WorldWideScience

Sample records for beans

  1. Peppery Hot Bean Curd

    Institute of Scientific and Technical Information of China (English)

    1997-01-01

    Peppery Hot Bean Curd is a famous dish that originated in Chengdu,Sichuan Province.Dating back to the year under the reign of Emperor Tongzhi during the Qing Dynasty(1862-1875),a woman chef named Chen created this dish.In Chinese it is called Mapo Bean Curd. Ingredients:Three pieces of bean curd,100 grams lean pork,25 grams green soy beans or garlic

  2. Baked Bean Curd

    Institute of Scientific and Technical Information of China (English)

    1996-01-01

    Ingredients: Two pieces of tender bean curd, shredded shrimp, minced fat and lean pork, minced ham, minced fresh mushrooms, fried dried shrimps, mashed scallion, ginger and garlic, cooking wine, salad oil, salt, MSG and pepper powder. Directions:

  3. Faba bean in cropping systems

    DEFF Research Database (Denmark)

    Steen Jensen, Erik; Peoples, Mark B.; Hauggaard-Nielsen, Henrik

    2010-01-01

    The grain legume (pulse) faba bean (Vicia faba L.) is grown world-wide as a protein source for food and feed. At the same time faba bean offers ecosystem services such as renewable inputs of nitrogen (N) into crops and soil via biological N2 fixation, and a diversification of cropping systems. Even...... though the global average grain yield has almost doubled during the past 50 years the total area sown to faba beans has declined by 56% over the same period. The season-to-season fluctuations in grain yield of faba bean and the progressive replacement of traditional farming systems, which utilized...... legumes to provide N to maintain soil N fertility, with industrialized, largely cereal-based systems that are heavily reliant upon fossil fuels (=N fertilizers, heavy mechanization) are some of the explanations for this decline in importance. Past studies of faba bean in cropping systems have tended...

  4. Healthy food trends -- beans and legumes

    Science.gov (United States)

    ... peas, and lentils are all types of legumes. Vegetables such as beans and other legumes are an important source of protein. They are a key food in healthy diets and have many benefits. Beans, lentils, and ...

  5. Epidemiology of bean rust in Ethiopia.

    NARCIS (Netherlands)

    Habtu Assefa,

    1994-01-01

    Field and greenhouse experiments were conducted to study the epidemiology of rust ( Uromyces appendiculatus ) on beans ( Phaseolus vulgaris L.) in Ethiopia. The experiments were conducted under low input conditions reflecting the traditional bean production practices. Surveys identified five major

  6. NetBeans IDE 8 cookbook

    CERN Document Server

    Salter, David

    2014-01-01

    If you're a Java developer of any level using NetBeans and want to learn how to get the most out of NetBeans, then this book is for you. Learning how to utilize NetBeans will provide a firm foundation for your Java application development.

  7. Chlorotic mottle of bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Jayasinghe, W.U.

    1982-01-01

    For the past years there have been outbreaks of a disease of bean ( Phaseolus vulgaris L.) in Colombia called bean chlorotic mottle. The etiology of bean chlorotic mottle was not known, but the disease was generally believed to be incited by the same whitefly-transmitted virus that causes variegatio

  8. Protein Quality of Irradiated Brazilian Beans

    Energy Technology Data Exchange (ETDEWEB)

    Delincee, Henry; Villavicencio, Anna-Lucia C.H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macacar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein ({approx}10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfestation process, without impairing the biological quality of the valuable bean protein.

  9. Protein Quality of Irradiated Brazilian Beans

    Science.gov (United States)

    Delincée, Henry; Villavicencio, Anna-Lucia C. H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macaçar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein (˜10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfection process, without impairing the biological quality of the valuable bean protein.

  10. Reflective Polyethylene Mulch Reduces Mexican Bean Beetle (Coleoptera: Coccinellidae) Densities and Damage in Snap Beans.

    Science.gov (United States)

    Nottingham, L B; Kuhar, T P

    2016-08-01

    Mexican bean beetle, Epilachna varivestis Mulsant, is a serious pest of snap beans, Phaseolus vulgaris L., in the eastern United States. These beetles are intolerant to direct sunlight, explaining why individuals are typically found on the undersides of leaves and in the lower portion of the plant canopy. We hypothesized that snap beans grown on reflective, agricultural polyethylene (plastic mulch) would have fewer Mexican bean beetles and less injury than those grown on black plastic or bare soil. In 2014 and 2015, beans were seeded into beds of metallized, white, and black plastic, and bare soil, in field plots near Blacksburg, VA. Mexican bean beetle density, feeding injury, predatory arthropods, and snap bean yield were sampled. Reflected light intensity, temperature, and humidity were monitored using data loggers. Pyranometer readings showed that reflected light intensity was highest over metallized plastic and second highest over white plastic; black plastic and bare soil were similarly low. Temperature and humidity were unaffected by treatments. Significant reductions in Mexican bean beetle densities and feeding injury were observed in both metallized and white plastic plots compared to black plastic and bare soil, with metallized plastic having the fewest Mexican bean beetle life stages and injury. Predatory arthropod densities were not reduced by reflective plastic. Metallized plots produced the highest yields, followed by white. The results of this study suggest that growing snap beans on reflective plastic mulch can suppress the incidence and damage of Mexican bean beetle, and increase yield in snap beans. PMID:27341891

  11. Transaction costs in beans market in Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Eterno Venâncio Assunção

    2015-05-01

    Full Text Available This paper aimed to evaluate the presence of transaction costs in the beans market in Brazil. Therefore, threshold autoregressive (TAR models were used to check co-integration and the existence of transaction costs in the Brazilian beans market. The results confirmed the presence of transaction costs in the beans market, which are mainly related to the freight component of production, since the markets are often far away from the producing regions.

  12. Kinetics model development of cocoa bean fermentation

    Science.gov (United States)

    Kresnowati, M. T. A. P.; Gunawan, Agus Yodi; Muliyadini, Winny

    2015-12-01

    Although Indonesia is one of the biggest cocoa beans producers in the world, Indonesian cocoa beans are oftenly of low quality and thereby frequently priced low in the world market. In order to improve the quality, adequate post-harvest cocoa processing techniques are required. Fermentation is the vital stage in series of cocoa beans post harvest processing which could improve the quality of cocoa beans, in particular taste, aroma, and colours. During the fermentation process, combination of microbes grow producing metabolites that serve as the precursors for cocoa beans flavour. Microbial composition and thereby their activities will affect the fermentation performance and influence the properties of cocoa beans. The correlation could be reviewed using a kinetic model that includes unstructured microbial growth, substrate utilization and metabolic product formation. The developed kinetic model could be further used to design cocoa bean fermentation process to meet the expected quality. Further the development of kinetic model of cocoa bean fermentation also serve as a good case study of mixed culture solid state fermentation, that has rarely been studied. This paper presents the development of a kinetic model for solid-state cocoa beans fermentation using an empirical approach. Series of lab scale cocoa bean fermentations, either natural fermentations without starter addition or fermentations with mixed yeast and lactic acid bacteria starter addition, were used for model parameters estimation. The results showed that cocoa beans fermentation can be modelled mathematically and the best model included substrate utilization, microbial growth, metabolites production and its transport. Although the developed model still can not explain the dynamics in microbial population, this model can sufficiently explained the observed changes in sugar concentration as well as metabolic products in the cocoa bean pulp.

  13. Yeasts are essential for cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2014-03-17

    Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics.

  14. Weed management strategies for castor bean crops

    Directory of Open Access Journals (Sweden)

    Augusto Guerreiro Fontoura Costa

    2014-04-01

    Full Text Available Castor bean crops are agriculturally relevant due to the quality and versatility of their oil, both for the chemical industry and for biodiesel production. Proper weed management is important for both the cultivation and the yield of castor bean crops; therefore, the intention of the present work is to review pertinent information regarding weed management, including the studies regarding weed interference periods, chemical controls for use in different crop production systems and herbicide selectivity, for castor bean crops. Weed science research for castor bean crops is scarce. One of the main weed management challenges for castor bean crops is the absence of herbicides registered with the Ministry of Agriculture, Livestock and Food Supply (MALFS. Research for viable herbicides for weed control in castor bean crops should be directed by research and/or rural extension institutions, associations and farmers cooperatives, as well as by manufactures, for the registration of these selective herbicides, which would be primarily used to control eudicotyledons in castor bean crops. New studies involving the integration of weed control methods in castor bean also may increase the efficiency of weed management, for both small farmers using traditional crop methods in the Brazilian Northeast region, as well as for areas with the potential for large scale production, using conservation tillage systems, such as the no-tillage crop production system.

  15. Common beans, diseases: ecology and control

    Science.gov (United States)

    Common bean, Phaseolus vulgaris, is one of the most important edible legume crops worldwide, nutritionally and economically. Diseases caused by pathogens that affect beans can have catastrophic effects, destroying entire crops in some instances. There are more than 200 pathogens (bacterial, fungal,...

  16. Performance of the Bean-protein Fiber

    Institute of Scientific and Technical Information of China (English)

    韩光亭; 杜宁; 孙亚宁

    2003-01-01

    The methods in testing the bean-protein fiber and the standards used were simply introduced. The fiber's mechanical and chemical performances were further analyzed. And the correlative performance of the bean-protein fibers and other natural fibers have been compared, then full knowledge of the fiber's performance was concluded.

  17. Nutritional and health benefits of dried beans.

    Science.gov (United States)

    Messina, Virginia

    2014-07-01

    Dried beans (often referred to as grain legumes) may contribute to some of the health benefits associated with plant-based diets. Beans are rich in a number of important micronutrients, including potassium, magnesium, folate, iron, and zinc, and are important sources of protein in vegetarian diets. In particular, they are among the only plant foods that provide significant amounts of the indispensable amino acid lysine. Commonly consumed dried beans are also rich in total and soluble fiber as well as in resistant starch, all of which contribute to the low glycemic index of these foods. They also provide ample amounts of polyphenols, many of which are potent antioxidants. Intervention and prospective research suggests that diets that include beans reduce low-density lipoprotein cholesterol, favorably affect risk factors for metabolic syndrome, and reduce risk of ischemic heart disease and diabetes. The relatively low bean intakes of North Americans and northern Europeans can be attributed to a negative culinary image as well as to intestinal discomfort attributable to the oligosaccharide content of beans. Cooking practices such as sprouting beans, soaking and discarding soaking water before cooking, and cooking in water with a more alkaline pH can reduce oligosaccharide content. Promotional efforts are needed to increase bean intake. PMID:24871476

  18. Enterprise JavaBeans 31

    CERN Document Server

    Rubinger, Andrew

    2010-01-01

    Learn how to code, package, deploy, and test functional Enterprise JavaBeans with the latest edition of this bestselling guide. Written by the developers of JBoss EJB 3.1, this book not only brings you up to speed on each component type and container service in this implementation, it also provides a workbook with several hands-on examples to help you gain immediate experience with these components. With version 3.1, EJB's server-side component model for building distributed business applications is simpler than ever. But it's still a complex technology that requires study and lots of practi

  19. Key odorants in cured Madagascar vanilla beans (Vanilla planiforia) of differing bean quality.

    Science.gov (United States)

    Takahashi, Makoto; Inai, Yoko; Miyazawa, Norio; Kurobayashi, Yoshiko; Fujita, Akira

    2013-01-01

    The odor-active volatiles in Madagascar vanilla beans (Vanilla planiforia) of two grades, red whole beans as standard quality and cuts beans as substandard quality, were characterized by instrumental and sensory analyses. The higher contents of vanillin and β-damascenone in red whole beans than in cuts beans respectively contributed to significant differences in the sweet and dried fruit-like notes, while the higher contents of guaiacol and 3-phenylpropanoic acid in cuts beans than in red whole beans respectively contributed to significant differences in the phenolic and metallic notes. A sensory evaluation to compare red whole beans and their reconstituted aroma characterized both samples as being similar, while in respect of the phenolic note, the reconstituted aroma significantly differed from the reconstituted aroma with guaiacol added at the concentration ratio of vanillin and guaiacol in cuts beans. It is suggested from these results that the concentration ratio of vanillin and guaiacol could be used as an index for the quality of Madagascar vanilla beans.

  20. 76 FR 68057 - Importation of French Beans and Runner Beans From the Republic of Kenya Into the United States

    Science.gov (United States)

    2011-11-03

    ... / Thursday, November 3, 2011 / Rules and Regulations#0;#0; ] DEPARTMENT OF AGRICULTURE Animal and Plant Health Inspection Service 7 CFR Part 319 RIN 0579-AD39 Importation of French Beans and Runner Beans From... importation of French beans and runner beans from the Republic of Kenya into the United States. As a...

  1. ISOLATED PROTEIN FROM CASTOR BEAN, PEANUT, SOY BEAN AND SAFFLOWER MEALS

    OpenAIRE

    B.Tavasolian; S.Nikpour; B.Makanvand

    1981-01-01

    Castor bean, peanut, Soy bean and safflower protein isolates were prepared. The amino acid content of each of the protein isolates was analysed and the essential amino acid contents were compared with the FAO human requirements. The results indicated that castor bean has the highest oil and the protein content of defatted meal. Safflower 3148 (Marand, Iran) has the highest amount of essential amino acids. Peanut (Gilan Iran) has the lowest content of essential amino acids, however, in compari...

  2. Weed management strategies for castor bean crops

    OpenAIRE

    Augusto Guerreiro Fontoura Costa; Valdinei Sofiatti; Cleber Daniel de Góes Maciel; Juliana Parisotto Poletine; João Igor de Sousa

    2014-01-01

    Castor bean crops are agriculturally relevant due to the quality and versatility of their oil, both for the chemical industry and for biodiesel production. Proper weed management is important for both the cultivation and the yield of castor bean crops; therefore, the intention of the present work is to review pertinent information regarding weed management, including the studies regarding weed interference periods, chemical controls for use in different crop production systems and herbicide s...

  3. Java EE 7 development with NetBeans 8

    CERN Document Server

    Heffelfinger, David R

    2015-01-01

    The book is aimed at Java developers who wish to develop Java EE applications while taking advantage of NetBeans functionality to automate repetitive tasks. Familiarity with NetBeans or Java EE is not assumed.

  4. 21 CFR 184.1343 - Locust (carob) bean gum.

    Science.gov (United States)

    2010-04-01

    ...) bean gum is primarily the macerated endosperm of the seed of the locust (carob) bean tree, Ceratonia siliqua (Linne), a leguminous evergreen tree, with lesser quantities of seed coat and germ. (b)...

  5. Effect of cooking methods on selected physicochemical and nutritional properties of barlotto bean, chickpea, faba bean, and white kidney bean.

    Science.gov (United States)

    Güzel, Demet; Sayar, Sedat

    2012-02-01

    The effects of atmospheric pressure cooking (APC) and high-pressure cooking (HPC) on the physicochemical and nutritional properties of barlotto bean, chickpea, faba bean, and white kidney bean were investigated. The hardness of the legumes cooked by APC or HPC were not statistically different (P > 0.05). APC resulted in higher percentage of seed coat splits than HPC. Both cooking methods decreased Hunter "L" value significantly (P < 0.05). The "a" and "b" values of dark-colored seeds decreased after cooking, while these values tended to increase for the light-colored seeds. The total amounts of solid lost from legume seeds were higher after HPC compared with APC. Rapidly digestible starch (RDS) percentages increased considerably after both cooking methods. High pressure cooked legumes resulted in higher levels of resistant starch (RS) but lower levels of slowly digestible starch (SDS) than the atmospheric pressure cooked legumes.

  6. Effects of fermented soya bean on digestion, absorption and diarrhoea

    OpenAIRE

    Kiers, J.L.

    2001-01-01

    For many centuries Asian people have consumed soya beans in various forms of traditional fermented soya bean foods. Major desirable aspects of fermented soya bean foods are their attractive flavour and texture, certain nutritional properties, and possible health promoting effects. This study describes effects of fermented soya beans on gastrointestinal physiology and addresses digestion, absorption and diarrhoea.Using an in vitro digestion model it appeared that fermentation increased solubil...

  7. Examining growth, yield and bean quality of Ethiopian coffee trees

    OpenAIRE

    Bote, Adugna

    2016-01-01

    Coffee (Coffeaarabica L.)bean production and quality are determined by a diversity of interacting factors (e.g. shade, nitrogen, crop traits). Bean yield increases with increase in radiation, but adequate fertilizer suppliesare needed to sustain the productivity. This thesis analysed coffee tree growth, bean production and bean quality in relation to different degrees of exposure to radiation and nitrogen supply. Growth of leaves and branches and properties of leaves such as specific leaf are...

  8. Blanching of green bean (Phaseolus vulgaris).

    Science.gov (United States)

    Kaack, K

    1994-12-01

    Experiments with one and two steps blanching of green beans have been carried out. Inactivation of the peroxydase requires more heating than inactivation of the enzymes which gives rise to off flavour from aldehydes. When blanching for about one minute to inactivate lipoxygenase, aldehyde formation of flavour ceases. The content of vitamin C decreases during blanching according to a first order reaction. Since considerable loss of vitamin C occurs during blanching, the treatment time should be reduced to a minimum. During preblanching at 65-75 degrees C and final blanching, chlorophyll is degraded to pheophytin and the surface colour expressed by the Hunter-values (-a/b) increases with time which means that the colour of the beans changes from green to yellow. The firmness of beans, which was measured by use of a tenderometer, decreases during blanching according to a first order reaction with 40 kcal/mole activation energy. Preblanching at 65-75 degrees C increases the firmness of the beans linearly with treatment time. This increase in firmness is stable after final blanching at 95 degrees C and even after thawing of frozen beans.

  9. Evaluation of the recycle of nitrogen in a succession bean - corn -bean By means of the isotopic method

    International Nuclear Information System (INIS)

    To determine the recycle of Nitrogen in a succession bean - corn - bean a was developed I experience under field conditions, on Red Ferralitic soils (Rhodic Ferrasols) with the one I use of the stable isotope 15 Nitrogen

  10. Outbreaks of Chrysodeixis includens (Walker (Lepidoptera: Noctuidae in common bean and castor bean in São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    Edson Luiz Lopes Baldin

    2014-12-01

    Full Text Available Since 2009, increasing populations of Chrysodeixis includens (Walker (Lepidoptera: Noctuidae have been observed in cultivated common bean (Phaseolus vulgaris L. and castor bean (Ricinus communis L. at the Lageado Experimental Farm, belonging to the FCA/UNESP, Botucatu, São Paulo State, Brazil. Defoliations around 80% and 50% were observed in the common bean cv. Pérola and castor bean cv. IAC-2028, respectively. Samples of individuals (caterpillars and pupae were collected in the field, and kept in laboratory until adult emergence aiming to confirm the species. These are new observations for common bean in São Paulo State and, in the case of castor bean, unpublished in Brazil. It suggests that C. includens has adapted to attack other agricultural crops, demanding attention of common bean and castor bean producers.

  11. Effects of fermented soya bean on digestion, absorption and diarrhoea

    NARCIS (Netherlands)

    Kiers, J.L.

    2001-01-01

    For many centuries Asian people have consumed soya beans in various forms of traditional fermented soya bean foods. Major desirable aspects of fermented soya bean foods are their attractive flavour and texture, certain nutritional properties, and possible health promoting effects. This study describ

  12. 9 CFR 319.301 - Chili con carne with beans.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Chili con carne with beans. 319.301 Section 319.301 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... Dehydrated Meat Food Products § 319.301 Chili con carne with beans. Chili con carne with beans shall...

  13. New bean seeds and the struggle for their dissemination

    NARCIS (Netherlands)

    Almekinders, C.J.M.; Aguilar, E.; Herrera, R.

    2007-01-01

    The northern region of Nicaragua has always been an important bean and maize producing area. But a widespread presence of the Golden Mosaic Virus made it impossible to grow beans in the last years. A Participatory Plant Breeding programme started in 1999, aiming to develop new bean varieties that wo

  14. Methyl bromide residues in fumigated cocoa beans

    International Nuclear Information System (INIS)

    The 14C activity in unroasted [14C]-methyl bromide fumigated cocoa beans was used to study the fate and persistence of CH3Br in the stored beans. About 70% of the residues occurred in the shells. Unchanged CH3Br could not be detected, all the sorbed CH3Br having reacted with bean constituents apparently to form 14C-methylated derivatives and inorganic bromide. No 14C activity was found in the lipid fraction. Roasting decreased the bound (non-volatile) residues, with corresponding changes in the activities and amounts of free sugars, free and protein amino acids. Roasted nibs and shells showed a two-fold increase in the volatile fraction of the 14C residue. This fraction may be related to the volatile aroma compounds formed by Maillard-type reactions. (author)

  15. 76 FR 16700 - Importation of French Beans and Runner Beans From the Republic of Kenya Into the United States

    Science.gov (United States)

    2011-03-25

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF AGRICULTURE Animal and Plant Health Inspection Service 7 CFR Part 319 RIN 0579-AD39 Importation of French Beans and... regulations to allow the importation of French beans and runner beans from the Republic of Kenya into...

  16. Nitrogen mineralization in soils amended with sunnhemp, velvet bean and common bean residues

    Directory of Open Access Journals (Sweden)

    Ambrosano Edmilson José

    2003-01-01

    Full Text Available Nitrogen (15N released from sunnhemp (Crotalaria juncea, velvet bean (Mucuna aterrima and from Phaseolus bean residues was evaluated after incubation of the plant material in an Eutrudox and a Paleudalf, in a greenhouse experiment with pots containing 6 kg of air dried soil. Dry matter equivalent to 13 Mg ha-1 of Phaseolus bean residues and the same amount of above ground parts of the leguminous species, associated to 2.7 and 2.2 Mg ha-1 of roots of sunnhemp and velvet bean respectively, were incorporated into the soil. A completely randomized experimental design was adopted, with treatments arranged in a 2 3 + 1 factorial, replicated three times. The treatments were the following: two soils (Eutrudox and Paleudalf and three plant materials: two green-manures (sunnhemp or velvet bean, and Phaseolus bean residues, besides one control without plant incorporation into the soil. For the green-manure treatments there were two sub-treatments for each legume species, with 15N labeling of either shoots or roots. Soil moisture was maintained relatively constant during the experiment al period and the treatments were sampled weekly during 49 days. Total mineral nitrogen in the soil, as well as that derived from the legume plants were determined by isotope dilution. Nitrogen from the velvet bean accounted for a greater proportion of the soil inorganic N; shoots were responsible for most of N accumulated. Dry bean residues caused immobilization of inorganic N. The leguminous species added were intensively and promptly mineralized preserving the soil native nitrogen. Mineralization of the legume plant N was greater in the Paleudalf soil than in the Eutrudox.

  17. Nitrogen mineralization in soils amended with sunnhemp, velvet bean and common bean residues

    Energy Technology Data Exchange (ETDEWEB)

    Ambrosano, Edmilson Jose [Estacao Experimental de Agronomia de Piracicaba, SP (Brazil). Centro de Acao Regional; Trivelin, Paulo Cesar Ocheuze; Muraoka, Takashi [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil). Lab. de Isotopos Estaveis; Cantarella, Heitor [Instituto Agronomico de Campinas (IAC), SP (Brazil). Centro de Solos e Recursos Agroambientais; Ambrosano, Glaucia Maria Bovi [Universidade Estadual de Campinas, Piracicaba, SP (Brazil). Faculdade de Odontologia. Dept. de Odontologia Social e Bioestatistica

    2003-03-01

    Nitrogen ({sup 15}N) released from sunnhemp (Crotalaria juncea), velvet bean (Mucuna aterrima) and from Phaseolus bean residues was evaluated after incubation of the plant material in an Eutrudox and a Paleudalf, in a greenhouse experiment with pots containing 6 kg of air dried soil. Dry matter equivalent to 13 Mg ha{sup -1} of Phaseolus bean residues and the same amount of above ground arts of the leguminous species, associated to 2.7 and 2.2 Mg ha{sup -1} of roots of sunnhemp and velvet bean respectively, were incorporated into the soil. A completely randomized experimental design was adopted, with treatments arranged in a 2 x 3 + 1 factorial, replicated three times. The treatments were the following: two soils (Eutrudox and Paleudalf) and three plant materials: two green-manures (sunnhemp or velvet bean), and Phaseolus bean residues, besides one control without plant incorporation into the soil. For the green-manure treatments there were two sub-treatments for each legume species, with {sup 15}N labeling of either shoots or roots. Soil moisture was maintained relatively constant during the experimental period and the treatments were sampled weekly during 49 days. Total mineral nitrogen in the soil, as well as that derived from the legume plants were determined by isotope dilution. Nitrogen from the velvet bean accounted for a greater proportion of the soil inorganic N; shoots were responsible for most of N accumulated. Dry bean residues caused immobilization of inorganic N. The leguminous species added were intensively and promptly mineralized preserving the soil native nitrogen. Mineralization of the legume plant N was greater in the Paleudalf soil than in the Eutrudox. (author)

  18. Nitrogen mineralization in soils amended with sunnhemp, velvet bean and common bean residues

    International Nuclear Information System (INIS)

    Nitrogen (15N) released from sunnhemp (Crotalaria juncea), velvet bean (Mucuna aterrima) and from Phaseolus bean residues was evaluated after incubation of the plant material in an Eutrudox and a Paleudalf, in a greenhouse experiment with pots containing 6 kg of air dried soil. Dry matter equivalent to 13 Mg ha-1 of Phaseolus bean residues and the same amount of above ground arts of the leguminous species, associated to 2.7 and 2.2 Mg ha-1 of roots of sunnhemp and velvet bean respectively, were incorporated into the soil. A completely randomized experimental design was adopted, with treatments arranged in a 2 x 3 + 1 factorial, replicated three times. The treatments were the following: two soils (Eutrudox and Paleudalf) and three plant materials: two green-manures (sunnhemp or velvet bean), and Phaseolus bean residues, besides one control without plant incorporation into the soil. For the green-manure treatments there were two sub-treatments for each legume species, with 15N labeling of either shoots or roots. Soil moisture was maintained relatively constant during the experimental period and the treatments were sampled weekly during 49 days. Total mineral nitrogen in the soil, as well as that derived from the legume plants were determined by isotope dilution. Nitrogen from the velvet bean accounted for a greater proportion of the soil inorganic N; shoots were responsible for most of N accumulated. Dry bean residues caused immobilization of inorganic N. The leguminous species added were intensively and promptly mineralized preserving the soil native nitrogen. Mineralization of the legume plant N was greater in the Paleudalf soil than in the Eutrudox. (author)

  19. Virus diseases of peas, beans, and faba bean in the Mediterranean region.

    Science.gov (United States)

    Makkouk, Khaled; Pappu, Hanu; Kumari, Safaa G

    2012-01-01

    In the Mediterranean region, pea, bean, and faba bean production is affected by around 17 major viruses. These viruses do not have the same ecology and consequently require a variety of different preventive measures to control them. Some of these viruses have a narrow host range, such as Faba bean necrotic yellows virus (FBNYV), and others, such as Alfalfa mosaic virus (AMV) and Cucumber mosaic virus (CMV), a very wide host range. Such features are important when identifying sources of virus inoculum in a region, and the vectors can transmit viruses from natural reservoirs to the crop plants. Some of these viruses are seed borne and, consequently, can be disseminated long distances through infected seeds. Crop losses caused by these viruses are variable, depending on the sensitivity and susceptibility of the crop to infection. Host resistance genes have been identified for some of these viruses, but in others, such as FBNYV, no resistance genes in faba bean have been identified yet. Significant progress was made in developing precise methods for the identification of these viruses, and new virus problems are being identified every year. This chapter is not intended to be a review for pea, bean, and faba bean viruses, but rather focuses on the major viruses which affect these crops in the Mediterranean basin with focus on the progress made over the past two decades. PMID:22682174

  20. Beans (Phaseolus spp.) - model food legumes

    International Nuclear Information System (INIS)

    Globally, 800 million people are malnourished. Heavily subsidised farmers in rich countries produce sufficient surplus food to feed the hungry, but not at a price the poor can afford. Even donating the rich world's surplus to the poor would not solve the problem. Most poor people earn their living from agriculture, so a deluge of free food would destroy their livelihoods. Thus, the only answer to world hunger is to safeguard and improve the productivity of farmers in poor countries. Diets of subsistence level farmers in Africa and Latin America often contain sufficient carbohydrates (through cassava, corn/maize, rice, wheat, etc.), but are poor in proteins. Dietary proteins can take the form of scarce animal products (eggs, milk, meat, etc.), but are usually derived from legumes (plants of the bean and pea family). Legumes are vital in agriculture as they form associations with bacteria that 'fix-nitrogen' from the air. Effectively this amounts to internal fertilisation and is the main reason that legumes are richer in proteins than all other plants. Thousands of legume species exist but more common beans (Phaseolus vulgaris L.) are eaten than any other. In some countries such as Mexico and Brazil, beans are the primary source of protein in human diets. As half the grain legumes consumed worldwide are common beans, they represent the species of choice for the study of grain legume nutrition. Unfortunately, the yields of common beans are low even by the standards of legumes, and the quality of their seed proteins is sub-optimal. Most probably this results from millennia of selection for stable rather than high yield, and as such, is a problem that can be redressed by modem genetic techniques. We have formed an international consortium called 'Phaseomics' to establish the necessary framework of knowledge and materials that will result in disease-resistant, stress-tolerant, high-quality protein and high-yielding beans. Phaseomics will be instrumental in improving

  1. Common bean and cowpea improvement in Angola

    Science.gov (United States)

    During 2014 and 2015, the Instituto de Investigação Agronómica (IIA) evaluated the performance of common bean (Phaselolus vulgaris L.) breeding lines and improved cowpea (Vigna unguiculata L. Walp.) varieties. The field experiments were planted in the lowlands at Mazozo and in the highlands at Chian...

  2. Seed coat darkening in Cowpea bean

    Science.gov (United States)

    Seed coat of cowpea bean (Vigna unguiculata L. Walp) slowly browns to a darker color during storage. High temperature and humidity during storage might contribute to this color change. Variation in browning rate among seeds in a lot leads to a mixture of seed colors creating an unacceptable product...

  3. Castor bean response to zinc fertilization

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Henrique Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Zinc is a trace element and it is absolutely essential for the normal healthy growth of plants. This element plays a part of several enzyme systems and other metabolic functions in the plants. Castor beans (Ricinus communis L.) crop is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor beans yield, few researches has been made on this issue, mainly on the use of zinc. In order to evaluate the effects of zinc on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Zn (0; 2; 4; 6 and 8 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Under conditions that the experiment was carried out the results showed that the Zn levels used, did not affect the castor bean plants growth. (author)

  4. Synthesis of a jojoba bean disaccharide.

    Science.gov (United States)

    Kornienko, A; Marnera, G; d'Alarcao, M

    1998-08-01

    A synthesis of the disaccharide recently isolated from jojoba beans, 2-O-alpha-D-galactopyranosyl-D-chiro-inositol, has been achieved. The suitably protected chiro-inositol unit was prepared by an enantiospecific synthesis from L-xylose utilizing SmI2-mediated pinacol coupling as a key step.

  5. Zinc supplementation, production and quality of coffee beans

    Directory of Open Access Journals (Sweden)

    Herminia Emilia Prieto Martinez

    2013-04-01

    Full Text Available Besides its importance in the coffee tree nutrition, there is almost no information relating zinc nutrition and bean quality. This work evaluated the effect of zinc on the coffee yield and bean quality. The experiment was conducted with Coffea arabica L. in "Zona da Mata" region, Minas Gerais, Brazil. Twelve plots were established at random with 4 competitive plants each. Treatments included plants supplemented with zinc (eight plots and control without zinc supplementation (four plots. Plants were subjected to two treatments: zinc supplementation and control. Yield, number of defective beans, beans attacked by berry borers, bean size, cup quality, beans zinc concentration, potassium leaching, electrical conductivity, color index, total tritable acidity, pH, chlorogenic acids contents and ferric-reducing antioxidant activity of beans were evaluated. Zinc positively affected quality of coffee beans, which presented lower percentage of medium and small beans, lower berry borer incidence, lower potassium leaching and electrical conductivity, higher contents of zinc and chlorogenic acids and higher antioxidant activity in comparison with control beans.

  6. Safety assessment of the biogenic amines in fermented soya beans and fermented bean curd.

    Science.gov (United States)

    Yang, Juan; Ding, Xiaowen; Qin, Yingrui; Zeng, Yitao

    2014-08-01

    To evaluate the safety of biogenic amines, high performance liquid chromatography (HPLC) was used to evaluate the levels of biogenic amines in fermented soya beans and fermented bean curd. In fermented soya beans, the total biogenic amines content was in a relatively safe range in many samples, although the concentration of histamine, tyramine, and β-phenethylamine was high enough in some samples to cause a possible safety threat, and 8 of the 30 samples were deemed unsafe. In fermented bean curd, the total biogenic amines content was more than 900 mg/kg in 19 white sufu amples, a level that has been determined to pose a safety hazard; putrescine was the only one detected in all samples and also had the highest concentration, which made samples a safety hazard; the content of tryptamine, β-phenethylamine, tyramine, and histamine had reached the level of threat to human health in some white and green sufu samples, and that may imply another potential safety risk; and 25 of the 33 samples were unsafe. In conclusion, the content of biogenic amines in all fermented soya bean products should be studied and appropriate limits determined to ensure the safety of eating these foods.

  7. Safety assessment of the biogenic amines in fermented soya beans and fermented bean curd.

    Science.gov (United States)

    Yang, Juan; Ding, Xiaowen; Qin, Yingrui; Zeng, Yitao

    2014-08-01

    To evaluate the safety of biogenic amines, high performance liquid chromatography (HPLC) was used to evaluate the levels of biogenic amines in fermented soya beans and fermented bean curd. In fermented soya beans, the total biogenic amines content was in a relatively safe range in many samples, although the concentration of histamine, tyramine, and β-phenethylamine was high enough in some samples to cause a possible safety threat, and 8 of the 30 samples were deemed unsafe. In fermented bean curd, the total biogenic amines content was more than 900 mg/kg in 19 white sufu amples, a level that has been determined to pose a safety hazard; putrescine was the only one detected in all samples and also had the highest concentration, which made samples a safety hazard; the content of tryptamine, β-phenethylamine, tyramine, and histamine had reached the level of threat to human health in some white and green sufu samples, and that may imply another potential safety risk; and 25 of the 33 samples were unsafe. In conclusion, the content of biogenic amines in all fermented soya bean products should be studied and appropriate limits determined to ensure the safety of eating these foods. PMID:25029555

  8. Ion beam analysis of ground coffee and roasted coffee beans

    Energy Technology Data Exchange (ETDEWEB)

    Debastiani, R., E-mail: rafa_debas@yahoo.com.br; Santos, C.E.I. dos; Yoneama, M.L.; Amaral, L.; Dias, J.F.

    2014-01-01

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans.

  9. Antioxidant activity of black bean (Phaseolus vulgaris L. protein hydrolysates

    Directory of Open Access Journals (Sweden)

    Jarine Amaral do EVANGELHO

    2016-01-01

    Full Text Available Abstract The objective of this work was to study the effect of enzymatic hydrolysis of black bean protein concentrate using different enzymes. Bean proteins were extracted and hydrolyzed over a period of 120 min using the enzymes pepsin or alcalase. The protein hydrolysates’ molecular weight was assayed by electrophoresis and the antioxidant activity was evaluated by the capturing methods of free radicals ABTS●+ and DPPH. Electrophoretic results showed that the bands above 50 kDa disappeared, when the beans protein was subjected to hydrolysis with pepsin. The bean protein hydrolysate obtained by hydrolysis with alcalase enzyme, showed higher antioxidant activity for inhibition of the radical ABTS●+. However, the hydrolysates obtained by hydrolysis with pepsin had higher antioxidant activity for inhibition of the radical DPPH. The use of pepsin and alcalase enzymes, under the same reaction time, produced black bean protein hydrolysates with different molecular weight profiles and superior antioxidant activity than the native bean protein.

  10. Ion beam analysis of ground coffee and roasted coffee beans

    International Nuclear Information System (INIS)

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans

  11. Removal of antinutritional factors from bean (Phaseolus vulgaris L.) seeds

    OpenAIRE

    Bollini R.; Carnovale E.; Campion B.

    1999-01-01

    Phytohemagglutinin and the lectin-related proteins present in bean seeds are toxic to monogastric animals and lower the nutritional value of beans. Since these antimetabolites are present in substantial amounts, a breeding program aimed to the removal ofphytohemagglutinin was developed. The character ""absence of phytohemagglutinin"" was transferred into a bean cultivar by backcrossing. The lines obtained maintained the agronomic performance of the recurrent parent. Preliminary results show t...

  12. Intermittent drying of beans in a spouted bed

    OpenAIRE

    de Oliveira, C A; S.C.S. Rocha

    2007-01-01

    Carioca beans are a highly nutritious grain, in terms of the amount of protein, iron and potassium as well as carbohydrates and fiber and as a source of vitamins. The moisture content of recently picked beans is too high for good preservation and storage, resulting in the need for drying before packaging. In this work, the drying of Carioca beans in a laboratory scale spouted bed under intermittent conditions of the drying air was experimentally analyzed. Experiments carried out consisted of ...

  13. Castor Bean Organelle Genome Sequencing and Worldwide Genetic Diversity Analysis

    OpenAIRE

    Rivarola, Maximo; Foster, Jeffrey T.; Chan, Agnes P.; Williams, Amber L.; Rice, Danny W; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M. J.; Khouri, Hoda M.; Beckstrom-Sternberg, Stephen M.; Allan, Gerard J; Keim, Paul; Ravel, Jacques

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and for...

  14. Effect of bean polyphenols on iron absorption in humans

    International Nuclear Information System (INIS)

    Iron deficiency and iron deficiency anaemia are major public health problems in many developing countries. Common beans are a staple food in various Eastern African countries. Beans contain high amounts of iron, but the iron is poorly absorbed due to the presence of the iron absorption inhibitors polyphenols and phytic acid. With the overall aim of increasing the intake of bioavailable iron from beans by plant breeding strategies, this study evaluates the importance bean polyphenols on iron absorption. In common beans the polyphenols are concentrated in the bean hulls. Therefore bean hulls were used as a source of natural bean polyphenols and added in three different amounts to a non-inhibitory test meal (phytic acid free bread rolls). Iron absorption from the test meals was measured in three groups of 16 apparently healthy female volunteers using stable iron isotope techniques. Each volunteer consumed a test meal with and a test meal without bean polyphenols extrinsically labeled with 57Fe and 58Fe respectively. Iron absorption was determined based on the incorporation of iron stable isotopes into red blood cells 14 days after administration. Isotopic analysis was performed by thermal ionization mass spectrometry. The results of the absorption studies showed a dose dependent negative effect of bean polyphenols on iron absorption in humans. At the lowest polyphenol content tested (20 mg per test meal) no impact on iron absorption was found (p 0.92). A polyphenol content of 50 mg reduced the mean iron absorption significantly from 20.3% to 17.3% (p 0.044). The highest polyphenol content of 200 mg significantly reduced the mean iron absorption from 14.3% to 7.9% (p 0.0001). Further studies are planned to evaluate the relative effect of polyphenols and phytic acid on iron absorption from beans to provide guidance for breeding beans with improved iron bioavailability. (author)

  15. Nutritional characteristics of biofortified common beans

    Directory of Open Access Journals (Sweden)

    Priscila Brigide

    2014-09-01

    Full Text Available Iron and zinc deficiency can cause anemia and alterations in the immune response and impair work capacity. To minimize this problem, biofortification has been developed to improve and/or maintain the nutritional status of the population. Beans are an important source of carbohydrates, proteins, and minerals. The objective of this study is to characterize biofortified beans, quantify the minerals in different cultivars, and determine mineral dialysis. Grains of raw and cooked beans were analyzed for moisture, protein, lipids, fiber, minerals, and in vitro availability using four treatments and one control. The data were analyzed using ANOVA, and the Tukey test (p<0.05. The chemical composition of the raw and cooked treatments showed a moisture content ranging from 13.4 to 81.4%, protein from 22.24 to 31.59%, lipids from 1.66 to 2.22%, fiber from 16.81 to 40.63%, carbohydrates from 27.80 to 34.78%, and ash from 4.1 to 4.82%. Different varieties of beans showed statistically significant differences in iron and zinc content compared to the control cultivar (Pérola. The iron content differed significantly from that of the Pérola cultivar in the raw treatment, while in the cooked treatment, the control cultivar did not differ from the Piratã. The same behavior was observed for the zinc content in both treatments. There was no significant difference between the cultivars in the treatments in terms of the content of the dialysis of Calcium (Ca, Iron (Fe, Magnesium (Mg, and Zinc (Zn.

  16. Elemental characterization of Brazilian beans using neutron activation analysis

    International Nuclear Information System (INIS)

    Beans are important for many developing countries as a source of protein and mineral nutrients. Here, ten commercial types of Brazilian beans, from the species Phaseolus vulgaris (common beans) and Vigna unguiculata (cowpeas), were analyzed by neutron activation analysis for the determination of Br, Ca, Co, Cs, Fe, K, Mo, Na, Rb, Sc and Zn. There were statistical differences (p/0.05) amongst the commercial types, except for Br, Rb and Sc. In general, non-essential elements showed high variability, indicating that the origin of beans had a strong influence on the mass fraction of such elements. (author)

  17. Pb-210 in beans grown in normal background environments

    Energy Technology Data Exchange (ETDEWEB)

    Mingote, Raquel M.; Nogueira, Regina A., E-mail: mingote@cnen.gov.br, E-mail: rnogueira@cnen.gov.br [Centro Regional de Ciencias Nucleares do Centro-Oeste (CRCN-CO/CNEN-GO), Abadia de Goias, GO (Brazil)

    2013-07-01

    A survey was carried out on the activity concentration of {sup 210}Pb in common beans (Phaseolus vulgaris L.) grown in normal background environments in Brazil. The Carioca beans and the black type were analyzed, which contribute with 90% of the Brazilian market share of the common beans. To this study 18 bean samples sowing in the Middle-Western and Southern regions of Brazil during the years 2010-2011 were analyzed. The proportion per bean type was similar to the national production: most of the Carioca beans (n=13; 72%) and black beans (n=5; 28%). Other 17 values of {sup 210}Pb activity concentration in beans grown in Southeastern region available in the GEORAD, a dataset of radioactivity in Brazil, were added to the statistic analysis of the data. Considering the information contained in censored observations (60%), representative value of {sup 210}Pb activity concentration in beans was estimated by using robust ROS, a censored data analysis method. The value 0.047 Bq kg{sup -1} fresh wt. obtained here is according to {sup 210}Pb activity concentration in grains reported by UNSCEAR 0.05 Bq kg{sup -1}. (author)

  18. The Effective Design of Bean Bag as a Vibroimpact Damper

    Directory of Open Access Journals (Sweden)

    A.Q. Liu

    2000-01-01

    Full Text Available The technique of a bean bag damper has been effectively applied in many engineering fields to control the vibroimpact of a structural system. In this study, the basic parameters responsible for the design of an effective bean bag: the size of beans, the mass ratio of the bean bag to the structure to which it is attached, the clearance distance and the position of the bag, are studied by both theoretical and experimental analyses. These will provide a better understanding of the performance of the bean bag for optimisation of damper design. It was found that reducing the size of beans would increase the exchange of momentum in the system due to the increase in the effective contact areas. Within the range of mass ratios studied, the damping performance of the damper was found to improve with higher mass ratios. There was an optimum clearance for any specific damper whereby the maximum attenuation could be achieved. The position of the bag with respect to nodes and antipodes of the primary structure determined the magnitude of attenuation attainable. Furthermore, the limitations of bean bags have been identified and a general criteria for the design of a bean bag damper has been formulated based on the study undertaken. It was shown that an appropriately configured bean bag damper was capable of reducing the amplitude of vibration by 80% to 90%.

  19. The Moche Lima beans recording system, revisited

    Directory of Open Access Journals (Sweden)

    Tomi S. Melka

    2010-08-01

    Full Text Available One matter that has raised sufficient uncertainties among scholarsin the study of the Old Moche culture is a system that comprises patterned Lima beans. The marked beans, plus various associated effigies, appear painted by and large with a mixture of realism and symbolism on the surface of ceramic bottles and jugs, with many of them showing an unparalleled artistry in the great area of the South American subcontinent. A range of accounts has been offered as to what the real meaning of these items is: starting from a recreationaland/or a gambling game, to a divination scheme, to amulets, to an application for determining the length and order of funerary rites, to a device close to an accountancy and data storage medium, ending up with an ‘ideographic’, or even a ‘pre-alphabetic’ system.The investigation brings together structural, iconographic and cultural aspects, and indicates that we might be dealing with an original form of mnemotechnology, contrived to solve the problems of medium and long-distance communication among the once thriving Moche principalities. Likewise, by reviewing the literature, by searching for new material, and exploring the structure and combinatory properties of the marked Lima beans, as well as by placing emphasis on joint scholarly efforts, may enhance the studies.

  20. Antinutritional factors in anasazi and other pinto beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Weder, J K; Telek, L; Vozári-Hampe, M; Saini, H S

    1997-01-01

    Antinutritional factors of anasazi bean were compared to traditional pinto bean (Phaseolus vulgaris L.). Anasazi beans contained less (p0.05) in stachyose and raffinose content were found between the two bean types; verbascose was not detected at all. Significant (plectin content were observed between anasazi and pinto bean. The lectins of anasazi beans were classified as non toxic and those of the pinto beans as toxic types. No differences (p>0.05) in inhibitor activity against human and bovine trypsin and chymotrypsin were found between the two bean types. PMID:9527344

  1. Export and Competitiveness of Indonesian Coffee Bean in International Market: Strategic Implication for the Development of Organic Coffee Bean

    OpenAIRE

    Bambang Drajat; Adang Agustian; Ade Supriatna

    2007-01-01

    The performance of Indonesian coffee bean export from 1995 to 2004was not satisfactory. This implied that there were problems of the competitiveness of Indonesian coffee bean export. This study was expected to come up withsome views related with the problem. This study was aimed to analyze the competitiveness of Indonesian coffee bean export in international markets. Somepolicy implication would be derived following the conclusions. In addition,this study was aimed to deliver some arguments r...

  2. Impact of Long Dry Season on Bean Characteristics of Robusta Coffee (Coffea canephora

    Directory of Open Access Journals (Sweden)

    Ucu Sumirat

    2008-07-01

    Full Text Available Bean characteristics in Robusta coffee (Coffea canephora should be taken into considerations in coffee breeding. Beside genetic factor, environment has been known as an important factor in the formation and change of composition of bean characteristics. This research aimed to find out the effect of long dry season on changes of bean characteristics. The population observed consisted of 277 genotypes originated from reciprocal crossings of three parental namely BP 409, BP 961 and Q 121. Observation was conducted in Kaliwining Experimental Garden of ICCRI in Jember, East Java during two years with different drought intensity i.e. 2005—2006 and 2006—2007 production years. The result showed that long dry season decreased the range value of population of normal beans, pea beans and triage beans, and followed by decreasing in the mean value except for normal beans. Long dry season also influence the change of value range of empty bean to higher proportion, and followed by increasing in the mean value. Distribution pattern of normal beans tend in to remain at high proportion, in contrast to those of pea and triage beans. In other side, long dry season tended to change distribution pattern of empty beans to at high proportion. Correlation analysis among beans characteristics showed that normal beans had negative correlations with pea beans and empty beans. Pea beans had a positive correlation with empty beans. Long dry season decreased proportion of pea bean and triage bean, in contrast to those of empty beans. Increasing proportion of empty bean was caused by failure of growth to normal bean under stress condition. Key words : Coffee canephora, bean characteristics, long dry season, variation, correlation, composition.

  3. Pretreatment of African yam bean (Sphenostylis stenocarpa): effect of soaking and blanching on the quality of African yam bean seed.

    Science.gov (United States)

    Aminigo, Ebiokpo R; Metzger, Lloyd E

    2005-12-01

    The effect of pretreatment (soaking in sodium salts and blanching) on hydration coefficient (HC), chemical composition, texture, and color of African yam bean (AYB) was investigated. Soaking in water and in salt solutions increased the HC and about 90% of final HC values were attained at 12 and 4 hr of soaking for whole and dehulled beans, respectively. Protein content was slightly increased by soaking and blanching while ash and fat contents were reduced. Generally, a combination of dehulling and wet-processing reduced firmness of the beans more than soaking or blanching of the whole beans. Antioxidant activity was lowest (3260 TE(3)100 g) in cream-colored beans and highest (16,600 TE/100 g) in brown-colored beans. The tannin contents of unprocessed cream-colored beans and dehulled wet-processed marble variety were not significantly different (p > 0.05). The levels of tannins in the marble variety were reduced by blanching for 40 min (19.2%), soaking for 12 hr (16.0%), dehulling (72.0%), dehulling and blanching (88.8%). The whiteness of bean flours was increased significantly by dehulling, slightly by wet-processing of marble variety, and reduced significantly by wet-processing of cream-colored beans.

  4. Susceptibility of pea, horse bean and bean to viruses in dependence on the age of the inoculated plants

    OpenAIRE

    Władysław Błaszczak; Grażyna Ellmann-Wąsik; Renata Lesiak-Jerzyk

    2013-01-01

    Three cultivars of pea did not differ in their susceptibility to Cucumber Mosaic Virus (CMV) notwithstanding the age of the inoculated plants. But their susceptibility to infection with Bean Yellow Mosaic Virus (BYMV) differed. Horse bean cultivars 'Nadwiślański' and 'Major' proved to be less susceptible to Broad Bean True Mosaic Virus (BBTMV) when older plants were-inoculated. Two bean cultivars 'Złota Saxa' and 'Earle' appeared to be susceptible to BBTMV only in the phase of developing prim...

  5. Evaluation of Genetic Diversity of Castor Bean for Biodiesel Utilization

    Science.gov (United States)

    Castor bean (Ricinus communis L., 2n=20) is a cross-pollinated diploid species belonging to the family Euphorbiaceae instead of the Leguminosae. It is a native of Africa but may have originated in India. Castor bean plants grow as annual or perennial, depending on geographical locations, climate a...

  6. Root rots of common and tepary beans in Puerto Rico

    Science.gov (United States)

    Root rots are a disease complex affecting common bean and can be severe in bean growing areas in the tropics and subtropics. The presence of several pathogens makes it difficult to breed for resistance because of the synergistic effect of the pathogens in the host and the interaction of soil factors...

  7. The composition of wax and oil in green coffee beans

    NARCIS (Netherlands)

    Folstar, P.

    1976-01-01

    Methods for the isolation of wax and oil from green coffee beans were studied and a method for the quantitative extraction of coffee oil from the beans was introduced. Coffee wax, coffee oil and wax-free coffee oil as well as the unsaponifiable matter prepared from each were fractionated by column c

  8. Incentives for cocoa bean production in Ghana: Does quality matter?

    NARCIS (Netherlands)

    Quarmine, W.; Haagsma, R.; Sakyi-Dawson, O.; Asante, F.; Huis, van A.; Obeng-Ofori, D.

    2012-01-01

    This paper investigates the institutional factors that constrain farmers’ incentives to enhance the quality of cocoa beans in Ghana. Data were collected at three levels of aggregation in the cocoa bean value chain: village, district, and national level. Multi-stage cluster sampling was employed to s

  9. Examining growth, yield and bean quality of Ethiopian coffee trees

    NARCIS (Netherlands)

    Bote, Adugna

    2016-01-01

    Coffee (Coffeaarabica L.)bean production and quality are determined by a diversity of interacting factors (e.g. shade, nitrogen, crop traits). Bean yield increases with increase in radiation, but adequate fertilizer suppliesare needed to sustain the productivity. This thesis analysed coffee tree gro

  10. Occurrence and distribution of viruses infecting the bean in Serbia

    Directory of Open Access Journals (Sweden)

    Petrović Dragana

    2010-01-01

    Full Text Available This work describes the incidence and distribution of the most important bean viruses in Serbia: Bean common mosaic virus (BCMV, Bean common mosaic necrosis virus (BCMNV, Bean yellow mosaic virus (BYMV, Cucumber mosaic virus (CMV and Alfalfa mosaic virus (AMV. The viral isolates were characterized serologically and biologically. BCMV was found in the largest number of plants (30.53%, followed by BCMNV (2.67%, CMV (5.34%, and AMV (3.41%, since BYMV was not determined. Mixed viral infections were found in several samples. The RT-PCR method was used to prove that the tested isolates belong to the BCMV, family Potyviridae and strains Russian and NL-3 D. Results obtained in this work will enable further studies of the genetic variability of bean virus isolates from Serbia. .

  11. IRON, ZINC, AND FERRITIN ACCUMULATION IN COMMON BEANS

    DEFF Research Database (Denmark)

    Urbanski, Dorian Fabian; Sørensen, Kirsten; Jurkiewicz, Anna Malgorzata;

      that the distribution of iron is dependant on the genotype. Using immunolocalization, we visualized the localization of  ferritin in mature common bean seeds.   This knowledge can contribute to the discovery of factors that affect the bioavailability of micronutrients and  can contribute to breeding common beans....... A common nutritional base for poor populations is a staple such as maize, wheat, rice, potatoes, cassava, or beans, but many of these have low iron and zinc content as well as potent inhibitors of iron uptake. Nutritional supplements are often unavailable to such populations due to lacking infrastructure...... in common beans. We used micro-PIXE (Particle Induced X-ray Emission) and proton backscattering analysis to localize and quantify zinc and iron in mature bean seeds. In addition the iron distribution in different P. vulgaris genotypes was studied using Perl's Prussian blue staining. We show...

  12. Antioxidant Activity of Phenolic Compounds from Fava Bean Sprouts.

    Science.gov (United States)

    Okumura, Koharu; Hosoya, Takahiro; Kawarazaki, Kai; Izawa, Norihiko; Kumazawa, Shigenori

    2016-06-01

    Fava beans are eaten all over the world and recently, marketing for their sprouts began in Japan. Fava bean sprouts contain more polyphenols and l-3,4-dihydroxyphenylalanine (l-DOPA) than the bean itself. Our antioxidant screening program has shown that fava bean sprouts also possess a higher antioxidant activity than other commercially available sprouts and mature beans. However, the individual constituents of fava bean sprouts are not entirely known. In the present study, we investigated the phenolic compounds of fava bean sprouts and their antioxidant activity. Air-dried fava bean sprouts were treated with 80% methanol and the extract was partitioned in water with chloroform and ethyl acetate. HPLC analysis had shown that the ethyl acetate-soluble parts contained phenolic compounds, separated by preparative HPLC to yield 5 compounds (1-5). Structural analysis using NMR and MS revealed that the compounds isolated were kaempferol glycosides. All isolated compounds had an α-rhamnose at the C-7 position with different sugars attached at the C-3 position. Compounds 1-5 had β-galactose, β-glucose, α-rhamnose, 6-acetyl-β-galactose and 6-acetyl-β-glucose, respectively, at the C-3 position. The amount of l-DOPA in fava bean sprouts was determined by the quantitative (1) H NMR technique. The l-DOPA content was 550.45 mg ± 11.34 /100 g of the raw sprouts. The antioxidant activities of compounds 2-5 and l-DOPA were evaluated using the 2,2-diphenyl-1-picrylhydrazyl scavenging assay. l-DOPA showed high antioxidant activity, but the isolated kaempferol glycosides showed weak activity. Therefore, it can be suggested that l-DOPA contributed to the antioxidant activity of fava bean sprouts. PMID:27155370

  13. Immunochromatographic purification of Bean Yellow Mosaic Virus.

    Science.gov (United States)

    Bujarski, J J; Wiatroszak, I

    1981-01-01

    The method of immunoadsorptional purification of Bean Yellow Mosaic Virus has been worked out. Immunosorbents were obtained by coupling the antibody (IgG) fraction isolated from anti-BYMV and anti-pea leaf protein antisera with CNBr-activated 1% agarose beads. Conditions for preparation of immunosorbents, for BYMV adsorption and elution as well as the method of plant protein separation from BYMV were pointed out. The purity of BYMV was checked by double immunodiffusion as well as by SDS-acrylamide gel electrophoresis. Also biological activity was determined. TMV was used as the model virus for further BYMV studies. PMID:7025790

  14. Effects of bioprocessed antinutritional factors on bean protein quality, with special emphasis on Phaseolus vulgaris L.

    NARCIS (Netherlands)

    Savelkoul, F.H.M.G.

    1994-01-01

    Legumes, e.g. beans and peas, can contain antinutritional factors. Some varieties of faba beans (Vicia faba), soya beans (Glycine max ) and white kidney beans (Phaseolus vulgaris) can contain in their raw state antinutritional factors such as tannins, trypsin inhibitors and lectins respectively whic

  15. Proteomic analysis of common bean (Phaseolus vulgaris) by two-dimensional gel electrophoresis and mass spectrometry

    Science.gov (United States)

    The modern cultivated common bean (Phaseolus vulgaris) has evolved from wild common beans distributed in Central America, Mexico and the Andean region of South America. It has been reported that wild common bean accessions have higher levels of protein content than the domesticated dry bean cultiva...

  16. Low-Income US Women Under-informed of the Specific Health Benefits of Consuming Beans

    OpenAIRE

    Winham, Donna M; Armstrong Florian, Traci L.; Thompson, Sharon V.

    2016-01-01

    Background Bean consumption can reduce chronic disease risk and improve nutrition status. Consumer knowledge of bean health benefits could lead to increased intakes. Low-income women have poorer health and nutrition, but their level of knowledge about bean health benefits is unknown. Beans are a familiar food of reasonable cost in most settings and are cultural staples for Hispanics and other ethnicities. Study objectives were to assess awareness of bean health benefits among low-income women...

  17. Diversification and population structure in common beans (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Matthew W Blair

    Full Text Available Wild accessions of crops and landraces are valuable genetic resources for plant breeding and for conserving alleles and gene combinations in planta. The primary genepool of cultivated common beans includes wild accessions of Phaseolus vulgaris. These are of the same species as the domesticates and therefore are easily crossable with cultivated accessions. Molecular marker assessment of wild beans and landraces is important for the proper utilization and conservation of these important genetic resources. The goal of this research was to evaluate a collection of wild beans with fluorescent microsatellite or simple sequence repeat markers and to determine the population structure in combination with cultivated beans of all known races. Marker diversity in terms of average number of alleles per marker was high (13 for the combination of 36 markers and 104 wild genotypes that was similar to the average of 14 alleles per marker found for the 606 cultivated genotypes. Diversity in wild beans appears to be somewhat higher than in cultivated beans on a per genotype basis. Five populations or genepools were identified in structure analysis of the wild beans corresponding to segments of the geographical range, including Mesoamerican (Mexican, Guatemalan, Colombian, Ecuadorian-northern Peruvian and Andean (Argentina, Bolivia and Southern Peru. The combined analysis of wild and cultivated accessions showed that the first and last of these genepools were related to the cultivated genepools of the same names and the penultimate was found to be distinct but not ancestral to the others. The Guatemalan genepool was very novel and perhaps related to cultivars of race Guatemala, while the Colombian population was also distinct. Results suggest geographic isolation, founder effects or natural selection could have created the different semi-discrete populations of wild beans and that multiple domestications and introgression were involved in creating the diversity of

  18. Removal of antinutritional factors from bean (Phaseolus vulgaris L. seeds

    Directory of Open Access Journals (Sweden)

    Bollini R.

    1999-01-01

    Full Text Available Phytohemagglutinin and the lectin-related proteins present in bean seeds are toxic to monogastric animals and lower the nutritional value of beans. Since these antimetabolites are present in substantial amounts, a breeding program aimed to the removal ofphytohemagglutinin was developed. The character ""absence of phytohemagglutinin"" was transferred into a bean cultivar by backcrossing. The lines obtained maintained the agronomic performance of the recurrent parent. Preliminary results show that removal of phytohemagglutinin results in a higher true protein digestibility. Further modification in the composition of the lectin-related protein family is now under way.

  19. The Paleobiolinguistics of the Common Bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Cecil H. Brown

    2014-10-01

    Full Text Available Paleobiolinguistics is used to determine when and where the common bean (Phaseolus vulgaris L. developed significance for prehistoric groups of Native America. Dates and locations of proto-languages for which common bean terms reconstruct generally accord with crop-origin and dispersal information from plant genetics and archaeobotany. Paleobiolinguistic and other lines of evidence indicate that human interest in the common bean became significant primarily with the widespread development of a village‐farming way of life in the New World rather than earlier when squash and maize and a few other crops became important.

  20. Advances in Faba Bean Genetics and Genomics.

    Science.gov (United States)

    O'Sullivan, Donal M; Angra, Deepti

    2016-01-01

    Vicia faba L, is a globally important grain legume whose main centers of diversity are the Fertile Crescent and Mediterranean basin. Because of its small number (six) of exceptionally large and easily observed chromosomes it became a model species for plant cytogenetics the 70s and 80s. It is somewhat ironic therefore, that the emergence of more genomically tractable model plant species such as Arabidopsis and Medicago coincided with a marked decline in genome research on the formerly favored plant cytogenetic model. Thus, as ever higher density molecular marker coverage and dense genetic and even complete genome sequence maps of key crop and model species emerged through the 1990s and early 2000s, genetic and genome knowledge of Vicia faba lagged far behind other grain legumes such as soybean, common bean and pea. However, cheap sequencing technologies have stimulated the production of deep transcriptome coverage from several tissue types and numerous distinct cultivars in recent years. This has permitted the reconstruction of the faba bean meta-transcriptome and has fueled development of extensive sets of Simple Sequence Repeat and Single Nucleotide Polymorphism (SNP) markers. Genetics of faba bean stretches back to the 1930s, but it was not until 1993 that DNA markers were used to construct genetic maps. A series of Random Amplified Polymorphic DNA-based genetic studies mainly targeted at quantitative loci underlying resistance to a series of biotic and abiotic stresses were conducted during the 1990's and early 2000s. More recently, SNP-based genetic maps have permitted chromosome intervals of interest to be aligned to collinear segments of sequenced legume genomes such as the model legume Medicago truncatula, which in turn opens up the possibility for hypotheses on gene content, order and function to be translated from model to crop. Some examples of where knowledge of gene content and function have already been productively exploited are discussed. The

  1. Heat-Induced Structural Changes in Faba Bean Starch Paste: The Effect of Steaming Faba Bean Seeds

    OpenAIRE

    Kaczynska, B.; Autio, K.; J. Fornal

    1993-01-01

    Heat-induced structural changes of faba bean starch dispersions were examined at a concentration range of 8-10% as a function of heat treatment. Faba bean starch was isolated from raw (RF-starch) and steamed (SF-starch) faba bean seeds. Hydrothermal treatment resulted in an increase in the amount of non-starch components in the isolated starch. Microstructure of low-sheared 8% starch suspensions heated at 75, 90 and 98°C (for 10 minutes) was studied by light microscopy. Heating induced huge s...

  2. Emulsification properties of soy bean protein

    Directory of Open Access Journals (Sweden)

    WENPU CHEN

    2014-12-01

    Full Text Available Chen W, Li X, Rahman MRT, Al-Hajj NQM, Dey KC, Raqib SM. 2014. Emulsification properties of soy bean protein. Nusantara Bioscience 6: 196-202. Emulsion stability and emulsifying ability are two important factors in food industry. Soy protein has the great of interest because of its amphilic structure. β-Conglycinnin and glycinin are main components in soy protein which can be used as emulsifiers in food processing. However, due to its size and molecular weight, the emulsifying ability of soy protein is limited. By chemical, physical and enzymatic modification, the emulsifying ability of soy protein can be improved. The addition of polysaccharides in emulsion is common. The interaction of polysaccharides and proteins are being discussed in this review. In some complex food emulsion, the function of soy protein molecules and emulsifier at the interface need to be investigated in the future study.

  3. The onset of faba bean farming in the Southern Levant

    Science.gov (United States)

    Caracuta, Valentina; Barzilai, Omry; Khalaily, Hamudi; Milevski, Ianir; Paz, Yitzhak; Vardi, Jacob; Regev, Lior; Boaretto, Elisabetta

    2015-10-01

    Even though the faba bean (Vicia faba L.) is among the most ubiquitously cultivated crops, very little is known about its origins. Here, we report discoveries of charred faba beans from three adjacent Neolithic sites in the lower Galilee region, in the southern Levant, that offer new insights into the early history of this species. Biometric measurements, radiocarbon dating and stable carbon isotope analyses of the archaeological remains, supported by experiments on modern material, date the earliest farming of this crop to ~10,200 cal BP. The large quantity of faba beans found in these adjacent sites indicates intensive production of faba beans in the region that can only have been achieved by planting non-dormant seeds. Selection of mutant-non-dormant stock suggests that the domestication of the crop occurred as early as the 11th millennium cal BP. Plant domestication| Vicia faba L.| Pre-Pottery Neolithic B| radiocarbon dating| Δ13C analysis.

  4. Ethiopian soya bean and sunflower value chains : Opportunities and challenges

    NARCIS (Netherlands)

    Wijnands, J.H.M.; Dufera Gurmesa, N.; Lute, J.C.M.; Loo, van E.N.

    2011-01-01

    This report analyses the business opportunities of soya beans and sunflowers. The opportunities are addressed to firms in all levels of the value chain ranging from consumers to farmers in the Ethiopian agriculture.

  5. Intermittent drying of beans in a spouted bed

    Directory of Open Access Journals (Sweden)

    C. A. Oliveira

    2007-12-01

    Full Text Available Carioca beans are a highly nutritious grain, in terms of the amount of protein, iron and potassium as well as carbohydrates and fiber and as a source of vitamins. The moisture content of recently picked beans is too high for good preservation and storage, resulting in the need for drying before packaging. In this work, the drying of Carioca beans in a laboratory scale spouted bed under intermittent conditions of the drying air was experimentally analyzed. Experiments carried out consisted of two types of intermittent regime: intermittence in the spout regime, referred to as spouted/fixed bed and intermittence of the air supply to the bed, called spouted bed/rest. The results were compared to those for bean drying in a spouted bed dryer without intermittence.

  6. Caffeine content of Ethiopian Coffea arabica beans

    Directory of Open Access Journals (Sweden)

    Maria Bernadete Silvarolla

    2000-03-01

    Full Text Available The coffee germplasm bank of the Instituto Agronômico de Campinas has many Coffea arabica accessions from Ethiopia, which is considered the primary center of genetic diversity in coffee plants. An evaluation of the caffeine content of beans from 99 progenies revealed intra- and inter-progeny variability. In 68 progenies from the Kaffa region we found caffeine values in the range 0.46-2.82% (mean 1.18%, and in 22 progenies from Illubabor region these values ranged from 0.42 to 2.90% (mean 1.10%. This variability could be exploited in a breeding program aimed at producing beans with low-caffeine content.O banco de germoplasma de café do Instituto Agronômico de Campinas contém grande número de introduções de Coffea arabica provenientes da Etiópia, considerada centro de diversidade genética desta espécie. A avaliação dos teores de cafeína nas sementes de 99 progênies revelou a presença de variabilidade entre e dentro das progênies, de acordo com a região de origem das introduções. Entre as 68 progênies da região de Kaffa encontraram-se valores de cafeína entre 0.46 e 2.82% (média 1.18% e entre as 22 progênies de Illubabor obtiveram-se plantas cujos teores de cafeína variaram de 0.42 a 2.90% (média 1.10%. A variabilidade aqui relatada poderá ser explorada na produção de uma variedade de café com baixos teores de cafeína nas sementes.

  7. Insects diversity in lima bean (Phaseolus lunatus

    Directory of Open Access Journals (Sweden)

    WIWIN SETIAWATI

    2005-10-01

    Full Text Available Lima bean (Phaseolus lunatus is a vegetable which usually made as a home yard plant for Indonesian people to fulfill their daily needs. This plant has not been produced in the large number by the farmer. So it is hard to find in the market. Lima bean is light by many kind of insect. Inventory, identification and the study of insect taxon to this plant is being done to collect some information about the insect who life in the plant. The research was done in Balitsa experiment garden in the district of Lembang in Bandung regency on November 2003-February 2004, the experiment start at 4 weeks age, at the height of 1260 m over the sea level. The observation was made systematically by absolute method (D-vac macine and relative method (sweeping net. The research so that there were 26 species of phytofagous insect, 9 species of predator insect, 6 species of parasitoid insect, 4 species of pollinator and 14 species of scavenger insect. According to the research the highest species number was got in the 8th week (3rd sampling, which had 27 variety of species, so the highest diversity was also got in this with 2,113 point. Aphididae and Cicadellidae was the most insect found in roay plant. The research also had high number of species insect so the diversity of insect and evenness become high. A community will have the high stability if it is a long with the high diversity. High evenness in community that has low species dominance and high species number of insect so the high of species richness.

  8. Magnet systems for ''Bean-Shaped'' tokamak

    International Nuclear Information System (INIS)

    Bean-shaping of tokamak plasmas offers a method of reaching stable operation at (beta) > 10%. In order to establish the indentation of the ''bean'', a set of high- current ''pushing coils'' (> 5 MA in a reactor) must be located at the midplane as close as possible to the inboard edge of the plasma. If located in the bore of the TF coils, then maintenance of the pushing coils may be impossible, and the interlocking coils may prevent reactor modularity. If located outside, the required pushing-coil current may be unacceptably large. This dilemma is overcome with a unique TF coil design in which the inboard leg is bent outward in the form of an arc. The pushing coils are housed in the midplane indentation of this arc, just outside the TF coils but adequately close to the plasma. The arched coil transfers forces to the top and bottom legs, where it can be reacted by a clamp structure if necessary. This technique would allow demountable joints to be placed near the inoard leg (for copper TF coils). Another design approach to the pushing coils is to use liquid Li or Na as the conductor and coolant. The liquid metal ''coils'' can be placed immediately adjacent to the plasma, giving optimal control of the plasma shape with minimal coil current, although modularity of the reactor may have to be surrendered. Conceptual designs are presented of PF and TF coil systems for an ignition test reactor with about 14% and for a full-scale demonstration reactor with about 20%, both using copper TF coils

  9. Effects of extrusion cooking on the chemical composition and functional properties of dry common bean powders.

    Science.gov (United States)

    Ai, Yongfeng; Cichy, Karen A; Harte, Janice B; Kelly, James D; Ng, Perry K W

    2016-11-15

    The impact of extrusion cooking on the chemical composition and functional properties of bean powders from four common bean varieties was investigated. The raw bean powders were extruded under eight different conditions, and the extrudates were then dried and ground (particle size⩽0.5mm). Compared with corresponding non-extruded (raw) bean powders (particle size⩽0.5mm), the extrusion treatments did not substantially change the protein and starch contents of the bean powders and showed inconsistent effects on the sucrose, raffinose and stachyose contents. The extrusion cooking did cause complete starch gelatinization and protein denaturation of the bean powders and thus changed their pasting properties and solvent-retention capacities. The starch digestibilities of the cooked non-extruded and cooked extruded bean powders were comparable. The extruded bean powders displayed functional properties similar to those of two commercial bean powders. PMID:27283664

  10. Antioxidant activity of black bean (Phaseolus vulgaris L.) protein hydrolysates

    OpenAIRE

    Jarine Amaral do EVANGELHO; Jose de J. BERRIOS; Vânia Zanella PINTO; Mariana Dias ANTUNES; Nathan Levien VANIER; Elessandra da Rosa ZAVAREZE

    2016-01-01

    Abstract The objective of this work was to study the effect of enzymatic hydrolysis of black bean protein concentrate using different enzymes. Bean proteins were extracted and hydrolyzed over a period of 120 min using the enzymes pepsin or alcalase. The protein hydrolysates’ molecular weight was assayed by electrophoresis and the antioxidant activity was evaluated by the capturing methods of free radicals ABTS●+ and DPPH. Electrophoretic results showed that the bands above 50 kDa disappeared,...

  11. Zinc supplementation, production and quality of coffee beans

    OpenAIRE

    Herminia Emilia Prieto Martinez; Yonara Poltronieri; Adriana Farah; Daniel Perrone

    2013-01-01

    Besides its importance in the coffee tree nutrition, there is almost no information relating zinc nutrition and bean quality. This work evaluated the effect of zinc on the coffee yield and bean quality. The experiment was conducted with Coffea arabica L. in "Zona da Mata" region, Minas Gerais, Brazil. Twelve plots were established at random with 4 competitive plants each. Treatments included plants supplemented with zinc (eight plots) and control without zinc supplementation (four plots). Pla...

  12. Watershed responses to Amazon soya bean cropland expansion and intensification

    OpenAIRE

    Neill, Christopher; Coe, Michael T.; Riskin, Shelby H.; Krusche, Alex V.; Elsenbeer, Helmut; Macedo, Marcia N.; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A.; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A.

    2013-01-01

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compar...

  13. Toxicity of ricin present in castor bean seeds

    OpenAIRE

    Nayanna Brunna da Silva Fonseca; Benito Soto-Blanco

    2014-01-01

    The castor bean (Ricinus communis) is a bush from Euphorbiacea family cultivated for obtaining oil from the seeds. This oil has broad industrial employment, particularly for biodiesel. However, castor bean seeds exhibit a potent toxin, ricin. It is a glycoprotein with highly toxic action of inactivating ribosomes. The toxic action of ricin is due to inhibition of protein synthesis in eukaryotic cells, causing cell death. Only one molecule of ricin that enters the cytosol is able to inactivate...

  14. Water transport in parchment and endosperm of coffee bean

    OpenAIRE

    Ramirez-Martinez, Alejandra; Salgado-Cervantes, M.A.; Rodriguez-Jimenes, G.C.; Garcia-Alvarado, M.A.; Cherblanc, Fabien; Benet, Jean-Claude

    2013-01-01

    International audience This paper aims at contributing to identify the eventual regions where fungus Aspergillus ochraceus could grow and produce ochratoxin A (OTA) during drying of coffee beans. Internal structure of coffee bean was analyzed by optical microscopy for endosperm and parchment. From the expression of the dissipation in the grain due to the water transport, we show that a relationship formally analogous to an equation of diffusion governs the water transport. Three structures...

  15. Internal structure and water transport in the coffee bean

    OpenAIRE

    Ramirez-Martinez, Alejandra; Benet, Jean-Claude; Cherblanc, Fabien; Garcia-Alvarado, M.A.; Rodriguez-Jimenes, G.

    2010-01-01

    Microscope observations gave evidence of the coffee bean structure heterogeneity, whereas, coffee bean isotherms of different parts of grain show not significant difference excluding the parchment. Diffusion tests allowed determining the relationship between the diffusion coefficient and the water content. Therefore we propose an original method to determine the water transfer resistance in different parts of grain including the parchment. The set of results will permit to simulate a coffee g...

  16. Watershed responses to Amazon soya bean cropland expansion and intensification.

    Science.gov (United States)

    Neill, Christopher; Coe, Michael T; Riskin, Shelby H; Krusche, Alex V; Elsenbeer, Helmut; Macedo, Marcia N; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A

    2013-06-01

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compared with forest. However, the deep and highly permeable soils on the broad plateaus on which much of the soya bean cultivation has expanded buffer small soya bean watersheds against increased stormflows. Concentrations of nitrate and phosphate do not differ between forest or soya bean watersheds because fixation of phosphorus fertilizer by iron and aluminium oxides and anion exchange of nitrate in deep soils restrict nutrient movement. Despite resistance to biogeochemical change, streams in soya bean watersheds have higher temperatures caused by impoundments and reduction of bordering riparian forest. In larger rivers, increased water flow, current velocities and sediment flux following deforestation can reshape stream morphology, suggesting that cumulative impacts of deforestation in small watersheds will occur at larger scales.

  17. Castor bean organelle genome sequencing and worldwide genetic diversity analysis.

    Science.gov (United States)

    Rivarola, Maximo; Foster, Jeffrey T; Chan, Agnes P; Williams, Amber L; Rice, Danny W; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M J; Khouri, Hoda M; Beckstrom-Sternberg, Stephen M; Allan, Gerard J; Keim, Paul; Ravel, Jacques; Rabinowicz, Pablo D

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade.

  18. Castor bean organelle genome sequencing and worldwide genetic diversity analysis.

    Directory of Open Access Journals (Sweden)

    Maximo Rivarola

    Full Text Available Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade.

  19. Watershed responses to Amazon soya bean cropland expansion and intensification.

    Science.gov (United States)

    Neill, Christopher; Coe, Michael T; Riskin, Shelby H; Krusche, Alex V; Elsenbeer, Helmut; Macedo, Marcia N; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A

    2013-06-01

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compared with forest. However, the deep and highly permeable soils on the broad plateaus on which much of the soya bean cultivation has expanded buffer small soya bean watersheds against increased stormflows. Concentrations of nitrate and phosphate do not differ between forest or soya bean watersheds because fixation of phosphorus fertilizer by iron and aluminium oxides and anion exchange of nitrate in deep soils restrict nutrient movement. Despite resistance to biogeochemical change, streams in soya bean watersheds have higher temperatures caused by impoundments and reduction of bordering riparian forest. In larger rivers, increased water flow, current velocities and sediment flux following deforestation can reshape stream morphology, suggesting that cumulative impacts of deforestation in small watersheds will occur at larger scales. PMID:23610178

  20. Biological nitrogen fixation in common bean and faba bean using N-15 methodology and two reference crops

    International Nuclear Information System (INIS)

    A field was conducted on a Typic ustropepts soil located at 'La Tola', the experimental campus of the Agricultural Sciences Faculty at Tumbaco, Ecuador. The objectives were to quantify faba bean (Vicia faba) and common bean (Phaseolus vulgaris) biological nitrogen fixation, using quinoa (chenopodium quinoa) and maize (Zea mays) as reference crops. The average values were 80 and 70 per cent for faba bean and 42 and 14 per cent for common bean, respectively. It was assumed that nitrogen use eficiency was the same for fixing crops but observed that a crop with high nitrogen use efficiency overestimates legume biological nitrogen fixation. Results suggests that greater caution is needed when selecting reference crops for legumes with nitrogen fixation

  1. Susceptibility of pea, horse bean and bean to viruses in dependence on the age of the inoculated plants

    Directory of Open Access Journals (Sweden)

    Władysław Błaszczak

    2013-12-01

    Full Text Available Three cultivars of pea did not differ in their susceptibility to Cucumber Mosaic Virus (CMV notwithstanding the age of the inoculated plants. But their susceptibility to infection with Bean Yellow Mosaic Virus (BYMV differed. Horse bean cultivars 'Nadwiślański' and 'Major' proved to be less susceptible to Broad Bean True Mosaic Virus (BBTMV when older plants were-inoculated. Two bean cultivars 'Złota Saxa' and 'Earle' appeared to be susceptible to BBTMV only in the phase of developing primary leaves and the age-dependent resistance to infection increased faster in plants of the cv. 'Złota Saxa'. Both cultivars of bean showed also age-dependent resistance to infection by BYMV. All these viruses restricted growth and yield of plants. The decreases were greater when younger plants were inoculated. These dependences appeared most distinctly in pea cv. 'Sześciotygodniowy' infected with CMV and in two cultivars of bean infected with BYMV.

  2. Effects of combined traditional processing methods on the nutritional quality of beans

    Science.gov (United States)

    Nakitto, Aisha M; Muyonga, John H; Nakimbugwe, Dorothy

    2015-01-01

    Consumption of dry beans is limited by long cooking times thus high fuel requirement. The bioavailability of nutrients in beans is also limited due to presence of antinutrients such as phytates and tannins. Little research has been done on combined processing methods for production of nutritious fast cooking bean flour and the effect of combined treatments on nutritional quality of beans has not previously determined. The aim of this study was to reduce cooking time and enhance the nutritional value of dry beans. Specifically to: develop protocols for production of fast cooking bean flours and assess the effect of processing on the nutritional characteristics of the flours. Dry beans (K131 variety) were soaked for 12 h; sprouted for 48 h; dehulled and steamed for 25 and 15 min for whole and dehulled beans respectively or roasted at 170°C for 45 and 15 min for whole and dehulled beans respectively. Dehulling eliminated phytates and tannins and increased protein digestibility. In vitro protein digestibility and mineral (iron and zinc) extractability were negatively correlated with tannin and phytate content. Total available carbohydrates were highest in moist heat-treated bean flours. Overall, combined processing of beans improved the nutritional quality of dry beans and the resulting precooked flours need less cooking time compared to whole dry beans. PMID:25987998

  3. Nutritional response of growing rats to faba beans (Vicia faba L., minor) and faba bean fractions.

    Science.gov (United States)

    Rubio, L A; Grant, G; Bardocz, S; Dewey, P; Pusztai, A

    1991-11-01

    The effects of raw faba bean (Vicia faba L., minor) meal (VFM) and its fractions on the growth and nitrogen utilization of rats have been determined in two experiments. Two commercial varieties of VFM were tested, local VFM (409-439 g/kg diet) and Troy VFM (439 g/kg diet). The bean fractions tested were V. faba lectin-depleted protein (VFDP), V. faba lectin (VFL) and V. faba cotyledon residue (VFCR). All diets were supplemented with amino acids to target requirements. Body-weight, body N and lipid contents of rats fed on VFM were reduced significantly in comparison with control rats fed on lactalbumin. This was due, in part, to the lower digestibility of the protein, lipid and dry matter (DM) of VFM diets. As a result, net protein utilization (NPU) and biological value (BV) of faba bean proteins were less than expected. Urine and urea-N outputs of the VFM-fed rats were also elevated in both experiments. Increasing the energy content of local VFM diets led to significantly higher dry body-weight, body N and lipid contents, with the result that the NPU and BV values of the protein also increased. However, the NPU values for VFM-fed rats were still significantly lower than those for the controls in both experiments. In contrast, true N, lipid and DM digestibilities in rats given local VFM were not significantly affected by the difference in the energy content of the diets. The replacement of two-thirds of the lactalbumin in the diet with VFDP (65 g/kg) reduced dry body-weight, N and lipid contents, NPU and BV compared with the control rats, even though N, lipid and DM digestibilities were not significantly different. The nutritional performance of rats fed on lactalbumin-based diets containing 7 g VFL/kg was similar to that of the controls. Similarly, the inclusion of the cotyledon residue (237 g VFCR/kg diet) had no appreciable effect on any of the variables studied. As VFL and VFCR had no antinutritional effects in these rats, it appears that the low nutritional

  4. Resistance of stored bean varieties to Acanthoscelides obtectus (Coleoptera: Bruchidae)

    Institute of Scientific and Technical Information of China (English)

    Edson L.L. Baldin; Fernando M. Lara

    2008-01-01

    During bean seed storage, yield can be lost due to infestations of Acanthoscelides obtectus Say, the bean weevil. The use of resistant varieties has shown promising results in fighting these insects, reducing infestation levels and eliminating chemical residues from the beans. The expression of resistance to A. obtectus in bean varieties is frequently attributed to the presence of phytohemagglutinins, protease inhibitors and alpha-amylase, and espe-cially to variants of the protein arcelin, which reduce the larval viability of these insects. Toevaluate the effect of bean seed storage time on the resistance expression of bean varietiesto A. obtectus, tests with seeds of three ages (freshly-harvested, 4-month-old, and 8-month-old) were conducted in the laboratory, using four commercial varieties: Carioca Pitoco, Ipa 6, PorriUo 70, 0nix; four improved varieties containing arcelin protein: Arc. 1, Arc.2, Arc.3, Arc.4; and three wild varieties also containing arcelin protein: Arc.lS, Arc.3S, and Arc.5S. The Arc.5S, Arc. 1S, and Arc.2 varieties expressed high antibiosis levels against the weevil; Arc. 1 and Arc3S expressed the same mechanism, but at lower levels. The occurrence of oviposition non-preference was also observed in Arc.5S and Arc. IS. The Arc.3 and Arc.4 varieties expressed low feeding non-preference levels against A. obtectus. The expression of resistance in arcelin-bearing, wild or improved varieties was affected during the storage of seeds, and was high under some parameters but low in others. The results showed that addition of chemical resistance factors such as protein arcelin via genetic breeding may be beneficial in improving the performance of bean crops.

  5. Variation in caffeine concentration in single coffee beans.

    Science.gov (United States)

    Fox, Glen P; Wu, Alex; Yiran, Liang; Force, Lesleigh

    2013-11-13

    Twenty-eight coffee samples from around the world were tested for caffeine levels to develop near-infrared reflectance spectroscopy (NIRS) calibrations for whole and ground coffee. Twenty-five individual beans from five of those coffees were used to develop a NIRS calibration for caffeine concentration in single beans. An international standard high-performance liquid chromatography method was used to analyze for caffeine content. Coffee is a legal stimulant and possesses a number of heath properties. However, there is variation in the level of caffeine in brewed coffee and other caffeinated beverages. Being able to sort beans on the basis of caffeine concentration will improve quality control in the level of caffeine in those beverages. The range in caffeine concentration was from 0.01 mg/g (decaffeinated coffee) to 19.9 mg/g (Italian coffee). The majority of coffees were around 10.0-12.0 mg/g. The NIRS results showed r(2) values for bulk unground and ground coffees were >0.90 with standard errors bean calibration the r(2) values were between 0.85 and 0.93 with standard errors of cross validation of 0.8-1.6 mg/g depending upon calibration. The results showed it was possible to develop NIRS calibrations to estimate the caffeine concentration of individual coffee beans. One application of this calibration could be sorting beans on caffeine concentration to provide greater quality control for high-end markets. Furthermore, bean sorting may open new markets for novel coffee products. PMID:24070227

  6. Results of preliminary investigations at radio sensitivity of bean (Vicia faba L.) on fast neutrons

    International Nuclear Information System (INIS)

    The seeds of bean (Vicia faba L.) were irradiated with fast neutrons. The radiation doses applied ranged from 40 to 600 rads. Then irradiated seeds were sowed. During bean vegetation radiation effects were observed. (A.S.)

  7. Melhoramento do feijoeiro Breeding of dry beans

    Directory of Open Access Journals (Sweden)

    Ibrahim O. Abrahão

    1960-01-01

    Full Text Available Os ensaios de variedades e linhagens de feijão, realizados no período de 1948 a 1957 pelo Seção de Genética e resumidamente aqui apresentados, vieram indicar que as variedades e linhagens do grupo Mulatinho e Chumbinho eram as mais produtivas. A partir dêste ano agrícola, novos ensaios comparativos de produção foram realizados, a fim de verificar o comportamento das variedades e linhagens existentes com as variedades recém-introduzidas e as novas linhagens selecionadas. As variedades comerciais e suas linhagens, estudadas neste trabalho, foram classificadas em oito grupos, com base nas observações realizadas principalmente sôbre o tipo de planta e característicos dos sementes, o saber: Mulatinho, Chumbinho, Rosinha, Roxinho, Manteiga, Prêto, Bico-de-Ouro e diversos. Dos oito ensaios analisados em detalhes e realizados em Campinas, chegou-se à conclusão de que as variedades dos grupos Prêta e Rosinha são as de maior capacidade produtiva, devendo ser intensificado o aproveitamento dêsses grupos no plano de melhoramento em execução. As do grupo Roxinho apresentam-se menos produtivas. A comparação das análises dos ensaios como látice e blocos ao acaso revelou uma eficiência média de ordem de 30% para o tipo látice nos oito ensaios analisados. A fim de observar se o pêso total de plantas por ocasião da colheita mostra correlação com a produção de grãos, determinou-se, para cada grupo, o índice entre essas duas variáveis. Observou-se que êstes índices são proporcionais à produção, servindo, assim, para melhor caracterizar os diversos grupos de variedades e linhagens de feijão.In spite of the fact that dry beans (Phaseolus vulgaris are one of the main sources of protein in the State of São Paulo, Brazil, they are considered a secondary crop and grown only in small patches or intercropped with coffee, sugar cane, or corn. The development of high yielding strains resistant to the most prevailing diseases, has

  8. Irradiation disinfestation of stored cocoa beans

    International Nuclear Information System (INIS)

    The relationship between effective dosages to induce mortality and sterility in several important storage beetles was investigated. To induce 100% mortality, doses ranging from 0.05 to 0.1 kGy require 4-7 weeks, 0.2-1.0 kGy need 1.5-3 weeks and 2.0 kGy require 1 week for Tribolium castaneum, Oryzaephilus surinamensis and Lasioderma serricorne, respectively. Only at 5.0 kGy did instant mortality occur in the insects tested. Total prevention of F1 progeny was achieved at the lowest dosage (0.05 kGy) for T. castaneum and O. surinamensis; for L. serricorne, the sterility level achieved was 92-99% for doses ranging from 0.05 to 1.0 kGy. Semi-pilot scale tests (12 months) were carried out to evaluate the efficacy of gamma irradiation to control insects (artificially infested L. serricorne and T. castaneum) and moulds in cocoa beans packed in either jute or laminated polypropylene or unlaminated polypropylene bags. Good control against insect infestations was achieved for the whole duration of storage. Laminated polypropylene afforded the best protection against insect reinfestation. Other than a change in moisture content, no changes in the physicochemical properties were observed in the flavour or in the total protein, soluble protein, amino acid and free fatty acid contents. 15 refs, 10 tabs

  9. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel; Ambachew; Firew; Mekbib; Asrat; Asfaw; Stephen; E.Beebe; Matthew; W.Blair

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot(BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly; iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress.In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  10. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Directory of Open Access Journals (Sweden)

    Daniel Ambachew

    2015-08-01

    Full Text Available Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM. The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i water deficit at mid-pod fill, or ii unprotected against bean fly; iii irrigated, well watered conditions, or iv bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  11. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel Ambachew; Firew Mekbib; Asrat Asfaw; Stephen E. Beebe; Matthew W. Blaird

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly;iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  12. Effects of bioprocessed antinutritional factors on bean protein quality, with special emphasis on Phaseolus vulgaris L.

    OpenAIRE

    Savelkoul, F.H.M.G.

    1994-01-01

    Legumes, e.g. beans and peas, can contain antinutritional factors. Some varieties of faba beans (Vicia faba), soya beans (Glycine max ) and white kidney beans (Phaseolus vulgaris) can contain in their raw state antinutritional factors such as tannins, trypsin inhibitors and lectins respectively which negatively effect the protein digestibility by nonruminants e.g. pigs. Also the storage protein is not easily digested by nonruminants. The main aim of the present study was to find a reasonable ...

  13. Draft genome sequence of the ricin-producing oilseed castor bean

    OpenAIRE

    Chan, Agnes P.; Crabtree, Jonathan; Zhao, Qi; Lorenzi, Hernan; Orvis, Joshua; Puiu, Daniela; Melake-Berhan, Admasu; Kristine M Jones; Redman, Julia; Chen, Grace; Cahoon, Edgar B.; Gedil, Melaku; Stanke, Mario; Haas, Brian J.; Wortman, Jennifer R

    2010-01-01

    Castor bean (Ricinus communis) is an oil crop that belongs to the spurge (Euphorbiaceae) family. Its seeds are the source of castor oil, used for the production of high-quality lubricants due to its high proportion of the unusual fatty acid ricinoleic acid. Castor bean seeds also produce ricin, a highly toxic ribosome inactivating protein, making castor bean relevant for biosafety. We report here the 4.6X draft genome sequence of castor bean, representing the first reported Euphorbiaceae geno...

  14. Reduction of Microbe Contamination through Steaming Process to Cocoa Beans Using Steaming Chamber

    OpenAIRE

    Hendy Firmanto

    2014-01-01

    Dry cocoa bean quality is also determined by its microbe contamination level. Steaming process for dried cocoa beans as a pretreatment process was selected because of less effect on organic compound inside the dried cocoa bean. This experiment aim was to study microbial contamination level of cocoa beans using steaming process, determining its microbial population and evaluate its chemical changes. Experiment was carried out in Postharvest Laboratory of Indonesian Coffee and Cocoa Research In...

  15. The fate of phosphorus fertilizer in Amazon soya bean fields.

    Science.gov (United States)

    Riskin, Shelby H; Porder, Stephen; Neill, Christopher; Figueira, Adelaine Michela e Silva; Tubbesing, Carmen; Mahowald, Natalie

    2013-06-01

    Fertilizer-intensive soya bean agriculture has recently expanded in southeastern Amazonia, and whereas intensive fertilizer use in the temperate zone has led to widespread eutrophication of freshwater ecosystems, the effects in tropical systems are less well understood. We examined the fate of fertilizer phosphorus (P) by comparing P forms and budgets across a chronosequence of soya bean fields (converted to soya beans between 2003 and 2008) and forests on an 800 km(2) soya bean farm in Mato Grosso, Brazil. Soya bean fields were fertilized with 50 kg P ha(-1) yr(-1) (30 kg P ha(-1) yr(-1) above what is removed in crops). We used modified Hedley fractionation to quantify soil P pools and found increases in less-plant-available inorganic pools and decreases in organic pools in agricultural soils compared with forest. Fertilizer P did not move below 20 cm. Measurements of P sorption capacity suggest that while fertilizer inputs quench close to half of the sorption capacity of fast-reacting pools, most added P is bound in more slowly reacting pools. Our data suggest that this agricultural system currently has a low risk of P losses to waterways and that long time-scales are required to reach critical soil thresholds that would allow continued high yields with reduced fertilizer inputs.

  16. Extraction and characterization of polysaccharides from green and roasted Coffea arabica beans.

    NARCIS (Netherlands)

    Oosterveld, A.; Harmsen, H.; Voragen, A.G.J.; Schols, H.A.

    2003-01-01

    Polysaccharides were sequentially extracted from green and roasted Coffea arabica beans with water (90 °C), EDTA, 0.05, 1, and 4 M NaOH and characterized chemically. Additionally, the beans were subjected to a single extraction with water at 170 °C. Green arabica coffee beans contained large proport

  17. Effect of fermented soya beans on diarrhoea and feed efficiency in weaned piglets

    NARCIS (Netherlands)

    Kiers, J.L.; Meijer, J.C.; Nout, M.J.R.; Rombouts, F.M.; Nabuurs, M.J.A.; Meulen, van der J.

    2003-01-01

    Aims: To evaluate anti-diarrhoeal and growth enhancing properties of fermented soya beans in weaned piglets. Methods and Results: In a first phase piglet diet, toasted full-fat soya beans (20%) were replaced with either cooked soya beans or Rhizopus microsporus or Bacillus subtilis fermented soya be

  18. Physicochemical characteristics of green coffee: comparison of graded and defective beans.

    Science.gov (United States)

    Ramalakshmi, K; Kubra, I R; Rao, L J M

    2007-06-01

    Defective (triage) coffee beans are beans rejected after separating the graded ones according to the size and color. These coffee beans represent about 15% to 20% of coffee production in India but are not utilized for beverages since these affect the quality of coffee brew. In the present study, physical characteristics such as bean density, brightness, titratable acidity, pH, moisture, and total soluble solids and also chemical composition, namely, caffeine, chlorogenic acids, lipids, sucrose, total polyphenols, and proteins, were evaluated in defective as well as in graded green coffee beans. The physical parameters such as weight, density, and brightness of defective coffee beans were low compared to the graded beans, which is due to the presence of immature, broken, bleached, and black beans. Caffeine content was low in triage beans compared to graded beans. Chlorogenic acids, one of the composition in coffee responsible for antioxidant activity, was found to be intact (marginally high in some cases) in defective coffee beans. Hence, triage coffee beans can be evaluated as a source of antioxidant or radical scavenging conserve for food systems.

  19. Navy bean flour particle size and protein content affect cake baking and batter quality

    Science.gov (United States)

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to three levels with navy bean starch. The effect...

  20. Comparative study of the chemical composition of wild and cultivated beans (Phaseolus vulgaris).

    Science.gov (United States)

    Sotelo, A; Sousa, H; Sánchez, M

    1995-02-01

    Five wild Phaseolus vulgaris beans were compared with five cultivated Phaseolus vulgaris beans in proximate composition, total (true) protein, amino acid composition, and toxic and antinutritional factors. The wild beans contained more protein (25.5% vs. 21.7%), ash (5.15 vs. 4.15%), crude fiber (7.08% vs. 5.04%) compared to cultivated beans while the former contained less fat (0.56 vs. 0.89%) and carbohydrates (61.64 vs. 68.05%). Sulfur amino acids were found to be limiting in both groups of bean as expected; however, the cultivated beans had a higher content of the limiting amino acids. Therefore, the cultivated beans showed a better amino acid profile than the wild beans. Toxic factors were not found in either type of bean; the determinations included saponins, alkaloids, and cyanogenic glycosides. The antinutritional factors investigated were hemagglutinins (lectins) and trypsin inhibitors. The wild beans presented a higher content of trypsin inhibitors (28 TUI per mg) and lectins (9.6) than the cultivated beans did (21 TUI per mg and 7 respectively). From the chemical point of view, domestication seems to be positive; however, the better protein nutritive quality of the cultivated beans should be further confirmed by biological assays. PMID:7792267

  1. Thoughts on the Sustainable Development of the Fava Bean Industry in Chongqing

    Institute of Scientific and Technical Information of China (English)

    Chengzhang DU; Yanghua LI; Jijun ZHANG

    2015-01-01

    The research analyzed the theoretical basis of the sustainable development of the Chongqing fava bean in terms of the current market economy situation. In re-gard to practice, several strategies wil be suggested for the Chongqing fava bean in-dustry to guide the development of Chongqing’s efficient fava bean agriculture.

  2. Physicochemical characteristics of green coffee: comparison of graded and defective beans.

    Science.gov (United States)

    Ramalakshmi, K; Kubra, I R; Rao, L J M

    2007-06-01

    Defective (triage) coffee beans are beans rejected after separating the graded ones according to the size and color. These coffee beans represent about 15% to 20% of coffee production in India but are not utilized for beverages since these affect the quality of coffee brew. In the present study, physical characteristics such as bean density, brightness, titratable acidity, pH, moisture, and total soluble solids and also chemical composition, namely, caffeine, chlorogenic acids, lipids, sucrose, total polyphenols, and proteins, were evaluated in defective as well as in graded green coffee beans. The physical parameters such as weight, density, and brightness of defective coffee beans were low compared to the graded beans, which is due to the presence of immature, broken, bleached, and black beans. Caffeine content was low in triage beans compared to graded beans. Chlorogenic acids, one of the composition in coffee responsible for antioxidant activity, was found to be intact (marginally high in some cases) in defective coffee beans. Hence, triage coffee beans can be evaluated as a source of antioxidant or radical scavenging conserve for food systems. PMID:17995751

  3. Hyperspectral imaging for differentiation of foreign materials from pinto beans

    Science.gov (United States)

    Mehrubeoglu, Mehrube; Zemlan, Michael; Henry, Sam

    2015-09-01

    Food safety and quality in packaged products are paramount in the food processing industry. To ensure that packaged products are free of foreign materials, such as debris and pests, unwanted materials mixed with the targeted products must be detected before packaging. A portable hyperspectral imaging system in the visible-to-NIR range has been used to acquire hyperspectral data cubes from pinto beans that have been mixed with foreign matter. Bands and band ratios have been identified as effective features to develop a classification scheme for detection of foreign materials in pinto beans. A support vector machine has been implemented with a quadratic kernel to separate pinto beans and background (Class 1) from all other materials (Class 2) in each scene. After creating a binary classification map for the scene, further analysis of these binary images allows separation of false positives from true positives for proper removal action during packaging.

  4. Stable isotope composition of cocoa beans of different geographical origin.

    Science.gov (United States)

    Perini, Matteo; Bontempo, Luana; Ziller, Luca; Barbero, Alice; Caligiani, Augusta; Camin, Federica

    2016-09-01

    The isotopic profile (δ(13) C, δ(15) N, δ(18) O, δ(2) H, δ(34) S) was used to characterise a wide selection of cocoa beans from different renowned production areas (Africa, Asia, Central and South America). The factors most influencing the isotopic signatures of cocoa beans were climate and altitude for δ(13) C and the isotopic composition of precipitation water for δ(18) O and δ(2) H, whereas δ(15) N and δ(34) S were primarily affected by geology and fertilisation practises. Multi-isotopic analysis was shown to be sufficiently effective in determining the geographical origin of cocoa beans, and combining it with Canonical Discriminant Analysis led to more than 80% of samples being correctly reclassified. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27484307

  5. Rhizosphere acidification of faba bean, soybean and maize

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, L.L. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences, Peking Union Medical College, Beijing, 100094 (China); Cao, J. [School of Life Science, Key Laboratory of Arid and Grassland Ecology, Lanzhou University, Lanzhou 730000 (China); Zhang, F.S. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Li, L., E-mail: lilong@cau.edu.cn [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China)

    2009-07-01

    Interspecific facilitation on phosphorus uptake was observed in faba bean/maize intercropping systems in previous studies. The mechanism behind this, however, remained unknown. Under nitrate supply, the difference in rhizosphere acidification potential was studied by directly measuring pH of the solution and by visualizing and quantifying proton efflux of roots between faba bean (Vicia faba L. cv. Lincan No.5), soybean (Glycine max L. cv. Zhonghuang No. 17) and maize (Zea mays L. cv. Zhongdan No.2) in monoculture and intercrop, supplied without or with 0.2 mmol L{sup -1} P as KH{sub 2}PO{sub 4}. The pH of the nutrient solution grown faba bean was lower than initial pH of 6.0 from day 1 to day 22 under P deficiency, whereas the pH of the solution with maize was declined from day 13 after treatment. Growing soybean increased solution pH irrespective of P supply. Under P deficiency, the proton efflux of faba bean both total (315.25 nmol h{sup -1} plant{sup -1}) and specific proton efflux (0.47 nmol h{sup -1} cm{sup -1}) was greater than that those of soybean (21.80 nmol h{sup -1} plant{sup -1} and 0.05 nmol h{sup -1} cm{sup -1}, respectively). Faba bean had much more ability of rhizosphere acidification than soybean and maize. The result can explain partly why faba bean utilizes sparingly soluble P more effectively than soybean and maize do, and has an important implication in understanding the mechanism behind interspecific facilitation on P uptake by intercropped species.

  6. Rhizosphere acidification of faba bean, soybean and maize

    International Nuclear Information System (INIS)

    Interspecific facilitation on phosphorus uptake was observed in faba bean/maize intercropping systems in previous studies. The mechanism behind this, however, remained unknown. Under nitrate supply, the difference in rhizosphere acidification potential was studied by directly measuring pH of the solution and by visualizing and quantifying proton efflux of roots between faba bean (Vicia faba L. cv. Lincan No.5), soybean (Glycine max L. cv. Zhonghuang No. 17) and maize (Zea mays L. cv. Zhongdan No.2) in monoculture and intercrop, supplied without or with 0.2 mmol L-1 P as KH2PO4. The pH of the nutrient solution grown faba bean was lower than initial pH of 6.0 from day 1 to day 22 under P deficiency, whereas the pH of the solution with maize was declined from day 13 after treatment. Growing soybean increased solution pH irrespective of P supply. Under P deficiency, the proton efflux of faba bean both total (315.25 nmol h-1 plant-1) and specific proton efflux (0.47 nmol h-1 cm-1) was greater than that those of soybean (21.80 nmol h-1 plant-1 and 0.05 nmol h-1 cm-1, respectively). Faba bean had much more ability of rhizosphere acidification than soybean and maize. The result can explain partly why faba bean utilizes sparingly soluble P more effectively than soybean and maize do, and has an important implication in understanding the mechanism behind interspecific facilitation on P uptake by intercropped species.

  7. Low-Income US Women Under-informed of the Specific Health Benefits of Consuming Beans.

    Directory of Open Access Journals (Sweden)

    Donna M Winham

    Full Text Available Bean consumption can reduce chronic disease risk and improve nutrition status. Consumer knowledge of bean health benefits could lead to increased intakes. Low-income women have poorer health and nutrition, but their level of knowledge about bean health benefits is unknown. Beans are a familiar food of reasonable cost in most settings and are cultural staples for Hispanics and other ethnicities. Study objectives were to assess awareness of bean health benefits among low-income women, and to evaluate any differences by acculturation status for Hispanic women in the Southwestern United States.A convenience sample of 406 primarily Mexican-origin (70% low-income women completed a survey on knowledge of bean health benefits and general food behaviors. Principal components analysis of responses identified two summary scale constructs representing "bean health benefits" and "food behaviors." Acculturation level was the main independent variable in chi-square or ANOVA.The survey completion rate was 86% (406/471. Most women agreed or strongly agreed that beans improved nutrition (65% and were satiating (62%. Over 50% answered 'neutral' to statements that beans could lower LDL cholesterol (52%, control blood glucose (56% or reduce cancer risk (56%, indicating indifference or possible lack of knowledge about bean health benefits. There were significant differences by acculturation for beliefs that beans aid weight loss and intestinal health. Scores on the bean health benefits scale, but not the food behavior scale, also differed by acculturation.Limited resource women have a favorable view of the nutrition value of beans, but the majority did not agree or disagreed with statements about bean health benefits. Greater efforts to educate low-income women about bean health benefits may increase consumption and improve nutrition.

  8. Medical image of the week: coffee bean and whirlpool signs

    Directory of Open Access Journals (Sweden)

    Bartolome B

    2016-01-01

    Full Text Available A 79-year-old woman with a history of Parkinson’s disease presented with altered mental status, poor oral intake, and multiple episodes of nausea and vomiting. An abdominal x-ray demonstrated dilated loops of bowel and the coffee bean sign concerning for sigmoid volvulus (Figure 1. The coffee bean sign occurs when a thick “inner wall” represents the double wall thickness of opposed loops of bowel while the thinner outer walls due single thickness. A contrast CT abdomen showed dilated sigmoid loop and whirlpool sign confirming sigmoid volvulus (Figure 2. She underwent a total colectomy with ileorectal anastomosis and full recovery.

  9. Locust bean gum: Exploring its potential for biopharmaceutical applications.

    Science.gov (United States)

    Dionísio, Marita; Grenha, Ana

    2012-07-01

    Polysaccharides have been finding, in the last decades, very interesting and useful applications in the biomedical and, specifically, in the biopharmaceutical field. Locust bean gum is a polysaccharide belonging to the group of galactomannans, being extracted from the seeds of the carob tree (Ceratonia siliqua). This polymer displays a number of appealing characteristics for biopharmaceutical applications, among which its high gelling capacity should be highlighted. In this review, we describe critical aspects of locust bean gum, contributing for its role in biopharmaceutical applications. Physicochemical properties, as well as strong and effective synergies with other biomaterials are described. The potential for in vivo biodegradation is explored and the specific biopharmaceutical applications are discussed.

  10. Effect of toasting field beans and of grass-clover

    DEFF Research Database (Denmark)

    Mogensen, Lisbeth; Vestergaard, Jannie Steensig; Fretté, Xavier;

    2010-01-01

    The effect of toasting field beans and of grass-clover: maize silage ratio on milk production, milk composition and the sensory quality of the milk was investigated in a 2   2 factorial experiment. Toasting of field beans resulted in lower milk contents of both fat (44.2 versus 46.1 g/kg, P = 0...... sensory characteristics. Increasing the proportion of maize silage at the expense of grass-clover silage did not affect milk production, but decreased the milk content of long-chain fatty acids, as well as the content of carotenes...

  11. Mapping Fusarium solani and Aphanomyces euteiches root rot resistance and root architecture quantitative trait loci in common bean (Phaseolus vulgaris)

    Science.gov (United States)

    Root rot diseases of bean (Phaseolus vulgaris L.) are a constraint to dry and snap bean production. We developed the RR138 RIL mapping population from the cross of OSU5446, a susceptible line that meets current snap bean processing industry standards, and RR6950, a root rot resistant dry bean in th...

  12. Determination of trace elements in various kinds of bean by X-ray spectrometric techniques (1995-96)

    International Nuclear Information System (INIS)

    Various kinds of bean such as Peanut, Gram Whole, Black Eye Bean, Small Red Bean, Lab Lab Bean, Green Mung Bean, Filed Pea, Seasame Seed, Sultani, Maize, Butter Bean, Dolichos Lab Lab, Toor Whole, Small Yellow Bean, Cow Pea have been collected and analysed by EDXRF analysis for trace elements. The measurement system consists of a Cd-109 annual excitation source, a Si (Li) detector, H V power supply, a spectrometry amplifier, a multichannel analyser and a personal computer. The samples were prepared as pressed pellets and measured by Emission Transmission Technique. The accuracy was determined by analysing standard reference material, SOIL-7 form IAEA. (author)

  13. Biofortified red mottled beans (Phaseolus vulgaris L. in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus and an in vitro digestion/Caco-2 model

    Directory of Open Access Journals (Sweden)

    Glahn Raymond P

    2011-10-01

    Full Text Available Abstract Background Our objective was to compare the capacities of biofortified and standard colored beans to deliver iron (Fe for hemoglobin synthesis. Two isolines of large-seeded, red mottled Andean beans (Phaseolus vulgaris L., one standard ("Low Fe" and the other biofortified ("High Fe" in Fe (49 and 71 μg Fe/g, respectively were used. This commercial class of red mottled beans is the preferred varietal type for most of the Caribbean and Eastern and Southern Africa where almost three quarters of a million hectares are grown. Therefore it is important to know the affect of biofortification of these beans on diets that simulate human feeding studies. Methods Maize-based diets containing the beans were formulated to meet the nutrient requirements for broiler except for Fe (Fe concentrations in the 2 diets were 42.9 ± 1.2 and 54.6 ± 0.9 mg/kg. One day old chicks (Gallus gallus were allocated to the experimental diets (n = 12. For 4 wk, hemoglobin, feed-consumption and body-weights were measured. Results Hemoglobin maintenance efficiencies (HME (means ± SEM were different between groups on days 14 and 21 of the experiment (P In-vitro analysis showed lower iron bioavailability in cells exposed to standard ("Low Fe" bean based diet. Conclusions We conclude that the in-vivo results support the in-vitro observations; biofortified colored beans contain more bioavailable-iron than standard colored beans. In addition, biofortified beans seems to be a promising vehicle for increasing intakes of bioavailable Fe in human populations that consume these beans as a dietary staple. This justifies further work on the large-seeded Andean beans which are the staple of a large-region of Africa where iron-deficiency anemia is a primary cause of infant death and poor health status.

  14. Pinto Beans (Phaseolus vulgaris L. as a Functional Food: Implications on Human Health

    Directory of Open Access Journals (Sweden)

    Vicki Schlegel

    2013-02-01

    Full Text Available Most foods are considered functional in terms of providing nutrients and energy to sustain daily life, but dietary systems that are capable of preventing or remediating a stressed or diseased state are classified as functional foods. Dry beans (Phaseolus vulgaris L. contain high levels of chemically diverse components (phenols, resistance starch, vitamins, fructooligosaccharides that have shown to protect against such conditions as oxidative stress, cardiovascular disease, diabetes, metabolic syndrome, and many types of cancer, thereby positioning this legume as an excellent functional food. Moreover, the United States has a rich dry bean history and is currently a top producer of dry beans in the world with pinto beans accounting for the vast majority. Despite these attributes, dry bean consumption in the US remains relatively low. Therefore, the objective of this manuscript is to review dry beans as an important US agricultural crop and as functional food for the present age with an emphasis on pinto beans.

  15. Studies on interference between newly defined bean-infecting potyviruses.

    NARCIS (Netherlands)

    Khan, J.A.

    1993-01-01

    Bean common mosaic virus (BCMV) and blackeye cowpea mosaic virus (BICMV) belonging to the genus Potyvirus of the plant virus family Potyviridae (Barnett, 1991, 1992) are of great economic importance. A large number of strains of BCMV and BlCMV are found to occur in nature, either in single or in mix

  16. Germination test for identification of gamma-irradiated bean seeds

    International Nuclear Information System (INIS)

    The feasibility of germination test for the practical detection of irradiated beans has not been investigated. The objective of this study was to determine if the relationship between the root growth rate and radiation dose could be used to produce a rapid analytical method for identification of irradiated beans. Such detection method could be potentially used for both (a) identification of irradiated food, and (b) for quarantine inspection (to certify that the agricultural product has been irradiated, and the pests present in it do not pose a quarantine risk). Results presented in this paper indicate that the germination test is not always capable of discriminating satisfactorily between irradiated and unirradiated samples of bean seeds, because the sensitivity of the test is often higher than the low doses which are suggested for disinfestation purposes. However, using the germination test, an unexperienced person can easily discriminate untreated bean seeds from those irradiated with 0.3-1.5 kGy doses of gamma radiation. (orig./vhe)

  17. Weed Interference Affects Dry Bean Yield and Growth

    Directory of Open Access Journals (Sweden)

    Hossein GHAMARI

    2012-08-01

    Full Text Available Dry bean is one of the most important pulse crops in Iran. Field study was conducted in 2011 to evaluate effects of weed competition from a natural flora on growth and yield of dry bean (Phaseolus vulgaris L.. The treatments consisted of weed infestation and weed removal periods (10, 20, 30, 40 and 50 days after crop emergence. Control plots kept weed-infested and weed-free throughout growing season. To assess the weed competition effect on crop characteristics, Richards, Gompertz and logistic equations were fitted to the data. The most abundant weed species were Chenopodium album and Amaranthus retroflexus. Increase in duration of weed interference decreased the stem height of dry bean. At the end of the growing season, dry bean was 20 cm taller in season-long weed-free treatment compared to the season-long weed-infested treatment. As the number of days of weed interference increased, a declining trend of LAI and number of pods was observed. The minimum number of pods was obtained in season-long weed-infested treatment (5.01 pods/plant. Weed interference during the whole growing season, caused a 60% reduction in yield. Considering 5% and 10% acceptable yield lost, the critical period of weed competition was determined from 20 to 68 and 23 to 55 days after planting (DAE, respectively.

  18. Characterization of pre-gelatinized rice and bean flour

    Directory of Open Access Journals (Sweden)

    Ana Vânia Carvalho

    2013-06-01

    Full Text Available The objective of this study was to develop a pre-gelatinized flour using a mixture of broken rice and split beans by thermoplastic extrusion, and to evaluate the physicochemical, nutritional, and technological quality of the final product. The extrusion parameters were maintained using three heating zones with temperatures of 30 ºC, 40 ºC, and 70 ºC; screw speed of 177 rpm; feed rate of 257 g/m, and circular matrix of 3.85 mm. The following characterization analyses were performed: physicochemical, nutritional, water absorption index (WAI, water solubility index (WSI, and paste viscosity. The pre-gelatinized rice and bean flour had an intermediate value of WAI, 7.51 g/g, and high WSI value, 24.61%. Regarding proteins, it was verified an average content of 12.9% in the final product. The amino acid contents found in the pre-gelatinized flour indicate that the mixture has the essential amino acids. It was also found that the pre-gelatinized flour supplies more than 60% of the essential amino acids recommended for children aged one to three years old. The gelatinized flour composed of broken rice and split beans is an alternative to the use of these by-products of the manufacture process of rice and beans to obtain a product with viable technological characteristics and high nutritional value.

  19. Detection of radiation treatment of beans using DNA comet assay

    International Nuclear Information System (INIS)

    A simple technique of microgel electrophoresis of single cells (DNA Comet Assay) enabled a quick detection of radiation treatment of several kinds of leguminous beans (azuki, black, black eye, mung, pinto, red kidney and white beans). Each variety was exposed to radiation doses of 0.5, 1 and 5 kGy covering the permissible limits for insect disinfestation. The cells or nuclei from beans were extracted in cold PBS, embedded in agarose on microscope slides, lysed between 15 and 60 min in 2.5% SDS and electrophoresis was carried out at a voltage of 2 V/cm for 2-2.5 min. After silver staining, the slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA stretched towards the anode and the damaged cells appeared as a comet. The density of DNA in the tails increased with increasing radiation dose. However, in non-irradiated samples, the large molecules of DNA remained relatively intact and there was only minor or no migration of DNA; the cells were round or had very short tails only. Hence, the DNA comet assay provides an inexpensive, rapid and relatively simple screening method for the detection of irradiated beans

  20. Detection of radiation treatment of beans using DNA comet assay

    Science.gov (United States)

    Khan, Ashfaq A.; Khan, Hasan M.; Delincée, Henry

    2002-03-01

    A simple technique of microgel electrophoresis of single cells (DNA Comet Assay) enabled a quick detection of radiation treatment of several kinds of leguminous beans (azuki, black, black eye, mung, pinto, red kidney and white beans). Each variety was exposed to radiation doses of 0.5, 1 and 5kGy covering the permissible limits for insect disinfestation. The cells or nuclei from beans were extracted in cold PBS, embedded in agarose on microscope slides, lysed between 15 and 60min in 2.5% SDS and electrophoresis was carried out at a voltage of 2V/cm for 2-2.5min. After silver staining, the slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA stretched towards the anode and the damaged cells appeared as a comet. The density of DNA in the tails increased with increasing radiation dose. However, in non-irradiated samples, the large molecules of DNA remained relatively intact and there was only minor or no migration of DNA; the cells were round or had very short tails only. Hence, the DNA comet assay provides an inexpensive, rapid and relatively simple screening method for the detection of irradiated beans.

  1. Performance Evaluation of Rotating Cylinder Type Coffee Bean Roaster

    Directory of Open Access Journals (Sweden)

    Sutarsi

    2010-04-01

    Full Text Available One strategy attempts to reduce dependence on primary commodity markets are overseas market expansion and development of secondary products. In the secondary product processing coffee beans is required of supporting equipment to facilitate these efforts. Research Center for Indonesian Coffee and Cocoa has developed coffee bean roaster. However, there are still many people who do not know about the technical aspects of roaster machine type of rotating cylinder so that more people use traditional ways to roast coffee beans. In order for the benefits of this machine is better known society it is necessary to study on the technical aspects. The purpose of this research is to evaluate the technical performance of the coffee beans roaster machine type of rotating cylinder. These include the technical aspects of work capacity of the machine, roasting technical efficiency, fuel requirements, and power requirements of using roaster machine. Research methods are including data collection, calculation and analysis. The results showed that the roaster machine type of a rotating cylinder has capacity of 12.3 kg/hour. Roasting efficiency is 80%. Fuel consumption is 0.6 kg. The calculated amount of the used power of current measurement is the average of 0.616 kW.

  2. Characterization of white mold disease avoidance in common bean

    Science.gov (United States)

    White mold, caused by Sclerotinia sclerotiorum, is a devastating fungal disease of common bean (Phaseolus vulgaris L.) worldwide. Physiological resistance and disease avoidance conferred by plant architecture-related traits contribute to white mold field resistance. Our objective was to further exam...

  3. Microbiological safety of kinema: a fermented soya bean food.

    NARCIS (Netherlands)

    Nout, M.J.R.; Bakshi, D.; Sarkar, P.K.

    1998-01-01

    Kinema is a fermented soya bean food of Nepal and the hilly regions of Northeastern States of India. Generally, the fermentation is dominated by Bacillus spp. that often cause alkalinity and desirable stickiness in the product. The present study was undertaken in a limited number of commercial (mark

  4. Phenolic compound in beans as protection against mycotoxins.

    Science.gov (United States)

    Telles, Annie Campello; Kupski, Larine; Furlong, Eliana Badiale

    2017-01-01

    Phenolic compounds, their inhibitory activity against fungal amylase and the occurrence of aflatoxins were determined in edible beans. The free, conjugated and bounded phenolic compounds and their phenolic acid profiles were determined in ten bean varieties. A method for aflatoxin B1, B2, G1 and G2 determination and confirmation by LC-MS/MS was validated. The red and carioca beans presented the highest total phenolic content (1.8 and 1.2mg.g(-1), respectively); the fradinho and white beans the lowest (0.18 and 0.19mg.g(-1), respectively). In the free and conjugated forms, chlorogenic acid was present in 60% of the samples, while in the bounded phenolic, ferulic acid was in 90% of the samples. The phenolic extracts were able to inhibit fungal amylase, and the PCA analysis confirmed that the relation between the chlorogenic and gallic acids is important to this effect. The absence of aflatoxins in samples confirm the protector effects of these phenolic compounds. PMID:27507478

  5. Cooking Up a Learning Community with Corn, Beans, and Rice.

    Science.gov (United States)

    Howell, Nancy M.

    1999-01-01

    Describes using cooking as a vehicle for creating community among three culturally diverse classrooms of prekindergartners and third graders. Notes how the choice of corn, beans, and rice in the cooking exercise planted the roots of understanding, tolerance, and compassion, and an appreciation of diversity. (SD)

  6. Utilization of half-embryo test to identify irradiated beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Mancini-Filho, Jorge [Sao Paulo Univ., SP (Brazil). Faculdade de Ciencias Farmaceuticas; Delincee, Henry [Federal Research Centre for Nutrition - BFE, Karlsruhe (Germany)

    1996-07-01

    Germination tests were carried out in irradiated and non-irradiated bean seeds which allow to observe characteristically variations on the shoots and roots. The methodology used in this work, is based upon biological changes which occur in two Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macacar, irradiated in a {sup 60} Co source, with doses of 0,0.5, 1.0, 2.5, 5.0 and 10.0 kGy. The shoots and roots were observed during 3 days of culturing period under specified conditions. The differences observed in these two varieties were analysed immediately after irradiation and after 6 months of storage period at room temperature. Irradiated half-embryos showed markedly reduced root grow and almost totally retarded shoot elongation. Differences between irradiated and nonirradiated half-embryo could be observed after irradiation when different beans and storage time were varied. The shoots of half-embryos irradiated with more than 2.5 kGy did not undergo any elongation, whereas, the shoots of non-irradiated or those beans irradiated under 1.0 kGy elongated significantly within the 3 day test period. (author)

  7. What Can Students Learn about Lab Safety from Mr. Bean?

    Science.gov (United States)

    Carr, Jeremy M.; Carr, June M.

    2016-01-01

    Chemical laboratory safety education is often synonymous with boring, dry, drawn-out lectures. In an effort to challenge this norm and stimulate vivid learning opportunities about laboratory safety, college chemistry classes analyzed a short, humorous video clip of a character, named Mr. Bean, who visits a chemistry laboratory and commits several…

  8. Allelopathic potential of a noxious weed on mung bean

    Directory of Open Access Journals (Sweden)

    Parthapratim Maiti

    2013-10-01

    Full Text Available Eupatorium odoratum have invaded the waste lands of South West Bengal, India. A field study indicated a gradual and also significant increase in Eupatorium odoratum accompanied with significant decrease in other coexisting species. Considering the above in mind, a study was undertaken to evaluate the existence of inhibitory effect of leaf extracts and leaf leachates noxious weed Eupatorium odoratum using fully viable seeds of mung bean (Vigna radiata as the bioassay material. The study showed the reduced the percentage germination and TTC stainability along with extended T50 values of mung bean seeds. The levels of protein, DNA and RNA, activities of dehydrogenase and catalase enzymes were significantly retarded in pretreated seed samples. Amino acid and sugar levels were increased in the leachates of seeds pretreated with leaf extracts and leaf leachates. Thus, from the overall results it can be concluded that various inhibitors present in E. odoratum can impart strong inhibitory effect on mung bean. The study suggests that the leaves of E. odoratum possess phytotoxic or allelopathic chemicals which potentially rendered the inhibitory action on mung bean seeds.

  9. A Nomadic Subtelomeric Disease Resistance Gene Cluster in Common Bean

    Science.gov (United States)

    The B4 resistance (R)-gene cluster, located in subtelomeric region of chromosome 4, is one of the largest clusters known in common bean (Phaseolus vulgaris, Pv). We sequenced 650 kb spanning this locus and annotated 97 genes, 26 of which correspond to Coiled-coil-Nucleotide-Binding-Site-Leucine-Rich...

  10. WATER NEEDS FOR WINTER BEAN CROP

    Directory of Open Access Journals (Sweden)

    A.E. Klar

    1997-09-01

    Full Text Available A study of water use by bean winter crop (Phaseolus vulgaris, L., cv. Carioca was carried out in a Red Yellow Latosol, clay texture. A furrow irrigation system maintained soil water potentials higher than -40 KPa. Two broadcast nitrogen treatments (0 and 30 kg N/ha were applied 25 days after planting. The major objectives were to study the nitrogen and evapotranspiration interaction and measure the crop coefficients (Kc. The maximum average evapotranspiration (ETm was 1.71 mm/day, or 157.16 mm over 92 days of observations; the ETm values for the vegetative (1, flowering (2 and pod formation (3 phases were 1.48, 2.35, and 1.50 mm/day, respectively, for the 30 kg/ha nitrogen treatment, and 1.48, 1.88 and 1.45 mm/day for the no nitrogen treatment. The crop coefficients (Kc = ETm / ETo were 0.62 and 0.78 for the phase 1, 0.80 and 1.10 for the phase 2, 0.45 and 0.55 for the phase 3 and 0.61 and 0.80 for the entire cycle, based on the FAO-Penman and Class A Pan reference methods (ETo, respectively. The latter one was the best approach to estimate maximum water use by winter bean crop. Nitrogen treatments did not affect evapotranspiration significantly. However, the measured evapotranspiration obtained from the water balance method was 59.78 and 27.12% higher in the flowering than in the vegetative phase, respectively, under 30 and 0 kg N/ha.Um estudo sobre o uso de água do feijoeiro de inverno (Phaseolus vulgaris L. cv. Carioca foi realizado num solo Latossol Vermelho Amarelo de textura argilosa. Um sistema de sulcos de infiltração foi usado para proceder a irrigação com o intuito de manter o solo em potenciais de água superiores a -40,0 KPa. Duas doses de aplicação de N em cobertura (0 a 30 Kg N/ha foram colocados 25 dias após o plantio. Os principais objetivos do estudo foram: avaliar a interação entre as duas doses de N com a evapotranspiração e medir os coeficientes de cultura (Kc. A evapotranspiração média máxima (ETm foi 1,71 mm

  11. Evaluation of some bean lines tolerance to alkaline soil

    Directory of Open Access Journals (Sweden)

    Abeer A. Radi

    2012-01-01

    Full Text Available Introduction: In less arid climates, salts are less concentrated and sodium dominates in carbonate and bicarbonate forms, which enhance the formation of alkaline soils. The development and identification of salt-tolerant crop cultivars or lines would complement salt management programs to improve the productivity and yields of salt stressed plants.Materials and methods: This work was to study the evaluation of alkalinity tolerance of some bean lines grown under different levels of sodium carbonate (Na2CO3 to select the most alkalinity tolerant lines versus the most-sensitive ones out of 6 lines of the test plants.Results: The symptoms induced by alkalinity included reduction in root, shoot growth, and leaf area which were more severe in some bean lines. Potassium leakage was severely affected by alkalinity in some lines at all tested levels, while in some others a moderate damage was manifested only at the higher levels. The increase in Na2CO3 level was associated with a gradual fall in chlorophyll a and b biosynthesis of all the test bean lines. However, alkalinity at low and moderate levels had a favorable effect on the biosynthesis of carotenoids in all the test bean lines. The increase in Na2CO3 supply had a considerable stimulatory effect on sodium accumulation, while potassium accumulation fluctuated in organs of bean lines.Conclusion: Assiut 1104 out of all the different lines investigated was found to display the lowest sensitivity to alkalinity stress, while Assiut 12/104 was the most sensitive one.

  12. AGRICULTURAL PRACTICES, MORPHOLOGIC, PROTEINIC AND CULINARY DESCRIPTION OF THE GRAIN OF BEAN CULTIVARS SOWED IN THE REGION OF TLATZALA, GUERRERO

    Directory of Open Access Journals (Sweden)

    Fausto Solano Cervantes

    2009-08-01

    Full Text Available The research had for object describe the productive process of the of bean culture in the community of Tlatzala, Guerrero and the species diversity by means of the morphologic characteristics of the grain, protein content and the culinary quality. 30 questionnaires were applied to bean producers and 20 varieties of bean were collected from which the morphologic characters of the grain, protein content and the culinary characters were obtained. The production cycle of bean initiates in May and finishes in October. The technology used is traditional, characterized by the use of the yoke in the labors of the culture that demands workforce to realize the activities of manual form. The biological cycle of the varieties begins in June, the variation at time is determinated for the cultivated genotype. The determinate or indeterminate bush beans are predominant (65 %. The sowing systems are intercalated (50 % and associated with maize (30 % and monoculture (20 %. The varieties Rojito and Blanco have special uses, the first one has the attribute of being consumed as green-bean all the year around and the second one is used to prepare the dish called Chile-ajo. The Black beans were the most frequent (45 % followed by the Red beans (35 % and the least frequent were the Striped one (5 % and Muddy-like (5 %. The kidney shape of grain was the most abundant (85 % and the oval one was the least frequent (5 %. The grain weight changed from 14.4 up to 38.5 g. The sizes of grains founded were medium (50 % and small (50 %. The protein content registered was: White beans 24.68 %, Red bean 24.64 %, Black beans 23.5 % and Striped beans of guide 22.27 %. The Rojito Enano had the major protein content (27.6 %. The cooking times were: Red beans 73 minutes, Striped of guide bean 65.5, Blacks bean 64.6 and Whites bean 59. The Black bean Enano-1 used less time (54 minutes. The Striped of guide bean registered the major amount of solid (0.32 %, followed by the Black beans

  13. Nutritional composition and cooking characteristics of tepary bean (Phaseolus acutifolius Gray) in comparison with common bean (Phaseolus vulgaris L.)

    Science.gov (United States)

    Tepary bean is a highly abiotic stress tolerant orphan crop, however, there has been limited research on its nutritional value and cooking characteristics, key aspects when considering the potential for broader adoption globally. The goal of this study was to evaluate a large set of seed composition...

  14. Export and Competitiveness of Indonesian Coffee Bean in International Market: Strategic Implication for the Development of Organic Coffee Bean

    Directory of Open Access Journals (Sweden)

    Bambang Drajat

    2007-07-01

    Full Text Available The performance of Indonesian coffee bean export from 1995 to 2004was not satisfactory. This implied that there were problems of the competitiveness of Indonesian coffee bean export. This study was expected to come up withsome views related with the problem. This study was aimed to analyze the competitiveness of Indonesian coffee bean export in international markets. Somepolicy implication would be derived following the conclusions. In addition,this study was aimed to deliver some arguments referring to organic coffee development as an alternative export development. Data used in this study wastime series data ranging from 1995 to 2004 supported with some primary data.The export data were analyzed descriptively and the Revealed ComparativeAdvantage (RCA Index employed to analyze the competitiveness of Indonesian coffee bean export. The results of the analysis gave some conclusions, asfollows : (1 The export of Indonesian coffee bean was product oriented notmarket oriented. (2 The Indonesian coffee bean export was characterized withlow quality with no premium price, different from that of Vietnam coffee export. (3 Besides quality, the uncompetitive Indonesian coffee export was related to market hegemony by buyers, emerging issue of Ochratoxin A. contamination and high cost economy in export. (4 The competitiveness of Indonesian coffee export was lower than those other countries, such as Columbia,Honduras, Peru, Brazil, and Vietnam. (5 Indonesia still held opportunity todevelop organic coffee for export. Some policy implications emerged from thediscussion were as follows : (1 The Government should facilitate market development through the provisions of market information and export incentives.(2 The Government should develop and applied national standard of coffeebean referring to that of international, as well as, improve processing technology equipments in the farm level for both wet and dry process. (3 Besides improving quality, the improvement

  15. Phenotypic Variability and Diversity Analysis of Bean Traits of Some Cocoa Hybrids in Nigeria

    Directory of Open Access Journals (Sweden)

    A.V. Oyedokun

    2011-03-01

    Full Text Available It is essential to understand the economic potential and superiority among cocoa hybrids. Therefore, the present study aims at detecting variability among cocoa hybrids for bean index in Nigeria. Dried bean of fourteen genotypes of cocoa were evaluated for their bean values. Analysis of variance (ANOVA was used to understand the variability among the fourteen genotypes and Principal Component Analysis (PCA was employed to identify distinguishing traits and the grouping of the genotypes based on similarities. The fourteen cocoa genotypes were significantly (p≤0.05 different from each other with respect to weight of one bean, bean length, width, thickness, 100 bean weight, bean length to width, length to thickness and width to thickness ratio. All the studied morphometric characters exhibited high (>70% broad sense heritability. G8, the hybrid between T53/5 and N38 was the most superior genotype for bean weight and some other bean characteristics. The mass of seventy-four dried cocoa bean of G8 approximated 100 g. The first three Principal Component axes explained 91% of the total variation and the PCA grouped the fourteen genotypes into four distinct clusters. Genotypes could be selected for specific traits and improvement of traits seemed to be genetically reliable.

  16. Agronomic performance of naked oat (Avena nuda L. and faba bean intercropping

    Directory of Open Access Journals (Sweden)

    Agnieszka Klimek-Kopyra

    2015-06-01

    Full Text Available The most common cereals for faba bean (Vicia faba L. used in intercrops is conventional oat (Avena sativa L. An alternative to oat may be naked oat (Avena nuda L., whose oil content and quality is double. Here, intercropping of naked oat with two different faba bean cultivars (determinate-high tannin and indeterminate-low tannin was compared with sole crops of each species in 2006-2008. The treatments were: sole naked oat at 500 kernels m², indeterminate sole faba bean at 50 seeds m², determinate sole faba bean at 70 seeds m², and an additive series of 25%, 50%, and 75% of faba bean seeding rate mixed with the naked oat seeding rate. Our results demonstrated that intercropping increased the Land Equivalent Ratio by +3% to +9% over sole cropping. Raising the faba bean seeding rate in a mixture from 25% to 75% reduced oat grain yield from 630 (determinate cultivar to 760 kg ha-1 (indeterminate cultivar but increased faba bean grain yield from 760 kg ha-1. Higher yield and leaf area index (LAI and photosynthetically active radiation (PAR values show that the indeterminate cultivar of faba bean is more suitable in mixture with naked oat. The high value of competition index (CR > 1 indicates domination and aggressiveness of faba bean towards naked oat. Regardless of cultivar type, mixture of faba bean with naked oat is less productive than pure sowing.

  17. High-throughput metabolic profiling of diverse green Coffea arabica beans identified tryptophan as a universal discrimination factor for immature beans.

    Directory of Open Access Journals (Sweden)

    Daiki Setoyama

    Full Text Available The maturity of green coffee beans is the most influential determinant of the quality and flavor of the resultant coffee beverage. However, the chemical compounds that can be used to discriminate the maturity of the beans remain uncharacterized. We herein analyzed four distinct stages of maturity (immature, semi-mature, mature and overripe of nine different varieties of green Coffea arabica beans hand-harvested from a single experimental field in Hawaii. After developing a high-throughput experimental system for sample preparation and liquid chromatography-mass spectrometry (LC-MS measurement, we applied metabolic profiling, integrated with chemometric techniques, to explore the relationship between the metabolome and maturity of the sample in a non-biased way. For the multivariate statistical analyses, a partial least square (PLS regression model was successfully created, which allowed us to accurately predict the maturity of the beans based on the metabolomic information. As a result, tryptophan was identified to be the best contributor to the regression model; the relative MS intensity of tryptophan was higher in immature beans than in those after the semi-mature stages in all arabica varieties investigated, demonstrating a universal discrimination factor for diverse arabica beans. Therefore, typtophan, either alone or together with other metabolites, may be utilized for traders as an assessment standard when purchasing qualified trading green arabica bean products. Furthermore, our results suggest that the tryptophan metabolism may be tightly linked to the development of coffee cherries and/or beans.

  18. Changes of sour taste and the composition of carboxylic acids induced in brewed coffee by γ-irradiation on green beans and storage of roast beans

    International Nuclear Information System (INIS)

    Brazil santos green coffee beans were irradiated with 60Co-γ rays at doses of 0, 0.05, 0.5 and 1.5 Mrad respectively and changes of the composition of carboxylic acids in roast beans were analyzed by means of GLC together with those of the organoleptic properties of roast beans during storage by use of the cup testing. The total acid content immediately after roasting was about 6,000 mg/100 g (roast beans) and the composition of carboxylic acids was as follows. Chlorogenic acid: hydroxy-carboxylic acids: mono-carboxylic acid: others = 73 : 18 : 7 : 2. Fresh coffee flavour was influenced markedly especially in acid taste by both irradiation of γ-rays on green beans and storage of roast beans, because of the change of above acids composition. On γ-ray irradiation, the change of the acid composition were more clear than that of stored roast beans. Therefore, the quality of γ-irradiated coffee beans seems to be closely associated with the ratio of hydroxy-carboxylic acids mg/ monocarboxylic acids mg, but little with total acid content. (author)

  19. High-throughput metabolic profiling of diverse green Coffea arabica beans identified tryptophan as a universal discrimination factor for immature beans.

    Science.gov (United States)

    Setoyama, Daiki; Iwasa, Keiko; Seta, Harumichi; Shimizu, Hiroaki; Fujimura, Yoshinori; Miura, Daisuke; Wariishi, Hiroyuki; Nagai, Chifumi; Nakahara, Koichi

    2013-01-01

    The maturity of green coffee beans is the most influential determinant of the quality and flavor of the resultant coffee beverage. However, the chemical compounds that can be used to discriminate the maturity of the beans remain uncharacterized. We herein analyzed four distinct stages of maturity (immature, semi-mature, mature and overripe) of nine different varieties of green Coffea arabica beans hand-harvested from a single experimental field in Hawaii. After developing a high-throughput experimental system for sample preparation and liquid chromatography-mass spectrometry (LC-MS) measurement, we applied metabolic profiling, integrated with chemometric techniques, to explore the relationship between the metabolome and maturity of the sample in a non-biased way. For the multivariate statistical analyses, a partial least square (PLS) regression model was successfully created, which allowed us to accurately predict the maturity of the beans based on the metabolomic information. As a result, tryptophan was identified to be the best contributor to the regression model; the relative MS intensity of tryptophan was higher in immature beans than in those after the semi-mature stages in all arabica varieties investigated, demonstrating a universal discrimination factor for diverse arabica beans. Therefore, typtophan, either alone or together with other metabolites, may be utilized for traders as an assessment standard when purchasing qualified trading green arabica bean products. Furthermore, our results suggest that the tryptophan metabolism may be tightly linked to the development of coffee cherries and/or beans. PMID:23936381

  20. Two Newly Described Begomoviruses of Macroptilium lathyroides and Common Bean.

    Science.gov (United States)

    Idris, A M; Hiebert, E; Bird, J; Brown, J K

    2003-07-01

    ABSTRACT Macroptilium lathyroides, a perennial weed in the Caribbean region and Central America, is a host of Macroptilium yellow mosaic Florida virus (MaYMFV) and Macroptilium mosaic Puerto Rico virus (MaMPRV). The genomes of MaYMFV and MaMPRV were cloned from M. lathyroides and/or field-infected bean and the DNA sequences were determined. Cloned A and B components for both viruses were infectious when inoculated to M. lathyroides and common bean. Comparison of the DNA sequences for cloned A and B components with well-studied begomovirus indicated that MaMPRV (bean and M. lathyroides) and MaYMFV (M. lathyroides) are unique, previously undescribed begomo-viruses from the Western Hemisphere. Phylogenetic analysis of viral A components indicated that the closest relative of MaYMFV are members of the Bean golden yellow mosaic virus (BGYMV) group, at 76 to 78% nucleotide identity, whereas the closest relative for the A component of MaMPRV was Rhynchosia golden mosaic virus at 78% nucleotide identity. In contrast, BGYMV is the closest relative for the B component of both MaYMFV and MaMPRV, with which they share approximately 68.0 and approximately 72% identity, respectively. The incongruent taxonomic placement for the bipartite components for MaMPRV indicates that they did not evolve entirely along a common path. MaYMFV and MaMPRV caused distinctive symptoms in bean and M. lathyroides and were transmissible by the whitefly vector and by grafting; however, only MaYMFV was mechanically transmissible. The experimental host range for the two viruses was similar and included species within the families Fabaceae and Malvaceae, but only MaYMFV infected Malva parviflora and soybean. These results collectively indicate that MaMPRV and MaYMFV are new, previously undescribed species of the BGYMV group, a clade previously known to contain only strains and isolates of BGYMV from the Caribbean region that infect Phaseolus spp. Both MaYMFV and MaMPRV may pose an economic threat to

  1. Distinction of Ecuadorian varieties of fermented cocoa beans using Raman spectroscopy.

    Science.gov (United States)

    Vargas Jentzsch, Paul; Ciobotă, Valerian; Salinas, Wilson; Kampe, Bernd; Aponte, Pedro M; Rösch, Petra; Popp, Jürgen; Ramos, Luis A

    2016-11-15

    Cocoa (Theobroma cacao) is a crop of economic importance. In Ecuador, there are two predominant cocoa varieties: National and CCN-51. The National variety is the most demanded, since its cocoa beans are used to produce the finest chocolates. Raman measurements of fermented, dried and unpeeled cocoa beans were performed using a handheld spectrometer. Samples of the National and CCN-51 varieties were collected from different provinces and studied in this work. For each sample, 25 cocoa beans were considered and each bean was measured at 4 different spots. The most important Raman features of the spectra were assigned and discussed. The spectroscopic data were processed using chemometrics, resulting in a distinction of varieties with 91.8% of total accuracy. Differences in the average Raman spectra of cocoa beans from different sites but within the same variety can be attributed to environmental factors affecting the cocoa beans during the fermentation and drying processes.

  2. Distinction of Ecuadorian varieties of fermented cocoa beans using Raman spectroscopy.

    Science.gov (United States)

    Vargas Jentzsch, Paul; Ciobotă, Valerian; Salinas, Wilson; Kampe, Bernd; Aponte, Pedro M; Rösch, Petra; Popp, Jürgen; Ramos, Luis A

    2016-11-15

    Cocoa (Theobroma cacao) is a crop of economic importance. In Ecuador, there are two predominant cocoa varieties: National and CCN-51. The National variety is the most demanded, since its cocoa beans are used to produce the finest chocolates. Raman measurements of fermented, dried and unpeeled cocoa beans were performed using a handheld spectrometer. Samples of the National and CCN-51 varieties were collected from different provinces and studied in this work. For each sample, 25 cocoa beans were considered and each bean was measured at 4 different spots. The most important Raman features of the spectra were assigned and discussed. The spectroscopic data were processed using chemometrics, resulting in a distinction of varieties with 91.8% of total accuracy. Differences in the average Raman spectra of cocoa beans from different sites but within the same variety can be attributed to environmental factors affecting the cocoa beans during the fermentation and drying processes. PMID:27283632

  3. Phytochemical characteristics of coffee bean treated by coating of ginseng extract.

    Science.gov (United States)

    Choi, Sang Yoon; Hong, Hee-Do; Bae, Hye-Min; Choi, Changsun; Kim, Kyung-Tack

    2011-11-01

    THE PRINCIPAL OBJECTIVE OF THIS STUDY WAS TO ASSESS THE INSTRUMENTAL AND SENSORY CHARACTERISTICS OF GINSENG COFFEE WITH DIFFERENT RATIOS OF THE INGREDIENTS: type of coffee bean (Colombia, Brazil, and Indonesia), type of ginseng extract (white ginseng, red ginseng, and America ginseng) and concentration of ginseng extract (3, 6, and 9 w/v %). The sensory optimal condition of white ginseng coffee, red ginseng coffee and America ginseng coffee were as follows: 3% Indonesian coffee bean coated with 3% white ginseng extract, Colombian coffee bean coated with 6% red ginseng extract and Colombian coffee bean coated with 3% American ginseng extract, respectively. In particular, the Colombian coffee bean coated with 6% red ginseng extract had significantly higher scores than other samples in terms of flavor, taste, and overall preference. Additionally, the contents of total ginsenoside and total sugar and total phenolic compounds were also highest in the Colombian coffee bean coated with 6% red ginseng extract. PMID:23717089

  4. Study on Drying Edible Soya-bean Oil Using Solar Energy

    Institute of Scientific and Technical Information of China (English)

    LIU Shengyong; LIU Peng; SHEN Xiaozhen; XU Guizhuan; SU Chaojie; CAI Xianjie

    2010-01-01

    Soya-bean oil(bean dregs)was dried in a solar energy drying system.Characteristics of the process were measured and the corresponding curves were done.The practicability of this process has been discussed.The results showed that the solar drying system could completely meet technological requirements of drying soy-bean oil,and it was feasible in technology to use the solar drying system to dry the vegetable oil.

  5. Viruses of faba bean (Vicia faba L.) in Morocco; surveying, identification, and ecological aspects.

    OpenAIRE

    Fortass, M

    1993-01-01

    A systematic virus survey covering the main areas where faba bean ( Viciafaba L.) is grown in Morocco was conducted in 1988 and 1990. From the 240 leaf samples collected on the basis of symptoms suggestive of virus infection from 52 fields, the following viruses were detected by means of electron microscopy, biological indexing, and serology, and their incidence and geographical distribution were assessed: alfalfa mosaic virus (AMV), bean yellow mosaic virus (BYMV), broad bean mottle virus (B...

  6. Italian Common Bean Landraces: History, Genetic Diversity and Seed Quality

    Directory of Open Access Journals (Sweden)

    Angela R. Piergiovanni

    2010-05-01

    Full Text Available The long tradition of common bean cultivation in Italy has allowed the evolution of many landraces adapted to restricted areas. Nowadays, in response to market demands, old landraces are gradually being replaced by improved cultivars. However, landraces still survive in marginal areas of several Italian regions. Most of them appear severely endangered with risk of extinction due to the advanced age of the farmers and the socio-cultural context where they are cultivated. The present contribution is an overview of the state of the art about the knowledge of Italian common bean germplasm, describing the most important and recent progresses made in its characterization, including genetic diversity and nutritional aspects.

  7. Formaldehyde exposure affects growth and metabolism of common bean

    International Nuclear Information System (INIS)

    Recent state and federal directives have slated a substantial increase in the use of methanol as an alternative to gasoline in both fleet and private vehicles in the coming decade. The incomplete combustion of methanol produces formaldehyde vapor, and catalytic converter technology that completely oxidizes formaldehyde has yet to be developed. The approach of this study was to use a range of methanol concentrations encompassing levels currently found or that may occur in the future in the ambient air of some heavily polluted areas to test the potential phytotoxicity of formaldehyde. The study had the following objectives: (1) design and build a formaldehyde vapor generator with sufficient capacity for long-term plant fumigations; (2) determine growth response of common bean to formaldehyde; (3) evaluate physiological and biochemical changes of bean plants associated with formaldehyde exposures. 20 refs., 2 figs., 2 tabs

  8. BEANS - a software package for distributed Big Data analysis

    CERN Document Server

    Hypki, Arkadiusz

    2016-01-01

    BEANS software is a web based, easy to install and maintain, new tool to store and analyse data in a distributed way for a massive amount of data. It provides a clear interface for querying, filtering, aggregating, and plotting data from an arbitrary number of datasets. Its main purpose is to simplify the process of storing, examining and finding new relations in the so-called Big Data. Creation of BEANS software is an answer to the growing needs of the astronomical community to have a versatile tool to store, analyse and compare the complex astrophysical numerical simulations with observations (e.g. simulations of the Galaxy or star clusters with the Gaia archive). However, this software was built in a general form and it is ready to use in any other research field or open source software.

  9. Locust bean gum: Exploring its potential for biopharmaceutical applications

    Directory of Open Access Journals (Sweden)

    Marita Dionísio

    2012-01-01

    Full Text Available Polysaccharides have been finding, in the last decades, very interesting and useful applications in the biomedical and, specifically, in the biopharmaceutical field. Locust bean gum is a polysaccharide belonging to the group of galactomannans, being extracted from the seeds of the carob tree (Ceratonia siliqua. This polymer displays a number of appealing characteristics for biopharmaceutical applications, among which its high gelling capacity should be highlighted. In this review, we describe critical aspects of locust bean gum, contributing for its role in biopharmaceutical applications. Physicochemical properties, as well as strong and effective synergies with other biomaterials are described. The potential for in vivo biodegradation is explored and the specific biopharmaceutical applications are discussed.

  10. 力争第二的Coffee Bean

    Institute of Scientific and Technical Information of China (English)

    蔡正蓁

    2003-01-01

    一个小雨的午后,在新加坡繁华的Orchard大街上的连锁咖啡店“Coffee Bean & Tea Leaf”里,维克多·沙宣从他的座位上一跃而起,脱口而出:“下雨了,我得把屋顶打开。”短短几秒钟之内,在天井上方。

  11. Microstructural Differences Among Adzuki Bean (Vigna Angularis) Cultivars

    OpenAIRE

    Engquist, Anup; Swanson, Barry G.

    1992-01-01

    Scanning electron microscopy (SEM) was used to study microstructural differences among five adzuki bean cultivars: Erimo, Express, Hatsune, Takara and VBSC. Seed coat surfaces showed different patterns of cracks, pits and deposits . Cross-sections of the seed coats revealed well organized layers of elongated palisade cells followed by many layers of amorphous parenchyma cells. Typical sub-epidermal layers of organized columnar, hour-glass cells were characteristica11y absent in the five culti...

  12. The cholesterol-raising factor from coffee beans.

    OpenAIRE

    Urgert, R.; Katan, M B

    1996-01-01

    Coffee beans and some types of coffee brew - not the regular types of coffee prepared with a paper filter or with soluble coffee granules - contain the diterpenes cafestol and kahweol. Cafestol and kahweol raise the serum concentration of cholesterol and triglycerides in humans, and they also appear mildly to affect the integrity of liver cells. Both effects are transient after withdrawal of the diterpenes, and it is as yet unsure whether these effects are associated. Patients at increased ri...

  13. A better bean. Reports from the field -- Latin America.

    Science.gov (United States)

    Powell, D

    1997-01-01

    Researchers from the Colegio de Postgraduados, in partnership with the University of Guelph in Canada, have used horizontal resistance breeding, without the aid of pesticides, to more than triple the yield of locally grown black beans. J.E. Vanderplank, a South African plant pathologist, coined the terms "vertical" and "horizontal" for the types of crop plant resistance in 1963. The former involves a single gene and breaks down when new pathogens appear; the latter involves several genes and is a more durable form of resistance to disease or to insects. Enhancing vertical resistance, which is based on classical Mendelian breeding techniques, requires crossing a wild plant that possesses the desired gene with a cultivar to create a hybrid; the hybrid offspring are then backcrossed with the cultivar parent for several generations until a hybrid is created that is identical to the cultivar, except for the wild parent's resistance gene. In horizontal resistance breeding, the best individuals from each generation are selected and bred with each other. According to Raoul Robinson, a Canadian crop scientist and member of the plant breeding team supported by IDRC, breeding to enhance vertical resistance, or under the protection of insecticides and fungicides, has caused the level of horizontal resistance to decline and plant susceptibility to parasites to increase. Dr. Robinson and Dr. Roberto Garcia Espinosa (the Mexican project manager) began their work using horizontal resistance breeding in black beans in 1991. Yields of 1500 kg/hectare were achieved in two breeding cycles (two years) without the use of pesticides. The average bean yield in the Mixteca region of Mexico is 400 kg/hectare with the use of pesticides. The 200,000 small farmers in the area cultivate over 300,000 hectares, 40,000 of which are beans. The breeding techniques used in this project can be applied to other crops and in other countries.

  14. Radiation disinfestation of dry leaf tobacco and coffee beans

    International Nuclear Information System (INIS)

    Preliminary tests conducted to determine the effect of gamma radiation in Araecerus fasciculatus De Geer indicated little differences in the mortality of insects exposed to 0.10-0.40 kGy. Other insects in the 2 kg bean lots were minimally affected by a dose of 0.05 kGy, but doses of 0.10-0.40 kGy resulted in nearly complete mortality. In 60 kg jute bags of export coffee exposed to 0.665-0.958 kGy, all the insects were dead when examined 1 month after irradiation. At 6 months, most of the untreated beans were damaged. In 15 kg tin cans, all the insects in both the irradiated and untreated cans were dead within 1 month; the insects in the untreated cans probably died from lack of oxygen and an increase in carbon dioxide. Irradiation had no detectable effect on the caffeine, fat and moisture contents, or on the pH. No moisture was gained by the coffee beans in cans, while the moisture in beans in jute bags increased from 9.6% to about 13.7% within 1 month. Export bales of leaf tobacco (about 100 kg, 100 cm x 75 cm x 40 cm) were artificially infested with Lasioderma serricorne (F.) and irradiated with 0.30-0.60 kGy at a rate of 0.5-1.0 kGy per hour. The bales were repositioned 12 times to provide thorough exposure to the gamma rays. There was no increase in the number of insects during the 6 months of storage; however, live insects were found at 2 months. Live insects found at the initial examination in phosphine fumigated bales indicated inadequate fumigation. A dose of 5 kGy had no effect on the nicotine content, the volatile oil content or composition, or the pH. (author). 11 refs, 3 figs, 10 tabs

  15. Trichoderma spp. decrease Fusarium root rot in common bean

    Directory of Open Access Journals (Sweden)

    Hudson Teixeira

    2012-12-01

    Full Text Available The effectiveness of six Trichoderma-based commercial products (TCP in controlling Fusarium root rot (FRR in common bean was assessed under field conditions. Three TCP, used for seed treatment or applied in the furrow, increased seedling emergence as much as the fungicide fludioxonil. FRR incidence was not affected, but all TCP and fludioxonil reduced the disease severity, compared to control. Application of Trichoderma-based products was as effective as that of fludioxonil in FRR management.

  16. Water infiltration in an ultisol after cultivation of common bean

    OpenAIRE

    Maria Aparecida do Nascimento dos Santos; Elói Panachuki; Teodorico Alves Sobrinho; Paulo Tarso Sanches de Oliveira; Dulce Buchala Bicca Rodrigues

    2014-01-01

    Water infiltration in the soil is an important hydrological process that occurs at the interface of the soil-atmosphere system; thus, the soil management practice used has a strong influence on this process. The aim of this study was to evaluate water infiltration in the soil and compare equations for estimating the water infiltration rate in an Ultisol after harvesting common bean (Phaseolus vulgaris L.) under simulated rainfall. Field tests with a rainfall simulator were carried out in thre...

  17. Impact of Molecular Technologies on Faba Bean (Vicia faba L. Breeding Strategies

    Directory of Open Access Journals (Sweden)

    Tao Yang

    2012-07-01

    Full Text Available Faba bean (Vicia faba L. is a major food and feed legume because of the high nutritional value of its seeds. The main objectives of faba bean breeding are to improve yield, disease resistance, abiotic stress tolerance, seed quality and other agronomic traits. The partial cross-pollinated nature of faba bean introduces both challenges and opportunities for population development and breeding. Breeding methods that are applicable to self-pollinated crops or open-pollinated crops are not highly suitable for faba bean. However, traditional breeding methods such as recurrent mass selection have been established in faba bean and used successfully in breeding for resistance to diseases. Molecular breeding strategies that integrate the latest innovations in genetics and genomics with traditional breeding strategies have many potential applications for future faba bean cultivar development. Hence, considerable efforts have been undertaken in identifying molecular markers, enriching genetic and genomic resources using high-throughput sequencing technologies and improving genetic transformation techniques in faba bean. However, the impact of research on practical faba bean breeding and cultivar release to farmers has been limited due to disconnects between research and breeding objectives and the high costs of research and implementation. The situation with faba bean is similar to other small crops and highlights the need for coordinated, collaborative research programs that interact closely with commercially focused breeding programs to ensure that technologies are implemented effectively.

  18. Tannins, trypsin inhibitors and lectin cytotoxicity in tepary (Phaseolus acutifolius) and common (Phaseolus vulgaris) beans.

    Science.gov (United States)

    De Mejia, Elvira Gonzalez; Del Carmen Valadez-Vega, Maria; Reynoso-Camacho, Rosalia; Loarca-Pina, Guadalupe

    2005-09-01

    This study compared the levels of antinutritional components and cytotoxic effect of extracts, from tepary (Phaseolus acutifolius) and common (Phaseolus vulgaris) beans. Antinutritional factors were evaluated by determining their effect on the viability of epithelial cells isolated from rat small intestine. The protein and carbohydrates content were similar in all the genotypes studied (20 and 60%, respectively). Common beans presented higher content of trypsin inhibitors, tannins and lectins than tepary beans. There was not a significant correlation between tannins and cooking time. However, water absorption and cooking time correlated significantly (p lectin activity (1302-18161 Ul/mg) of extracts from different beans. Tannins, lectins, trypsin inhibitors and fat content differed between bean varieties whereas protein content was similar. The percent cellularity on rat epithelial cells was significantly different among protein extracts from different bean cultivars and ranged between 53.5% and 87.4% (p < 0.05). These results suggest that the incorporation of tepary beans in the diet would not alter the current nutritional contribution of common beans or introduce adverse toxic effects. The agronomic characteristics of tepary beans make them attractive for cultivation. However, the harder to cook phenomenon may be a limiting factor that needs further consideration. PMID:16187017

  19. Navy Bean Flour Particle Size and Protein Content Affect Cake Baking and Batter Quality(1).

    Science.gov (United States)

    Singh, Mukti; Byars, Jeffrey A; Liu, Sean X

    2015-06-01

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to 3 levels with navy bean starch. The effect of navy bean flour and its fractions at 3 levels of protein on cake batter rheology and cake quality was studied and compared with wheat flour samples. Batters prepared from navy bean flour and its fractions had higher viscosity than the cake flour. Reducing the protein content by addition of starch significantly lowered the viscosity of cake batters. The whole navy bean flour and coarse bean fraction cakes were softer than cakes made with wheat flour but had reduced springiness. Principal component analysis showed a clear discrimination of cakes according to protein. It also showed that low protein navy bean flour cakes were similar to wheat flour cakes. Navy bean flour with protein content adjusted to the level of cake (wheat) flour has potential as a healthy alternative in gluten-free cakes.

  20. Navy Bean Flour Particle Size and Protein Content Affect Cake Baking and Batter Quality(1).

    Science.gov (United States)

    Singh, Mukti; Byars, Jeffrey A; Liu, Sean X

    2015-06-01

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to 3 levels with navy bean starch. The effect of navy bean flour and its fractions at 3 levels of protein on cake batter rheology and cake quality was studied and compared with wheat flour samples. Batters prepared from navy bean flour and its fractions had higher viscosity than the cake flour. Reducing the protein content by addition of starch significantly lowered the viscosity of cake batters. The whole navy bean flour and coarse bean fraction cakes were softer than cakes made with wheat flour but had reduced springiness. Principal component analysis showed a clear discrimination of cakes according to protein. It also showed that low protein navy bean flour cakes were similar to wheat flour cakes. Navy bean flour with protein content adjusted to the level of cake (wheat) flour has potential as a healthy alternative in gluten-free cakes. PMID:25922214

  1. An increase in renal dopamine does not stimulate natriuresis after fava bean ingestion123

    OpenAIRE

    Garland, Emily M.; Cesar, Tericka S; Lonce, Suzanna; Ferguson, Marcus C.; Robertson, David

    2013-01-01

    Background: Fava beans (Vicia faba) contain dihydroxyphenylalanine (dopa), and their ingestion may increase dopamine stores. Renal dopamine regulates blood pressure and blood volume via a natriuretic effect.

  2. [Broad beans (Vicia fava, L.) as an alternative source of protein in chick diets].

    Science.gov (United States)

    Bezares, A; Cuca, M; Avila, E; Velásquez, C

    1980-03-01

    Three experiments were conducted to study the possibility of improving the nutritive value of broad beans (Vicia faba, L.) in poultry diets. In the first experiment, raw and autoclaved (1.0 kg/cm2/15 min) beans, with and without antibiotic supplementation, were studied. The results after 21 days showed no significant differences among treatments in regard to body weight. In feed conversion, however, a significant difference was observed when diets prepared with raw beans were supplemented with 20 ppm of flavomycin. In the second experiment raw and autoclaved beans were supplemented with 0, 10, and 20 ppm of virginiamycin and 200 and 400 ppm of flavomycin to study the effect of these two antibiotics. After 28 days, the results indicated no significant differences with antibiotic supplementation in either raw or autoclaved beans. However, a significant difference (P < 0.05) in body weight was found when beans were autoclaved. In the third experiment, two levels, 31 and 76% of raw and autoclaved beans, were included in the chick diets. The results in body weight, after 28 days, did not show any significant differences between raw and autoclaved beans fed at a 31% level. With the 76% level the autoclaved treatment, however, induced a significantly higher body weight than the diets containing raw beans. PMID:7447590

  3. Specific pretreatments reduce curing period of vanilla (Vanilla planifolia) beans.

    Science.gov (United States)

    Sreedhar, R V; Roohie, K; Venkatachalam, L; Narayan, M S; Bhagyalakshmi, N

    2007-04-18

    With the aiming of reducing the curing period, effects of pretreatments on flavor formation in vanilla beans during accelerated curing at 38 degrees C for 40 days were studied. Moisture loss, change in texture, levels of flavoring compounds, and activities of relevant enzymes were compared among various pretreatments as well as the commercial sample. Use of naphthalene acetic acid (NAA; 5 mg/L) or Ethrel (1%) with blanching pretreatment resulted in 3-fold higher vanillin on the 10th day. Other flavoring compounds-vanillic acid, p-hydroxybenzoic acid, and p-hydroxybenzaldehyde-fluctuated greatly, showing no correlation with the pretreatments. Scarification of beans resulted in nearly 4- and 3.6-fold higher vanillin formations on the 10th day in NAA- and Ethrel-treated beans, respectively, as compared to control with a significant change in texture. When activities of major relevant enzymes were followed, addition of NAA or Ethrel helped to retain higher levels of cellulase throughout the curing period and higher levels of beta-glucosidase on the 20th day that correlated with higher vanillin content during curing and subsequent periods. Peroxidase, being highest throughout, did not correlate with the change in levels of major flavoring compounds. The pretreatment methods of the present study may find importance for realizing higher flavor formation in a shorter period because the major quality parameters were found to be comparable to those of a commercial sample.

  4. Adzuki beans (Vigna angularis seed quality under several drying conditions

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.

  5. FTIR Spectroscopic Study of Broad Bean 3iseased Leaves

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    [Objective] The aim was to indentify diseased leaves of broad bean by vibra- tional spectroscopy. [Method] In this paper, broad bean rust, fusarium rhizome rot, broad bean zonate spot, yellow leaf curl virus and normal leaves were studied using Fourier transform infrared spectroscopy combined with chemometrics. [Result] The spectra of the samples were similar, only with minor differences in absorption inten- sity of several peaks. Second derivative analyses show that the significant difference of all samples was in the range of 1 200-700 cm2. The data in the range of 1 200- 700 cm' were selected to evaluate correlation coefficients, hierarchical cluster analy- sis (HCA) and principal component analysis (PCA). Results showed that the correla- tion coefficients are larger than 0.928 not only between the healthy leaves, but also between the same diseased leaves. The values between healthy and diseased leaves, and among diseased leaves, are all declined. HCA and PCA yielded about 73.3% and 82.2% accuracy, respectively. [Conclusion] This study demonstrated that FTIR techniques might be used to detect crop diseases.

  6. Drying of green bean and okra under solar energy

    Directory of Open Access Journals (Sweden)

    İBRAHİM DOYMAZ

    2011-06-01

    Full Text Available In this study, sun drying characteristics of green bean and okra were investigated. Drying experiments were conducted in Iskenderun-Hatay, Turkey. The drying study showed that the times taken for drying of green bean and okra from the initial moisture contents of 89.5% and 88.7% (w.b. to final moisture content of around 15±0.5% (w.b. were 60 and 100 h in open sun drying, respectively. The constant rate period is absent in drying curves. The drying process took place in the falling rate period. The drying data were fitted to thirteen thin-layer drying models. The performance of these models was investigated by comparing the determination of coefficient (R2, reduced chi-square (2 and root mean square error (RMSE between the observed and predicted moisture ratios. Estimations by Approximation of diffusion (for green bean and Midilli et al. models (for okra were in good agreement with the experimental data obtained.

  7. Changes in flavour and taste of irradiated coffee beans

    International Nuclear Information System (INIS)

    The possibility of changes in the smell and taste of coffee from beans submitted to irradiation for preservation is a significant gap in the programme devoted to increasing the product life time with such a process. Therefore, the main objective of the paper was to evaluate changes in aroma and flavour that can be noticed by the consumer. Coffee beans were given disinfestation doses of 50krad, producing an insect mortality rate of 98.33% +-2.89 in Araecerus fasciculatus (adult stage). The samples, provided by IBC, were from the same crop and free from pesticides. Some of the material was kept by that Institute for organoleptic tests. The remainder was sent to the National Institute of Technology for gas-chromatographic analysis. Should any significant changes be noticed, it could be assumed that the gamma-irradiation process would be rejected by the consumer. However, no significant change was observed in the most important characteristics, flavour and aroma, that might induce the consumer to reject irradiated coffee beans. (author)

  8. Changes in Flavour and Taste of Irradiated Coffee Beans

    International Nuclear Information System (INIS)

    The possibility of changes in the smell and taste of coffee from beans submitted to irradiation for preservation is a significant gap in the programme devoted to increasing the product life time with such a process. Therefore, the main objective of the paper was to evaluate changes in aroma and flavour that can be noticed by the consumer. Coffee beans were given disinfestation doses of 50 krad, producing an insect mortality rate of 98.33% ± 2.89 in Araecerus fasciculatus (adult stage). The samples, provided by IBC, were from the same crop and free from pesticides. Some of the material was kept by that Institute for organoleptic tests. The remainder was sent to the National Institute of Technology for gas-chromatographic analysis. Should any significant changes be noticed, it could be assumed that the gamma-irradiation process would be rejected by the consumer. However, no significant change was observed in the most important characteristics, flavour and aroma, that might induce the consumer to reject irradiated coffee beans. (author)

  9. The water budget of rainfed maize and bean intercrop

    Science.gov (United States)

    Walker, S.; Ogindo, H. O.

    Food production in the South African Development Community (SADC) region is predominantly under rainfed conditions and therefore experiences annual fluctuations due to the rainfall variability. Although the staple food of maize ( Zea mays) is commonly grown in the same field as dry beans ( Phaseolus vulgaris) little work has been done to characterize the soil water budget of this intercropping system. The evapotranspiration can theoretically be divided into transpiration from the leaves and evaporation from the soil surface. However, it is difficult to separate the components in field studies. In this paper the Ritchie model is used to estimate the soil surface evaporation using the fractional radiation interception which depends on the crop leaf area. The intercropping system has higher leaf area than the sole crops of both maize and beans in all seasons. Therefore, the soil surface is shaded and the canopy is more dense resulting in a lower soil surface evaporation. The water budget thus gives a higher value of transpiration for the intercrop during each of the four growing seasons. This appears to be due to the complimentary use of the water resources by the maize and bean plants in the intercropping system. This illustrates the ability of the intercrop to use the available soil water in a semi-arid environment more productively. Thus the experience of the small-holder farmers in the SADC region is based on sound physical principles of water use by the two crops.

  10. Castor bean (Ricinus communis L.) as a potential environmental bioindicator.

    Science.gov (United States)

    Mendes, M G; Santos Junior, C D; Dias, A C C; Bonetti, A M

    2015-10-21

    Biomonitoring of air quality using living organisms is a very interesting approach to environmental impact assessment. Organisms with a vast distribution, such as plants, are widely used for these purposes. The castor bean (Ricinus communis L.) is an oleaginous plant that can potentially be used as a bioindicator plant owing to its rapid growth and large leaves, which have a wide surface area of contact with the air and the pollutants therein. This study investigated the the bioindicator potential of the castor bean by performing several tests. We observed statistically significant differences in the concentrations of chlorophyll a and b in the leaves of plants in polluted areas compared to that in the control group plants, which were located in a pollution-free area. Leaves of plants in the former group had higher peroxidase activity and showed a greater buffering ability than those of plants in the control group. The pKa values obtained via buffering capacity tests, revealed the presence of aminoazobenzene (an industrial dye) in leaves of R. communis. Genotoxicity was evaluated through the comet assay technique and revealed that other than some differences in DNA fragmentation, there is no statistically significant difference in this parameter between places analyzed. Our data indicate that R. communis can be a highly useful biological indicator. Further, we hypothesized that the castor bean can be a potential candidate for phytoremediation owing its physiological buffering capacity when exposed to substantial pollution.

  11. Populational survey of arthropods on transgenic common bean expressing the rep gene from Bean golden mosaic virus.

    Science.gov (United States)

    Pinheiro, Patrícia V; Quintela, Eliane D; Junqueira, Ana Maria R; Aragão, Francisco J L; Faria, Josias C

    2014-01-01

    Genetically modified (GM) crops is considered the fastest adopted crop technology in the history of modern agriculture. However, possible undesirable and unintended effects must be considered during the research steps toward development of a commercial product. In this report we evaluated effects of a common bean virus resistant line on arthropod populations, considered as non-target organisms. This GM bean line (named M1/4) was modified for resistance against Bean golden mosaic virus (BGMV) by expressing a mutated REP protein, which is essential for virus replication. Biosafety studies were performed for a period of three years under field conditions. The abundance of some species was significantly higher in specific treatments in a particular year, but not consistently different in other years. A regular pattern was not observed in the distribution of insects between genetically modified and conventional treatments. Data analyses showed that minor differences observed can be attributed to random variation and were not consistent enough to conclude that the treatments were different. Therefore the present study indicates that the relative abundance of species are similar in transgenic and non-transgenic fields. PMID:24922280

  12. Effect of raw soya bean particle size on productive performance and digestion of dairy cows.

    Science.gov (United States)

    Naves, A B; Freitas Júnior, J E; Barletta, R V; Gandra, J R; Calomeni, G D; Gardinal, R; Takiya, C S; Vendramini, T H A; Mingoti, R D; Rennó, F P

    2016-08-01

    Differing soya bean particle sizes may affect productive performance and ruminal fermentation due to the level of fatty acid (FA) exposure of the cotyledon in soya bean grain and because the protein in small particles is more rapidly degraded than the protein in large particles, which influence ruminal fibre digestion and the amounts of ruminally undegradable nutrients. The objective of this experiment was to investigate the effects of raw soya bean particle size on productive performance, digestion and milk FA profile of dairy cows. Twelve Holstein cows were assigned to three 4 × 4 Latin squares with 21-day periods. At the start of the experiment, cows were 121 days in milk (DIM) and yielded 30.2 kg/day of milk. Cows were fed 4 diets: (i) control diet (CO), without raw soya bean; (ii) whole raw soya bean (WRS); (iii) cracked raw soya bean in Wiley mill 4-mm screen (CS4); and (iv) cracked raw soya bean in Wiley mill 2-mm screen (CS2). The inclusion of soya beans (whole or cracked) was 200 g/kg on dry matter (DM) basis and partially replaced ground corn and soya bean meal. Uncorrected milk yield and composition were not influenced by experimental diets; however, fat-corrected milk (FCM) decreased when cows were fed soya bean treatments. Soya bean diets increased the intake of ether extract (EE) and net energy of lactation (NEL ), and decreased the intake of DM and non-fibre carbohydrate (NFC). Ruminal propionate concentration was lower in cows fed WRS than cows fed CS2 or CS4. Cows fed cracked raw soya bean presented lower nitrogen in faeces than cows fed WRS. The milk of cows fed WRS, CS2 and CS4 presented higher unsaturated FA than cows fed CO. The addition of raw soya bean in cow diets, regardless of the particle size, did not impair uncorrected milk yield and nutrient digestion, and increased the concentration of unsaturated FA in milk. Cows fed cracked raw soya bean presented similar productive performance to cows fed whole raw soya bean.

  13. Effects of dietary cooked navy bean on the fecal microbiome of healthy companion dogs.

    Directory of Open Access Journals (Sweden)

    Katherine R Kerr

    Full Text Available BACKGROUND: Cooked bean powders are a promising novel protein and fiber source for dogs, which have demonstrated potential to alter microbial composition and function for chronic disease control and prevention. This study aimed to determine the impact of cooked navy bean powder fed as a staple food ingredient on the fecal microbiome of healthy adult pet dogs. METHODOLOGY/PRINCIPAL FINDINGS: Fecal samples from healthy dogs prior to dietary control and after 4 wk of dietary treatment with macro- and micronutrient matched diets containing either 0 or 25% cooked navy beans (n = 11 and n = 10, respectively were analyzed by 454-pyrosequencing of the 16S rRNA gene. There were few differences between dogs fed the control and navy bean diets after 4 wk of treatment. These data indicate that there were no major effects of navy bean inclusion on microbial populations. However, significant differences due to dietary intervention onto both research diets were observed (i.e., microbial populations at baseline versus 4 wk of intervention with 0 or 25% navy bean diets. After 4 wk of dietary intervention on either control or navy bean diet, the Phylum Firmicutes was increased and the Phyla Actinobacteria and Fusobacteria were decreased compared to baseline. CONCLUSIONS: No negative alterations of microbial populations occurred following cooked navy bean intake in dogs, indicating that bean powders may be a viable protein and fiber source for commercial pet foods. The highly variable microbial populations observed in these healthy adult pet dogs at baseline is one potential reason for the difficulty to detect alterations in microbial populations following dietary changes. Given the potential physiological benefits of bean intake in humans and dogs, further evaluation of the impacts of cooked navy bean intake on fecal microbial populations with higher power or more sensitive methods are warranted.

  14. Effect of processing methods on nutritional, sensory, and physicochemical characteristics of biofortified bean flour.

    Science.gov (United States)

    Nkundabombi, Marie Grace; Nakimbugwe, Dorothy; Muyonga, John H

    2016-05-01

    Common beans (Phaseolus vulgaris L.) are rich nutritious and affordable by vulnerable groups, thus a good choice for biofortification to address malnutrition. However, increasing micronutrients content of beans, without improving micronutrients bioavailability will not improve the micronutrients status of consumers. Effect of different processing methods on the physicochemical characteristics of biofortified bean flour was determined. Processing methods used in this study were malting (48 h), roasting (170°C/45 min), and extrusion cooking using a twin screw extruder with three heating sections, the first set at 60°C, the second at 130°C, and the last one at 150°C. The screw was set at a speed of 35 Hz (123g) and bean flour moisture content was 15%. Mineral extractability, in vitro protein digestibility, pasting properties, and sensory acceptability of porridge and sauce from processed flour were determined. All processing methods significantly increased (P porridge or sauce from extruded biofortified bean flour and malted/roasted biofortified bean flour. Acceptability was also not affected by the bean variety used. Mineral bioavailability and in vitro protein digestibility increased more for extruded flour than for malted/roasted flours. Sauce and porridge prepared from processed biofortified bean flour had lower viscosity (extruded flour had the lowest viscosity), thus higher nutrient and energy density than those prepared from unprocessed biofortified bean flour. Estimated nutritional contribution of sauce and porridge made from processed ROBA1 flour to daily requirement of children below 5 years and women of reproductive age found to be high. These results show that processing methods enhanced nutritional value of biofortified bean flour and that processed biofortified bean flour can be used to prepare nutrient and energy-dense gruel to improve on nutritional status of children under 5 years and women of reproductive age.

  15. Discrimination of green arabica and Robusta coffee beans by Raman spectroscopy.

    Science.gov (United States)

    Keidel, Anke; von Stetten, David; Rodrigues, Carla; Máguas, Cristina; Hildebrandt, Peter

    2010-11-10

    This paper presents an approach that may be applied as an accurate and rapid tool for classifying coffee beans on the basis of the specific kahweol content. Using Fourier-transform Raman spectroscopy with 1064 nm excitation it is possible to monitor the characteristic Raman bands of kahweol in green coffee beans without chemical and physical processing of the beans. The procedure was optimized on the basis of 83 and 125 measurements of whole and ground beans, respectively, using coffee samples of two different species, Coffea arabica L. and Coffea canephora L. (var. Robusta), and different origins (Asia, Africa, and South America). The relative contribution of the kahweol in individual beans can be determined quantitatively by means of a component analysis of the spectra, yielding a spectral kahweol index (σka) that is proportional to the relative content of kahweol in a coffee bean. The reproducibility of the spectroscopic measurement and analysis was found to be 3.5%. Individual beans of the same type and origin reveal a scattering of the σka values. Nevertheless, an unambiguous distinction between Arabica and Robusta samples is possible on the basis of single-bean measurements as the σka values are greater than and less than 10 for Arabica and Robusta coffees, respectively. Measurements of whole and ground beans afforded very similar results, despite the heterogeneous distribution of kahweol within a bean. Unlike conventional analytical techniques, the single-bean sensitivity of the present approach may also allow for a rapid detection of unwanted admixtures of low-value Robusta coffee to high-quality and more expensive Arabica coffee. PMID:20942389

  16. Evaluation of the tepary bean (Phaseolus acutifolius) diversity panel for response to the NL 3 strain of Bean Common Mosaic Necrosis Virus (BCMNV) and for biological nitrogen fixation with Bradyrhizobium strains

    Science.gov (United States)

    Aphid-transmitted Bean Common Mosaic Necrosis Virus (BCMNV) and Bean Common Mosaic Virus (BCMV) are potyviruses that are seed transmitted in tepary bean. Developing resistance to these viruses will be critical for expanding production in areas where they are endemic. Biological nitrogen fixation (BN...

  17. Identification of quantitative trait loci associated with fructose, glucose and sucrose concentration in snap bean (Phaseolus Vulgaris L.) pods

    Science.gov (United States)

    Sugars, including fructose, glucose, and sucrose contribute significantly to the flavor and consumer acceptance of snap beans (Phaseolus vulgaris L.). Differences between dry and snap bean cultivars and among snap bean cultivars in the patterns of accumulation of sugars have been observed. In ‘Eagle...

  18. Visualization of resistance responses in Phaseolus vulgaris using reporter tagged clones of Bean common mosaic virus

    DEFF Research Database (Denmark)

    Naderpour, Masoud; Johansen, Ida Elisabeth

    2011-01-01

    Reporter tagged virus clones can provide detailed information on virus–host interactions. In Phaseolus vulgaris (bean), four recessive and one dominant gene are known to control infection by strains of the potyvirus species Bean common mosaic virus (BCMV). To study the interactions between BCMV...

  19. Effect of fungal infection on phenolic compounds during the storage of coffee beans

    Directory of Open Access Journals (Sweden)

    Amal, A. A.

    2013-12-01

    Full Text Available Aims: This work was undertaken to study the effect of Aspergillus infection on phenolic compounds in beans from four cultivars of the coffee plant (Coffea arabica L.. The effects of storage conditions of the coffee beans were also examined. Methodology and results: Beans from four varieties of coffee were artificially infected with three species of Aspergillus: A. niger, A. melleus and A. alliacus, and stored at 0, 8 and 25 ± 2 °C. After 3, 6 and 9 months, the contents of phenolic compounds in the beans were determined using high performance liquid chromatography (HPLC. Conclusion, significance and impact study: The results of this study showed that phenolic compounds were qualitatively and quantitatively higher in the inoculated beans as compared with the uninfected control beans, reflecting a possible induced defense mechanism in the infected beans. Increased storage periods resulted in higher levels of phenols, but the average total, bound and free phenols did not differ between the cultivars tested. Effective control of Apergillus infection in coffee beans can prevent such changes in phenolics that may affect their commercial value.

  20. Draft Genome Sequence of Arthrobacter chlorophenolicus Strain Mor30.16, Isolated from the Bean Rhizosphere

    OpenAIRE

    Miranda-Ríos, José Antonio; Ramírez-Trujillo, José Augusto; Nova-Franco, Bárbara; Lozano-Aguirre Beltrán, Luis Fernando; Iturriaga, Gabriel; Suárez-Rodríguez, Ramón

    2015-01-01

    Bacteria of the genus Arthrobacter are commonly found in the soil and plant rhizosphere. In this study we report the draft genome of Arthrobacter chlorophenolicus strain Mor30.16 that was isolated from rhizosphere of beans grown in Cuernavaca Morelos, Mexico. This strain promotes growth and ameliorates drought stress in bean plants.

  1. A new method to select the drought resistance azuki bean germplasm

    Institute of Scientific and Technical Information of China (English)

    Chen Xin; Peerasak Srinives

    2006-01-01

    120 azuki bean germplasms from different regions of China were selected for drought-resistance. Results showed that there is a significant positive correlation between drought-resistance and photooxidation-resistance. So, the detecting technique for photooxidation-resistance should be suggested as a reference method to select the drought-resistance germplasms in azuki bean.

  2. First Complete Genome Sequence of Bean common mosaic necrosis virus from East Timor

    Science.gov (United States)

    Maina, Solomon; Edwards, Owain R.; de Almeida, Luis; Ximenes, Abel

    2016-01-01

    We present here the first complete Bean common mosaic necrosis virus (BCMNV) genomic sequence isolated from virus-infected common bean (Phaseolus vulgaris) in East Timor, and compare it with six complete BMCNV genomes from the Netherlands, and one each from the United States, Tanzania, and an unspecified country. It most resembled the Netherlands strain NL-8 genome. PMID:27688343

  3. Evaluation of common bean (Phaseolus vulgaris L.) collection for agromorphological and seed mineral concentration

    Science.gov (United States)

    A collection of common bean comprising totally 223 genotypes of which 176 genotypes from the USDA, 37 common bean landraces and 10 commercial cultivars from Turkey, evaluated for several agromorphological plant characters and mineral concentrations in seeds. There were wide range of variations for t...

  4. Genetic Diversity of North American Wild kidney bean (Phaseolus polystachios) in the Eastern US

    Science.gov (United States)

    North American wild kidney bean or thicket bean (Phaseolus polystachios (L.) Britton, Sterns, & Poggenb) is a perennial vine found in the eastern United States from Texas to Connecticut. It is the only Phaseolus species native to temperate North America. Its closest cultivated relative is P. lunatus...

  5. Yields and quality of Phaseolus bean cultivars under farmers’ conditions in eastern and southern Africa

    DEFF Research Database (Denmark)

    Jensen, Henning Høgh; Kamalongo, Donwell; Ngwira, Amos;

    2014-01-01

    Common bean (Phaseolus vulgaris L.) is a dominant grain legume in eastern and southern Africa, where it constitutes a major source of protein and microminerals in peoples’ diet. The current studies aimed at determining how initially promising genotypes of bean responded in terms of yield and grai...

  6. Phenotype and seed production among hyacinth bean (Lablab purpureus L. Sweet) accessions rescued using hydroponic techniques

    Science.gov (United States)

    Hyacinth bean, Lablab purpureus L. (Sweet) is a legume used as a vegetable, forage, and in home gardens as an ornamental plant. Many accessions do not flower during their juvenile period in Byron, GA. Other hyacinth bean accessions produce few seed when regenerated in the field. This study was condu...

  7. Inquiry-based Investigation in Biology Laboratories: Does Neem Provide Bioprotection against Bean Beetles?

    Science.gov (United States)

    Pearce, Amy R.; Sale, Amanda Lovelace; Srivatsan, Malathi; Beck, Christopher W.; Blumer, Lawrence S.; Grippo, Anne A.

    2013-01-01

    We developed an inquiry-based biology laboratory exercise in which undergraduate students designed experiments addressing whether material from the neem tree ("Azadirachta indica") altered bean beetle ("Callosobruchus maculatus") movements and oviposition. Students were introduced to the bean beetle life cycle, experimental…

  8. First Complete Genome Sequence of Bean common mosaic necrosis virus from East Timor.

    Science.gov (United States)

    Maina, Solomon; Edwards, Owain R; de Almeida, Luis; Ximenes, Abel; Jones, Roger A C

    2016-01-01

    We present here the first complete Bean common mosaic necrosis virus (BCMNV) genomic sequence isolated from virus-infected common bean (Phaseolus vulgaris) in East Timor, and compare it with six complete BMCNV genomes from the Netherlands, and one each from the United States, Tanzania, and an unspecified country. It most resembled the Netherlands strain NL-8 genome. PMID:27688343

  9. Resistance of common bean breeding lines to Phaeoisariopsis griseola isolates from Honduras

    Science.gov (United States)

    Angular leaf spot (ALS) disease caused by Phaeoisariopsis griseola Sacc. Ferraris, is currently one of the most important factors limiting bean productivity in Central America. The development of breeding lines which combine resistance to ALS and Bean Golden Yellow Mosaic Virus (BGYMV) and tolerance...

  10. Iron and zinc bioavailabilities to pigs from red and white beans (Phaseolus vulgaris L.) are similar

    Science.gov (United States)

    Common beans contain relatively high concentrations of iron (Fe) and zinc (Zn) but are also high in polyphenols and phytates, factors that may inhibit Fe and Zn absorption. In vitro (Caco-2 cells) and in vivo (pigs) models were used to compare Fe and Zn bioavailabilities between red and white beans,...

  11. Effect of acetylation, oxidation and annealing on physicochemical properties of bean starch.

    Science.gov (United States)

    Simsek, Senay; Ovando-Martínez, Maribel; Whitney, Kristin; Bello-Pérez, Luis A

    2012-10-15

    Black and Pinto bean starches were physically and chemically modified to investigate the effect of modification on digestibility and physicochemical properties of bean starch. The impact of acetylation, oxidation (ozonation) and annealing on the chemical composition, syneresis, swelling volume, pasting, thermal properties and digestibility of starches was evaluated. The physicochemical and estimated glycemic index (eGI) of the Black and Pinto bean starches treated with ozone were not significantly (P>0.05) different than that of their respective control starches. Annealed starches had improved thermal and pasting properties compared to native starches. Acetylated starches presented reduced syneresis, good pasting properties and lower eGI. Also, all modified starches had increased levels of resistant starch (RS). Therefore, the digestibility and physicochemical properties of bean starch were affected by the type of modification but there were no significant (P>0.05) differences between the Black and Pinto bean starches.

  12. Uncertainty measurement in the homogenization and sample reduction in the physical classification of rice and beans

    Directory of Open Access Journals (Sweden)

    Dieisson Pivoto

    2016-04-01

    Full Text Available ABSTRACT: The study aimed to i quantify the measurement uncertainty in the physical tests of rice and beans for a hypothetical defect, ii verify whether homogenization and sample reduction in the physical classification tests of rice and beans is effective to reduce the measurement uncertainty of the process and iii determine whether the increase in size of beans sample increases accuracy and reduces measurement uncertainty in a significant way. Hypothetical defects in rice and beans with different damage levels were simulated according to the testing methodology determined by the Normative Ruling of each product. The homogenization and sample reduction in the physical classification of rice and beans are not effective, transferring to the final test result a high measurement uncertainty. The sample size indicated by the Normative Ruling did not allow an appropriate homogenization and should be increased.

  13. Phosphorus Use Efficiency by Brazilian Common Bean Genotypes Assessed by the 32P Dilution Technique

    International Nuclear Information System (INIS)

    The objectives of this work were to identify the most efficient common bean (Phaseolus vulgaris L.) genotypes on phosphorus (P) utilization, and verify if P from the seed affects the classification of common bean genotypes on P uptake efficiency when the 32P isotopic dilution technique is used. The experiment was conducted in a greenhouse, and plants were grown in pots with surface samples of a dystrophic Typic Haplustox. The treatments consisted of 50 common bean genotypes and two standard plant species, efficient or inefficient in P uptake. The results were assessed through correlation and cluster analysis (multivariate). Sangue de Boi, Rosinha, Thayu, Grafite, Horizonte, Pioneiro and Jalo Precoce common bean genotypes were the most efficient on P uptake, and Carioca 80, CNF 10, Perola, IAPAR 31, Roxao EEP, Apore, Pioneiro, Pontal, Timbo and Ruda were the most efficient in P utilization. The P derived from seed influences the identification of common bean genotypes for P uptake efficiency. (author)

  14. Mineral composition of some varieties of beans from Mediterranean and Tropical areas.

    Science.gov (United States)

    Di Bella, Giuseppa; Naccari, Clara; Bua, Giuseppe Daniel; Rastrelli, Luca; Lo Turco, Vincenzo; Potortì, Angela Giorgia; Dugo, Giacomo

    2016-01-01

    In this study has been evaluated the mineral composition (Cd, Pb, As, Hg, Ba, Cr, Co, Ni, Se, Sb, V, Cu, Fe, Zn, Mo, Na, K, Ca, Mg) of some varieties of bean (Phaseolus vulgaris, Vigna unguiculata and V. angularis) from Mediterranean and Tropical areas of the world (Italy, Mexico, India, Japan, Ghana and Ivory Coast); the correlation between beans mineral composition in micro and macroelements and botanical and/or geographical origin; trace elements dietary intake by beans consumption. The results showed a correlation between beans mineral composition and their geographical origin, with higher values in Ivory Coast samples. Moreover, minerals content found confirmed the importance of these legumes in the diet for the significant content of essential micro and macroelements and a safe consumption of beans for the low residual levels of toxic metals. PMID:26940501

  15. Effect of 60Co-γ ray irradiation on green coffee beans, 1

    International Nuclear Information System (INIS)

    Green coffee beans were irradiated with 60Co-γ rays at doses of 0, 0.05, 0.5, 5.0 and 10.0 Mrad and the changes of general components in green and roast coffee beans were investigated together with those of the organoleptic properties of roast beans during storage according to the cup testing. In case of Brazil santos beans, irradiation of some 0.05 Mrad 60Co-γ ray gave rather favourable mild flavour and no harmful influence on the quality of coffee, and moreover, would tend to extend the shelf life of roast beans. But influence of irradiation on the quality of coffee differed somewhat between two cultivars, Brazil santos and Colombia. (auth.)

  16. Marker-assisted selection in common beans and cassava

    International Nuclear Information System (INIS)

    Marker-assisted selection (MAS) in common beans (Phaseolus vulgaris L.) and cassava (Manihot esculenta) is reviewed in relation to the breeding system of each crop and the breeding goals of International Agricultural Research Centres (IARCs) and National Agricultural Research Systems (NARS). The importance of each crop is highlighted and examples of successful use of molecular markers within selection cycles and breeding programmes are given for each. For common beans, examples are given of gene tagging for several traits that are important for bean breeding for tropical environments and aspects considered that contribute to successful application of MAS. Simple traits that are tagged with easy-to-use markers are discussed first as they were the first traits prioritized for breeding at the International Center for Tropical Agriculture (CIAT) and with NARS partners in Central America, Colombia and eastern Africa. The specific genes for MAS selection were the bgm-1 gene for bean golden yellow mosaic virus (BGYMV) resistance and the bc-3 gene for bean common mosaic virus (BCMV) resistance. MAS was efficient for reducing breeding costs under both circumstances as land and labour savings resulted from eliminating susceptible individuals. The use of markers for other simply inherited traits in marker-assisted backcrossing and introgression across Andean and Mesoamerican gene pools is suggested. The possibility of using MAS for quantitative traits such as low soil phosphorus adaptation is also discussed as are the advantages and disadvantages of MAS in a breeding programme. For cassava, the use of multiple flanking markers for selection of a dominant gene, CMD2 for cassava mosaic virus (CMV) resistance at CIAT and the International Institute of Tropical Agriculture (IITA) as well as with NARS partners in the United Republic of Tanzania using a participatory plant breeding scheme are reviewed. MAS for the same gene is important during introgression of cassava green mite

  17. Apple Latent Spherical Virus Vector as Vaccine for the Prevention and Treatment of Mosaic Diseases in Pea, Broad Bean, and Eustoma Plants by Bean Yellow Mosaic Virus

    OpenAIRE

    Nozomi Satoh; Tatsuya Kon; Noriko Yamagishi; Tsubasa Takahashi; Tomohide Natsuaki; Nobuyuki Yoshikawa

    2014-01-01

    We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV) harboring a segment of the Bean yellow mosaic virus (BYMV) genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic sym...

  18. Gene-based SNP discovery in tepary bean (Phaseolus acutifolius) and common bean (P. vulgaris) for diversity analysis and comparative mapping

    OpenAIRE

    Gujaria-Verma, Neha; Ramsay, Larissa; Sharpe, Andrew G; Sanderson, Lacey-Anne; Daniel G. Debouck; Tar’an, Bunyamin; Bett, Kirstin E.

    2016-01-01

    Background Common bean (Phaseolus vulgaris) is an important grain legume and there has been a recent resurgence in interest in its relative, tepary bean (P. acutifolius), owing to this species’ ability to better withstand abiotic stresses. Genomic resources are scarce for this minor crop species and a better knowledge of the genome-level relationship between these two species would facilitate improvement in both. High-throughput genotyping has facilitated large-scale single nucleotide polymor...

  19. Gamma Radiosensitivity Study on Long Bean (Vigna sesquipedalis

    Directory of Open Access Journals (Sweden)

    Ellyfa Kon

    2007-01-01

    Full Text Available This study was conducted to determine the LD50 and effect of gamma ray on germination percentage, plant height, survival percentage, root length, root dry weight and shoot dry weight of seedlings derived from seeds of long bean (Vigna sesquipedalis. Seeds of this crop were treated with 300, 400, 500, 600 and 800 Gy gamma rays at Malaysian Institute of Nuclear Technology (MINT. The treated seeds including control were sown in sand beds in size 4.6 x 0.7 m2 in a greenhouse at Horticulture Unit, Universiti Putra Malaysia Bintulu Campus (UPMKB. After germination, plants were transferred into polybags. Each polybag contained 1.2 kg blended growth medium with top soil, sand, and processed chicken dung ratio of 3:2:1. Standard procedures were used to observe and record the variables studied in this research. The experiment was designed as a 4 x 6 factorial Completely Randomized Design with 3 replications. Lethal dose 50 % of population (LD50 was assayed. The study revealed that germination percentage, plant height, survival percentage, root length, root dry weight and shoot dry weight decreased with increasing dose of gamma ray. The 800 Gy gamma ray dose in particular had a pronounced effect on these morphological characteristics probably because of injury it might have caused to the seeds of the long bean. As a result, poor growth and development was noticed. The LD50 for survival and height ranged between 600-800 Gy and 400-500 Gy, respectively. Generally, higher gamma ray doses particularly 800 Gy significantly affected the morphological characteristics of long bean seedlings obtained from irradiated seeds.

  20. Induced mutations for a determinate habit in rice bean

    International Nuclear Information System (INIS)

    Induced mutation techniques were used to create polygenic variability in rice bean (Vigna umbellata). Dry seeds of the genotype (sel. I) were irradiated with 40-80 kR of gamma rays at 10 kR intervals. A wide variation in quantitative characters was induced in both the M2 and M3 generations. Some mutants were isolated that showed a determinate growth habit, earliness, a high yield and photoinsensitivity. These mutants were found to be breeding true. (author). 5 refs, 1 tab

  1. Texture losses of green beans along frozen storage

    OpenAIRE

    R.C. Martins; Silva, C. L. M.

    2000-01-01

    The texture loss of frozen green beans ( Phaseolus vulgaris, L., variety Bencanta) was macroscopically evaluated by a puncture test, using the INSTRON (Universal Testing Machine, model 4500) with a 4,85 mm diameter plunger, along 250 days of isothermal storage at -7, -15 and -30°C. The force deformation curves were recorded for data analysis of: i) Energy - the area below the force deformation curve, as a measurement of the resistance to compression by the plunger, ii) Stress at the fai...

  2. Acute anuric renal failure following jering bean ingestion.

    Science.gov (United States)

    Wong, Jin Shyan; Ong, Teng-Aik; Chua, Hock-Hin; Tan, Clare

    2007-01-01

    Djenkol beans or jering (Pithecellobium jeringa) is a traditional delicacy consumed by the local population in Malaysia. Jering poisoning or djenkolism is characterized by spasmodic pain, urinary obstruction and acute renal failure. The underlying pathology is an obstructive nephropathy, which is usually responsive to aggressive hydration and diuretic therapy. We present a case of djenkolism following ingestion of jering. The patient required urgent bilateral ureteric stenting following the failure of conservative therapy. Healthcare providers need to recognize djenkolism as a cause of acute renal failure and the public educated on this potential health hazard.

  3. Application of 1H NMR for the characterisation of cocoa beans of different geographical origins and fermentation levels.

    Science.gov (United States)

    Caligiani, Augusta; Palla, Luigi; Acquotti, Domenico; Marseglia, Angela; Palla, Gerardo

    2014-08-15

    This study reports for the first time the use of (1)H NMR technique combined with chemometrics to study the metabolic profile of cocoa (Theobroma cacao L.) beans of different varieties, origin and fermentation levels. Results of PCA applied to cocoa bean (1)H NMR dataset showed that the main factor influencing the cocoa bean metabolic profile is the fermentation level. In fact well fermented brown beans form a group clearly separated from unfermented, slaty, and underfermented, violet, beans, independently of the variety or geographical origin. Considering only well fermented beans, the metabolic profile obtained by (1)H NMR permitted to discriminate between some classes of samples. The National cocoa of Ecuador, known as Arriba, showed the most peculiar characteristics, while the samples coming from the African region showed some similar traits. The dataset obtained, representative of all the classes of soluble compounds of cocoa, was therefore useful to characterise fermented cocoa beans as a function of their origin and fermentation level.

  4. Efficacy of Locust Beans Husk Char in Heavy Metal Sequestration

    Directory of Open Access Journals (Sweden)

    Ademola Ayodeji Ajayi-Banji

    2016-03-01

    Full Text Available Most solid waste management schemes minimally consider low concentration biodegradable agricultural waste management, though the environmental impact of this waste category is significant over a time frame. The column-mode study seeks to address the issue by suggesting potential utilisation of post-harvest waste for heavy metal sequestering. Locust beans husk char of 100 and 200 g was employed to inspect removal efficiency, isotherm and kinetic models of some heavy metals at 30, 60, 90, 120 and 150 min contact time. Elemental composition of the biosorbent was investigated using the SEM-EDX machine. The results obtained depict that over 85% aluminium and nickel removal was achieved at 150 min detention time. The Freundlich isotherm well described most of the sorbates sorption (R2 ≥ 0.91. The sorption rate equally fitted into the second-order pseudo kinetic model (R2 ≥ 0.88. Ion exchange took place during the sorption. Locust beans husk has promising adsorption potential in heavy metal ions removal from fouled surface water. DOI: http://dx.doi.org/10.5755/j01.erem.71.4.13081

  5. Molecular assessment of genetic diversity in mung bean germplasm

    Indian Academy of Sciences (India)

    G. Roopa Lavanya; Jyoti Srivastava; Shirish A. Ranade

    2008-04-01

    RAPD profiles were used to identify the extent of diversity among 54 accessions of mung bean that included both improved and local land races. Out of the 40 primers screened, seven primers generated 174 amplification products with an average of 24.85 bands per primer. The RAPD profiles were analysed for Jaccard’s similarity coefficients that was found to be in the range from 0 to 0.48, indicating the presence of wide range of genetic diversity at molecular level. Cluster analysis was carried out based on distances (1-similarity coefficient) using neighbour-joining method in Free Tree package. The dendrogram resolved all the accessions into two major clusters, I (with 11 accessions) and II (with 43 accessions). However, the cluster was further divided into four subclusters (II A with six, II B with nine, II C with 15 and II D with 13 accessions). The distribution of the accessions in different clusters and subclusters appeares to be related to their performance in field conditions for 10 morphological traits that were scored. This study indicated that the RAPD profiles provide an easy and simple technique for preliminary genetic diversity assessment of mung bean accessions that may reflect morphological trait differences among them.

  6. Breeding common bean populations for traits using selection index

    Directory of Open Access Journals (Sweden)

    Dayane Cristina Lima

    2015-02-01

    Full Text Available A common bean (Phaseolus vulgarisL. cultivar must combine desirable genotypes for several traits in order to be accepted by producers and consumers. This study aimed to evaluate selection efficiency when segregating bean populations for traits, by means of a selection index, in order to obtain superior progenies for traits considered. A total of 16 populations from the F4 and F5generations were evaluated in 2011 and 2012, respectively. The traits evaluated were plant architecture, plant disease, grain type and yield. Using standard scores (Z, the sum of the four traits (∑Z was obtained and, based on this information, the best populations were identified. The evaluation of selection effectiveness was performed on 31 progenies from each population. The 496 progenies plus eight controls were evaluated in the F5:6and F5:7 generations for the same traits in July and November 2012, respectively. The selection, using the index based on the sum of standardized variables (∑Z, was efficient for identifying populations with superior progenies for all the traits considered.

  7. An antifungal peptide from Phaseolus vulgaris cv. brown kidney bean

    Institute of Scientific and Technical Information of China (English)

    Yau Sang Chan; Jack Ho Wong; Evandro Fei Fang; Wen Liang Pan; Tzi Bun Ng

    2012-01-01

    A 5.4-kDa antifungal peptide,with an N-terminal sequence highly homologous to defensins and inhibitory activity against Mycosphaerella arachidicola (IC5o=3 μM),Setospaeria turcica and Bipolaris maydis,was isolated from the seeds of Phaseolus vulgaris cv.brown kidney bean.The peptide was purified by employing a protocol that entailed adsorption on Affi-gel blue gel and Mono S and finally gel filtration on Superdex 75.The antifungal activity of the peptide against M.arachidicola was stable in the pH range 3-12 and in the temperature range 0℃ to 80℃.There was a slight reduction of the antifungal activity at pH 2 and 13,and the activity was indiscernible at pH 0,1,and 14.The activity at 90℃ and 100℃ was slightly diminished.Deposition of Congo red at the hyphal tips of M.arachidicola was induced by the peptide indicating inhibition of hyphal growth.The lack of antiproliferative activity of brown kidney bean antifungal peptide toward tumor cells,in contrast to the presence of such activity of other antifungal peptides,indicates that different domains are responsible for the antifungal and antiproliferative activities.

  8. Prosopis pubescens (screw bean mesquite) seedlings are hyperaccumulators of copper.

    Science.gov (United States)

    Zappala, Marian N; Ellzey, Joanne T; Bader, Julia; Peralta-Videa, Jose R; Gardea-Torresdey, Jorge

    2013-08-01

    Due to health reasons, toxic metals must be removed from soils contaminated by mine tailings and smelter activities. The phytoremediation potential of Prosopis pubescens (screw bean mesquite) was examined by use of inductively-coupled plasma optical emission spectroscopy. Transmission electron microscopy was used to observe ultrastructural changes of parenchymal cells of leaves in the presence of copper. Elemental analysis was used to localize copper within leaves. A 600-ppm copper sulfate exposure to seedlings for 24 days resulted in 31,000 ppm copper in roots, 17,000 ppm in stems, 11,000 in cotyledons and 20 ppm in the true leaves. For a plant to be considered a hyperaccumulator, the plant must accumulate a leaf-to-root ratio <1. Screw bean mesquite exposed to copper had a leaf-to-root ratio of 0.355 when cotyledons were included. We showed that P. pubescens grown in soil is a hyperaccumulator of copper. We recommend that this plant should be field tested.

  9. Improvement of tuber yield in yam bean by mutation induction

    International Nuclear Information System (INIS)

    Full text: The genus Pachyrrhizus, a native of Mexico and Central America is now widely distributed throughout the tropics. Pachyrrhizus erosus (L.) Urb., commonly known as the yam bean is cultivated in many parts of India for its edible tubers. The young tubers have a crisp and juicy flesh and can be eaten raw or cooked. Genetic variability for agronomically important characters is rare. It was therefore felt desirable to increase it by mutation induction. Seeds of a locally adapted variety were subjected to gamma irradiation (10, 15, 20 and 25 kR). Evaluation of the M3 raised from the different treatments unveiled mutants possessing significantly higher yields than the control. While the control plants showed a mean tuber yield of 168 g, one of the higher yielding mutants from the progenies of 10 kR treatment recorded 415 g. Two other mutants selected from the 25 kR treatment showed yields of 401 and 411 g. These mutants, first identified in M2, were found to breed true in M3-M5 generations. Yield trials conducted in M5 generation showed more than two-fold increase in yield by the mutants. Apparently there are remarkable possibilities of improving the yield potential in yam bean by mutation induction. (author)

  10. Faba bean hulls as a potential source of pectin.

    Science.gov (United States)

    Korish, Mohamed

    2015-09-01

    This study aimed for the first time to assess the potential use of faba bean hulls as a source of pectin. The study involved extracting pectin under various conditions of pH, temperature and extraction time and determining how these conditions affected pectin yield and its characteristics. The maximum yield of extracted pectin did not coincide with the highest degree of esterification since the maximum yield (15.75 %) was recorded at pH 1.5 and at a temperature of 85 °C for an 80-min extraction period and solid to liquid (1: 25) ratio, while the highest degree of esterification (54.62 %) occurred at pH 2.5 and at temperature of 90 °C for a 60-min extraction period. The composition of the pectin varied according to the extraction conditions: the neutral sugars galactose, arabinose and rhamnose increased under milder extraction conditions while glucose, mannose and xylose sugars predominated under harsher extraction conditions. The results indicated that faba bean hulls contains adequate amount of pectin, suitable for commercial utilization.

  11. Biological treatment to bean seeds before sowing them.

    Directory of Open Access Journals (Sweden)

    Silvano Edel Castro Mayo

    2013-09-01

    Full Text Available Even in some bibliography about the bean cultivation is recommended the use of Rhizobium which association with the cultivation is very advantageous for the fixation of the atmospheric nitrogen, as well as the employment of the antagonistic mushroom Trichoderma spp., for the control of fungous illnesses of the floor and knowing that the cultivation has its fertilization demands and of the plagues control and illnesses that are in definitive the causes that limit the yields of the cultivation, these practices are not used. We proceeded to the disinfection of bean seeds with the resulting solution of the laundry of 1Kg of Trichoderma harzianum of the stock A-34 with 2 liters of water and the mixture of this fluid with 1 Kg of Rhizobium, more a package (134 grams of Gaucho PS 70 for 45.35 kg (100 pounds of t seed. The disinfection of the seed was made by hand, 12 hour before sowing them and the results were very encouraging, so much in the delay of days in appearing the illnesses and the plagues and its low attack intensity as the increase of the yields with relationship to the not treated seed.

  12. Effect of gamma irradiation on antinutritional factors in broad bean

    International Nuclear Information System (INIS)

    The effect of gamma irradiation on the level of antinutritional factors (trypsin inhibitor (TI), phytic acid and oligosaccharides) of broad bean was investigated. The seeds were subjected to gamma irradiation at 0, 2.5, 5, 7.5 and 10 kGy, respectively using cobalt-60 gamma radiation with a dose rate 2.37 kGy/h. TI activity was reduced by 4.5%, 6.7%, 8.5% and 9.2% at 2.5, 5, 7.5 and 10 kGy, respectively. Meanwhile, irradiation at 10.2, 12.3, 15.4 and 18.2 kGy reduced the phytic acid content. The flatulence causing oligosaccharides were decreased as the radiation dose increased. The chemical composition (protein, oil, ash and total carbohydrates) of the tested seeds was determined. Gamma radiation seems to be a good procedure to improve the quality of broad bean from the nutritional point of view

  13. Effect of gamma irradiation on antinutritional factors in broad bean

    Science.gov (United States)

    Al-Kaisey, Mahdi T.; Alwan, Abdul-Kader H.; Mohammad, Manal H.; Saeed, Amjed H.

    2003-06-01

    The effect of gamma irradiation on the level of antinutritional factors (trypsin inhibitor (TI), phytic acid and oligosaccharides) of broad bean was investigated. The seeds were subjected to gamma irradiation at 0, 2.5, 5, 7.5 and 10 kGy, respectively using cobalt-60 gamma radiation with a dose rate 2.37 kGy/h. TI activity was reduced by 4.5%, 6.7%, 8.5% and 9.2% at 2.5, 5, 7.5 and 10 kGy, respectively. Meanwhile, irradiation at 10.2, 12.3, 15.4 and 18.2 kGy reduced the phytic acid content. The flatulence causing oligosaccharides were decreased as the radiation dose increased. The chemical composition (protein, oil, ash and total carbohydrates) of the tested seeds was determined. Gamma radiation seems to be a good procedure to improve the quality of broad bean from the nutritional point of view.

  14. Effect of copper on castor bean (Ricinus communis L.) growth

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Castor beans crop (Ricinus communis L.) is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor yield, few research has been made on this issue, mainly on the use de copper. In order to evaluate the effects of copper on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Cu (0; 1; 2; 3 and 4 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Copper levels used, in general, did not affect the plant height, stem diameter and leaf area, however they influenced the leaves and shoot biomass dry mass and the quadratic trend was the best to show the behavior of these. (author)

  15. Economic viability of common bean variety BRS Estilo

    Directory of Open Access Journals (Sweden)

    Osmira Fatima da Silva

    2015-11-01

    Full Text Available This study aims to evaluate financially BRS Estilo, a variety of common bean (Phaseolus vulgaris L., the carioca group, developed by “Embrapa Rice and Beans” and partners, estimating the regional economic benefit from the knowledge of the costs generation and transfer of technology and production system. The BRS Estilo variety was evaluated in four successive seasons: 2010/2011, 2011/2012, 2012/2013 and 2013/2014. The BRS Estilo technology contribution to the bean agribusiness in Brazil was R$ 239.431.760,83, about US$ 106 million during the period. The transfer process of the BRS Estilo to the productive sector represents 7,5% of the total cost on developing technology, which began in 2000. In addition to the economic benefit provided by the adoption of this technology, there has also been generating more jobs in its supply chain and also increasing the product offered in the market. JEL-Code | O13; Q16; R32.

  16. Sunning as a technique for disinfecting stored beans

    International Nuclear Information System (INIS)

    The effectiveness of sunning (solar heating) as a small farm technique for controlling the bean bruchids Zabrotes subfasciatus (Boheman) and Acanthoscelides obtectus (Say) was investigated. Bean seeds infested with mixed-stage larvae were placed on clear or black polyethylene sheets or inside polyethylene pouches with clear upper and black lower surfaces and exposed to the sun for five hours each day for 0, 3 and 5 successive days. No live insects emerged from seeds heated in the pouches while the few that emerged from seeds on the black sheets resulted in damage to less than 1% of the seeds. Of the three polyethylene systems used, the clear sheet was the least useful, while the pouches even for only 3 days, were the most effective in eliminating infestations. These studies demonstrated that effective bruchid control can be achieved with daily 5-h exposure periods of seeds for a successive 5-day duration. However, the success of the method of control may be influenced by the time of the year and prevailing environmental conditions

  17. Agronomic performance of velvet bean at different spatial arrangement

    International Nuclear Information System (INIS)

    The objective of this work was to evaluate the effect of different plant spatial arrangements on agronomic performance of velvet-bean (Mucuna pruriens var. utilis). The experiment was performed with eight treatments, distributed in a randomized complete block design in a 2x4 factorial arrangement, with four replicates. The treatments were velvet bean sowing at two spacings between furrows (0.5 and 1.0 m) and four plant densities (2, 4, 8 and 16 plants m-1). Determinations were made for the soil covering and biological nitrogen fixation (BNF) rates, and for the dry matter yield and N accumulation in the plant shoots. Total soil cover was accomplished at 50 days after sowing at 16 plants m-1 density and 0.5 m spacing between furrows. The combination of 16 plants m-11density with the 1.0 m spacing between furrows provided the greatest dry matter yield and accumulated most N in the plant shoots. Irrespective of the plant spatial arrangement, the estimation of BNF in this species shows that about 70% N present in the shoot is derived from the atmosphere. (author)

  18. Diversity and the role of yeast in spontaneous cocoa bean fermentation from Southeast Sulawesi, Indonesia

    Directory of Open Access Journals (Sweden)

    JAMILI

    2016-06-01

    Full Text Available Abstract. Jamili, Yanti NA, Susilowati PE. 2016. Diversity and the role of yeast in spontaneous cocoa bean fermentation from Southeast Sulawesi, Indonesia. Biodiversitas 17: 90-95. Yeast is one of the microbial group which is role in the process of cocoa spontaneously fermentation. The objective of this study was to determinate and to know the diversity of yeast that role on cocoa bean fermentation. Yeast was isolated by pour plate method from cocoa bean that was naturally fermented by a cocoa farmer in Kolaka District, Southeast Sulawesi using yeast mannitol agar (YMA media. Yeast was characterized and identified using phenotypic characters based on numeric-phenetic analysis. Yeast isolates applied to cocoa bean to determine its role in cocoa bean fermentation. The result was obtained seven isolates the dominant yeast during cocoa bean fermentation in Kolaka District, Southeast Sulawesi. The result of numerical-phenetic analysis based on phenotypic characters to seven yeast isolates showed that 1 isolates (Klk1 identical with Candida krusei. Three isolates (Klk4, Klk5 and Klk7 identical with Candida tropicalis, one isolate (Klk2 identical with Saccharomycopsis fibuligera, one isolate (Klk3 identical with Kloeckera sp. and one isolate (Klk6 identical with Saccharomyces cerevisiae. The result also showed that fermentation of cocoa with seeding of yeast inoculums served to increase the quality of cocoa beans than spontaneous fermentation. Therefore, the seven yeast isolates potentially be used as an inoculum to improve the cocoa quality.

  19. Effect of Radiation processing on sensory and chemical characteristics of broad beans (Giza,2)(Vicia Faba)

    International Nuclear Information System (INIS)

    Broad bean is the important leguminous protein consumed in egypt as a source of protein diet. The most popular way of preparing beans is the stewd form (Fool Medames). However, great losses due to insect infestation occur during storage. To combat these losses radiation processing has been used as an effective alternative of chemical fumigants to combat insect pets. The beans were irradiated at 25.5, 10 and kgy. The effects of treatments were investigated on sensory and chemical characteristics and on the solubility of broad beans protein, the amino acids content and on the nutritive value of bean protein from the view of its amino acids profile. The results of study indicate that the sensory evaluation of sewed irradiated 2.5 and 5 kGy samples revealed no significantdiffference in hardness, gumminess and acceptability. moreover, no significant changes in adhesivess, between samples irradiated at 5, 10 and 20 KGy, irradiation up to 20 KGy was found to improve the hardness of stewed broad bean which would improve the quality of broad of bean

  20. Molecular structure and physicochemical properties of potato and bean starches as affected by gamma-irradiation.

    Science.gov (United States)

    Chung, Hyun-Jung; Liu, Qiang

    2010-08-01

    In this study, potato and bean starches were treated by gamma-irradiation up to 50kGy. Molecular structure and physicochemical properties of irradiated potato and bean starches were investigated. Microscopic observation under scanning electron microscope (SEM) and polarized microscope showed that some of potato and bean starch granules were destroyed by gamma-irradiation and the breakage was much greater at a higher dose (50 kGy). Carboxyl content and amylose leaching increased, whereas the swelling factor and apparent amylose content decreased after irradiation in both potato and bean starches. The proportions of short (DP 6-12) and long (DP > or = 37) amylopectin chains as well as average chain length increased with increasing irradiation dose. However, the proportion of DP 13-24 decreased by irradiation. The relative crystallinity, the degree of granule surface order, and gelatinization enthalpy decreased with an increase in irradiation dose. The extent of decrease in potato starch was greater than that in bean starch. The exothermic peak around 90-110 degrees C was observed in DSC thermogram when the potato starch was irradiated at 50 kGy. The pasting viscosity significantly decreased with an increase in irradiation dose. The proportion of slowly digestible starch (SDS) decreased and resistant starch (RS) content increased by irradiation in both potato and bean starches. However, the rapidly digestible starch (RDS) of potato starch increased with increasing irradiation dose, whereas the bean starch showed the opposite trend to potato starch in RDS content.

  1. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    International Nuclear Information System (INIS)

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macacar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g-1 dry basis, 1.8 mg g-1 dry basis and 13.5 μmol g-1 dry basis in the raw non-irradiated Carioca beans and 0.30 mg g-1 dry basis, 0.42 mg g-1 dry basis and 7.5 μmol g-1 dry basis in the raw non-irradiated Macacar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macacar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties

  2. Effect of edible coating on the aromatic attributes of roasted coffee beans.

    Science.gov (United States)

    Rattan, Supriya; Parande, A K; Ramalakshmi, K; Nagaraju, V D

    2015-09-01

    Coffee is known throughout the world for its distinct aroma and flavour which results from a number of volatile compounds present in it. It is very difficult to arrest the aromatic compounds once the roasting process is complete and it becomes even more challenging to store the beans for a longer time with the retained volatiles as these compounds are easily lost during industrialized processing such as the grinding of roasted coffee beans and storage of ground coffee. Thus, an attempt was made to minimise the loss of volatile from roasted coffee beans by coating with Carboxymethyl cellulose (CMC), Hydroxypropylmethyl cellulose (HPMC) and Whey protein concentrate. Coffee volatiles were analysed by Gas chromatography and 14 major compounds were identified and compared in this study. Results showed an increase in the relative area of major volatile compounds in coated roasted coffee beans when compared with unroasted coffee beans for consecutive two months. Moreover, effect of coating on textural properties and non-volatiles were also analysed. The results have indicated that edible coatings preserve the sensory properties of roasted coffee beans for a longer shelf life and cellulose derivatives, as an edible coating, exhibited the best protecting effect on roasted coffee beans.

  3. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. E-mail: villavic@net.ipen.br; Mancini-Filho, Jorge E-mail: jmancini@usp.br; Delincee, Henry; Greiner, Ralf E-mail: ralf.greiner@bfe.uni-karlsruhe.de

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macacar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g{sup -1} dry basis, 1.8 mg g{sup -1} dry basis and 13.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Carioca beans and 0.30 mg g{sup -1} dry basis, 0.42 mg g{sup -1} dry basis and 7.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Macacar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macacar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  4. In Vivo Antistress and Antioxidant Effects of Fermented and Germinated Mung Bean

    Directory of Open Access Journals (Sweden)

    Swee Keong Yeap

    2014-01-01

    Full Text Available Mung bean has been traditionally used to alleviate heat stress. This effect may be contributed by the presence of flavonoids and γ-aminobutyric acid (GABA. On the other hand, fermentation and germination have been practised to enhance the nutritional and antioxidant properties of certain food products. The main focus of current study was to compare the antistress effect of none-process, fermented and germinated mung bean extracts. Acute and chronic restraint stresses were observed to promote the elevation of serum biochemical markers including cholesterol, triglyceride, total protein, liver enzymes, and glucose. Chronic cold restraint stress was observed to increase theadrenal gland weight, brain 5-hydroxytryptamine (5-HT, and malondialdehyde (MDA level while reducing brain antioxidant enzyme level. However, these parameters were found reverted in mice treated with diazepam, high concentration of fermented mung bean and high concentration of germinated mung bean. Moreover, enhanced level of antioxidant on the chronic stress mice was observed in fermented and germinated mung bean treated groups. In comparison between germinated and fermented mung bean, fermented mung bean always showed better antistress and antioxidant effects throughout this study.

  5. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Science.gov (United States)

    Villavicencio, Anna Lucia C. H.; Mancini-Filho, Jorge; Delincée, Henry; Greiner, Ralf

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macaçar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g -1 dry basis, 1.8 mg g -1 dry basis and 13.5 μmol g -1 dry basis in the raw non-irradiated Carioca beans and 0.30 mg g -1 dry basis, 0.42 mg g -1 dry basis and 7.5 μmol g -1 dry basis in the raw non-irradiated Macaçar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macaçar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  6. Effect of processing methods on nutritional, sensory, and physicochemical characteristics of biofortified bean flour.

    Science.gov (United States)

    Nkundabombi, Marie Grace; Nakimbugwe, Dorothy; Muyonga, John H

    2016-05-01

    Common beans (Phaseolus vulgaris L.) are rich nutritious and affordable by vulnerable groups, thus a good choice for biofortification to address malnutrition. However, increasing micronutrients content of beans, without improving micronutrients bioavailability will not improve the micronutrients status of consumers. Effect of different processing methods on the physicochemical characteristics of biofortified bean flour was determined. Processing methods used in this study were malting (48 h), roasting (170°C/45 min), and extrusion cooking using a twin screw extruder with three heating sections, the first set at 60°C, the second at 130°C, and the last one at 150°C. The screw was set at a speed of 35 Hz (123g) and bean flour moisture content was 15%. Mineral extractability, in vitro protein digestibility, pasting properties, and sensory acceptability of porridge and sauce from processed flour were determined. All processing methods significantly increased (P nutrient and energy density than those prepared from unprocessed biofortified bean flour. Estimated nutritional contribution of sauce and porridge made from processed ROBA1 flour to daily requirement of children below 5 years and women of reproductive age found to be high. These results show that processing methods enhanced nutritional value of biofortified bean flour and that processed biofortified bean flour can be used to prepare nutrient and energy-dense gruel to improve on nutritional status of children under 5 years and women of reproductive age. PMID:27247769

  7. Reduction of Microbe Contamination through Steaming Process to Cocoa Beans Using Steaming Chamber

    Directory of Open Access Journals (Sweden)

    Hendy Firmanto

    2014-05-01

    Full Text Available Dry cocoa bean quality is also determined by its microbe contamination level. Steaming process for dried cocoa beans as a pretreatment process was selected because of less effect on organic compound inside the dried cocoa bean. This experiment aim was to study microbial contamination level of cocoa beans using steaming process, determining its microbial population and evaluate its chemical changes. Experiment was carried out in Postharvest Laboratory of Indonesian Coffee and Cocoa Research Institute. Cocoa beans for the experiment were lots collected from four farms in Jayapura, Papua with different microbial contamination level for each lot. Results of this experiment showed that optimum steaming process was 15 minutes at 100 O C with 10 minutes preheating time. Microbial analysis result of the four lots after complete steaming process by total plate count method showed the same result (<3.0 x 103 cfu. Most of the decrease in microbial contaminant appeared in the plate was 73.5% of Staphylococcus aureusand 0.058% of Penicilliumsp. Bean acidity (pH after steaming increased (4.76 to 4.80 and free fatty acid increased (1.81% to 1.96% while carbohydrate content decreased (17.5% to 15.9% and as well as protein content (12.6% into 11.7%. Key words: cocoa bean, steaming process, microbe reduction, nutrient changes

  8. Bean responds to Endospor 33® at reduced dose of Nitrogen and

    Directory of Open Access Journals (Sweden)

    Juan Manuel Sanchez-Yañez

    2014-06-01

    Full Text Available Bean is a legume its production requires nitrogen (N combined as ammonium (NH4 or nitrate (NO3 and phosphates (NPF, its indiscriminate application causes soil lost productivity. An alternative solution for reducing and optimizing NPF is applying mixed inoculant which could be improved by plant growth promoting bacteria (PGPB and mycohrrizae. The objective of this research was to analyze the response of beans to mixed inoculant Endospor 33® at 50% reduced dose of NPF. In that sense a red ferralitic soil poor in N and organic matter was used. By experimental design: 5 treatments and 6 replications. Results showed a positive bean responds achieving 100% germination at 20mg/seed with Endospor 33® at 50% NPF dose. At seedling level bean was 6.63g of total fresh weight (TFW and 0.66g total dry weight (TDW with the same Endospor 33® dose compared to 0.28g of TDW of bean used as relative control (RC at 100% NPF dose. At flowering with 30 mg/plant got 1.5 g of TDW compared to 1.0g TDW of bean as CR. At physiological maturity bean with 30mg/plant had 34.83g/100 grains compared to 20.39g/grains of bean as CR. Those data supporting that Endopre 33® is an excellent choice in bean’s production at NPF 50% dose but not adverse effect on bean growth and yield in protected agriculture.

  9. Diets enriched with cranberry beans alter the microbiota and mitigate colitis severity and associated inflammation.

    Science.gov (United States)

    Monk, Jennifer M; Lepp, Dion; Zhang, Claire P; Wu, Wenqing; Zarepoor, Leila; Lu, Jenifer T; Pauls, K Peter; Tsao, Rong; Wood, Geoffrey A; Robinson, Lindsay E; Power, Krista A

    2016-02-01

    Common beans are rich in phenolic compounds and nondigestible fermentable components, which may help alleviate intestinal diseases. We assessed the gut health priming effect of a 20% cranberry bean flour diet from two bean varieties with differing profiles of phenolic compounds [darkening (DC) and nondarkening (NDC) cranberry beans vs. basal diet control (BD)] on critical aspects of gut health in unchallenged mice, and during dextran sodium sulfate (DSS)-induced colitis (2% DSS wt/vol, 7 days). In unchallenged mice, NDC and DC increased (i) cecal short-chain fatty acids, (ii) colon crypt height, (iii) crypt goblet cell number and mucus content and (iv) Muc1, Klf4, Relmβ and Reg3γ gene expression vs. BD, indicative of enhanced microbial activity and gut barrier function. Fecal 16S rRNA sequencing determined that beans reduced abundance of the Lactobacillaceae (Ruminococcus gnavus), Clostridiaceae (Clostridium perfringens), Peptococcaceae, Peptostreptococcaceae, Rikenellaceae and Pophyromonadaceae families, and increased abundance of S24-7 and Prevotellaceae. During colitis, beans reduced (i) disease severity and colonic histological damage, (ii) increased gene expression of barrier function promoting genes (Muc1-3, Relmβ, and Reg3γ) and (iii) reduced colonic and circulating inflammatory cytokines (IL-1β, IL-6, IFNγ and TNFα). Therefore, prior to disease induction, bean supplementation enhanced multiple concurrent gut health promoting parameters that translated into reduced colitis severity. Moreover, both bean diets exerted similar effects, indicating that differing phenolic content did not influence the endpoints assessed. These data demonstrate a proof-of-concept regarding the gut-priming potential of beans in colitis, which could be extended to mitigate the severity of other gut barrier-associated pathologies. PMID:26878790

  10. Relationship between Physiological Characteristic and Bean Quality on Some Cocoa Clones (Theobroma cacao L.

    Directory of Open Access Journals (Sweden)

    Indah Anita Sari

    2015-12-01

    Full Text Available Photosynthesis is one of the physiological process that influence the bean weight and this process related with the efectiveness of the stomata character and chlorophyll content in the leaves. The research was conducted at Kaliwining Research Station, Indonesian Coffee and Cocoa Research Institute. Design of experiment was randomized complete block design (RCBD consisted of six clones as treatment were Sulawesi 1, Sulawesi 2, Sca 6, ICS 60, TSH 858, ICCRI 03, PA 300. Each treatment was replicated three times.  Stomata resistance diffusion, tranpiration,the content of chlorophyll a, chlorophyll b, chlorophyll total (a+b, bean number and bean weight were observed. The resuts  of experiment showed that  difference in chlorophyll a, chlorophyll b, chlorophyll total (a+b, stomata resistance diffusion, bean number and bean weight existed within  six clones tested. Transpiration rate did not show the significantly different between six clones tested. Sulawesi 1 showed the highest content of chlorophyll a and  ICS 60 and ICCRI 03 showed higher content of chlorophyll b than the other clones. Chlorophyll a, b and total (a+b showed positively influence on bean number and bean weight. Transpiration rate had negatively influence to bean number per pod, on the otherhand it showed positively influence to bean weight. Chlorophyll total (a+b showed high genetic variance (σg2, high phenotypic variance (σf2  and high estimated value of heritability (H.  The chlorophyll a,b had moderate genetic variance, moderate phenotypic variance and high of estimated value of heritability.  Chlorophyll total (a+b could be used a selection criteria based on the value of correlation, genetic variance, phenotypic variance and estimated value of heritability would give high opportunity in selection process. 

  11. In vitro starch digestibility and predicted glycemic index of corn tortilla, black beans, and tortilla-bean mixture: effect of cold storage.

    Science.gov (United States)

    Sáyago-Ayerdi, S G; Tovar, Juscelino; Osorio-Díaz, P; Paredes-López, Octavio; Bello-Pérez, Luis A

    2005-02-23

    People in the rural areas of Mexico consume corn tortillas and beans as basic components of their diet. However, little is known about the nutritionally relevant features of starch present in such combined meals. The objective of the present study was to evaluate the in vitro bioavailability of starch in tortilla-bean mixtures stored at 4 degrees C for different times, as compared to that of corn tortilla and boiled black beans kept separately under the same conditions. Available starch (AS), resistant starch (RS), and retrograded resistant starch (RRS) contents were measured. The in vitro starch hydrolysis indices (HI) of freshly cooked and cold-stored samples were evaluated using a chewing/dialysis digestion protocol. HIs were used to predict glycemic indices (pGI) of the samples. AS in tortilla and beans decreased between 3 and 6% after 48-72 h, whereas values in the mixture fell by 3% after 48 h, with no further change by 72 h. Only minor rises in RS contents (1.5-1.6%) were recorded for tortilla and beans after 72 h of storage, and a lower increase (0.4%) was recorded in the mixture. Judging from RRS values, an important proportion of RS is due to starch retrogradation. The HI and pGI were higher in tortilla than in bean and the mixture. Hydrolysis rate values decreased in the stored samples, a pattern that corresponded with RS and RRS changes. The slow digestion features of common beans are largely retained by the legume-tortilla combination. Data support the perceived health beneficial properties of starch in this traditional cereal-legume food.

  12. Locust bean gum: processing, properties and food applications--a review.

    Science.gov (United States)

    Barak, Sheweta; Mudgil, Deepak

    2014-05-01

    Locust bean gum or carob gum is a galactomannan obtained from seed endosperm of carob tree i.e. Ceratonia siliqua. It is widely utilized as an additive in various industries such as food, pharmaceuticals, paper, textile, oil well drilling and cosmetics. Industrial applications of locust bean gum are due to its ability to form hydrogen bonding with water molecule. It is also beneficial in the control of many health problems like diabetes, bowel movements, heart disease and colon cancer due to its dietary fiber action. This article focuses on production, processing, composition, properties, food applications and health benefits of locust bean gum.

  13. Effects of sulphur dioxide on southern bean mosaic and maize dwarf mosaic

    Energy Technology Data Exchange (ETDEWEB)

    Laurence, J.A.; Aluisio, A.L.; Weinstein, L.H.; McCune, D.C.

    1981-01-01

    Sub-acute doses of sulphur dioxide (SO/sub 2/) (either 262 or 524 ..mu..g m/sup -3/) for 5-10 days caused small but consistent increases in the titre of southern bean mosaic virus (SBMV) in Bountiful bean and maize dwarf mosaic virus (MDMV) in maize. Exposure to SO/sub 2/ also increased infection and intensified symptoms caused by MDMV. Sulphur uptake by the host plant was not affected by either virus; however, pre- and post-inoculation exposures of bean plants to SO/sub 2/ resulted in greater than additive effects on sulphur uptake.

  14. Impact of Market Information System (E-Soko) on Beans Markets Integration: Case of Rwanda

    OpenAIRE

    Bizimana, Jean-Claude; Bessler, David A.; Angerer, Jay P.

    2013-01-01

    The goal of this study was to analyze the impact of a newly introduced market information system “E-Soko”, on beans markets integration by comparing the period before and after the system was implemented in Rwanda. Beans, both bush and climbing, are the most important traded crop in rural areas of Rwanda, and third most important in urban areas in terms of value. Bi-weekly prices on beans were analyzed for the two time periods: one before the introduction of the market information system “E-S...

  15. MONTHLY PRICE ANALYSIS OF COWPEA (BEANS AND MAIZE IN AKWA IBOM STATE, SOUTHERN NIGERIA

    Directory of Open Access Journals (Sweden)

    Sunday Brownson Akpan

    2014-04-01

    Full Text Available The study examined the price transmission and market integration of Maize and Beans in the rural and urban markets of Akwa Ibom State, Nigeria. Average monthly prices (measured in naira per kilogram of Maize and Cowpea in rural and urban markets were used in the analysis. The data was obtained from the quarterly publications of the Akwa Ibom State Agricultural Development Programme (AKADEP. The data covered the period; January 2005 to June 2013. The trend analysis showed that, prices of Maize and Beans in the rural and urban markets had exponential growth rates that were less than unity, which suggested a possible co-movement of these prices in the study area. Also, the Pearson correlation coefficient generated for the pair of rural and urban prices of Maize and Beans revealed significant linear symmetric relationships. The result implies the existence of symmetric market information flows between the rural and urban markets for Maize and Beans in the state. The Granger causality test revealed bi-directional relationships between the rural and urban price of Maize and Beans in the study area. The co-integration test revealed the presence of co-integration between the rural and urban prices of Maize and Beans. The coefficients of the price variables in the co-integration equations for Maize and Beans markets converged to unity or law of one price which implied perfect market integration in the long run. The results of the error correction model (ECM also confirm the existence of the short run market integration between the rural and urban prices of Maize and Beans in the study area. In addition, it was discovered that, the rural price of Maize adjusted faster to the stable state in the long run than the urban price. Likewise, the urban price of Beans adjusted faster than its corresponding rural price. The index of market connection (IMC supported the high short run market integration for prices of Maize and Beans in rural and urban markets. Based

  16. Changes in differently processed soya bean (Glycine max.) and lima bean (Phaseolus lunatus) with particular reference to their chemical composition and their mineral and some inherent anti-nutritional constituents.

    Science.gov (United States)

    Aletor, V A; Ojo, O I

    1989-01-01

    The effects of 3 processing techniques: cooking, roasting and autoclaving on the proximate chemical composition, the mineral content and some inherent toxic factors of soya and lima beans were investigated. The processing techniques generally reduced the crude fibre levels and enhanced the extractable fat in the soya and lima beans. The coefficients of variability for crude fibre and ether extract due to the processing techniques of soya and lima beans were 20.9%, 16.0% and 22.3%, 38.1%, respectively. In parallel with decreased ash content in the cooked bean samples, there was a decrease in the K, Mg, Na and P levels relative to the raw bean and also relative to the other processing techniques. Mineral contents of the autoclaved bean samples were generally similar to those of the raw (unprocessed) samples. Under the processing conditions, roasting caused the highest reduction in thioglucoside content (59%) in soya bean while cooking caused the highest reduction in lima bean (78%). Trypsin inhibitor activity (TIA) ranged between 0.59 mg/g sample in the cooked soya bean and 11.6 mg/g sample in the raw bean while the corresponding values for lima bean ranged between 0.59 and 6.3 mg/g sample. Cooking and roasting caused over 90% reduction of TIA, while autoclaving caused 64-69% reduction in both bean samples. Under the assay conditions, haemagglutinating activity was not detected in the cooked and autoclaved soya and lima beans. The need to prevent both functional and nutritional damage to food proteins and other nutrients, resulting from excessive heating, was discussed.

  17. Review: The Potential of the Common Bean (Phaseolus vulgaris as a Vehicle for Iron Biofortification

    Directory of Open Access Journals (Sweden)

    Nicolai Petry

    2015-02-01

    Full Text Available Common beans are a staple food and the major source of iron for populations in Eastern Africa and Latin America. Bean iron concentration is high and can be further increased by biofortification. A major constraint to bean iron biofortification is low iron absorption, attributed to inhibitory compounds such as phytic acid (PA and polyphenol(s (PP. We have evaluated the usefulness of the common bean as a vehicle for iron biofortification. High iron concentrations and wide genetic variability have enabled plant breeders to develop high iron bean varieties (up to 10 mg/100 g. PA concentrations in beans are high and tend to increase with iron biofortification. Short-term human isotope studies indicate that iron absorption from beans is low, PA is the major inhibitor, and bean PP play a minor role. Multiple composite meal studies indicate that decreasing the PA level in the biofortified varieties substantially increases iron absorption. Fractional iron absorption from composite meals was 4%–7% in iron deficient women; thus the consumption of 100 g biofortified beans/day would provide about 30%–50% of their daily iron requirement. Beans are a good vehicle for iron biofortification, and regular high consumption would be expected to help combat iron deficiency (ID.

  18. A comparison of antioxidative and anti-inflammatory activities of sword beans and soybeans fermented with Bacillus subtilis.

    Science.gov (United States)

    Han, Seon Su; Hur, Sun Jin; Lee, Si Kyung

    2015-08-01

    This study was conducted to determine the antioxidative and anti-inflammatory activities of non-fermented or Bacillus subtilis-fermented soybeans and sword beans (red and white). The total flavonoid content in both sword bean types was higher (1.9-2.5-fold) than that in soybeans. The total phenolic content in fermented red sword beans was 2.5-fold greater than that in non-fermented red sword beans. HPLC profiles revealed that gallic acid, methyl gallate, and ellagic acid were major phenolic components of non-fermented/fermented red sword beans. DPPH radical scavenging activity and ferric-reducing antioxidant power were higher in fermented red sword beans than in other beans. Non-fermented/fermented red sword beans had higher nitrite scavenging activity than butylated hydroxytoluene and non-fermented/fermented soybeans. The hyaluronidase inhibitory activity of non-fermented/fermented red sword beans was higher (1.5-2.6-fold) than that of non-fermented/fermented soybeans. These results suggest that B. subtilis-fermented sword beans are potential natural antioxidant sources and anti-inflammatory agents for the food industry. PMID:26149963

  19. Early selection of agronomic traits in segregating black bean populations

    Directory of Open Access Journals (Sweden)

    Juliano Garcia Bertoldo

    2010-01-01

    Full Text Available This study evaluated the agronomic performance of six segregating populations of black bean (BRS Supremo x CHP 97-01, BRS Supremo x CHP 97-04, BRS Supremo x CHP 97-05-16, BRS Supremo x CHP 97-26, BRS Supremo x IPR Graúna and BRS Supremo x Uirapuru IPR in the F3 generation, conducted by the bulk method. Populations and parents were evaluated in the 2007/08 growing season in a randomized block design with four replications. Results show promising traits of the segregating population BRS Supremo x CHP 97-04, which was superior to parent BRS Supremo, indicating the line for further selection. The segregating populations and their parents were grouped by Ward’s method, indicating the similarity of the selected lines.

  20. Three mimic mutants for reclining foliage in common bean

    International Nuclear Information System (INIS)

    Two new mutants for the reclining foliage (RF) character were induced by treating seed of dry bean (Phaseolus vulgaris L.) breeding lines B-351 and 182-1 with 20 krad of .gamma.-radiation. These two mutants were shown to be monogenic and recessive. Allelism tests between the common RF gene rf and the two new mimic mutants for RF indicated that each of the three mutants has an independent locus. The symbols rf2 and rf3 were given to the new mutants. F2 data from the allelism tests showed that the rf2 stock carries a recessive epistatic gene in that does not affect rf2 but suppresses expression of rf and rf3. The rf locus was shown to be independent of the Sur locus for RF in linkage group VII

  1. NOTE - Contribution of components of production on snap bean yield

    Directory of Open Access Journals (Sweden)

    Rogério Figueiredo Daher

    2012-09-01

    Full Text Available Aiming to estimate the path coefficients among morphological traits and effects of production components on the yield of grains and pods, thirty snap bean genotypes (27 lines and three commercial controls were evaluated in Bom Jesus of Itabapoana-RJ. The experiments were carried out in a randomized block design, with four replications, from May to June, in 2009 and 2010. Eight traits were evaluated and the number of pods per plant, associated with high genetic correlation, is the character with the most significant direct effect on productivity. There is a high rate of genotypic association between the yields of pods and grains, as well as direct effects of high magnitude and positive signal between them, indicating that the selection for increased pod yield allows increased grain yield.

  2. BEAN PRODUCERS’ PERSPECTIVES OF DEVELOPMENT IN SOMBRERETE, ZACATECAS

    Directory of Open Access Journals (Sweden)

    Octaviano Ceceñas-Jacquez

    2015-07-01

    Full Text Available In this investigation production strategies, marketing, food security and development possibilities for bean producers in the municipality of Sombrerete, Zacatecas are identified. The study is approached from the perspective of the theory of rural territorial development, and surveys producers were conducted. It is concluded that the region is moving smallholdings and decrease in family income, so that agriculture becomes increasingly a subsistence activity where diversification becomes more important. Productive transformation has its limitations due to factors such as the arid climate, the largest division of the land, the high cost of credit, low level of technology and knowledge producers. Additionally, much of small producers is outside the new models of organization and government support, so cannot be considered solved the institutional framework to promote equitable development of producers.

  3. ARTICLE - Inbreeding depression in castor bean (Ricinus communis L. progenies

    Directory of Open Access Journals (Sweden)

    Milton Krieger

    2012-12-01

    Full Text Available The purpose of this study was to investigate inbreeding depression (DE in castor bean. From a population derived from the Guarani cultivar, 60 mother plants were sampled. Three types of progenies were obtained from each one: from self-pollination (AU, from crosses (CR and from open pollination (PL. Grain yield of the progenies was evaluated in two locations. There was a strong interaction of progenies x locations, which led to obtaining estimates within each location. Broad variation was observed in inbreeding depression, with mean values of 6.7% and 13.4%, comparing AU progenies with PL progenies. It was observed that the population has high potential for selecting promising inbred lines. The frequency of mother plants generating progenies with simultaneous high general combination capacity and low inbreeding depression was low. Recurrent selection will increase the occurrence of parent plants associating these two properties, which is necessary for obtaining superior synthetic varieties.

  4. Confirmation of bean leaf beetle, Cerotoma trifurcata, feeding on cucurbits

    Directory of Open Access Journals (Sweden)

    R.L. Koch

    2004-02-01

    Full Text Available The objective of these studies was to assess the degree to which bean leaf beetle, Cerotoma trifurcata (Forster, will feed on cucurbits. In 2003, we documented an infestation of C. trifurcata in a commercial pumpkin field near Rosemount, MN, USA. To evaluate C. trifurcata feeding on cucurbits, we conducted laboratory no-choice and choice test feeding studies. In the laboratory, C. trifurcata fed most heavily on cotyledon-stage cucumber plants, followed by pumpkin and squash. With soybean plants present, C. trifurcata still fed on cucumber plants. However, C. trifurcata appeared to prefer soybeans until the quality of the soybean plants was diminished through feeding damage. This is the first known report of C. trifurcata feeding on cucurbits. The pest potential of C. trifurcata in cucurbit cropping systems should be further evaluated.

  5. Fate of labelled allitin in bean plant and mosquito

    International Nuclear Information System (INIS)

    Allitin, the insecticidal principle of garlic (Allium sativum L) is a mixture of diallyl di- and tri-sulfides. 35S-labelled allitin has been synthesised using different methods and used for the evaluation of its persistence in water. Results of these experiments showed that allitin has low persistence; more than 80% of the initial radioactivity was lost in 24 hr. when an aqueous emulsion of labelled allitin was exposed under the laboratory conditions. Fate of labelled allitin was studied in larvae and pupae of mosquitoes, Culex pipiens quinquefasciatus Say. Assimilation of allitin was found to be faster in larva compared to pupa. Intake of allitin by bean plant was also studied. Implications of the results obtained in the above experiments will be discussed. (author)

  6. Crop physiological analysis of seed quality variation in common bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Muasya, R.M.

    2001-01-01

    Keywords : Physiological maturity, harvest maturity, earliness, common bean, Phaseolus vulgaris L., morphological markers, variation, moisture content, dry weight, viability, vigour, electrical conductivity, tetrazolium, seed lot, seed filling, maturation drying, temperature, rainfa

  7. 豆渣调味酱的研制%Study on Bean Dregs Tartare Sauce

    Institute of Scientific and Technical Information of China (English)

    何欢; 黄宇; 黄莉萍; 林琳

    2009-01-01

    利用豆渣为主要原料,加入白砂糖、食盐、豆油、豆酱、酱油、白酒、味精、食品添加荆等辅料,开发出风味较好、酱香味浓郁的豆渣调味酱.研究了去除豆渣油腻味最佳的方法,通过正交试验确定了豆渣调味酱的最佳配方.%Bean dregs tartare sauce regard fresh bean dregs as main raw materials,adding such batching as sugar,sah,oil,sauce,soy sauce,liquor,MSG,food additives,etc.,to make delicious food.This experiment studied the best way of Ilemoving the bean dregs'greasy taste,and determined the best formula of bean dregs tartare sauce through orthogonal test.

  8. Black bean (Phaseolus vulgaris L.) protein hydrolysates: Physicochemical and functional properties.

    Science.gov (United States)

    Evangelho, Jarine Amaral do; Vanier, Nathan Levien; Pinto, Vânia Zanella; Berrios, Jose J De; Dias, Alvaro Renato Guerra; Zavareze, Elessandra da Rosa

    2017-01-01

    Black bean protein hydrolysates obtained from pepsin and alcalase digestions until 120min of hydrolysis were evaluated by gel electrophoresis, relative fluorescence intensity, emulsifying properties, light micrograph of emulsions and in vitro antioxidant activity. The emulsion stability of the bean protein hydrolysates were evaluated during 30days of storage. The pepsin-treated bean protein hydrolysates presented higher degree of hydrolysis than the alcalase-treated protein hydrolysates. The alcalase-treated bean protein hydrolysates showed higher surface hydrophobicity. Moreover, the protein hydrolysates obtained with alcalase digestion presented higher emulsion stability during 30-days than those obtained from pepsin digestion. The protein concentrate and especially the hydrolysates obtained from alcalase digestion had good emulsion stability and antioxidant activity. Thus, they could be exploited as protein supplements in the diet as nutritional and bioactive foods. PMID:27507499

  9. The effect of bean origin and temperature on grinding roasted coffee

    Science.gov (United States)

    Uman, Erol; Colonna-Dashwood, Maxwell; Colonna-Dashwood, Lesley; Perger, Matthew; Klatt, Christian; Leighton, Stephen; Miller, Brian; Butler, Keith T.; Melot, Brent C.; Speirs, Rory W.; Hendon, Christopher H.

    2016-04-01

    Coffee is prepared by the extraction of a complex array of organic molecules from the roasted bean, which has been ground into fine particulates. The extraction depends on temperature, water chemistry and also the accessible surface area of the coffee. Here we investigate whether variations in the production processes of single origin coffee beans affects the particle size distribution upon grinding. We find that the particle size distribution is independent of the bean origin and processing method. Furthermore, we elucidate the influence of bean temperature on particle size distribution, concluding that grinding cold results in a narrower particle size distribution, and reduced mean particle size. We anticipate these results will influence the production of coffee industrially, as well as contribute to how we store and use coffee daily.

  10. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos;

    2008-01-01

    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles...

  11. Fumonisin B2 production by Aspergillus niger in Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, P.; Mahakarnchanaku, W.; Nielsen, Kristian Fog;

    2009-01-01

    During 2006 and 2007, a total of 64 Thai dried coffee bean samples (Coffea arabica) from two growing sites in Chiangmai Province and 32 Thai dried coffee bean samples (Coffea canephora) from two growing sites in Chumporn Province, Thailand, were collected and assessed for fumonisin contamination...... by black Aspergilli. No Fusarium species known to produce fumonisin were detected, but black Aspergilli had high incidences on both Arabica and Robusta Thai coffee beans. Liquid chromatography (LC) with high-resolution mass spectrometric (HRMS) detection showed that 67% of Aspergillus niger isolates from...... coffee beans were capable of producing fumonisins B2 (FB2) and B4 when grown on Czapek Yeast Agar with 5% NaCl. Small amounts (1-9.7 ng g-1) of FB2 were detected in seven of 12 selected coffee samples after ion-exchange purification and LC-MS/MS detection. Two samples also contained FB4...

  12. Analysis of Determinants of Productivity and Technical Efficiency among Smallholder Common Bean Farmers in Eastern Uganda

    Directory of Open Access Journals (Sweden)

    K.W. Sibiko

    2013-09-01

    Full Text Available The study evaluated factors influencing bean productivity and technical efficiency among smallholder farmers in Eastern Uganda, using a stochastic frontier model and a Tobit model. Findings showed that bean productivity was significantly influenced by plot-size, seeds and planting fertilizer; mean technical efficiency for sampled farms was 48.2%. The Tobit model estimation revealed that technical efficiency was positively influenced by value of assets (at 1% level, extension service and group membership (at 5% level; while age and distance to the factor market negatively influenced technical efficiency at 10 and 5% levels respectively. Hence the study recommended the need for increased provision of extension service and training on correct input application and improved farming technologies to increase bean productivity. It also suggested the need for policy to discourage land fragmentation, develop road and market infrastructure in rural areas and encourage further formation of well managed farmer groups to improve production efficiency of bean farms.

  13. Transcriptome Sequencing of Lima Bean (Phaseolus lunatus to Identify Putative Positive Selection in Phaseolus and Legumes

    Directory of Open Access Journals (Sweden)

    Fengqi Li

    2015-07-01

    Full Text Available The identification of genes under positive selection is a central goal of evolutionary biology. Many legume species, including Phaseolus vulgaris (common bean and Phaseolus lunatus (lima bean, have important ecological and economic value. In this study, we sequenced and assembled the transcriptome of one Phaseolus species, lima bean. A comparison with the genomes of six other legume species, including the common bean, Medicago, lotus, soybean, chickpea, and pigeonpea, revealed 15 and 4 orthologous groups with signatures of positive selection among the two Phaseolus species and among the seven legume species, respectively. Characterization of these positively selected genes using Non redundant (nr annotation, gene ontology (GO classification, GO term enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analyses revealed that these genes are mostly involved in thylakoids, photosynthesis and metabolism. This study identified genes that may be related to the divergence of the Phaseolus and legume species. These detected genes are particularly good candidates for subsequent functional studies.

  14. Research on Development Strategy of Industry of Edible Beans in West China

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The West China is main producing region and advantageous producing region of edible beans. Developing industry of edible beans in West China has prominent regional advantage, production advantage, quality advantage, market advantage, and price advantage. We analyze the problems existing in the process of development of industry of edible beans in West China as follows: the cognition is insufficient; fund for scientific research is short; the basic research is weak; the planting is sparse; the industrialization is not sound; the information is restricted. Corresponding suggestions are put forward in this paper as follows, in order to ensure the healthy development of industry of edible beans in China: formulate preferential policies; establish high-quality edible producing bases; promote the brand effect; pay attention to post-production development; develop the idea of new agricultural planting and cultivation.

  15. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  16. Common bean cultivars and lines interactions with environments

    Directory of Open Access Journals (Sweden)

    Carbonell Sérgio Augusto Morais

    2004-01-01

    Full Text Available The performance of bean lines brought forth in breeding programs or of cultivars in use can be affected by environmental variability. The adaptability and stability of grain yield of 18 common bean cultivars and lines in 23 environments (combinations of seasons, years and locations were evaluated in the State of São Paulo, Brazil. 'IAC-Carioca' and 'IAC-Carioca Eté' were used as standard cultivars for the carioca grain type, while 'FT-Nobre' and 'IAC-Una' represented the standard for black grains. The experiment was set up in a randomized complete block design with four replications and plots consisting of two, two central five meters rows flanked by border rows. Stability parameters were estimated by the methods Maximum Yield Deviations (MYD and by the Additive Main Effects and Multiplicative Interaction Analysis (AMMI. For the identification of the most stable cultivars, the two methods led to consistent results, although by MYD the highest stability was always associated to the highest yield. 'MAC-733327' and 'LP 9637' were the most suitable cultivars and lines for the joint seasons, while 'LP 9637' and 'FT-Nobre' were the most suitable for the dry season. The MYD method combined a simple procedure, easiness of result interpretation, uniqueness of parameters, and association between stability and yield. On the other hand, the AMMI method simplified the identification of stable cultivars by visual inspection, also providing information on the environments. However, the complex nature which combines uni-and multivariate techniques hampers its widespread use in breeding programs.

  17. Induced mutations for disease resistance in wheat and field beans

    International Nuclear Information System (INIS)

    Wheat disease in Egypt is reviewed and results of mutation breeding by γ irradiation for disease resistance in wheat and field beans are described. Wheat mutants of the variety Giza 155 resistant to leaf rust, Giza 156 resistant to both leaf and yellow rusts, and Tosson with a reasonable level of combined resistance to the three rusts in addition to mutants of the tetraploid variety Dakar 52 with a good level of stem and yellow rust resistance are required. Their seeds were subjected to 10, 15 and 20 krad. Of 3000-3700 M2 plants from each variety and dosage, 22 plants from both Giza 155 and Giza 156, although susceptible, showed a lower level of disease development. In 1975, M3 families of these selected plants and 6000 plants from bulked material were grown from each variety and dosage at two locations. Simultaneously, an additional population consisting of 3000 mutagen-treated seeds was grown to have a reasonable chance of detecting mutants; 2 heads from each plant were harvested. These will be grown next season (1976) to make a population of 25,000-30,000 M2 plants and screened to composite cultures of specific rusts. Vicia faba seeds of field bean varieties Giza 1, Giza 2 and Rebaya 40, equally susceptible to rust and chocolate spot, were subjected to 3, 5 and 7 krad of 60Co gamma radiation and 800 M1 plants were grown in 1972 per variety and dose. Up to this later growing season (M3) no resistance was detected in M3 plank

  18. Radiation disinfestation of tobacco leaves and coffee beans

    International Nuclear Information System (INIS)

    The most important insects found on coffee and tobacco in storage are A. fasciculatus and L. serricorne, respectively. Some genera of mold, such as Rhyzopus, Aspergillus, Penicillium and Mucor, were found on stored coffee. A preliminary study of radiation disinfestation of coffee beans was carried out using 24 bags (each l.5 kg) of Arabica coffee. Each bag was infested with l00 adults of l-day-old to 8-day old A. fasciculatus. One month after infestation, the bags were divided into 6 groups (4 bags each). Five groups were irradiated with doses of 0, 0.05, 0.l0, 0.20, and 0.40 kGy, while the sixth group was fumigated with about 3 g phosphine-m/sup 3/. The work is still in progress. The preliminary data (insect density, percentage weight loss of coffee beans, and mold infestation) from l0 observation periods during 20 weeks of storage after treatment was reported. Radiation disinfestation of tobacco was done on 36 export-size bales (each l00 x 75 x 40 cm in size and about k00 kg in weight) of tobacco. Each bale was infested with larvae, pupae, and adults of L. serricorne. One week after infestation, the bales were divided into 3 groups, the first group kept untreated as controls, the second group irradiated at a dose range of 0.30 to 0.60 kGy, and the third group fumigated with about 3 g phosphine/m/sup 3/. Insect density, leaf moisture content and mold infestation will be observed after 0, 2, 4, and 6 months of storage. The work was begun in October l983 and data presently are being collected

  19. Genetic diversity analysis of common beans based on molecular markers

    Directory of Open Access Journals (Sweden)

    Homar R. Gill-Langarica

    2011-01-01

    Full Text Available A core collection of the common bean (Phaseolus vulgaris L., representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each, as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP +3/+3 primer combinations and seven simple sequence repeats (SSR loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA and molecular variance (AMOVA analyses. AFLP analysis produced 530 bands (88.5% polymorphic while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus. AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  20. Genetic diversity analysis of common beans based on molecular markers.

    Science.gov (United States)

    Gill-Langarica, Homar R; Muruaga-Martínez, José S; Vargas-Vázquez, M L Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl

    2011-10-01

    A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  1. Host preference of the bean weevil Zabrotes subfasciatus

    Institute of Scientific and Technical Information of China (English)

    Isabel Ribeiro do Valle Teixeira; Angel Roberto Barchuk; Fernando Sérgio Zucoloto

    2008-01-01

    It is largely known that the range of an insect diet is mostly determined by oviposition behavior, mainly in species with endophytic larvae such as Zabrotes subfasciatus.However, the proximate factors determining host choice and the subsequent steps leading to the expansion or reduction of the host number and occasional host shifts are largelyun known. We analyzed various factors determining host preference of Z. subfasciatus through the evaluation of: (i) oviposition preference of a wild population of Z. subfasciatus on the usual host (bean) and unusual hosts (lentil, chickpea and soy), and the performance of the offspring; (ii) artificial selection for increasing preference for hosts initially less frequently chosen; (iii) comparison of oviposition behavior between two different popula-tions (reared for~30 generations in beans or chickpeas, respectively); (iv) oviposition timing on usual and unusual hosts; and (v) identification of preference hierarchies. We found that when using unusual hosts, there is no correlation between performance and preference and that the preference hierarchy changes only slightly when the population passes through several generations on the less frequently accepted host. We also found a positive response to artificial selection for increasing oviposition on the less preferred host; however, when the host-choice experiment involved two varieties of the usual host, the response was faster than when the choice involved usual and unusual hosts. Finally, beetles reared on an unusual host (chickpea) for 26 generations showed similar good fitness on both usual and unusual hosts,indicating that the use of a new host does not necessarily result in the loss of performance on the original host. Nevertheless, this population showed lower fitness on the usual host than that of the original population, suggesting an underlying partial trade-off phenomenon which may contribute to a broadening of diet of this insect species.

  2. Inheritance of resistance to the bean-pod weevil (Apion godmani Wagner) in common beans from Mexico.

    Science.gov (United States)

    Garza, R; Cardona, C; Singh, S P

    1996-03-01

    The bean-pod weevil (BPW), Apion godmani Wagner, often causes heavy losses in crops of common bean (Phaseolus vulgaris L.). Farmers need resistant bean cultivars to minimize losses, cut production costs, stabilize seed yield, and reduce pesticide use and consequent health hazards. To design effective breeding methods, breeders need new and better sources of resistance and increased knowledge of their modes of inheritance. We therefore: (1) compared sources of resistance to BPW, (2) studied the inheritance of resistance, and (3) determined whether the sources possess similar or different genes for BPW resistance. The following sources of resistance, originating from the Mexican highlands, were evaluated for 3 years at INIFAP-Santa Lucía de Prias, Texcoco, Mexico: 'Amarillo 153', 'Amarillo 169', 'Hidalgo 58', 'J 117', 'Pinto Texcoco', 'Pinto 168', and 'Puebla 36'. All except 'Puebla 36' were crossed with the susceptible cultivar 'Jamapa'. 'Amarillo 153' and 'Puebla 36' were crossed with another susceptible cultivar, 'Bayo Mex'. The parents, F1 hybrids, and F2 populations were evaluated for BPW damage in 1992. Backcrosses of the F1 of Jamapa/Pinto 168 to the respective susceptible and resistant parents were also evaluated in 1992. All seven resistant accessions were crossed in all possible combinations, excluding reciprocals. The resulting 21 F1 hybrids and 21 F2 populations were evaluated for BPW damage in 1994. 'J 117' had the highest level of resistance to BPW. 'Pinto Texcoco' and 'Puebla 36' had the highest mean damage score of all seven sources of resistance. The F1 hybrids between susceptible parents and resistant sources were generally intermediate. Two genes segregating independently controlled the BPW resistance in each accession. One gene, Agm, has no effect when present alone, whereas the other gene, Agr, alone conferred intermediate resistance. When both genes were present, resistance to BPW was higher. Based on mean BPW damage scores, all 21 F1 hybrids

  3. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker

  4. Analysis of simple sequence repeats in rice bean (Vigna umbellata) using an SSR-enriched library

    Institute of Scientific and Technical Information of China (English)

    Lixia Wang; Kyung Do Kim; Dongying Gao; Honglin Chen; Suhua Wang; SukHa Lee; Scott A. Jackson; Xuzhen Cheng

    2016-01-01

    Rice bean (Vigna umbellata Thunb.), a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%). Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7%of the total, followed by AAG/CTT (14.3%), and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2%were involved in cellular components, 24.2%were involved molecular functions, and 64.6%were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker-assisted selection in

  5. Identification and analysis of common bean (Phaseolus vulgaris L. transcriptomes by massively parallel pyrosequencing

    Directory of Open Access Journals (Sweden)

    Thimmapuram Jyothi

    2011-10-01

    Full Text Available Abstract Background Common bean (Phaseolus vulgaris is the most important food legume in the world. Although this crop is very important to both the developed and developing world as a means of dietary protein supply, resources available in common bean are limited. Global transcriptome analysis is important to better understand gene expression, genetic variation, and gene structure annotation in addition to other important features. However, the number and description of common bean sequences are very limited, which greatly inhibits genome and transcriptome research. Here we used 454 pyrosequencing to obtain a substantial transcriptome dataset for common bean. Results We obtained 1,692,972 reads with an average read length of 207 nucleotides (nt. These reads were assembled into 59,295 unigenes including 39,572 contigs and 19,723 singletons, in addition to 35,328 singletons less than 100 bp. Comparing the unigenes to common bean ESTs deposited in GenBank, we found that 53.40% or 31,664 of these unigenes had no matches to this dataset and can be considered as new common bean transcripts. Functional annotation of the unigenes carried out by Gene Ontology assignments from hits to Arabidopsis and soybean indicated coverage of a broad range of GO categories. The common bean unigenes were also compared to the bean bacterial artificial chromosome (BAC end sequences, and a total of 21% of the unigenes (12,724 including 9,199 contigs and 3,256 singletons match to the 8,823 BAC-end sequences. In addition, a large number of simple sequence repeats (SSRs and transcription factors were also identified in this study. Conclusions This work provides the first large scale identification of the common bean transcriptome derived by 454 pyrosequencing. This research has resulted in a 150% increase in the number of Phaseolus vulgaris ESTs. The dataset obtained through this analysis will provide a platform for functional genomics in common bean and related legumes and

  6. Nutritional and Biochemical Studies on Irradiated Broad Beans (Giza-2)(Vicia Faba)

    International Nuclear Information System (INIS)

    Broad bean is an important source of dietary protein in Egypt. High losses due to insect infestation occur after each harvest. Radiation processing is an excellent alternative method which could be used to combat these losses. The beans were irradiated at doses of 2.5,5, 10 and 20 kGy. The effects of treatments were investigated on trypsin inhibitor, hemagglutination activity, in vitro protein digestibility, in vivo protein efficiency ratio (PER) and short-term rats feeding. A dose of 20 kGy significantly caused a great reduction in trypsin inhibitor (by 67.12%) and hemagglutination activity (by 87.5%) in broad bean, whereas its in vitro protein digestibility increased from 67.15 to 80, 68% and PER also increased from 1.01 to 1.22. The results of short term of rat feeding experiments indicated that the growth of young rats given raw or irradiated beans at 2.5 and 5 kGy was much lower than that of rats given diet based upon casein or irradiated beans up to 20 kGy. Feeding raw and processed beans at 2.5 and 5 kGy, caused a significant increase in the relative weight of pancreas while feeding irradiated beans at 10 and 20 kGy normalized the relative pancreas weight. No changes have been observed in relative weight for stomach, heart, liver, spleen, kidney and lungs in rats fed casein diet as compared with those fed raw and irradiated beans up to 20 kGy for 8 weeks

  7. Tannins in faba beans (Vicia faba L.) : antinutritional properties in monogastric animals

    OpenAIRE

    A.J.M. Jansman

    1993-01-01

    Condensed tannins are found in coloured-flowering varieties of faba beans ( Viciafaba L.). They are considered as antinutritional factors for nonruminant species. High-tannin hulls of faba beans and isolated tannins were shown to induce a rapid hypertrophy of the parotid glands in rats and increase the secretion of salivary proline-rich proteins with a high affinity for tannins. In this way rats are able to defend themselves against more harmful effects of tannins. The growth performance of c...

  8. Analysis of Determinants of Productivity and Technical Efficiency among Smallholder Common Bean Farmers in Eastern Uganda

    OpenAIRE

    Sibiko, K.W.; G Owuor; Birachi, E.; Gido, E.O.; O.I. Ayuya; Mwangi, J.K.

    2013-01-01

    The study evaluated factors influencing bean productivity and technical efficiency among smallholder farmers in Eastern Uganda, using a stochastic frontier model and a Tobit model. Findings showed that bean productivity was significantly influenced by plot-size, seeds and planting fertilizer; mean technical efficiency for sampled farms was 48.2%. The Tobit model estimation revealed that technical efficiency was positively influenced by value of assets (at 1% level), extension service and grou...

  9. Eat dry beans, split peas, lentils and soya regularly: a food–based dietary guideline

    OpenAIRE

    C. S. Venter; Vorster, H H; Ochse, R; Swart, R.

    2013-01-01

    The objective of this paper is to review recent scientific evidence to support the food-based dietary guideline (FBDG): “Eat dry beans, split peas, lentils and soya regularly”. In this review, legumes are synonymous with the term “pulses”, while soy beans are classified as “oilseeds”. The FBDG was originally introduced to address both under- and overnutrition in South Africa. The nutrient and non-nutrient content, results of recent epidemiological and intervention studies on health e...

  10. Common Beans and Their Non-Digestible Fraction: Cancer Inhibitory Activity—An Overview

    OpenAIRE

    Rocio Campos-Vega; B Dave Oomah; Guadalupe Loarca-Piña; Haydé Azeneth Vergara-Castañeda

    2013-01-01

    The US Department of Agriculture’s MyPyramid guidelines introduced a near doubling of the dietary recommendations for vegetables including dry beans—an important food staple in many traditional diets that can improve public health and nutrition. Populations with high legume (peas, beans, lentils) consumption have a low risk of cancer and chronic degenerative diseases. Common beans (Phaseolus vulgaris L.) are known as a rich, reliable source of non-digested compounds like fiber, phenolics, pep...

  11. Phytochemical Evaluation of Moth Bean (Vigna aconitifolia L.) Seeds and Their Divergence

    OpenAIRE

    Neha Gupta; Nidhi Shrivastava; Pramod Kumar Singh; Bhagyawant, Sameer S.

    2016-01-01

    In the present study, phytochemical contents of 25 moth bean (Vigna aconitifolia) seed accessions were evaluated. This includes protease inhibitors, phytic acid, radical scavenging activity, and tannins. The studies revealed significant variation in the contents of theses phytochemicals. Presence of photochemical composition was correlated with seed storage proteins like albumin and globulin. Qualitative identification of total seed storage protein abundance across two related moth bean acces...

  12. Performance of Disk Mill Type Mechanical Grinder for Size Reducing Process of Robusta Roasted Beans

    Directory of Open Access Journals (Sweden)

    Sri Mulato

    2006-12-01

    Full Text Available One of improtant steps in secondary coffee processing that influence on final product quality such as consistency and uniformity is milling process. Usually, Indonesian smallholder used "lumpang" for milling coffee roasted beans to coffee powder product which caused the final product not uniformed and consistent, and low productivity. Milling process of coffee roasted beans can be done by disk mill type mechanical grinder which is used by smallholder for milling several cereals. Indonesian Coffee and Cocoa Research Institute have developed disk mill type grinding machine for milling coffee roasted beans. Objective of this research is to find performance of disk mill type grinding machine for size reducing process of Robusta roasted beans from several size dried beans and roasting level treatments. Robusta dried beans which are taken from dry processing method have 13—14% moisture content (wet basis, 680—685 kg/m3 density, and classified in 3 sizes level. The result showed that the disk mill type of grinding machine could be used for milling Robusta roasted beans. Machine hascapacity 31—54 kg/h on 5,310—5,610 rpm axle rotation and depend on roasting level. Other technical parameters were 91—98% process efficientcy, 19—31 ml/ kg fuel consumption, 0.3—1% slips, 50—55% particles had diameter less than 230 mesh and 38—44% particles had diameter bigger than 100 mesh, 32—38% lightness was increased, 0.6—12.6% density was decreased, and solubility of coffee powder between 28—30%. Cost milling process per kilogram of Robusta roasted beans which light roast on capacity 30 kg/hour was Rp362.9. Key words : Coffee roasted, Robusta, disk mill, mechanical grinder, size reduction.

  13. Polyphenol Content and Antiradical Activity of “Sarconi” Beans (Phaseolus vulgaris L.) Ecotype

    OpenAIRE

    A. Romani; P. VIGNOLINI; M.A. Falvino; D. HEIMLER

    2013-01-01

    The aim of this study was to establish the distribution and content of polyphenols (anthocyans, flavonols and hydroxycinnamic acids) in hulls and seeds of Sarconi beans having different colours and shapes. Sarconi beans are protected by the indication of geographic provenance (IGP) denomination and include different ecotypes. The seeds sampled in the study area (Basilicata, val d’Agri) exhibited different colours from white (Riso bianco) to dark yellow (Tabacchino), to green (Verdolino) and t...

  14. Soluble and Insoluble Dietary Fiber in Cooked Common Bean (Phaseolus Vulgaris) Seeds

    OpenAIRE

    Hughes, Joe S.; Swanson, Barry G.

    1989-01-01

    The common bean (Phaseolus vulgaris) requires cooking for extended periods of time prior to consumption. In this investigation both quantitative and microstructural changes in common bean dietary fiber as a result of cooking were examined. Cooking resulted in a slight decrease in soluble dietary fiber and a marked increase in insoluble dietary fiber. The increase in insoluble dietary fiber was responsible for a 15 -30 percent increase in total dietary fiber. Scanning electron microscopy wa...

  15. Treatment of sugar beet extraction juice stillage by natural coagulants extracted from common bean

    OpenAIRE

    Prodanović Jelena M.; Šćiban Marina B.; Antov Mirjana G.; Kukić Dragana V.; Vasić Vesna M.

    2015-01-01

    Distillery wastewaters have a great pollution potential, and pollution caused by them is one of the most critical environmental issues. This study is concerned with the coagulation efficiency of a new, environmental friendly, natural coagulant extracted from common bean seeds in the primary treatment of distillery wastewater in the bioethanol production from sugar beet juice. Active coagulation components were extracted from ground seeds of common bean with...

  16. Iron and zinc retention in common beans (Phaseolus vulgaris L.) after home cooking

    OpenAIRE

    Lucia M. J. Carvalho; Corrêa, Mariana M.; Elenilda J. Pereira; Nutti, Marília R.; Carvalho, José L. V.; Ribeiro, Ediane M. G.; Freitas, Sidinéa C.

    2012-01-01

    Background: According to the World Health Organization (WHO), iron, iodine, and Vitamin A deficiencies are the most common forms of malnutrition, leading to severe public health consequences. The importance of iron and zinc in human nutrition and the number of children found to be deficient in these nutrients make further studies on retention in cooked grains and cooked bean broth important. Objectives: This work aimed to evaluate iron and zinc retention in six common bean (Phaseolus vulgaris...

  17. Presence of aspergillus and other fungal symbionts in coffee beans from colombia

    OpenAIRE

    Gamboa-Gaitán Miguel Ángel

    2011-01-01

    Fungi are common inhabitants of plants and plant-derived products. Some of these fungal species are potentially dangerous to human health since they are able to produce chemical substances that alter normal physiological activity. There are no studies about natural mycoflora associated with coffee beans in Colombia, and nothing is known about the presence and abundance of toxigenic fungal species in Colombian coffee. In this study 5,000 coffee beans were studied by plating them on potato-base...

  18. Physical Characteristics of Coffee Beans from Steaming Processin Single Column Reactor

    Directory of Open Access Journals (Sweden)

    Sukrisno Widyotomo

    2010-05-01

    Full Text Available One of important steps in decaffeination process is steaming. The aim of steaming is to expand coffee beans porosity in order to obtain optimal condition for decaffeination process. Steaming can be done in single column reactor using saturated water vapour as media. The objective of this research is to study physical characteristics of coffee beans after steaming process using single column reactor. Material tested was Robusta coffee with 13—14% moisture content after dry processing. Reactor capacity is 6 kg dried coffee beans and 30 l water to produce water vapour. Dried coffee beans classified in 4 grades, i.e. diameter size (d d>7,5 mm; 6,5beans expanded 8.6—9.5% in length, 12.2—13.3% in width, and 18.3—20.6% in thickness. Coffee bean volume increased 30—50%. Coffee bean moisture content increased f. Aritmatic diameter increased 8—13% while geometric diameter increased 9—18%. Sphericity not affected. Surface area increased 18—37%. True density increased 19—30% while bulk density was while. Porosity increased from 13—18% to 24—39% while coffee beans texture decreased from 323—384 g/1 mm to 212—225 g/1 mm. Color change increased from 14—20 to 38—40. The optimum steaming process was 3 hours.Key words : Coffee, steaming, single column reactor, decaffeination.

  19. THE RESPONSE STRATEGY OF MAIZE, PEA AND BROAD BEAN PLANTS TO DIFFERENT OSMOTIC POTENTIAL STRESS

    OpenAIRE

    Hamdia M. Abd El-Samad; SHADADD M.A.K.

    2013-01-01

    This investigation was conducted to study the tolerance strategy of maize, broad bean and pea plants to salinity stress with exogenous applications of proline or phenylalanine on seed germination and seedlings growth. From the results obtained, it can be observed that osmotic stress affected adversely the rate of germination in maize, broad bean and pea plants. The excessive inhibition was more prominent at higher concentration of NaCl. The seeds and grains tested were exhibited some differen...

  20. Application of extruded broken bean flour for formulation of gluten-free cake blends

    OpenAIRE

    Luciana de Oliveira Froes Gomes; Raquel de Andrade Cardoso Santiago; Ana Vania Carvalho; Rosangela Nunes Carvalho; Iana Gabriela de Oliveira; Priscila Zaczuk Bassinello

    2015-01-01

    The aim of this study was to determine the physical and microbiological characteristics of extruded broken beans flour, in addition to developing mixtures for gluten-free cake with these flours, evaluating their technological and sensory quality. Gluten-free formulations were prepared with 45%, 60% and 75% of extruded broken beans. All analyzes of the flours and mixtures for cakes were performed according to standard techniques found in the literature. Sensory analyzes of cakes applied the 9-...

  1. Optimized formulation and processing protocol for a supplementary bean-based composite flour.

    Science.gov (United States)

    Ndagire, Catherine T; Muyonga, John H; Manju, Reddy; Nakimbugwe, Dorothy

    2015-11-01

    Protein-energy malnutrition is the most serious nutritional body depletion disorder among infants and young children in developing countries, attributable to inadequate energy and nutrient intake, partly due to high dietary bulk of weaning and infant foods. The gruels fed to children are typically of low nutrient and energy density due to the low flour incorporation rate required for drinking viscosity. The aim of this study was to develop a nutritious product, based on common dry beans and other grains, suitable for supplementary feeding. The optimal processing conditions for desired nutritional and sensory attributes were determined using Response Surface Methodology. For bean processing, soaking for 6, 15, or 24 h, germination for 24 or 48 h, and cooking under pressure for either 10 or 20 min were the independent variables. The processed bean flour's total polyphenol, phytic acid and protein content, the sensory acceptability of the bean-based composite porridge and its protein and starch digestibility were dependent variables. Based on product acceptability, antinutrients and protein content, as well as on protein and starch digestibility, the optimum processing conditions for the bean flour for infant and young child feeding were 24 h of soaking, 48 h of malting, and 19 min of steaming under pressure. These conditions resulted in a product with the highest desirability. The model equations developed can be used for predicting the quality of the bean flour and the bean-based composite porridge. Bean optimally processed and incorporated with grain amaranth and rice flours of a ratio of 40: 30: 30, respectively, resulted into flour with high energy, mineral, and nutrient density of the final porridge. The composite is well adaptable to preparation at rural community level. The use of these locally available grains and feasible processes could make a great contribution to nutrition security in sub-Saharan Africa and other developing countries. PMID:26788294

  2. An increase in renal dopamine does not stimulate natriuresis after fava bean ingestion123

    Science.gov (United States)

    Garland, Emily M; Cesar, Tericka S; Lonce, Suzanna; Ferguson, Marcus C; Robertson, David

    2013-01-01

    Background: Fava beans (Vicia faba) contain dihydroxyphenylalanine (dopa), and their ingestion may increase dopamine stores. Renal dopamine regulates blood pressure and blood volume via a natriuretic effect. Objective: The objective was to determine the relation between dietary fava beans, plasma and urinary catechols, and urinary sodium excretion in 13 healthy volunteers. Design: Catechol and sodium data were compared by using a longitudinal design in which all participants consumed a fixed-sodium study diet on day 1 and the fixed-sodium diet plus fava beans on day 2. Blood was sampled at 1, 2, 4, and 6 h after a meal, and 3 consecutive 4-h urine samples were collected. Results: Mean (±SD) plasma dopa was significantly greater 1 h after fava bean consumption (11,670 ± 5440 compared with 1705 ± 530 pg/mL; P = 0.001) and remained elevated at 6 h. Plasma dopamine increased nearly 15-fold during this period. Fava bean consumption also increased urinary dopamine excretion to 306 ± 116, 360 ± 235, and 159 ± 111 μg/4-h urine sample compared with 45 ± 21, 54 ± 29, and 44 ± 17 μg in the 3 consecutive 4-h samples after the control diet (P ≤ 0.005). These substantial increases in plasma and urinary dopa and dopamine were unexpectedly associated with decreased urinary sodium. Conclusion: The failure of fava bean consumption to provoke natriuresis may indicate that dopa concentrations in commercially available beans do not raise renal dopamine sufficiently to stimulate sodium excretion, at least when beans are added to a moderate-sodium diet in healthy volunteers. This trial was registered at clinicaltrials.gov as NCT01064739. PMID:23553159

  3. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    Science.gov (United States)

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed. PMID:26838420

  4. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    OpenAIRE

    Devaraj Illakkiam; Manoharan Shankar; Paramasivan Ponraj; Jeyaprakash Rajendhran; Paramasamy Gunasekaran

    2014-01-01

    Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases) achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The ...

  5. Localization of β‐d‐Glucosidase Activity and Glucovanillin in Vanilla Bean (Vanilla planifolia Andrews)

    OpenAIRE

    ODOUX, E.; ESCOUTE, J.; VERDEIL, J. ‐L.; BRILLOUET, J. ‐M.

    2003-01-01

    The morphology, anatomy and histology of mature green vanilla beans were examined by light and transmission electron microscopy. Beans have a triangular cross‐section with a central cavity containing seeds. Each angle is lined with tubular cells, or papillae, while the cavity sides consist of placental laminae. The epicarp and endocarp are formed by one or two layers of very small cells, while the mesocarp contains large, highly vacuolarized cells, the cytoplasm being restricted to a thin lay...

  6. Identification of novel orosensory active molecules in cured vanilla Beans (Vanilla planifolia).

    Science.gov (United States)

    Schwarz, Bernd; Hofmann, Thomas

    2009-05-13

    Sequential application of solvent extraction, gel permeation chromatography, and HPLC in combination with taste dilution analyses, followed by LC-MS and 1D/2D NMR experiments, led to the discovery of seven velvety mouth-coating molecules in cured beans of Vanilla planifolia . Among these, 5-(4-hydroxybenzyl)vanillin, 4-(4-hydroxybenzyl)-2-methoxyphenol, 4-hydroxy-3-(4-hydroxy-3-methoxybenzyl)-5-methoxybenzaldehyde, (1-O-vanilloyl)-(6-O-feruloyl)-beta-d-glucopyranoside, americanin A, and 4',6'-dihydroxy-3',5-dimethoxy-[1,1'-biphenyl]-3-carboxaldehyde were previously not reported in vanilla beans. Sensory studies revealed human recognition thresholds for the velvety mouth-coating sensation between 1.0 and 5.0 mumol/kg (water). Interestingly, the biphenyl derivatives were found to enhance the perception of creaminess and fatty body of sweetened skim milk, among which 4',6'-dihydroxy-3',5-dimethoxy-[1,1'-biphenyl]-3-carboxaldehyde showed the lowest threshold level of 5 mumol/kg. Quantitative analysis of these compounds in cured vanilla beans from different origins as well as in noncured beans revealed that, with the exception of americanin A, all of the other taste compounds are not present in the green vanilla beans and are formed during the bean curing process.

  7. Effects of High Hydrostatic Pressure on Water Absorption of Adzuki Beans

    Directory of Open Access Journals (Sweden)

    Shigeaki Ueno

    2015-05-01

    Full Text Available The effect of high hydrostatic pressure (HHP treatment on dried soybean, adzuki bean, and kintoki kidney bean, which are low-moisture-content cellular biological materials, was investigated from the viewpoint of water absorption. The samples were vacuum-packed with distilled water and pressurized at 200 MPa and 25 °C for 10 min. After the HHP treatment, time courses of the moisture contents of the samples were measured, and the dimensionless moisture contents were estimated. Water absorption in the case of soybean could be fitted well by a simple water diffusion model. High pressures were found to have negligible effects on water absorption into the cotyledon of soybean and kintoki kidney bean. A non-linear least square method based on the Weibull equation was applied for the adzuki beans, and the effective water diffusion coefficient was found to increase significantly from 8.6 × 10−13 to 6.7 × 10−10 m2/s after HHP treatment. Approximately 30% of the testa of the adzuki bean was damaged upon HHP treatment, which was comparable to the surface area of the testa in the partially peeled adzuki bean sample. Thus, HHP was confirmed to promote mass transfer to the cotyledon of legumes with a tight testa.

  8. Influence of conservation tillage and zero tillage on arable weeds in organic faba bean production

    Directory of Open Access Journals (Sweden)

    Jung, Rüdiger

    2016-02-01

    Full Text Available The field experiments were conducted in 2008, 2009 and 2010 on a Gleyic Cambisol near Goettingen, Lower Saxony, Germany. A crop sequence of summer barley, winter cover crops (intercropped oat and sunflower and summer faba bean was examined under organic farming conditions. Emphasis was given to the studying of arable weeds in faba beans. However, enhancing symbiotic nitrogen fixation of summer faba beans by accumulation of soil-nitrogen by winter cover crops was a second objective in these experiments. The faba bean field plots had been cultivated with three different tillage systems: 1. zero tillage, sowing with cross-slottechnique, 2. conservation tillage (wing share cultivator, rotary harrow sowing with cross-slot-technique and 3. conventional tillage with mouldboard plough followed by rotary harrow, sowing with precision monoseeder. In plots with zero tillage preceding cover crops were left as mulch on the soil surface. Cover crops accumulated adequate nitrogen amounts and following faba beans reacted with significant increase (up to 10% in symbiotic nitrogen fixation. Maximum of arable weed biomass was observed in zero tillage-plots at the end of May or early in June. The abundance of the predominant weed wild mustard (Sinapis arvensis increased with tillage intensity, whereas the abundance of creeping thistle (Cirsium arvense increased in 2010 with decreasing tillage intensity. Average grain yield of faba beans was low with only 3.0 and 2.4 t ha-1 in 2009 and 2010, respectively.

  9. Amino Acid, Organic Acid, and Sugar Profiles of 3 Dry Bean (Phaseolus vulgaris L.) Varieties.

    Science.gov (United States)

    John, K M Maria; Luthria, Devanand

    2015-12-01

    In this study, we compared the amino acid, organic acid and sugar profiles of 3 different varieties of dry beans (black bean [BB], dark red bean [DRB], and cranberry bean [CB]). The efficiency of the 2 commonly used extraction solvents (water and methanol:chloroform:water [2.5:1:1, v/v/v/]) for cultivar differentiation based on their metabolic profile was also investigated. The results showed that the BB contained the highest concentration of amino acids followed by DRB and CB samples. Phenylalanine, a precursor for the biosynthesis of phenolic secondary metabolites was detected at low concentration in CB samples and correlated with the reduced anthocyanins content in CB extract as documented in the published literature. Comparing the extractability of 2 extraction solvents, methanol:chloroform:water (2.5:1:1, v/v/v/) showed higher recoveries of amino acids from 3 beans, whereas, sugars were extracted in higher concentration with water. Analytically, gas chromatography detected sugars (9), amino acids (11), and organic acids (3) in a single run after derivatization of the extracts. In comparison, ion chromatography detected only sugars in a single run without any derivatization step with the tested procedure. Bean samples are better differentiated by the sugar content extracted with water as compared to the aqueous organic solvent extracts using partial least-square discriminant analysis.

  10. Detoxification Of Ochratoxin AIN Green Coffee Beans By Physical Methods With Studying Genotoxicity Of Treated Samples

    International Nuclear Information System (INIS)

    Ochratoxin A (OTA) is potently nephrotoxic, teratogenic and carcinogenic, and the potency was varied markedly between species and sexes. Unfortunately, OTA are present due to mold contamination in different food stuffs such as coffee bean, therefore, the present study was carried out on collected imported coffee samples from super markets in Egypt. The isolation and identification proved presence of Penicilli sp. and Aspergillus sp. whereas the last one was dominant in two samples as A. niger and A. ochoruses. Determination of OTA by using HPLC analysis showed presence of high levels than the allowance levels in green coffee beans (more than 5 μg/kg; ppb). In addition, another group of collected samples as roasted coffee beans indicated the presence of high toxic concentrations of OTA. The study was then conducted on samples contain the highest OTA content by using some physical methods as gamma irradiation (5 and 10 kGy), charcoal (powder, granules), roasting (at 2000C for 7-10 min and 20 min). The results showed that proposed physical methods, mainly gamma irradiation and charcoal, could be efficient to decrease OTA in green beans coffee without produce toxic substance as well as non-significant changes in its properties. In addition, safety of resulted coffee beans after treatments were checked by ESR and genotoxicity test, which raise the preferability of gamma irradiation (10 kGy) treatment before using medium roasting to get coffee beans free from OTA

  11. Morphological characteristic of purple long yard bean cultivars and their tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    M W Lestari

    2015-01-01

    Full Text Available The cultivation of purple long yard bean which tolerance to drought stress and have high productivity can improve farming in arid area. The purpose of this study was to evaluate the mechanism of the tolerance purple long yard beans to drought stress based on morphologic characters, to get the hypothesis method of tolerance and to obtain tolerance cultivars to the drought stress. Eight cultivars of purple long yard beans, i.e. UBPHU1-41, UBPHU1-130, UBPU3-153, UBPU1-202, UBPU2-222, UBPU1-365, Brawijaya 4 and Bagong 2, were tested in two environmental conditions, 100% field capacity and 50% field capacity. The results showed that drought stress in purple long yard bean affected all morphological characters observed, except for root length and flowering time. Estimation of tolerance to drought stress using the Principles Component Analysis (PCA showed that the shoot fresh weight could be an indicator of purple pod bean tolerance to drought stress. However, the test using Stress Susceptibility Index (SSI was not able to classify the purple long yard bean tolerance to drought stress. The results of analysis using PCA followed by discriminant analysis and clustering dendrogram showed that the UBPU1-41, UBPU1-130, UBPU2-222, UBPU1-365, UB4 and Bagong 2 cultivars were medium cultivars that are tolerant to drought stress. Therefore, they can be planted in semiarid regions.

  12. Putative Rust Fungal Effector Proteins in Infected Bean and Soybean Leaves.

    Science.gov (United States)

    Cooper, Bret; Campbell, Kimberly B; Beard, Hunter S; Garrett, Wesley M; Islam, Nazrul

    2016-05-01

    The plant-pathogenic fungi Uromyces appendiculatus and Phakopsora pachyrhizi cause debilitating rust diseases on common bean and soybean. These rust fungi secrete effector proteins that allow them to infect plants, but their effector repertoires are not understood. The discovery of rust fungus effectors may eventually help guide decisions and actions that mitigate crop production loss. Therefore, we used mass spectrometry to identify thousands of proteins in infected beans and soybeans and in germinated fungal spores. The comparative analysis between the two helped differentiate a set of 24 U. appendiculatus proteins targeted for secretion that were specifically found in infected beans and a set of 34 U. appendiculatus proteins targeted for secretion that were found in germinated spores and infected beans. The proteins specific to infected beans included family 26 and family 76 glycoside hydrolases that may contribute to degrading plant cell walls. There were also several types of proteins with structural motifs that may aid in stabilizing the specialized fungal haustorium cell that interfaces the plant cell membrane during infection. There were 16 P. pachyrhizi proteins targeted for secretion that were found in infected soybeans, and many of these proteins resembled the U. appendiculatus proteins found in infected beans, which implies that these proteins are important to rust fungal pathology in general. This data set provides insight to the biochemical mechanisms that rust fungi use to overcome plant immune systems and to parasitize cells.

  13. Use of Wild Relatives and Closely Related Species to Adapt Common Bean to Climate Change

    Directory of Open Access Journals (Sweden)

    James D. Kelly

    2013-05-01

    Full Text Available Common bean (Phaseolus vulgaris L. is an important legume crop worldwide. However, abiotic and biotic stress limits bean yields to <600 kg ha−1 in low-income countries. Current low yields result in food insecurity, while demands for increased yields to match the rate of population growth combined with the threat of climate change are significant. Novel and significant advances in genetic improvement using untapped genetic diversity available in crop wild relatives and closely related species must be further explored. A meeting was organized by the Global Crop Diversity Trust to consider strategies for common bean improvement. This review resulted from that meeting and considers our current understanding of the genetic resources available for common bean improvement and the progress that has been achieved thus far through introgression of genetic diversity from wild relatives of common bean, and from closely related species, including: P. acutifolius, P. coccineus, P. costaricensis and P. dumosus. Newly developed genomic tools and their potential applications are presented. A broad outline of research for use of these genetic resources for common bean improvement in a ten-year multi-disciplinary effort is presented.

  14. Antihyperglycemic Effects of Fermented and Nonfermented Mung Bean Extracts on Alloxan-Induced-Diabetic Mice

    Directory of Open Access Journals (Sweden)

    Swee Keong Yeap

    2012-01-01

    Full Text Available Mung bean was reported as a potential antidiabetic agent while fermented food has been proposed as one of the major contributors that can reduce the risk of diabetes in Asian populations. In this study, we have compared the normoglycemic effect, glucose-induced hyperglycemic effect, and alloxan-induced hyperglycemic effect of fermented and nonfermented mung bean extracts. Our results showed that fermented mung bean extracts did not induce hypoglycemic effect on normal mice but significantly reduced the blood sugar levels of glucose- and alloxan-induced hyperglycemic mice. The serum levels of cholesterol, triglyceride (TG, and low-density lipoprotein (LDL were also lowered while insulin secretion and antioxidant level as measured by malonaldehyde (MDA assays were significantly improved in the plasma of the fermented mung bean-treated group in alloxan-induced hyperglycemic mouse. These results indicated that fermentation using Mardi Rhizopus sp. strain 5351 inoculums could enhance the antihyperglycemic and the antioxidant effects of mung bean in alloxan-treated mice. The improvement in the antihyperglycemic effect may also be contributed by the increased content of GABA and the free amino acid that are present in the fermented mung bean extracts.

  15. Effect of storage on the amino acid composition and biological quality of irradiated macacar beans Vigna unguiculata (L.) Walp

    International Nuclear Information System (INIS)

    The effects of two doses of gamma radiation (100 and 1,000 krad) upon the stability over a 6-month storage period of the amino acid composition and protein efficiency ratio (PER) of the macacar bean Vigna unguiculata (L.) Walp were investigated. No important differences were noted when the aminograms of irradiated and nonirradiated beans, either raw or cooked were compared. Nevertheless, the losses of lysine, arginine, and histidine due to cooking were greater in the irradiated beans. The PER of nonirradiated was higher than that of irradiated beans before and after the 6 months of storage, and was always lowest in the beans subjected to the higher dose of radiation. Qualitatively, an association was observed between the nutritional value (PER) and small decreases in the content of certain amino acids which resulted mainly from increased thermal lability of the irradiated bean protein

  16. Carcass, organ and organoleptic characteristics of broilers fed yeast treated raw soya bean and full fat soya bean

    Directory of Open Access Journals (Sweden)

    I.J. Onwumelu

    2014-02-01

    Full Text Available Carcass, Organs andOrganoleptic Characteristics of broilers fed yeast treated raw soya bean (RSBand full fat soya bean (FFSB were studied using one hundred and eighty day oldchicks. Standard poultry management techniques were applied and experimenteddiets provided ad libitum. Fifteen diets consisting of various proportions ofFFSB, RSB and yeast were formulated for the starter phase (0- 28 days andfinisher phase (29-56 days, respectively. The diets in each phase wereformulated to be isocaloric and isonitrogenous with the starter dietscontaining approximately 2900 kcal/kg ME and 23% crude protein, and thefinisher diets containing approximately 3000 kcal/kg and 20% crude protein. Thecarcass and organs studied include weights after defeathering, cut- up partswhich include thighs drumstick, shanks, wings, neck, back, breast head, andorgans such as heart, liver, spleen and gizzard. The lengths of theproventriculus, small intestine, colon and caeca were also measured. The studyshowed that RSB at the levels fed with and without yeast inclusion had nolethal effect on broiler chickens. However, higher performance may be achievedwhen RSB is fed at 25 % with 6 g/kg yeast inclusion at starter phase and at 25% without yeast or 75 % with 12 g/kg yeast inclusion. The study therefore,further maintained that inclusion of RSB with or without yeast in the diets ofbroilers can equally produce broiler with good weight comparable with feedingFFSB or conventional diets; feeding 75 % FFSB + 25 % RSB without yeastinclusion is capable of increasing the proportion of the broilers’ head andshank; RSB inclusion in broiler diets cause increase in the weight of thegizzard, pancreas as well as on the abdominal fat, and feeding FFSB and RSBwith or without east inclusion do not exert any noticeable effect on theorganoleptic ualities tenderness, flavour and in general acceptability ofbroilers. However, RSB enhances the juiciness of broilers

  17. Contribution of Bacillus Isolates to the Flavor Profiles of Vanilla Beans Assessed through Aroma Analysis and Chemometrics

    OpenAIRE

    Fenglin Gu; Yonggan Chen; Yiming Fang; Guiping Wu; Lehe Tan

    2015-01-01

    Colonizing Bacillus in vanilla (Vanilla planifolia Andrews) beans is involved in glucovanillin hydrolysis and vanillin formation during conventional curing. The flavor profiles of vanilla beans under Bacillus-assisted curing were analyzed through gas chromatography-mass spectrometry, electronic nose, and quantitative sensory analysis. The flavor profiles were analytically compared among the vanilla beans under Bacillus-assisted curing, conventional curing, and non-microorganism-assisted curin...

  18. Development of Gene-Based SSR Markers in Rice Bean (Vigna umbellata L.) Based on Transcriptome Data

    OpenAIRE

    Honglin Chen; Xin Chen; Jing Tian; Yong Yang; Zhenxing Liu; Xiyu Hao; Lixia Wang; Suhua Wang; Jie Liang; Liya Zhang; Fengxiang Yin; Xuzhen Cheng

    2016-01-01

    Rice bean (Vigna umbellata (Thunb.) Ohwi & Ohashi) is a warm season annual legume mainly grown in East Asia. Only scarce genomic resources are currently available for this legume crop species and no simple sequence repeat (SSR) markers have been specifically developed for rice bean yet. In this study, approximately 26 million high quality cDNA sequence reads were obtained from rice bean using Illumina paired-end sequencing technology and assembled into 71,929 unigenes with an average length o...

  19. FORMULATION AND NUTRITIONAL QUALITY OF INFANT FORMULA PRODUCED FROM GERMINATED POPCORN, BAMBARA GROUNDNUT AND AFRICAN LOCUST BEAN FLOUR

    OpenAIRE

    Oluwole Steve Ijarotimi; Oluremi Olufunke Keshinro

    2012-01-01

    The aim of this present study was to produce and evaluate the nutritional quality of complementary foods from popcorn, African locust bean and Bambara groundnut. The popcorn, bambara groundnut and African locust beans were obtained locally in Akure, Nigeria. The seeds were germinated, oven dried, milled and sieved into flours. The flours were mixed as follows: GPA (70% popcorn, 30% African locust bean), GPB (70% popcorn, 30% bambara groundnut) and GPAB (70% popcorn, 20% bambara groundnut, 10%...

  20. Kidney bean: a major sensitizer among legumes in asthma and rhinitis patients from India.

    Directory of Open Access Journals (Sweden)

    Ramkrashan Kasera

    Full Text Available BACKGROUND: The prevalence of IgE mediated food allergies has increased over the last two decades. Food allergy has been reported to be fatal in highly sensitive individuals. Legumes are important food allergens but their prevalence may vary among different populations. The present study identifies sensitization to common legumes among Indian population, characterizes allergens of kidney bean and establishes its cross reactivity with other legumes. METHODOLOGY: Patients (n = 355 with history of legume allergy were skin prick tested (SPT with 10 legumes. Specific IgE (sIgE and total IgE were estimated in sera by enzyme-linked immunosorbent assay. Characterization of kidney bean allergens and their cross reactivity was investigated by immunobiochemical methods. Identification of major allergens of kidney bean was carried out by mass spectrometry. PRINCIPAL FINDINGS: Kidney bean exhibited sensitization in 78 (22.0% patients followed by chickpea 65 (18.0% and peanut 53 (15%. SPT positive patients depicted significantly elevated sIgE levels against different legumes (r = 0.85, p<0.0001. Sera from 30 kidney bean sensitive individuals exhibited basophil histamine release (16-54% which significantly correlated with their SPT (r = 0.83, p<0.0001 and sIgE (r = 0.99, p<0.0001. Kidney bean showed eight major allergens of 58, 50, 45, 42, 40, 37, 34 and 18 kDa on immunoblot and required 67.3±2.51 ng of homologous protein for 50% IgE inhibition. Inhibition assays revealed extensive cross reactivity among kidney bean, peanut, black gram and pigeon pea. nLC-MS/MS analysis identified four allergens of kidney bean showing significant matches with known proteins namely lectin (phytohemagglutinin, phaseolin, alpha-amylase inhibitor precursor and group 3 late embryogenesis abundant protein. CONCLUSION/SIGNIFICANCE: Among legumes, kidney bean followed by chick pea and peanut are the major allergic triggers in asthma and rhinitis patients in India

  1. Regulation of copper homeostasis and biotic interactions by microRNA 398b in common bean.

    Directory of Open Access Journals (Sweden)

    Loreto Naya

    Full Text Available MicroRNAs are recognized as important post-transcriptional regulators in plants. Information about the roles of miRNAs in common bean (Phaseolus vulgaris L., an agronomically important legume, is yet scant. The objective of this work was to functionally characterize the conserved miRNA: miR398b and its target Cu/Zn Superoxide Dismutase 1 (CSD1 in common bean. We experimentally validated a novel miR398 target: the stress up-regulated Nodulin 19 (Nod19. Expression analysis of miR398b and target genes -CSD1 and Nod19- in bean roots, nodules and leaves, indicated their role in copper (Cu homeostasis. In bean plants under Cu toxicity miR398b was decreased and Nod19 and CSD1, that participates in reactive oxygen species (ROS detoxification, were up-regulated. The opposite regulation was observed in Cu deficient bean plants; lower levels of CSD1 would allow Cu delivery to essential Cu-containing proteins. Composite common bean plants with transgenic roots over-expressing miR398 showed ca. 20-fold higher mature miR398b and almost negligible target transcript levels as well as increased anthocyanin content and expression of Cu-stress responsive genes, when subjected to Cu deficiency. The down-regulation of miR398b with the consequent up-regulation of its targets was observed in common bean roots during the oxidative burst resulting from short-time exposure to high Cu. A similar response occurred at early stage of bean roots inoculated with Rhizobium tropici, where an increase in ROS was observed. In addition, the miR398b down-regulation and an increase in CSD1 and Nod19 were observed in bean leaves challenged with Sclerotinia scleortiorum fungal pathogen. Transient over-expression of miR398b in Nicotiana benthamiana leaves infected with S. sclerotiorum resulted in enhanced fungal lesions. We conclude that the miR398b-mediated up-regulation of CSD and Nod19 is relevant for common bean plants to cope with oxidative stress generated in abiotic and biotic

  2. THE OCCURRENCE OF INSECTS AND MOULDS IN STORED COCOA BEANS AT SOUTH SULAWESI

    Directory of Open Access Journals (Sweden)

    OKKY S. DHARMAPUTRA

    1999-01-01

    Full Text Available Surveys on postharvest handling and technology processing of cocoa beans at farmer, trader and exporter levels in South Sulawesi were conducted together with investigations on moisture content, pest infestation (insect and mould and quality characteris tics in terms of reducing sugar, free amino acid and free fatty acid content. Surveys were conducted during dry (July 1997 and wet seasons (February 1998 in three regencies (Pinrang, Polewali-Mamasa and Luwu and Ujung Pandang, South Sulawesi province. Interviews were carried out during surveys in the dry season. Number of respondents from farmers, trailers and exporters was 38, 15 and 5, respectively. In each season, number of samples taken from farmers, traders and exporters was 9, 21 and 15, respectively. In general, farmers, traders and exporters did not carry out postharvest handling and technology processing properly. Moisture content of cocoa beans collected from farmers, traders and exporters were higher than the tolerabl e limit recommended by SNI (7.5%. Moisture content of cocoa beans collected during the wet season was higher than in the dry season. Insects were found on cocoa beans collected from traders and exporters. Species composition and the presence of each insect species were varied among the two seasons, but the predominant species was Tribolium castaneum. At trader level the percentage of insect-damaged beans during the wet season was higher than that during the dry season, while at exporter le vel it was lower. During the two seasons the percentage of mouldy beans at farmer level was lower than the tolerable limit recommended by SNI (4%, while those from some samples at trader and exporter levels were higher than 4%, but based on the direct plating method, all of the samples at trader and exporter levels were mouldy. Species composition and the percentage of beans infected by each mould species at farmer, trader and exporter levels during the two seasons were va ried. The

  3. Morphological and genetic characterisation of some lima bean (phaseolus lunatus l.) cultivars and their nodulating rhizobia

    International Nuclear Information System (INIS)

    Three major investigations were carried out to assess the morphological traits and nodulation potential of thirteen lima bean cultivars as well as the genetic diversity of rhizobia nodulating these lima bean cultivars. Thirteen lima bean cultivars obtained from the CSIR-PGGRI and various market centres in Ghana were used. The experiment was conducted in pots filled with natural topsoil and arranged in a randomised complete block design (RCBD) with three replicates at the Biotechnology and Nuclear Agriculture Research Institute (BNARI) of the Ghana Atomic Energy Commission (GAEC). The study aimed at obtaining some relevant information on the morphological traits of the lima bean to be improved upon, to evaluate their nodulation tendencies and determine similarities and differences of their nodulating rhizobia. Significant differences were obtained in quantitative characters (leaflet length, leaflet width, pod length, pod width, seed length, seed width, seed weight per 10 seeds and days to 50% emergence), contributing to divergence among the lima bean cultivars. Qualitative traits, however, were mostly similar, with few exceptions such as the flower wing colour, growth habit, leaf shape, main stem pigmentation, pod beak shape, seed secondary colour and seed pattern colour showing divergence among the lima bean cultivars. Two major clusters were joined at the similarity distance of 0.69. Majority of the lima bean cultivars were identified to be of the same morphotype with exception in cultivars M4 and A2. There were no significant differences in mean nodule number, mean effective and non-effective nodule counts. The lima bean cultivar GH 17I4 showed superior performance with respect to nodule number counts, effective nodules, fresh shoot weight and fresh root weight. Additionally lima bean cultivars, M5 and A2 indicated superior radiation use efficiency with total shoot dry matter of 731kg/ha and 704kg/ha respectively. A positive and high correlation existed between

  4. Common Bean: A Legume Model on the Rise for Unraveling Responses and Adaptations to Iron, Zinc, and Phosphate Deficiencies.

    Science.gov (United States)

    Castro-Guerrero, Norma A; Isidra-Arellano, Mariel C; Mendoza-Cozatl, David G; Valdés-López, Oswaldo

    2016-01-01

    Common bean (Phaseolus vulgaris) was domesticated ∼8000 years ago in the Americas and today is a staple food worldwide. Besides caloric intake, common bean is also an important source of protein and micronutrients and it is widely appreciated in developing countries for their affordability (compared to animal protein) and its long storage life. As a legume, common bean also has the economic and environmental benefit of associating with nitrogen-fixing bacteria, thus reducing the use of synthetic fertilizers, which is key for sustainable agriculture. Despite significant advances in the plant nutrition field, the mechanisms underlying the adaptation of common bean to low nutrient input remains largely unknown. The recent release of the common bean genome offers, for the first time, the possibility of applying techniques and approaches that have been exclusive to model plants to study the adaptive responses of common bean to challenging environments. In this review, we discuss the hallmarks of common bean domestication and subsequent distribution around the globe. We also discuss recent advances in phosphate, iron, and zinc homeostasis, as these nutrients often limit plant growth, development, and yield. In addition, iron and zinc are major targets of crop biofortification to improve human nutrition. Developing common bean varieties able to thrive under nutrient limiting conditions will have a major impact on human nutrition, particularly in countries where dry beans are the main source of carbohydrates, protein and minerals. PMID:27200068

  5. Common bean: a legume model on the rise for unraveling responses and adaptations to iron, zinc and phosphate deficiencies.

    Directory of Open Access Journals (Sweden)

    Norma A Castro Guerrero

    2016-05-01

    Full Text Available Common bean (Phaseolus vulgaris was domesticated ~8000 years ago in the Americas and today is a staple food worldwide. Besides caloric intake, common bean is also an important source of protein and micronutrients and it is widely appreciated in developing countries for their affordability (compared to animal protein and its long storage life. As a legume, common bean also has the economic and environmental benefit of associating with nitrogen-fixing bacteria, thus reducing the use of synthetic fertilizers, which is key for sustainable agriculture. Despite significant advances in the plant nutrition field, the mechanisms underlying the adaptation of common bean to low nutrient input remains largely unknown. The recent release of the common bean genome offers, for the first time, the possibility of applying techniques and approaches that have been exclusive to model plants to study the adaptive responses of common bean to challenging environments. In this review, we discuss the hallmarks of common bean domestication and subsequent distribution around the globe. We also discuss recent advances in phosphate, iron, and zinc homeostasis, as these nutrients often limit plant growth, development and yield. In addition, iron and zinc are major targets of crop biofortification to improve human nutrition. Developing common bean varieties able to thrive under nutrient limiting conditions will have a major impact on human nutrition, particularly in countries where dry beans are the main source of carbohydrates, protein and minerals.

  6. Effects of plant oils on oviposition preference and larval survivorship of Callosobruchus chinensis (Coleoptera : Bruchidae) on azuki bean

    OpenAIRE

    Ahmed, Kazi Shahanara; Itino, Takao; Ichikawa, Toshihide

    1999-01-01

    The efficacy of four kinds of oils, neem, castor, sunflower and sesame, was evaluated for the control of infestation of stored azuki bean with Callosobruchus chinensis. Neem and sesame oil-treated beans were less preferred and oviposition of adults on these beans decreased. After three days of release, 100% adults were found dead on neem oil-treated beans and very few eggs were laid. Effects on the survival rate of immature beetles and percentage of seed weight loss were also recorded, Neem a...

  7. NITROGEN BALANCE AND RUMEN MICROBIAL PROTEIN SYNTHESIS IN GOATS FED DIETS CONTAINING SOAKED AND ROASTED MUCUNA BEAN (Mucuna Pruriens

    Directory of Open Access Journals (Sweden)

    M. R. MBEWE

    2014-01-01

    Full Text Available The effect of soaking and roasting velvet beans (Mucuna pruriens on nitrogen utilization and rumen microbial protein synthesis in goats was investigated. Sixteen goats were randomly assigned to four diets in a completely randomized design. Goats were fed a basal diet of Cynodon dactylon hay plus 30% soaked (treatment 1, 30% roasted (treatment 2 and 30% untreated velvet bean (treatment 3. The control diet had 100% hay (treatment 4. Animals were given experimental diets over 14 days following a 7-day adjustment period. Feed, refusals, urine and faecal samples were collected daily from individual goats for determination of nitrogen, nitrogen intake, utilization and allantoin in faeces and urine. Microbial protein yield was estimated from the allantoin. Data were analysed using PROC General Linear Model of Statistical Analysis Software. Goats fed a diet with soaked beans had significantly higher (P0.05 from that of goats fed untreated beans. Microbial protein synthesis was highest for diets with soaked beans although this was non-significantly different (P>0.05 from diets with roasted and untreated beans. All diets containing velvet beans, processed or not, contributed to significantly higher (P<0.05 microbial protein yield than diets with hay only. In terms of nitrogen balance, soaking can be recommended as an appropriate processing method for velvet beans for goat feeding. However, for microbial protein yield, processing method was not statistically important and the bean could be used untreated producing the same results.

  8. Homostachydrine (pipecolic acid betaine) as authentication marker of roasted blends of Coffea arabica and Coffea canephora (Robusta) beans.

    Science.gov (United States)

    Servillo, Luigi; Giovane, Alfonso; Casale, Rosario; Cautela, Domenico; D'Onofrio, Nunzia; Balestrieri, Maria Luisa; Castaldo, Domenico

    2016-08-15

    The occurrence of pipecolic acid betaine (homostachydrine) and its biosynthetic precursor N-methylpipecolic acid was detected for the first time in green coffee beans of Robusta and Arabica species. The analyses were conducted by HPLC-ESI tandem mass spectrometry and the metabolites identified by product ion spectra and comparison with authentic standards. N-methylpipecolic acid was found at similar levels in green coffee beans of Robusta and Arabica, whereas a noticeable difference of homostachydrine content was observed between the two green coffee bean species. Interestingly, homostachydrine content was found to be unaffected by coffee bean roasting treatment because of a noticeable heat stability, a feature that makes this compound a candidate marker to determine the content of Robusta and Arabica species in roasted coffee blends. To this end, a number of certified pure Arabica and Robusta green beans were analyzed for their homostachydrine content. Results showed that homostachydrine content was 1.5±0.5mg/kg in Arabica beans and 31.0±10.0mg/kg in Robusta beans. Finally, to further support the suitability of homostachydrine as quality marker of roasted blends of Arabica and Robusta coffee beans, commercial samples of roasted ground coffee blends were analyzed and the correspondence between the derived percentages of Arabica and Robusta beans with those declared on packages by manufacturers was verified. PMID:27006213

  9. Long-distance transport of natrium in bean plants

    International Nuclear Information System (INIS)

    After Na+-application to a certain zone of the root or after application to the tip or to the base of a primary leaf or along the stem of bean plants, the long-distance transport of Na+ was studied. The age of the plants was 8 d when root application took place, 10 d at the time of leaf application. After application to the root zone, the long-distance transport of Na+ in the direction of the shoot was strongly prevented, and the transport in the direction of the root point could be neglected. Presence of K+ in the ambient nutritive solution led to a strong increase of Na+ efflux from the roots. Within 48 hrs., 30-40% of the Na+ applied to a primary leaf were transported towards the roots. The Na+ efflux to the ambient nutritive solution came from the basal regions; it was mostly more than 10% of the amount recepted through the leaf and was only slightly increased by the presence of K+ in the external solution. In the case of Na+ application through the hypokotyl, this Na+-efflux from the roots was even more than 25% within 12 hrs. Both with leaf and with stem application, only 1% of the Na+ taken up was transported in the direction of the shoot point. The separation of the hypocotyl tissue in the bark and in the central cylinder showed the extremely high Na+ storage capacity of the central cylinder. The transfer of Na+ from the central cylinder into the bark seems to be fast in the hypocotyl, while the escape of Na+ from the phloem of the bark into the central cylinder is rather limited. Long-distance transport of Na+ in the phloem of the bark is highly basispetal and of high efficiency. Low Na+-contents in bean leaves are thus due to several regulation mechanisms: K+-stimulated Na+-efflux in the root, restricted long-distance transport in the xylemadue to high storage capacity of the xylemparenchyma, Na+ influx pumps at the phloem in stem and leaf and strictly basipetal phloem-retransport of Na+ in the root and efflux into the surrounding solution. (orig./MG)

  10. Evaluation of aminoacids in irradiated beans (Vigna unguiculata (L.) Walp) by high performance liquid chromatography (HPLC)

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Keila S. Cople; Souza, Luciana B.; Coelho, Maysa J.; Lima, Antonio L. Santos; Hernandes, Nilber K. [Instituto Militar de Engenharia (IME), Rio de Janeiro, RJ (Brazil). Secao de Engenharia Nuclear]. E-mail: keila@ime.eb.br; Godoy, Ronoel L.O. [EMBRAPA Agroindustria de Alimentos, Rio de Janeiro, RJ (Brazil)]. E-mail: ronoel@ctaa.embrapa.br

    2007-07-01

    Fradinho-bean (Vigna unguiculata (L.) Walp) is originated from Africa and is known in Brazil as 'caupi', 'corda' or 'macassar'. It is grown in the interior of Northeast Brazil (semi-arid region) and can be found in parts of the North, being one of the most important components of people's diet in those regions. The Northeast area produces around 429,375 ton of fradinho-bean per year. Leguminous plants are very important sources of proteins, vitamins, carbohydrates and minerals. This kind of bean is an excellent source of proteins (around 23- 25% of its nutritional content), being superior to regular beans (Phaseolus vulgaris). The irradiation process is an alternative to avoid post-harvesting losses, without changing the nutritional value of food. This study has the objective to evaluate the effect of different gamma irradiation doses (0.0; 0.5; 1.0; 2.5; 5.0 and 10.0 kGy) on aminoacid content of fradinho-bean by high performance liquid chromatography (HPLC) and the accompanying of the grains during storage time of 6 months. After irradiation, the bean grains went through a milling process in order to make flour for posterior extraction. A liquid chromatographer Waters, model Alliance 2695, with fluorescent detector Waters 2475, having a mobile phase with gradient elution of sodium acetate. acetonitrile and Milli-Q water, was employed. The flux used was 1 mL/min and the injection volume of 10 {mu}L. The column (C 18 150.0 x 3.9 mm) was kept at 36 deg C. The results show that gamma irradiation is a promise process for fradinho bean during conservation storage time of 6 months, until the dose of 10.0 kGy. Even the most radio-sensitive aminoacids like aromatics and basic lateral chains were preserved. (author)

  11. The toxicity and invasive effects of QDs on mung bean development

    Science.gov (United States)

    Zhai, Peng; Wang, Xiaomei; Wang, Ruhua; Huang, Xuan; Feng, Gang; Lin, Guimiao; Chen, Qiang; Xu, Gaixia; Chen, Danni

    2014-09-01

    Objective: Nowadays, the nanomaterials have been applied in every aspects of our life, including cosmetics, fresh-keeping, antisepsis and medicines. However, we know little about the toxic effects of nanoparticles towards plants. In this thesis, we synthesized quantum dots (QDs), and then toxicity and invasive effects of QDs for mung beans were investigated. Methods: We synthesised red CdTe QDs in water sphase with L-Cystein stabilizers, then prepared different concentration of QDs solution to cultivate mung bean plant, the radical length of mung beans was measured after four days every day, after 7 days, the distribution of QDs in mung bean plant was recorded under the microscopic. Results: The result showed the QDs inhibited the growth of mung beans, the higher the concentration of QDs was, the greater the inhibition effect was. After 7 days, the radicle average lengths of mung beans in different concentrations of QDs solution - blank 0.1μmol/L 0.2μmol/L 0.5 μmol/L 1 μmol/L - were 19.350+/- 0.427, 14.050+/- 0.879, 10.525+/- 0.554, 7.250+/- 0.522, 7.650+/- 0.229. The QDs mostly adhered onto the root surface and hairs. Conclusion: In conclusion, the QDs synthesized with L-cystein have effects on the growth of mung beans. However, it is necessary to do more experiments to confirm the mechanism of the toxicity effect of QDs on plants.

  12. Implications of mitotic and meiotic irregularities in common beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Lima, D C; Braz, G T; Dos Reis, G B; Techio, V H; Davide, L C; de F B Abreu, A

    2016-01-01

    The common bean has great social and economic importance in Brazil and is the subject of a high number of publications, especially in the fields of genetics and breeding. Breeding programs aim to increase grain yield; however, mitosis and meiosis represent under explored research areas that have a direct impact on grain yield. Therefore, the study of cell division could be another tool available to bean geneticists and breeders. The aim of this study was to investigate irregularities occurring during the cell cycle and meiosis in common bean. The common bean cultivar used was BRSMG Talismã, which owing to its high yield and grain quality is recommended for cultivation in Brazil. We classified the interphase nuclei, estimated the mitotic and meiotic index, grain pollen viability, and percentage of abnormalities in both processes. The mitotic index was 4.1%, the interphase nucleus was non-reticulated, and 19% of dividing somatic cells showed abnormal behavior. Meiosis also presented irregularities resulting in a meiotic index of 44.6%. Viability of pollen grains was 94.3%. These results indicate that the common bean cultivar BRSMG Talismã possesses repair mechanisms that compensate for changes by producing a large number of pollen grains. Another important strategy adopted by bean plants to ensure stability is the elimination of abnormal cells by apoptosis. As the common bean cultivar BRSMG Talismã is recommended for cultivation because of its good agronomic performance, it can be concluded that mitotic and meiotic irregularities have no negative influence on its grain quality and yield. PMID:27323072

  13. Assess suitability of hydroaeroponic culture to establish tripartite symbiosis between different AMF species, beans, and rhizobia

    Directory of Open Access Journals (Sweden)

    Jansa Jan

    2009-06-01

    Full Text Available Abstract Background Like other species of the Phaseoleae tribe, common bean (Phaseolus vulgaris L. has the potential to establish symbiosis with rhizobia and to fix the atmospheric dinitrogen (N2 for its N nutrition. Common bean has also the potential to establish symbiosis with arbuscular mycorrhizal fungi (AMF that improves the uptake of low mobile nutrients such as phosphorus, from the soil. Both rhizobial and mycorrhizal symbioses can act synergistically in benefits on plant. Results The tripartite symbiosis of common bean with rhizobia and arbuscular mycorrhizal fungi (AMF was assessed in hydroaeroponic culture with common bean (Phaseolus vulgaris L., by comparing the effects of three fungi spp. on growth, nodulation and mycorrhization of the roots under sufficient versus deficient P supplies, after transfer from initial sand culture. Although Glomus intraradices Schenck & Smith colonized intensely the roots of common bean in both sand and hydroaeroponic cultures, Gigaspora rosea Nicolson & Schenck only established well under sand culture conditions, and no root-colonization was found with Acaulospora mellea Spain & Schenck under either culture conditions. Interestingly, mycorrhization by Glomus was also obtained by contact with mycorrhized Stylosanthes guianensis (Aubl. sw in sand culture under deficient P before transfer into hydroaeroponic culture. The effect of bean genotype on both rhizobial and mycorrhizal symbioses with Glomus was subsequently assessed with the common bean recombinant inbreed line 7, 28, 83, 115 and 147, and the cultivar Flamingo. Significant differences among colonization and nodulation of the roots and growth among genotypes were found. Conclusion The hydroaeroponic culture is a valuable tool for further scrutinizing the physiological interactions and nutrient partitioning within the tripartite symbiosis.

  14. Comparison of Cocoa Beans from China, Indonesia and Papua New Guinea

    Directory of Open Access Journals (Sweden)

    Fenglin Gu

    2013-05-01

    Full Text Available A survey on five kinds of cocoa beans from new cocoa planting countries was conducted to analyze each kind’s basic quality. The average bean weight and butter content of Hainan cocoa beans were the lowest, at less than 1.1 g, and 39.24% to 43.44%, respectively. Cocoa beans from Indonesia where shown to be about 8.0% and 9.0% higher in average bean weight and butter content, respectively, than that of Papua New Guinea and about 20.0% and 25.0% higher in average bean weight and butter content than Chinese dried beans, respectively. The average total polyphenolic content ranged from 81.22 mg/10 g to 301.01 mg/10 g. The Hainan 2011 sample had the highest total polyphenolic content, followed by the unfermented sample from Indonesia and the Papua New Guinea sample. The polyphenolic levels found in the Hainan 2010 sample were 123.61 mg/10 g and lower than the other three samples, but the Indonesian fermented sample had the lowest total polyphenolic content of 81.22 mg/10 g. The average total amino acid content ranged from 11.58 g/100 g to 18.17 g/100 g. The total amino acid content was the highest in the Indonesian unfermented sample, followed by the Hainan 2011 sample and the Papua New Guinea sample. The levels found in the Hainan 2010 sample were lower; the Indonesian fermented sample had the lowest total amino acid content.

  15. Open sun drying of green bean: influence of pretreatments on drying kinetics, colour and rehydration capacity

    Science.gov (United States)

    İsmail, Osman; Kantürk Figen, Aysel; Pişkin, Sabriye

    2016-08-01

    Green bean (Phaseolus Vulgaris L), classified under legume family, is a primary source of dietary protein in human diets especially in the agricultural countries. Green bean is susceptible to rapid deterioration because of their high moisture content and in order to prevent and present the green bean drying process is applied. In this study, effects of pretreatments on drying kinetics, colour and rehydration capacity of green bean were investigated. It was observed that the pretreatment affected the drying time. The shortest drying times were obtained from pretreated samples with blanched. Drying times were determined as 47, 41 and 29 h for natural, salted and blanch, respectively. The results showed that pretreatment and ambient temperature significantly (P = 0.05) affected the drying rate and the drying time. The effective moisture diffusivity was determined by using Fick's second law and was found to be range between 3.15 × 10-10 and 1.2 × 10-10 m2/s for the pre-treated and natural green bean samples. The rehydration values were obtained 2.75, 2.71, 2.29 (g water/g dry matter) for the blanched, salted and natural samples. The effective diffusion coefficients were calculated using the data collected during the falling rate period and the experimental data are fitted to seven thin layer drying models which found in the literature. The Logarithmic model was found to best describe the drying behavior of fresh green beans under open air sun. Rehydration time and color parameters had been determined in order to improve the quality of dried green bean. Regarding with rehydration time and colour data, the best results were obtained at blanched drying conditions.

  16. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin

    2012-06-01

    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  17. Influence of partial replacement of soya bean meal by faba beans or peas in heavy pigs diet on meat quality, residual anti-nutritional factors and phytoestrogen content.

    Science.gov (United States)

    Gatta, Domenico; Russo, Claudia; Giuliotti, Lorella; Mannari, Claudio; Picciarelli, Piero; Lombardi, Lara; Giovannini, Luca; Ceccarelli, Nello; Mariotti, Lorenzo

    2013-06-01

    The study evaluated the partial substitution of soybean meal by faba beans (18%) or peas (20%) as additional protein sources in diets destined for typical Italian heavy pig production. It compared animal performances, meat quality, the presence of residual anti-nutritional factors (ANF) and phytoestrogens in plasma and meat and the possible effects on pig health, by evaluating oxidative, inflammatory and pro-atherogenic markers. The results showed that the productive performances, expressed as body weight and feed conversion ratio, of pigs fed with faba bean and pea diets were similar to those of pigs fed only the soybean meal. Meat quality of pigs fed with the three diets was similar in colour, water-holding capacity, tenderness and chemical composition. Despite the higher levels of phytoestrogen in the plasma of pigs fed only the soybean meal, phytoestrogen concentration in the muscle was equivalent to that of animals fed diets with faba beans, whereas pigs fed a diet with peas showed a lower concentration. Inflammation and pro-atherogenic parameters did not show significant differences among the three diets. Overall, the partial substitution of soybean meal by faba beans appears more interesting than with peas, particularly in relation to the higher amount of polyphenols in the diet and the highest concentration of phytoestrogens found in the plasma and muscle of animals, while the pyrimidine anti-nutritional compounds present in the diet did not appear to accumulate and had no effect on the growth performance of animals.

  18. Understanding and improving flavor in beans: Screening the USDA Phaseolus core collection for pod sugar and flavor compounds in snap and dry bean accessions

    Science.gov (United States)

    The objective of our research is to gain knowledge regarding variation in sugar and flavor content among a sample of dry bean and green pod-type accessions from the USDA Phaseolus Germplasm Core Collection, Pullman, WA. Knowledge of the variation will allow better utilization of germplasm resources ...

  19. Apple latent spherical virus vector as vaccine for the prevention and treatment of mosaic diseases in pea, broad bean, and eustoma plants by bean yellow mosaic virus.

    Science.gov (United States)

    Satoh, Nozomi; Kon, Tatsuya; Yamagishi, Noriko; Takahashi, Tsubasa; Natsuaki, Tomohide; Yoshikawa, Nobuyuki

    2014-11-01

    We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV) harboring a segment of the Bean yellow mosaic virus (BYMV) genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic symptoms due to BYMV infection were observed in the challenged plants pre-inoculated with the ALSV vaccine. Simultaneous inoculation with the ALSV vaccine and BYMV also prevented mosaic symptoms in broad bean and eustoma plants, and BYMV accumulation was strongly inhibited in the upper leaves of plants treated with the ALSV vaccine. Pea and eustoma plants were pre-inoculated with BYMV followed by inoculation with the ALSV vaccine to investigate the curative effects of the ALSV vaccine. In both plant species, recovery from mosaic symptoms was observed in upper leaves and BYMV accumulation was inhibited in leaves developing post-ALSV vaccination. These results show that ALSV vaccination not only prevents mosaic diseases in pea, broad bean, and eustoma, but that it is also effective in curing these diseases. PMID:25386843

  20. Apple Latent Spherical Virus Vector as Vaccine for the Prevention and Treatment of Mosaic Diseases in Pea, Broad Bean, and Eustoma Plants by Bean Yellow Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Nozomi Satoh

    2014-11-01

    Full Text Available We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV harboring a segment of the Bean yellow mosaic virus (BYMV genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic symptoms due to BYMV infection were observed in the challenged plants pre-inoculated with the ALSV vaccine. Simultaneous inoculation with the ALSV vaccine and BYMV also prevented mosaic symptoms in broad bean and eustoma plants, and BYMV accumulation was strongly inhibited in the upper leaves of plants treated with the ALSV vaccine. Pea and eustoma plants were pre-inoculated with BYMV followed by inoculation with the ALSV vaccine to investigate the curative effects of the ALSV vaccine. In both plant species, recovery from mosaic symptoms was observed in upper leaves and BYMV accumulation was inhibited in leaves developing post-ALSV vaccination. These results show that ALSV vaccination not only prevents mosaic diseases in pea, broad bean, and eustoma, but that it is also effective in curing these diseases.

  1. Effects of processing moisture on the physical properties and in vitro digestibility of starch and protein in extruded brown rice and pinto bean composite flours.

    Science.gov (United States)

    Sumargo, Franklin; Gulati, Paridhi; Weier, Steven A; Clarke, Jennifer; Rose, Devin J

    2016-11-15

    The influence of pinto bean flour and processing moisture on the physical properties and in vitro digestibility of rice-bean extrudates has been investigated. Brown rice: pinto bean flour (0%, 15%, 30%, and 45% bean flour) were extruded under 5 moisture conditions (17.2%, 18.1%, 18.3%, 19.5%, and 20.1%). Physical properties [bulk density, unit density, radial expansion, axial expansion, overall expansion, specific volume, hardness, color, water solubility index, and water absorption index] and in vitro starch and protein digestibilities were determined. Increasing bean flour and processing moisture increased density and hardness while decreasing expansion. Rapidly digestible starch decreased and resistant starch increased as bean substitution and processing moisture increased. In vitro protein digestibility increased with increasing bean flour or with decreasing processing moisture. Incorporating bean flour into extruded snacks can negatively affect physical attributes (hardness, density, and expansion) while positively affecting in vitro starch (decrease) and protein (increase) digestibilities. PMID:27283689

  2. Study on Dielectric Propertiesof Black Bean and Red Kidney Bean%黑豆与红芸豆介电特性比较研究

    Institute of Scientific and Technical Information of China (English)

    王竹怡; 钟宇; 邓云; 赵艳云

    2014-01-01

    Dielectric properties ofblack bean and red kidney bean samples were determined using an open-ended coaxial-line probe with an impedance analyzer over the frequency ranging from 300 MHz to 4 500 MHz , moisture contents ca. 12%and 32%, temperature from 25℃to 55℃. The results indicated that the dielectric constant and loss factor of the two bean samples decreased with the increasing frequency but increased with the increasing temperature and moisture content. Power penetration depth decreased with the increasing moisture content,temperature and frequency, which could be applied in thin layers of products.For the two kinds of beans, the dependence of dielectric properties for red kidney bean on temperature was more obvious.%应用网络分析仪和同轴探头技术,分析比较含水率约为12%、32%的黑豆与红芸豆在频率300 MHz~4500 MHz,温度25℃~55℃下的介电性能。结果表明:两种豆类的介电常数和介电损耗因子均随频率升高而降低,随温度和含水率的增加而增大。微波在豆中的能量穿透深度随水分、温度和频率的升高而降低,适于处理薄层物料。对于两种豆类,红芸豆的介电特性随温度变化更为明显。

  3. Complete genome sequence of bean rugose mosaic virus, genus Comovirus.

    Science.gov (United States)

    Picoli, M H S; Garcia, A; Barboza, A A L; de Souto, Eliezer Rodrigues; Almeida, A M R

    2016-06-01

    Since the first report in Costa Rica in 1971, bean rugose mosaic virus (BRMV) has been found in Colombia, El Salvador, Guatemala and Brazil. In this study, the complete genome sequence of a soybean isolate of BRMV from Paraná State, Brazil, was determined. The BRMV genome consists of two polyadenylated RNAs. RNA1 is 5909 nucleotides long and encodes a single polypeptide of 1856 amino acids (aa), with an estimated molecular weight of 210 kDa. The RNA1 polyprotein contains the polypeptides for viral replication and proteolytic processing. RNA2 is 3644 nucleotides long and codes for a single polypeptide of 1097 aa, containing the movement and coat proteins. This is the first complete genome sequence of BRMV. When compared with available aa sequences of comoviruses, the highest identities of BRMV coat proteins and proteinase polymerase were 57.5 and 58 %, respectively. These were below the 75 and 80 % identity limits, respectively, established for species demarcation in the genus. This confirms that BRMV is a member of a distinct species in the genus Comovirus.

  4. Morphology and viability of castor bean genotypes pollen grains

    Directory of Open Access Journals (Sweden)

    Maria Selma Alves Silva Diamantino

    2016-01-01

    Full Text Available The objective of this work was to characterize the morphology and viability of the pollen of 15 genotypes of castor bean (Ricinus communis L. and to generate information that can assist in the selection of highly promising male parents for future use in genetic improvement programs aimed at producing seeds for oil extraction. Acetolysis and scanning electron microscopy was used to characterize the morphology of the pollen. The viability of the pollen grains was estimated by in vitro germination and colorimetric analysis (acetocarmine 2% and 2, 3, 5-triphenyltetrazolium chloride 1%. For the in vitro germination, pollen grains were grown in 10 types of solidified culture medium consisting of different concentrations of sucrose, boric acid, calcium nitrate, magnesium sulfate and potassium nitrate. The pollen grains had the following characteristics: medium size, isopolar and subspheroidal shape, radial symmetry, circular ambit, 3-colporate, elongated endoapertures, tectate exine and granulated sexine. The acetocarmine dye overestimated pollen viability. The media M5 and M8 were the most efficient at promoting the germination of pollen grains. The studied genotypes had high levels of viability and can therefore be used as male parents in genetic improvement programs.

  5. Phosphate-solubilizing bacteria associated with runner bean rhizosphere

    Directory of Open Access Journals (Sweden)

    Mihalache Gabriela

    2015-01-01

    Full Text Available Soil microorganisms, especially rhizobacteria, play a key role in soil phosphorus (P dynamics and the subsequent availability of phosphate to plants. Utilization of phosphate-solubilizing bacteria as biofertilizers instead of synthetic chemicals is known to improve plant growth through the supply of plant nutrients, and may help to sustain environmental health and soil productivity. The main purpose of this study was to identify new phosphate-solubilizing bacteria isolated from runner bean rhizosphere. Ten out of 25 isolated bacterial strains solubilized Ca3(PO42 in qualitative and quantitative P-solubilization. The strain that exhibited the highest potential to solubilize Ca3(PO42, was selected for further determination of the mechanisms involved in the process. The medium pH was measured, organic acids released in the culture medium were identified by HPLC analysis, and the acid and alkaline phosphatase activities were determined. Our results showed that strain R7 solubilized phosphorous through the production of various organic acids such as lactic, isocitric, tartaric and pyruvic acids, and that it can be used as a potential biofertilizer.

  6. Lipid composition of organelles from germinating castor bean endosperm

    Energy Technology Data Exchange (ETDEWEB)

    Donaldson, R.P.; Beevers, H.

    1977-02-01

    Glyoxysome, endoplasmic reticulum, mitochondria, and proplastid fractions were isolated from endosperm of castor beans (Ricinus communis) germinated for 5 days at 30 C. Samples from sucrose density gradients were diluted with 0.15 M KCl and the membranes pelleted. Lipid extracts of these membranes were analyzed for phosphoglyceride, acyl lipid, and sterol content. The endoplasmic reticulum contains 1.24 ..mu..mol of phosphoglyceride per mg of protein; the mitochondria, 0.65 ..mu..mol/mg; and the glyoxysome membranes, 0.55 ..mu..mol/mg. Phosphatidyl choline and phosphatidyl ethanolamine are the most abundant lipids in all membranes studied, accounting for 70% or more of the lipid phosphorus and 50% or more of the fatty acid. Glyoxysome membranes and endoplasmic reticulum also contain phosphatidyl inositol (respectively, 9 and 17% of the lipid phosphorus) and free fatty acids (13% of the total fatty acid in each). Compared with other organelles, mitochondrial membranes have more phosphatidyl ethanolamine relative to phosphatidyl choline and are characterized by the presence of cardiolipin, in which 80% of the fatty acid is linoleate. The relative amounts of linoleate, palmitate, oleate, stearate, and linolenate in each of the phosphotoglycerides are constant regardless of the membrane source. Stimasgasterol and ..beta..-sitosterol are present in the membranes (1 to 9 nmol each/mg protein). The data provide further evidence that glyoxysome membranes are derived from the endoplasmic reticulum but at the same time indicate some differentiation.

  7. Antixenosis of bean genotypes to Chrysodeixis includens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Rafaela Morando

    2015-06-01

    Full Text Available The objective of this work was to evaluate bean genotypes for resistance to soybean looper (Chrysodeixis includens. Initially, free-choice tests were carried out with 59 genotypes, divided into three groups according to leaf color intensity (dark green, light green, and medium green, in order to evaluate oviposition preference. Subsequently, 12 genotypes with high potential for resistance were selected, as well as two susceptible commercial standards. With these genotypes, new tests were performed for oviposition in a greenhouse, besides tests for attractiveness and consumption under laboratory conditions (26±2ºC, 65±10% RH, and 14 h light: 10 h dark photophase. In the no-choice test with adults, in the greenhouse, the 'IAC Jabola', Arcelina 1, 'IAC Boreal', 'Flor de Mayo', and 'IAC Formoso' genotypes were the least oviposited, showing antixenosis-type resistance for oviposition. In the free-choice test with larvae, Arcelina 4, 'BRS Horizonte', 'Pérola', H96A102-1-1-1-52, 'IAC Boreal', 'IAC Harmonia', and 'IAC Formoso' were the less consumed genotypes, which indicates antixenosis to feeding. In the no-choice test, all genotypes (except for 'IAPAR 57' expressed moderate levels of antixenosis to feeding against C. includens larvae.

  8. Inhalable Antitubercular Therapy Mediated by Locust Bean Gum Microparticles.

    Science.gov (United States)

    Alves, Ana D; Cavaco, Joana S; Guerreiro, Filipa; Lourenço, João P; Rosa da Costa, Ana M; Grenha, Ana

    2016-01-01

    Tuberculosis remains a major global health problem and alternative therapeutic approaches are needed. Considering the high prevalence of lung tuberculosis (80% of cases), the pulmonary delivery of antitubercular drugs in a carrier system capable of reaching the alveoli, being recognised and phagocytosed by alveolar macrophages (mycobacterium hosts), would be a significant improvement to current oral drug regimens. Locust bean gum (LBG) is a polysaccharide composed of galactose and mannose residues, which may favour specific recognition by macrophages and potentiate phagocytosis. LBG microparticles produced by spray-drying are reported herein for the first time, incorporating either isoniazid or rifabutin, first-line antitubercular drugs (association efficiencies >82%). Microparticles have adequate theoretical properties for deep lung delivery (aerodynamic diameters between 1.15 and 1.67 μm). The cytotoxic evaluation in lung epithelial cells (A549 cells) and macrophages (THP-1 cells) revealed a toxic effect from rifabutin-loaded microparticles at the highest concentrations, but we may consider that these were very high comparing with in vivo conditions. LBG microparticles further evidenced strong ability to be captured by macrophages (percentage of phagocytosis >94%). Overall, the obtained data indicated the potential of the proposed system for tuberculosis therapy. PMID:27240337

  9. Glutamate functions in stomatal closure in Arabidopsis and fava bean.

    Science.gov (United States)

    Yoshida, Riichiro; Mori, Izumi C; Kamizono, Nobuto; Shichiri, Yudai; Shimatani, Tetsuo; Miyata, Fumika; Honda, Kenji; Iwai, Sumio

    2016-01-01

    Guard cells are indispensable for higher plants because they control gas exchange and water balance to maintain photosynthetic activity. The signaling processes that govern their movement are controlled by several factors, such as abscisic acid (ABA), blue light, pathogen-associated molecular patterns (PAMPs), and carbon dioxide. Herein, we demonstrated that the amino acid glutamate (Glu), a well-known mammalian neurotransmitter, functions as a novel signaling molecule in stomatal closure in both Arabidopsis and fava bean (Vicia faba L.). Pharmacological and electrophysiological analyses provided important clues for the participation of Glu-receptors, Ca(2+), and protein phosphorylation during the signaling process. Genetic analyses using Arabidopsis ABA-deficient (aba2-1) and ABA-insensitive (abi1-1 and abi2-1) mutants showed that ABA is not required for Glu signaling. However, loss-of-function of the Arabidopsis gene encoding Slow Anion Channel-Associated 1 (SLAC1) and Calcium-Dependent Protein Kinase 6 (CPK6) impaired the Glu response. Moreover, T-DNA knockout mutations of the Arabidopsis Glu receptor-like gene (GLR), GLR3.5, lost their sensitivity to Glu-dependent stomatal closure. Our results strongly support functional Glu-signaling in stomatal closure and the crucial roles of GLRs in this signaling process. PMID:26586261

  10. Comprehensive multidimensional GC for the characterization of roasted coffee beans.

    Science.gov (United States)

    Mondello, Luigi; Casilli, Alessandro; Tranchida, Peter Quinto; Dugo, Paola; Costa, Rosaria; Festa, Saverio; Dugo, Giovanni

    2004-04-01

    The present investigation is based on the separation of one of the most complex food matrices: the roasted coffee bean volatile fraction. Analysis of the two main species of coffee (Arabica/Robusta) was achieved through an effective and simple sampling procedure, headspace solid-phase microextraction (SPME), and the unprecedented resolving power of comprehensive gas chromatography (GC x GC). The combination of these two techniques proved to be a powerful tool for the extraction and separation of coffee volatiles. In fact, thousands of compounds that play various roles in the constitution of coffee aroma profile were resolved in the 2-D contour plot, each occupying a specific position pinpointed by two retention time coordinates. The potential use of this method for the assessment of coffee quality and the detection of commercial fraud is discussed. The potential of GC x GC for identification and classification of unknowns was also demonstrated, as the formation of characteristic patterns for structurally related compounds was observed in the bidimensional chromatogram. Moreover, reproducibility results were supported by the use of an autosampler for SPME applications that allowed any inaccuracy arising from manual handling to be avoided. PMID:15335079

  11. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, E. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); He, Z.L., E-mail: zhe@ufl.edu [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Stoffella, P.J. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Mylavarapu, R.S. [University of Florida, Institute of Food and Agricultural Science, Soil and Water Science Department, Gainesville, FL 33611 (United States); Li, Y.C. [University of Florida, Institute of Food and Agricultural Science, Tropical Research and Education Center, Homestead, FL 33031 (United States); Moyano, B. [Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); Baligar, V.C. [United State Department of Agriculture, ARS, Beltsville, MD 20705 (United States)

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg{sup −1}) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg{sup −1}, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg{sup −1}. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg{sup −1}), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg{sup −1}, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil

  12. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    International Nuclear Information System (INIS)

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg−1) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg−1, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg−1. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg−1), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg−1, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil Cd contamination is likely

  13. Phytochemical distribution in hull and cotyledon of adzuki bean (Vigna angularis L.) and mung bean (Vigna radiate L.), and their contribution to antioxidant, anti-inflammatory and anti-diabetic activities.

    Science.gov (United States)

    Luo, Jiaqiang; Cai, Weixi; Wu, Tong; Xu, Baojun

    2016-06-15

    Total saponin content, total phenolics content, total flavonoids content, condensed tannin content in hull, cotyledon and whole grain of both adzuki bean and mung bean were determined by colorimetric methods. Vitexin and isovitexin contents in mung bean were determined by HPLC. Antioxidant effects were evaluated with DPPH scavenging activity and ferric reducing antioxidant power assay. In vitro anti-inflammatory and anti-diabetic effects of beans were evaluated by protease and aldose reductase inhibitory assays, respectively. The results indicated that the bean hulls were the most abundant in phytochemicals and largely contributed antioxidant activities, anti-inflammatory effects and anti-diabetic effects of whole grains. The result showed that mung bean hull was the most abundant with vitexin at 37.43 mg/g and isovitexin at 47.18 mg/g, respectively. Most of the phytochemicals and bioactivities were most predominantly contributed by the bean hulls with exception for condensed tannin of mung bean; which was more abundant in the cotyledon than its hull. PMID:26868587

  14. Common Beans and Their Non-Digestible Fraction: Cancer Inhibitory Activity—An Overview

    Directory of Open Access Journals (Sweden)

    Rocio Campos-Vega

    2013-08-01

    Full Text Available The US Department of Agriculture’s MyPyramid guidelines introduced a near doubling of the dietary recommendations for vegetables including dry beans—an important food staple in many traditional diets that can improve public health and nutrition. Populations with high legume (peas, beans, lentils consumption have a low risk of cancer and chronic degenerative diseases. Common beans (Phaseolus vulgaris L. are known as a rich, reliable source of non-digested compounds like fiber, phenolics, peptides and phytochemicals that are associated with health benefits. Emerging evidence indicates that common bean consumption is associated with reduced cancer risk in human populations, inhibiting carcinogenesis in animal models and inducing cell cycle arrest and apoptosis in cell cultures. Fiber may reduce the risk of premature death from all causes, whereas the whole non-digestible fraction from common beans exhibits anti-proliferative activity and induces apoptosis in vitro and in vivo colon cancer. The mechanisms responsible for this apparently protective role may include gene-nutrient interactions and modulation of proteins’ expression. This review investigates the potential health benefits and bioactivity of beans on tumor inhibition, highlighting studies involving functional compounds, mainly non-digestible fractions that modulate genes and proteins, thereby, unraveling their preventive role against the development of cancer.

  15. Comparative analysis of volatiles in traditionally cured Bourbon and Ugandan vanilla bean ( Vanilla planifolia ) extracts.

    Science.gov (United States)

    Zhang, Suying; Mueller, Christoph

    2012-10-24

    Traditionally cured vanilla beans ( Vanilla planifolia ) from Madagascar and Uganda were extracted with organic solvents, and the volatiles were separated from the nonvolatile fraction using the solvent assisted flavor evaporation (SAFE) technique. Concentrated vanilla bean extracts were analyzed using GC-MS and GC-O. Two hundred and forty-six volatile compounds were identified using the Automated Mass Spectral Deconvolution and Identification System (AMDIS) software, of which 13 were confirmed with authentic compounds from commercial sources and the others were tentatively identified on the basis of calibrated linear retention indices and the comparison of deconvoluted mass spectra with the in-house and/or NIST spectra databases. Vanillin was the most abundant constituent followed by guaiacol. The total concentration of the volatile compounds, excluding vanillin, was 301 mg/kg for Bourbon and 398 mg/kg for Ugandan vanilla bean extracts. Analytical comparison between the two vanilla bean extracts was discussed. Seventy-eight compounds were identified as odor-active compounds in the vanilla bean extracts with 10 confirmed with authentic references. It was found that there were substantial analytical differences in the odor-active compounds of the two extracts.

  16. Genetic diversity in cultivated carioca common beans based on molecular marker analysis

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    2011-01-01

    Full Text Available A wide array of molecular markers has been used to investigate the genetic diversity among common bean species. However, the best combination of markers for studying such diversity among common bean cultivars has yet to be determined. Few reports have examined the genetic diversity of the carioca bean, commercially one of the most important common beans in Brazil. In this study, we examined the usefulness of two molecular marker systems (simple sequence repeats - SSRs and amplified fragment length polymorphisms - AFLPs for assessing the genetic diversity of carioca beans. The amount of information provided by Roger's modified genetic distance was used to analyze SSR data and Jaccards similarity coefficient was used for AFLP data. Seventy SSRs were polymorphic and 20 AFLP primer combinations produced 635 polymorphic bands. Molecular analysis showed that carioca genotypes were quite diverse. AFLPs revealed greater genetic differentiation and variation within the carioca genotypes (Gst = 98% and Fst = 0.83, respectively than SSRs and provided better resolution for clustering the carioca genotypes. SSRs and AFLPs were both suitable for assessing the genetic diversity of Brazilian carioca genotypes since the number of markers used in each system provided a low coefficient of variation. However, fingerprint profiles were generated faster with AFLPs, making them a better choice for assessing genetic diversity in the carioca germplasm.

  17. Accumulation of atmospheric deposition of As, Cd and Pb by bush bean plants

    International Nuclear Information System (INIS)

    Bush bean (Phaseolus vulgaris) was exposed to atmospheric deposition of As, Cd and Pb in a polluted and a reference area. The atmospheric deposition of these elements was significantly related to the concentrations in leaves, stems and pods at green harvest. Surprisingly there was also a clear relation for As and Pb in the seeds at dry harvest, even though these seeds were covered by the husks. Root uptake of accumulated atmospheric deposits was not likely in such a short term experiment, as confirmed by the fact that soil pore water analysis did not reveal significant differences in trace element concentrations in the different exposure areas. For biomonitoring purposes, the leaves of bush bean are the most suitable, but also washed or unwashed pods can be used. This means that the obtained relationships are suitable to estimate the transfer of airborne trace elements in the food chain via bush bean. - Highlights: • Atmospheric deposition of trace elements accumulates in bean leaves, stems and pods. • Also thoroughly washed green pods are suitable for biomonitoring. • Even the non-exposed bean seeds accumulate As and Pb deposits to some extend. • A migration of trace elements from the husks to the seeds is most likely. - In a polluted area, atmospheric deposition of trace elements on the above-ground plant parts is influencing their concentration, even in the seeds

  18. Genetic Characterization of Green Bean (Phaseolus vulgaris L.) Accessions from Turkey with SCAR and SSR Markers.

    Science.gov (United States)

    Madakbaş, Seher Yıldız; Sarıkamış, Gölge; Başak, Hakan; Karadavut, Ufuk; Özmen, Canan Yüksel; Daşçı, Mete Gürhan; Çayan, Selin

    2016-08-01

    Characterization, conservation, and utilization of genetic resources is essential for the sustainability in agriculture. Plant genetic resources are important for breeding efforts designed for the generation of new cultivars or for the improvement of existing ones. Green bean has been cultivated extensively in Turkey giving rise to local accessions through selection over time and adaptation to various environmental conditions. The objective of the present study was to determine the genetic relationships of green bean accessions collected from Kırşehir Province of Turkey, located at the central Anatolia. Within a population of 275 green bean accessions, 50 accessions were selected on the basis of morphological observations for further evaluation with SSR and STS/SCAR markers together with 4 reference cultivars of Andean and Mesoamerican origin. SSR markers selected on the basis of high polymorphism information content revealed the genetic relatedness of selected green bean accessions. STS/SCAR markers associated with bean anthracnose, common bacterial blight, white mold, halo blight, and phaseolin protein demonstrated the inheritance of resistance traits of local accessions at the selected loci. These findings may help better utilize genetic resources and furthermore are expected to facilitate forthcoming breeding studies for the generation of novel cultivars well adapted to the region. PMID:27156082

  19. Biodiversity and biogeography of rhizobia associated with common bean (Phaseolus vulgaris L.) in Shaanxi Province.

    Science.gov (United States)

    Wang, Li; Cao, Ying; Wang, En Tao; Qiao, Ya Juan; Jiao, Shuo; Liu, Zhen Shan; Zhao, Liang; Wei, Ge Hong

    2016-05-01

    The biodiversity and biogeography of rhizobia associated with bean in Shaanxi Province were investigated. A total of 194 bacterial isolates from bean nodules collected from 13 sampling sites were characterized based on phylogenetic analyses of the 16S rRNA gene, the housekeeping genes recA, glnII and atpD, and the symbiotic genes nodC and nifH. Fifteen genospecies belonging to the genera Rhizobium, Agrobacterium, Ensifer, Bradyrhizobium and Ochrobactrum were defined among the isolates, with Rhizobium sp. II, Agrobacterium sp. II, E. fredii and R. phaseoli being the dominant groups. Four symbiotic gene lineages corresponding to Rhizobium sp. I, Rhizobium sp. II, R. phaseoli and B. liaoningense were detected in the nodC and nifH sequence analyses, indicating different origins for the symbiotic genes and their co-evolution with the chromosome of the bacteria. Moreover, the Ensifer isolates harbored symbiotic genes closely related to bean-nodulating Pararhizobium giardinii, indicating possible lateral gene transfer from Rhizobium to Ensifer. Correlation of rhizobial community composition with moisture, temperature, intercropping, soil features and nutrients were detected. All the results demonstrated a great diversity of bean rhizobia in Shaanxi that might be due to the adaptable evolution of the bean-nodulating rhizobia subjected to the diverse ecological conditions in the area. PMID:26966063

  20. Biodiversity and biogeography of rhizobia associated with common bean (Phaseolus vulgaris L.) in Shaanxi Province.

    Science.gov (United States)

    Wang, Li; Cao, Ying; Wang, En Tao; Qiao, Ya Juan; Jiao, Shuo; Liu, Zhen Shan; Zhao, Liang; Wei, Ge Hong

    2016-05-01

    The biodiversity and biogeography of rhizobia associated with bean in Shaanxi Province were investigated. A total of 194 bacterial isolates from bean nodules collected from 13 sampling sites were characterized based on phylogenetic analyses of the 16S rRNA gene, the housekeeping genes recA, glnII and atpD, and the symbiotic genes nodC and nifH. Fifteen genospecies belonging to the genera Rhizobium, Agrobacterium, Ensifer, Bradyrhizobium and Ochrobactrum were defined among the isolates, with Rhizobium sp. II, Agrobacterium sp. II, E. fredii and R. phaseoli being the dominant groups. Four symbiotic gene lineages corresponding to Rhizobium sp. I, Rhizobium sp. II, R. phaseoli and B. liaoningense were detected in the nodC and nifH sequence analyses, indicating different origins for the symbiotic genes and their co-evolution with the chromosome of the bacteria. Moreover, the Ensifer isolates harbored symbiotic genes closely related to bean-nodulating Pararhizobium giardinii, indicating possible lateral gene transfer from Rhizobium to Ensifer. Correlation of rhizobial community composition with moisture, temperature, intercropping, soil features and nutrients were detected. All the results demonstrated a great diversity of bean rhizobia in Shaanxi that might be due to the adaptable evolution of the bean-nodulating rhizobia subjected to the diverse ecological conditions in the area.

  1. Analytical determination of thiamine (vitamin B1) in irradiated and stored Brazilian beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna L.C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Mancini-Filho, Jorge [Sao Paulo Univ., SP (Brazil). Faculdade de Ciencias Farmaceuticas; Delincee, Henry [Bundesforschungsanstalt fuer Ernaehrung, Karlsruhe (Germany); Bognar, A. [Bundesforschungsanstalt fuer Ernaehrung, Stuttgart (Germany)

    1997-12-01

    Thiamine (vitamin B{sub 1}) content in two varieties of Brazilian beans, Phaselus vulgaris L., var. carioca and Vigna unguiculata (L) Walp, var. macacar , irradiated with doses ranging from 0,05, 1.0, 2.5, 5.0 and 10.0 kGy was investigated. After a 6 months storage period, the optimum cooking time was established for each dose and variety. Sensorial evaluation tests were carried out by a panel of six people trained to this specific task. Our purpose to work with these beans is because conflicting results have appeared in studies about vitamin loss after low-dose irradiation. In our case, after a 6-month storage period of this two kinds of beans, in addition to the analysis of cooking time and sensory properties the vitamin B{sub 1} content was evaluated. No significant vitamin losses were observed in Macacar beans until 10.0 kGy. Carioca beans showed small losses after 2.5 kGy. (author). 23 refs., 2 figs., 5 tabs.

  2. Incidence, level, and behavior of aflatoxins during coffee bean roasting and decaffeination.

    Science.gov (United States)

    Soliman, K M

    2002-12-01

    Screening for aflatoxins (Afs), isolation and identification of Aspergillus flavus, and the effect of decaffeination and roasting on the level of contamination in coffee beans are studied. The percent frequency of A. flavus ranged between 4 and 80% in green coffee beans (GCB), whereas in ground roasted coffee beans (GRCB), it ranged between 1 and 71%. Aflatoxins were detected in 76.5 and 54.6% of the infected samples with averages of 4.28 and 2.85 microg/kg of GCB and GRCB, respectively. Roasting was demonstrated to lower the concentration of Afs in GCB. The Afs levels were reduced by approximately 42.2-55.9% depending on the type and temperature of roasting. The highest yields of Afs were detected in the decaffeinated green coffee beans (24.29 microg/kg) and roasted coffee beans (16.00 microg/kg). The growth of A. flavus in liquid medium containing 1 or 2% caffeine was reduced by 50%, and the level of aflatoxin in the medium was undetectable.

  3. Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice

    Science.gov (United States)

    Song, Su Jin; Choi, Sena; Park, Taesun

    2014-01-01

    This study investigated whether decaffeinated green coffee bean extract prevents obesity and improves insulin resistance and elucidated its mechanism of action. Male C57BL/6N mice (N = 48) were divided into six dietary groups: chow diet, HFD, HFD-supplemented with 0.1%, 0.3%, and 0.9% decaffeinated green coffee bean extract, and 0.15% 5-caffeoylquinic acid. Based on the reduction in HFD-induced body weight gain and increments in plasma lipids, glucose, and insulin levels, the minimum effective dose of green coffee bean extract appears to be 0.3%. Green coffee bean extract resulted in downregulation of genes involved in WNT10b- and galanin-mediated adipogenesis and TLR4-mediated proinflammatory pathway and stimulation of GLUT4 translocation to the plasma membrane in white adipose tissue. Taken together, decaffeinated green coffee bean extract appeared to reverse HFD-induced fat accumulation and insulin resistance by downregulating the genes involved in adipogenesis and inflammation in visceral adipose tissue. PMID:24817902

  4. Naturally occurring and experimentally induced castor bean (Ricinus communis) poisoning in ducks

    Science.gov (United States)

    Jensen, W.I.; Allen, J.P.

    1981-01-01

    Castor bean (Ricinus communis) poisoning accounted for the death of several thousand ducks in the Texas panhandle in the fall and winter months of 1969-1971. Signs of intoxication resembled those of botulism, except for mucoid, blood-tinged excreta. The most common lesions were severe fatty change in the liver, widely distributed internal petechial hemorrhages or ecchymoses, and catarrhal enteritis. Nearly intact castor beans were found in the stomach of one duck during field necropsy. Fragments of seed coat resembling castor bean were found in the stomachs of 10 of 14 ducks examined in the laboratory. Clinical signs and postmortem lesions observed in wild ducks were induced experimentally in mallards (Anas platyrhynchos) by force-feeding intact castor beans. Toxicity titrations were erratic, but the LD50 appeared to be between three and four seeds. The mouse toxicity test, used to detect Clostridium botulinum toxin in the blood serum of intoxicated ducks, was negative in every case. Hemagglutination and precipitin tests generally failed to detect castor bean in extracts of excreta or intestinal contents of experimentally intoxicated ducks.

  5. Evaluation of green coffee beans quality using near infrared spectroscopy: a quantitative approach.

    Science.gov (United States)

    Santos, João Rodrigo; Sarraguça, Mafalda C; Rangel, António O S S; Lopes, João A

    2012-12-01

    Characterisation of coffee quality based on bean quality assessment is associated with the relative amount of defective beans among non-defective beans. It is therefore important to develop a methodology capable of identifying the presence of defective beans that enables a fast assessment of coffee grade and that can become an analytical tool to standardise coffee quality. In this work, a methodology for quality assessment of green coffee based on near infrared spectroscopy (NIRS) is proposed. NIRS is a green chemistry, low cost, fast response technique without the need of sample processing. The applicability of NIRS was evaluated for Arabica and Robusta varieties from different geographical locations. Partial least squares regression was used to relate the NIR spectrum to the mass fraction of defective and non-defective beans. Relative errors around 5% show that NIRS can be a valuable analytical tool to be used by coffee roasters, enabling a simple and quantitative evaluation of green coffee quality in a fast way. PMID:22953929

  6. The cotyledon cell wall of the common bean (phaseolus vulgaris) resists digestion in the upper intestine and thus may limit iron bioavailability

    Science.gov (United States)

    Strategies that enhance the Fe bioavailability from the bean are of keen interest to nutritionists, bean breeders and growers. In beans, the cotyledon contains 75-80% of the total seed Fe, most of which appears to be located within the cotyledon cell. The cotyledon cell wall is known to be resistan...

  7. Modified bean seed protein phaseolin did not accumulate stably in transgenic tobacco seeds after methionine enhancement mutations

    Science.gov (United States)

    The major seed storage protein phaseolin of common bean (Phaseolus vulgaris L.) is deficient in methionine, an essential amino acid for human and animal health. To improve the nutritional quality of common bean, we designed methionine enhancement of phaseolin based on the three dimensional structure...

  8. CULTIVAR RELEASE - BRSMG União: common bean cultivar with jalo grain for the state of Minas Gerais

    Directory of Open Access Journals (Sweden)

    Magno Antonio Patto Ramalho

    2012-12-01

    Full Text Available The bean cultivar BRSMG União as a new option of a bean cultivar with jalo grains for the state of Minas Gerais. The cultivar BRSMG União had an average grain yield of 9.8% above the mean of the controls (Jalo EEP 558 and BRS Radiante and was resistant to powdery-mildew.

  9. Chemical Composition, Starch Digestibility and Antioxidant Capacity of Tortilla Made with a Blend of Quality Protein Maize and Black Bean

    Directory of Open Access Journals (Sweden)

    Luis A. Bello-Pérez

    2011-12-01

    Full Text Available Tortilla and beans are the basic components in the diet of people in the urban and rural areas of Mexico. Quality protein maize is suggested for tortilla preparation because it presents an increase in lysine and tryptophan levels. Beans contain important amounts of dietary fiber. The objective of this study was to prepare tortilla with bean and assesses the chemical composition, starch digestibility and antioxidant capacity using a quality protein maize variety. Tortilla with bean had higher protein, ash, dietary fiber and resistant starch content, and lower digestible starch than control tortilla. The hydrolysis rate (60 to 50% and the predicted glycemic index (88 to 80 of tortilla decreased with the addition of bean in the blend. Extractable polyphenols and proanthocyanidins were higher in the tortilla with bean than control tortilla. This pattern produced higher antioxidant capacity of tortilla with bean (17.6 μmol Trolox eq/g than control tortilla (7.8 μmol Trolox eq/g. The addition of bean to tortilla modified the starch digestibility and antioxidant characteristics of tortilla, obtaining a product with nutraceutical characteristics.

  10. Rice and Bean Targets for Biofortification Combined with High Carotenoid Content Crops Regulate Transcriptional Mechanisms Increasing Iron Bioavailability.

    Science.gov (United States)

    Dias, Desirrê Morais; de Castro Moreira, Maria Eliza; Gomes, Mariana Juste Contin; Lopes Toledo, Renata Celi; Nutti, Marilia Regini; Pinheiro Sant'Ana, Helena Maria; Martino, Hércia Stampini Duarte

    2015-11-01

    Iron deficiency affects thousands of people worldwide. Biofortification of staple food crops aims to support the reduction of this deficiency. This study evaluates the effect of combinations of common beans and rice, targets for biofortification, with high carotenoid content crops on the iron bioavailability, protein gene expression, and antioxidant effect. Iron bioavailability was measured by the depletion/repletion method. Seven groups were tested (n = 7): Pontal bean (PB); rice + Pontal bean (R + BP); Pontal bean + sweet potato (PB + SP); Pontal bean + pumpkin (PB + P); Pontal bean + rice + sweet potato (PB + R + P); Pontal bean + rice + sweet potato (PB + R + SP); positive control (Ferrous Sulfate). The evaluations included: hemoglobin gain, hemoglobin regeneration efficiency (HRE), gene expression of divalente metal transporter 1 (DMT-1), duodenal citocromo B (DcytB), ferroportin, hephaestin, transferrin and ferritin and total plasma antioxidant capacity (TAC). The test groups, except the PB, showed higher HRE (p DMT-1, DcytB and ferroportin increased (p < 0.05) in the groups fed with high content carotenoid crops (sweet potato or pumpkin). The PB group presented lower (p < 0.05) TAC than the other groups. The combination of rice and common beans, and those with high carotenoid content crops increased protein gene expression, increasing the iron bioavailability and antioxidant capacity. PMID:26610564

  11. The cotyledon cell wall and intracellular matrix are factors that limit iron bioavailability of the common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Glahn, Raymond P; Tako, Elad; Cichy, Karen; Wiesinger, Jason

    2016-07-13

    Strategies that enhance the Fe bioavailability of the bean are of keen interest to nutritionists, bean breeders and growers. In beans, the cotyledons contain 75-80% of the total seed Fe, most of which appears to be located within the cotyledon cells. The cotyledon cell walls are known to be resistant to digestion in the stomach and the upper small intestine. Therefore, given the above and the general belief that the primary site for human Fe absorption is the upper small intestine, the present study was designed to determine if the cotyledon cell walls represent a barrier to Fe absorption from the bean. To do so, we utilized high pressure to rupture bean cotyledon cells. The iron bioavailability of cooked bean samples was assessed using an in vitro digestion/Caco-2 cell culture model. Microscopy analyses confirmed that the cotyledon cell walls are highly resistant to pepsin, the low pH of the stomach, and the pancreatic enzymes, indicating that the walls are a barrier to Fe absorption from the bean. Relatively high intracellular pressure (>4000 psi) was required to initiate cell wall rupture. Surprisingly, the lysis of cotyledon cells did not result in a consistent or strong enhancement of bioavailable Fe, suggesting that the liberated intracellular starch and protein influenced the Fe bioavailability by creating a matrix that inhibited the exchange of Fe with the cell transport mechanism. Such observations warrant further pursuit in vivo as the confirmation of these effects would reshape strategies to enhance Fe absorption from beans. PMID:27326892

  12. Polyphenolic compounds appear to limit the nutritional benefit of biofortified higher iron black bean (phaseolus vulgaris L.)

    Science.gov (United States)

    Background: Our objective was to compare the capacities of biofortified and standard black beans to deliver Fe for Hb synthesis. Two isolines of black beans (Phaseolus vulgaris L.), a standard (DOR500, "Low Fe") and biofortified (MIB465, "High Fe") in Fe (59 and 88 ug Fe/g, respectively) were used. ...

  13. Chemical Composition, Starch Digestibility and Antioxidant Capacity of Tortilla Made with a Blend of Quality Protein Maize and Black Bean

    Science.gov (United States)

    Grajales-García, Eva M.; Osorio-Díaz, Perla; Goñi, Isabel; Hervert-Hernández, Deisy; Guzmán-Maldonado, Salvador H.; Bello-Pérez, Luis A.

    2012-01-01

    Tortilla and beans are the basic components in the diet of people in the urban and rural areas of Mexico. Quality protein maize is suggested for tortilla preparation because it presents an increase in lysine and tryptophan levels. Beans contain important amounts of dietary fiber. The objective of this study was to prepare tortilla with bean and assesses the chemical composition, starch digestibility and antioxidant capacity using a quality protein maize variety. Tortilla with bean had higher protein, ash, dietary fiber and resistant starch content, and lower digestible starch than control tortilla. The hydrolysis rate (60 to 50%) and the predicted glycemic index (88 to 80) of tortilla decreased with the addition of bean in the blend. Extractable polyphenols and proanthocyanidins were higher in the tortilla with bean than control tortilla. This pattern produced higher antioxidant capacity of tortilla with bean (17.6 μmol Trolox eq/g) than control tortilla (7.8 μmol Trolox eq/g). The addition of bean to tortilla modified the starch digestibility and antioxidant characteristics of tortilla, obtaining a product with nutraceutical characteristics. PMID:22312252

  14. Cost benefit analysis of the introduction of heat tolerant bean varieties in Atlántida, Honduras.

    Science.gov (United States)

    Rising ambient air temperatures, migration, and deforestation threaten the sustainability of hillside common bean (Phaseolus vulgaris L.) farming in Atlántida, Honduras. Farmers avoid climatic constraints to common bean production by planting at different altitudes during different seasons. In this ...

  15. Genetic diversity of indigenous common bean (Phaseolus vulgaris L. rhizobia from the state of Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Adalgisa Ribeiro Torres

    2009-12-01

    Full Text Available We characterized indigenous common bean rhizobia from five districts of the state of Minas Gerais, Brazil. The isolates were trapped by two common bean varieties, the Mineiro Precoce (Andean origin and Ouro Negro (Mesoamerican origin. Analysis by BOX-PCR of selected isolates detected a high level of genetic diversity.

  16. EFFECT OF THE ADDITION OF COMMON BEAN FLOUR ON THE COOKING QUALITY AND ANTIOXIDANT CHARACTERISTICS OF SPAGHETTI

    Directory of Open Access Journals (Sweden)

    José Alberto

    2012-10-01

    Full Text Available Pasta is a nutritionally unbalanced food, due to its low fat and fiber and low value of its protein. It is considered an adequate vehicle for food supplementation with minerals, proteins and other healthy components such as bioactive compounds present in common beans. The effect of composite pasta (wheat – common bean; 30 % w/w on the cooking quality (optimal cooking time, cooking loss, weight loss, firmness, color, total phenolic content, antioxidant capacity by DPPH and ORAC assays and phenolic acid profile was investigated. According to the quality parameters, pasta added with bean flour was less hard with respect to the pasta made from durum wheat. The total phenolic content and antioxidant capacity by DPPH and ORAC assays were higher in the pasta with common bean flour than in the pasta control. Also, more phenolic acids were identified in cooked pasta containing common bean flour as analyzed by HPLC.

  17. Repeatability of adaptability and stability parameters of common bean in unpredictable environments

    Directory of Open Access Journals (Sweden)

    Lidiane Kely de Lima

    2013-09-01

    Full Text Available The objective of this work was to estimate the repeatability of adaptability and stability parameters of common bean between years, within each biennium from 2003 to 2012, in Minas Gerais state, Brazil. Grain yield data from trials of value for cultivation and use common bean were analyzed. Grain yield, ecovalence, regression coefficient, and coefficient of determination were estimated considering location and sowing season per year, within each biennium. Subsequently, a analysis of variance these estimates was carried out, and repeatability was estimated in the biennia. Repeatability estimate for grain yield in most of the biennia was relatively high, but for ecovalence and regression coefficient it was null or of small magnitude, which indicates that confidence on identification of common bean lines for recommendation is greater when using means of yield, instead of stability parameters.

  18. The Research on the Impact of Green Beans Sports Drinks on Relieving Fatigue in Sports Training.

    Science.gov (United States)

    Qi, Li; Ying, Liu

    2015-01-01

    For researching the function of relieving fatigue of green beans sports drinks, this paper selected 60 mice as subjects. They were randomly divided into four groups (low dose group, middle dose group, high dose group and physiological saline group). Each time they were respectively feed 10g 20g/L, 40g/L, 80 g/L green beans sports drinks and 15ml/(kg.d) physiological saline. The experiment lasted for a month. We recorded weight of mice, swimming time and blood urea nitrogen indicators. The results show that green beans sports drinks can significantly prolong swimming time of mice (p sports drinks have a certain function of relieving physical fatigue.

  19. Determination of Mineral Contents in Unpolished Rice and Bean Samples by Neutron Activation Analysis

    International Nuclear Information System (INIS)

    As scientists have focused their researches on the health impacts caused by mineral nutrient deficiencies and hazardous elements, public concern regarding mineral intake from dietary food is rising. In this reason, the dietary habits of Koreans have been shifted from white rice to more nutrient rice like unpolished rice and rice mixed with beans. It is known that unpolished rice and beans contain more protein, vitamin and mineral contents than white rice and are more beneficial to human health, even though they sometimes cause indigestion or allergy. The objectives of this study were to determine the mineral contents in unpolished rice and bean samples by a neutron activation analysis (NAA) and to compare the level of mineral contents between the samples

  20. Uniformity of liquid distribution in the canopy of the bean plant, using the spectrophotometric analysis

    Directory of Open Access Journals (Sweden)

    Murilo Mesquita Baesso

    2011-12-01

    Full Text Available Fungal diseases are important factors limiting common bean yield. White mold is one of the main diseases caused by soil pathogens. The objective of this study was to quantify the distribution of a fungicide solution sprayed into the canopy of bean plants by spectrophotometry, using a boom sprayer with and without air assistance. The experiment was arranged in a 2 x 2 x 2 factorial (two types of nozzles, two application rates, and air assistance on and off randomized block design with four replications. Air assistance influenced the deposition of solution on the bean plant and yield increased significantly with the increased rate of application and air assistance in the boom sprayer.

  1. EVALUATION OF PHYSIOLOGY AND BIOCHEMISTRY THE CASTOR BEAN FUNCTION OF DOSES AND FERTILIZER IN SOIL

    Directory of Open Access Journals (Sweden)

    Fabiana Xavier Costa

    2011-04-01

    Full Text Available Aimed at with this work to investigate the physiology and biochemistry of the castor bean, after use of compost and organic castor bean. The trial began on October 3, 2005 ending on March 20, 2006, in green-house, controlled environment of the National Center of Cotton Research (CNPA / EMBRAPA, in Campina Grande , State of Paraiba. Was used to cultivate castor BRS Paraguaçu. We used a randomized block design with four replications, totaling 11 treatments, since they are derived from doses of castor-oil and organic compost (four doses of each and three witnesses, with further study of orthogonal contrasts . The castor bean showed effective results in the variables chlorophyll content (ppm in leaves and number of days to flowering of the first cluster (DIAFI. Compost organic waste not produced any significant result for both variables.

  2. Use of the NetBeans Platform for NASA Robotic Conjunction Assessment Risk Analysis

    Science.gov (United States)

    Sabey, Nickolas J.

    2014-01-01

    The latest Java and JavaFX technologies are very attractive software platforms for customers involved in space mission operations such as those of NASA and the US Air Force. For NASA Robotic Conjunction Assessment Risk Analysis (CARA), the NetBeans platform provided an environment in which scalable software solutions could be developed quickly and efficiently. Both Java 8 and the NetBeans platform are in the process of simplifying CARA development in secure environments by providing a significant amount of capability in a single accredited package, where accreditation alone can account for 6-8 months for each library or software application. Capabilities either in use or being investigated by CARA include: 2D and 3D displays with JavaFX, parallelization with the new Streams API, and scalability through the NetBeans plugin architecture.

  3. The Response Strategy of Maize, Pea and Broad Bean Plants to Different Osmotic Potential Stress

    Directory of Open Access Journals (Sweden)

    Hamdia M. Abd El-Samad

    2013-08-01

    Full Text Available This investigation was conducted to study the tolerance strategy of maize, broad bean and pea plants to salinity stress with exogenous applications of proline or phenylalanine on seed germination and seedlings growth. From the results obtained, it can be observed that osmotic stress affected adversely the rate of germination in maize, broad bean and pea plants. The excessive inhibition was more prominent at higher concentration of NaCl. The seeds and grains tested were exhibited some differential responses to salinity, in a manner that the inhibitory effect of salinity on seed germination ran in the order, maize higher than broad bean and the later was higher than pea plant. Treatment with proline or phenylalanine (100 ppm significantly increased these seed germination and seedlings growth characteristics even at lowest salinity level tested.

  4. Phytochemical Evaluation of Moth Bean (Vigna aconitifolia L. Seeds and Their Divergence

    Directory of Open Access Journals (Sweden)

    Neha Gupta

    2016-01-01

    Full Text Available In the present study, phytochemical contents of 25 moth bean (Vigna aconitifolia seed accessions were evaluated. This includes protease inhibitors, phytic acid, radical scavenging activity, and tannins. The studies revealed significant variation in the contents of theses phytochemicals. Presence of photochemical composition was correlated with seed storage proteins like albumin and globulin. Qualitative identification of total seed storage protein abundance across two related moth bean accessions using two-dimensional gel electrophoresis (2D-GE was performed. Over 20 individual protein fractions were distributed over the gel as a series of spots in two moth bean accessions. Seed proteome accumulated spots of high intensity over a broad range of pI values of 3–10 in a molecular weight range of 11–170 kDa. In both seed accessions maximum protein spots are seen in the pI range of 6–8.

  5. Determination of Mineral Contents in Unpolished Rice and Bean Samples by Neutron Activation Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Moon, J. H.; Kim, S. H.; Baek, S. Y.; Chung, Y. S. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    As scientists have focused their researches on the health impacts caused by mineral nutrient deficiencies and hazardous elements, public concern regarding mineral intake from dietary food is rising. In this reason, the dietary habits of Koreans have been shifted from white rice to more nutrient rice like unpolished rice and rice mixed with beans. It is known that unpolished rice and beans contain more protein, vitamin and mineral contents than white rice and are more beneficial to human health, even though they sometimes cause indigestion or allergy. The objectives of this study were to determine the mineral contents in unpolished rice and bean samples by a neutron activation analysis (NAA) and to compare the level of mineral contents between the samples

  6. Hypergravity inhibits elongation growth of azuki bean epicotyls independently of the direction of stimuli

    Science.gov (United States)

    Soga, K.; Wakabayashi, K.; Kamisaka, S.; Hoson, T.

    We examined the effects of basipetal, horizontal, and acropetal hypergravity stimulation on growth and cell wall properties of azuki bean seedlings. Horizontal and acropetal hypergravity inhibited elongation growth of epicotyls by decreasing the cell wall extensibility, as did basipetal hypergravity. Hypergravity stimulation increased the thickness of cell walls and suppressed xyloglucan breakdown regardless of direction. All hypergravity treatments increased the pH in the apoplastic fluid, which is involved in the processes of the suppression of xyloglucan breakdown. Gadolinium and lanthanum, both blockers of mechanoreceptors, nullified the growth-inhibiting effects of hypergravity. These results show that growth inhibition by hypergravity is independent of its direction in azuki bean epicotyls. The findings also suggest that mechanoreceptors on the plasma membrane perceive the gravity signal independently of its direction, and affect growth of azuki bean epicotyls.

  7. Roasting green coffee beans using spouted bed roaster: changes in physical characteristics.

    Science.gov (United States)

    Nagaraju, V D; Bhattacharya, Suvendu

    2010-12-01

    Pea-berry grade of green coffee (Coffea arabica) beans were roasted in a laboratory model spouted bed roaster at different temperatures (150-250°C) and times (30-300 s). The roasted samples were analysed for instrumental colour (hue, chroma and brightness) and texture. Brightness of the roasted samples varied between 5.2 and 20.4%, and time of roasting markedly decreased the brightness values. The chroma showed a curvilinear decrease with both time and temperature of roasting; the lowest values were with highest roasting times and temperatures. The hue or dominant wavelength increased from 576 to 603 nm due to roasting. The maximum force offered by the roasted beans decreased with temperature and/or time of roasting. An appropriate condition for spouted bed roasting of green coffee beans was obtained considering colour of samples and desirable low failure/fracture force. PMID:23572704

  8. COLOR CHARACTERISTICS OF COCOA BUTTER MADE FROM THE PROCESSING OF THE IVORIAN COCOA BEANS

    Directory of Open Access Journals (Sweden)

    DAVID KOFFI AKAKI

    2013-05-01

    Full Text Available Color of cocoa butters was measured using a CM-2002 Minolta Spectrocolorimeter. The results showed that the ‘’L’’ values (lightness varied from 73.11 to 84.76, the ‘’a’’ values (greenness varied from – 2.15 to – 1.08 and a redness of 4.99, and the ‘’b’’ values (yellowness varied from 28.63 to 41.11. Acidities of all typescocoa butters varied from 0.47 to 10.26. The best cocoa butters were obtained from staly and fully purple beans and cocoa beans of grades 4, 5, and 6. These butters had acidities of 0.48 and 0.56 for fully purple and staly beans and 2.41, 1.30, and 0.47 for grades 4, 5, and 6, respectively.

  9. Phytochemical Evaluation of Moth Bean (Vigna aconitifolia L.) Seeds and Their Divergence.

    Science.gov (United States)

    Gupta, Neha; Shrivastava, Nidhi; Singh, Pramod Kumar; Bhagyawant, Sameer S

    2016-01-01

    In the present study, phytochemical contents of 25 moth bean (Vigna aconitifolia) seed accessions were evaluated. This includes protease inhibitors, phytic acid, radical scavenging activity, and tannins. The studies revealed significant variation in the contents of theses phytochemicals. Presence of photochemical composition was correlated with seed storage proteins like albumin and globulin. Qualitative identification of total seed storage protein abundance across two related moth bean accessions using two-dimensional gel electrophoresis (2D-GE) was performed. Over 20 individual protein fractions were distributed over the gel as a series of spots in two moth bean accessions. Seed proteome accumulated spots of high intensity over a broad range of pI values of 3-10 in a molecular weight range of 11-170 kDa. In both seed accessions maximum protein spots are seen in the pI range of 6-8. PMID:27239343

  10. Stress ethylene evolution of bean plants—a parameter indicating ozone pollution

    Science.gov (United States)

    Stan, Hans-Jürgen; Schicker, Sieglinde; Kassner, Helmut

    Bean plants treated with varying ozone concentrations for varying exposure times showed increased rates of ethylene production compared with controls. A standard method was worked out in which primary leaves of bean plants were encapsulated in 250 ml Erlenmeyer flasks after exposure. The amount of ethylene produced was determined by gas chromatography after about 24 h. The 'no effect level' of the bean plant was found to be 100 ppb ozone because there was no significant stress ethylene production even after 12 h fumigation. A treatment with 150 ppb ozone induced the beginning of stress ethylene production after about 8 h. With higher ozone concentrations shorter exposure times are necessary to induce a first response. Stress ethylene production correlates better with ozone concentration than with exposure time comparing the same products of concentration and time.

  11. Allelopathic potential of Hyptis suaveolens on physio-biochemical changes of mung bean seeds

    Directory of Open Access Journals (Sweden)

    Parthapratim Maiti

    2015-10-01

    Full Text Available Hyptis suaveolens is an exotic invasive weed in many areas of West Bengal, India. The allelopathic potential of leaf extracts and leachates of H. suaveolens was investigated on germination and metabolism of mung bean seeds (Vigna radiata cv. K851. The extracts and leachates reduced the germination and seed viability. The insoluble carbohydrates, proteins, and the activities of dehydrogenase and catalase enzymes were significantly reduced. Amino acid and soluble carbohydrate levels were increased in seeds pretreated with leaf extracts and leachates. The overall biochemical results indicate that various inhibitors present in H. suaveolens impart strong inhibitory effect on mung bean. The leaves of H. suaveolens possess phytotoxic chemicals, which potentially rendered the inhibitory action on mung bean seeds and provided key information for the proper management of H. suaveolens and other invasive weeds showing similar behavior.

  12. Engineering analysis of the high-density heterotrophic cultivation of mung bean sprouts.

    Science.gov (United States)

    Tamate, Haruka; Nakai, Ran; Nakamori, Yasuyuki; Esashi, Masahiro; Iwamoto, Yasushi; Tsukada, Yoshihiro; Saito, Mika; Ishikawa, Daitaro; Fujii, Tomoyuki

    2016-08-01

    This study investigated the heterotrophic growth behavior of mung beans cultivated in an individual bed under water supply. The fresh weight of mung beans in the bed was estimated, and changes in temperature, and oxygen and carbon dioxide concentrations were recorded during the cultivation period. The specific growth rate, oxygen uptake rate, and carbon dioxide evolution rate, based on the fresh weight in the bed, were calculated. Growth under heterotrophic cultivation can be classified into the following three stages. Reductions in specific oxygen uptake rate, specific carbon dioxide evolution rate, and specific energy production rate corresponded to that of specific growth rate. Indicators of biological activity related to oxygen and carbon dioxide were evaluated quantitatively for beds under high-density heterotrophic cultivation. Moreover, the results obtained from this study successfully demonstrate that there is a relationship between the growth of mung beans and indicators of biological activity. PMID:27121990

  13. Effect of N and K doses in nutritive solution on growth, production and coffee bean size

    Directory of Open Access Journals (Sweden)

    Junia Maria Clemente

    2013-04-01

    Full Text Available An adequate supply of nutrients is essential for obtaining high yields of coffee. The objective of this study was to evaluate the effect of N, K and the N:K ratio on vegetative and reproductive growth of coffee. For this purpose, coffee plants were grown in nutrient solution containing K in the concentrations of 1.08; 2.15; 3.23 and 5.38 mmol L-1 combined with a dose of 6 mmol L-1 N, resulting in the N:K ratios (w/w: 1:0.5; 1:1; 1:1.5 and 1:2.5. The control treatment consisted of the doses 3 and 1.61 mmol L-1 of N and K respectively, resulting in the N:K ratio (w/w 1.0:1.5. The following variables were evaluated: height, stem diameter, number of nodes of the eighth plagiotrofic branch (index branch, pairs of plagiotrofic branches and number of nodes in the orthotropic branch every three weeks from the beginning of the experiment. Additionally, it was evaluated the chemical composition of processed beans and leaves between the flowering and the rapid expansion stage of the cherry beans, production of cherry beans per plant and classification of beans according to the size. N influenced mainly the characteristics of vegetative growth and K influenced mainly the reproductive growth evaluated by the production. The lowest production resulted in the highest percentages of beans retained on sieves with holes larger than 16/64", while the highest production promoted an increase in the percentage of beans retained on sieves with holes smaller than 16/64".

  14. Reduction of weed pressure by establishing catch crops in maize-bean-intercropping systems

    Directory of Open Access Journals (Sweden)

    Fischer, Jenny

    2016-02-01

    Full Text Available Intercropping field experiments with maize and Phaseolus beans are conducted at the Thünen-Institute of Organic Farming (Schleswig-Holstein, SL, 740 mm, 8.7 °C from 2014-2016. As known from previous experiments, maize and beans have a very low competitiveness against weeds, due to their relative slow youth development. Therefore, the beans were sown subsequently to the mechanical weed control with harrow and hoe, at the 4-leaf development stage (BBCH 14 of maize. Hence a mechanical weed control after bean emergence is critical, a field experiment is conducted to find out whether the establishment of an additional catch crop can reduce weed pressure substantially. For this purpose two catch crop mixtures are evaluated in pure maize plots as well as in intercropping plots with scarlet runner beans (Phaseolus coccineus, cv. Preisgewinner or common runner beans (Phaseolus vulgaris, cv. Tarbais respectively. As control variants, plots without undersown crops were used. The undersown crop mixtures are composed of Italian ryegrass (cv. Gersimi, sowing density: 15 kg ha-1, which is combined with subterranean clover (cv. Seaton Park, sowing density: 30 kg ha-1 in US1 and with Chicory (cv. Puna II, sowing density 7.5 kg ha-1 in US2. The highest biomass (50 g DM m-2 was produced by US1 in all variants, while the biomass of US2 was significantly lower with 32 g DM m-2. As a result of a successful mechanical weed control as well as a good development of the main crops, the weed pressure in 2014 was generally low. Nevertheless, the results show that undersown crops can reduce weeds substantially. While the significantly highest weed biomass was recorded in the plots without undersown crops, it was reduced by 70% with US1 and by 80% with US2 on average respectively.

  15. Productivity of irrigated beans due to sources of stabilized nitrogen fertilizer and controlled release

    Directory of Open Access Journals (Sweden)

    Tatiely Gomes Bernardes

    2015-12-01

    Full Text Available ABSTRACT New nitrogen fertilizers are available in the market actually, however, does not have results on the efficiency of the Cerrado conditions. With that objective of this study was to evaluate the effect of urea including stabilized and controlled release urea on yield of irrigated common beans (Phaseolus vulgaris L in no-tillage system. The experiment was conducted in the winter crop, at Embrapa Arroz e Feijão, in Santo Antônio de Goiás, State of Goiás, Brazil. The experimental design was randomized blocks, with five replicates. Treatments consisted of five N sources (urea, urea + NBPT, urea + polymer, ammonium sulphate, and ammonium nitrate and a control (without N being applied 20 kg ha-1 of N at sowing and 80 kg ha-1 onf N in topdressing. We evaluated the chlorophyll content in leaves of common beans, the leaf N content and dry mass weight (MSPA in the flowering of common beans, the number of pods per plant, number of grains per pod, mass of 100 grains, grain yield and final stand of the common beans. The sources of nitrogen fertilizer did not influence, leaf N content, the mass of MSPA and the relative chlorophyll index of common beans. The use of polymerized urea and urea with urease inhibitor, did not produce increases in the number of grains per pod, number of pods per plant, mass of 100 grains and common beans yield compared to traditional sources of N, urea, ammonium sulfate and ammonium nitrate.

  16. Bean and rice meals reduce postprandial glycemic response in adults with type 2 diabetes: a cross-over study

    Directory of Open Access Journals (Sweden)

    Thompson Sharon V

    2012-04-01

    Full Text Available Abstract Background Around the world, beans and rice are commonly consumed together as a meal. With type 2 diabetes increasing, the effect of this traditional diet pattern on glycemic response has not been studied fully. Methods We evaluated the glycemic response of bean and rice traditional meals compared to rice alone in adults with type 2 diabetes. Seventeen men and women with type 2 diabetes controlled by metformin (n = 14 or diet/exercise (n = 3 aged 35–70 years participated in the randomized 4 × 4 crossover trial. The white long grain rice control, pinto beans/rice, black beans/rice, red kidney beans/rice test meals, matched for 50 grams of available carbohydrate, were consumed at breakfast after a 12 hour fast. Capillary blood glucose concentrations at baseline and at 30 minute intervals up to 180 minutes postprandial were collected. MANOVA for repeated measures established glucose differences between treatments. Paired t tests identified differences between bean types and the rice control following a significant MANOVA. Results Postprandial net glucose values were significantly lower for the three bean/rice treatments in contrast to the rice control at 90, 120 and 150 minutes. Incremental area under the curve values were significantly lower for the pinto and black bean/rice meals compared to rice alone, but not for kidney beans. Conclusions Pinto, dark red kidney and black beans with rice attenuate the glycemic response compared to rice alone. Promotion of traditional foods may provide non-pharmaceutical management of type 2 diabetes and improve dietary adherence with cultural groups. Trial registration Clinical Trials number NCT01241253

  17. Bacillus vanillea sp. nov., Isolated from the Cured Vanilla Bean.

    Science.gov (United States)

    Chen, Yong-gan; Gu, Feng-lin; Li, Ji-hua; Xu, Fei; He, Shu-zhen; Fang, Yi-ming

    2015-02-01

    A Gram-positive bacterium, designated strain XY18(T), was isolated from a cured vanilla bean in Hainan province, China. Cells were rod-shaped, endospore producing, and peritrichous flagella. Strain XY18(T) grew at salinities of 0-8 % (w/v) NaCl (optimally 1-4 %), pH 4.0-8.0 (optimally 5.0-7.0 %) and temperature range 20-45 °C (optimally 28-35 °C). The predominant menaquinone was MK-7. The major cellular fatty acids were anteiso-C15:0, iso-C15:0, anteiso-C17:0, and iso-C17:0. Phylogenetic analysis based on 16S rRNA gene sequence indicated that strain XY18(T) was a member of the genus Bacillus, and closely related to B. amyloliquefaciens NBRC 15535(T) and B. siamensis PD-A10(T), with 99.1 and 99.2 % sequence similarity, respectively. However, the DNA-DNA hybridization value between strain XY18(T) and B. amyloliquefaciens NBRC 15535(T) was 35.7 %. The genomic DNA G+C content of strain XY18(T) was 46.4 mol%, significantly differed from B. siamensis PD-A10(T) (41.4 %), which was higher than the range of 4 % indicative of species. On the basis of polyphasic taxonomic study, including phenotypic features, chemotaxonomy, and phylogenetic analyses, strain XY18(T) represents a novel species within the genus Bacillus, for which the name Bacillus vanillea sp. nov. is proposed. The type strain is XY18(T) (=CGMCC 8629 = NCCB 100507).

  18. Bacillus vanillea sp. nov., Isolated from the Cured Vanilla Bean.

    Science.gov (United States)

    Chen, Yong-gan; Gu, Feng-lin; Li, Ji-hua; Xu, Fei; He, Shu-zhen; Fang, Yi-ming

    2015-02-01

    A Gram-positive bacterium, designated strain XY18(T), was isolated from a cured vanilla bean in Hainan province, China. Cells were rod-shaped, endospore producing, and peritrichous flagella. Strain XY18(T) grew at salinities of 0-8 % (w/v) NaCl (optimally 1-4 %), pH 4.0-8.0 (optimally 5.0-7.0 %) and temperature range 20-45 °C (optimally 28-35 °C). The predominant menaquinone was MK-7. The major cellular fatty acids were anteiso-C15:0, iso-C15:0, anteiso-C17:0, and iso-C17:0. Phylogenetic analysis based on 16S rRNA gene sequence indicated that strain XY18(T) was a member of the genus Bacillus, and closely related to B. amyloliquefaciens NBRC 15535(T) and B. siamensis PD-A10(T), with 99.1 and 99.2 % sequence similarity, respectively. However, the DNA-DNA hybridization value between strain XY18(T) and B. amyloliquefaciens NBRC 15535(T) was 35.7 %. The genomic DNA G+C content of strain XY18(T) was 46.4 mol%, significantly differed from B. siamensis PD-A10(T) (41.4 %), which was higher than the range of 4 % indicative of species. On the basis of polyphasic taxonomic study, including phenotypic features, chemotaxonomy, and phylogenetic analyses, strain XY18(T) represents a novel species within the genus Bacillus, for which the name Bacillus vanillea sp. nov. is proposed. The type strain is XY18(T) (=CGMCC 8629 = NCCB 100507). PMID:25292250

  19. Geometry applied to breeding common beans (Phaseolus vulgaris).

    Science.gov (United States)

    Lima, J G; Ramalho, M A P

    2016-01-01

    The primary components of common bean (Phaseolus vulgaris) grain yield (W) are the number of pods (X), the number of grains per pod (Y), and the weight of the grains (Z). In 1964, Grafius suggested using geometry in plant breeding; W corresponds to the volume of a parallelepiped with three axes, X, Y, and Z. Because the cube is the largest parallelepiped by volume, maximum yield is obtained when the relative contributions of X, Y, and Z are the same. We evaluated individual plants of a 'Talismã' x 'L.59583' cross in two sowing periods. The sum of squares of deviations from the ideal plant (GI), i.e., the plant in which the X, Y, and Z contributions were the same, was estimated. Mean and variance genetic components, and genetic and phenotypic correlations between the characteristics were also estimated. Good concordance was observed in the magnitude and direction of the genetic and phenotypic correlation estimates of the paired characteristics. However, a low GI heritability (h(2)r = 6.7%) indicated that success due to selection should be small. Ninety-four progenies of 'Pérola' x 'ESAL 686' crosses were also evaluated, where X, Y, Z, and W were obtained and GI was estimated. The h(2) estimate was higher, but still low (h(2) = 39.0%). Therefore, the selection of individuals to obtain plants in which the X, Y, and Z products tend to the cube is unfeasible, because the sums of X, Y, and Z vary between individuals. In addition, the GI h2 value was low. PMID:27173247

  20. Damping performance of bean bag dampers in zero gravity environments

    Science.gov (United States)

    Zhang, Chao; Chen, Tianning; Wang, Xiaopeng

    2016-06-01

    Bean bag dampers (BBDs), developed from impact damping technology, have been widely applied in engineering field to attenuate the vibration of a structural system. The damping effect of a BBD on vibration control in ground gravity environments is good, but its performance in zero gravity environments is not clear, and there are few studies on it. Therefore, the damping effect of BBDs in zero gravity environments was investigated based on the discrete element method (DEM) in this paper. Firstly, a three-dimensional DEM model of a BBD was established, and the damping effects of the single degree of freedom (SDOF) systems with BBDs and non-obstructive particle dampers (NOPDs) in zero gravity environments were compared. Moreover, the influences of the diameter of the inner ball, the tightness of BBD, the vibration frequency of SDOF system and the gap between BBD and cavity on the vibration reduction effect of BBD in zero gravity environments were also studied, and the results were compared with the system with BBD in ground gravity environments. There are optimum ranges of the diameter of the inner ball, tightness and gap for BBD, and the effects of these parameters on the damping performances of BBD in gravity and zero gravity environments are similar in evolving trends, and the values are without big differences in the optimum ranges. Thereby the parameter selection in BBD design in zero gravity environments is similar to that in gravity environments. However, the diameter of BBD should be a slightly larger than the size of the cavity when the structures with BBD work in zero gravity environments. The BBD is supposed to be picked tightly when the vibration frequency is high, and the BBD has better to be picked more tightly in zero gravity environments. These results can be used as a guide in the design of BBDs in zero gravity environments.

  1. Utilisation of total solar radiation energy in the photosynthetic production of radish, red beet and bean

    Directory of Open Access Journals (Sweden)

    Wiesław Nowakowski

    2014-02-01

    Full Text Available Utilisation of total solar radiation energy in the photosynthetic production of radish, red beet and bean is expressed as per cent of solar radiation accumulated in the carbon of -the dry mass per 1 cm2 of the assimilation surface area. Utilisation of this energy ranges from 2.6 to 8.4 per cent in radish, from 1.7 to 7.5 per cent in beet and from 1.9 to 4.9 per cent in bean.

  2. Disinfestation of copra, desiccated coconut and coffee beans by gamma radiation

    International Nuclear Information System (INIS)

    Nine insect pests were found associated with copra of which copra beetle, Necrobia rufipes, saw-toothed grain beetle, Oryzaephilus surinamensis, red flour beetle, Tribolium castaneum, cigarette beetle, Lasioderma serricorne and tropical warehouse moth, Ephestia cautella were found feeding on this food. While feeding on different coffee beans, coffee bean weevil, Araecerus fasciculatus De Geer showed preference on Arabica, Liberica and Excelsa but not in Robusta coffee beans. For mass rearing, the most suitable medium for copra beetle was desiccated coconut + yeast (2:1) and for coffee bean beetle, it was dried cassava chips + yeast (3:1). The life cycles completed in these food media were 43 to 60 and 42 to 56 days by copra beetle and coffee bean weevil respectively. Irradiation studies on these 2 species of insects showed that the eggs were most sensitive followed by larvae and pupae. A dose of 0.05 kGy prevented adult emergence from irradiated eggs and younger larvae, while doses of 0.10 to 0.25 kGy effected the survival of emerged adults. However, a dose of 0.50 kGy would be effective for the disinfestation of small packages (i.e. 0.25 to 0.50 kg in each) of copra or coffee beans initially infested with immature stages of beetles and weevils respectively. Packaging of irradiated commodities in polypropylene bags particularly those impregnated with permethrin prevented reinfestation by the insect pests. Toxic residues of permethrin in the prolypropylene film resulted in high mortality thereby preventing insect penetration of the packaging materials. Both copra beetles and coffee bean weevils were rather good invaders than penetrators as these species entered into the packages readily through existing openings in jute sack, woven polypropylene sack or flour bag. Organoleptic tests showed no change in aroma, flavour and general acceptability of irradiated coffee beans. In microbial studies it was observed that a dose of 0.6 kGy would eliminate Salmonella

  3. 糟方的制作方法%The making method of white preserved bean curd

    Institute of Scientific and Technical Information of China (English)

    李学贵

    2011-01-01

    So as to promote the research and development of preserved bean curd products,the processing technology of white preserved bean curd is concluded.The raw material,ingredients and technological process are explained in detail and the operation points are g%为了促进豆腐乳新品的研究和开发,总结了糟方的制作方法,对制作糟方所需的原料、配方和工艺流程做了较为详细的介绍,并着重讨论了制作糟方的操作要点。

  4. Laboratory invesitgations of variability of Ascochyta fabae Speg. isolates obtained from horse bean

    Directory of Open Access Journals (Sweden)

    Antoni Józef Filipowicz

    2014-08-01

    Full Text Available Fifty five isolates of Ascochyta fabae Speg. were investigated. They were selected from 1650 isolates of this fungus obtained from horse bean seeds in 1974-1976. All the isolates grew and sporulated on Potato Dextrose Agar, Malt Agar and Horse Bean Agar. The rate of their growth amounted to 1-4 mm per 24 hours. The variability of isolates in size of pycnidia and conidia and number of sepia was noticed. A few spores with untypical shapes were observed as well.

  5. Transcriptome-wide identification and characterization of microRNAs from castor bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Wei Xu

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are endogenously encoded small RNAs that post-transcriptionally regulate gene expression and play essential roles in numerous developmental and physiological processes. Currently, little information on the transcriptome and tissue-specific expression of miRNAs is available in the model non-edible oilseed crop castor bean (Ricinus communis L., one of the most important non-edible oilseed crops cultivated worldwide. Recent advances in sequencing technologies have allowed the identification of conserved and novel miRNAs in many plant species. Here, we used high-throughput sequencing technologies to identify and characterize the miRNAs in castor bean. RESULTS: Five small RNA libraries were constructed for deep sequencing from root tips, leaves, developing seeds (at the initial stage, seed1; and at the fast oil accumulation stage, seed2 and endosperms in castor bean. High-throughput sequencing generated a large number of sequence reads of small RNAs in this study. In total, 86 conserved miRNAs were identified, including 63 known and 23 newly identified. Sixteen miRNA isoform variants in length were found from the conserved miRNAs of castor bean. MiRNAs displayed diverse organ-specific expression levels among five libraries. Combined with criteria for miRNA annotation and a RT-PCR approach, 72 novel miRNAs and their potential precursors were annotated and 20 miRNAs newly identified were validated. In addition, new target candidates for miRNAs newly identified in this study were proposed. CONCLUSIONS: The current study presents the first high-throughput small RNA sequencing study performed in castor bean to identify its miRNA population. It characterizes and increases the number of miRNAs and their isoforms identified in castor bean. The miRNA expression analysis provides a foundation for understanding castor bean miRNA organ-specific expression patterns. The present study offers an expanded picture of miRNAs for castor

  6. CAF\\'E-BEANS: An exhaustive hunt for high-mass binaries

    CERN Document Server

    Negueruela, I; Simón-Díaz, S; Alfaro, E J; Herrero, A; Alonso, J; Barbá, R; Lorenzo, J; Marco, A; Monguió, M; Morrell, N; Pellerin, A; Sota, A; Walborn, N R

    2014-01-01

    CAF\\'E-BEANS is an on-going survey running on the 2.2 m telescope at Calar Alto. For more than two years, CAF\\'E-BEANS has been collecting high-resolution spectra of early-type stars with the aim of detecting and characterising spectroscopic binaries. The main goal of this project is a thorough characterisation of multiplicity in high-mass stars by detecting all spectroscopic and visual binaries in a large sample of Galactic O-type stars, and solving their orbits. Our final objective is eliminating all biases in the high-mass-star IMF created by undetected binaries.

  7. First report of Cowpea mild mottle Carlavirus on yardlong bean (Vigna unguiculata subsp. sesquipedalis) in Venezuela.

    Science.gov (United States)

    Brito, Miriam; Fernández-Rodríguez, Thaly; Garrido, Mario José; Mejías, Alexander; Romano, Mirtha; Marys, Edgloris

    2012-12-14

    Yardlong bean (Vigna unguiculata subsp. sesquipedalis) plants with virus-like systemic mottling and leaf distortion were observed in both experimental and commercial fields in Aragua State, Venezuela. Symptomatic leaves were shown to contain carlavirus-like particles. RT-PCR analysis with carlavirus-specific primers was positive in all tested samples. Nucleotide sequences of the obtained amplicons showed 84%-74% similarity to corresponding sequences of Cowpea mild mottle virus (CPMMV) isolates deposited in the GenBank database. This is the first report of CPMMV in Venezuela and is thought to be the first report of CPMMV infecting yardlong bean.

  8. First Report of Cowpea Mild Mottle Carlavirus on Yardlong Bean (Vigna unguiculata subsp. sesquipedalis in Venezuela

    Directory of Open Access Journals (Sweden)

    Edgloris Marys

    2012-12-01

    Full Text Available Yardlong bean (Vigna unguiculata subsp. sesquipedalis plants with virus-like systemic mottling and leaf distortion were observed in both experimental and commercial fields in Aragua State, Venezuela. Symptomatic leaves were shown to contain carlavirus-like particles. RT-PCR analysis with carlavirus-specific primers was positive in all tested samples. Nucleotide sequences of the obtained amplicons showed 84%–74% similarity to corresponding sequences of Cowpea mild mottle virus (CPMMV isolates deposited in the GenBank database. This is the first report of CPMMV in Venezuela and is thought to be the first report of CPMMV infecting yardlong bean.

  9. Quality assessment of coffee beans with ESR and gamma-ray irradiation

    International Nuclear Information System (INIS)

    Peroxy radical formation in raw coffee beans of different qualities and origins from all over the world has been studied with electron spin resonance (ESR) analysis. The γ-ray equivalent absorbed dose (ED) which creates the same concentration of radicals is obtained by the additive γ-ray irradiation of the coffee beans. The ED and the cup quality is somewhat inversely related suggesting that the peroxidation of the unsaturated fatty acid is somewhat indicative of the degree of the aromatic decomposition and rancidity. (author)

  10. EVALUATION OF PHYSIOLOGY AND BIOCHEMISTRY THE CASTOR BEAN FUNCTION OF DOSES AND FERTILIZER IN SOIL

    OpenAIRE

    Fabiana Xavier Costa

    2011-01-01

    Aimed at with this work to investigate the physiology and biochemistry of the castor bean, after use of compost and organic castor bean. The trial began on October 3, 2005 ending on March 20, 2006, in green-house, controlled environment of the National Center of Cotton Research (CNPA / EMBRAPA), in Campina Grande , State of Paraiba. Was used to cultivate castor BRS Paraguaçu. We used a randomized block design with four replications, totaling 11 treatments, since they are derived from doses of...

  11. Composição volátil dos defeitos intrínsecos do café por CG/EM-headspace Volatile composition of intrinsic defective coffee beans by GC/MS-headspace

    Directory of Open Access Journals (Sweden)

    Raquel D. C. C. Bandeira

    2009-01-01

    Full Text Available About 20% of Brazilian raw coffee production is considered inappropriate for exportation. Consequently, these beans are incorporated to good quality beans in the Brazilian market. This by-product of coffee industry is called PVA due to the presence of black (P, green (V and sour (A defective beans which are known to contribute considerably for cup quality decrease. Data on the volatile composition of Brazilian defective coffee beans are scarce. In this study, we evaluated the volatile composition of immature, black-immature, black defective beans and PVA compared to good quality beans. Potential defective beans markers were identified.

  12. Development and field evaluation of an intercropping machine for corn and bean

    Directory of Open Access Journals (Sweden)

    A Mondani

    2016-09-01

    Full Text Available Introduction Maximum efficiency of natural resources, reduced risk of production, improved fertility of soil, and increased production per area enjoyment have made intercropping a preferential practice compared with cropping. One of the fundamental problems in this kind of cropping is non-existence of suitable machines. In this research, a new intercropping machine has been designed and built for intercropping of corn and bean with precise ratios and different planting patterns. Materials and Methods The experiments were conducted at the Badjgah Research Station, Shiraz University, located in NW Shiraz, Iran. The soil texture was clay loam (16% sand, 48% silt, and 35% clay. The plot size was 9 m wide and 12 m long. The total number of the plots were 9. The basic components of intercropping machine were an adjustable frame to adjust row spacing for each unit planter about 550 mm horizontally independently (the row spacing between corn and bean planting lines was considered 375 mm, a hinged frame for adjustment of seeding depth and possible poor emergence of plants due to very deep or shallow planting, metering case frames for installing the vacuum metering disk units around which the seed drums have a row of 36 holes of 4.5 and 5.5 mm diameter for corn and bean, respectively, seed delivery tubes, a suction fan, shovel openers used for bedder planting for corn and lister planting for bean, a knife covering attachment, seed-firming wheels, interchangeable gears which are mechanical chain drives for 43 varying seeding rates driven by carrying wheel drives, two metal seed hoppers whose lower side walls’ slope can be adjust at a maximum level of 45 . A front wheel assist, Massey Ferguson tractor (MF-399 (ITM, Tabriz, Iran with a maximum engine power of 81 kW was used for field test of intercropping machine. Moldboard plow was used for primary tillage and the depth of plowing was 25 cm. Next, by an offset disk harrow, the field was disked twice for

  13. Identification of the key odorants in Tahitian cured vanilla beans (Vanilla tahitensis) by GC-MS and an aroma extract dilution analysis.

    Science.gov (United States)

    Takahashi, Makoto; Inai, Yoko; Miyazawa, Norio; Kurobayashi, Yoshiko; Fujita, Akira

    2013-01-01

    The key odorants of Tahitian vanilla beans (Vanilla tahitensis) were characterized by a sensory evaluation, aroma extract dilution analysis (AEDA), quantification, and aroma reconstitution. Vanillin and anisaldehyde were identified in the same highest flavor dilution (FD) factor as the most characteristic odor-active compounds in Tahitian vanilla beans, followed by anisyl alcohol and anisyl acetate. Vanillin and anisyl alcohol were by far the most abundant odorants present with the highest concentration in the beans, followed by acetic acid, anisaldehyde, and anisyl acetate. A sensory evaluation of Tahitian vanilla beans and its reconstitute aroma concentrate characterized both samples as similar. These results indicated vanillin, anisaldehyde, anisyl alcohol, and anisyl acetate to be the key odorants in Tahitian vanilla beans. 3-Methylnonane-2,4-dione were identified for the first time in vanilla beans. β-Damascenone and phenylacetic acid were identified for the first time in Tahitian vanilla beans.

  14. The use of ionising radiation from 60CO gamma source in controlling mouldiness in dried cocoa beans

    International Nuclear Information System (INIS)

    Mouldiness in stored cocoa beans in Ghana and the production of aflatoxin have been studied. Based on actual weight of discarded beans, mouldy beans have been estimated to constitute 0.13 % and 0.00002 % of marketable beans at the farmers' level and the buying agents' depots respectively in the Tafo District. This is contrasted with an estimated value of 0.16 % obtained in a questionnaire type study involving farmers. Estimated mouldy beans at the Tema port was 0.69 % per year (based on the cut test) representing a financial loss of $1,688,637.19 per year at $989/T should the mouldy beans be discarded. Fifty-eight (58) internally- and externally- borne fungal species were isolated from dried cocoa beans. Of these, forty-eight (48) were internally- borne and ten (10) were superficial. Twenty-nine (29) of the internally occurring fungi have been recorded for the first time on cocoa beans in Ghana. Twenty-six (26) of the fungi isolated belong to Aspergillus group. They included A. parasiticus and A. flavus, which can produce aflatoxins. Five (5) belong to Penicillium, eight (8) to Fusarium and nineteen (19) to other species. Ionising radiation effectively controlled fungi associated with mouldiness in cocoa beans in a dose - dependent manner. A radiation dose of 6 kGy completely inactivated the moulds. A. flavus and A. tamarii were the most radiation - resistant moulds encountered. The moisture content of the beans before, during and after irradiation influenced the effect of radiation. The relative humidity during storage and the type of packaging also influenced the radiation effect. Conidia of A. flavus subjected to moist heat at temperatures 20 0C to 60 0C for 2.5, 5 and 10 min respectively were not significantly affected by heating up to 50 0C. Heating an aqueous conidial suspension at 60 0C for at least 2.5 min reduced the number of fungal colonies by at least 5 log cycles when the suspension was assayed on agar plate media. Heating at 59 0C for 10 min

  15. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis and comparison with the broader species.

    Directory of Open Access Journals (Sweden)

    Pei Xu

    Full Text Available Asparagus bean (Vigna. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea [Vigna. unguiculata (L. Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  16. Effects of inclusion level on nutrient digestibility and energy content of wheat middlings and soya bean meal for growing pigs.

    Science.gov (United States)

    Huang, Qiang; Piao, Xiangshu; Liu, Ling; Li, Defa

    2013-01-01

    Two experiments were conducted to determine the effects of inclusion level of wheat middlings and soya bean meal on apparent total tract digestibility (ATTD) of energy and chemical components of these ingredients in growing pigs. Furthermore, the effects of the inclusion level on their contents of digestible energy (DE) and metabolisable energy (ME) were also determined by the difference method. In Experiment 1, six diets were fed to 36 growing pigs according to a completely randomised design. The basal diet was a corn-soya bean meal diet while the other five diets contained 9.6%, 19.2%, 28.8%, 38.4% or 48.0% of wheat middlings added at the expense of corn and soya bean meal. The measured digestibility of energy and most nutrients of wheat middlings increased (p soya bean meal (22.2% and 33.6%). The content of DE in soya bean meal did not differ at 22.2% and 33.6% inclusion levels (16.2 and 16.3 MJ/kg DM, respectively), but the digestibility of dry matter (DM), organic matter and carbohydrates was increased at a higher inclusion level (p soya bean meal and wheat middlings was affected by their dietary inclusion levels. For soya bean meal, the estimated energy contents was independent of its inclusion level, but not for wheat middlings. Therefore, the inclusion level of wheat middlings has to be considered for estimating their energy value.

  17. Evaluation of thirteen lines (M8) of 'May flower' beans selected after gamma irradiation with cobalt 60

    International Nuclear Information System (INIS)

    For the nutrition of mexican people, cultivation of bean is necessary. The constant increase in population and the low yields in bean crops had bring as a consequence a great demand of beans, for which reason it is necessary to increase the production and productivity in order to satisfy such a demand. In 1986, in the state of Guanajuato the bean harvest was of 80, 119 hectare. In 1964 the harvest was 225458 hectare and began a lowering until reach in 1980 a surface of 64,122 hectare. The average yield estimated for 1960, was 309 kilogram-hectare, in 1975 the yield was 554 kilogram and starting from 1976 the trend was descendent until reach an average of 484 kilogram-hectare in 1980. According to estimations of Instituto Nacional de Investigaciones Agronomicas (INIA) in 1981, the diminishing in harvest surface and the low yields in crops were owing between other factors to: mosaic virus which is common in beans, roya, pest, etc. Utilization of radioinduced mutagenesis in feeding crops, constitute an alternative for the obtention of new genotypes more productive and resistant to diseases which can help to solve the great demand for this crop. The goal of this work is the obtention of mutants resistant to the main diseases in El Bajio zone (Mosaic virus common to bean and roya) in join with higher yields, starting from irradiation of the variety of bean 'May flower' with gamma radiation from cobalt 60. (Author). 6 refs, 2 tabs

  18. Application of different techniques to identify the effects of irradiation on Brazilian beans after six months storage

    Science.gov (United States)

    Villavicencio, A. L. C. H.; Mancini-Filho, J.; Delincée, H.

    1998-06-01

    Four different techniques to detect the effect of irradiation in beans were investigated. Two types of Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macaçar, were irradiated using a 60Co source with doses ranging from 10.0 kGy. After 6 months storage at ambient temperature the detection tests were carried out. Firstly, germination tests showed markedly reduced root growth and almost totally retarded shoot elongation of irradiated beans as compared to non-irradiated beans. Secondly, DNA fragmentation was studied using a microgel electrophoresis. Irradiated cells produced typical comets with DNA fragments migrating towards the anode. DNA of non-irradiated cells exhibited a limited migration. Thirdly, electron spin resonance for detection of cellulose radicals was tested, since it was expected that these free radicals are quite stable in solid and dry foods. However, only in beans irradiated with 10 kGy a small signal could be detected. Fourtly, thermoluminescence, a method to analyze mineral debris adhering to food, turned out to be a good choice to detect irradiation effects in beans, even after 6 months of storage. The results indicate that three of these four techniques proposed, can be used to detect the effect of irradiation in these two varieties of Brazilian beans at a dose level useful for insect disinfestation (1 kGy).

  19. Breeding for culinary and nutritional quality of common bean (Phaseolus vulgaris L. in intercropping systems with maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Rodino A.P.

    1999-01-01

    Full Text Available Common bean (Phaseolus vulgaris L. is widely intercropped with maize (Zea mays L. in the North of Spain. Breeding beans for multiple cropping systems is important for the development of a productive and sustainable agriculture, and is mainly oriented to minimize intercrop competition and to stabilize complementarity with maize. Most agricultural research on intercropping to date has focused on the agronomic and overall yield effects of the different species, but characters related with socio-economic and food quality aspects are also important. The effect of intercropping beans with maize on food seed quality traits was studied for thirty-five bush bean varieties under different environments in Galicia (Northwestern Spain. Parameters determining Asturian (Northern Spain white bean commercial and culinary quality have also been evaluated in fifteen accessions. There are significant differences between varieties in the selected cropping systems (sole crop, intercrop with field maize and intercrop with sweet maize for dry and soaked seed weight, coat proportion, crude protein, crude fat and moisture. Different white bean accessions have been chosen according to their culinary quality. Under these environmental conditions it appears that intercropping systems with sweet maize give higher returns than sole cropping system. It is also suggested that the culinary and nutritional quality potential of some white bean accessions could be the base material in a breeding programme the objectives of which are to develop varieties giving seeds with high food quality.

  20. Western bean cutworm survival and the development of economic injury levels and economic thresholds in field corn.

    Science.gov (United States)

    Paula-Moraes, S; Hunt, T E; Wright, R J; Hein, G L; Blankenship, E E

    2013-06-01

    Western bean cutworm, Striacosta albicosta (Smith) (Lepidoptera: Noctuidae), is a native pest of dry beans (Phaseolus vulgaris L.) and corn (Zea mays L.). Historically, the western bean cutworm was distributed in the western United States, but since 1999 eastward expansion has been observed. In corn, economic impact is caused by larval ear feeding. Information on western bean cutworm biology, ecology, and economic impact is relatively limited, and the development of economic injury levels (EILs) and economic thresholds (ETs) is required for more effective management. Studies during 2008-2011, across three ecoregions of Nebraska, sought to characterize western bean cutworm survival and development of EILs and ETs. Calculations of EILs and ETs incorporated the dynamics of corn price, management cost, and pest survival. The results from the current study demonstrated low larval survival of this species (1.51-12.82%). The mean yield loss from one western bean cutworm larva per plant was 945.52 kg/ha (15.08 bu/acre), based on 74,100 plants per ha. Economic thresholds are expressed as a percentage of plants with at least one egg mass. This study is the first study that explicitly incorporates variable management costs and crop values into western bean cutworm EIL calculations, and larval survival into ET calculations. PMID:23865192

  1. Comparison of growth, nitrogen metabolism and organ weights in piglets and rats fed on diets containing Phaseolus vulgaris beans.

    Science.gov (United States)

    Huisman, J; van der Poel, A F; van Leeuwen, P; Verstegen, M W

    1990-11-01

    The effects of lectins in the diet have been mainly studied in rats. An important question is whether results obtained in rats can be extrapolated to larger animals like the pig. Phaseolus vulgaris beans are rich in toxic lectins. Therefore a study was carried out to compare the effects of diets containing 200 g Phaseolus vulgaris beans (raw or toasted)/kg in rats and piglets. Live-weight gain, nitrogen digestibility and N balance were much lower in piglets than in rats fed on diets containing raw beans. Live-weight gain and N balance were slightly negative in the piglets. When toasted beans were given, live-weight gain and N balance values were reduced in piglets but hardly at all in rats. Giving raw beans caused hypertrophy of the pancreas in the rats but in piglets the weight of the pancreas was reduced. Spleen weight was depressed in the piglets but not in the rats. Weight of liver was not affected in either animal species. When toasted beans were given no effects on the weights of pancreas, spleen or liver were found in piglets or rats. It was concluded that the piglet is much more sensitive to antinutritional factors in the Phaseolus vulgaris bean than the rat. PMID:2265182

  2. Application of different techniques to identify the effects of irradiation on Brazilian beans after six months storage

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, A.L.C.H.; Mancini-Filho, J.; Delincee, H

    1998-06-01

    Four different techniques to detect the effect of irradiation in beans were investigated. Two types of Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macacar, were irradiated using a {sup 60}Co source with doses ranging from 0, 1.0 to 10.0 kGy. After 6 months storage at ambient temperature the detection tests were carried out. Firstly, germination tests showed markedly reduced root growth and almost totally retarded shoot elongation of irradiated beans as compared to non-irradiated beans. Secondly, DNA fragmentation was studied using a microgel electrophoresis. Irradiated cells produced typical comets with DNA fragments migrating towards the anode. DNA of non-irradiated cells exhibited a limited migration. Thirdly, electron spin resonance for detection of cellulose radicals was tested, since it was expected that these free radicals are quite stable in solid and dry foods. However, only in beans irradiated with 10 kGy a small signal could be detected. Fourthly, thermoluminescence, a method to analyze mineral debris adhering to food, turned out to be a good choice to detect irradiation effects in beans, even after 6 months of storage. The results indicate that three of these four techniques proposed, can be used to detect the effect of irradiation in these two varieties of Brazilian beans at a dose level useful for insect disinfestation (1 kGy)

  3. Viruses of faba bean (Vicia faba L.) in Morocco; surveying, identification, and ecological aspects.

    NARCIS (Netherlands)

    Fortass, M.

    1993-01-01

    A systematic virus survey covering the main areas where faba bean ( Viciafaba L.) is grown in Morocco was conducted in 1988 and 1990. From the 240 leaf samples collected on the basis of symptoms suggestive of virus infection from 52 fields, the following viruses were detected by means of electron mi

  4. Guided-Inquiry Labs Using Bean Beetles for Teaching the Scientific Method & Experimental Design

    Science.gov (United States)

    Schlueter, Mark A.; D'Costa, Allison R.

    2013-01-01

    Guided-inquiry lab activities with bean beetles ("Callosobruchus maculatus") teach students how to develop hypotheses, design experiments, identify experimental variables, collect and interpret data, and formulate conclusions. These activities provide students with real hands-on experiences and skills that reinforce their understanding of the…

  5. Yield, Grade, and Revenue of Double Cropped Green Bean and Sweet Corn with Cotton

    Science.gov (United States)

    Double cropping green bean, (Phaseolus vulgaris L.; GB) and sweet corn (Zea mays L.; SC) with cotton (Gossypium hirsutum L.; CT) can increase the economic return but can also be at risk of crop failure due to inclement weather patterns. The objectives were to: 1) quantify the yield of GB and SC doub...

  6. Effect of roasting on the carbohydrate composition of Coffea arabica beans.

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2003-01-01

    Coffee beans (arabica) with different degrees of roast were sequentially extracted with water (90 °C, 1 h), water (170 °C, 30 min), and 0.05 M NaOH (0 °C, 1 h). The amount and composition of polysaccharides, oligosaccharides and monosaccharides in the extracts and residues were analyzed. The results

  7. Rapid differentiation of Ghana cocoa beans by FT-NIR spectroscopy coupled with multivariate classification

    Science.gov (United States)

    Teye, Ernest; Huang, Xingyi; Dai, Huang; Chen, Quansheng

    2013-10-01

    Quick, accurate and reliable technique for discrimination of cocoa beans according to geographical origin is essential for quality control and traceability management. This current study presents the application of Near Infrared Spectroscopy technique and multivariate classification for the differentiation of Ghana cocoa beans. A total of 194 cocoa bean samples from seven cocoa growing regions were used. Principal component analysis (PCA) was used to extract relevant information from the spectral data and this gave visible cluster trends. The performance of four multivariate classification methods: Linear discriminant analysis (LDA), K-nearest neighbors (KNN), Back propagation artificial neural network (BPANN) and Support vector machine (SVM) were compared. The performances of the models were optimized by cross validation. The results revealed that; SVM model was superior to all the mathematical methods with a discrimination rate of 100% in both the training and prediction set after preprocessing with Mean centering (MC). BPANN had a discrimination rate of 99.23% for the training set and 96.88% for prediction set. While LDA model had 96.15% and 90.63% for the training and prediction sets respectively. KNN model had 75.01% for the training set and 72.31% for prediction set. The non-linear classification methods used were superior to the linear ones. Generally, the results revealed that NIR Spectroscopy coupled with SVM model could be used successfully to discriminate cocoa beans according to their geographical origins for effective quality assurance.

  8. Natural occurrence of alternariol and alternariol monomethyl ether in soya beans.

    Science.gov (United States)

    Oviedo, M S; Barros, G G; Chulze, S N; Ramirez, M L

    2012-08-01

    The natural occurrence of alternariol (AOH) and alternariol monomethyl ether (AME) in soya beans harvested in Argentina was evaluated. Both toxins were simultaneously detected by using HPLC analysis coupled with a solid phase extraction column clean-up. Characteristics of this in-house method such as accuracy, precision and detection and quantification limits were defined by means of recovery test with spiked soya bean samples. Out of 50 soya bean samples, 60% showed contamination with the mycotoxins analyzed; among them, 16% were only contaminated with AOH and 14% just with AME. Fifteen of the positive samples showed co-occurrence of both mycotoxins analyzed. AOH was detected in concentrations ranging from 25 to 211 ng/g, whereas AME was found in concentrations ranging from 62 to 1,153 ng/g. Although a limited number of samples were evaluated, this is the first report on the natural occurrence of Alternaria toxins in soya beans and is relevant from the point of view of animal public health.

  9. PHYSIOLOGICAL AND BIOCHEMICAL RESPONSES OF BUSH BEAN (PHASEOLUS VULGARIS) TO OZONE AND DROUGHT STRESS

    Science.gov (United States)

    Bush bean (Phaseolus vulgaris L.) plants were exposed to ozone (O3) episodes in open-top chambers in early and late season studies at Corvallis, Oregon. lants were grown in cultural systems that controlled plant water status. he 7-h seasonal mean O3 concentrations were 0.067 and ...

  10. INFLUENCE OF PEROXYACETYL NITRATE (PAN) ON WATER STRESS IN BEAN PLANTS

    Science.gov (United States)

    Bean plants (Phaseolus vulgaris) were exposed to 395 micrograms/cu m (0.08 ppm) peroxyacetyl nitrate (PAN) for 0.5 hr and subjected to drought stress following exposure. PAN influenced the plant water potential of PAN-sensitive 'Provider' resulting in visible wilting and reduced ...

  11. Micro-PIXE investigation of bean seeds to assist micronutrient biofortification

    Energy Technology Data Exchange (ETDEWEB)

    Cvitanich, Cristina, E-mail: crc@mb.au.dk [Centre for Carbohydrate Recognition and Signalling, Department of Molecular Biology Aarhus University, Aarhus (Denmark); Przybylowicz, Wojciech J.; Mesjasz-Przybylowicz, Jolanta [Materials Research Department, iThemba LABS, P.O. Box 722, Somerset West 7129 (South Africa); Blair, Matthew W.; Astudillo, Carolina [CIAT - Centro International de Agricultura Tropical, Cali (Colombia); Orlowska, Elzbieta; Jurkiewicz, Anna M.; Jensen, Erik O.; Stougaard, Jens [Centre for Carbohydrate Recognition and Signalling, Department of Molecular Biology Aarhus University, Aarhus (Denmark)

    2011-10-15

    This study compares the distribution and concentrations of micro- and macronutrients in different bean cultivars with the aim of optimizing the biofortification, a sustainable approach towards improving dietary quality. Micro-PIXE was used to reveal the distribution of Fe, Zn, Mn, Ca, P, S in seeds of common beans (Phaseolus vulgaris) and runner beans (Phaseolus coccineus). Average concentrations of elements in different tissues were obtained using ICP-AES. The highest concentrations of Zn in the studied beans were found in the embryonic axis, but an increased concentration of this element was also detected in the provascular bundles of the cotyledons. The first layer of cells surrounding provascular bundles accumulated high concentrations of Fe, while the next cell layer had an increased concentration of Mn. The analysis showed that the provascular bundles and the first cell layers surrounding them could have a significant role in the storage of important seed micronutrients - Zn, Fe, and Mn. This information has important implications for molecular biology studies aimed at seed biofortification.

  12. Effect of Superheated Steam Roasting on Radical Scavenging Activity and Phenolic Content of Robusta Coffee Beans

    Directory of Open Access Journals (Sweden)

    Ooi Ee Shan

    2015-04-01

    Full Text Available Robusta coffee is one of the coffee species grown in Malaysia. However, there is little research conducted on Robusta coffee beans as Arabica coffee is more popular among the consumers. Coffee is a rich source of antioxidants, therefore research on antioxidant properties of Robusta coffee beans is important to explore its market value. Nowadays, most of coffee analysis is on conventional roasted coffee which reduces their antioxidant properties. In this study, Robusta coffee beans (Coffea canephora were subjected to superheated steam roasting at 200, 220 and 240 ˚C for 20-40 min to obtain light, medium and dark roast. The effect of different roasting temperature and time on the total phenolic content (TPC and radical scavenging activity (RSA of Robusta coffee bean was investigated. Total phenolic content of coffee brews decreased with the increase of roasting degree due to the degradation of phenolic compounds. The highest phenolic content was found at 220 ˚C for 20 min. Meanwhile, brews extracted from light roasted coffee and medium roasted at 220 ˚C for 20 min showed a maximum scavenging activity than those from green coffee. Brews from dark roasted coffee showed lowest radical scavenging activity and total phenol content. Hence, based on the results from this study, the best superheated steam roasting condition is at 220 ˚C for 20 min (medium roast to achieve a maximum antioxidant activity and highest phenolic content.

  13. Design and Fabrication of a Hand Fed Motorized Oil Bean Slicing Machine

    Directory of Open Access Journals (Sweden)

    O. Oduma

    2016-09-01

    Full Text Available A hand fed African oil bean slicing machine which would be affordable, simple to operate and easy to maintain by local and/or small scale farmers and processors was designed and fabricated with locally available materials. The design was based on the engineering standard and specifications. Factors such as physical and mechanical properties of oil bean seeds, mechanical properties of construction materials, mach inability or deformability of construction materials, wear resistance, availability of power and cost of materials were considered in the fabrication of the device. 1hp electric motor powered the machine. The machine was tested for performance and it recorded an efficiency of 96.64% with minimal damage of the product. The bill of engineering measurement and evaluation revealed that the machine was fabricated at a total cost of ₦91,353.00. The device match the need of the oil bean processors and with adequate maintenance and/or management, it would ameliorate the difficulties involved in oil bean processing and, therefore boost the farmers’ production

  14. Mating disruption for control of Plodia interpunctella (Hübner) (Lepidoptera: Pyralidae) in dried beans

    Science.gov (United States)

    We compared the impact of mating disruption and aerosol space treatment using synergized pyrethrins on Indianmeal moth Plodia interpunctella in 2200 to 2900 m3 structures at a dried bean storage and processing facility in Stanislaus County, CA USA. Mating disruption was applied using a high volume a...

  15. Synthesis of Zinc Oxide Particles Using Green Beans as Biotemplating Agent

    International Nuclear Information System (INIS)

    A bio template-heating method using green beans for the synthesize of ZnO particles was developed. The results show that this method is able to synthesize ZnO particles with non uniform granular morphologies with average diameter of 0.4 m as characterized by field emission scanning electron microscopy (FESEM) and X-ray diffraction (XRD). (author)

  16. Soya bean tempe extracts show antibacterial activity against Bacillus cereus cells and spores

    NARCIS (Netherlands)

    Roubos-van den Hil, P.J.; Dalmas, E.; Nout, M.J.R.; Abee, T.

    2010-01-01

    Aims: Tempe, a Rhizopus ssp.-fermented soya bean food product, was investigated for bacteriostatic and/or bactericidal effects against cells and spores of the food-borne pathogen Bacillus cereus. Methods and results: Tempe extract showed a high antibacterial activity against B. cereus ATCC 14579 bas

  17. Shape and size of jatropha beans (Jatropha curcas L. during drying at different temperatures

    Directory of Open Access Journals (Sweden)

    Valdiney Cambuy Siqueira

    2013-12-01

    Full Text Available This study was carried out to study the physical properties of the jatropha beans over the drying under six air conditions, based on measurements of roundness, sphericity, volume, superficial area, projected area and surface/volume ratio. Jatropha beans with moisture content around 0.61 (decimal d.b. were subjected to thin-layer drying in oven with forced-air circulation under six temperature conditions (36, 45, 60, 75, 90 and 105 °C and relative humidity of 31.7; 19.6; 9.4; 4.8; 2.6 and 1.5% respectively, until reaching the moisture content of 0.11 ± 0.006 (decimal d. b.. The results showed that the necessary time for jatropha beans to reach the moisture content of 0.11 ± 0.006 (decimal d.b. were 1.5; 2.25; 3.0; 4.75; 6.75 and 12.0 h for the drying temperatures of 105, 90, 75, 60, 45 and 36 °C, respectively; and the reduction in the moisture content as well as the drying conditions promoted changes in the shape and reduced the size of the jatropha beans.

  18. Actual and potential nitrogen fixation in pea and field bean as affected by combined nitrogen

    NARCIS (Netherlands)

    Mil, van M.G.

    1981-01-01

    Actual nitrogen fixation of pea and field-bean plants, grown in soil in the open air, was determined as the acetylene reduction of nodulated roots. During the major part of the vegetative growth of these plants, actual nitrogen fixation was equal to the potential maximum nitrogenase activity of the

  19. Field level risk assessment for root-knot nematodes in lima beans

    Science.gov (United States)

    Southern Root-Knot Nematode (RKN), Meloidogyne incognita, is a major yield limiting pest in lima beans (Phaseolus lunatus). RKN are not evenly distributed through fields and population dynamics are fluid making whole field management challenging. The objectives of this research were to characterize ...

  20. Modelling the change in colour in broccoli and green beans during blanching

    NARCIS (Netherlands)

    Tijskens, L.M.M.; Schijvens, E.P.H.M.; Biekman, E.S.A.

    2001-01-01

    The green colour of vegetables changes considerably during heat treatments like blanching. Green beans from two different countries and growing seasons, and the stems and florets of broccoli were heat-treated from 40 up to 96 °C. The colour was monitored with the CIE-Lab system. Expressing the green

  1. Apis mellifera pollination improves agronomic productivity of anemophilous castor bean (Ricinus communis).

    Science.gov (United States)

    Rizzardo, Rômulo A G; Milfont, Marcelo O; Silva, Eva M S da; Freitas, Breno M

    2012-12-01

    Castor bean (Ricinus communis L.) is cultivated mainly for biodiesel production because of its oil-rich seeds; it is assumed to be an anemophylous species. But pollination deficit can lead to low productivity often attributed to other reasons. In this paper, we investigated pollination requirements, pollination mechanism, occurrence of pollination deficit, and the role of biotic pollinators in a large commercial plantation of castor bean. Our results show that R. communis bears a mixed breeding system favoring selfing by geitonogamy, although the wind promotes mostly outcrossing. We also found that the honey bee (Apis mellifera L.) foraging on castor bean can both transfer pollen from male to female flowers within the same raceme and boost the release of airborne pollen by male flowers. Both situations increase geitonogamy rates, raising significantly fruit set and seed yield. This is the first report of an animal foraging activity increasing seed yield in an anemophilous and geitonogamous crop and elucidates the role of biotic pollinators in castor bean reproduction.

  2. Kinetic study of Saponins B stability in navy beans under different processing conditions

    Science.gov (United States)

    Saponins are rich in the legumes which are known to provide many health benefits for human beings. Saponins B is the main component in the saponins group present in navy beans. The stability of saponins B during food processing is a key issue to evaluating the quality and nutrition of food products....

  3. Chemical composition and in vitro polysaccharide fermentation of different beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Campos-Vega, R; Reynoso-Camacho, R; Pedraza-Aboytes, G; Acosta-Gallegos, J A; Guzman-Maldonado, S H; Paredes-Lopez, O; Oomah, B D; Loarca-Piña, G

    2009-09-01

    The composition of bioactives including polysaccharide yield and resistant starch (RS) content of 4 raw and cooked bean (Phaseolus vulgaris L.) cultivars was evaluated. Polysaccharide was fermented in vitro by incubation with human gut flora under anaerobic conditions and short-chain fatty acids (SCFAs) production was compared at 6, 12, and 24 h by gas chromatography. Polysaccharide and soluble fiber contents increased upon cooking with stachyose as the major oligosaccharide. Cooked bean of cultivar Bayo Madero had the highest yield of polysaccharides (55%) and resistant starch (37%), followed by those of Negro 8025 (48% and 32%, respectively). Acetate was the most abundant SCFAs formed in all bean varieties. The concentration of SCFAs was cultivar-dependent; Bayo Madero and Negro 8025 displayed the highest concentration of butyrate (15 mmol/L), while Azufrado Higuera had the lowest and highest concentrations of acetate (39 mmol/L) and propionate (14 mmol/L), respectively. The results suggest that the common bean is an excellent source of polysaccharides that can be fermented in the colon and produce SCFAs, compounds previously reported to exert health benefits.

  4. Reaction of common bean lines and aggressiveness of Sclerotinia sclerotiorum isolates.

    Science.gov (United States)

    Silva, P H; Santos, J B; Lima, I A; Lara, L A C; Alves, F C

    2014-11-07

    The aims of this study were to evaluate the reaction of common bean lines to white mold, the aggressiveness of different Sclerotinia sclerotiorum isolates from various common bean production areas in Brazil, and comparison of the diallel and GGE (genotype main effect plus genotype-by-environment interaction) biplot analysis procedures via study of the line-by-isolate interaction. Eleven common bean (Phaseolus vulgaris) lines derived from 3 backcross populations were used. Field experiments were performed in the experimental area of the Departamento de Biologia of the Universidade Federal de Lavras, Lavras, MG, Brazil, in the 2011 and 2012 dry crop season and 2011 winter crop season through a randomized block design with 3 replications. This study was also set up in a greenhouse. Inoculations were performed 28 days after sowing by means of the straw test method. The reaction of the bean lines to white mold was assessed according to a diagrammatic scale from 1 (plant without symptoms) to 9 (dead plant). Estimations of general reaction capacity (lines) and general aggressiveness capacity (isolates) indicated different horizontal levels of resistance in the lines and levels of aggressiveness in the isolates. Therefore, it was possible to select more resistant lines and foresee those crosses that are the most promising for increasing the level of resistance. It was also possible to identify the most aggressive isolates that were more efficient in distinguishing the lines. Both diallel and GGE biplot analyses were useful in identifying the genotypic values of lines and isolates.

  5. Influence of Roasting on the Antioxidant Activity and HMF Formation of a Cocoa Bean Model Systems

    NARCIS (Netherlands)

    Oliviero, T.; Capuano, E.; Cämmerer, B.; Fogliano, V.

    2009-01-01

    During the roasting of cocoa beans chemical reactions lead to the formation of Maillard reaction (MR) products and to the degradation of catechin-containing compounds, which are very abundant in these seeds. To study the modifications occurring during thermal treatment of fat and antioxidant rich fo

  6. Design of Green Beans Detector%青豆检测机的设计

    Institute of Scientific and Technical Information of China (English)

    李春胜; 王蔚; 李娜

    2012-01-01

    以透明皮带为载体将被检测的青豆送入具有透射作用的冷光源与成像箱之间,使冷光源对青豆进行透射,经过冷光源透射的青豆在相机内成像,使青豆的内容物清晰的显现在图像中,通过图像识别将不合格青豆清除,达到检测目的.%The paper takes transparent belt as the carrier to bring the testing green beans into the place between cold light source and imaging box with transmission role, then make the cold light source conduct transmission to the green beans, and then form the image, so that the contents of green beans can be clearly shown in the image. Through image recognition we will clear the fail beans and get testing purposes.

  7. Simultaneous determination of organophosphorous insecticides in bean samples by gas chromatography - flame photometric detection

    Directory of Open Access Journals (Sweden)

    Keyller Bastos Borges

    2014-02-01

    Full Text Available The indiscriminate use of organophosphorous pesticides (OPPs in crops may leave residues in food and may cause poisoning in the applicators. A method was developed for the determination of five OPPs in bean samples by Gas Chromatography-Flame Photometric Detection (GC-FPD. Validation parameters comprised linearity between 0.24 and 8.56 μg g-1 (r = 0.9985 for diazinon; 0.23 and 8.14 μg g-1 (r = 0.9959 for methyl parathion; 0.28 and 10.25 μg g-1 (r = 0.9987 for methyl pirimiphos; 0.52 and 18.87 μg g-1 (r = 0.9955 for malathion; 0.86 and 13.67 μg g-1 (r = 0.9919 for ethion. The limits of quantification (equal to those of detection were the lowest rates of ranges mentioned above for each compound. The extraction method showed approximately 95% recovery, with CV% < 15%. Although twenty-eight bean samples obtained in the southern region of the state of Minas Gerais,Brazil, were analyzed, they failed to match any of the OPPs under analysis. The absence of OPPs in the samples could be due to the degradation that occurred between the use of OPPs and bean commercialization, levels below the detection /quantification limits and the non-use of OPPs in bean cultivation.

  8. Uptake studies of environmentally hazardous {sup 51}Cr in Mung beans

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Anupam [Department of Botany, University of Calcutta, 35, Ballygunge Circular Road, Kolkata 700019 (India); Nayak, Dalia [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India); Chakrabortty, Dipanwita [Sikkim Manipal University, A 15, Paryavaran Complex, New Delhi 110030 (India); Lahiri, Susanta [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India)], E-mail: susanta.lahiri@saha.ac.in

    2008-01-15

    Attempt has been made to study the accumulation behaviour of a common plant, Mung bean (Vigna radiata) towards Cr(III) and Cr(VI) to have an insight on the migration and bio-magnification of Cr. For this purpose healthy germinated Mung bean seeds were sown in the sand in the presence of Hoagland's nutrient solution containing measured amount of K{sub 2}{sup 51}Cr{sub 2}O{sub 7} and {sup 51}Cr(NO{sub 3}){sub 3}.9H{sub 2}O. Growth rate was also studied in the presence and absence of phosphate salts in the medium. It has been found that the transfer of chromium from soil to plant is significantly low (maximum 5% for both Cr(III) and Cr(VI)). Maximum accumulation of Cr occurs in the root with respect to the total chromium accumulation by the plant. Other parts of the Mung bean plant, e.g. cotyledons, shoot and leaves, show negligible accumulation. Therefore, the chance of direct intake of Cr through food as well as through the grazing animals to human body is less. - The chance of bio-magnification of Cr(III) or Cr(VI) to human body via direct or indirect intake of Mung bean is negligible.

  9. Virulence of Macrophomina phaseolina isolates in common bean (Phaseolus vulgaris) genotypes

    Science.gov (United States)

    Charcoal rot caused by Macrophomina phaseolina (Tassi) Goid, is an important disease in common beans (Phaseolus vulgaris) in the dry and warmer areas of Puerto Rico and in much of the tropics and subtropics worldwide. The virulence of three isolates from Isabela (Mph-ISA-TARS), Juana Diaz (Mph-JD) a...

  10. Genome-wide association studies of morphological and agronomical traits in cultivated tepary beans (Phaseolus acutifolius)

    Science.gov (United States)

    Tepary bean (Phaseolus acutifolius A. Gray) is adapted to high temperature arid agroecological zones. In light of the ongoing and rapid changes in the world climate, the evaluation and development of alternate grain legume species that have similar nutritional and culinary characteristics as common ...

  11. Dynamics of a Novel Highly Repetitive CACTA Family in Common Bean (Phaseolus vulgaris).

    Science.gov (United States)

    Gao, Dongying; Zhao, Dongyan; Abernathy, Brian; Iwata-Otsubo, Aiko; Herrera-Estrella, Alfredo; Jiang, Ning; Jackson, Scott A

    2016-01-01

    Transposons are ubiquitous genomic components that play pivotal roles in plant gene and genome evolution. We analyzed two genome sequences of common bean (Phaseolus vulgaris) and identified a new CACTA transposon family named pvCACTA1. The family is extremely abundant, as more than 12,000 pvCACTA1 elements were found. To our knowledge, this is the most abundant CACTA family reported thus far. The computational and fluorescence in situ hybridization (FISH) analyses indicated that the pvCACTA1 elements were concentrated in terminal regions of chromosomes and frequently generated AT-rich 3 bp target site duplications (TSD, WWW, W is A or T). Comparative analysis of the common bean genomes from two domesticated genetic pools revealed that new insertions or excisions of pvCACTA1 elements occurred after the divergence of the two common beans, and some of the polymorphic elements likely resulted in variation in gene sequences. pvCACTA1 elements were detected in related species but not outside the Phaseolus genus. We calculated the molecular evolutionary rate of pvCACTA1 transposons using orthologous elements that indicated that most transposition events likely occurred before the divergence of the two gene pools. These results reveal unique features and evolution of this new transposon family in the common bean genome. PMID:27185400

  12. A study on Maruca vitrata infestation of Yard-long beans (Vigna unguiculata subspecies sesquipedalis).

    Science.gov (United States)

    Jayasinghe, R C; Premachandra, W T S Dammini; Neilson, Roy

    2015-09-01

    Globally, Maruca vitrata (Geyer) is a serious yield constraint on food legumes including Yard-long bean (Vigna unguiculata subspecies sesquipedalis). However, there is a dearth of information on its damage potential, distribution and population dynamics in Yard-long beans. In the present study, the level of M. vitrata larval infestation on flowers and pods of Yard-long beans in Sri Lanka was determined with respect to three consecutive cropping seasons, Yala, Off and Maha. Results indicated that larval infestation and abundance varied with developmental stage of flowers and pods, cropping season and their combined interactive effects. Flowers of Yard-long beans were more prone to M. vitrata larval attack compared to pods. Abundance and level of infestation of M. vitrata varied with plant parts, having a ranking of flower buds (highest) > open flowers > mature pods > immature pods (lowest). Peak infestation was observed six and eight weeks after planting on flowers and pods, respectively. Among the three cropping seasons, M. vitrata infestation was found to be higher during Maha and Off seasons compared to Yala. The findings of this study contribute to the identified knowledge gap regarding the field biology of an acknowledged important pest, M. vitrata, in a previously understudied crop in Sri Lanka. PMID:27441212

  13. A study on Maruca vitrata infestation of Yard-long beans (Vigna unguiculata subspecies sesquipedalis).

    Science.gov (United States)

    Jayasinghe, R C; Premachandra, W T S Dammini; Neilson, Roy

    2015-09-01

    Globally, Maruca vitrata (Geyer) is a serious yield constraint on food legumes including Yard-long bean (Vigna unguiculata subspecies sesquipedalis). However, there is a dearth of information on its damage potential, distribution and population dynamics in Yard-long beans. In the present study, the level of M. vitrata larval infestation on flowers and pods of Yard-long beans in Sri Lanka was determined with respect to three consecutive cropping seasons, Yala, Off and Maha. Results indicated that larval infestation and abundance varied with developmental stage of flowers and pods, cropping season and their combined interactive effects. Flowers of Yard-long beans were more prone to M. vitrata larval attack compared to pods. Abundance and level of infestation of M. vitrata varied with plant parts, having a ranking of flower buds (highest) > open flowers > mature pods > immature pods (lowest). Peak infestation was observed six and eight weeks after planting on flowers and pods, respectively. Among the three cropping seasons, M. vitrata infestation was found to be higher during Maha and Off seasons compared to Yala. The findings of this study contribute to the identified knowledge gap regarding the field biology of an acknowledged important pest, M. vitrata, in a previously understudied crop in Sri Lanka.

  14. Profitability of soybean crop, corn and bean grown under conditions of upland

    Directory of Open Access Journals (Sweden)

    Gisele Aparecida Vivan

    2015-10-01

    Full Text Available The climate, particularly water availability, presents itself as a limiting factor to obtain yields close to the productive potential of crops, being the major cause of interannual variability in grain production and income in different regions of Brazil. In this context, this study aims to identify and characterize the effect of water stress on the yield of soybean crops, maize and beans and on the costs, gross income and profit from these in the region of Santiago, RS. Therefore, we used the calibrated DSSAT system and validated for the conditions and cultures being studied, and used the historical period 1961-2010 to generate production data for each crop. Data were adimensionalizados building on the potential production of each culture, establishing frequency histogram for assessing the risk of production loss in respect of each crop. Later they used historical data series costs and selling prices of crops in the same study period for performing simplified economic analysis. In terms of production, bean, corn and soybeans in 65%, 50% and 41% of the years, respectively, achieved yields below 50% of the potential of these crops. In economic terms, the biggest cost; gross income and average income are associated with corn, followed by the bean crop and soybean, respectively. The three crops, soybean, corn, beans, showed significant reductions in production and consequently profit depending on water restriction.

  15. Nutrient composition of selected newly bred and established mung bean varieties

    NARCIS (Netherlands)

    Dahiya, P.K.; Linnemann, A.R.; Nout, M.J.R.; Boekel, van M.A.J.S.; Grewal, R.B.

    2013-01-01

    Seven newly bred and three established varieties of mung bean were analysed for proximate composition, minerals, anti-nutrients and in vitro mineral accessibility. They contained 18–23 g protein, 4.0–5.6 g crude fibre and 2.5–4.1 g ash per 100 g dry sample. Iron, zinc, calcium, sodium and potassium

  16. Cadmium accumulation by jack-bean and sorghum in hydroponic culture.

    Science.gov (United States)

    Francato Zancheta, Ariana Carramaschi; De Abreu, Cleide Aparecida; Zambrosi, Fernando César Bachiega; de Magalhães Erismann, Norma; Andrade Lagôa, Ana Maria Magalhães

    2015-01-01

    Among the technologies used to recuperate cadmium (Cd) contaminated soils, phytoextraction are particularly important, where the selection of suitable plants is critical to the success of the soil remediation. Thus, the objectives of this study were to evaluate the responses of jack-bean and sorghum to Cd supply and to quantify Cd accumulation by these species grown in hydroponic culture. The plants were subjected to 0, 15, 30, or 60 μmol Cd L(-1) in the nutrient solution, and gas exchange, plant growth and Cd accumulation were measured at 25 days after starting Cd treatments. The Cd supply severely reduced growth of shoots and roots in both species. In jack-bean, Cd decreased photosynthesis by 56-86%, stomatal conductance by 59-85% and transpiration by 48-80%. The concentrations and amounts of Cd accumulated in the plant tissues were proportional to the metal supply in the nutrient solution. Sorghum was more tolerant than jack-bean to Cd toxicity, but the latter showed a greater metal concentration and accumulation in the shoot. Therefore, jack-bean would be more suitable than sorghum for use in Cd phytoremediation programs based on phytoextraction.

  17. The mitochondrial genome of the western bean cutworm, Striacosta albicosta (Lepidoptera: Noctuidae)

    Science.gov (United States)

    The complete 15,553 bp mitochondrial genome of the western bean cutworm, Stricosta albicosta, (Lepidoptera: Noctuidae) was assembled from next generation sequencing data. Annotation showed that 13 predicted protein coding genes (PCGs), 22 tRNAs, and 2 rRNAs have an order and orientation typical of ...

  18. Fungal endophytes in germinated seeds of the common bean, Phaseolus vulgaris

    Science.gov (United States)

    The common bean (Phaseolus vulgaris) is the most important food legume in the world, but its production is severely limited by several biotic and abiotic stressors. In search of a sustainable solution to this problem, we conducted a survey of fungal endophytes in 582 germinated seeds belonging to 11...

  19. Growth characteristics of mung beans and water convolvuluses exposed to 425-MHz electromagnetic fields.

    Science.gov (United States)

    Jinapang, Peeraya; Prakob, Panida; Wongwattananard, Pongtorn; Islam, Naz E; Kirawanich, Phumin

    2010-10-01

    Effects of high-frequency, continuous wave (CW) electromagnetic fields on mung beans (Vigna radiata L.) and water convolvuluses (Ipomoea aquatica Forssk.) were studied at different growth stages (pre-sown seed and early seedling). Specifically, the effects of the electromagnetic source's power and duration (defined as power-duration level) on the growth of the two species were studied. Mung beans and water convolvuluses were exposed to electromagnetic fields inside a specially designed chamber for optimum field absorption, and the responses of the seeds to a constant frequency at various power levels and durations of exposure were monitored. The frequency used in the experiments was 425 MHz, the field strengths were 1 mW, 100 mW, and 10 W, and the exposure durations were 1, 2, and 4 h. Results show that germination enhancement is optimum for the mung beans at 100 mW/1 h power-duration level, while for water convolvuluses the optimum germination power-duration level was 1 mW/2 h. When both seed types were exposed at the early sprouting phase with their respective optimum power-duration levels for optimum seed growth, water convolvuluses showed growth enhancement while mung bean sprouts showed no effects. Water content analysis of the seeds suggests thermal effects only at higher field strength.

  20. Navy bean flour particle size and protein content affect cake baking and batter quality

    Science.gov (United States)

    There is a great demand for wheat alternatives in foods, particularly baked goods, as gluten sensitivity increases. Baked goods such as cakes have wheat flour as a major ingredient, which is rich in gluten protein. Bean proteins do not have gluten, and are a good source of soluble fiber, B-vitamins,...

  1. Jasmonic acid and herbivory differentially induce carnivore-attracting plant volatiles in Lima bean plants

    NARCIS (Netherlands)

    Dicke, M.; Gols, R.; Ludeking, D.; Posthumus, M.A.

    1999-01-01

    Lima bean plants respond to feeding damage of two-spotted spider mites (Tetranychus urticae) with the emission of a complex blend of volatiles that are products of several different biosynthetic pathways. These volatiles attract the carnivorous mite Phytoseiulus persimilis, a specialist predator of

  2. CULTIVAR RELEASE - BRS Esplendor – Common bean cultivar with black grain, upright growth and disease resistance

    Directory of Open Access Journals (Sweden)

    Joaquim Geraldo Cáprio da Costa

    2011-01-01

    Full Text Available BRS Esplendor is a common bean cultivar with black grain, suitable for 12 Brazilian states. The mean productivity is 2,156 kg ha-1, by 7.5 % higher than of controls, has a high yield potential (4,120 kg ha-1, upright growth, high tolerance to lodging and high resistance to anthracnose, fusarium wilt and common bacterial blight.

  3. Fluorescence action spectra of algae and bean leaves at room and at liquid nitrogen temperatures

    NARCIS (Netherlands)

    Goedheer, J.C.

    1965-01-01

    Fluorescence action spectra were determined, both at room temperature and at liquid nitrogen temperature, with various blue-green, red and green algae, and greening bean leaves. The action spectra of algae were established with samples of low light absorption as well as dense samples. Fluorescence

  4. Evaluation of common bean lines for adaptation to high temperatures in Honduras

    Science.gov (United States)

    As in other regions worldwide, common bean (Phaseolus vulgaris L.) production in Central America and the Caribbean (CA/C) region is threatened by effects of climate change including increasing temperatures and drought due to variable rainfall patterns. One of the main alternatives for increasing ada...

  5. Application of extruded broken bean flour for formulation of gluten-free cake blends

    Directory of Open Access Journals (Sweden)

    Luciana de Oliveira Froes Gomes

    2015-06-01

    Full Text Available The aim of this study was to determine the physical and microbiological characteristics of extruded broken beans flour, in addition to developing mixtures for gluten-free cake with these flours, evaluating their technological and sensory quality. Gluten-free formulations were prepared with 45%, 60% and 75% of extruded broken beans. All analyzes of the flours and mixtures for cakes were performed according to standard techniques found in the literature. Sensory analyzes of cakes applied the 9-point structured hedonic scale. Results were submitted to variance analysis and comparison of means test (Tukey, p<0.05. The use of extruded broken beans improved the water absorbed and water solubility index of the mixtures for gluten-free cake, and for the lower viscosity and retrogradation when compared to the standard formulation. All cakes were accepted (rate ≥ 7 for all the analyzed attributes. From the technological and sensory standpoints, the development of gluten-free cake mixtures is feasible with up to 75% of extruded broken beans.

  6. Treatment of sugar beet extraction juice stillage by natural coagulants extracted from common bean

    Directory of Open Access Journals (Sweden)

    Prodanović Jelena M.

    2015-01-01

    Full Text Available Distillery wastewaters have a great pollution potential, and pollution caused by them is one of the most critical environmental issues. This study is concerned with the coagulation efficiency of a new, environmental friendly, natural coagulant extracted from common bean seeds in the primary treatment of distillery wastewater in the bioethanol production from sugar beet juice. Active coagulation components were extracted from ground seeds of common bean with 0.5 mol/L NaCl. The obtained raw extract was used as a coagulant. The coagulation efficiency was measured by jar test at different pH values of wastewater, and a decrease in organic matter content was determined. The experiments confirmed that natural coagulant from common bean could be successfully used for the treatment of extraction juice distillery wastewater. The highest coagulation efficiencies were achieved at the pH 5.2 with a coagulant dose of 30 mL/L, and at the pH 8.5 with a coagulant dose of 5 mL/L, and they were 64.71% and 68.75% respectively. These encouraging results indicate that natural coagulant from common bean seeds is a potential alternative to conventional chemical coagulant/flocculant agents for treatment of wastewaters.[Projekat Ministarstva nauke Republike Srbije, br. III 43005

  7. Phytotoxicity, Uptake, and Translocation of Fluorescent Carbon Dots in Mung Bean Plants.

    Science.gov (United States)

    Li, Wei; Zheng, Yinjian; Zhang, Haoran; Liu, Zulang; Su, Wei; Chen, Shi; Liu, Yingliang; Zhuang, Jianle; Lei, Bingfu

    2016-08-10

    Fluorescent carbon dots (CDs) have been widely studied in bioscience and bioimaging, but the effect of CDs on plants has been rarely studied. Herein, mung bean was adopted as a model plant to study the phytotoxicity, uptake, and translocation of red emissive CDs in plants. The incubation with CDs at a concentration range from 0.1 to 1.0 mg/mL induced physiological response of mung bean plant and imposed no phytotoxicity on mung bean growth. The lengths of the root and stem presented an increasing trend up to the treatment of 0.4 mg/mL. Confocal imaging showed that CDs were transferred from the roots to the stems and leaves by the vascular system through the apoplastic pathway. The uptake kinetics study was performed and demonstrated that the CDs were abundantly incubated by mung beans during both germination and growth periods. Furthermore, in vivo visualization of CDs provides potential for their successful application as delivery vehicles in plants based on the unique optical properties. PMID:27425200

  8. Organic matter and soil water content influence on BRS 188 castor bean growth

    Energy Technology Data Exchange (ETDEWEB)

    Lacerda, Rogerio Dantas de; Araujo, Ester Luiz de; Nascimento, Elka Costa Santos; Barros Junior, Genival [Universidade Federal de Campina Grande (UFCG), PB (Brazil); Guerra, Hugo O. Carvallo; Chaves, Lucia Helena G. [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    The castor bean culture has been highlighted due to the several applications of its oil, which constitutes one of the best row materials for biodiesel manufacturing, and the base for several other industrial products. The objective of the present work was to study the effect of different soil water and soil organic matter on the castor bean growth. The experiment was conducted from April to August 2006 under greenhouse conditions using a randomized block 2x4 factorial design with two soil organic mater content (5.0 g.kg{sup -1} e 25.0 g.kg{sup -1}), four levels of available water (100, 90, 80 e 70% ) and three replicates. For this, 24 plastic containers, 75 kg capacity, were used on which was grown one plant 120 days after the seedling. At regular intervals the plant height was measured and the results analyzed statistically. For the qualitative treatments (with and without organic matter) the treatment means were compared through the Tukey test. For the quantitative ones (water levels) were used regressions. The castor bean cultivar height was significantly influenced by the organic matter content only after 80 days. Castor bean height increased significantly with the soil water content after 40 days of growing. (author)

  9. Comparison of two soya bean simulation models under climate change : II Application of climate change scenarios

    NARCIS (Netherlands)

    Wolf, J.

    2002-01-01

    The effects of climate change (for 2050 compared to ambient climate) and change in climatic variability on soya bean growth and production at 3 sites in the EU have been calculated. These calculations have been done with both a simple growth model, SOYBEANW, and a comprehensive model, CROPGRO. Compa

  10. Determining radio frequency heating uniformity of mixed beans during disinfestation treatments

    Science.gov (United States)

    Since chickpeas and lentils are difficulty to artificially infest with live insects for radio frequency (RF) treatment validation, black-eyed peas and mung beans were selected to infest with insects before mixing with chickpeas and lentils. Temperature difference between black-eyed pea and chickpea ...

  11. Biocontrol of seed pathogens and growth promotion of common bean seedlings by Trichoderma harzianum

    Directory of Open Access Journals (Sweden)

    Daniel Diego Costa Carvalho

    2011-08-01

    Full Text Available The objective of this work was to evaluate isolates of Trichoderma harzianum regarding biocontrol of common bean seed-borne pathogens, plant growth promotion, and rhizosphere competence. Five isolates of T. harzianum were evaluated and compared with commercial isolate (Ecotrich, Carboxin+Thiram, and an absolute control. Bean seeds of the cultivar Jalo Precoce, contaminated with Aspergillus, Cladosporium, and Sclerotinia sclerotiorum, were microbiolized with antagonists, and seed health tests were carried out. Isolates were evaluated on autoclaved substrate and in field conditions. Ten days after sowing (DAS, plant length was measured. To test rhizosphere competence, isolates were applied in boxes containing autoclaved washed sand, and root colonization was evaluated at 10 DAS, using five plants per box. The most effective isolates in the seed health tests were: CEN287 and CEN289 to control Aspergillus; the commercial isolate to control Cladosporium; and CEN287 and CEN316 to control S. sclerotiorum. Isolates CEN289 and CEN290 promoted bean growth in greenhouse and field. Seed treatment with T. harzianum reduces the incidence of Aspergillus, Cladosporium, and S. sclerotiorum in 'Jalo Precoce' common bean seeds.

  12. Formation of cereulide and enterotoxins by Bacillus cereus in fermented African locust beans

    DEFF Research Database (Denmark)

    Thorsen, Line; Azokpota, Paulin; Munk Hansen, Bjarne;

    2011-01-01

    Afitin, iru and sonru are three spontaneously fermented African locust bean Benin condiments. The fermentation processes are exothermic, with temperatures mostly being above 40 °C. A total of 19 predominant Bacillus cereus isolates from afitin, iru and sonru, were investigated. The enterotoxin ge...

  13. An Evaluation of the NetBeans Module System as a Product line Implementation Technology

    DEFF Research Database (Denmark)

    Mærsk-Møller, Hans Martin; Jørgensen, Bo Nørregaard

    2011-01-01

    to standalone applications, these platforms and their facilities have not been investigated scientifically from a SPLE perspective. This paper remedies the situation by providing an evaluation and a discussion of the module system provided by NetBeans Platform (a RCP). The paper contributes to the catalog...

  14. Variability of nutritional and cooking quality in bean (Phaseolus vulgaris L) as a function of genotype.

    Science.gov (United States)

    Saha, Supradip; Singh, Gyanendra; Mahajan, V; Gupta, H S

    2009-06-01

    Screening of natural biodiversity for the better quality traits are of prime importance for quality breeding programs. The objective of this investigation was to select candidate accession of bean having high concentrations of protein as well as macro and micro minerals with good cooking quality for use as parents in breeding programme for these compounds. Thirty-five accessions of bean (Phaseolus vulgaris L) were field grown and their seeds were analyzed for their cooking quality and nutritional composition. Wide variations were observed in most of the measurements e.g. protein (18.7-26.2%), iron (79.4-137.6 ppm) and hardness after cooking (4.65-9.88 Kg) suggesting that there are considerable levels of genetic diversity. Across all accessions the concentration of potassium was negatively correlated with protein (r = -0.43, P XXX and XXXI. Bean line XIX contains high protein (24.9%) with high zinc (33.3 ppm) and highest iron (137.6 ppm), but it has high hardness after cooking (7.32 kg). Four clusters were computed by cluster analysis that explained quite a good variation in the traits. The great variability for these attributes suggests that these selected accessions may be useful as parents in hybridization programs to produce bean with value-added traits. This information was also potentially useful for pulse breeders working on the development of new varieties.

  15. Differences in common bean rhizobial populations associated with soil tillage management in southern Brazil

    NARCIS (Netherlands)

    Kaschuk, G.; Hungria, M.; Santos, J.C.P.; Berton-Junior, J.F.

    2006-01-01

    Progressive adoption of no-tillage (NT) agriculture in the tropics is finally reversing physical, chemical, and biological erosion of soil and in Brazil, an estimated 19 Mha are now devoted to NT. Common bean (Phaseolus vulgaris L.) is a main component of Brazilian agriculture, and enhancement of yi

  16. Consumption Habits and Innovation Potential of Mung Bean Foods in Hisar District of Haryana State, India

    NARCIS (Netherlands)

    Dahiya, P.K.; Linnemann, A.R.; Nout, M.J.R.; Boekel, van M.A.J.S.; Khetarpaul, N.K.; Grewal, R.B.

    2014-01-01

    Consumption habits for mung bean foods were assessed by the free word association method and interview techniques. Four groups of closely related products and perceived quality were revealed. The largest group comprised sweets and snacks, which were associated with unhealthiness, expensiveness and s

  17. 黑豆面包的研制%Research on the Production of Black Bean Bread

    Institute of Scientific and Technical Information of China (English)

    潘艳; 冷静; 张昕; 徐淼

    2014-01-01

    The direct fermentation method was used to produce black bean bread with the low-gluten flour being the main ingredient, and black beans, sugar, yeast, salt and bread improver being the excipients. An optimal formula was determined by using the response surface method, which consisted of sugar 63 g, black beans 10.7 g, and yeast 7.5 g (flour 300 g). The black bean bread produced in this way has pure flavor, and the tissue was fine.%采用一次发酵工艺生产黑豆面包,主要原料为低筋面粉,添加黑豆、白砂糖、酵母、盐、面包改良剂等辅料,通过响应面方法确定黑豆面包的最佳工艺配方。结果显示:黑豆面包的最佳工艺为:白砂糖量为63 g、黑豆为10.7 g、酵母量为7.5 g(以面粉300 g计)。此工艺生产出的黑豆面包风味纯正、组织状态良好。

  18. Biogenic amine profile in unripe Arabica coffee beans processed according to dry and wet methods.

    Science.gov (United States)

    Dias, Eduardo C; Pereira, Rosemary G F A; Borém, Flávio M; Mendes, Eulália; de Lima, Renato R; Fernandes, José O; Casal, Susana

    2012-04-25

    Immature coffee fruit processing contributes to a high amount of defective beans, which determines a significant amount of low-quality coffee sold in the Brazilian internal market. Unripe bean processing was tested, taking the levels of bioactive amines as criteria for evaluating the extent of fermentation and establishing the differences between processing methods. The beans were processed by the dry method after being mechanically depulped immediately after harvest or after a 12 h resting period in a dry pile or immersed in water. Seven bioactive amines were quantified: putrescine, spermine, spermidine, serotonin, cadaverine, histamine, and tyramine, with global amounts ranging from 71.8 to 80.3 mg/kg. The levels of spermine and spermidine were lower in the unripe depulped coffee than in the natural coffee. The specific conditions of dry and wet processing also influenced cadaverine levels, and histamine was reduced in unripe depulped coffee. A resting period of 12 h does not induce significant alteration on the beans and can be improved if performed in water. These results confirm that peeling immature coffee can decrease fermentation processes while providing more uniform drying, thus reducing the number of defects and potentially increasing beverage quality. PMID:22429054

  19. Locke's Children? Rousseau and the Beans (Beings?) of the Colonial Learner

    Science.gov (United States)

    Papastephanou, Marianna; Gregoriou, Zelia

    2014-01-01

    Rousseau's story about Emile having his first moral lesson in property rights by planting beans in a garden plot has educationally been discussed from various perspectives. What remains unexplored in such readings, however, is the connection of the theory of the natural learner with the Lockean rationalization of appropriation of land through…

  20. Influence of stomatic aperture on photosynthetic activity of bean-seedlings leaves

    International Nuclear Information System (INIS)

    The present paper contains the data of photosynthetic activity and stomatic aperture of bean-seedlings Ieaves, and the relations obtained with both results. It has been observed that the product of photosynthetic activity by the resistance; to transpiration measured by a promoter ia a constant, between some limits. (Author) 45 refs

  1. Influence of bitter lupin on consumption and digestibility in organic dairy cattle soya bean free diets

    Directory of Open Access Journals (Sweden)

    R. Tocci

    2010-04-01

    Full Text Available One of the main principles of organic husbandry is that animal feed must be GMO free, and soya bean is well-known as a high risk GMO alimentary source. About 25 dry dairy cattle of the Italian Holstein breed, from the Cooperativa Emilio Sereni of Borgo S. Lorenzo (FI, were fed in two successive diets: the first with extruded soya bean (A, and the second in which bitter lupin, faba bean and proteinic pea substituted the soya bean (B. We evaluated both the consumption and the apparent digestibility (using acid insoluble ash as internal marker of the two diets, repeating the trial twice. The presence of bitter lupin did not influence either the consumption of other feed, or the faecal water content. The apparent digestibility of the organic matter resulted satisfactory in both the diets, but was significantly higher in diet (A than in diet (B (71,6% vs 67,3%. In conclusion, even though we wish the cultivation of sweet lupin would be increase in Italy, we retain that also bitter lupin (mixed with other feed to increase the palatability could be used as alternative protein source in dairy cattle diets.

  2. Proximate, functional and pasting properties of FARO 44 rice, African yam bean and brown cowpea seeds composite flour

    Directory of Open Access Journals (Sweden)

    M.O. Iwe

    2016-12-01

    Full Text Available FARO 44 rice, brown cowpea and African yam bean seeds were processed into flours and their proximate, functional and pasting properties were assessed. Functional properties—loose bulk density, packed bulk density, water absorption capacity, oil absorption capacity, emulsion capacity, foam capacity, gelation capacity and swelling index ranged from 0.63 to 0.69 g/ml, 0.84 to 1.00 g/ml, 0.63 to 1.32%, 0.46 to 1.48%, 42.50 to 56.78%, 10.40 to 18.17%, 50.93 to 57.90°C and 0.45 to 0.67, respectively. Proximate and amylose composition ranged as follows; Moisture: 8% (75% rice:25% African yam bean to 14% (100% rice; Protein: 12.86% (100% wheat to 28.13% (50% rice:50% African yam bean; Fat: 1.64% (100% rice to 5.79% (100% cowpea; Ash: 1% (100% cowpea, 75% rice:25% African yam bean, 50% rice:50% African yam bean to 1.97% (25% rice:75% African yam bean; Crude fibre: 0.95% (100% wheat to 6.27% (100% African yam bean; Carbohydrate: 52.62% (50% rice:50% African yam bean to 72.58% (100% wheat and Amylose: 17.13% (100% rice to 28.07% (100% African yam bean. Pasting properties—peak, trough, breakdown, final, peak time and pasting temperature ranged from 128.50 to 245 RVU, 85.08 to 159.25 RVU, 22.08 to 106.75 RVU, 123.58 to 294.33 RVU, 33.50 to 135.08 RVU, 5.18 to 5.92 min and 79.95 to 84.75°C.

  3. RESPONSE OF THE JAMAICA-BEAN-CORN POLYCULTURE CROPPING SYSTEM TO THREE TREATMENTS OF FERTILIZATION IN VILLAFLORES, CHIAPAS, MEXICO

    Directory of Open Access Journals (Sweden)

    Rosey Obet Ruiz-González

    2014-07-01

    Full Text Available The corn (Zeamays Linneo and bean (Phaseolusvulgaris Linneo are the economic basis to meet the basic needs of rural families, but these crops are no longer economically viable for various reasons and jeopardize the family livelihood and productive alternatives are needed to improve the rural economy. The research was conducted during the spring-summer cycle from 1999 to 2000 in Villaflores , Chiapas, in order to evaluate the response of polyculturejamaica-bean-corn three fertilization treatments ( 00-00-00 , 60-60-60 and 120-60-60 . The experimental design was random blocks with three fertilization treatments, seven patterns of crops, and three replications and performance in the three plant species and vegetative variables were evaluated. With the data an ANOVA was performed and the treatment means were compared with the test of Tukey (p ≤ 0.05. The best vegetative response of the jamaica was to associate it with beans and corn with 60-60 fertilization treatment - 60, getting as much of: foliage (170 hojasplanta-1, branches (31 ramasplanta-1, acorns (54 bellotasplanta-1 and increased performance of dried calyxes (698 kgha-1.The beans associated with maize without fertilizations showed increase in foliage (62 hojasplanta-1 and in monoculture with fertilization 60-60 - 60 had the best performance (1,565 kgha-1of beans. Corn had the best vegetative response (18 hojasplanta-1 associated with beans and fertilization 120 - 60-60, and the best performance was when teamed with the beans and the jamaica (7,667 kgha-1. The best equivalent land-use was 3.31 in jamaica-bean-corn crop pattern. The analysis of the results indicates that the jamaica by associating it with corn and beans represents a biological and economic production alternative to improve the economy of rural families in Mexican soils which are acidified.

  4. Influence of NaCl and NaHCO/sub 3/ on reduction of phytic acid in red kidney bean

    International Nuclear Information System (INIS)

    Influence of sodium chloride (NaCI) and sodium bicarbonate (NaHCO/sub 3/) was studied on phytic acid in Red kidney bean (phaseolus sp). Two varieties of Red Kidney bean VI (Orakzai Korkha) and V2 (Kurram Korkha) were obtained from NWFP Agriculture University, Peshawar. The amount of phytic acid in V1 and V2 of Red kidney bean was 10 mg and 9.80 mg, respectively. Red kidney-bean flour soaked for 6 and 12 hrs. in water and in pH4 and 6 solutions has significantly reduced (70%) amount of phytic acid. Solution of pH6 was found most effective, while pH4 and water was less effective in lowering the phytic acid in Red kidney bean. Mixed food additives (1% NaCI + 2% NaHCO/sub 3/) in water, and pH4 and 6 solutions, reduced the level of phytic acid in Red kidney bean to 40%, 54% and 58% for 6 hrs, and 50%, 57% and 70% for 12 hrs. in respective solutions. Results revealed that soaking Red kidney bean flour in pH6 solution with the presence of NaCI and NaHCO/sub 3/, the action of phytase enzyme was well activated to hydrolyze phytic acid. It has been observed that soaking of flour in the respective solutions is a simple inexpensive method of lowering phytic acid in bean. The treatment with such a sophisticated combination of food additives will improve the nutritional status of Red kidney bean, which is used in many food products. (author)

  5. Modification of water absorption capacity of a plastic based on bean protein using gamma irradiated starches as additives

    Energy Technology Data Exchange (ETDEWEB)

    Koeber, E. [Facultad de Ingenieria, Grupo de Ingenieria Bioquimica, Universidad de Buenos Aires, Paseo Colon 850, 1063, Buenos Aires (Argentina); Gonzalez, M.E. [Comision Nacional Energia Atomica, Av. Del Libertador 8250, Buenos Aires (Argentina); Gavioli, N. [Facultad de Ingenieria, Grupo de Ingenieria Bioquimica, Universidad de Buenos Aires, Paseo Colon 850, 1063, Buenos Aires (Argentina); Salmoral, E.M. [Facultad de Ingenieria, Grupo de Ingenieria Bioquimica, Universidad de Buenos Aires, Paseo Colon 850, 1063, Buenos Aires (Argentina)]. E-mail: esalmor@fi.uba.ar

    2007-01-15

    Some properties of a bean protein-starch plastic were modified by irradiation of the starch. Two kinds of starch from bean and cassava were irradiated with doses until 50 kGy before their inclusion in the composite. Water absorption of the resultant product was reduced by 36% and 60% in materials containing bean and cassava starch, respectively. A large decline in the elongation is observed till 10 kGy in both materials, while tensile strength diminished by 11% in the cassava composite.

  6. Multi-effects and Mechanism of Broad Bean M1 Root-tip Cells Implanted by Low Energy N+ Beam

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Broad beans were divided into six groups and implanted with N+ beam of 30 KeV, 8 × 1016/cm2 per time for various radiating times respectively. Besides the statistics of its vigor of germination, the M1 root-tip cells of these broad beans were systematically analyzed on their changes in mitotic percentage, morphology and behavior of chromosomes, along with the structure of cytoskeletons, including microtubule and intermediate filament. Based on all results of these studies, our opinions have been expressed in the report on the mechanism of low-energy N+ beams effecting on higher dicotyledons such as broad bean.

  7. Annotation and sequence diversity of transposable elements in common bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Scott eJackson

    2014-07-01

    Full Text Available Common bean (Phaseolus vulgaris is an important legume crop grown and consumed worldwide. With the availability of the common bean genome sequence, the next challenge is to annotate the genome and characterize functional DNA elements. Transposable elements (TEs are the most abundant component of plant genomes and can dramatically affect genome evolution and genetic variation. Thus, it is pivotal to identify TEs in the common bean genome. In this study, we performed a genome-wide transposon annotation in common bean using a combination of homology and sequence structure-based methods. We developed a 2.12-Mb transposon database which includes 791 representative transposon sequences and is available upon request or from www.phytozome.org. Of note, nearly all transposons in the database are previously unrecognized TEs. More than 5,000 transposon-related expressed sequence tags (ESTs were detected which indicates that some transposons may be transcriptionally active. Two Ty1-copia retrotransposon families were found to encode the envelope-like protein which has rarely been identified in plant genomes. Also, we identified an extra open reading frame (ORF termed ORF2 from 15 Ty3-gypsy families that was located between the ORF encoding the retrotransposase and the 3’LTR. The ORF2 was in opposite transcriptional orientation to retrotransposase. Sequence homology searches and phylogenetic analysis suggested that the ORF2 may have an ancient origin, but its function is not clear. This transposon data provides a useful resource for understanding the genome organization and evolution and may be used to identify active TEs for developing transposon-tagging system in common bean and other related genomes.

  8. Irrigation water demand of common bean on field and regional scale under varying climatic conditions

    Directory of Open Access Journals (Sweden)

    Michael Wagner

    2016-09-01

    Full Text Available Crop irrigation plays an important role in the world's food production and its role is expected to increase still further. For policy makers, the quantification of the irrigation water demand and the water availability on a regional scale is crucial. In the project ‘SAPHIR’, a new stochastic framework was developed to upscale crop yield and crop water demand from irrigation experiments with common bean to the regional scale using the one-dimensional mechanistic crop model Daisy. The crop model parameters – derived based on a comprehensive experimental data collection and a sound calibration of the crop model – were used to simulate potential bean yield, yield reduction due to drought stress, and crop water demand in mid and northern Saxony, Eastern Germany, using the dominant soil characteristics. The stochastic relationship between irrigated water and crop yield (stochastic crop water production function enabled the prediction of the crop productivity on a regional scale. Furthermore, the available water resources for irrigation on the catchment scale were compared to the predicted irrigation water requirements to estimate the degree of local water self sufficiency. The simulation results show that an irrigation of common bean has high yield effects especially in locations with low precipitation during the growing season or for soils with a low water storage capacity. Especially in the drier northern parts of Saxony with its lower soil water storage capability, a decrease in non-irrigated fresh matter bean yield up to 40 % is predicted for the future. Irrigation and the projected increasing temperature can enhance the bean yield in southern Saxony. However, the required amount of irrigation water in northern Saxony can only be delivered by down to 20 % and less from the local precipitation. The presented framework enables policy makers to compare water demand and available water which allows a precise estimation of relevant

  9. Effect of post-harvest treatments on the occurrence of ochratoxin A in raw cocoa beans.

    Science.gov (United States)

    Kedjebo, Kra Brou Didier; Guehi, Tagro Simplice; Kouakou, Brou; Durand, Noël; Aguilar, Philippe; Fontana, Angélique; Montet, Didier

    2016-01-01

    Cocoa beans are the principal raw material for chocolate manufacture. Moulds have an important place in the change in the quality of cocoa beans due to their role in the production of free fatty acids and mycotoxins, namely ochratoxin A (OTA). This study investigated the impact of the key post-harvest treatments, namely the fermentation and drying methods on OTA contamination of raw cocoa beans. Analytical methods for OTA detection were based on solid-liquid extraction, clean-up using an immunoaffinity column, and identification by reversed-phase HPLC with fluorescence detection. Of a total of 104 randomly selected cocoa samples analysed, 32% had OTA contents above 2 µg kg(-1). Cocoa sourced from pods in a bad state of health had a maximum OTA content of 39.2 µg kg(-1), while that obtained from healthy pods recorded 11.2 µg kg(-1). The production of OTA in cocoa beans increased according to the pod-opening delay and reached 39.2 µg kg(-1) after an opening delay of 7 days after harvest, while 6.1 and 11.2 µg kg(-1) were observed when pods were opened after 0 and 4 days. OTA production also seemed to depend considerably to the cocoa fermentation materials. When using plastic boxes for bean fermentation, the OTA production was enhanced and reached an average OTA content of about 4.9 µg kg(-1), while the raw cocoa treated in banana leaves and wooden boxes recorded 1.6 and 2.2 µg kg(-1) on average respectively. In parallel, the OTA production was not really influenced by either the mixing or the duration of the fermentation or the drying materials.

  10. Influence of Milling Process of Roasted Cocoa Beans on Size Distribution Change of Cocoa Cotyledon

    Directory of Open Access Journals (Sweden)

    Sukrisno Widyotomo

    2007-05-01

    Full Text Available One of important steps in secondarycocoa process is deshelling cocoa beans roasted. The aim of deshelling is to enrich cotyledon cocoa surface area which affects to reduce energy and processing time with good quality of the chocolate product. The objective of this research is to study the influence of milling process on physical characteristic change of cocoa beans roasted such as size distribution change, geometrical diameter average, uniformity index, fineness modulus, and average dimension of cotyledoncocoa roasted. The Indonesian Coffee and Cocoa Research Institute has designed and tested deshelling of roasted cocoa beans which will be used in this research. Before deshelling process, C grade bulk cocoa beans has been roasted up to 2.5—3% water contents. The result showed that optimal milling process by rotary cutter type milling unit has good size distribution change, geometrical diameter average, uniformity index, fineness modulus, and average dimension on 500 rpm rotary speed and 2.8 m/s air flow. On optimal process condition, 74.5% of cocoa cotyledon roasted has diameter size between 2.0—4.75 mm, 2.116 mm average of geometrical diameter, 0.864 mm average dimension, 3.052 fineness modulus, and 80% as crude size particel-20% as temperate size particel on uniformity index. Therefore, more than 80% of cocoa cotyledon roasted has diameter size between 2.0—4.75 mm with 700—900 rpm rotary cutter speed. Average of geometric diameter was 1.65—2.19 mm, and the dimension average was 0.69—0.89 mm. Uniformity index was crude size particle up to 80—90%, and in temperate size particle10—20%. Fineness modulus value was 2.73—3.09. Key words: cocoa, milling, size distribution, roasted beans.

  11. Large-Scale Transcriptome Analysis in Faba Bean (Vicia faba L. under Ascochyta fabae Infection.

    Directory of Open Access Journals (Sweden)

    Sara Ocaña

    Full Text Available Faba bean is an important food crop worldwide. However, progress in faba bean genomics lags far behind that of model systems due to limited availability of genetic and genomic information. Using the Illumina platform the faba bean transcriptome from leaves of two lines (29H and Vf136 subjected to Ascochyta fabae infection have been characterized. De novo transcriptome assembly provided a total of 39,185 different transcripts that were functionally annotated, and among these, 13,266 were assigned to gene ontology against Arabidopsis. Quality of the assembly was validated by RT-qPCR amplification of selected transcripts differentially expressed. Comparison of faba bean transcripts with those of better-characterized plant genomes such as Arabidopsis thaliana, Medicago truncatula and Cicer arietinum revealed a sequence similarity of 68.3%, 72.8% and 81.27%, respectively. Moreover, 39,060 single nucleotide polymorphism (SNP and 3,669 InDels were identified for genotyping applications. Mapping of the sequence reads generated onto the assembled transcripts showed that 393 and 457 transcripts were overexpressed in the resistant (29H and susceptible genotype (Vf136, respectively. Transcripts involved in plant-pathogen interactions such as leucine rich proteins (LRR or plant growth regulators involved in plant adaptation to abiotic and biotic stresses were found to be differently expressed in the resistant line. The results reported here represent the most comprehensive transcript database developed so far in faba bean, providing valuable information that could be used to gain insight into the pathways involved in the resistance mechanism against A. fabae and to identify potential resistance genes to be further used in marker assisted selection.

  12. BIOLOGICAL CONTROL OF SPODOPTERA FRUGIPERDA EGGS USING TELENOMUS REMUS NIXON IN MAIZE-BEAN-SQUASH POLYCULTURE

    Directory of Open Access Journals (Sweden)

    Antonio GutiA©rrez-MartAnez

    2012-01-01

    Full Text Available The maize earworm, Spodoptera frugiperda (J.E. Smith (Lepidoptera: Noctuidae, is an important pest in maize. Telenomus remus Nixon (Hymenoptera: Scelionidae is an important control agent of this pest due to its capacity to invade the whole egg mass. The percentage of parasitism by Telenomus remus Nixon (Hymenoptera: Scelionidae on Spodoptera frugiperda (J.E. Smith (Lepidoptera: Noctuidae eggs was evaluated in maize-bean, maize-squash and maize-bean-squash polyculture and maize monoculture systems. Data were analyzed statistically by using a Poisson regression (log-linear model. The analysis showed highly significant differences in the percentage of parasitism of S. frugiperda eggs by T. remus in plots with jarocho crema maize in polyculture systems (91.00±1.42% compared to the yellow maize genotype (68.90±3.10%. Parasitism percentages increased in the jarocho crema maize genotype in maize-bean, maize-squash, maize-bean-squash polycultures and maize monoculture by 87.88±3.27%, 89.75±1.99, 99.50±0.19 and 86.88±2.66%, respectively and in the yellow maize genotype they dropped by 70.00±7.05, 64.50±5.63, 77.88±6.51 and 63.25±5.20%, respectively. The percentage of T. remus parasitism on S. frugiperda eggs was found to be affected by the genotype of maize, bean and squash, polyculture system, weeds, densities of the host eggs and numbers and quality of egg masses.

  13. The Potential Use of Fermented Chickpea and Faba Bean Flour as Food Ingredients.

    Science.gov (United States)

    Chandra-Hioe, Maria V; Wong, Christina H M; Arcot, Jayashree

    2016-03-01

    Apart from being a rich and inexpensive protein source, legumes provide essential vitamins, minerals and dietary fibre. Considering the nutritional benefits, legumes flour can potentially be incorporated in the development of new products. The aim of this study was to investigate whether fermentation affects the protein content, in vitro protein digestibility, trypsin inhibitor activity and the functionality of proteins in faba bean, desi and kabuli chickpea. Australian grown chickpea and faba bean were selected and initially soaked, de-hulled, dried and milled into flour. This was fermented with lyophilised yoghurt cultures in a 30 °C orbital shaker for 16 h. While protein contents in fermented desi and kabuli flour were lower than their raw counterparts (p > 0.05), it was significantly higher in fermented faba bean. A significant increase (9.5%) in in vitro protein digestibility was found in fermented desi. Trypsin inhibitor activity in fermented desi, kabuli and faba bean reduced by 2.7, 1.1 and 4.7%, respectively (p > 0.05). Overall, the in vitro protein digestibility in flour samples increased, while simultaneously reducing the trypsin inhibitor activity. The water absorption capacity of the fermented kabuli flour significantly increased by 11.3%. All fermented flour samples had significantly higher oil absorption capacity than their corresponding raw flour that was likely due to increased insoluble hydrophobic protein. Although, the foaming capacity in all fermented flour samples was significantly lower than their respective raw samples, only fermented desi and faba bean flour showed lower foaming stability (p > 0.05). The present study suggests that fermented legume flour could fulfill the demand for innovative products of higher nutritional value.

  14. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    International Nuclear Information System (INIS)

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 μW cm-2; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H2O2) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at ≥2 h), and radicle and plumule growths (≥1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H2O2 accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  15. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ved Parkash [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Department of Zoology, Panjab University, Chandigarh 160014 (India); Singh, Harminder Pal, E-mail: hpsingh_01@yahoo.com [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Kohli, Ravinder Kumar; Batish, Daizy Rani [Department of Botany, Panjab University, Chandigarh 160014 (India)

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 {mu}W cm{sup -2}; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H{sub 2}O{sub 2}) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at {>=}2 h), and radicle and plumule growths ({>=}1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H{sub 2}O{sub 2} accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  16. Performance of Rotary Cutter Type Breaking Machine for Breakingand Deshelling Cocoa Roasted Beans

    Directory of Open Access Journals (Sweden)

    Sukrisno Widyotomo

    2005-12-01

    Full Text Available Conversion of cocoa beans to chocolate product is, therefore, one of the promising alternatives to increase the value added of dried cocoa beans. On the other hand, the development of chocolate industry requires an appropriate technology that is not available yet for small or medium scale of business. Breaking and deshelling cocoa roasted beans is one important steps in cocoa processing to ascertain good chocolate quality. The aim of this research is to study performance of rotary cutter type breaking machine for breaking and deshelling cocoa roasted beans. Indonesian Coffee and Cocoa Research Institute has designed and tested a rotary cutter type breaking machine for breaking and deshelling cocoa roasted beans. Breaker unit has rotated by ½ HP power, single phase, 110/220 V and 1440 rpm. Transmission system that use for rotating breaker unit is pulley and single V belt. Centrifugal blower as separator unit between cotyledon and shell has specification 0.5 m 3 /min air flow, 780 Pa, 370 W, and 220 V. Field tests showed that the optimum capacity of the machine was 268 kg/h with 500 rpm speed of rotary cutter, 2,8 m/s separator air flow, and power require was 833 W. Percentage product in outlet 1 and 2 were 94.5% and 5.5%. Particle distribution from outlet 1 was 92% as cotyledon, 8% as shell in cotyledon and on outlet 2 was 97% as shell, 3% as cotyledon in shell. Key words:cocoa, breaking, rotary cutter, quality.

  17. [Effects of La on the growth of kidney bean seedling under Cd stress].

    Science.gov (United States)

    Zhou, Qing; Zhang, Hui; Huang, Xiaohua; Lu, Ganchao; Liang, Chanjuan; Lu, Tianhong

    2003-07-01

    In this study, kidney bean (Phaseolus vulgaris) was used as experiment-material, and effects of lanthanum on growth and metabolism of kidney bean seedling under cadmium stress was studied by water culture. The results showed that kidney bean seedling was chronically harmed by 30 mumol.L-1 Cd2+, however, its height and main root were reduced about 31.1% and 39.2%, meanwhile, leaf area, fresh and dry weight of leaf, stem and root were decreased 48.0%, 42.7%, 29.6%, 61.3% and 49.4% respectively. With acute damage of 50 mumol.L-1 Cd2+, physiological and biochemical characteristics of seedling changed greatly, e.g., chlorophyll content and root activity were decreased about 23.5% and 28.7%, cell membrane permeability, the malonydialdehyde (MDA) content, activities of catalase (CAT) and peroxidase (POD) were increased 5.58%, 28.6%, 0.6% and 7.0% respectively. And with longer treatment time, the damage became more serious. When 10 mg.L-1 La was used to spray on kidney bean seedling under cadmium stress one time, growth and metabolism of seedling was obviously reconditioned and the damage of Cd pollution was reduced. It is proved, by the experiment, that La can improve chlorophyll content(30.0%) and reduce cell membrane permeability (0.87%) and content of MDA(9.5%), and keep the activities of CAT (0.1%) and POD(1.6%) of kidney bean seedling.

  18. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress.

    Science.gov (United States)

    Sharma, Ved Parkash; Singh, Harminder Pal; Kohli, Ravinder Kumar; Batish, Daizy Rani

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 microW cm(-2); 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H(2)O(2)) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at > or =2 h), and radicle and plumule growths (> or =1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H(2)O(2) accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  19. The Potential Use of Fermented Chickpea and Faba Bean Flour as Food Ingredients.

    Science.gov (United States)

    Chandra-Hioe, Maria V; Wong, Christina H M; Arcot, Jayashree

    2016-03-01

    Apart from being a rich and inexpensive protein source, legumes provide essential vitamins, minerals and dietary fibre. Considering the nutritional benefits, legumes flour can potentially be incorporated in the development of new products. The aim of this study was to investigate whether fermentation affects the protein content, in vitro protein digestibility, trypsin inhibitor activity and the functionality of proteins in faba bean, desi and kabuli chickpea. Australian grown chickpea and faba bean were selected and initially soaked, de-hulled, dried and milled into flour. This was fermented with lyophilised yoghurt cultures in a 30 °C orbital shaker for 16 h. While protein contents in fermented desi and kabuli flour were lower than their raw counterparts (p > 0.05), it was significantly higher in fermented faba bean. A significant increase (9.5%) in in vitro protein digestibility was found in fermented desi. Trypsin inhibitor activity in fermented desi, kabuli and faba bean reduced by 2.7, 1.1 and 4.7%, respectively (p > 0.05). Overall, the in vitro protein digestibility in flour samples increased, while simultaneously reducing the trypsin inhibitor activity. The water absorption capacity of the fermented kabuli flour significantly increased by 11.3%. All fermented flour samples had significantly higher oil absorption capacity than their corresponding raw flour that was likely due to increased insoluble hydrophobic protein. Although, the foaming capacity in all fermented flour samples was significantly lower than their respective raw samples, only fermented desi and faba bean flour showed lower foaming stability (p > 0.05). The present study suggests that fermented legume flour could fulfill the demand for innovative products of higher nutritional value. PMID:26880215

  20. Faba beans (Vicia faba in dairy cow diet: effect on milk production and quality

    Directory of Open Access Journals (Sweden)

    Rosanna Scipioni

    2010-02-01

    Full Text Available The use of alternative plant proteins in place of the soybean meal protein in diets for farmed animals aims to reduce the extra-EU soybean import and partially substitute the GMO in the food chain. Among the possible alternatives, the heat-processed (flaked faba beans appears interesting for dairy cow diet. Two consecutive experiments were carried out to test flaked faba beans as a partial substitute for soybean meal in the diet of Reggiana breed dairy cows producing milk for Parmigiano-Reggiano cheese-making. In both experiments a “Control” concentrate (12% soybean meal, no faba beans was compared with a “Faba” concentrate (7.5% soybean meal and 10% flaked faba beans. Forages fed to animals were hay (mixed grass and alfalfa plus mixed grass in experiment 1, hay only in experiment 2. Milk yield and quality and the characteristics of grab faecal samples as empirical indicators of digestibility, were similar between feeding groups. The milk urea content was slightly lower in the “Faba” group, particularly in experiment 2 (“Control” vs “Faba”: 34.6 vs 32.9 mg/dL in experiment 1, P<0.1; 27.4 vs 23.4 mg/dL in experiment 2, P<0.01; the plasma urea content in experiment 2 confirmed the trend observed in milk (3.9 vs 3.0 mmol/L, P<0.01. The inclusion of faba beans, within the allowed limit of the Parmigiano-Reggiano Consortium for diet formulation, could represent a feasible opportunity for a partial substitution of soybean meal.