is present, probably yielded by epimerisation of (-)-epicatechin occurred during the manufacture of chocolate.

  7. Effect of post-harvest treatments on the occurrence of ochratoxin A in raw cocoa beans.

    Science.gov (United States)

    Kedjebo, Kra Brou Didier; Guehi, Tagro Simplice; Kouakou, Brou; Durand, Noël; Aguilar, Philippe; Fontana, Angélique; Montet, Didier

    2016-01-01

    Cocoa beans are the principal raw material for chocolate manufacture. Moulds have an important place in the change in the quality of cocoa beans due to their role in the production of free fatty acids and mycotoxins, namely ochratoxin A (OTA). This study investigated the impact of the key post-harvest treatments, namely the fermentation and drying methods on OTA contamination of raw cocoa beans. Analytical methods for OTA detection were based on solid-liquid extraction, clean-up using an immunoaffinity column, and identification by reversed-phase HPLC with fluorescence detection. Of a total of 104 randomly selected cocoa samples analysed, 32% had OTA contents above 2 µg kg(-1). Cocoa sourced from pods in a bad state of health had a maximum OTA content of 39.2 µg kg(-1), while that obtained from healthy pods recorded 11.2 µg kg(-1). The production of OTA in cocoa beans increased according to the pod-opening delay and reached 39.2 µg kg(-1) after an opening delay of 7 days after harvest, while 6.1 and 11.2 µg kg(-1) were observed when pods were opened after 0 and 4 days. OTA production also seemed to depend considerably to the cocoa fermentation materials. When using plastic boxes for bean fermentation, the OTA production was enhanced and reached an average OTA content of about 4.9 µg kg(-1), while the raw cocoa treated in banana leaves and wooden boxes recorded 1.6 and 2.2 µg kg(-1) on average respectively. In parallel, the OTA production was not really influenced by either the mixing or the duration of the fermentation or the drying materials.

  8. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress.

    Science.gov (United States)

    Sharma, Ved Parkash; Singh, Harminder Pal; Kohli, Ravinder Kumar; Batish, Daizy Rani

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 microW cm(-2); 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H(2)O(2)) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at > or =2 h), and radicle and plumule growths (> or =1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H(2)O(2) accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  9. Some physiological responses of wheat and bean to soil salinity at low matric suctions

    Science.gov (United States)

    Khatar, Mahnaz; Mohammadi, Mohammad Hossein; Shekari, Farid

    2017-01-01

    The effect of soil matric suction (2-33 kPa) and salinity (soil solution electrical conductivity 0.7-8 dS m-1 for bean and 2-20 dS m-1 for wheat) on some physiological characteristics of bean and wheat in a clay loam soil under greenhouse condition was investigated. The results showed that the leaf chlorophyll content index and potassium concentration decrease under salinity stress and increase with matric suction from 2 to 33 kPa suction for both plants. The wheat chlorophyll content index declines during the stress spell but bean chlorophyll content index remains nearly constant. The lowest values of the content of soluble sugars and the highest values of leaf proline content are observed at2 kPa matric suction (highest aeration stress) for bean and wheat. As matric suction increases from 2 to 6 kPa, the soluble sugars increases and proline content decreases significantly and then soluble sugars decreases and proline content increases until 10 kPa suction, and the soluble sugars remains nearly constant at the higher matric suctions for both plants. While the electrical conductivity effect on the soluble sugars is not significant, the values of proline content for both crop increase significantly with electrical conductivity. It was shown that the aeration stress can result in more considerable and rapid physiological responses, in comparison with salinity stress. There is a strong correlation between wheat and bean chlorophyll content index and potassium concentration under salinity and aeration stresses.

  10. [Effects of La on the growth of kidney bean seedling under Cd stress].

    Science.gov (United States)

    Zhou, Qing; Zhang, Hui; Huang, Xiaohua; Lu, Ganchao; Liang, Chanjuan; Lu, Tianhong

    2003-07-01

    In this study, kidney bean (Phaseolus vulgaris) was used as experiment-material, and effects of lanthanum on growth and metabolism of kidney bean seedling under cadmium stress was studied by water culture. The results showed that kidney bean seedling was chronically harmed by 30 mumol.L-1 Cd2+, however, its height and main root were reduced about 31.1% and 39.2%, meanwhile, leaf area, fresh and dry weight of leaf, stem and root were decreased 48.0%, 42.7%, 29.6%, 61.3% and 49.4% respectively. With acute damage of 50 mumol.L-1 Cd2+, physiological and biochemical characteristics of seedling changed greatly, e.g., chlorophyll content and root activity were decreased about 23.5% and 28.7%, cell membrane permeability, the malonydialdehyde (MDA) content, activities of catalase (CAT) and peroxidase (POD) were increased 5.58%, 28.6%, 0.6% and 7.0% respectively. And with longer treatment time, the damage became more serious. When 10 mg.L-1 La was used to spray on kidney bean seedling under cadmium stress one time, growth and metabolism of seedling was obviously reconditioned and the damage of Cd pollution was reduced. It is proved, by the experiment, that La can improve chlorophyll content(30.0%) and reduce cell membrane permeability (0.87%) and content of MDA(9.5%), and keep the activities of CAT (0.1%) and POD(1.6%) of kidney bean seedling.

  11. Nitrogen 15 abundance in protein fractions of beans fertilized with (15NH42SO4

    Directory of Open Access Journals (Sweden)

    Chaud Saula Goulart

    2002-01-01

    Full Text Available Studies evaluating the protein nutritive value of beans labelled with 15N, ussing nitrogen balance and the quantitation of faecal and urinary endogenous nitrogen, determined by isotopic dilution, have been extensively used. The objective of this research was to verify if the isotopic labelling of raw, freeze dried beans (Phaseolus vulgaris L., cultivar Piratã 1 with 1.394 atoms%15N, resulted in the same abundance of the whole flour and of the protein fractions extracted from the beans with 0.5 mol L-1 NaCl. The isotopic abundance found in the whole bean flour, in the protein extract, in the globulin and albumin fractions were respectively: 1.394 ± 0.011; 1.403 ± 0.012; 1.399 ± 0.007 and 1.399 ± 0.028 atoms % of 15N, presenting no difference (P > 0.05. However, a difference was found (P < 0.05 between the above mentioned abundances and the isotopic abundance found in the nitrogen of the proteins in the extraction residue, which was 0.969 ± 0.084. Since the abundances did not differ, the protein nutritive indexes, such as digestibility and biological value, determined from the nitrogen balance and corrected for isotopic dilution, would not be affected by extracting the proteins from the beans with 0.5 mol L¹ NaCl. If working with the nitrogen balance of the residual proteins after extraction and even with the whole flours, these indexes could present incorrect values, since the isotopic labelling of the residual proteins was less than that of the protein fractions.

  12. Nutritional composition and antioxidant activity of twenty mung bean cultivars in China

    Directory of Open Access Journals (Sweden)

    Zhenxing Shi

    2016-10-01

    Full Text Available Interest in mung bean (Vigna radiata L. as a functional food is growing; however, studies on the nutritional composition of major mung bean cultivars planted in China are limited. Twenty Chinese mung bean cultivars were collected and their nutritional compositions including starch, fat, protein, and phytochemicals were analyzed. The cultivars were found to have a high amount of resistant starch, accounting for 16.1%–22.3% of total starch, and balanced amino acid constitutions. Palmitic acid and linoleic acid were the two dominant fatty acids, accounting for respectively 32.4% and 36.1% of all of the assayed fatty acids. Four bound phenolic acids (syringic, caffeic, p-coumaric, and ferulic acids and two free phenolic acids (caffeic and ferulic acids were identified by HPLC. The antioxidant activity of 70% ethanol extracts from the 20 mung bean cultivars was evaluated. Their DPPH and ABTS+ free-radical-scavenging capacity ranged from 28.13 ± 2.24 to 35.68 ± 0.71 μmol g−1 and from 3.82 ± 0.25 to 13.44 ± 1.76 μmol g−1, respectively. Significant positive correlations of ABTS+ free-radical-scavenging capacity with total phenolic acids and total flavonoid contents were observed. These results suggest that Chinese mung bean cultivars are rich in balanced nutrients and that their phytochemicals should be considered as potential sources of natural antioxidants.

  13. Large-Scale Transcriptome Analysis in Faba Bean (Vicia faba L. under Ascochyta fabae Infection.

    Directory of Open Access Journals (Sweden)

    Sara Ocaña

    Full Text Available Faba bean is an important food crop worldwide. However, progress in faba bean genomics lags far behind that of model systems due to limited availability of genetic and genomic information. Using the Illumina platform the faba bean transcriptome from leaves of two lines (29H and Vf136 subjected to Ascochyta fabae infection have been characterized. De novo transcriptome assembly provided a total of 39,185 different transcripts that were functionally annotated, and among these, 13,266 were assigned to gene ontology against Arabidopsis. Quality of the assembly was validated by RT-qPCR amplification of selected transcripts differentially expressed. Comparison of faba bean transcripts with those of better-characterized plant genomes such as Arabidopsis thaliana, Medicago truncatula and Cicer arietinum revealed a sequence similarity of 68.3%, 72.8% and 81.27%, respectively. Moreover, 39,060 single nucleotide polymorphism (SNP and 3,669 InDels were identified for genotyping applications. Mapping of the sequence reads generated onto the assembled transcripts showed that 393 and 457 transcripts were overexpressed in the resistant (29H and susceptible genotype (Vf136, respectively. Transcripts involved in plant-pathogen interactions such as leucine rich proteins (LRR or plant growth regulators involved in plant adaptation to abiotic and biotic stresses were found to be differently expressed in the resistant line. The results reported here represent the most comprehensive transcript database developed so far in faba bean, providing valuable information that could be used to gain insight into the pathways involved in the resistance mechanism against A. fabae and to identify potential resistance genes to be further used in marker assisted selection.

  14. Deficiency symptoms and uptake of micronutrients by castor bean grown in nutrient solution

    Directory of Open Access Journals (Sweden)

    José Lavres Junior

    2012-02-01

    Full Text Available Castor bean is a nutrient-demanding species, but there is still little information on its micronutrient requirements. The objectives of this study were to evaluate the effects of levels of B (2.5, 12.5 and 25.0 µmol L-1, Cu (0.05, 0.25 and 0.50 µmol L-1, Mn (0.2, 1.0 and 2.0 µmol L-1 and Zn (0.2, 1.0 and 2.0 µmol L-1 in a nutrient solution on plant B, Cu, Mn and Zn concentrations and uptake, vegetative growth and fruit yield of castor bean "Iris", grown in greenhouse. The experiment was arranged in a completely randomized block design with three replicates. The first deficiency symptoms were observed for B, followed by Zn, Cu and Mn. The main changes in the cell ultrastructure due to lack of B were thickening of the cell walls and middle lamellae, distorted chloroplasts and tightly stacked thylakoids, besides the absence of starch grains. The Mn, Zn and Cu deficiencies led to disruption of chloroplasts, disintegration of thylakoids and absence of amyloplasts. The concentration and uptake of B, Cu, Mn, and Zn in castor bean plants increased with micronutrient supply in the solution. Fruit yield was drastically reduced by B and Mn deficiencies. On the other hand, the dry matter yield of the shoot and root of castor bean plants was not. In the treatment with full nutrient solution, the leaves accumulated 56 and 48 % of the total B and Mn taken up by the plants, respectively, and the seeds and roots 85 and 61 % of the total Cu and Zn taken up, respectively. This shows the high demand of castor bean Iris for B and Mn for fruit yield.

  15. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ved Parkash [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Department of Zoology, Panjab University, Chandigarh 160014 (India); Singh, Harminder Pal, E-mail: hpsingh_01@yahoo.com [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Kohli, Ravinder Kumar; Batish, Daizy Rani [Department of Botany, Panjab University, Chandigarh 160014 (India)

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 {mu}W cm{sup -2}; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H{sub 2}O{sub 2}) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at {>=}2 h), and radicle and plumule growths ({>=}1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H{sub 2}O{sub 2} accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  16. Influence of Milling Process of Roasted Cocoa Beans on Size Distribution Change of Cocoa Cotyledon

    Directory of Open Access Journals (Sweden)

    Sukrisno Widyotomo

    2007-05-01

    Full Text Available One of important steps in secondarycocoa process is deshelling cocoa beans roasted. The aim of deshelling is to enrich cotyledon cocoa surface area which affects to reduce energy and processing time with good quality of the chocolate product. The objective of this research is to study the influence of milling process on physical characteristic change of cocoa beans roasted such as size distribution change, geometrical diameter average, uniformity index, fineness modulus, and average dimension of cotyledoncocoa roasted. The Indonesian Coffee and Cocoa Research Institute has designed and tested deshelling of roasted cocoa beans which will be used in this research. Before deshelling process, C grade bulk cocoa beans has been roasted up to 2.5—3% water contents. The result showed that optimal milling process by rotary cutter type milling unit has good size distribution change, geometrical diameter average, uniformity index, fineness modulus, and average dimension on 500 rpm rotary speed and 2.8 m/s air flow. On optimal process condition, 74.5% of cocoa cotyledon roasted has diameter size between 2.0—4.75 mm, 2.116 mm average of geometrical diameter, 0.864 mm average dimension, 3.052 fineness modulus, and 80% as crude size particel-20% as temperate size particel on uniformity index. Therefore, more than 80% of cocoa cotyledon roasted has diameter size between 2.0—4.75 mm with 700—900 rpm rotary cutter speed. Average of geometric diameter was 1.65—2.19 mm, and the dimension average was 0.69—0.89 mm. Uniformity index was crude size particle up to 80—90%, and in temperate size particle10—20%. Fineness modulus value was 2.73—3.09. Key words: cocoa, milling, size distribution, roasted beans.

  17. Studies of Cream Seeded Carioca Beans (Phaseolus vulgaris L. from a Rwandan Efficacy Trial: In Vitro and In Vivo Screening Tools Reflect Human Studies and Predict Beneficial Results from Iron Biofortified Beans.

    Directory of Open Access Journals (Sweden)

    Elad Tako

    Full Text Available Iron (Fe deficiency is a highly prevalent micronutrient insufficiency predominantly caused by a lack of bioavailable Fe from the diet. The consumption of beans as a major food crop in some populations suffering from Fe deficiency is relatively high. Therefore, our objective was to determine whether a biofortified variety of cream seeded carioca bean (Phaseolus vulgaris L. could provide more bioavailable-Fe than a standard variety using in-vivo (broiler chicken, Gallus gallus and in-vitro (Caco-2 cell models. Studies were conducted under conditions designed to mimic the actual human feeding protocol. Two carioca-beans, a standard (G4825; 58 μg Fe/g and a biofortified (SMC; 106 μg Fe/g, were utilized. Diets were formulated to meet the nutrient requirements of Gallus gallus except for Fe (33.7 and 48.7 μg Fe/g, standard and biofortified diets, respectively. In-vitro observations indicated that more bioavailable-Fe was present in the biofortified beans and diet (P<0.05. In-vivo, improvements in Fe-status were observed in the biofortified bean treatment, as indicated by the increased total-body-Hemoglobin-Fe, and hepatic Fe-concentration (P<0.05. Also, DMT-1 mRNA-expression was increased in the standard bean treatment (P<0.05, indicating an upregulation of absorption to compensate for less bioavailable-Fe. These results demonstrate that the biofortified beans provided more bioavailable Fe; however, the in vitro results revealed that ferritin formation values were relatively low. Such observations are indicative of the presence of high levels of polyphenols and phytate that inhibit Fe absorption. Indeed, we identified higher levels of phytate and quercetin 3-glucoside in the Fe biofortified bean variety. Our results indicate that the biofortified bean line was able to moderately improve Fe-status, and that concurrent increase in the concentration of phytate and polyphenols in beans may limit the benefit of increased Fe-concentration. Therefore

  18. Identification of common bean alleles resistant to anthracnose using RAPD

    Directory of Open Access Journals (Sweden)

    Ana L.M. Castanheira

    1999-12-01

    Full Text Available RAPD markers were identified close to common bean alleles responsible for resistance to the fungus Colletotrichum lindemuthianum and may be useful in selecting plants resistant to this pathogen. DNA from F2 plants of the crosses Carioca 300V x P45, Carioca 300V x Ouro and P24 x Ouro was amplified by RAPD. Line P45 has the Co.4 allele for resistance, and the Ouro cultivar has the Co.5 allele. The primer OPC08 amplified a DNA fragment of about 1059 bp linked to the Co.4 allele. The recombination frequency was 0.133 (SE = 0.039; 95% CI = 0.056-0.211. Using the primer OPF10 a DNA fragment of about 912 bp was amplified and found to be associated with the Co.5 allele. The recombination frequency was 0.115 (SE = 0.038; 95% CI = 0.041-0.189. A second marker (1122 pb amplified by the OPR03 primer was identified in the population P24 x Ouro. The recombination frequency for this marker was 0.363 (SE = 0.081; 95% CI = 0.205-0.522. Both these markers flanked the Co.5 allele. The markers identified in this study may be useful in identifying lines with the Co.4 and Co.5 alleles.Marcadores RAPD foram identificados próximos de alelos do feijão responsáveis pela resistência ao Colletotrichum lindemuthianum, visando auxiliar na seleção de plantas resistentes ao patógeno. Empregou-se o método dos bulks segregantes de DNA extraídos de plantas F2 dos seguintes cruzamentos: Carioca 300V x P45, Carioca 300V x Ouro e P24 x Ouro. A linhagem P45 é portadora do alelo Co.4 de resistência e o cultivar Ouro é portador do alelo Co.5, os quais foram marcados. Procedeu-se à reação RAPD dos bulks e foi identificado o iniciador OPC08 que amplificou um fragmento de DNA com cerca de 1059 pb, ligado ao alelo Co.4. A freqüência de recombinação foi de 0,133 (erro padrão 0,039 e o intervalo de confiança foi 0,056 e 0,211, com 95% de probabilidade. Em relação ao alelo Co.5 foi identificado um fragmento de DNA amplificado pelo iniciador OPF10 com cerca de 912 pb, na

  19. Efforts to accelerate domestication of winged bean (Psophocarpus tetragonolobus (L.) DC.) by means of induced mutations and tissue culture.

    NARCIS (Netherlands)

    Klu, G.Y.P.

    1996-01-01

    This thesis describes mutation breeding and tissue culture techniques developed for accelerated domestication of winged bean ( Psophocarpustetragonolobus (L.) DC.). The tissue culture techniques, which are the first steps towards genetic transformation of the crop, include: (1) direct adventitious s

  20. Development of a quantitative PCR assay for rapid detection of Lactobacillus plantarum and Lactobacillus fermentum in cocoa bean fermentation.

    Science.gov (United States)

    Schwendimann, Livia; Kauf, Peter; Fieseler, Lars; Gantenbein-Demarchi, Corinne; Miescher Schwenninger, Susanne

    2015-08-01

    To monitor dominant species of lactic acid bacteria during cocoa bean fermentation, i.e. Lactobacillus plantarum and Lactobacillus fermentum, a fast and reliable culture-independent qPCR assay was developed. A modified DNA isolation procedure using a commercial kit followed by two species-specific qPCR assays resulted in 100% sensitivity for L. plantarum and L. fermentum. Kruskal-Wallis and post-hoc analyses of data obtained from experiments with cocoa beans that were artificially spiked with decimal concentrations of L. plantarum and L. fermentum strains allowed the calculation of a regression line suitable for the estimation of both species with a detection limit of 3 to 4 Log cells/g cocoa beans. This process was successfully tested for efficacy through the analyses of samples from laboratory-scale cocoa bean fermentations with both the qPCR assay and a culture-dependent method which resulted in comparable results.

  1. Analysis of simple sequence repeats in rice bean(Vigna umbellata) using an SSR-enriched library

    Institute of Scientific and Technical Information of China (English)

    Lixia Wang; Kyung Do Kim; Dongying Gao; Honglin Chen; Suhua Wang; Suk Ha Lee; Scott A. Jackson; Xuzhen Cheng

    2016-01-01

    Rice bean(Vigna umbellata Thunb.), a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop.Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers.In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides(17.8%). Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT(14.3%), and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean.However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker-assisted selection in rice

  2. EVALUATION OF VARIOUS CHARACTERISTICS OF Akara (FRIED BEANS CAKE) MADE FROM COWPEA (vigna unguiculata) AND SOYBEAN (glycine max) BLENDS

    OpenAIRE

    Ogundele G F; Ojubanire B A; Bamidele O P

    2014-01-01

    Akara (fried bean cake) is one of the most popular local dishes in Nigeria. Proximate composition, functional properties and sensory evaluation of akara prepared from cowpea and soybean blends were carried out in present study. Furthermore, study was also planned to determine the best ratio of cowpea & soybean blend that can give best akara production (fried beans cake). Result of proximate analysis revealed that the combination of cowpea and soybean blends (sample B, C and D) h...

  3. [Evaluation of the nixtamal-tortilla-making quality of mixtures of corn (Zea mays) and hard beans (Phaseolus vulgaris)].

    Science.gov (United States)

    García-Osorio, C; Vázquez Carrillo, M G

    1997-12-01

    In Mexico, some varieties of beans become hard during storage, and required a longer time for cooking. Beans which need more than four hours to cook are deemed unsuitable for human consumption by the government agency CONASUPO even though their nutritional value is unaltered. The objective of this study was to evaluate the nixtamal-tortilla-making quality of mixtures of maize and hard beans, protein, sensory evaluation, and shelf life of the tortillas. The tortillas were made from mixtures of maize with 5% and 10% hard beans without the seed coat and compared with tortillas made with 100% maize. The mixtures and the control were nixtamalized for 20, 30 and 40 minutes with 1% lime (CaO). The maximum viscosity of the mass were statistically equal to that of the control. The mixture with 10% beans, 90% maize, and 30 min of nixtamalization produced tortillas with 26.3% more protein than the control. The texture evaluated in the Instron showed that the tortillas with 10% beans were harder than the control; however, in the sensory evaluation, the recently-made tortillas with 30 min nixtamalization were judged the best, with no significant differences between the control and the mixtures of maize with hard beans. The analysis of fungi, yeasts, and bacteria at room temperature and with refrigeration (4 degrees C), showed that the growth of microorganisms was directly proportional to the percentage of beans added and the duration of storage. The largest number of microorganisms was found at room temperature after 48 h of storage.

  4. The influence of water management and environmental conditions on the chemical composition and beverage quality of coffee beans

    OpenAIRE

    Silva,Emerson A da; MAZZAFERA, Paulo; Brunini,Orivaldo; Sakai,Emílio; Flávio B. Arruda; Mattoso,Luiz Henrique C.; Carvalho, Cássia R. L.; Pires, Regina Célia M.

    2005-01-01

    The influence of environmental conditions and irrigation on the chemical composition of green coffee beans and the relationship of these parameters to the quality of the beverage were investigated in coffee plantations in the regions of Adamantina, Mococa and Campinas, in the state of São Paulo, Brazil. The chemical composition and physical aspects of green coffee beans produced in the three regions were related through Principal Component Analyses (PCA) to the quality of beverage, as determi...

  5. Diversity in the rhizobia associated with Phaseolus vulgaris L. in Ecuador, and comparisons with Mexican bean rhizobia.

    Science.gov (United States)

    Bernal, G; Graham, P H

    2001-06-01

    Common beans (Phaseolus vulgaris L.) have centers of origin in both Mesoamerica and Andean South America, and have been domesticated in each region for perhaps 5000 years. A third major gene pool may exist in Ecuador and Northern Peru. The diversity of the rhizobia associated with beans has also been studied, but to date with an emphasis on the Mesoamerican center of origin. In this study we compared bean rhizobia from Mexico and Andean South America using both phenotypic and phylogenetic approaches. When differences between the rhizobia of these two regions were shown, we then examined the influence of bean cultivar on the most probable number (MPN) count and biodiversity of rhizobia recovered from different soils. Three clusters of bean rhizobia were distinguished using phenotypic analysis and principal-component analysis of Box AIR-PCR banding patterns. They corresponded principally to isolates from Mexico, and the northern and southern Andean regions, with isolates from southern Ecuador exhibiting significant genetic diversity. Rhizobia from Dalea spp., which are infective and effective on beans, may have contributed to the apparent diversity of rhizobia recovered from the Mesoamerican region, while the rhizobia of wild Phaseolus aborigineus from Argentina showed only limited similarity to the other bean rhizobia tested. Use of P. vulgaris cultivars from the Mesoamerican and Andean Phaseolus gene pools as trap hosts did not significantly affect MPN counts of bean rhizobia from the soils of each region, but did influence the diversity of the rhizobia recovered. Such differences in compatibility of host and Rhizobium could be a factor in the poor reputation for nodulation and N2 fixation in this crop.

  6. Triple-Layer Plastic Bags Protect Dry Common Beans (Phaseolus vulgaris) Against Damage by Acanthoscelides obtectus (Coleoptera: Chrysomelidae) During Storage.

    Science.gov (United States)

    Mutungi, C; Affognon, H D; Njoroge, A W; Manono, J; Baributsa, D; Murdock, L L

    2015-10-01

    Fumigated dry common beans (Phaseolus vulgaris L.) that were artificially infested with Acanthoscelides obtectus Say, and others that were not artificially infested, were stored in hermetic triple-layer PICS (Lela Agro, Kano, Nigeria) or woven polypropylene (PP) bags for 6 mo at ambient laboratory temperature conditions of 22.6 ± 1.9°C and 60.1 ± 4.3% relative humidity. In an additional trial, beans contained in PP bags were treated with Actellic Super dust before introducing A. obtectus. Moisture content, number of live adult A. obtectus, seed damage, weight loss, and seed germination were determined at monthly intervals. At 6 mo, beans stored in PICS bags retained higher moisture than those stored in PP bags, but in all treatments the moisture level remained below that recommended for safe storage of beans. In the PICS bags, proliferation of A. obtectus did not proceed and at 6 mo, beans stored in these bags did not have insect-inflicted seed damage or weight loss. In contrast, seed damage and weight loss in PP bags exceeded economic threshold after 1 mo in the absence of Actellic Super dust (Syngenta Crop protection AG, Basle, Switzerland), and after 2 mo in the presence of it. Germination of beans stored in PP bags decreased greatly whereas the beans stored in PICS bags did not show reduced germination. Chemical free storage of common beans in PICS bags protects them against damage by A. obtectus.

  7. Soya beans and Maize : The effect of chemical and physical structure of cell wall polysaccharides on fermentation kinetics

    OpenAIRE

    Laar, van de, P.

    2000-01-01

    The analysis of the relationship between cell wall composition and fermentation of endosperm cell walls of soya beans and maize was approached from three different angles. Firstly, the fermentation (rate and extent of fermentation, the sugar degradation pattern, and volatile fatty acid production) of soya bean and maize cell walls was analysed, both in situ and in vitro. This analysis revealed that the physical structure of the cell wall (particle size and cell wall thickness) influences cell...

  8. Cowpeas and pinto beans: yields and light efficiency of candidate space crops in the Laboratory Biosphere closed ecological system

    Science.gov (United States)

    Nelson, M.; Dempster, W. F.; Silverstone, S.; Alling, A.; Allen, J. P.; van Thillo, M.

    An experiment utilizing cowpeas Vigna unguiculata pinto beans Phaseolus vulgaris L and Apogee ultra-dwarf wheat was conducted in the soil-based closed ecological facility Laboratory Biosphere from February to May 2005 The lighting regime was 13 hours light 11 hours dark at a light intensity of 960 mu mol m -2 s -1 45 moles m -2 day -1 supplied by high-pressure sodium lamps The pinto beans and cowpeas were grown at two different plant densities The pinto bean produced 710 g m -2 total aboveground biomass and 341 g m -2 at 33 5 plants per m 2 and at 37 5 plants per m 2 produced 1092 g m -2 total biomass and 537 g m -2 of dry seed an increase of almost 50 Cowpeas at 28 plants m -2 yielded 1060 g m -2 of total biomass and 387 g seed m -2 outproducing the less dense planting by more than double 209 in biomass and 86 more seed as the planting of 21 plants m -2 produced 508 g m-2 of total biomass and 209 g m-2 of seed Edible yield rate EYR for the denser cowpea bean was 4 6 g m -2 day -1 vs 2 5 g m -2 day -1 for the less dense stand average yield was 3 5 g m -2 day -1 EYR for the denser pinto bean was 8 5 g m -2 day -1 vs 5 3 g m -2 day -1 average EYR for the pinto beans was 7 0 g m -2 day -1 Yield efficiency rate YER the ratio of edible to non-edible biomass was 0 97 for the dense pinto bean 0 92 for the less dense pinto bean and average 0 94 for the entire crop The cowpeas

  9. Effects of altitude above sea level on the cooking time and nutritional value of common beans.

    Science.gov (United States)

    Bressani, R; Chon, C

    1996-01-01

    The present study was conducted with the objective to determine the effects of altitude above sea level, on the cooking time and nutritional value of common black beans (Phaseolus vulgaris). Three 100 g samples of the Ostua variety were cooked at 8 individual locations, ranging in altitude from 0 to 2256 meters, in Guatemala, to establish water uptake and cooking time. The cooked samples were separated into cooked beans and cooking broth for chemical analysis. This included moisture, protein, lysine, tannins, total and enzyme susceptible starch, and fiber fractionation. The cooking liquor was analyzed for total solids, moisture, protein, ash and K. A 1200 g sample was cooked for the cooking time established previously, for biological testing of nutritional value, which included Net Protein Ratio (NPR), Protein Efficiency Ratio (PER), and protein digestibility. Altitude influenced cooking time which increased from 78 min at 0 m, to 264 min at 2256 m. Final moisture content in the cooked bean was similar at all altitudes and there was a tendency to yield smaller amounts of solids in the cooking broth at higher altitudes. The increase in cooking time was significant. Bean water uptake at all times was significantly slower and smaller at ambient as compared to water uptake at boiling T, at all altitudes. Protein and lysine content were not affected by altitude, however, tannin and catechin were lower in cooked samples, as compared to the raw material. Altitude did not affect the content of these substances. Total starch and total sugars were higher in the raw sample, as compared to the cooked samples, but there was no effect of altitude. Enzyme susceptible starch (ESS) was lower in the raw sample as compared to the cooked samples, which contained similar amounts with respect to altitude. No change was observed in fiber fractions of the cooked beans. Likewise, the composition of the cooking broth was very similar between cooking locations. There was a small tendency to

  10. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador.

    Science.gov (United States)

    Chavez, E; He, Z L; Stoffella, P J; Mylavarapu, R S; Li, Y C; Moyano, B; Baligar, V C

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg(-1)) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0-5, 5-15, 15-30, and 30-50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg(-1), respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg(-1). Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg(-1)), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans>shell>leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg(-1), and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0-5 and 5-15 cm depths (r=0.80 and 0.82 for M3, and r=0.78 and 0.82 for HCl; Pcacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils.

  11. Infestation of Caliothrips phaseoli (Thysanoptera: Thripidae) on Bean Cultivars Grown in the Winter, Rainy, and Dry Seasons in Brazil.

    Science.gov (United States)

    Boiça Júnior, Arlindo Leal; Costa, Eduardo Neves; De Souza, Bruno Henrique Sardinha; Da Silva, Anderson Gonçalves; Chiorato, Alisson Fernando

    2015-08-01

    The present study aimed to identify common bean (Phaseolus vulgaris L.) cultivars less susceptible to Caliothrips phaseoli (Hood) in different growing seasons, to evaluate whether climatic conditions influence plant resistance to C. phaseoli infestation, and to investigate the preferred plant part for insect feeding. Eighteen common bean cultivars were evaluated in the winter season, and 19 cultivars were assessed in the rainy and dry seasons, under field conditions in the municipality of Jaboticabal, state of São Paulo, Brazil. Infestation of C. phaseoli nymphs in the upper and lower parts of the beans plants was recorded at weekly intervals from 25 days after plant emergence (DAE) to 60 DAE. In the winter season, the cultivars 'IAC Galante,' 'IAC Centauro,' 'IAC Carioca Eté,' and 'IAC Formoso' had significantly lower number of thrips than the cultivar 'IAC Diplomata.' In the rainy season, the cultivars 'IAC Harmonia' and 'IPR Siriri' had the lowest thrips infestation, differing from the cultivars 'BRS Pontal' and 'IAC Una.' The bean cultivars were equally susceptible to C. phaseoli in the dry season. The results suggest that C. phaseoli nymphs prefer to infest leaves of the lower part of bean plants, like most generalist herbivorous insects. In the winter and dry seasons, the highest thrips infestation was observed at 60 DAE, while in the rainy season, it was recorded from 32 to 46 DAE. Overall, C. phaseoli infestation on bean cultivars was not influenced by either temperature, relative humidity, or rainfall.

  12. Effect of Dehydration Conditions on the Chemical, Physical, and Rehydration Properties of Instant Whole Bean (Phaseolus vulgaris L. var. Azufrado

    Directory of Open Access Journals (Sweden)

    Juan Alberto Resendiz Vazquez

    2015-01-01

    Full Text Available The purpose of this study was to evaluate the effect of dehydration conditions on the chemical, physical, and rehydration properties of instant whole beans (Phaseolus vulgaris L. var. Azufrado using a 22 factorial design (air temperature: 25°C and 30°C, air velocity: 0.5 m/s and 1.0 m/s. To determine the kinetic parameters, the rehydration data were fitted to three models: Peleg’s, First Order, and Sigmoid. The protein, fat, and ash contents of the beans were not significantly affected (P>0.05 by the dehydration conditions. Of the 11 physical properties of the instant whole beans, only water activity and splitting were significantly affected by dehydration conditions (P0.05 between the observed and predicted equilibrium moisture contents of the instant whole beans. Regarding the rehydration kinetics for the instant whole beans, the activation energy values ranged from 23.56 kJ/mol to 30.48 kJ/mol, depending on the dehydration conditions. The dehydration conditions had no significant effect (P>0.05 on the rehydration properties of instant whole beans.

  13. Effect of cooking and germination on phenolic composition and biological properties of dark beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    López, Ana; El-Naggar, Tarek; Dueñas, Montserrat; Ortega, Teresa; Estrella, Isabel; Hernández, Teresa; Gómez-Serranillos, M Pilar; Palomino, Olga M; Carretero, M Emilia

    2013-05-01

    Legumes are the basés diet in several countries. They hold a high nutritional value, but other properties related to human health are nowadays being studied. The aim of this work was to study the influence of processes (boiling or germination) on the phenolic composition of dark beans (Phaseolus vulgaris L. c.v. Tolosana) and their effect on their antioxidant, neuroprotective and anticancer ability. Phenolic composition of raw and processed dark beans was analysed by HPLC-PAD and HPLC-ESI/MS. The antioxidant activity was evaluated by ORAC. Astrocytes cultures (U-373) have been used to test their neuroprotective effect. Anticancer activities were evaluated on three different cell lines (renal adenocarcinoma (TK-10), breast adenocarcinoma (MCF-7) and melanoma (UACC-62)) by sulphorhodamine B method. Qualitative and quantitative differences in phenolic composition have been observed between raw and processed dark beans that influence the antioxidant activity, mainly for germinated samples which show a decrease of antioxidant capacity. Although every assayed extracts decreased reactive oxygen species release and exhibited cytotoxicity activities on cancer cell lines, raw beans proved to be the most active in neuroprotective and antitumoral effects; this sample is especially rich in phenolic compounds, mainly anthocyanins. This study further demonstrated that phenolic composition of dark beans is related with cooking process and so with their neuroprotective and anticancer activity; cooking of dark beans improves their digestion and absorption at intestinal level, while maintaining its protective ability on oxidative process at cellular level.

  14. Contribution of Bacillus Isolates to the Flavor Profiles of Vanilla Beans Assessed through Aroma Analysis and Chemometrics

    Directory of Open Access Journals (Sweden)

    Fenglin Gu

    2015-10-01

    Full Text Available Colonizing Bacillus in vanilla (Vanilla planifolia Andrews beans is involved in glucovanillin hydrolysis and vanillin formation during conventional curing. The flavor profiles of vanilla beans under Bacillus-assisted curing were analyzed through gas chromatography-mass spectrometry, electronic nose, and quantitative sensory analysis. The flavor profiles were analytically compared among the vanilla beans under Bacillus-assisted curing, conventional curing, and non-microorganism-assisted curing. Vanilla beans added with Bacillus vanillea XY18 and Bacillus subtilis XY20 contained higher vanillin (3.58% ± 0.05% and 3.48% ± 0.10%, respectively than vanilla beans that underwent non-microorganism-assisted curing and conventional curing (3.09% ± 0.14% and 3.21% ± 0.15%, respectively. Forty-two volatiles were identified from endogenous vanilla metabolism. Five other compounds were identified from exogenous Bacillus metabolism. Electronic nose data confirmed that vanilla flavors produced through the different curing processes were easily distinguished. Quantitative sensory analysis confirmed that Bacillus-assisted curing increased vanillin production without generating any unpleasant sensory attribute. Partial least squares regression further provided a correlation model of different measurements. Overall, we comparatively analyzed the flavor profiles of vanilla beans under Bacillus-assisted curing, indirectly demonstrated the mechanism of vanilla flavor formation by microbes.

  15. Standardization of DNA isolation and PCR protocols for ISSR analysis in Cluster bean [Cyamopsis tetragonoloba (L. Taub.] Genotypes

    Directory of Open Access Journals (Sweden)

    Vikas Kumar,

    2015-05-01

    Full Text Available Cluster bean [Cyamopsis tetragonoloba (L Taub.] is one of the most important cash legume crop has played an increasingly important role in wide range of industries. Owing to the significance of molecular marker studies in numerous applications including in genetic improvement of crops, there is an obvious need to undertake such studies in cluster bean. Present research work was carried out with the genomic DNA optimization and PCR standardization for ISSR analysis in cluster bean genotypes. The standard CTAB method for isolation of genomic DNA from cluster bean have their own limitation as it produces gel image with high contamination of yellowish, sticky and viscous matrix. The commonly used CTAB method was modified by giving Polyvinylpyrrolidone (PVP treatments after grinding fresh young leaves of cluster bean. The yield of genomic DNA was increased in ranged from120 ng/µl to 220 ng/µl of 0.2 g leaf tissue and the purity (ratio was between 1.5-1.7 indicating minimal levels of contaminating metabolites. ISSR protocol was standardized after implementing various modifications. Based on above findings of present experiment work this modified genomic DNA isolation and PCR protocol may be utilized for ISSR profiling to produce sharp and clear bands in cluster bean genotypes.

  16. Contribution of Bacillus Isolates to the Flavor Profiles of Vanilla Beans Assessed through Aroma Analysis and Chemometrics.

    Science.gov (United States)

    Gu, Fenglin; Chen, Yonggan; Fang, Yiming; Wu, Guiping; Tan, Lehe

    2015-01-01

    Colonizing Bacillus in vanilla (Vanilla planifolia Andrews) beans is involved in glucovanillin hydrolysis and vanillin formation during conventional curing. The flavor profiles of vanilla beans under Bacillus-assisted curing were analyzed through gas chromatography-mass spectrometry, electronic nose, and quantitative sensory analysis. The flavor profiles were analytically compared among the vanilla beans under Bacillus-assisted curing, conventional curing, and non-microorganism-assisted curing. Vanilla beans added with Bacillus vanillea XY18 and Bacillus subtilis XY20 contained higher vanillin (3.58%±0.05% and 3.48%±0.10%, respectively) than vanilla beans that underwent non-microorganism-assisted curing and conventional curing (3.09%±0.14% and 3.21%±0.15%, respectively). Forty-two volatiles were identified from endogenous vanilla metabolism. Five other compounds were identified from exogenous Bacillus metabolism. Electronic nose data confirmed that vanilla flavors produced through the different curing processes were easily distinguished. Quantitative sensory analysis confirmed that Bacillus-assisted curing increased vanillin production without generating any unpleasant sensory attribute. Partial least squares regression further provided a correlation model of different measurements. Overall, we comparatively analyzed the flavor profiles of vanilla beans under Bacillus-assisted curing, indirectly demonstrated the mechanism of vanilla flavor formation by microbes.

  17. Prediction of fermentation index of cocoa beans (Theobroma cacao L.) based on color measurement and artificial neural networks.

    Science.gov (United States)

    León-Roque, Noemí; Abderrahim, Mohamed; Nuñez-Alejos, Luis; Arribas, Silvia M; Condezo-Hoyos, Luis

    2016-12-01

    Several procedures are currently used to assess fermentation index (FI) of cocoa beans (Theobroma cacao L.) for quality control. However, all of them present several drawbacks. The aim of the present work was to develop and validate a simple image based quantitative procedure, using color measurement and artificial neural network (ANNs). ANN models based on color measurements were tested to predict fermentation index (FI) of fermented cocoa beans. The RGB values were measured from surface and center region of fermented beans in images obtained by camera and desktop scanner. The FI was defined as the ratio of total free amino acids in fermented versus non-fermented samples. The ANN model that included RGB color measurement of fermented cocoa surface and R/G ratio in cocoa bean of alkaline extracts was able to predict FI with no statistical difference compared with the experimental values. Performance of the ANN model was evaluated by the coefficient of determination, Bland-Altman plot and Passing-Bablok regression analyses. Moreover, in fermented beans, total sugar content and titratable acidity showed a similar pattern to the total free amino acid predicted through the color based ANN model. The results of the present work demonstrate that the proposed ANN model can be adopted as a low-cost and in situ procedure to predict FI in fermented cocoa beans through apps developed for mobile device.

  18. Effect of fermentation with Monascus pilosus on the antioxidant activities and phenolic acid contents of adzuki bean (Vigna angularis)

    Institute of Scientific and Technical Information of China (English)

    Jinhua Cheng; Sung-Kwon Lee; Joo-Won Suh; Seung HwanYang

    2015-01-01

    Objective: To enhance physiological activities of adzuki bean (Vigna angularis) via fermentation with Monascus pilosus (M. pilosus). Methods: The adzuki bean fermentation conditions with M. pilosus were optimized, and the effect of Monascus-fermentation on the antioxidant capacity and phenolic acid contents of adzuki bean was investigated. Results: Optimal fermentation conditions were determined by the production of monacolin K. The highest monacolin K production was observed in 5% inoculum sized on day 15 in fermentation. Free and bound phenolic acids were isolated from native and fermented adzuki bean. A 1.9-fold decrease was observed in bound p-coumaric acid content, whereas the contents of bound ferulic and sinapic acids were increased by 28- and 1.7-fold, respectively. However, the contents of free phenolic acids such as p-coumaric, ferulic, and sinapic acids were increased by 2.6-, 5.2-, and 7.2-fold, respectively. The fermentation of adzuki bean by M. pilosus enhanced the activities of DPPH· radical scavenging, ferrous ion-chelating, nitric oxide scavenging, and ferric antioxidant reducing activities 2.2-, 1.7-, 1.2-, and 1.8-fold, respectively. Conclusions: Results from our study suggest that the contents of p-coumaric, ferulic, and sinapic acids in adzuki bean were highly increased by fermentation with M. pilosus, resulting in enhanced various antioxidant activities.

  19. Effect of fermentation with Monascus pilosus on the antioxidant activities and phenolic acid contents of adzuki bean (Vigna angularis

    Directory of Open Access Journals (Sweden)

    Jinhua Cheng

    2015-04-01

    Full Text Available Objective: To enhance physiological activities of adzuki bean (Vigna angularis via fermentation with Monascus pilosus (M. pilosus. Methods: The adzuki bean fermentation conditions with M. pilosus were optimized, and the effect of Monascus-fermentation on the antioxidant capacity and phenolic acid contents of adzuki bean was investigated. Results: Optimal fermentation conditions were determined by the production of monacolin K. The highest monacolin K production was observed in 5% inoculum sized on day 15 in fermentation. Free and bound phenolic acids were isolated from native and fermented adzuki bean. A 1.9-fold decrease was observed in bound p-coumaric acid content, whereas the contents of bound ferulic and sinapic acids were increased by 28- and 1.7-fold, respectively. However, the contents of free phenolic acids such as p-coumaric, ferulic, and sinapic acids were increased by 2.6-, 5.2-, and 7.2-fold, respectively. The fermentation of adzuki bean by M. pilosus enhanced the activities of DPPH● radical scavenging, ferrous ion-chelating, nitric oxide scavenging, and ferric antioxidant reducing activities 2.2-, 1.7-, 1.2-, and 1.8-fold, respectively. Conclusions: Results from our study suggest that the contents of p-coumaric, ferulic, and sinapic acids in adzuki bean were highly increased by fermentation with M. pilosus, resulting in enhanced various antioxidant activities

  20. Effects of industrial canning on the proximate composition, bioactive compounds contents and nutritional profile of two Spanish common dry beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Pedrosa, Mercedes M; Cuadrado, Carmen; Burbano, Carmen; Muzquiz, Mercedes; Cabellos, Blanca; Olmedilla-Alonso, Begoña; Asensio-Vegas, Carmen

    2015-01-01

    This study investigated the changes produced by canning in the proximate composition and in the bioactive constituents of two "ready to eat" Spanish beans. The foremost difference in the raw beans corresponded to the lectin: a higher content was found in raw Curruquilla beans (16.50 mg 100 mg(-1)) compared with raw Almonga beans (0.6 mg 100 mg(-1)). In general, industrial canning significantly increased the protein (>7%) and dietary fibre (>5%) contents of both beans varieties. However, the minerals, total α-galactosides and inositol phosphates contents were reduced (>25%) in both canned seeds. The trypsin inhibitors content was almost abolished by canning, and no lectins were found in either of the canned samples. Canned Curruquilla showed a decrease (38%) of their antioxidant activity. These "ready to eat" beans exhibited adequate nutritive profiles according to the USDA dietary recommendations. Furthermore, they had bioactive components content that are suitable for establishing a healthy lifestyle.

  1. KARAKTERISASI EDIBLE FILM KOMPOSIT PROTEIN BIJI KECIPIR DAN TAPIOKA [Characterization of Composite Edible Film of Winged Bean Seeds Protein and Tapioca

    OpenAIRE

    C Dewi Poeloengasih1); Djagal W Marseno2)

    2003-01-01

    The advantageous winged bean seeds and tapioca as edible film ingredients are due to its relative abundance, inexpensive, biodegradable and their renewable nature. Research objectives were to isolate protein of winged bean (Psophocarpus tetragonolobus L. (DC.)) seeds and to characterize physical, mechanical and barrier properties of edible film made from protein fraction of winged bean seeds, tapioca and palmitic acid. The first group of edible film was prepared using 1% (w/v) of tapioca, 1 Ã...

  2. Estimation of phenotypic variability in symbiotic nitrogen fixation ability of common bean under drought stress using 15N natural abundance in grain

    OpenAIRE

    Polania, Jose; Poschenrieder, Charlotte; Rao, Idupulapati; Beebe, Stephen

    2016-01-01

    Common bean (Phaseolus vulgaris L.) is the most important food legume, cultivated by small farmers and is usually exposed to unfavorable conditions with minimum use of inputs. Drought and low soil fertility, especially phosphorus and nitrogen (N) deficiencies, are major limitations to bean yield in smallholder systems. Beans can derive part of their required N from the atmosphere through symbiotic nitrogen fixation (SNF). Drought stress severely limits SNF ability of plants. The main objectiv...

  3. Alleviation Effect of Lanthanum on Cadmium Stress in Seedling Hydroponic Culture of Kidney Bean and Corn

    Institute of Scientific and Technical Information of China (English)

    Huang Xiaohua; Zhou Qing

    2006-01-01

    The seedling hydroponic culture experiment of kidney bean (Phaseolus vulgaris) and corn (Zea mays) was conducted to investigate the alleviation effect of lanthanum on Cd stress.It is found that growth is seriously inhibited and metabolism is maladjusted in the two crops under 30 and 300 μmol·L-1 Cd2+ stress.Plant height, taproot length, leaf area, and fresh or dry weight of root, stem, and leaf are all obviously decreased.Further, chlorophyll content decreases, membrane permeability, malonydialdehyde (MDA) content, activities of catalase (CAT) and peroxidase (POD) increases under Cd stress, as compared with the control.The damage to these two crops becomes more conspicuous with the prolongation of Cd stress.It is suggested that lanthanum might help kidney bean and corn seedlings alleviate Cd stress by improving the photosynthetic capacity, reducing membrane permeability and MDA content, and maintaining the activities of CAT and POD of these two crops.

  4. Biological control of white mold by Trichoderma harzianum in common bean under field conditions

    Directory of Open Access Journals (Sweden)

    Daniel Diego Costa Carvalho

    2015-12-01

    Full Text Available Abstract: The objective of this work was to evaluate Trichoderma harzianum isolates for biological control of white mold in common bean (Phaseolus vulgaris. Five isolates were evaluated for biocontrol of white mold in 'Perola' common bean under field conditions, in the 2009 and 2010 crop seasons. A commercial isolate (1306 and a control treatment were included. Foliar applications at 2x109 conidia mL-1 were performed at 42 and 52 days after sowing (DAS, in 2009, and at 52 DAS in 2010. The CEN287, CEN316, and 1306 isolates decreased the number of Sclerotinia sclerotiorum apothecia per square meter in comparison to the control, in both crop seasons. CEN287, CEN316, and 1306 decreased white mold severity during the experimental period, when compared to the control.

  5. A highly efficient and thermostable α-amylase from soya bean seeds.

    Science.gov (United States)

    Prakash, Om; Jaiswal, Nivedita

    2010-12-01

    The α-amylase from soya bean seeds was purified by affinity precipitation, resulting in approx. 20-fold purification with approx. 84% recovery. The purified α-amylase had an optimum pH of 5.5, optimum temperature of 75 °C, Arrhenius energy of activation of 6.03 kcal/mol (1 kcal≈4.184 kJ) and a Km of 2.427 mg/ml (starch substrate). The enzyme had maximum substrate specificity for starch. Among the various metal ions tested, Co2+ and Mn2+ were found to be strong activators. The effect of thiol group modifying agents showed that the thiols of soya bean α-amylase are not directly involved in catalysis. The thermostability of the enzyme makes it suitable for starch liquefaction and the detergent industry respectively.

  6. Free cyclitol, soluble carbohydrate and protein contents in Vigna unguiculata and Phaseolus vulgaris bean sprouts.

    Science.gov (United States)

    Ribeiro, Elane da Silva; Centeno, Danilo da Cruz; Figueiredo-Ribeiro, Rita de Cássia; Fernandes, Kátia Valevski Sales; Xavier-Filho, José; Oliveira, Antônia Elenir Amancio

    2011-04-27

    Seeds sprouts have been used as a good source of basic nutrients and nutraceutical compounds. The high nutritional value of seeds derives from the deposition of compounds during development. However some of these molecules are used in metabolic processes like germination, which leads to a considerable variation in their concentrations once these events are completed. In this work, we investigate the levels of inositols (myo-inositol, D-pinitol and ononitol), soluble carbohydrates and proteins in cotyledons of Phaseolus vulgaris and Vigna unguiculata sprouts. Sprouting increased myo-inositol and glucose content and reduction of raffinose and ononitol was observed. The protein levels increased in P. vulgaris and decreased in V. unguiculata sprouting. The level of sucrose was maintained in both sprouts. D-Pinitol was detected only in quiescent seeds. Our results suggested that bean sprout is an important source of proteins, sucrose, glucose and myo-inositol. Additionally, bean sprouts have low levels of raffinose, an antinutritional compound.

  7. Growth of castor bean BRS-149 nordestina fertilized with nitrogen, phosphorus and potassium

    Directory of Open Access Journals (Sweden)

    Diva Lima de Araujo

    2009-12-01

    Full Text Available A trial was carried out in a greenhouse located at the Federal University of Campina Grande, in Campina Grande, Paraiba State, Brazil, with castor bean plants (Ricinus communis L., cv BRS Nordestina, in order to evaluate the effects of nitrogen, phosphorus and potassium on the growth. A completely randomized design with three replications and 15 treatments originated from a baconian matrix was adopted. Reference doses were 40:90:60 kg ha-1 of N:P2O5:K2O, respectively. Plant height, stem diameter, number and length of leaves were measured at 20, 40, 60, 80, 100, 120 and 140 days after planting (DAP. The unbalanced fertilization affected the development and seed production of castor bean, and the best response of the plants was observed at levels of 200 kg ha-1 de N; 150 kg ha-1 de P2O5 and 150 kg ha-1 de K2O.

  8. Oviposition choice of Mexican bean beetle (Epilachna varivestis) depends on host plants cyanogenic capacity.

    Science.gov (United States)

    Ballhorn, Daniel J; Lieberei, Reinhard

    2006-08-01

    The choice of insect females as to where to lay their eggs strongly affects progeny survival and, thus, fitness. We conducted choice experiments with female Mexican bean beetles, which were offered lima bean plants differing in their cyanogenic capacity (HCNc), i.e., in the intensity of hydrogen cyanide release per time unit from damaged plant tissue. Females preferred to lay their eggs on plants with low HCNc. In contrast, the mere concentration of cyanide-containing precursors (the cyanogenic potential, HCNp) did not affect oviposition choices. Plant cyanogenesis occurs after tissue damage, which brings specific beta-glucosidases in contact with their substrates, cyanogenic glycosides, from which they are separated by compartmentation in the intact plant tissue. Plants commonly store toxic compounds in an inactive form. Our results demonstrate that for cyanogenesis, which is widespread in plants, it is the toxic product itself rather than the precursor that affects oviposition choices of a specialized herbivore.

  9. Lipolytic activity of Svetol®, a decaffeinated green coffee bean extract.

    Science.gov (United States)

    Flanagan, John; Bily, Antoine; Rolland, Yohan; Roller, Marc

    2014-06-01

    The beneficial health effects of chlorogenic acids (CGAs), major components of coffee beans, are well known and have been attributed to multiple mechanisms of action. However, the lipolytic activity of CGAs does not appear to have been reported. We studied the effects of varying concentrations of Svetol®, a decaffeinated green coffee bean extract enriched in CGAs, on the liberation of free fatty acids from human adipocytes following short-term (2 h) and long-term (192 h) exposure. The results showed that although lipolytic activity observed following short-term incubation could be tentatively linked to residual caffeine traces in the sample, longer-term exposure clearly showed the effects of Svetol® on release of free fatty acids, and this effect was not due to caffeine. The results of this study provide a further mechanism by which to explain the long-term health benefits of CGAs and Svetol®.

  10. A Determination of Potential α-Glucosidase Inhibitors from Azuki Beans (Vigna angularis

    Directory of Open Access Journals (Sweden)

    Guixing Ren

    2011-09-01

    Full Text Available A 70% ethanol extract from azuki beans (Vigna angularis was extracted further with CH2Cl2, EtOAc and n-BuOH to afford four fractions: CH2Cl2-soluble, EtOAc-soluble, n-BuOH-soluble and residual extract fractions. The EtOAc-soluble fractions showed the highest α-glucosidase inhibitory activity. Two pure flavonoid compounds, vitexin and isovitexin, were isolated (using the enzyme assay-guide fractionation method from the EtOAc-soluble fractions. We further evaluated the interaction between the flavonoid compounds and α-glucosidase by fluorescence spectroscopy. Vitexin and isovitexin showed high inhibitory activities, with IC50 values of 0.4 mg·mL−1 and 4.8 mg·mL−1, respectively. This is the first study of the active compositions of azuki beans against α-glucosidase.

  11. Intrauterine midgut volvulus without malrotation:Diagnosis from the 'coffee bean sign'

    Institute of Scientific and Technical Information of China (English)

    Jun Seok Park; Seong Jae Cha; Beom Gyu Kim; Yong Seok Kim; Yoo Shin Choi; In Talk Chang; Gwang Jun Kim; Woo Seok Lee; Gi Hyeon Kim

    2008-01-01

    Fetal midgut volvulus is quite rare,and most cases areassociated with abnormalities of intestinal rotation orfixation.We report a case of midgut volvulus withoutmalrotation,associated with a meconium pellet,duringthe gestation period.This 2.79 kg,33-wk infant was bornvia a spontaneous vaginal delivery caused by pretermlabor.Prenatal ultrasound showed dilated bowel loopswith the appearance of a 'coffee bean sign" This patienthad an unusual presentation with a distended abdomenshowing skin discoloration.An emergency laparotomyrevealed a midgut volvulus and a twisted small bowel,caused by complicated meconium ileus.Such nonspecificprenatal radiological signs and a low index of suspicionof a volvulus during gestation might delay appropriatesurgical management and result in ischemic necrosis of the bowel.Preterm labor,specific prenatal sonographicfindings (for example,the coffee bean sign) and bluishdiscoloration of the abdominal wall could suggestintrauterine midgut volvulus requiring prompt surgicalintervention.

  12. Genetic progress and potential of common bean families obtained by recurrent selection

    Directory of Open Access Journals (Sweden)

    Anatércia Ferreira Alves

    2015-12-01

    Full Text Available The objective of this study was to estimate the genetic gain of two recurrent selection cycles in common bean breeding and identify families with the potential to generate superior lines. The base population, cycle zero (C0, was obtained by combining 20 carioca bean parents, populations with favorable phenotypes for several agronomically important traits. The parents were recombined in a circulant diallel scheme, in which each parent participated in two crosses, generating 20 populations. From these populations, families were derived and evaluated for three seasons in the generations F2:3, F2:4 and F2:5. The same procedures of recombination and evaluation in C0 were performed in cycle one (CI. The genetic gain for yield, estimated from the simultaneous evaluation of the 40 best families of each cycle, was 8.6%. Families with potential to generate superior lines to cultivar Pérola were identified, especially among the CI families.

  13. Influence of the composition of common bean extracts on their coagulation ability

    Directory of Open Access Journals (Sweden)

    Kukić Dragana V.

    2011-01-01

    Full Text Available Coagulation and flocculation are the most used methods for removal of turbidity of water. Recently, many studies have focused on the investigation of natural coagulants for this purpose. In view of the fact that extracts of common bean have coagulation activity, this study is concerned with the chemical composition of these extracts and their influence on the coagulation activity. Extraction was conducted with distilled water, 0.5M NaCl and 1M NaCl and total sugars content, proteins, phytic acid and total phenolics content and their coagulation activity were determined in the obtained extracts. These experiments confirmed that an extraction time of 10 minutes is sufficient for the extraction of active coagulant components from common bean seeds and that water is satisfactorily efficient and most economical solvent.

  14. Motor effects of broad beans (Vicia faba) in Parkinson's disease: single dose studies.

    Science.gov (United States)

    Kempster, P A; Bogetic, Z; Secombei, J W; Martin, H D; Balazs, N D; Wahlqvist, M L

    1993-06-01

    Broad beans (Vicia faba) are a natural source of L-dopa. To investigate a possible role for this substance in the treatment of Parkinsonian motor oscillations, we carried out single dose studies of Vicia faba pod mixture plus carbidopa in six patients. Motor responses of equivalent magnitude to those of conventional L-dopa medication occurred in five cases with mean onset of 39 min and mean duration of 104 min. Vicia faba meals produced comparable L-dopa blood levels to fasting standard tablet doses and recovery studies yielded 0.25% L-dopa per weight of bean pod mixture. Vicia faba contains sufficient L-dopa to be pharmacologically active in patients with Parkinson's disease and can potentially be incorporated into dietary strategies to manage Parkinsonian motor oscillations.

  15. Yield response of red kidney bean Phaseolus vulgaris to incremental ozone concentrations in the field

    Energy Technology Data Exchange (ETDEWEB)

    Kohut, R.; Laurence, J.A.

    1983-01-01

    Field-grown red kidney beans were exposed to incremental levels of ozone in open-top chambers for 21 days during pod filling. Treatments consisted of ambient plots without chambers, chambers receiving charcoal-filtered air and chambers receiving non-filtered air to which either 0.00, 0.03, 0.06 or 0.09 ppm O/sub 3/ was added for 7 h each day. The addition of 0.06 or 0.09 ppm O/sub 3/ produced foliar injury, extensive defoliation and reductions in per plant bean yield of 24 and 27%, respectively. Regression analysis indicated a significant linear relationship between the 7-h mean O/sub 3/ concentration and yield per plant. This relationship was expressed as: Yield = 17.44 - 35.51 (CONC).

  16. Oligopolistic differentiation of the Colombian green bean coffee in the US market

    Directory of Open Access Journals (Sweden)

    Andrés Julián Rendón Cardona

    2013-06-01

    Full Text Available New Empirical Industrial Organization (NEIO literature notes that imperfect foreign competition among commodities may be characterized by prices, quantities and product differentiation. This paper shows that the effectiveness of the differentiation strategy of Colombian green bean coffee in the US market has caused Colombia to compete in terms of quantities with its major opponent, Brazil. In order to show it, this paper brings a set of models which allow us to identify the competitive structure followed by Brazil and Colombia in the United States market of green bean coffee imports. These models are evaluated through a likelihood ratio test to determine which of them best explains the data. Stackelberg is the best model showing Brazil’s leadership in terms of quantities.

  17. Effect of nitroxin and humic acid on yield and yield components of faba bean

    Directory of Open Access Journals (Sweden)

    Kholdi Abolfazl

    2015-01-01

    Full Text Available Quality and quantity improvement of crops using organic matter and low-cost method in the field is very important. Bio-fertilizer nitroxin and humic acid can increase root and shoot biomass through improved intake of nutrition and they can lead to quality and quantity improvement of product. An experiment was carried out as a completely randomized block design with 4 treatments to study the effect of nitroxin and humic acid on faba bean (Vicia faba L. traits. Trial treatments included control, nitroxin, humic acid and nitroxin + humic acid. Analysis of variance showed that the effect of combination of nitroxin + humic acid was significant (p< 1% on some traits such as stem height and yield of faba bean. The highest yield (2,315 kg ha-1 was obtained under nitroxin + humic acid treatment.

  18. Fate of allelopathic substances in space--allelopathy of velvet bean plant and gravity.

    Science.gov (United States)

    Tomita-Yokotani, Kaori; Hashimoto, Hirofumi; Fujii, Yoshiharu; Nakamura, Teruko; Yamashita, Masamichi

    2004-11-01

    Interactions between organisms and species have been long known. It has not been known that the interactive phenomena (allelopathy) may (or may not) differ in space from those on earth. We have studied the gravitational effects on allelopathy by exposing a plant-plant system to pseudo-microgravity, which was generated by a 3D-clinostat. We hypothesized that allelopathy would be modified under altered gravity. L-DOPA (L-3,4-dihydroxyphenylalanine) is known to be the major substance in the allelopathy of velvet bean, released from its root. It has been found that there have been some differences of the allelopathic action of velvet bean plant under pseudo-microgravity. Biosynthesis, release, transport and sensing mechanism associated with allelopathy might be affected by gravity.

  19. Space distribution of a weed seedbank in a bean cultivation area

    Directory of Open Access Journals (Sweden)

    Jefferson Luis Meirelles Coimbra

    2009-12-01

    Full Text Available The objective of this work was to elucidate the characteristics of space distribution of a weed seedbank in order to assist in decision-making for the adoption of management techniques applied to an area under bean monoculture. Agricultural precision tools, as well as techniques of geostatistic analysis, were utilized. The samples were composed of 24 soil samples from georeferenced points, within a quadratic mesh consisting of 20x20 meter cells. The samples of soil were conditioned in plastic trays to provide ideal conditions for seed germination. Some samples presented a potential weed infestation of about 8000 plants m-2 constituting a problem for bean cultivation, disfavoring its development and grain yield.

  20. Stability of ochratoxin A (OTA) during processing and decaffeination in commercial roasted coffee beans.

    Science.gov (United States)

    Nehad, E A; Farag, M M; Kawther, M S; Abdel-Samed, A K M; Naguib, K

    2005-08-01

    The fate of ochratoxin A (OTA) during the processing of artificially contaminated green coffee beans, the effect of decaffeination on the production of OTA in green and roasted coffee beans, and the effect of caffeine on the growth and OTA production by Aspergillus ochraceus were studied. The data indicated that the roasting, milling and decoction (brewing and Turkish coffee making) processes caused different percentage reductions in OTA. Decaffeinated samples showed a significantly higher concentration of OTA production than the caffeinated ones. A significantly higher percentage of OTA was reduced when the decaffeination process was performed before roasting treatment. Caffeine at 1.0 and 2.0% concentrations completely prevented OTA production and completely inhibited A. ochraceus growth in YES medium after 3-21 days.