WorldWideScience

Sample records for bean enhancing extracellular

  1. Enhanced production of extracellular ice nucleators from Erwinia herbicola.

    Science.gov (United States)

    Li, Jingkun; Lee, Tung-Ching

    1998-12-01

    The effects of growth conditions and chemical or physical treatments on the production of extracellular ice nucleators (ECINs) by Erwinia herbicola cells were investigated. The spontaneous release of ECINs, active at temperatures higher than -4 degrees C, into the environment depended on culture conditions, with optimal production when cells were grown in yeast extract to an early stationary phase at temperatures below 22 degrees C. ECINs were vesicular, released from cell surfaces with sizes ranging from 0.1 to 0.3 &mgr;m as determined by ultrafiltration and transmission electron microscopy. Protein profiles of ECIN fractions during bacterial growth were examined by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and Ina proteins were detected by Western blotting. ECIN production was enhanced 5-fold when cells were treated with EDTA and 20- to 30-fold when subjected to sonication. These conditions provide a means for large-scale preparationage> ECINs by E. herbicola. PMID:12501408

  2. Xylella fastidiosa Extracellular Genomic DNA May Play a Role For Enhancing Biofilm Formation In Vitro

    Science.gov (United States)

    Xylella fastidiosa (Xf) produces extracellular DNA in PD3 liquid medium. This extracellular DNA may play a role in enhancing biofilm formation, a factor that is required by Xf to establish infection in host plants. Amounts of extracellular DNA generated by Xf in vitro were positively correlated with...

  3. Plant Growth Promoting Rhizobacteria and Silicon Synergistically Enhance Salinity Tolerance of Mung Bean

    KAUST Repository

    Mahmood, Sajid

    2016-06-17

    The present study explored the eco-friendly approach of utilizing plant-growth-promoting rhizobacteria (PGPR) inoculation and foliar application of silicon (Si) to improve the physiology, growth, and yield of mung bean under saline conditions. We isolated 18 promising PGPR from natural saline soil in Saudi Arabia, and screened them for plant-growth-promoting activities. Two effective strains were selected from the screening trial, and were identified as Enterobacter cloacae and Bacillus drentensis using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry and 16S rRNA gene sequencing techniques, respectively. Subsequently, in a 2-year mung bean field trial, using a randomized complete block design with a split-split plot arrangement, we evaluated the two PGPR strains and two Si levels (1 and 2 kg ha−1), in comparison with control treatments, under three different saline irrigation conditions (3.12, 5.46, and 7.81 dS m−1). The results indicated that salt stress substantially reduced stomatal conductance, transpiration rate, relative water content (RWC), total chlorophyll content, chlorophyll a, chlorophyll b, carotenoid content, plant height, leaf area, dry biomass, seed yield, and salt tolerance index. The PGPR strains and Si levels independently improved all the aforementioned parameters. Furthermore, the combined application of the B. drentensis strain with 2 kg Si ha−1 resulted in the greatest enhancement of mung bean physiology, growth, and yield. Overall, the results of this study provide important information for the benefit of the agricultural industry.

  4. Efficient production and enhanced tumor delivery of engineered extracellular vesicles.

    Science.gov (United States)

    Watson, Dionysios C; Bayik, Defne; Srivatsan, Avinash; Bergamaschi, Cristina; Valentin, Antonio; Niu, Gang; Bear, Jenifer; Monninger, Mitchell; Sun, Mei; Morales-Kastresana, Aizea; Jones, Jennifer C; Felber, Barbara K; Chen, Xiaoyuan; Gursel, Ihsan; Pavlakis, George N

    2016-10-01

    Extracellular vesicles (EV), including exosomes and microvesicles, are nano-sized intercellular communication vehicles that participate in a multitude of physiological processes. Due to their biological properties, they are also promising candidates for the systemic delivery of therapeutic compounds, such as cytokines, chemotherapeutic drugs, siRNAs and viral vectors. However, low EV production yield and rapid clearance of administered EV by liver macrophages limit their potential use as therapeutic vehicles. We have used a hollow-fiber bioreactor for the efficient production of bioactive EV bearing the heterodimeric cytokine complex Interleukin-15:Interleukin-15 receptor alpha. Bioreactor culture yielded ∼40-fold more EV per mL conditioned medium, as compared to conventional cell culture. Biophysical analysis and comparative proteomics suggested a more diverse population of EV in the bioreactor preparations, while serum protein contaminants were detectable only in conventional culture EV preparations. We also identified the Scavenger Receptor Class A family (SR-A) as a novel monocyte/macrophage uptake receptor for EV. In vivo blockade of SR-A with dextran sulfate dramatically decreased EV liver clearance in mice, while enhancing tumor accumulation. These findings facilitate development of EV therapeutic methods. PMID:27522254

  5. Determination of the Effects of Nutrient sources on Enhancement of Crop Tolerance to Bean Root Rot and Bean Stem Maggot in Western Kenya

    International Nuclear Information System (INIS)

    Field bean phaseolus vulgaris tolerance to root rot (BRR) and bean stem maggot (BSM) is enhanced by improvement of soil nutrients. Organic and inorganic sources of soil nutrients were evaluated in this study to determine their effects on crop tolerance to BRR and BSM. Three variety of GLP 585 susceptible to BRR and BSM; GLP X92 tolerant to BRR and BSM; and KK-8 resistant to BRR and BSM were used. The study was conducted in farmer's field with high level of BRR and BSM over three seasons in a split plot design. Nutrient sources were laid down in main plots while varieties were in subplots. KK-8 gave the highest plant survival and yield over the seasons. GLP 585 had the lowest mean yield and plant survival. Crop tolerance was greatly improved by application of DAP as applied as nutrient sources and varieties for crop tolerance were identified

  6. Plant Growth Promoting Rhizobacteria and Silicon Synergistically Enhance Salinity Tolerance of Mung Bean

    Science.gov (United States)

    Mahmood, Sajid; Daur, Ihsanullah; Al-Solaimani, Samir G.; Ahmad, Shakeel; Madkour, Mohamed H.; Yasir, Muhammad; Hirt, Heribert; Ali, Shawkat; Ali, Zahir

    2016-01-01

    The present study explored the eco-friendly approach of utilizing plant-growth-promoting rhizobacteria (PGPR) inoculation and foliar application of silicon (Si) to improve the physiology, growth, and yield of mung bean under saline conditions. We isolated 18 promising PGPR from natural saline soil in Saudi Arabia, and screened them for plant-growth-promoting activities. Two effective strains were selected from the screening trial, and were identified as Enterobacter cloacae and Bacillus drentensis using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry and 16S rRNA gene sequencing techniques, respectively. Subsequently, in a 2-year mung bean field trial, using a randomized complete block design with a split-split plot arrangement, we evaluated the two PGPR strains and two Si levels (1 and 2 kg ha−1), in comparison with control treatments, under three different saline irrigation conditions (3.12, 5.46, and 7.81 dS m−1). The results indicated that salt stress substantially reduced stomatal conductance, transpiration rate, relative water content (RWC), total chlorophyll content, chlorophyll a, chlorophyll b, carotenoid content, plant height, leaf area, dry biomass, seed yield, and salt tolerance index. The PGPR strains and Si levels independently improved all the aforementioned parameters. Furthermore, the combined application of the B. drentensis strain with 2 kg Si ha−1 resulted in the greatest enhancement of mung bean physiology, growth, and yield. Overall, the results of this study provide important information for the benefit of the agricultural industry. PMID:27379151

  7. Effects of Enhanced UV-B Radiation on the Activity and Expression of Alternative Oxidase in Red Kidney Bean Leaves

    Institute of Scientific and Technical Information of China (English)

    Ming-Guang Zhao; Ying-Gao Liu; Li-Xin Zhang; Lin Zheng; Yu-Rong Bi

    2007-01-01

    An increase in ultraviolet (UV) B radiation on the earth's surface is a feature of current global climate changes. It has been reported that alternative oxidase (AOX) may have a protective role against oxidative stress induced by environmental stresses, such as UV-B. To better understand the characteristic tolerance of plants to UV-B radiation, the effects of enhanced UV-B radiation on the activity and expression of AOX in red kidney bean (Phaseolus vulgaris) leaves were investigated in the present study. The results show that the total respiration rate and AOX activity in red kidney bean leaves increased significantly during treatment with enhanced UV-B. However, cytochrome oxidase (COX) activity did not change at 24 h of UV-B treatment, before dropping rapidly. Both alternative pathway content and alternative pathway activity were increased in the presence of exogenous H2O2. Immunoblotting analysis with anti-AOX monoclonal antibody revealed that expression of the AOX protein increased in red kidney bean leaves under enhanced UV-B radiation, reaching a peak at 72increase in AOX activity in red kidney bean leaves under enhanced UV-B radiation was mainly due to H2O2-induced AOX expression.

  8. Extracellular Xylella fastidiosa genomic DNA enhances biofilm formation in vitro

    Science.gov (United States)

    Xylella fastidiosa (Xf) is a Gram negative, xylem-limited bacterium that causes Pierce’s Disease (PD) of grapevine, as well as other diseases of economically important crops and landscape plants. Many bacteria produce large amounts of extracellular DNA, which may function as a matrix component in b...

  9. The Pathophysiology of Extracellular Hemoglobin Associated with Enhanced Oxidative Reactions

    Directory of Open Access Journals (Sweden)

    Joseph M Rifkind

    2015-01-01

    Full Text Available Hemoglobin (Hb continuously undergoes autoxidation producing superoxide which dismutates into hydrogen peroxide (H2O2 and is a potential source for subsequent oxidative reactions. Autoxidation is most pronounced under hypoxic conditions in the microcirculation and for unstable dimers formed at reduced Hb concentrations. In the red blood cell (RBC, oxidative reactions are inhibited by an extensive antioxidant system. For extracellular Hb, whether from hemolysis of RBCs and/or the infusion of Hb-based blood substitutes, the oxidative reactions are not completely neutralized by the available antioxidant system. Un-neutralized H2O2 oxidizes ferrous and ferric Hbs to Fe(IV-ferrylHb and oxyferrylHb, respectively. FerrylHb further reacts with H2O2 producing heme degradation products and free iron. OxyferrylHb, in addition to Fe(IV contains a free radical that can undergo additional oxidative reactions. Fe(IIIHb produced during Hb autoxidation also readily releases heme, an additional source for oxidative stress. These oxidation products are a potential source for oxidative reactions in the plasma, but to a greater extent when the lower molecular weight Hb dimers enter cells and tissues. Heme and oxyferryl have been shown to have a proinflammatory effect further increasing their potential for oxidative stress. These oxidative reactions contribute to a number of pathological situations including atherosclerosis, kidney malfunction, sickle cell disease and malaria. The toxic effects of extracellular Hb are of particular concern for increased hemolysis due to hemolytic anemia. Hemolysis is further exacerbated in various diseases and their treatments. Blood transfusions are required whenever there is an appreciable decrease in RBCs due to hemolysis or blood loss. It is, therefore, essential that transfused blood, whether stored RBCs or blood obtained by an Autologous Blood Recovery System from the patient, does not further increase extracellular Hb.

  10. Enhanced invasion of metastatic cancer cells via extracellular matrix interface.

    Directory of Open Access Journals (Sweden)

    Jiangrui Zhu

    Full Text Available Cancer cell invasion is a major component of metastasis and is responsible for extensive cell diffusion into and major destruction of tissues. Cells exhibit complex invasion modes, including a variety of collective behaviors. This phenomenon results in the structural heterogeneity of the extracellular matrix (ECM in tissues. Here, we systematically investigated the environmental heterogeneity facilitating tumor cell invasion via a combination of in vitro cell migration experiments and computer simulations. Specifically, we constructed an ECM microenvironment in a microfabricated biochip and successfully created a three-dimensional (3D funnel-like matrigel interface inside. Scanning electron microscopy demonstrated that the interface was at the interior defects of the nano-scale molecular anisotropic orientation and the localized structural density variations in the matrigel. Our results, particularly the correlation of the collective migration pattern with the geometric features of the funnel-like interface, indicate that this heterogeneous in vitro ECM structure strongly guides and promotes aggressive cell invasion in the rigid matrigel space. A cellular automaton model was proposed based on our experimental observations, and the associated quantitative analysis indicated that cell invasion was initiated and controlled by several mechanisms, including microenvironment heterogeneity, long-range cell-cell homotype and gradient-driven directional cellular migration. Our work shows the feasibility of constructing a complex and heterogeneous in vitro 3D ECM microenvironment that mimics the in vivo environment. Moreover, our results indicate that ECM heterogeneity is essential in controlling collective cell invasive behaviors and therefore determining metastasis efficiency.

  11. Effects of enhanced UVB on growth and yield of two Syrian crops, wheat (Triticum durum desf. var. horani) and broad beans (Vicia Faba L.) under field conditions

    International Nuclear Information System (INIS)

    Wheat and broad beans were exposed, under field conditions, to a daily UVB of 20 % above the ambient UVB. The plant height, tiller number, number of flowers, spikletes, dry weight and leaf area in both species showed positive responses to UVB treatment. At harvest, the seeds weight of broad beans was virtually equal in exposed and unexposed plants. In wheat, seeds yield increased significantly by 15 %. In conclusion, broad beans can be considered as a tolerant cultivar to enhanced UVB, while wheat is more tolerant. (Author). 17 Tabs. 36 Refs

  12. Extracellular matrix formation enhances the ability of Streptococcus pneumoniae to cause invasive disease.

    Directory of Open Access Journals (Sweden)

    Claudia Trappetti

    Full Text Available During infection, pneumococci exist mainly in sessile biofilms rather than in planktonic form, except during sepsis. However, relatively little is known about how biofilms contribute to pneumococcal pathogenesis. Here, we carried out a biofilm assay on opaque and transparent variants of a clinical serotype 19F strain WCH159. After 4 days incubation, scanning electron microscopy revealed that opaque biofilm bacteria produced an extracellular matrix, whereas the transparent variant did not. The opaque biofilm-derived bacteria translocated from the nasopharynx to the lungs and brain of mice, and showed 100-fold greater in vitro adherence to A549 cells than transparent bacteria. Microarray analysis of planktonic and sessile bacteria from transparent and opaque variants showed differential gene expression in two operons: the lic operon, which is involved in choline uptake, and in the two-component system, ciaRH. Mutants of these genes did not form an extracellular matrix, could not translocate from the nasopharynx to the lungs or the brain, and adhered poorly to A549 cells. We conclude that only the opaque phenotype is able to form extracellular matrix, and that the lic operon and ciaRH contribute to this process. We propose that during infection, extracellular matrix formation enhances the ability of pneumococci to cause invasive disease.

  13. Exploitation of Common Bean Flours with Low Antinutrient Content for Making Nutritionally Enhanced Biscuits.

    Science.gov (United States)

    Sparvoli, Francesca; Laureati, Monica; Pilu, Roberto; Pagliarini, Ella; Toschi, Ivan; Giuberti, Gianluca; Fortunati, Paola; Daminati, Maria G; Cominelli, Eleonora; Bollini, Roberto

    2016-01-01

    Consumption of legumes is associated with a number of physiological and health benefits. Legume proteins complement very well those of cereals and are often used to produce gluten-free products. However, legume seeds often contain antinutritional compounds, such as phytate, galactooligosaccharides, phenolic compounds, lectins, enzyme inhibitors, whose presence could affect their nutritional value. Screening natural and induced biodiversity for useful traits, followed by breeding, is a way to remove undesirable components. We used the common bean cv. Lady Joy and the lpa1 mutant line, having different seed composition for absence/presence of lectins,α-amylase inhibitor, (α-AI) and phytic acid, to verify the advantage of their use to make biscuits with improved nutritional properties. We showed that use of unprocessed flour from normal beans (Taylor's Horticulture and Billò) must be avoided, since lectin activity is still present after baking, and demonstrated the advantage of using the cv. Lady Joy, lacking active lectins and having active α-AI. To assess the contribution of bean flour to biscuit quality traits, different formulations of composite flours (B12, B14, B22, B24, B29) were used in combinations with wheat (B14), maize (gluten-free B22 and B29), or with both (B12 and B24). These biscuits were nutritionally better than the control, having a better amino acid score, higher fiber amount, lower predicted glycemic index (pGI) and starch content. Replacement of cv. Lady Joy bean flour with that of lpa1, having a 90% reduction of phytic acid and devoid of α-AI, contributed to about a 50% reduction of phytic acid content. We also showed that baking did not fully inactivate α-AI, further contributing to lowering the pGI of the biscuits. Finally, data from a blind taste test using consumers indicated that the B14 biscuit was accepted by consumers and comparable in terms of liking to the control biscuit, although the acceptability of these products decreased

  14. TOL plasmid carriage enhances biofilm formation and increases extracellular DNA content in Pseudomonas putida KT2440

    DEFF Research Database (Denmark)

    D'Alvise, Paul; Sjoholm, O.R.; Yankelevich, T.;

    2010-01-01

    Adherent growth of Pseudomonas putida KT2440 with and without the TOL plasmid (pWWO) at the solid-liquid and air-liquid interface was examined. We compared biofilm formation on glass in flow cells, and assayed pellicle (air-liquid interface biofilm) formation in stagnant liquid cultures by confocal...... laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid-specific stains revealed differences in the production of extracellular polymeric substances......: TOL carriage leads to more extracellular DNA (eDNA) in pellicles and biofilms. Pellicles were dissolved by DNase I treatment. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads to...

  15. Enhancing the Mobilization of Native Phosphorus in the Mung Bean Rhizosphere Using ZnO Nanoparticles Synthesized by Soil Fungi.

    Science.gov (United States)

    Raliya, Ramesh; Tarafdar, Jagadish Chandra; Biswas, Pratim

    2016-04-27

    Phosphorus (P) is a limiting factor to plant growth and productivity in almost half of the world's arable soil, and its uptake in plants is often constrained because of its low solubility in the soil. To avoid repeated and large quantity application of rock phosphate as a P fertilizer and enhance the availability of native P acquisition by the plant root surface, in this study a biosynthesized ZnO nanoparticle was used. Zn acts as a cofactor for P-solubilizing enzymes such as phosphatase and phytase, and nano ZnO increased their activity between 84 and 108%. The level of resultant P uptake in mung bean increased by 10.8%. In addition, biosynthesized ZnO also improves plant phenology such as stem height, root volume, and biochemical indicators such as leaf protein and chlorophyll contents. In the rhizosphere, increased chlorophyll content and root volume attract microbial populations that maintain soil biological health. ICP-MS results showed ZnO nanoparticles were distributed in all plant parts, including seeds. However, the concentration of Zn was within the limit of the dietary recommendation. To the best of our knowledge, this is the first holistic study focusing on native P mobilization using ZnO nanoparticles in the life cycle of mung bean plants. PMID:27054413

  16. Low Temperature Enhances Photosynthetic Down‐regulation in French Bean (Phaseolus vulgaris L.) Plants

    OpenAIRE

    Tsonev, Tsonko; VELIKOVA Violeta; Georgieva, Katya; HYDE, PAUL F.; Jones, Hamlyn G.

    2003-01-01

    The mechanisms of photosynthetic adaptation to different combinations of temperature and irradiance during growth, and especially the consequences of exposure to high light (2000 µmol m–2 s–1 PPFD) for 5 min, simulating natural sunflecks, was studied in bean plants (Phaseolus vulgaris L.). A protocol using only short (3 min) dark pre‐treatment was introduced to maximize the amount of replication possible in studies of chlorophyll fluorescence. High light at low temperature (10 °C) significant...

  17. Extracellular VirB5 enhances T-DNA transfer from Agrobacterium to the host plant.

    Directory of Open Access Journals (Sweden)

    Benoît Lacroix

    Full Text Available VirB5 is a type 4 secretion system protein of Agrobacterium located on the surface of the bacterial cell. This localization pattern suggests a function for VirB5 which is beyond its known role in biogenesis and/or stabilization of the T-pilus and which may involve early interactions between Agrobacterium and the host cell. Here, we identify VirB5 as the first Agrobacterium virulence protein that can enhance infectivity extracellularly. Specifically, we show that elevating the amounts of the extracellular VirB5--by exogenous addition of the purified protein, its overexpression in the bacterium, or transgenic expression in and secretion out of the host cell--enhances the efficiency the Agrobacterium-mediated T-DNA transfer, as measured by transient expression of genes contained on the transferred T-DNA molecule. Importantly, the exogenous VirB5 enhanced transient T-DNA expression in sugar beet, a major crop recalcitrant to genetic manipulation. Increasing the pool of the extracellular VirB5 did not complement an Agrobacterium virB5 mutant, suggesting a dual function for VirB5: in the bacterium and at the bacterium-host cell interface. Consistent with this idea, VirB5 expressed in the host cell, but not secreted, had no effect on the transformation efficiency. That the increase in T-DNA expression promoted by the exogenous VirB5 was not due to its effects on bacterial growth, virulence gene induction, bacterial attachment to plant tissue, or host cell defense response suggests that VirB5 participates in the early steps of the T-DNA transfer to the plant cell.

  18. Enhanced cell attachment using a novel cell culture surface presenting functional domains from extracellular matrix proteins

    OpenAIRE

    Cooke, M. J.; Phillips, S R; Shah, D. S. H.; Athey, D.; Lakey, J H; Przyborski, S A

    2008-01-01

    Many factors contribute to the creation and maintenance of a realistic environment for cell growth in vitro, e.g. the consistency of the growth medium, the addition of supplements, and the surface on which the cells grow. The nature of the surface on which cells are cultured plays an important role in their ability to attach, proliferate, migrate and function. Components of the extracellular matrix (ECM) are often used to coat glass or plastic surfaces to enhance cell attachment in vitro. Fra...

  19. Fosfomycin enhances phagocyte-mediated killing of Staphylococcus aureus by extracellular traps and reactive oxygen species.

    Science.gov (United States)

    Shen, Fengge; Tang, Xudong; Cheng, Wei; Wang, Yang; Wang, Chao; Shi, Xiaochen; An, Yanan; Zhang, Qiaoli; Liu, Mingyuan; Liu, Bo; Yu, Lu

    2016-01-01

    The successful treatment of bacterial infections is the achievement of a synergy between the host's immune defences and antibiotics. Here, we examined whether fosfomycin (FOM) could improve the bactericidal effect of phagocytes, and investigated the potential mechanisms. FOM enhanced the phagocytosis and extra- or intracellular killing of S. aureus by phagocytes. And FOM enhanced the extracellular killing of S. aureus in macrophage (MФ) and in neutrophils mediated by extracellular traps (ETs). ET production was related to NADPH oxidase-dependent reactive oxygen species (ROS). Additionally, FOM increased the intracellular killing of S. aureus in phagocytes, which was mediated by ROS through the oxidative burst process. Our results also showed that FOM alone induced S. aureus producing hydroxyl radicals in order to kill the bacterial cells in vitro. In a mouse peritonitis model, FOM treatment increased the bactericidal extra- and intracellular activity in vivo, and FOM strengthened ROS and ET production from peritoneal lavage fluid ex vivo. An IVIS imaging system assay further verified the observed in vivo bactericidal effect of the FOM treatment. This work may provide a deeper understanding of the role of the host's immune defences and antibiotic interactions in microbial infections. PMID:26778774

  20. Immune-enhancing activity of extracellular polysaccharides isolated from Rhizopus nigricans.

    Science.gov (United States)

    Yu, Zhidan; Kong, Mengli; Zhang, Pengying; Sun, Qingjie; Chen, Kaoshan

    2016-09-01

    Extracellular polysaccharides (EPS1-1) was extracted from fermentation liquor of Rhizopus nigricans and evaluated its immune-enhancing activities in vitro and in vivo. Results suggested that the proliferation of lymphocyte was stimulated after treated with EPS1-1. Moreover, the activities of macrophages were enhanced by increasing the activities of phagocytosis and acid phosphatase, the production of NO and the mRNA levels of IL-2, TNF-α and iNOS. Furthermore, EPS1-1 could significantly boost the immunity of normal and immunosuppressed mice, which included the increase of loaded swimming time, footpad swelling, organ index and the secretion of IL-2 and TNF-α in serum, thus suggesting that EPS1-1 could improve the body immunity through cellular immunity and humoral immunity. These findings provided further insights into the potential use of EPS1-1 as immunopotentiator or new function food. PMID:27185145

  1. Roles of extracellular polymeric substances in enhanced biological phosphorus removal process.

    Science.gov (United States)

    Li, Wen-Wei; Zhang, Hai-Ling; Sheng, Guo-Ping; Yu, Han-Qing

    2015-12-01

    Enhanced biological phosphorus removal (EBPR) process is known to mainly rely on the ability of phosphorus-accumulating organisms to take up, transform and store excess amount of phosphorus (P) inside the cells. However, recent studies have revealed considerable accumulation of P also in the extracellular polymeric substances (EPS) of sludge, implying a non-negligible role of EPS in P removal by EBPR sludge. However, the contribution of EPS to P uptake and the forms of accumulated extracellular P vary substantially in different studies, and the underlying mechanism of P transformation and transportation in EPS remains poorly understood. This review provides a new recognition into the P removal process in EBPR system by incorporating the role of EPS. It overviews on the characteristics of P accumulation in EPS, explores the mechanism of P transformation and transportation in EBPR sludge and EPS, summarizes the main influential factors for the P-accumulation properties of EPS, and discusses the remaining knowledge gaps and needed future efforts that may lead to better understanding and use of such an EPS role for maximizing P recovery from wastewater. PMID:26143588

  2. The Extracellular Matrix Protein Brevican Limits Time-Dependent Enhancement of Cocaine Conditioned Place Preference.

    Science.gov (United States)

    Lubbers, Bart R; Matos, Mariana R; Horn, Annemarie; Visser, Esther; Van der Loo, Rolinka C; Gouwenberg, Yvonne; Meerhoff, Gideon F; Frischknecht, Renato; Seidenbecher, Constanze I; Smit, August B; Spijker, Sabine; van den Oever, Michel C

    2016-06-01

    Cocaine-associated environmental cues sustain relapse vulnerability by reactivating long-lasting memories of cocaine reward. During periods of abstinence, responding to cocaine cues can time-dependently intensify a phenomenon referred to as 'incubation of cocaine craving'. Here, we investigated the role of the extracellular matrix protein brevican in recent (1 day after training) and remote (3 weeks after training) expression of cocaine conditioned place preference (CPP). Wild-type and Brevican heterozygous knock-out mice, which express brevican at ~50% of wild-type levels, received three cocaine-context pairings using a relatively low dose of cocaine (5 mg/kg). In a drug-free CPP test, heterozygous mice showed enhanced preference for the cocaine-associated context at the remote time point compared with the recent time point. This progressive increase was not observed in wild-type mice and it did not generalize to contextual-fear memory. Virally mediated overexpression of brevican levels in the hippocampus, but not medial prefrontal cortex, of heterozygous mice prevented the progressive increase in cocaine CPP, but only when overexpression was induced before conditioning. Post-conditioning overexpression of brevican did not affect remote cocaine CPP, suggesting that brevican limited the increase in remote CPP by altering neuro-adaptive mechanisms during cocaine conditioning. We provide causal evidence that hippocampal brevican levels control time-dependent enhancement of cocaine CPP during abstinence, pointing to a novel substrate that regulates incubation of responding to cocaine-associated cues. PMID:26711251

  3. Understanding the role of extracellular polymeric substances in an enhanced biological phosphorus removal granular sludge system.

    Science.gov (United States)

    Wang, Randeng; Peng, Yongzhen; Cheng, Zhanli; Ren, Nanqi

    2014-10-01

    The role of extracellular polymeric substances (EPS) in the enhanced biological phosphorus removal (EBPR) process was investigated in a P-accumulating granular sludge system by analyzing the distribution and transfer of P, K(+), Mg(2+) and Ca(2+) in the sludge phase, EPS, and the bulk liquid. In the sludge phase, about 30% P, 44.7% K(+), 27.7% Mg(2+), 28% Ca(2+) accumulated in the EPS at the end of aeration. The rate of P, K(+), Mg(2+) and Ca(2+) released from the EPS matrix into the bulk liquid in the anaerobic phase was faster than the rate they were adsorbed from the bulk liquid into the EPS in the aerobic phase. P, K(+), Mg(2+) and Ca(2+) were retained in EPS before transferring into the phosphorus accumulating organisms (PAOs). These results suggest that EPS play a critical role in facilitating the accumulation and transfer of P, K(+), Ca(2+) and Mg(2+) between PAO cells and bulk liquid. PMID:25063972

  4. Enhanced stability and dissolution of CuO nanoparticles by extracellular polymeric substances in aqueous environment

    Energy Technology Data Exchange (ETDEWEB)

    Miao, Lingzhan; Wang, Chao; Hou, Jun, E-mail: hhuhjyhj@126.com; Wang, Peifang; Ao, Yanhui; Li, Yi; Lv, Bowen; Yang, Yangyang; You, Guoxiang; Xu, Yi [Hohai University, Key Laboratory of Integrated Regulation and Resources Development on Shallow Lakes, Ministry of Education (China)

    2015-10-15

    Stability of engineered nanoparticles in aquatic environment is an essential parameter to evaluate their fate, bioavailability, and potential toxic effects toward living organisms. As CuO NPs enter the wastewater systems, they will encounter extracellular polymeric substances (EPS) from microbial community before directly interacting with bacterial cells. EPS may play an important role in affecting the stability and the toxicity of CuO NPs in aquatic environment. In this study, the influences of flocculent sludge-derived EPS, as well as model protein (BSA) and natural polysaccharides (alginate) on the dissolution kinetics and colloidal stability of CuO NPs were investigated. Results showed that the presence of NOMs strongly suppressed CuO NPs aggregation, confirmed by DLS, zeta potentials, and TEM analysis. The enhanced stability of CuO NPs in the presence of EPS and alginate were attributed to the electrostatic combined with steric repulsion, while the steric-hindrance effect may be the predominant mechanism retarding nano-CuO aggregation for BSA. Higher degrees of copper release were achieved with the increasing concentrations of NOMs. EPS are more effective than alginate and BSA in releasing copper, probably due to the abundant functional groups and the excellent metal-binding capacity. The ratio of free-Cu{sup 2+}/total dissolved Cu significantly decreased in the presence of EPS, indicating that EPS may affect the speciation and Cu bioavailability in aqueous environment. These results may be important for assessing the fate and transport behaviors of CuO NPs in the environment as well as for setting up usage regulation and treatment strategy.

  5. Enhanced stability and dissolution of CuO nanoparticles by extracellular polymeric substances in aqueous environment

    International Nuclear Information System (INIS)

    Stability of engineered nanoparticles in aquatic environment is an essential parameter to evaluate their fate, bioavailability, and potential toxic effects toward living organisms. As CuO NPs enter the wastewater systems, they will encounter extracellular polymeric substances (EPS) from microbial community before directly interacting with bacterial cells. EPS may play an important role in affecting the stability and the toxicity of CuO NPs in aquatic environment. In this study, the influences of flocculent sludge-derived EPS, as well as model protein (BSA) and natural polysaccharides (alginate) on the dissolution kinetics and colloidal stability of CuO NPs were investigated. Results showed that the presence of NOMs strongly suppressed CuO NPs aggregation, confirmed by DLS, zeta potentials, and TEM analysis. The enhanced stability of CuO NPs in the presence of EPS and alginate were attributed to the electrostatic combined with steric repulsion, while the steric-hindrance effect may be the predominant mechanism retarding nano-CuO aggregation for BSA. Higher degrees of copper release were achieved with the increasing concentrations of NOMs. EPS are more effective than alginate and BSA in releasing copper, probably due to the abundant functional groups and the excellent metal-binding capacity. The ratio of free-Cu2+/total dissolved Cu significantly decreased in the presence of EPS, indicating that EPS may affect the speciation and Cu bioavailability in aqueous environment. These results may be important for assessing the fate and transport behaviors of CuO NPs in the environment as well as for setting up usage regulation and treatment strategy.

  6. Increased extracellular dopamine and 5-hydroxytryptamine levels contribute to enhanced subthalamic nucleus neural activity during exhausting exercise

    OpenAIRE

    Hu, Y.; Liu, X.; D. QIAO

    2015-01-01

    The purpose of the study was to explore the mechanism underlying the enhanced subthalamic nucleus (STN) neural activity during exhausting exercise from the perspective of monoamine neurotransmitters and changes of their corresponding receptors. Rats were randomly divided into microdialysis and immunohistochemistry study groups. For microdialysis study, extracellular fluid of the STN was continuously collected with a microdialysis probe before, during and 90 min after one bout of exhausting ex...

  7. A Novel Compound Rasatiol Isolated from Raphanus sativus Has a Potential to Enhance Extracellular Matrix Synthesis in Dermal Fibroblasts

    OpenAIRE

    Roh, Seok-Seon; Park, Seung-Bae; Park, Seong-Mo; Choi, Byoung Wook; Lee, Min-Ho; Hwang, Yul-Lye; Kim, Chang Hun; Jeong, Hyun-Ah; Kim, Chang Deok; Lee, Jeung-Hoon

    2013-01-01

    Background The fibrous proteins of extracellular matrix (ECM) produced by dermal fibroblast contributes to the maintenance of connective tissue integrity. Objective This study is carried out to identify the bioactive ingredient from natural products that enhances ECM production in dermal fibroblasts. Methods Bioassay-directed fractionation was used to isolate the active ingredient from natural extracts. The effects of rasatiol (isolated from Raphanus sativus) on ECM production in primary cult...

  8. Incentives for smallholders to enhance the production of quality cocoa beans in Ghana: the role of institutions

    NARCIS (Netherlands)

    Quarmine, W.

    2013-01-01

      Cocoa beans from Ghana have a reputation of being of consistent quality. As such they sell at a premium on the international market. As a result of this quality reputation, Ghana is able to sell over 70% of its annual produce in forward markets. This trading practice ensur

  9. Increased extracellular dopamine and 5-hydroxytryptamine levels contribute to enhanced subthalamic nucleus neural activity during exhausting exercise.

    Science.gov (United States)

    Hu, Y; Liu, X; Qiao, D

    2015-09-01

    The purpose of the study was to explore the mechanism underlying the enhanced subthalamic nucleus (STN) neural activity during exhausting exercise from the perspective of monoamine neurotransmitters and changes of their corresponding receptors. Rats were randomly divided into microdialysis and immunohistochemistry study groups. For microdialysis study, extracellular fluid of the STN was continuously collected with a microdialysis probe before, during and 90 min after one bout of exhausting exercise. Dopamine (DA) and 5-hydroxytryptamine (5-HT) levels were subsequently detected with high-performance liquid chromatography (HPLC). For immunohistochemistry study, the expression of DRD2 and HT2C receptors in the STN, before, immediately after and 90 min after exhaustion was detected through immunohistochemistry technique. Microdialysis study results showed that the extracellular DA and 5-HT neurotransmitters increased significantly throughout the procedure of exhausting exercise and the recovery period (Prat STN immediately after exhausting exercise and at the time point of 90 min after exhaustion were both higher than those of the rest condition, but the difference was not significant (P>0.05). Our results suggest that the increased extracellular DA and 5-HT in the STN might be one important factor leading to the enhanced STN neural activity and the development of fatigue during exhausting exercise. This study may essentially offer useful evidence for better understanding of the mechanism of the central type of exercise-induced fatigue. PMID:26424920

  10. Laminin and biomimetic extracellular elasticity enhance functional differentiation in mammary epithelia

    Energy Technology Data Exchange (ETDEWEB)

    Alcaraz, Jordi; Xu, Ren; Mori, Hidetoshi; Nelson, Celeste M.; Mroue, Rana; Spencer, Virginia A.; Brownfield, Doug; Radisky, Derek C.; Bustamante, Carlos; Bissell, Mina J.

    2008-10-20

    In the mammary gland, epithelial cells are embedded in a 'soft' environment and become functionally differentiated in culture when exposed to a laminin-rich extracellular matrix gel. Here, we define the processes by which mammary epithelial cells integrate biochemical and mechanical extracellular cues to maintain their differentiated phenotype. We used single cells cultured on top of gels in conditions permissive for {beta}-casein expression using atomic force microscopy to measure the elasticity of the cells and their underlying substrata. We found that maintenance of {beta}-casein expression required both laminin signalling and a 'soft' extracellular matrix, as is the case in normal tissues in vivo, and biomimetic intracellular elasticity, as is the case in primary mammary epithelial organoids. Conversely, two hallmarks of breast cancer development, stiffening of the extracellular matrix and loss of laminin signalling, led to the loss of {beta}-casein expression and non-biomimetic intracellular elasticity. Our data indicate that tissue-specific gene expression is controlled by both the tissues unique biochemical milieu and mechanical properties, processes involved in maintenance of tissue integrity and protection against tumorigenesis.

  11. Enhancement of extracellular expression of Bacillus naganoensis pullulanase from recombinant Bacillus subtilis: Effects of promoter and host.

    Science.gov (United States)

    Song, Wan; Nie, Yao; Mu, Xiao Qing; Xu, Yan

    2016-08-01

    Pullulanase plays an important role in industrial applications of starch processing. However, extracellular production of pullulanase from recombinant Bacillus subtilis is yet limited due to the issues on regulatory elements of B. subtilis expression system. In this study, the gene encoding B. naganoensis pullulanase (PUL) was expressed in B. subtilis WB800 under the promoter PHpaII in the shuttle vector pMA0911. The extracellular activity of expressed pullulanase was 3.9 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-PHpaII-pul. To further enhance the yield of PUL, the promoter PHpaII in pMA0911 was replaced by a stronger constitutive promoter P43. Then the activity was increased to 8.7 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-P43-pul. Effect of host on pullulanase expression was further investigated by comparison between B. subtilis WB600 and B. subtilis WB800. In addition to the available B. subtilis WB800 recombinants, the constructed plasmids pMA0911-PHpaII-pul and pMA0911-P43-pul were transformed into B. subtilis WB600, respectively. Consequently, the extracellular production of PUL was significantly enhanced by B. subtilis WB600/pMA0911-P43-pul, resulting in the extracellular pullulanase activity of 24.5 U ml(-1). Therefore, promoter and host had an impact on pullulanase expression and their optimization would be useful to improve heterologous protein expression in B. subtilis. PMID:27109467

  12. Incentives for smallholders to enhance the production of quality cocoa beans in Ghana: the role of institutions

    OpenAIRE

    Quarmine, W.

    2013-01-01

      Cocoa beans from Ghana have a reputation of being of consistent quality. As such they sell at a premium on the international market. As a result of this quality reputation, Ghana is able to sell over 70% of its annual produce in forward markets. This trading practice ensures that farmers are protected from price fluctuation in the international market. Consequently, farmers, buyers, scientists and policy makers agree that sustaining Ghana’s premium quality position on the intern...

  13. Extracellular control of intracellular drug release for enhanced safety of anti-cancer chemotherapy

    Science.gov (United States)

    Zhu, Qian; Qi, Haixia; Long, Ziyan; Liu, Shang; Huang, Zhen; Zhang, Junfeng; Wang, Chunming; Dong, Lei

    2016-06-01

    The difficulty of controlling drug release at an intracellular level remains a key challenge for maximising drug safety and efficacy. We demonstrate herein a new, efficient and convenient approach to extracellularly control the intracellular release of doxorubicin (DOX), by designing a delivery system that harnesses the interactions between the system and a particular set of cellular machinery. By simply adding a small-molecule chemical into the cell medium, we could lower the release rate of DOX in the cytosol, and thereby increase its accumulation in the nuclei while decreasing its presence at mitochondria. Delivery of DOX with this system effectively prevented DOX-induced mitochondria damage that is the main mechanism of its toxicity, while exerting the maximum efficacy of this anti-cancer chemotherapeutic agent. The present study sheds light on the design of drug delivery systems for extracellular control of intracellular drug delivery, with immediate therapeutic implications.

  14. Semi-continuous in situ magnetic separation for enhanced extracellular protease productionmodeling and experimental validation

    DEFF Research Database (Denmark)

    Cerff, M.; Scholz, A.; Käppler, T.;

    2013-01-01

    In modern biotechnology proteases play a major role as detergent ingredients. Especially the production of extracellular protease by Bacillus species facilitates downstream processing because the protease can be directly harvested from the biosuspension. In situ magnetic separation (ISMS) constit...... production, and was used to optimize ISMS steps to obtain the maximum overall protease yield. Biotechnol. Bioeng. 2013; 110: 2161–2172. © 2013 Wiley Periodicals, Inc....

  15. An extracellular matrix, calmodulin-binding protein from Dictyostelium with EGF-like repeats that enhance cell motility.

    Science.gov (United States)

    Suarez, Andres; Huber, Robert J; Myre, Michael A; O'Day, Danton H

    2011-07-01

    CyrA is a novel cysteine-rich protein with four EGFL repeats that was isolated using the calmodulin (CaM) binding overlay technique (CaMBOT), suggesting it is a CaM-binding protein (CaMBP). The full-length 63kDa cyrA is cleaved into two major C-terminal fragments, cyrA-C45 and cyrA-C40. A putative CaM-binding domain was detected and both CaM-agarose binding and CaM immunoprecipitation verified that cyrA-C45 and cyrA-C40 each bind to CaM in both a Ca(2+)-dependent and -independent manner. cyrA-C45 was present continuously throughout growth and development but was secreted at high levels during the multicellular slug stage of Dictyostelium development. At this time, cyrA localizes to the extracellular matrix (ECM). ECM purification verified the presence of cyrA-C45. An 18 amino acid peptide (DdEGFL1) from the first EGFL repeat sequence of cyrA (EGFL1) that is present in both cyrA-C45 and -C40 enhances both random cell motility and cAMP-mediated chemotaxis. Here we reveal that the dose-dependent enhancement of motility by DdEGFL1 is related to the time of cell starvation. Addition of DdEGFL1 also inhibits cyrA proteolysis. The status of cyrA as an extracellular CaMBP was further clarified by the demonstration that CaM is secreted during development. Antagonism of CaM with W7 resulted in enhanced cyrA proteolysis suggesting a functional role for extracellular CaM in protecting CaMBPs from proteolysis. cyrA is the first extracellular CaMBP identified in Dictyostelium and since it is an ECM protein with EGF-like repeats that enhance cell motility and it likely also represents the first matricellular protein identified in a lower eukaryote. PMID:21402150

  16. Enhanced accumulation of adipocytes in bone marrow stromal cells in the presence of increased extracellular and intracellular [Ca2+

    International Nuclear Information System (INIS)

    Highlights: ► High [Ca2+]o enhances adipocyte accumulation in the presence of adipogenic inducers. ► High [Ca2+]o enhances both proliferation and adipocyte differentiation in BMSCs. ► High [Ca2+]o induces an increase in [Ca2+]o in BMSCs. ► An intracellular Ca2+ chelator suppresses the enhancement in adipocyte accumulation. ► Controlling [Ca2+]o may govern the balance of adipocyte and osteoblast development. -- Abstract: The bone marrow stroma contains osteoblasts and adipocytes that have a common precursor: the pluripotent mesenchymal stem cell found in bone marrow stromal cells (BMSCs). Local bone marrow Ca2+ levels can reach high concentrations due to bone resorption, which is one of the notable features of the bone marrow stroma. Here, we describe the effects of high [Ca2+]o on the accumulation of adipocytes in the bone marrow stroma. Using primary mouse BMSCs, we evaluated the level of adipocyte accumulation by measuring Oil Red O staining and glycerol-3-phosphate dehydrogenase (GPDH) activity. High [Ca2+]o enhanced the accumulation of adipocytes following treatment with both insulin and dexamethasone together but not in the absence of this treatment. This enhanced accumulation was the result of both the accelerated proliferation of BMSCs and their differentiation into adipocytes. Using the fura-2 method, we also showed that high [Ca2+]o induces an increase in [Ca2+]i. An intracellular Ca2+ chelator suppressed the enhancement in adipocyte accumulation due to increased [Ca2+]o in BMSCs. These data suggest a new role for extracellular Ca2+ in the bone marrow stroma: increased [Ca2+]o induces an increase in [Ca2+]i levels, which in turn enhances the accumulation of adipocytes under certain conditions.

  17. Elevation of extracellular adenosine enhances haemopoiesis-stimulating effects of G-CSF in normal and gamma-irradiated mice

    International Nuclear Information System (INIS)

    Effects of combined treatment with drugs elevating extracellular adenosine (dipyridamole /DP/, inhibiting the extracellular uptake of adenosine, and adenosine monophosphate /AMP/, an adenosine pro-drug), and G-CSF (granulocyte colony-stimulating factor) on haemopoiesis of normal and gamma-irradiated mice were ascertained. The agents were administered alone or in combination in a 4-day regimen. In normal, unirradiated animals, the haematological endpoints were determined 24 hours after the completion of the treatment. It was shown that the effects of G-CSF, i.e., increases in peripheral blood neutrophils, granulocyte-macrophage progenitor cells (GM-CFC) and morphologically recognizable granulocyte cells in femoral marrow and a decrease in the marrow erythroid cells, can be enhanced by the combination of DP plus AMP administrated 30 minutes before G-CSF. Furthermore, it was found that the stimulatory action of DP plus AMP was expressed particularly at lower doses of G-CSF (1.5, 3, and 4.5 μg/d). In experiments with irradiated mice, when the 4-day therapeutic regimen was applied on days 3 to 6 following irradiation with the dose of 4 Gy, analogical stimulation of granulopoiesis was observed in the recovery phase on days 14 and 18 after irradiation. As example, see Fig. 1 for counts of granulocyte cells in femoral bone marrow. (authors)

  18. Human VE-Cadherin Fusion Protein as an Artificial Extracellular Matrix Enhancing the Proliferation and Differentiation Functions of Endothelial Cell.

    Science.gov (United States)

    Xu, Ke; Shuai, Qizhi; Li, Xiaoning; Zhang, Yan; Gao, Chao; Cao, Lei; Hu, Feifei; Akaike, Toshihiro; Wang, Jian-Xi; Gu, Zhongwei; Yang, Jun

    2016-03-14

    In an attempt to enhance endothelial cell capture and promote the vascularization of engineered tissue, we biosynthesized and characterized the recombinant fusion protein consisting of human vascular endothelial-cadherin extracellular domain and immunoglobulin IgG Fc region (hVE-cad-Fc) to serve as a bioartificial extracellular matrix. The hVE-cad-Fc protein naturally formed homodimers and was used to construct hVE-cad-Fc matrix by stably adsorbing on polystyrene plates. Atomic force microscop assay showed uniform hVE-cad-Fc distribution with nanorod topography. The hVE-cad-Fc matrix markedly promoted human umbilical vein endothelial cells (HUVECs) adhesion and proliferation with fibroblastoid morphology. Additionally, the hVE-cad-Fc matrix improved HUVECs migration, vWF expression, and NO release, which are closely related to vascularization. Furthermore, the hVE-cad-Fc matrix activated endogenous VE-cadherin/β-catenin proteins and effectively triggered the intracellular signals such as F-actin stress fiber, p-FAK, AKT, and Bcl-2. Taken together, hVE-cad-Fc could be a promising bioartificial matrix to promote vascularization in tissue engineering. PMID:26859785

  19. Elevation of extracellular adenosine enhances haemopoiesis-stimulating effects of G-CSF in normal and gamma-irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Hofer, M.; Pospisil, M.; Netikiva, J.; Hola, J. [Institute of Biophysics, Academy of Sciences of the Czech Republic (Czech Republic)

    1997-03-01

    Effects of combined treatment with drugs elevating extracellular adenosine (dipyridamole /DP/, inhibiting the extracellular uptake of adenosine, and adenosine monophosphate /AMP/, an adenosine pro-drug), and G-CSF (granulocyte colony-stimulating factor) on haemopoiesis of normal and gamma-irradiated mice were ascertained. The agents were administered alone or in combination in a 4-day regimen. In normal, unirradiated animals, the haematological endpoints were determined 24 hours after the completion of the treatment. It was shown that the effects of G-CSF, i.e., increases in peripheral blood neutrophils, granulocyte-macrophage progenitor cells (GM-CFC) and morphologically recognizable granulocyte cells in femoral marrow and a decrease in the marrow erythroid cells, can be enhanced by the combination of DP plus AMP administrated 30 minutes before G-CSF. Furthermore, it was found that the stimulatory action of DP plus AMP was expressed particularly at lower doses of G-CSF (1.5, 3, and 4.5 {mu}g/d). In experiments with irradiated mice, when the 4-day therapeutic regimen was applied on days 3 to 6 following irradiation with the dose of 4 Gy, analogical stimulation of granulopoiesis was observed in the recovery phase on days 14 and 18 after irradiation. As example, see Fig. 1 for counts of granulocyte cells in femoral bone marrow. (authors)

  20. Enhanced resistance to nanoparticle toxicity is conferred by overproduction of extracellular polymeric substances

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Nimisha, E-mail: joshi.nimisha@gmail.com [School of GeoSciences, Microbial Geochemistry Laboratory, University of Edinburgh, West Mains Road, Edinburgh EH9 3JW (United Kingdom); Ngwenya, Bryne T. [School of GeoSciences, Microbial Geochemistry Laboratory, University of Edinburgh, West Mains Road, Edinburgh EH9 3JW (United Kingdom); French, Christopher E. [School of Biological Sciences, Institute of Cell Biology, Darwin Building, University of Edinburgh, Mayfield Road, Edinburgh EH9 3JR (United Kingdom)

    2012-11-30

    Highlights: Black-Right-Pointing-Pointer Demonstration that bacteria engineered for EPS overproduction have better survival against Ag nanotoxicity. Black-Right-Pointing-Pointer EPS destabilises Ag nanoparticles and promotes their aggregation. Black-Right-Pointing-Pointer TEM demonstration that EPS traps the Ag nanoparticles outside the cell. Black-Right-Pointing-Pointer EPS from overexpressing strains offers protection to non-EPS strains of bacteria. Black-Right-Pointing-Pointer EPS polymer analogues such as xanthan also produce a similar response. - Abstract: The increasing production and use of engineered nanoparticles, coupled with their demonstrated toxicity to different organisms, demands the development of a systematic understanding of how nanoparticle toxicity depends on important environmental parameters as well as surface properties of both cells and nanomaterials. We demonstrate that production of the extracellular polymeric substance (EPS), colanic acid by engineered Escherichia coli protects the bacteria against silver nanoparticle toxicity. Moreover, exogenous addition of EPS to a control strain results in an increase in cell viability, as does the addition of commercial EPS polymer analogue xanthan. Furthermore, we have found that an EPS producing strain of Sinorhizobium meliloti shows higher survival upon exposure to silver nanoparticles than the parent strain. Transmission electron microscopy (TEM) observations showed that EPS traps the nanoparticles outside the cells and reduces the exposed surface area of cells to incoming nanoparticles by inducing cell aggregation. Nanoparticle size characterization in the presence of EPS and xanthan indicated a marked tendency towards aggregation. Both are likely effective mechanisms for reducing nanoparticle toxicity in the natural environment.

  1. Enhanced resistance to nanoparticle toxicity is conferred by overproduction of extracellular polymeric substances

    International Nuclear Information System (INIS)

    Highlights: ► Demonstration that bacteria engineered for EPS overproduction have better survival against Ag nanotoxicity. ► EPS destabilises Ag nanoparticles and promotes their aggregation. ► TEM demonstration that EPS traps the Ag nanoparticles outside the cell. ► EPS from overexpressing strains offers protection to non-EPS strains of bacteria. ► EPS polymer analogues such as xanthan also produce a similar response. - Abstract: The increasing production and use of engineered nanoparticles, coupled with their demonstrated toxicity to different organisms, demands the development of a systematic understanding of how nanoparticle toxicity depends on important environmental parameters as well as surface properties of both cells and nanomaterials. We demonstrate that production of the extracellular polymeric substance (EPS), colanic acid by engineered Escherichia coli protects the bacteria against silver nanoparticle toxicity. Moreover, exogenous addition of EPS to a control strain results in an increase in cell viability, as does the addition of commercial EPS polymer analogue xanthan. Furthermore, we have found that an EPS producing strain of Sinorhizobium meliloti shows higher survival upon exposure to silver nanoparticles than the parent strain. Transmission electron microscopy (TEM) observations showed that EPS traps the nanoparticles outside the cells and reduces the exposed surface area of cells to incoming nanoparticles by inducing cell aggregation. Nanoparticle size characterization in the presence of EPS and xanthan indicated a marked tendency towards aggregation. Both are likely effective mechanisms for reducing nanoparticle toxicity in the natural environment.

  2. Enhanced airway smooth muscle cell thromboxane receptor signaling via activation of JNK MAPK and extracellular calcium influx

    DEFF Research Database (Denmark)

    Lei, Ying; Cao, Yongxiao; Zhang, Yaping;

    2011-01-01

    airway smooth muscle cells by using an organ culture model and a set of selective pharmacological inhibitors for mitogen-activated protein kinase (MAPK) and calcium signal pathways. Western-blot, immunohistochemistry, myograph and a selective TP receptor agonist U46619 were used for examining TP receptor...... signal proteins and function. Organ culture of rat bronchial segments for up to 48 h induces a time-dependently increased airway contractile response to U46619. This indicates that organ culture increases TP receptor signaling in the airway smooth muscle cells. The enhanced bronchial contraction was...... attenuated by the inhibition of c-Jun N-terminal kinase (JNK) MAPK activity, chelation of extracellular calcium and calcium channel blocker nifedipine, suggesting that JNK MAPK activity and elevated intracellular calcium level are required for the TP receptor signaling. In conclusion, airway smooth muscle...

  3. Phosphotidylserine exposure and neutrophil extracellular traps enhance procoagulant activity in patients with inflammatory bowel disease.

    Science.gov (United States)

    He, Zhangxiu; Si, Yu; Jiang, Tao; Ma, Ruishuang; Zhang, Yan; Cao, Muhua; Li, Tao; Yao, Zhipeng; Zhao, Lu; Fang, Shaohong; Yu, Bo; Dong, Zengxiang; Thatte, Hemant S; Bi, Yayan; Kou, Junjie; Yang, Shufen; Piao, Daxun; Hao, Lirong; Zhou, Jin; Shi, Jialan

    2016-04-01

    Inflammatory bowel disease (IBD)-associated thromboembolic event often lacks precise aetiology. The aim of this study was to investigate the contribution of phosphatidylserine (PS) exposure and neutrophil extracellular traps (NETs) towards the hypercoagulable state in IBD. We demonstrated that the levels of PS exposed MPs and the sources of MP-origin, platelets, erythrocytes, leukocytes and cultured endothelial cells (ECs) were higher in IBD groups than in healthy controls using flow cytometry and confocal microscopy. Wright-Giemsa and immunofluorescence staining demonstrated that the elevated NETs were released by activated IBD neutrophils or by control neutrophils treated with IBD sera obtained from patients with the active disease. MPs and MP-origin cells in IBD groups, especially in active stage, markedly shortened coagulation time and had increased levels of fibrin, thrombin and FXa production as assessed by coagulation function assays. Importantly, we found that on stimulated ECs, PS rich membranes provided binding sites for FXa and FVa, promoting fibrin formation while TNF blockage or IgG depletion attenuated this effect. Treatment of control neutrophils with TNF and isolated IgG from PR3-ANCA-positive active IBD patients also resulted in the release of NETs. Blockade of PS with lactadherin prolonged coagulation time, decreased fibrin formation to control levels, and inhibited the procoagulant enzymes production in the MPs and MP-origin cells. NET cleavage by DNase I partly decreased PCA in IBD or stimulated neutrophils. Our study reveals a previously unrecognised link between hypercoagulable state and PS exposure or NETs, and may further explain the epidemiological association of thrombosis within IBD patients. PMID:26660948

  4. PEGylated and targeted extracellular vesicles display enhanced cell specificity and circulation time.

    Science.gov (United States)

    Kooijmans, S A A; Fliervoet, L A L; van der Meel, R; Fens, M H A M; Heijnen, H F G; van Bergen En Henegouwen, P M P; Vader, P; Schiffelers, R M

    2016-02-28

    Extracellular vesicles (EVs) are increasingly being recognized as candidate drug delivery systems due to their ability to functionally transfer biological cargo between cells. However, the therapeutic applicability of EVs may be limited due to a lack of cell-targeting specificity and rapid clearance of exogenous EVs from the circulation. In order to improve EV characteristics for drug delivery to tumor cells, we have developed a novel method for decorating EVs with targeting ligands conjugated to polyethylene glycol (PEG). Nanobodies specific for the epidermal growth factor receptor (EGFR) were conjugated to phospholipid (DMPE)-PEG derivatives to prepare nanobody-PEG-micelles. When micelles were mixed with EVs derived from Neuro2A cells or platelets, a temperature-dependent transfer of nanobody-PEG-lipids to the EV membranes was observed, indicative of a 'post-insertion' mechanism. This process did not affect EV morphology, size distribution, or protein composition. After introduction of PEG-conjugated control nanobodies to EVs, cellular binding was compromised due to the shielding properties of PEG. However, specific binding to EGFR-overexpressing tumor cells was dramatically increased when EGFR-specific nanobodies were employed. Moreover, whereas unmodified EVs were rapidly cleared from the circulation within 10min after intravenous injection in mice, EVs modified with nanobody-PEG-lipids were still detectable in plasma for longer than 60min post-injection. In conclusion, we propose post-insertion as a novel technique to confer targeting capacity to isolated EVs, circumventing the requirement to modify EV-secreting cells. Importantly, insertion of ligand-conjugated PEG-derivatized phospholipids in EV membranes equips EVs with improved cell specificity and prolonged circulation times, potentially increasing EV accumulation in targeted tissues and improving cargo delivery. PMID:26773767

  5. Disassembling bacterial extracellular matrix with DNase-coated nanoparticles to enhance antibiotic delivery in biofilm infections.

    Science.gov (United States)

    Baelo, Aida; Levato, Riccardo; Julián, Esther; Crespo, Anna; Astola, José; Gavaldà, Joan; Engel, Elisabeth; Mateos-Timoneda, Miguel Angel; Torrents, Eduard

    2015-07-10

    Infections caused by biofilm-forming bacteria are a major threat to hospitalized patients and the main cause of chronic obstructive pulmonary disease and cystic fibrosis. There is an urgent necessity for novel therapeutic approaches, since current antibiotic delivery fails to eliminate biofilm-protected bacteria. In this study, ciprofloxacin-loaded poly(lactic-co-glycolic acid) nanoparticles, which were functionalized with DNase I, were fabricated using a green-solvent based method and their antibiofilm activity was assessed against Pseudomonas aeruginosa biofilms. Such nanoparticles constitute a paradigm shift in biofilm treatment, since, besides releasing ciprofloxacin in a controlled fashion, they are able to target and disassemble the biofilm by degrading the extracellular DNA that stabilize the biofilm matrix. These carriers were compared with free-soluble ciprofloxacin, and ciprofloxacin encapsulated in untreated and poly(lysine)-coated nanoparticles. DNase I-activated nanoparticles were not only able to prevent biofilm formation from planktonic bacteria, but they also successfully reduced established biofilm mass, size and living cell density, as observed in a dynamic environment in a flow cell biofilm assay. Moreover, repeated administration over three days of DNase I-coated nanoparticles encapsulating ciprofloxacin was able to reduce by 95% and then eradicate more than 99.8% of established biofilm, outperforming all the other nanoparticle formulations and the free-drug tested in this study. These promising results, together with minimal cytotoxicity as tested on J774 macrophages, allow obtaining novel antimicrobial nanoparticles, as well as provide clues to design the next generation of drug delivery devices to treat persistent bacterial infections. PMID:25913364

  6. Granulocyte colony-stimulating factor and drugs elevating extracellular adenosine synergize to enhance haematopoietic reconstitution in irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Pospisil, M.; Hofer, M.; Netikova, J.; Hola, J.; Vacek, A. [Academy of Sciences of the Czech Republic, Inst. of Biophysics, Brno (Czech Republic); Znojil, V.; Vacha, J. [Masaryk Univ., Medical Faculty, Brno (Czech Republic)

    1998-03-01

    The activation of adenosine receptors has recently been demonstrated to stimulate haematopoiesis. In the present study, we investigated the ability of drugs elevating extracellular adenosine to influence curative effects of granulocyte colony-stimulating factor (G-CSF) in mice exposed to a sublethal dose of 4 Gy of {sup 60}Co radiation. Elevation of extracellular adenosine in mice was induced by the combined administration of dipyridamole, a drug inhibiting the cellular uptake of adenosine, and adenosine monophosphate (AMP), an adenosine prodrug. The effects of dipyridamole plus AMP, and G-CSF, administered either alone or in combination, were evaluated. The drugs were injected to mice in a 4-d treatment regimen starting on d 3 after irradiation and the haematopoietic response was evaluated on d 7, 10, 14, 18 and 24 after irradiation. While the effects of G-CSF on the late maturation stages of blood cells, appearing shortly after the completion of the treatment, were not influenced by dipyridamole plus AMP, positive effects of the combination therapy occurred in the post-irradiation recovery phase which is dependent on the repopulation of haematopoietic stem cells. This was indicated by the significant elevation of counts of granulocyte-macrophage progenitor cells (GM-CFC) and granulocytic cells in the bone marrow (d 14), of GM-CFC (d 14), granulocytic and erythroid cells (d 14 and 18) in the spleen, and of neutrophils (d 18), monocytes (d 14 and 18) and platelets (d 18) in the peripheral blood. These effects suggest that the repopulation potential of the combination therapy lies in a common multi-lineage cell population. The results of this study implicate the promising possibility to enhance the curative effects of G-CSF under conditions of myelosuppressive state induced by radiation exposure. (au) 43 refs.

  7. An efficient protocol to enhance the extracellular production of recombinant protein from Escherichia coli by the synergistic effects of sucrose, glycine, and Triton X-100.

    Science.gov (United States)

    Bao, Ru-Meng; Yang, Hong-Ming; Yu, Chang-Mei; Zhang, Wei-Fen; Tang, Jin-Bao

    2016-10-01

    Targeting recombinant proteins at highly extracellular production in the culture medium of Escherichia coli presents a significant advantage over cytoplasmic or periplasmic expression. In this work, a recombinant protein between ZZ protein and alkaline phosphatase (rZZ-AP) was constructed. Because rZZ-AP has the IgG-binding capacity and enzymatic activity, it can serve as an immunoreagent in immunoassays. However, only a very small portion of rZZ-AP is generally secreted into the aqueous medium under conventional cultivation procedure. Hence, we emphasized on the optimization of the culture procedures and attempted to dramatically enhance the yield of extracellular rZZ-AP from E. coli HB101 host cells by adding sucrose, glycine, and Triton X-100 in the culture medium. Results showed that the extracellular production of rZZ-AP in the culture medium containing 5% sucrose, 1% glycine, and 1% Triton X-100 was 18.6 mg/l, which was 18.6-fold higher than that without the three chemicals. And the β-galactosidase activity test showed that the increased extracellular rZZ-AP was not due to cell lysis. Further analysis suggested a significant interaction effect among the three chemicals for the enhancement of extracellular production. Ultrastructural analysis indicated that the enhancement may be due to the influence of sucrose, glycine, and Triton X-100 on the periplasmic osmolality, permeability, or integrity of the cell wall, respectively. This proposed approach presents a simple strategy to enhance the extracellular secretion of recombinant proteins in the E. coli system at the process of cell cultivation. PMID:27189822

  8. Tumour cell–derived extracellular vesicles interact with mesenchymal stem cells to modulate the microenvironment and enhance cholangiocarcinoma growth

    Directory of Open Access Journals (Sweden)

    Hiroaki Haga

    2015-01-01

    Full Text Available The contributions of mesenchymal stem cells (MSCs to tumour growth and stroma formation are poorly understood. Tumour cells can transfer genetic information and modulate cell signalling in other cells through the release of extracellular vesicles (EVs. We examined the contribution of EV-mediated inter-cellular signalling between bone marrow MSCs and tumour cells in human cholangiocarcinoma, highly desmoplastic cancers that are characterized by tumour cells closely intertwined within a dense fibrous stroma. Exposure of MSCs to tumour cell–derived EVs enhanced MSC migratory capability and expression of alpha-smooth muscle actin mRNA, in addition to mRNA expression and release of CXCL-1, CCL2 and IL-6. Conditioned media from MSCs exposed to tumour cell–derived EVs increased STAT-3 phosphorylation and proliferation in tumour cells. These effects were completely blocked by anti-IL-6R antibody. In conclusion, tumour cell–derived EVs can contribute to the generation of tumour stroma through fibroblastic differentiation of MSCs, and can also selectively modulate the cellular release of soluble factors such as IL-6 by MSCs that can, in turn, alter tumour cell proliferation. Thus, malignant cells can “educate” MSCs to induce local microenvironmental changes that enhance tumour cell growth.

  9. Enhanced transcription of contractile 5-hydroxytryptamine 2A receptors via extracellular signal-regulated kinase 1/2 after organ culture of rat mesenteric artery

    DEFF Research Database (Denmark)

    Cao, Yong-Xiao; He, Lang-Chong; Xu, Cang-Bao;

    2005-01-01

    5-Hydroxytryptamine (5-HT) has been found to elicit enhanced contractile effects in some vascular disorders. The present study was designed to examine if vascular 5-HT2A receptors are up-regulated during organ culture and if the extracellular signal-regulated protein kinase 1/2 (ERK1/2) pathways ...

  10. Fungal decontamination and enhancement of shelf life of edible split beans of wild legume Canavalia maritima by the electron beam irradiation

    Science.gov (United States)

    Supriya, P.; Sridhar, K. R.; Ganesh, S.

    2014-03-01

    Ripened split beans of the coastal sand dune wild legume Canavalia maritima serve as one of the traditional nutritional sources of the coastal dwellers in Southwest coast of India. Nine fungi were isolated from the unirradiated dry beans by plating on the potato dextrose agar medium. Toxigenic fungus Aspergillus niger showed the highest incidence (33-50%) followed by Aspergillus flavus (14-20%) and Penicillium chrysogenum (7-13%). Unirradiated dry beans and irradiated dry beans with electron beam doses 2.5, 5, 10 and 15 kGy were monitored for occurrence of fungal species and their incidence during 0, 3 and 6 months storage period under laboratory conditions. Irradiation resulted in dose-dependent decrease in fungal species (5-7, 4-6, 3-6 and 0 on irradiation at 0, 2.5, 5 and 10 or 15 kGy, respectively) as well as incidence (80-99, 19-46, 13-21 and 0%, respectively). Although aflatoxins (B1 and B2) were found below detectable level (<2 ng/g) in 0, 3 and 6 months stored unirradiated and irradiated beans (2.5 and 5 kGy), they were not present in beans irradiated with 10 and 15 kGy. In spite of occurrence of toxigenic fungus Aspergillus ochraceus in unirradiated and irradiated beans (2.5 and 5 kGy) stored for 3 and 6 months, the beans were devoid of ochratoxin-A. Electron beam irradiation dose 10 kGy could be recommended for fungal decontamination and improvement of shelf life of C. maritima ripened dry split beans.

  11. TOL Plasmid Carriage Enhances Biofilm Formation and Increases Extracellular DNA Content in Pseudomonas Putida KT2440

    DEFF Research Database (Denmark)

    Smets, Barth F.; D'Alvise, Paul; Yankelovich, T.;

    Adherent growth of Pseudomonas putida KT2440 with and without the TOL plasmid (pWWO) at the solid-liquid and air-liquid interface was examined. We compared biofilm formation on glass in flow cells, and assayed pellicle (air-liquid interface biofilm) formation in stagnant liquid cultures by confocal...... laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid- specific stains (cytox orange, propidium iodide) revealed differences in production...... combined with specific cytostains; release of cytoplasmic material was assayed by a β-glucosidase assay. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads to increased biofilm formation...

  12. Enhancement of rat bladder contraction by artificial sweeteners via increased extracellular Ca2+ influx

    International Nuclear Information System (INIS)

    Introduction: Consumption of carbonated soft drinks has been shown to be independently associated with the development of overactive bladder symptoms (OR 1.62, 95% CI 1.18, 2.22) [Dallosso, H.M., McGrother, C.W., Matthews, R.J., Donaldson, M.M.K., 2003. The association of diet and other lifestyle factors with overactive bladder and stress incontinence: a longitudinal study in women. BJU Int. 92, 69-77]. We evaluated the effects of three artificial sweeteners, acesulfame K, aspartame and sodium saccharin, on the contractile response of isolated rat detrusor muscle strips. Methods: Strips of detrusor muscle were placed in an organ bath and stimulated with electrical field stimulation (EFS) in the absence and presence of atropine, and with α,β methylene ATP, potassium, calcium and carbachol. Results: Sweeteners 10-7 M to 10-2 M enhanced the contractile response to 10 Hz EFS compared to control (p -6 M, aspartame 10-7 M and sodium saccharin 10-7 M. Acesulfame K 10-6 M increased the maximum contractile response to α,β methylene ATP by 35% (± 9.6%) (p -6 M increased the log EC5 from -2.79 (± 0.037) to -3.03 (± 0.048, p -7 M from -2.74 (± 0.03) to 2.86 (± 0.031, p +2 channels

  13. Incentives for cocoa bean production in Ghana: Does quality matter?

    NARCIS (Netherlands)

    Quarmine, W.; Haagsma, R.; Sakyi-Dawson, O.; Asante, F.; Huis, van A.; Obeng-Ofori, D.

    2012-01-01

    This paper investigates the institutional factors that constrain farmers’ incentives to enhance the quality of cocoa beans in Ghana. Data were collected at three levels of aggregation in the cocoa bean value chain: village, district, and national level. Multi-stage cluster sampling was employed to s

  14. Fungal decontamination and enhancement of shelf life of edible split beans of wild legume Canavalia maritima by the electron beam irradiation

    International Nuclear Information System (INIS)

    Ripened split beans of the coastal sand dune wild legume Canavalia maritima serve as one of the traditional nutritional sources of the coastal dwellers in Southwest coast of India. Nine fungi were isolated from the unirradiated dry beans by plating on the potato dextrose agar medium. Toxigenic fungus Aspergillus niger showed the highest incidence (33–50%) followed by Aspergillus flavus (14–20%) and Penicillium chrysogenum (7–13%). Unirradiated dry beans and irradiated dry beans with electron beam doses 2.5, 5, 10 and 15 kGy were monitored for occurrence of fungal species and their incidence during 0, 3 and 6 months storage period under laboratory conditions. Irradiation resulted in dose-dependent decrease in fungal species (5–7, 4–6, 3–6 and 0 on irradiation at 0, 2.5, 5 and 10 or 15 kGy, respectively) as well as incidence (80–99, 19–46, 13–21 and 0%, respectively). Although aflatoxins (B1 and B2) were found below detectable level (1 and B2). • Irradiated split beans (10 kGy) showed improved shelf life up to six months without deterioration under normal laboratory conditions

  15. Alteration of cell-wall porosity is involved in osmotic stress-induced enhancement of aluminium resistance in common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Yang, Zhong-Bao; Eticha, Dejene; Rao, Idupulapati Madhusudana; Horst, Walter Johannes

    2010-07-01

    Aluminium (Al) toxicity and drought are the two major abiotic stress factors limiting common bean production in the tropics. Using hydroponics, the short-term effects of combined Al toxicity and drought stress on root growth and Al uptake into the root apex were investigated. In the presence of Al stress, PEG 6000 (polyethylene glycol)-induced osmotic (drought) stress led to the amelioration of Al-induced inhibition of root elongation in the Al-sensitive genotype VAX 1. PEG 6000 (> PEG 1000) treatment greatly decreased Al accumulation in the 1 cm root apices even when the roots were physically separated from the PEG solution using dialysis membrane tubes. Upon removal of PEG from the treatment solution, the root tips recovered from osmotic stress and the Al accumulation capacity was quickly restored. The PEG-induced reduction of Al accumulation was not due to a lower phytotoxic Al concentration in the treatment solution, reduced negativity of the root apoplast, or to enhanced citrate exudation. Also cell-wall (CW) material isolated from PEG-treated roots showed a low Al-binding capacity which, however, was restored after destroying the physical structure of the CW. The comparison of the Al(3+), La(3+), Sr(2+), and Rb(+) binding capacity of the intact root tips and the isolated CW revealed the specificity of the PEG 6000 effect for Al. This could be due to the higher hydrated ionic radius of Al(3+) compared with other cations (Al(3+) > La(3+) > Sr(2+) > Rb(+)). In conclusion, the results provide circumstantial evidence that the osmotic stress-inhibited Al accumulation in root apices and thus reduced Al-induced inhibition of root elongation in the Al-sensitive genotype VAX 1 is related to the alteration of CW porosity resulting from PEG 6000-induced dehydration of the root apoplast. PMID:20511277

  16. Effects of combined traditional processing methods on the nutritional quality of beans

    OpenAIRE

    Nakitto, Aisha M; Muyonga, John H.; Nakimbugwe, Dorothy

    2015-01-01

    Consumption of dry beans is limited by long cooking times thus high fuel requirement. The bioavailability of nutrients in beans is also limited due to presence of antinutrients such as phytates and tannins. Little research has been done on combined processing methods for production of nutritious fast cooking bean flour and the effect of combined treatments on nutritional quality of beans has not previously determined. The aim of this study was to reduce cooking time and enhance the nutritiona...

  17. Adenovirus-induced extracellular signal-regulated kinase phosphorylation during the late phase of infection enhances viral protein levels and virus progeny

    DEFF Research Database (Denmark)

    Schümann, Michael; Dobbelstein, Matthias

    2006-01-01

    . Hence, adenovirus induces the oncogenic Raf/MEK/ERK signaling pathway to enhance viral progeny by sustaining the levels of viral proteins. Concerning therapy, our results suggest that the use of Raf/MEK/ERK inhibitors will interfere with the propagation of oncolytic adenoviruses.......The Raf/mitogen-activated protein/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK signaling cascade enhances tumor cell proliferation in many cases. Here, we show that adenovirus type 5, a small DNA tumor virus used in experimental cancer therapy, strongly induces ERK phosphorylation...

  18. Effects of combined traditional processing methods on the nutritional quality of beans

    Science.gov (United States)

    Nakitto, Aisha M; Muyonga, John H; Nakimbugwe, Dorothy

    2015-01-01

    Consumption of dry beans is limited by long cooking times thus high fuel requirement. The bioavailability of nutrients in beans is also limited due to presence of antinutrients such as phytates and tannins. Little research has been done on combined processing methods for production of nutritious fast cooking bean flour and the effect of combined treatments on nutritional quality of beans has not previously determined. The aim of this study was to reduce cooking time and enhance the nutritional value of dry beans. Specifically to: develop protocols for production of fast cooking bean flours and assess the effect of processing on the nutritional characteristics of the flours. Dry beans (K131 variety) were soaked for 12 h; sprouted for 48 h; dehulled and steamed for 25 and 15 min for whole and dehulled beans respectively or roasted at 170°C for 45 and 15 min for whole and dehulled beans respectively. Dehulling eliminated phytates and tannins and increased protein digestibility. In vitro protein digestibility and mineral (iron and zinc) extractability were negatively correlated with tannin and phytate content. Total available carbohydrates were highest in moist heat-treated bean flours. Overall, combined processing of beans improved the nutritional quality of dry beans and the resulting precooked flours need less cooking time compared to whole dry beans. PMID:25987998

  19. FAP-overexpressing fibroblasts produce an extracellular matrix that enhances invasive velocity and directionality of pancreatic cancer cells

    International Nuclear Information System (INIS)

    Alterations towards a permissive stromal microenvironment provide important cues for tumor growth, invasion, and metastasis. In this study, Fibroblast activation protein (FAP), a serine protease selectively produced by tumor-associated fibroblasts in over 90% of epithelial tumors, was used as a platform for studying tumor-stromal interactions. We tested the hypothesis that FAP enzymatic activity locally modifies stromal ECM (extracellular matrix) components thus facilitating the formation of a permissive microenvironment promoting tumor invasion in human pancreatic cancer. We generated a tetracycline-inducible FAP overexpressing fibroblastic cell line to synthesize an in vivo-like 3-dimensional (3D) matrix system which was utilized as a stromal landscape for studying matrix-induced cancer cell behaviors. A FAP-dependent topographical and compositional alteration of the ECM was characterized by measuring the relative orientation angles of fibronectin fibers and by Western blot analyses. The role of FAP in the matrix-induced permissive tumor behavior was assessed in Panc-1 cells in assorted matrices by time-lapse acquisition assays. Also, FAP+ matrix-induced regulatory molecules in cancer cells were determined by Western blot analyses. We observed that FAP remodels the ECM through modulating protein levels, as well as through increasing levels of fibronectin and collagen fiber organization. FAP-dependent architectural/compositional alterations of the ECM promote tumor invasion along characteristic parallel fiber orientations, as demonstrated by enhanced directionality and velocity of pancreatic cancer cells on FAP+ matrices. This phenotype can be reversed by inhibition of FAP enzymatic activity during matrix production resulting in the disorganization of the ECM and impeded tumor invasion. We also report that the FAP+ matrix-induced tumor invasion phenotype is β1-integrin/FAK mediated. Cancer cell invasiveness can be affected by alterations in the tumor

  20. Ouabain enhancement of compound 48/80 induced histamine secretion from rat peritoneal mast cells: dependence on extracellular sodium

    DEFF Research Database (Denmark)

    Knudsen, T; Bertelsen, Niels Haldor; Johansen, Torben

    1992-01-01

    Purified populations of rat peritoneal mast cells were used to study the effect of ouabain on compound 48/80-induced histamine secretion and on 86Rb+ uptake. 86Rb+ was used as a tracer for extracellular K+. The calculated value of the ouabain-sensitive uptake of K+ and 86Rb+ was considered a meas...

  1. Deltorphin II enhances extracellular levels of dopamine in the nucleus accumbens via opioid receptor-independent mechanisms.

    NARCIS (Netherlands)

    Murakawa, K.; Hirose, N.; Takada, K.; Suzuki, T.; Nagase, H.; Cools, A.R.; Koshikawa, N.

    2004-01-01

    The effects of the delta2-opioid receptor agonist, deltorphin II, on extracellular levels of dopamine in the rat nucleus accumbens were investigated in awake animals by in vivo brain microdialysis. In agreement with previous studies, perfusion of deltorphin II (50.0 nmol) into the nucleus accumbens

  2. Hypoosmolar conditions reduce extracellular volume fraction and enhance epileptiform activity in the CA3 region of the immature hippocampus

    Czech Academy of Sciences Publication Activity Database

    Kilb, W.; Dierkes, P.W.; Syková, Eva; Vargová, Lýdia; Luhmann, H.J.

    2006-01-01

    Roč. 84, - (2006), s. 119-129. ISSN 0360-4012 R&D Projects: GA MŠk 1M0538 Institutional research plan: CEZ:AV0Z50390512 Keywords : Epileptic seizure * Field potential recordings * Extracellular space Subject RIV: FH - Neurology Impact factor: 3.476, year: 2006

  3. Internalization of the Extracellular Full-Length Tau Inside Neuro2A and Cortical Cells Is Enhanced by Phosphorylation.

    Science.gov (United States)

    Wauters, Mathilde; Wattiez, Ruddy; Ris, Laurence

    2016-01-01

    Tau protein is mainly intracellular. However, several studies have demonstrated that full-length Tau can be released into the interstitial fluid of the brain. The physiological or pathological function of this extracellular Tau remains unknown. Moreover, as evidence suggests, extracellular Tau aggregates can be internalized by neurons, seeding Tau aggregation. However, much less is known about small species of Tau. In this study, we hypothesized that the status of phosphorylation could alter the internalization of recombinant Tau in Neuro2A and cortical cells. Our preliminary results revealed that the highly phosphorylated form of Tau entered the cells ten times more easily than a low phosphorylated one. This suggests that hyperphosphorylated Tau protein could spread between neurons in pathological conditions such as Alzheimer's disease. PMID:27548242

  4. Chronic treatment with zinc and antidepressants induces enhancement of presynaptic/extracellular zinc concentration in the rat prefrontal cortex

    OpenAIRE

    Sowa-Kućma, Magdalena; Kowalska, Magdalena; Szlósarczyk, Marek; Gołembiowska, Krystyna; Opoka, Włodzimierz; Baś, Bogusław; Pilc, Andrzej; Nowak, Gabriel

    2010-01-01

    Zinc exhibits antidepressant-like activity in preclinical tests/models. Moreover, zinc homeostasis is implicated in the pathophysiology of affective disorders. The aim of the present study was to examine the effect of chronic zinc, citalopram and imipramine intraperitoneal administration on the presynaptic and extracellular zinc concentration in the rat prefrontal cortex and hippocampus. We used two methods: zinc–selenium histochemistry (which images the pool of presynaptic-vesicle zinc) and ...

  5. Alteration of cell-wall porosity is involved in osmotic stress-induced enhancement of aluminium resistance in common bean (Phaseolus vulgaris L.)

    OpenAIRE

    Yang, Zhong-Bao; Eticha, Dejene; Rao, Idupulapati Madhusudana; Horst, Walter Johannes

    2010-01-01

    Aluminium (Al) toxicity and drought are the two major abiotic stress factors limiting common bean production in the tropics. Using hydroponics, the short-term effects of combined Al toxicity and drought stress on root growth and Al uptake into the root apex were investigated. In the presence of Al stress, PEG 6000 (polyethylene glycol)-induced osmotic (drought) stress led to the amelioration of Al-induced inhibition of root elongation in the Al-sensitive genotype VAX 1. PEG 6000 (>> PEG 1000)...

  6. BMP7 enhances the effect of BMSCs on extracellular matrix remodeling in a rabbit model of intervertebral disc degeneration.

    Science.gov (United States)

    Xu, Jun; E, Xiao-Qiang; Wang, Nan-Xiang; Wang, Mo-Nan; Xie, Huan-Xin; Cao, Yan-Hui; Sun, Li-Hua; Tian, Jun; Chen, Hua-Jiang; Yan, Jing-Long

    2016-05-01

    Intervertebral discs (IVDs) provide stability and flexibility to the spinal column; however, IVDs, and in particular the nucleus pulposus (NP), undergo a degenerative process characterized by changes in the disc extracellular matrix (ECM), decreased cell viability, and reduced synthesis of proteoglycan and type II collagen. Here, we investigated the efficacy and feasibility of stem cell therapy using bone marrow mesenchymal stem cells (BMSCs) over-expressing bone morphogenetic protein 7 (BMP7) to promote ECM remodeling of degenerated IVDs. Lentivirus-mediated BMP7 over-expression induced differentiation of BMSCs into an NP phenotype, as indicated by expression of the NP markers collagen type II, aggrecan, SOX9 and keratins 8 and 19, increased the content of glycosaminoglycan, and up-regulated β-1,3-glucuronosyl transferase 1, a regulator of chondroitin sulfate synthesis in NP cells. These effects were suppressed by Smad1 silencing, indicating that the effect of BMP7 on ECM remodeling was mediated by the Smad pathway. In vivo analysis in a rabbit model of disc degeneration showed that implantation of BMSCs over-expressing BMP7 promoted cell differentiation and proliferation in the NP, as well as their own survival, and these effects were mediated by the Smad pathway. The results of the present study indicate the beneficial effects of BMP7 on restoring ECM homeostasis in NP cells, and suggest potential strategies for improving cell therapy for the treatment of disc diseases. PMID:26929154

  7. Effects of Faba Bean (Vicia faba L.) Flour on Viability of Probiotic Bacteria During Kefir Storage

    OpenAIRE

    Souhila Boudjou; Farid Zaidi; Farah Hosseinian; B. Dave Oomah

    2014-01-01

    Whole ground faba bean was investigated for its capability and efficiency to enhance bacterial survival and growth during kefir storage. Microbial analyses, pH and total titratable acidity (TTA) were measured in kefir samples, containing starter cultures with or without probiotic bacteria, (Lactobacillus acidophilus and Bifidobacterium lactis) supplemented with whole ground faba bean during 28 days cold storage at 4 ºC. Faba bean flour supplementation (4%) stimulated bifidogenic microbial gro...

  8. Use of sourdough fermentation and mixture of wheat, chickpea, lentil and bean flours for enhancing the nutritional, texture and sensory characteristics of white bread.

    Science.gov (United States)

    Rizzello, Carlo Giuseppe; Calasso, Maria; Campanella, Daniela; De Angelis, Maria; Gobbetti, Marco

    2014-06-16

    This study aimed at investigating the addition of legume (chickpea, lentil and bean) flours to wheat flour bread. Type I sourdough containing legumes or wheat-legume flours were prepared and propagated (back slopped) in laboratory, according to traditional protocols that are routinely used for making typical Italian breads. Based on kinetic of acidification and culture-dependent data, the wheat-legume sourdough was further characterized and selected for bread making. As determined by RAPD-PCR and partial sequencing of 16S rDNA gene analyses, lactic acid bacteria in wheat-legume sourdough included Lactobacillus plantarum, Lactobacillus sanfranciscensis, Leuconostoc mesenteroides, Lactobacillus fermentum, Weissella cibaria, Lactobacillus pentosus, Lactobacillus coryneformis, Lactobacillus rossiae, Lactobacillus brevis, Lactobacillus parabuchneri and Lactobacillus paraplantarum. Two breads containing 15% (w/w) of legume (chickpea, lentil and bean) flours were produced using selected wheat-legume sourdough (WLSB) and traditional wheat sourdough (WSB). Compared to wheat yeasted bread (WYB), the level of total free amino acids (FAA) was higher in WSB and WLSB. Phytase and antioxidant activities were the highest in WLSB. Compared to bread WYB, the addition of legume flours decreased the in vitro protein digestibility (IVPD) (WYB versus WSB). However, the dough fermentation with WSLB favored an increase of IVPD. According to the levels of carbohydrates, dietary fibers and resistant starch, WSB and WLSB showed lower values of hydrolysis index (HI) compared to WYB. As showed by texture and image analyses and sensory evaluation of breads, a good acceptability was found for WSB and, especially, WLSB breads. PMID:24794619

  9. Degradation of slime extracellular polymeric substances and inhibited sludge flocs destruction contribute to sludge dewaterability enhancement during fungal treatment of sludge using filamentous fungus Mucor sp. GY-1.

    Science.gov (United States)

    Wang, Zhenyu; Zheng, Guanyu; Zhou, Lixiang

    2015-09-01

    Mechanisms responsible for the sludge dewaterability enhanced by filamentous fungi during fungal treatment of sludge were investigated in the present study. The filamentous fungus Mucor sp. GY-1, isolated from waste activated sludge, enhanced sludge dewaterability by 82.1% to achieve the lowest value of normalized sludge specific resistance to filtration (SRF), 8.18 × 10(10) m · L/kg · g-TSS. During the fungal treatment of sludge, 57.8% of slime extracellular polymeric substances (EPS) and 51.1% of polysaccharide in slime EPS were degraded, respectively, by Mucor sp. GY-1, contributing to the improvement of sludge dewaterability. Slime EPS is much more available for Mucor sp. GY-1 than either LB-EPS or TB-EPS that bound with microbial cells. In addition, filamentous fungus Mucor sp. GY-1 entrapped small sludge particles and inhibited the destruction of sludge flocs larger than 100 μm, thus enhancing sludge dewaterability, during fungal treatment of sludge using Mucor sp. GY-1. PMID:26086084

  10. Can leek interfere with bean plant–bean fly interaction?

    OpenAIRE

    Bandara, PB; V Kumar; Ninkovic, Velemir; Ahmed, Elham; Pettersson, Jan; Glinwood, Robert

    2009-01-01

    Effects of volatile odors from leek, Allium porum L., on the behavior of bean ßy, Ophiomyia phaseoli (Tryon) (Diptera: Agromyzidae), were tested in laboratory olfactometer bioassays. Aqueous and solvent extracts (dichloromethane and methanol) of leek were repellent to adult ßies. Whole leek plants were repellent and prevented attraction to the host plant, beans. Beans that had been exposed to volatiles from living leek plants for 7 d became repellent to the ßy. Leek and several...

  11. Beans (Phaseolus spp.) - model food legumes

    International Nuclear Information System (INIS)

    living conditions in deprived regions of Africa and the Americas. It will contribute to social equity and sustainable development and enhance inter- and intra-cultural understanding, knowledge and relationships: A major goal of Phaseomics is to generate new common bean varieties that are not only suitable for but also desired by the local farmer and consumer communities. Therefore, the socio-economic dimension of improved bean production and the analysis of factors influencing the acceptance of novel varieties will be an integral part of the proposed research. Here, we give an overview of the economic and nutritional importance of common beans as a food crop. Priorities and targets of current breeding programmes are outlined, along with ongoing efforts in genomics. Recommendations for an international coordinated effort to join knowledge, facilities and expertise in a variety of scientific undertakings that will contribute to the overall goal of better beans are given. To be rapid and effective, plant breeding programmes (i.e., those that involve crossing two different 'parents') rely heavily on molecular 'markers'. These genetic landmarks are used to position important genes (e.g. for resistance to particular pests, for yield, etc.) on a chromosome and ensure that they can be 'crossed in' to another plant. There are several ways of obtaining molecular markers but the project will establish partial sequences of messenger RNA's extracted from tissues of interest (e.g. developing pods). These so-called expressed sequence-tags (ESTs), can be used like milestones on a chromosome, to position these and other genes. These efforts will complement current studies on other legumes such as Lotus japonicus and Medicago truncatula as well as the EST projects in soybean by providing a framework for comparative genomics between legumes. Complete sequencing and molecular analysis of the bean genome will follow. Individual laboratories will be encouraged to internally finance or find

  12. Comparative genomic analysis of Geobacter sulfurreducens KN400, a strain with enhanced capacity for extracellular electron transfer and electricity production

    Directory of Open Access Journals (Sweden)

    Butler Jessica E

    2012-09-01

    Full Text Available Abstract Background A new strain of Geobacter sulfurreducens, strain KN400, produces more electrical current in microbial fuel cells and reduces insoluble Fe(III oxides much faster than the wildtype strain, PCA. The genome of KN400 was compared to wildtype with the goal of discovering how the network for extracellular electron transfer has changed and how these two strains evolved. Results Both genomes were re-annotated, resulting in 14 fewer genes (net in the PCA genome; 28 fewer (net in the KN400 genome; and ca. 400 gene start and stop sites moved. 96% of genes in KN400 had clear orthologs with conserved synteny in PCA. Most of the remaining genes were in regions of genomic mobility and were strain-specific or conserved in other Geobacteraceae, indicating that the changes occurred post-divergence. There were 27,270 single nucleotide polymorphisms (SNP between the genomes. There was significant enrichment for SNP locations in non-coding or synonymous amino acid sites, indicating significant selective pressure since the divergence. 25% of orthologs had sequence differences, and this set was enriched in phosphorylation and ATP-dependent enzymes. Substantial sequence differences (at least 12 non-synonymous SNP/kb were found in 3.6% of the orthologs, and this set was enriched in cytochromes and integral membrane proteins. Genes known to be involved in electron transport, those used in the metabolic cell model, and those that exhibit changes in expression during growth in microbial fuel cells were examined in detail. Conclusions The improvement in external electron transfer in the KN400 strain does not appear to be due to novel gene acquisition, but rather to changes in the common metabolic network. The increase in electron transfer rate and yield in KN400 may be due to changes in carbon flux towards oxidation pathways and to changes in ATP metabolism, both of which indicate that the overall energy state of the cell may be different. The

  13. Overexpression of Cell Surface Cytokeratin 8 in Multidrug-Resistant MCF-7/MX Cells Enhances Cell Adhesion to the Extracellular Matrix

    Directory of Open Access Journals (Sweden)

    Fang Liu

    2008-11-01

    Full Text Available Accumulating evidence suggests that multiple complex mechanisms may be involved, simultaneously or complementarily, in the emergence and development of multidrug resistance (MDR in various cancers. Cell adhesion-mediated MDR is one such mechanism. In the present study, we initially observed increased cell adhesion to extracellular matrix proteins by the MDR human breast tumor cell line MCF-7/MX compared to its parental cells. We then used a strategy that combined antibody-based screening technique and mass spectrometry-based proteomics to identify membrane proteins that contribute to the enhanced adhesion of MCF-7/MX cells. Using MCF-7/MX cells as immunogen, we isolated a mouse monoclonal antibody, 9C6, that preferentially reacts with MCF-7/MX cells over the parental MCF-7 cells. The molecular target of 9C6 was identified as cytokeratin 8 (CK8, which was found to be overexpressed on the cell surface of MCF-7/MX cells. We further observed that down-regulation of cell surface levels of CK8 through siRNA transfection significantly inhibited MCF-7/MX cell adhesion to fibronectin and vitronectin. In addition, anti-CK8 siRNA partially reversed the MDR phenotype of MCF-7/MX cells. Taken together, our results suggest that alterations in the expression level and cellular localization of CK8 may play a significant role in enhancing the cellular adhesion of MDR MCF-7/MX cells.

  14. Enhanced accumulation of adipocytes in bone marrow stromal cells in the presence of increased extracellular and intracellular [Ca{sup 2+}

    Energy Technology Data Exchange (ETDEWEB)

    Hashimoto, Ryota, E-mail: hryota@juntendo.ac.jp [Department of Physiology, Juntendo University Faculty of Medicine, Hongo 2-1-1, Bunkyo-ku, Tokyo 113-8421 (Japan); Katoh, Youichi, E-mail: katoyo@juntendo-urayasu.jp [Institute for Environmental and Gender-Specific Medicine, Department of Cardiology, Juntendo University Faculty of Medicine Urayasu Hospital, Tomioka 2-1-1, Urayasu-shi, Chiba 279-0022 (Japan); Nakamura, Kyoko [Department of Physiology, Juntendo University Faculty of Medicine, Hongo 2-1-1, Bunkyo-ku, Tokyo 113-8421 (Japan); Itoh, Seigo [Department of Cardiology, Juntendo University Faculty of Medicine, Hongo 2-1-1, Bunkyo-ku, Tokyo 113-8421 (Japan); Iesaki, Takafumi [Department of Physiology, Juntendo University Faculty of Medicine, Hongo 2-1-1, Bunkyo-ku, Tokyo 113-8421 (Japan); Daida, Hiroyuki [Department of Cardiology, Juntendo University Faculty of Medicine, Hongo 2-1-1, Bunkyo-ku, Tokyo 113-8421 (Japan); Nakazato, Yuji [Institute for Environmental and Gender-Specific Medicine, Department of Cardiology, Juntendo University Faculty of Medicine Urayasu Hospital, Tomioka 2-1-1, Urayasu-shi, Chiba 279-0022 (Japan); Okada, Takao [Department of Physiology, Juntendo University Faculty of Medicine, Hongo 2-1-1, Bunkyo-ku, Tokyo 113-8421 (Japan)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer High [Ca{sup 2+}]{sub o} enhances adipocyte accumulation in the presence of adipogenic inducers. Black-Right-Pointing-Pointer High [Ca{sup 2+}]{sub o} enhances both proliferation and adipocyte differentiation in BMSCs. Black-Right-Pointing-Pointer High [Ca{sup 2+}]{sub o} induces an increase in [Ca{sup 2+}]{sub o} in BMSCs. Black-Right-Pointing-Pointer An intracellular Ca{sup 2+} chelator suppresses the enhancement in adipocyte accumulation. Black-Right-Pointing-Pointer Controlling [Ca{sup 2+}]{sub o} may govern the balance of adipocyte and osteoblast development. -- Abstract: The bone marrow stroma contains osteoblasts and adipocytes that have a common precursor: the pluripotent mesenchymal stem cell found in bone marrow stromal cells (BMSCs). Local bone marrow Ca{sup 2+} levels can reach high concentrations due to bone resorption, which is one of the notable features of the bone marrow stroma. Here, we describe the effects of high [Ca{sup 2+}]{sub o} on the accumulation of adipocytes in the bone marrow stroma. Using primary mouse BMSCs, we evaluated the level of adipocyte accumulation by measuring Oil Red O staining and glycerol-3-phosphate dehydrogenase (GPDH) activity. High [Ca{sup 2+}]{sub o} enhanced the accumulation of adipocytes following treatment with both insulin and dexamethasone together but not in the absence of this treatment. This enhanced accumulation was the result of both the accelerated proliferation of BMSCs and their differentiation into adipocytes. Using the fura-2 method, we also showed that high [Ca{sup 2+}]{sub o} induces an increase in [Ca{sup 2+}]{sub i}. An intracellular Ca{sup 2+} chelator suppressed the enhancement in adipocyte accumulation due to increased [Ca{sup 2+}]{sub o} in BMSCs. These data suggest a new role for extracellular Ca{sup 2+} in the bone marrow stroma: increased [Ca{sup 2+}]{sub o} induces an increase in [Ca{sup 2+}]{sub i} levels, which in turn enhances the accumulation of

  15. Extracellular vesicles from a muscle cell line (C2C12) enhance cell survival and neurite outgrowth of a motor neuron cell line (NSC-34)

    OpenAIRE

    Madison, Roger D.; McGee, Christopher; Rawson, Renee; Robinson, Grant A.

    2014-01-01

    Introduction: There is renewed interest in extracellular vesicles over the past decade or 2 after initially being thought of as simple cellular garbage cans to rid cells of unwanted components. Although there has been intense research into the role of extracellular vesicles in the fields of tumour and stem cell biology, the possible role of extracellular vesicles in nerve regeneration is just in its infancy.Background: When a peripheral nerve is damaged, the communication between spinal cord ...

  16. Enhanced extracellular production of trans-resveratrol in Vitis vinifera suspension cultured cells by using cyclodextrins and coronatine.

    Science.gov (United States)

    Almagro, Lorena; Belchí-Navarro, Sarai; Martínez-Márquez, Ascensión; Bru, Roque; Pedreño, María A

    2015-12-01

    In the present work the effect of cyclodextrin and coronatine on both trans-resveratrol production and the expression of stilbene biosynthetic genes in Vitis vinifera L. cv Monastrell suspension cultured cells were evaluated. The results showed the maximum level of trans-resveratrol produced by cells and secreted to the culture medium with 50 mM cyclodextrins and 1 μM coronatine. Since the levels of trans-resveratrol produced in the combined treatment were higher than the sum of the individual treatments, a synergistic effect between both elicitors was assumed. In addition, all the analysed genes were induced by cyclodextrins and/or coronatine. The expression of the phenylalanine ammonia lyase and stilbene synthase genes was greatly enhanced by coronatine although an increase in the amount of trans-resveratrol in the spent medium was not detected. Therefore, despite the fact that trans-resveratrol production is related with the expression of genes involved in the biosynthetic process, other factors may be involved, such as post-transcriptional and post-traductional regulation. The expression maximal levels of cinnamate 4-hydroxylase and 4-coumarate-CoA ligase genes were found with cyclodextrins alone or in combination with coronatine suggesting that the activity of these enzymes could be not only important for the formation of intermediates of trans-R biosynthesis but also for those intermediates involved in the biosynthesis of lignins and/or flavonoids. PMID:26529079

  17. Registration of 'Croissant' pinto bean

    Science.gov (United States)

    ‘Croissant’ (Reg. No. CV-299, PI 656597), a new medium-maturity (94–98 d) pinto bean (Phaseolus vulgaris L.) cultivar was released by the Colorado Agricultural Experiment Station to provide dry bean producers in the USA with a high-yielding cultivar that combines resistance to rust [caused by Uromyc...

  18. Enhanced Production of Extracellular Alkaline Lipase by an Improved Strain of Pseudomonas aeruginosa MTCC 10,055

    Directory of Open Access Journals (Sweden)

    Deepali Bisht

    2012-01-01

    Full Text Available Problem statement: Lipases are industrially important enzymes having applications in numerous industries. For easy commercialization it is necessary to produce lipases at industrial level which could be achieved by strain improvement and medium formulation. Approach: In the present study strain improvement of Pseudomonas aeruginosa MTCC 10,055 was done by chemical mutagenesis using mutagen 4-nitroquinoline1-oxide for alkaline lipase production. Different fermentation parameters affecting lipase production were optimized using one-variable-at-a-time approach. Results: The selected mutant (M-05 exhibited 3.6-fold higher productivity over wild type. Maximum alkaline lipase was produced when culture was incubated at 35°C with initial medium pH 9.0 in 28 h with inoculum density 0.5% (v/v (Abs610-1.0. Supplementation of production medium with combination of castor oil and starch as carbon source and Triton-X-100 as surfactant significantly influenced the alkaline lipase production. The composition of fully optimized medium was determined to be (g L-1: (NH42SO4, 1.0; KH2PO4, 0.6; MgSO4, 0.4; yeast extract, 0.2; castor oil, 2.0; starch 20.0; gum arabic, 5.0; Triton-X-100, 1.0. An overall 14-fold enhanced production was achieved after complete medium optimization. Conclusion/Recommendations: The improved strain was capable to produce high titer of alkaline lipase at flask level, which can be examined at fermentor level to obtain sufficient enzyme yield to meet the world wide industrial demand.

  19. Characterization of the extracellular biodemulsifiers secreted by Bacillus cereus LH-6 and the enhancement of demulsifying efficiency by optimizing the cultivation conditions.

    Science.gov (United States)

    Hou, Ning; Feng, Fengzhao; Shi, Yan; Cao, Huiming; Li, Chunyan; Cao, Zhi; Cheng, Yi

    2014-09-01

    A highly efficient demulsifying strain, LH-6, was isolated from petroleum-contaminated soil and identified as Bacillus cereus by 16S rDNA gene analysis. It achieved 95.61 and 95.40 % demulsifying ratios within 12 h for water-in-oil (W/O) and oil-in-water (O/W) model emulsions, respectively. Fourier transform infrared spectroscopy (FT-IR) and thin-layer chromatography (TLC) detections indicated that the LH-6's extracellular biodemulsifiers were different types of lipopeptides for the W/O and O/W emulsions. Optimization of the culture medium composition was conducted to improve the biosynthesis and demulsifying efficiency of the biodemulsifier. The optimal carbon source was liquid paraffin, while waste frying oil could also be an alternative carbon source. The optimal nitrogen sources were ammonium sulfate and yeast extract. To further enhance the biodemulsifier efficiency, the optimal cultivation conditions were determined using response surface methodology (RSM) based on central composite rotation design (CCRD). Using the optimized cultivation conditions, the demulsifying ratios increased to 98.23 and 97.65 % for the W/O and O/W model emulsions, respectively. PMID:24777330

  20. Evidence that brain glucose availability influences exercise-enhanced extracellular 5-HT level in hippocampus: a microdialysis study in exercising rats.

    Science.gov (United States)

    Béquet, F; Gomez-Merino, D; Berthelot, M; Guezennec, C Y

    2002-09-01

    The relationship between brain glucose and serotonin is still unclear and no direct evidence of an action of brain glucose on serotonergic metabolism in central fatigue phenomena has been shown yet. In order to determine whether or not brain glucose could influence the brain 5-hydroxytryptamine (5-HT) system, we have monitored in microdialysis the effects of a direct injection of glucose in rat brain hippocampus on serotonergic metabolism [i.e. 5-HT, 5-hydroxyindoleacetic acid (5-HIAA) and tryptophan (TRP)], during high intensive treadmill running. The injection was performed just before and after exercise. We have shown that glucose induced a decrease of brain 5-HT levels to a minimum of 73.0 +/- 3.5% of baseline after the first injection (P exercise-induced 5-HT enhanced levels. We have observed the same phenomenon concerning the 5-HIAA, but brain TRP levels were not decreased by the injections. In conclusion, this study demonstrates that brain glucose can act on serotonergic metabolism and thus can prevent exercise-induced increase of 5-HT levels. The results also suggest that extracellular brain glucose does not act on the synthesis way of 5-HT, but probably on the release/reuptake system. PMID:12193220

  1. Irradiated cocoa beans

    International Nuclear Information System (INIS)

    Groups of 40 male and 40 female CD rats were fed powdered rodent diet containing 25% (w/w) of either non-irradiated, irradiated or fumigated cocoa beans. The diets were supplemented with certain essential dietary constituents designed to satisfy normal nutritional requirements. An additional 40 male and 40 female rats received basal rodent diet alone (ground) and acted as an untreated control. After 70 days of treatment, 15 male and 15 female rats from each group were used to assess reproductive function of the F0 animals and growth and development of the F1 offspring up to weaning; the remaining animals were killed after 91 days of treatment. (orig.)

  2. The Moche Lima beans recording system, revisited

    Directory of Open Access Journals (Sweden)

    Tomi S. Melka

    2010-08-01

    Full Text Available One matter that has raised sufficient uncertainties among scholarsin the study of the Old Moche culture is a system that comprises patterned Lima beans. The marked beans, plus various associated effigies, appear painted by and large with a mixture of realism and symbolism on the surface of ceramic bottles and jugs, with many of them showing an unparalleled artistry in the great area of the South American subcontinent. A range of accounts has been offered as to what the real meaning of these items is: starting from a recreationaland/or a gambling game, to a divination scheme, to amulets, to an application for determining the length and order of funerary rites, to a device close to an accountancy and data storage medium, ending up with an ‘ideographic’, or even a ‘pre-alphabetic’ system.The investigation brings together structural, iconographic and cultural aspects, and indicates that we might be dealing with an original form of mnemotechnology, contrived to solve the problems of medium and long-distance communication among the once thriving Moche principalities. Likewise, by reviewing the literature, by searching for new material, and exploring the structure and combinatory properties of the marked Lima beans, as well as by placing emphasis on joint scholarly efforts, may enhance the studies.

  3. A titanium surface with nano-ordered spikes and pores enhances human dermal fibroblastic extracellular matrix production and integration of collagen fibers.

    Science.gov (United States)

    Yamada, Masahiro; Kato, Eiji; Yamamoto, Akiko; Sakurai, Kaoru

    2016-02-01

    The acquisition of substantial dermal sealing determines the prognosis of percutaneous titanium-based medical devices or prostheses. A nano-topographic titanium surface with ordered nano-spikes and pores has been shown to induce periodontal-like connective tissue attachment and activate gingival fibroblastic functions. This in vitro study aimed to determine whether an alkali-heat (AH) treatment-created nano-topographic titanium surface could enhance human dermal fibroblastic functions and binding strength to the deposited collagen on the titanium surface. The surface topographies of commercially pure titanium machined discs exposed to two different AH treatments were evaluated. Human dermal fibroblastic cultures grown on the discs were evaluated in terms of cellular morphology, proliferation, extracellular matrix (ECM) and proinflammatory cytokine synthesis, and physicochemical binding strength of surface-deposited collagen. An isotropically-patterned, shaggy nano-topography with a sponge-like inner network and numerous well-organized, anisotropically-patterned fine nano-spikes and pores were observed on each nano-topographic surface type via scanning electron microscopy. In contrast to the typical spindle-shaped cells on the machined surfaces, the isotropically- and anisotropically-patterned nano-topographic titanium surfaces had small circular/angular cells containing contractile ring-like structures and elongated, multi-shaped cells with a developed cytoskeletal network and multiple filopodia and lamellipodia, respectively. These nano-topographic surfaces enhanced dermal-related ECM synthesis at both the protein and gene levels, without proinflammatory cytokine synthesis or reduced proliferative activity. Deposited collagen fibers were included in these surfaces and sufficiently bound to the nano-topographies to resist the physical, enzymatic and chemical detachment treatments, in contrast to machined surfaces. Well-organized, isotropically

  4. Effect of soaking and fermentation on content of phenolic compounds of soybean (Glycine max cv. Merit) and mung beans (Vigna radiata [L] Wilczek).

    Science.gov (United States)

    María Landete, José; Hernández, Teresa; Robredo, Sergio; Dueñas, Montserrat; de Las Rivas, Blanca; Estrella, Isabel; Muñoz, Rosario

    2015-03-01

    Mung beans (Vigna radiata [L] Wilczek) purchased from a Spanish company as "green soybeans", showed a different phenolic composition than yellow soybeans (Glycine max cv. Merit). Isoflavones were predominant in yellow soybeans, whereas they were completely absent in the green seeds on which flavanones were predominant. In order to enhance their health benefits, both types of bean were subjected to technological processes, such as soaking and fermentation. Soaking increased malonyl glucoside isoflavone extraction in yellow beans and produced an increase in apigenin derivatives in the green beans. Lactobacillus plantarum CECT 748 T fermentation produced an increase in the bioactivity of both beans since a conversion of glycosylated isoflavones into bioactive aglycones and an increase of the bioactive vitexin was observed in yellow and green beans, respectively. In spite of potential consumer confusion, since soybean and "green soybean" are different legumes, the health benefits of both beans were enhanced by lactic fermentation. PMID:25582183

  5. Locomotion of Mexican jumping beans

    International Nuclear Information System (INIS)

    The Mexican jumping bean, Laspeyresia saltitans, consists of a hollow seed housing a moth larva. Heating by the sun induces movements by the larva which appear as rolls, jumps and flips by the bean. In this combined experimental, numerical and robotic study, we investigate this unique means of rolling locomotion. Time-lapse videography is used to record bean trajectories across a series of terrain types, including one-dimensional channels and planar surfaces of varying inclination. We find that the shell encumbers the larva's locomotion, decreasing its speed on flat surfaces by threefold. We also observe that the two-dimensional search algorithm of the bean resembles the run-and-tumble search of bacteria. We test this search algorithm using both an agent-based simulation and a wheeled Scribbler robot. The algorithm succeeds in propelling the robot away from regions of high temperature and may have application in biomimetic micro-scale navigation systems. (paper)

  6. purple_bean_crithab_streams

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This linear coverage represents critical habitat deliniation for the Purple Bean in the Tennessee and Cumberland River Basins. Linear segments were digitized over a...

  7. Faba bean in cropping systems

    DEFF Research Database (Denmark)

    Steen Jensen, Erik; Peoples, Mark B.; Hauggaard-Nielsen, Henrik

    2010-01-01

    the plant–soil system associated with faba bean cropping via nitrate leaching or emissions of N2O to the atmosphere as a consequence of the rapid mineralization of N from its N-rich residues. It is important to develop improved preventive measures, such as catch crops, intercropping, or no-till technologies......The grain legume (pulse) faba bean (Vicia faba L.) is grown world-wide as a protein source for food and feed. At the same time faba bean offers ecosystem services such as renewable inputs of nitrogen (N) into crops and soil via biological N2 fixation, and a diversification of cropping systems. Even...... legumes to provide N to maintain soil N fertility, with industrialized, largely cereal-based systems that are heavily reliant upon fossil fuels (=N fertilizers, heavy mechanization) are some of the explanations for this decline in importance. Past studies of faba bean in cropping systems have tended...

  8. Response of two cultivars of Phaseolus vulgaris L. (French beans) plants exposed to enhanced UV-B radiation under mountain ecosystem.

    Science.gov (United States)

    Raghuvanshi, Rashmi; Sharma, Rajesh Kumar

    2016-01-01

    Enhanced solar ultraviolet-B (UV-B) irradiance resulting from depletion in the ozone layer has the potential to cause detrimental effects on plants. Higher altitudes tend to receive higher doses of ambient UV-B radiation. The present study was carried out to assess the effects of enhanced UV-B (ambient + 10.2 kJ m(-2) day(-1)) radiation on two cultivars of Phaseolus vulgaris L. (cv. Pusa Himlata and Pusa Parvati) at growth, physiological, and biochemical levels grown under mountain ecosystem. The magnitudes of negative effects of enhanced UV-B radiation were found more in Pusa Parvati as compared to Pusa Himlata. Non-enzymatic (total phenolics and flavonoids content) and enzymatic antioxidants (superoxide dismutase, catalase, and peroxidase) were increased in both cultivars at both the ages of growth but increase was found more in Pusa Himlata as compared to Pusa Parvati. The study further showed that the economic yield of Pusa Himlata and Pusa Parvati was decreased by 14 and 44%, respectively, due to enhanced UV-B radiation. The higher decrease in the economic yield of Pusa Parvati depicted that increased amounts of total flavonoids content and stimulation of their antioxidant defense mechanism via increasing the activities of enzymatic antioxidants were not able to completely detoxify the produced reactive oxygen species under enhanced UV-B radiation and made it more sensitive to applied stress. From the present study, it can be concluded that enhanced UV-B radiation in the mountain areas of the Indian Himalayan Regions could be one of the environmental causes for lower yields of agricultural crops. Cultivation of P. vulgaris L. cv. Pusa Himlata should be promoted at higher altitudes of the Indian Himalayan Regions. PMID:26342300

  9. Extracellular vesicles from a muscle cell line (C2C12 enhance cell survival and neurite outgrowth of a motor neuron cell line (NSC-34

    Directory of Open Access Journals (Sweden)

    Roger D. Madison

    2014-02-01

    Full Text Available Introduction: There is renewed interest in extracellular vesicles over the past decade or 2 after initially being thought of as simple cellular garbage cans to rid cells of unwanted components. Although there has been intense research into the role of extracellular vesicles in the fields of tumour and stem cell biology, the possible role of extracellular vesicles in nerve regeneration is just in its infancy. Background: When a peripheral nerve is damaged, the communication between spinal cord motor neurons and their target muscles is disrupted and the result can be the loss of coordinated muscle movement. Despite state-of-the-art surgical procedures only approximately 10% of adults will recover full function after peripheral nerve repair. To improve upon such results will require a better understanding of the basic mechanisms that influence axon outgrowth and the interplay between the parent motor neuron and the distal end organ of muscle. It has previously been shown that extracellular vesicles are immunologically tolerated, display targeting ligands on their surface, and can be delivered in vivo to selected cell populations. All of these characteristics suggest that extracellular vesicles could play a significant role in nerve regeneration. Methods: We have carried out studies using 2 very well characterized cell lines, the C2C12 muscle cell line and the motor neuron cell line NSC-34 to ask the question: Do extracellular vesicles from muscle influence cell survival and/or neurite outgrowth of motor neurons? Conclusion: Our results show striking effects of extracellular vesicles derived from the muscle cell line on the motor neuron cell line in terms of neurite outgrowth and survival.

  10. Utilization of ice regenerative heat system for cooling process in manufacturing bean curd, and realization of productivity enhancement as well as cost reduction; Tofu seizo no reikyaku kotei ni kori chikunetsu system wo katsuyoshi, seisansei kojo to costdown wo jitsugen

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    There is a process of cooling a product finished at high temperature in the manufacturing of bean curd. The temperature reaches 60-70 degrees C in the center of the bean curd just finished. In the conventional process, bean curd used to be cooled by ground water, by keeping the bean curd for along time in the temperature range of 30-40 degrees C which is liable to growth of miscellaneous bacteria. Instead, a rapid cooling method was employed using an ice regenerative system. This cooling system by an ice regenerative heat pump is such that ice made by night electricity is stored in a heat storage tank and that the ice is used as cooling water at 2 degree C during the daytime. Consequently, it can contribute to the reduction of cooling time and to the suppression of bacteria growth. Naturally, being rapid cooling, the method does not spoil the flavor of bean curd. Moreover, since the operation is fully automatic, there is no need to assign a man specially for the operation, while the cold water is ready to be used immediately from the start. In addition, the cooling temperature is constant, with less amount of water serving the purpose. An industrial regenerative adjustment contract makes it possible to use electricity at the economical night rate and to contrive a large reduction in cost. (NEDO)

  11. 76 FR 16700 - Importation of French Beans and Runner Beans From the Republic of Kenya Into the United States

    Science.gov (United States)

    2011-03-25

    ... ). The PRA, titled ``Importation of French Bean, Phaseolus vulgaris L., and Runner Bean, Phaseolus... as follows: Sec. 319.56-51 French beans and runner beans from Kenya. French beans (Phaseolus vulgaris L.) and runner beans (Phaseolus coccineus L.) may be imported into the United States from Kenya...

  12. Healthy food trends -- beans and legumes

    Science.gov (United States)

    ... peas, and lentils are all types of legumes. Vegetables such as beans and other legumes are an important source of protein. They are a key food in healthy diets and have many benefits. Beans, lentils, and ...

  13. In Vivo Antistress and Antioxidant Effects of Fermented and Germinated Mung Bean

    Directory of Open Access Journals (Sweden)

    Swee Keong Yeap

    2014-01-01

    Full Text Available Mung bean has been traditionally used to alleviate heat stress. This effect may be contributed by the presence of flavonoids and γ-aminobutyric acid (GABA. On the other hand, fermentation and germination have been practised to enhance the nutritional and antioxidant properties of certain food products. The main focus of current study was to compare the antistress effect of none-process, fermented and germinated mung bean extracts. Acute and chronic restraint stresses were observed to promote the elevation of serum biochemical markers including cholesterol, triglyceride, total protein, liver enzymes, and glucose. Chronic cold restraint stress was observed to increase theadrenal gland weight, brain 5-hydroxytryptamine (5-HT, and malondialdehyde (MDA level while reducing brain antioxidant enzyme level. However, these parameters were found reverted in mice treated with diazepam, high concentration of fermented mung bean and high concentration of germinated mung bean. Moreover, enhanced level of antioxidant on the chronic stress mice was observed in fermented and germinated mung bean treated groups. In comparison between germinated and fermented mung bean, fermented mung bean always showed better antistress and antioxidant effects throughout this study.

  14. Organ culture of the trigeminal ganglion induces enhanced expression of calcitonin gene-related peptide via activation of extracellular signal-regulated protein kinase 1/2

    DEFF Research Database (Denmark)

    Tajti, János; Kuris, Anikó; Vécsei, László;

    2011-01-01

    BACKGROUND AND OBJECTIVE: Clinical and experimental studies have revealed a central role of calcitonin gene-related peptide (CGRP) in primary headaches. The role of extracellular signal-regulated kinase 1 and 2 (ERK1/2) in neuronal and glial cell expression of CGRP- immunoreactivity (-ir) in rat ...

  15. NetBeans IDE 8 cookbook

    CERN Document Server

    Salter, David

    2014-01-01

    If you're a Java developer of any level using NetBeans and want to learn how to get the most out of NetBeans, then this book is for you. Learning how to utilize NetBeans will provide a firm foundation for your Java application development.

  16. Chlorotic mottle of bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Jayasinghe, W.U.

    1982-01-01

    For the past years there have been outbreaks of a disease of bean ( Phaseolus vulgaris L.) in Colombia called bean chlorotic mottle. The etiology of bean chlorotic mottle was not known, but the disease was generally believed to be incited by the same whitefly-transmitted virus that causes variegatio

  17. The cotyledon cell wall and intracellular matrix are factors that limit iron bioavailability of the common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Glahn, Raymond P; Tako, Elad; Cichy, Karen; Wiesinger, Jason

    2016-07-13

    Strategies that enhance the Fe bioavailability of the bean are of keen interest to nutritionists, bean breeders and growers. In beans, the cotyledons contain 75-80% of the total seed Fe, most of which appears to be located within the cotyledon cells. The cotyledon cell walls are known to be resistant to digestion in the stomach and the upper small intestine. Therefore, given the above and the general belief that the primary site for human Fe absorption is the upper small intestine, the present study was designed to determine if the cotyledon cell walls represent a barrier to Fe absorption from the bean. To do so, we utilized high pressure to rupture bean cotyledon cells. The iron bioavailability of cooked bean samples was assessed using an in vitro digestion/Caco-2 cell culture model. Microscopy analyses confirmed that the cotyledon cell walls are highly resistant to pepsin, the low pH of the stomach, and the pancreatic enzymes, indicating that the walls are a barrier to Fe absorption from the bean. Relatively high intracellular pressure (>4000 psi) was required to initiate cell wall rupture. Surprisingly, the lysis of cotyledon cells did not result in a consistent or strong enhancement of bioavailable Fe, suggesting that the liberated intracellular starch and protein influenced the Fe bioavailability by creating a matrix that inhibited the exchange of Fe with the cell transport mechanism. Such observations warrant further pursuit in vivo as the confirmation of these effects would reshape strategies to enhance Fe absorption from beans. PMID:27326892

  18. Diets enriched with cranberry beans alter the microbiota and mitigate colitis severity and associated inflammation.

    Science.gov (United States)

    Monk, Jennifer M; Lepp, Dion; Zhang, Claire P; Wu, Wenqing; Zarepoor, Leila; Lu, Jenifer T; Pauls, K Peter; Tsao, Rong; Wood, Geoffrey A; Robinson, Lindsay E; Power, Krista A

    2016-02-01

    Common beans are rich in phenolic compounds and nondigestible fermentable components, which may help alleviate intestinal diseases. We assessed the gut health priming effect of a 20% cranberry bean flour diet from two bean varieties with differing profiles of phenolic compounds [darkening (DC) and nondarkening (NDC) cranberry beans vs. basal diet control (BD)] on critical aspects of gut health in unchallenged mice, and during dextran sodium sulfate (DSS)-induced colitis (2% DSS wt/vol, 7 days). In unchallenged mice, NDC and DC increased (i) cecal short-chain fatty acids, (ii) colon crypt height, (iii) crypt goblet cell number and mucus content and (iv) Muc1, Klf4, Relmβ and Reg3γ gene expression vs. BD, indicative of enhanced microbial activity and gut barrier function. Fecal 16S rRNA sequencing determined that beans reduced abundance of the Lactobacillaceae (Ruminococcus gnavus), Clostridiaceae (Clostridium perfringens), Peptococcaceae, Peptostreptococcaceae, Rikenellaceae and Pophyromonadaceae families, and increased abundance of S24-7 and Prevotellaceae. During colitis, beans reduced (i) disease severity and colonic histological damage, (ii) increased gene expression of barrier function promoting genes (Muc1-3, Relmβ, and Reg3γ) and (iii) reduced colonic and circulating inflammatory cytokines (IL-1β, IL-6, IFNγ and TNFα). Therefore, prior to disease induction, bean supplementation enhanced multiple concurrent gut health promoting parameters that translated into reduced colitis severity. Moreover, both bean diets exerted similar effects, indicating that differing phenolic content did not influence the endpoints assessed. These data demonstrate a proof-of-concept regarding the gut-priming potential of beans in colitis, which could be extended to mitigate the severity of other gut barrier-associated pathologies. PMID:26878790

  19. Reduction of Inflammatory Responses and Enhancement of Extracellular Matrix Formation by Vanillin-Incorporated Poly(Lactic-co-Glycolic Acid) Scaffolds

    OpenAIRE

    Lee, Yujung; Kwon, JeongIl; Khang, Gilson; Lee, Dongwon

    2012-01-01

    Vanillin is one of the major components of vanilla, a commonly used flavoring agent and preservative and is known to exert potent antioxidant and anti-inflammatory activities. In this work, vanillin-incorporated poly(lactic-co-glycolic acid) (PLGA) films and scaffolds were fabricated to evaluate the effects of vanillin on the inflammatory responses and extracellular matrix (ECM) formation in vitro and in vivo. The incorporation of vanillin to PLGA films induced hydrophilic nature, resulting i...

  20. Application of extracellular lipopeptide biosurfactant produced by endophytic Bacillus subtilis K1 isolated from aerial roots of banyan (Ficus benghalensis) in microbially enhanced oil recovery (MEOR)

    OpenAIRE

    Pathak, Khyati V.; Keharia, Hareshkumar

    2013-01-01

    Bacillus subtilis K1 isolated from aerial roots of banyan tree secreted mixture of surfactins, iturins and fengycins with high degree of heterogeneity. The extracellular extract consisting of mixture of these cyclic lipopeptides exhibited very good emulsification activity as well as excellent emulsion stability. The culture accumulated maximum surfactant up to 48 h of growth during batch fermentation in Luria broth. The emulsion of hexane, heptane and octane prepared using 48-h-old culture su...

  1. A novel transcriptional enhancer is involved in the prolactin- and extracellular matrix-dependent regulation of beta-casein gene expression.

    OpenAIRE

    Schmidhauser, C; Casperson, G F; Myers, C A; Sanzo, K T; Bolten, S; Bissell, M.J.

    1992-01-01

    Lactogenic hormones and extracellular matrix (ECM) act synergistically to regulate beta-casein expression in culture. We have developed a functional subpopulation of the mouse mammary epithelial cell strain COMMA-1D (designated CID 9), which expresses high level of beta-casein, forms alveolar-like structures when plated onto the EHS tumor-derived matrix, and secretes beta-casein unidirectionally into a lumen. We have further shown that ECM- and prolactin-dependent regulations of beta-casein o...

  2. Interaction between beans and objects

    International Nuclear Information System (INIS)

    The interaction between the X-ray beans and objects are studied, with the modification in the intensity. The kilovolt, the bundle filtration, the structure and composition of the patient and the quantity of scattered radiation are also described, as the main parameters for the contrast and for the dose of the patient. (C.G.C.)

  3. The pulmonary extracellular lining.

    OpenAIRE

    George, G; Hook, G E

    1984-01-01

    The extracellular lining of the lungs is reviewed. The pulmonary extracellular lining is a complex mixture of phospholipids, proteins and carbohydrates which is absolutely essential for the maintenance of normal pulmonary functions such as gas exchange. Without the lining the lungs would collapse. Alterations in the pulmonary extracellular lining may underlie some disease conditions induced by toxic agents, especially those which interfere with the formation of pulmonary surfactant. The extra...

  4. Protein Quality of Irradiated Brazilian Beans

    International Nuclear Information System (INIS)

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macacar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein (∼10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfestation process, without impairing the biological quality of the valuable bean protein

  5. Protein Quality of Irradiated Brazilian Beans

    Energy Technology Data Exchange (ETDEWEB)

    Delincee, Henry; Villavicencio, Anna-Lucia C.H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macacar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein ({approx}10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfestation process, without impairing the biological quality of the valuable bean protein.

  6. Protein Quality of Irradiated Brazilian Beans

    Science.gov (United States)

    Delincée, Henry; Villavicencio, Anna-Lucia C. H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macaçar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein (˜10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfection process, without impairing the biological quality of the valuable bean protein.

  7. Evaluation of some bean lines tolerance to alkaline soil

    Directory of Open Access Journals (Sweden)

    Abeer A. Radi

    2012-01-01

    Full Text Available Introduction: In less arid climates, salts are less concentrated and sodium dominates in carbonate and bicarbonate forms, which enhance the formation of alkaline soils. The development and identification of salt-tolerant crop cultivars or lines would complement salt management programs to improve the productivity and yields of salt stressed plants.Materials and methods: This work was to study the evaluation of alkalinity tolerance of some bean lines grown under different levels of sodium carbonate (Na2CO3 to select the most alkalinity tolerant lines versus the most-sensitive ones out of 6 lines of the test plants.Results: The symptoms induced by alkalinity included reduction in root, shoot growth, and leaf area which were more severe in some bean lines. Potassium leakage was severely affected by alkalinity in some lines at all tested levels, while in some others a moderate damage was manifested only at the higher levels. The increase in Na2CO3 level was associated with a gradual fall in chlorophyll a and b biosynthesis of all the test bean lines. However, alkalinity at low and moderate levels had a favorable effect on the biosynthesis of carotenoids in all the test bean lines. The increase in Na2CO3 supply had a considerable stimulatory effect on sodium accumulation, while potassium accumulation fluctuated in organs of bean lines.Conclusion: Assiut 1104 out of all the different lines investigated was found to display the lowest sensitivity to alkalinity stress, while Assiut 12/104 was the most sensitive one.

  8. Effect of processing methods on nutritional, sensory, and physicochemical characteristics of biofortified bean flour.

    Science.gov (United States)

    Nkundabombi, Marie Grace; Nakimbugwe, Dorothy; Muyonga, John H

    2016-05-01

    reproductive age found to be high. These results show that processing methods enhanced nutritional value of biofortified bean flour and that processed biofortified bean flour can be used to prepare nutrient and energy-dense gruel to improve on nutritional status of children under 5 years and women of reproductive age. PMID:27247769

  9. Reflective Polyethylene Mulch Reduces Mexican Bean Beetle (Coleoptera: Coccinellidae) Densities and Damage in Snap Beans.

    Science.gov (United States)

    Nottingham, L B; Kuhar, T P

    2016-08-01

    Mexican bean beetle, Epilachna varivestis Mulsant, is a serious pest of snap beans, Phaseolus vulgaris L., in the eastern United States. These beetles are intolerant to direct sunlight, explaining why individuals are typically found on the undersides of leaves and in the lower portion of the plant canopy. We hypothesized that snap beans grown on reflective, agricultural polyethylene (plastic mulch) would have fewer Mexican bean beetles and less injury than those grown on black plastic or bare soil. In 2014 and 2015, beans were seeded into beds of metallized, white, and black plastic, and bare soil, in field plots near Blacksburg, VA. Mexican bean beetle density, feeding injury, predatory arthropods, and snap bean yield were sampled. Reflected light intensity, temperature, and humidity were monitored using data loggers. Pyranometer readings showed that reflected light intensity was highest over metallized plastic and second highest over white plastic; black plastic and bare soil were similarly low. Temperature and humidity were unaffected by treatments. Significant reductions in Mexican bean beetle densities and feeding injury were observed in both metallized and white plastic plots compared to black plastic and bare soil, with metallized plastic having the fewest Mexican bean beetle life stages and injury. Predatory arthropod densities were not reduced by reflective plastic. Metallized plots produced the highest yields, followed by white. The results of this study suggest that growing snap beans on reflective plastic mulch can suppress the incidence and damage of Mexican bean beetle, and increase yield in snap beans. PMID:27341891

  10. Kinetics model development of cocoa bean fermentation

    Science.gov (United States)

    Kresnowati, M. T. A. P.; Gunawan, Agus Yodi; Muliyadini, Winny

    2015-12-01

    Although Indonesia is one of the biggest cocoa beans producers in the world, Indonesian cocoa beans are oftenly of low quality and thereby frequently priced low in the world market. In order to improve the quality, adequate post-harvest cocoa processing techniques are required. Fermentation is the vital stage in series of cocoa beans post harvest processing which could improve the quality of cocoa beans, in particular taste, aroma, and colours. During the fermentation process, combination of microbes grow producing metabolites that serve as the precursors for cocoa beans flavour. Microbial composition and thereby their activities will affect the fermentation performance and influence the properties of cocoa beans. The correlation could be reviewed using a kinetic model that includes unstructured microbial growth, substrate utilization and metabolic product formation. The developed kinetic model could be further used to design cocoa bean fermentation process to meet the expected quality. Further the development of kinetic model of cocoa bean fermentation also serve as a good case study of mixed culture solid state fermentation, that has rarely been studied. This paper presents the development of a kinetic model for solid-state cocoa beans fermentation using an empirical approach. Series of lab scale cocoa bean fermentations, either natural fermentations without starter addition or fermentations with mixed yeast and lactic acid bacteria starter addition, were used for model parameters estimation. The results showed that cocoa beans fermentation can be modelled mathematically and the best model included substrate utilization, microbial growth, metabolites production and its transport. Although the developed model still can not explain the dynamics in microbial population, this model can sufficiently explained the observed changes in sugar concentration as well as metabolic products in the cocoa bean pulp.

  11. Phenotyping common beans for adaptation to drought

    OpenAIRE

    Beebe, Stephen E.; Rao, Idupulapati M.; Blair, Matthew W.; Acosta-Gallegos, Jorge A.

    2013-01-01

    Common beans (Phaseolus vulgaris L.) originated in the New World and are the grain legume of greatest production for direct human consumption. Common bean production is subject to frequent droughts in highland Mexico, in the Pacific coast of Central America, in northeast Brazil, and in eastern and southern Africa from Ethiopia to South Africa. This article reviews efforts to improve common bean for drought tolerance, referring to genetic diversity for drought response, the physiology of droug...

  12. Propoxur residues in cocoa beans

    International Nuclear Information System (INIS)

    Pod-bearing Amazon and Amelonado cocoa plants were sprayed with Unden 20% (propoxur, arprocarb, baygon) at the recommended rate of 210 g a.i./ha and twice the recommended rate at monthly intervals from July to October, 1976, and cured beans from the ripe pods analysed for propoxur residues by gas chromatography. In a radiotracer study with 14C-labelled propoxur, the effect of processing methods on residues and systemic uptake of propoxur from insecticide deposits on pod surfaces were also investigated. Residues did not exceed 0.03 ppm. There was no relationship between residues and harvesting time, cocoa type or rate of application. Contamination of beans with insecticide deposits on the pod surface during processing, and systemic uptake of insecticide from pod surfaces were negligible. (author)

  13. Assesing potential effects of inulin and probiotic bacteria on Fe bioavailability from common beans (Phaseolus vulgaris L.) to Caco-2 cells

    Science.gov (United States)

    Inulin, a prebiotic, may enhance intestinal Fe absorption. Our objective was to assess the effects of supplemental inulin and two probiotic bacteria (B. infantis and L.acidophillus) on Fe availability to Caco-2 cells from common white and red beans (Phaseolus vulgaris L.). Cooked beans were mixed o...

  14. Antihyperglycemic Effects of Fermented and Nonfermented Mung Bean Extracts on Alloxan-Induced-Diabetic Mice

    Directory of Open Access Journals (Sweden)

    Swee Keong Yeap

    2012-01-01

    Full Text Available Mung bean was reported as a potential antidiabetic agent while fermented food has been proposed as one of the major contributors that can reduce the risk of diabetes in Asian populations. In this study, we have compared the normoglycemic effect, glucose-induced hyperglycemic effect, and alloxan-induced hyperglycemic effect of fermented and nonfermented mung bean extracts. Our results showed that fermented mung bean extracts did not induce hypoglycemic effect on normal mice but significantly reduced the blood sugar levels of glucose- and alloxan-induced hyperglycemic mice. The serum levels of cholesterol, triglyceride (TG, and low-density lipoprotein (LDL were also lowered while insulin secretion and antioxidant level as measured by malonaldehyde (MDA assays were significantly improved in the plasma of the fermented mung bean-treated group in alloxan-induced hyperglycemic mouse. These results indicated that fermentation using Mardi Rhizopus sp. strain 5351 inoculums could enhance the antihyperglycemic and the antioxidant effects of mung bean in alloxan-treated mice. The improvement in the antihyperglycemic effect may also be contributed by the increased content of GABA and the free amino acid that are present in the fermented mung bean extracts.

  15. Influence of conservation tillage and zero tillage on arable weeds in organic faba bean production

    Directory of Open Access Journals (Sweden)

    Jung, Rüdiger

    2016-02-01

    Full Text Available The field experiments were conducted in 2008, 2009 and 2010 on a Gleyic Cambisol near Goettingen, Lower Saxony, Germany. A crop sequence of summer barley, winter cover crops (intercropped oat and sunflower and summer faba bean was examined under organic farming conditions. Emphasis was given to the studying of arable weeds in faba beans. However, enhancing symbiotic nitrogen fixation of summer faba beans by accumulation of soil-nitrogen by winter cover crops was a second objective in these experiments. The faba bean field plots had been cultivated with three different tillage systems: 1. zero tillage, sowing with cross-slottechnique, 2. conservation tillage (wing share cultivator, rotary harrow sowing with cross-slot-technique and 3. conventional tillage with mouldboard plough followed by rotary harrow, sowing with precision monoseeder. In plots with zero tillage preceding cover crops were left as mulch on the soil surface. Cover crops accumulated adequate nitrogen amounts and following faba beans reacted with significant increase (up to 10% in symbiotic nitrogen fixation. Maximum of arable weed biomass was observed in zero tillage-plots at the end of May or early in June. The abundance of the predominant weed wild mustard (Sinapis arvensis increased with tillage intensity, whereas the abundance of creeping thistle (Cirsium arvense increased in 2010 with decreasing tillage intensity. Average grain yield of faba beans was low with only 3.0 and 2.4 t ha-1 in 2009 and 2010, respectively.

  16. The modulation of extracellular superoxide dismutase in the specifically enhanced cellular immune response against secondary challenge of Vibrio splendidus in Pacific oyster (Crassostrea gigas).

    Science.gov (United States)

    Liu, Conghui; Zhang, Tao; Wang, Lingling; Wang, Mengqiang; Wang, Weilin; Jia, Zhihao; Jiang, Shuai; Song, Linsheng

    2016-10-01

    Extracellular superoxide dismutase (EcSOD) is a copper-containing glycoprotein playing an important role in antioxidant defense of living cells exposed to oxidative stress, and also participating in microorganism internalization and cell adhesion in invertebrates. EcSOD from oyster (designated CgEcSOD) had been previously reported to bind lipopolysaccharides (LPS) and act as a bridge molecule in Vibrio splendidus internalization. Its mRNA expression pattern, PAMP binding spectrum and microorganism binding capability were examined in the present study. The mRNA expression of CgEcSOD in hemocytes was significantly up-regulated at the initial phase and decreased sharply at 48 h post V. splendidus stimulation. The recombinant CgEcSOD protein (rCgEcSOD) could bind LPS, PGN and poly (I:C), as well as various microorganisms including Micrococcus luteus, Staphylococcus aureus, Escherichia coli, Vibrio anguillarum, V. splendidus, Pastoris pastoris and Yarrowia lipolytica at the presence of divalent metal ions Cu(2+). After the secondary V. splendidus stimulation, the mRNA and protein of CgEcSOD were both down-regulated significantly. The results collectively indicated that CgEcSOD could not only function in the immune recognition, but also might contribute to the immune priming of oyster by inhibiting the foreign microbe invasion through a specific down-regulation. PMID:27268574

  17. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker

  18. Analysis of simple sequence repeats in rice bean (Vigna umbellata) using an SSR-enriched library

    Institute of Scientific and Technical Information of China (English)

    Lixia Wang; Kyung Do Kim; Dongying Gao; Honglin Chen; Suhua Wang; SukHa Lee; Scott A. Jackson; Xuzhen Cheng

    2016-01-01

    Rice bean (Vigna umbellata Thunb.), a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%). Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7%of the total, followed by AAG/CTT (14.3%), and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2%were involved in cellular components, 24.2%were involved molecular functions, and 64.6%were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker-assisted selection in

  19. Weed management strategies for castor bean crops

    Directory of Open Access Journals (Sweden)

    Augusto Guerreiro Fontoura Costa

    2014-04-01

    Full Text Available Castor bean crops are agriculturally relevant due to the quality and versatility of their oil, both for the chemical industry and for biodiesel production. Proper weed management is important for both the cultivation and the yield of castor bean crops; therefore, the intention of the present work is to review pertinent information regarding weed management, including the studies regarding weed interference periods, chemical controls for use in different crop production systems and herbicide selectivity, for castor bean crops. Weed science research for castor bean crops is scarce. One of the main weed management challenges for castor bean crops is the absence of herbicides registered with the Ministry of Agriculture, Livestock and Food Supply (MALFS. Research for viable herbicides for weed control in castor bean crops should be directed by research and/or rural extension institutions, associations and farmers cooperatives, as well as by manufactures, for the registration of these selective herbicides, which would be primarily used to control eudicotyledons in castor bean crops. New studies involving the integration of weed control methods in castor bean also may increase the efficiency of weed management, for both small farmers using traditional crop methods in the Brazilian Northeast region, as well as for areas with the potential for large scale production, using conservation tillage systems, such as the no-tillage crop production system.

  20. Performance of the Bean-protein Fiber

    Institute of Scientific and Technical Information of China (English)

    韩光亭; 杜宁; 孙亚宁

    2003-01-01

    The methods in testing the bean-protein fiber and the standards used were simply introduced. The fiber's mechanical and chemical performances were further analyzed. And the correlative performance of the bean-protein fibers and other natural fibers have been compared, then full knowledge of the fiber's performance was concluded.

  1. Common beans, diseases: ecology and control

    Science.gov (United States)

    Common bean, Phaseolus vulgaris, is one of the most important edible legume crops worldwide, nutritionally and economically. Diseases caused by pathogens that affect beans can have catastrophic effects, destroying entire crops in some instances. There are more than 200 pathogens (bacterial, fungal,...

  2. Nutritional and health benefits of dried beans.

    Science.gov (United States)

    Messina, Virginia

    2014-07-01

    Dried beans (often referred to as grain legumes) may contribute to some of the health benefits associated with plant-based diets. Beans are rich in a number of important micronutrients, including potassium, magnesium, folate, iron, and zinc, and are important sources of protein in vegetarian diets. In particular, they are among the only plant foods that provide significant amounts of the indispensable amino acid lysine. Commonly consumed dried beans are also rich in total and soluble fiber as well as in resistant starch, all of which contribute to the low glycemic index of these foods. They also provide ample amounts of polyphenols, many of which are potent antioxidants. Intervention and prospective research suggests that diets that include beans reduce low-density lipoprotein cholesterol, favorably affect risk factors for metabolic syndrome, and reduce risk of ischemic heart disease and diabetes. The relatively low bean intakes of North Americans and northern Europeans can be attributed to a negative culinary image as well as to intestinal discomfort attributable to the oligosaccharide content of beans. Cooking practices such as sprouting beans, soaking and discarding soaking water before cooking, and cooking in water with a more alkaline pH can reduce oligosaccharide content. Promotional efforts are needed to increase bean intake. PMID:24871476

  3. Enterprise JavaBeans 31

    CERN Document Server

    Rubinger, Andrew

    2010-01-01

    Learn how to code, package, deploy, and test functional Enterprise JavaBeans with the latest edition of this bestselling guide. Written by the developers of JBoss EJB 3.1, this book not only brings you up to speed on each component type and container service in this implementation, it also provides a workbook with several hands-on examples to help you gain immediate experience with these components. With version 3.1, EJB's server-side component model for building distributed business applications is simpler than ever. But it's still a complex technology that requires study and lots of practi

  4. Extracellular calcium sensing and extracellular calcium signaling

    Science.gov (United States)

    Brown, E. M.; MacLeod, R. J.; O'Malley, B. W. (Principal Investigator)

    2001-01-01

    The cloning of a G protein-coupled extracellular Ca(2+) (Ca(o)(2+))-sensing receptor (CaR) has elucidated the molecular basis for many of the previously recognized effects of Ca(o)(2+) on tissues that maintain systemic Ca(o)(2+) homeostasis, especially parathyroid chief cells and several cells in the kidney. The availability of the cloned CaR enabled the development of DNA and antibody probes for identifying the CaR's mRNA and protein, respectively, within these and other tissues. It also permitted the identification of human diseases resulting from inactivating or activating mutations of the CaR gene and the subsequent generation of mice with targeted disruption of the CaR gene. The characteristic alterations in parathyroid and renal function in these patients and in the mice with "knockout" of the CaR gene have provided valuable information on the CaR's physiological roles in these tissues participating in mineral ion homeostasis. Nevertheless, relatively little is known about how the CaR regulates other tissues involved in systemic Ca(o)(2+) homeostasis, particularly bone and intestine. Moreover, there is evidence that additional Ca(o)(2+) sensors may exist in bone cells that mediate some or even all of the known effects of Ca(o)(2+) on these cells. Even more remains to be learned about the CaR's function in the rapidly growing list of cells that express it but are uninvolved in systemic Ca(o)(2+) metabolism. Available data suggest that the receptor serves numerous roles outside of systemic mineral ion homeostasis, ranging from the regulation of hormonal secretion and the activities of various ion channels to the longer term control of gene expression, programmed cell death (apoptosis), and cellular proliferation. In some cases, the CaR on these "nonhomeostatic" cells responds to local changes in Ca(o)(2+) taking place within compartments of the extracellular fluid (ECF) that communicate with the outside environment (e.g., the gastrointestinal tract). In others

  5. Enhanced expression of extracellular calcium sensing receptor in monocyte-differentiated versus undifferentiated HL-60 cells: potential role in regulation of a nonselective cation channel

    Science.gov (United States)

    Yamaguchi, T.; Ye, C.; Chattopadhyay, N.; Sanders, J. L.; Vassilev, P. M.; Brown, E. M.; O'Malley, B. W. (Principal Investigator)

    2000-01-01

    Human promyelocytic leukemia cells (HL-60) have been used widely as a model for studying the differentiation of hematopoietic progenitor cells in vitro. After treatment with phorbol-12-myristate-13-acetate (PMA) or 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)], HL-60 cells differentiate into cells with the phenotype of monocytes/macrophages. We previously showed that peripheral blood monocytes and the murine J774 monocytic cell line express the CaR, and myeloid progenitors in the bone marrow and myeloid cells in peripheral blood other than monocytes express lower levels of the CaR. Therefore, we investigated whether undifferentiated HL-60 cells express a functional G protein-coupled, extracellular calcium (Ca(2+)(o))-sensing receptor (CaR) and if the expression of the CaR increases as these cells differentiate along the monocytic lineage. The use of reverse transcription-polymerase chain reaction (RT-PCR) with CaR-specific primers, followed by sequencing of the amplified products, identified an authentic CaR transcript in undifferentiated HL-60 cells. Both immunocytochemistry and Western blot analysis using a CaR-specific antiserum detected low levels of CaR protein expression in undifferentiated HL-60 cells. The levels of CaR protein increased considerably following treatment of the cells with PMA (50 nM) or 1,25(OH)(2)D(3) (100 nM) for 5 days. Northern analysis using a CaR-specific riboprobe identified CaR transcripts in undifferentiated HL-60 cells, but CaR mRNA levels did not change appreciably after treatment with either agent, suggesting that upregulation of CaR protein occurs at a translational level. PMA-treated HL-60 cells expressed a nonselective cation channel (NCC), and the calcimimetic CaR activator, NPS R-467, but not its less active stereoisomer, NPS S-467, as well as the polycationic CaR agonist, neomycin, activated this NCC, demonstrating that the CaR expressed in these cells is functionally active. Therefore, HL-60 cells exhibit an increase in Ca

  6. Eotaxin and FGF enhance signaling through an Extracellular signal-related kinase (ERK-dependent pathway in the pathogenesis of Eosinophilic Esophagitis

    Directory of Open Access Journals (Sweden)

    Huang Jennifer J

    2010-09-01

    Full Text Available Abstract Background Eosinophilic esophagitis (EoE is characterized by the inflammation of the esophagus and the infiltration of eosinophils into the esophagus, leading to symptoms such as dysphagia and stricture formation. Systemic immune indicators like eotaxin and fibroblast growth factor were evaluated for possible synergistic pathological effects. Moreover, blood cells, local tissue, and plasma from EoE and control subjects were studied to determine if the localized disease was associated with a systemic effect that correlated with presence of EoE disease. Method Real-time polymerase chain reaction from peripheral blood mononuclear cells (PBMC, immunohistochemistry from local esophageal biopsies, fluid assays on plasma, and fluorescence-activated cell sorting on peripheral blood cells from subjects were used to study the systemic immune indicators in newly diagnosed EoE (n = 35, treated EoE (n = 9, Gastroesophageal reflux disease (GERD (n = 8, ulcerative colitis (n = 5, Crohn's disease (n = 5, and healthy controls (n = 8. Result Of the transcripts tested for possible immune indicators, we found extracellular signal-regulated kinase (ERK, Bcl-2, bFGF (basic fibroblast growth factor, and eotaxin levels were highly upregulated in PBMC and associated with disease presence of EoE. Increased FGF detected by immunohistochemistry in esophageal tissues and in PBMC was correlated with low levels of pro-apoptotic factors (Fas, Caspase 8 in PBMC from EoE subjects. Plasma-derived bFGF was shown to be the most elevated and most specific in EoE subjects in comparison to healthy controls and disease control subjects. Conclusion We describe for the first time a possible mechanism by which increased FGF is associated with inhibiting apoptosis in local esophageal tissues of EoE subjects as compared to controls. Eotaxin and FGF signaling pathways share activation through the ERK pathway; together, they could act to increase eosinophil activation and prolong the

  7. Effect of fermentation with Monascus pilosus on the antioxidant activities and phenolic acid contents of adzuki bean (Vigna angularis)

    Institute of Scientific and Technical Information of China (English)

    Jinhua Cheng; Sung-Kwon Lee; Joo-Won Suh; Seung HwanYang

    2015-01-01

    Objective: To enhance physiological activities of adzuki bean (Vigna angularis) via fermentation with Monascus pilosus (M. pilosus). Methods: The adzuki bean fermentation conditions with M. pilosus were optimized, and the effect of Monascus-fermentation on the antioxidant capacity and phenolic acid contents of adzuki bean was investigated. Results: Optimal fermentation conditions were determined by the production of monacolin K. The highest monacolin K production was observed in 5% inoculum sized on day 15 in fermentation. Free and bound phenolic acids were isolated from native and fermented adzuki bean. A 1.9-fold decrease was observed in bound p-coumaric acid content, whereas the contents of bound ferulic and sinapic acids were increased by 28- and 1.7-fold, respectively. However, the contents of free phenolic acids such as p-coumaric, ferulic, and sinapic acids were increased by 2.6-, 5.2-, and 7.2-fold, respectively. The fermentation of adzuki bean by M. pilosus enhanced the activities of DPPH· radical scavenging, ferrous ion-chelating, nitric oxide scavenging, and ferric antioxidant reducing activities 2.2-, 1.7-, 1.2-, and 1.8-fold, respectively. Conclusions: Results from our study suggest that the contents of p-coumaric, ferulic, and sinapic acids in adzuki bean were highly increased by fermentation with M. pilosus, resulting in enhanced various antioxidant activities.

  8. Radiation disinfestation of grains and cocoa beans

    International Nuclear Information System (INIS)

    A series of experiments has been performed by Ghanaian scientists from 1977 to 1987 to evaluate the seriousness of infestation and to establish effective doses for radiation disinfestation against insects and fungi which cause deterioration in grains and cocoa beans. Supporting investigations have been done on the effect of radiation disinfestation on some quality parameters and wholesomeness of grains (with maize as the test grain) and cocoa beans. A minimum dose of 0.8 kGy was established for effective control of insects present in stored grains and cocoa beans. For the decontamination against fungi and yeasts, a combination of moist heat (85% RH) applied to 60 deg. C for 30 min followed by a dose of 4 kGy was effective for maize and moist heat (85% RH) applied 80 deg. C and a dose of 4 kGy was recommended for cocoa beans. No significant difference was found between the organoleptic qualities of the products from maize and cocoa that had been treated with moist heat and radiation and the untreated samples. The cooling (solidifying) curves of cocoa butter prepared from untreated and treated cocoa beans were very similar. Irradiated cocoa beans were found to be wholesome. The prospects of radiation disinfestation of grains and cocoa beans have also been discussed. (author). 27 refs, 4 tabs

  9. Regulation of copper homeostasis and biotic interactions by microRNA 398b in common bean.

    Directory of Open Access Journals (Sweden)

    Loreto Naya

    Full Text Available MicroRNAs are recognized as important post-transcriptional regulators in plants. Information about the roles of miRNAs in common bean (Phaseolus vulgaris L., an agronomically important legume, is yet scant. The objective of this work was to functionally characterize the conserved miRNA: miR398b and its target Cu/Zn Superoxide Dismutase 1 (CSD1 in common bean. We experimentally validated a novel miR398 target: the stress up-regulated Nodulin 19 (Nod19. Expression analysis of miR398b and target genes -CSD1 and Nod19- in bean roots, nodules and leaves, indicated their role in copper (Cu homeostasis. In bean plants under Cu toxicity miR398b was decreased and Nod19 and CSD1, that participates in reactive oxygen species (ROS detoxification, were up-regulated. The opposite regulation was observed in Cu deficient bean plants; lower levels of CSD1 would allow Cu delivery to essential Cu-containing proteins. Composite common bean plants with transgenic roots over-expressing miR398 showed ca. 20-fold higher mature miR398b and almost negligible target transcript levels as well as increased anthocyanin content and expression of Cu-stress responsive genes, when subjected to Cu deficiency. The down-regulation of miR398b with the consequent up-regulation of its targets was observed in common bean roots during the oxidative burst resulting from short-time exposure to high Cu. A similar response occurred at early stage of bean roots inoculated with Rhizobium tropici, where an increase in ROS was observed. In addition, the miR398b down-regulation and an increase in CSD1 and Nod19 were observed in bean leaves challenged with Sclerotinia scleortiorum fungal pathogen. Transient over-expression of miR398b in Nicotiana benthamiana leaves infected with S. sclerotiorum resulted in enhanced fungal lesions. We conclude that the miR398b-mediated up-regulation of CSD and Nod19 is relevant for common bean plants to cope with oxidative stress generated in abiotic and biotic

  10. Immunocytochemical characterization of the cell walls of bean cell suspensions during habituation and dehabituation to dichlobenil

    DEFF Research Database (Denmark)

    Garcia-Angulo, P.; Willats, W. G. T.; Encina, A. E.;

    2006-01-01

    analysed showed calcofluor-stained appositions. However, in habituated and dehabituated cells, appositions were not recognized by an anticallose antibody. This finding suggested the accumulation of an extracellular polysaccharide different to callose, probably a 1,4-ß-glucan in these cell lines......The effects of the cellulose inhibitor dichlobenil on the cell wall composition and structure during the habituation/dehabituation process of suspension-cultured bean cells were assessed. A range of techniques were used including cell wall fractionation, sugar analysis, immunofluorescence and...... fluorochrome labelling of resin-embedded sections, and immunodot assays (IDAs) of cell wall fractions. The cell walls from bean cell suspensions with initial levels of habituation to dichlobenil had decreased levels of cellulose, but this effect lessened with increasing numbers of subcultures. All cell walls...

  11. ISOLATED PROTEIN FROM CASTOR BEAN, PEANUT, SOY BEAN AND SAFFLOWER MEALS

    OpenAIRE

    B.Tavasolian; S.Nikpour; B.Makanvand

    1981-01-01

    Castor bean, peanut, Soy bean and safflower protein isolates were prepared. The amino acid content of each of the protein isolates was analysed and the essential amino acid contents were compared with the FAO human requirements. The results indicated that castor bean has the highest oil and the protein content of defatted meal. Safflower 3148 (Marand, Iran) has the highest amount of essential amino acids. Peanut (Gilan Iran) has the lowest content of essential amino acids, however, in compari...

  12. Extracellular Vesicle (EV) Array

    DEFF Research Database (Denmark)

    Jørgensen, Malene; Bæk, Rikke; Pedersen, Shona;

    2013-01-01

    Exosomes are one of the several types of cell-derived vesicles with a diameter of 30-100 nm. These extracellular vesicles are recognized as potential markers of human diseases such as cancer. However, their use in diagnostic tests requires an objective and high-throughput method to define...

  13. Bacterial extracellular lignin peroxidase

    Science.gov (United States)

    Crawford, Donald L.; Ramachandra, Muralidhara

    1993-01-01

    A newly discovered lignin peroxidase enzyme is provided. The enzyme is obtained from a bacterial source and is capable of degrading the lignin portion of lignocellulose in the presence of hydrogen peroxide. The enzyme is extracellular, oxidative, inducible by lignin, larch wood xylan, or related substrates and capable of attacking certain lignin substructure chemical bonds that are not degradable by fungal lignin peroxidases.

  14. Response of Snap Bean Cultivars to Rhizobium Inoculation under Dryland Agriculture in Ethiopia

    Directory of Open Access Journals (Sweden)

    Hussien Mohammed Beshir

    2015-07-01

    Full Text Available High yield in snap bean (Phaseolus vulgaris L. production requires relatively high nitrogen (N inputs. However, little information is available on whether the use of rhizobial inoculants for enhanced biological dinitrogen fixation can provide adequate N to support green pod yield. The objectives of this study were to test the use of rhizobia inoculation as an alternative N source for snap bean production under rain fed conditions, and to identify suitable cultivars and appropriate agro-ecology for high pod yield and N2 fixation in Ethiopia. The study was conducted in 2011 and 2012 during the main rainy season at three locations. The treatments were factorial combinations of three N treatments (0 and 100 kg·N·ha−1, and Rhizobium etli (HB 429 and eight snap bean cultivars. Rhizobial inoculation and applied N increased the total yield of snap bean pod by 18% and 42%, respectively. Cultivar Melkassa 1 was the most suitable for a reduced input production system due to its greatest N2 fixation and high pod yield. The greatest amount of fixed N was found at Debre Zeit location. We concluded that N2 fixation achieved through rhizobial inoculation can support the production of snap bean under rain fed conditions in Ethiopia.

  15. Weed management strategies for castor bean crops

    OpenAIRE

    Augusto Guerreiro Fontoura Costa; Valdinei Sofiatti; Cleber Daniel de Góes Maciel; Juliana Parisotto Poletine; João Igor de Sousa

    2014-01-01

    Castor bean crops are agriculturally relevant due to the quality and versatility of their oil, both for the chemical industry and for biodiesel production. Proper weed management is important for both the cultivation and the yield of castor bean crops; therefore, the intention of the present work is to review pertinent information regarding weed management, including the studies regarding weed interference periods, chemical controls for use in different crop production systems and herbicide s...

  16. Java EE 7 development with NetBeans 8

    CERN Document Server

    Heffelfinger, David R

    2015-01-01

    The book is aimed at Java developers who wish to develop Java EE applications while taking advantage of NetBeans functionality to automate repetitive tasks. Familiarity with NetBeans or Java EE is not assumed.

  17. In Vivo Immunomodulation and Lipid Peroxidation Activities Contributed to Chemoprevention Effects of Fermented Mung Bean against Breast Cancer

    Directory of Open Access Journals (Sweden)

    Swee Keong Yeap

    2013-01-01

    Full Text Available Mung bean has been reported to have antioxidant, cytotoxic, and immunomodulatory effects in vitro. Fermented products are reported to have enhanced immunomodulation and cancer chemopreventive effects. In this study, fermented mung bean treatments in vivo were studied by monitoring tumor development, spleen immunity, serum cytokine (interleukin 2 and interferon gamma levels, and spleen/tumor antioxidant levels after injection with low and high risk 4T1 breast cancer cells. Pretreatment with fermented mung bean was associated with delayed tumor formation in low risk mice. Furthermore, this treatment was connected with higher serum anticancer cytokine levels, spleen T cell populations, splenocyte cytotoxicity, and spleen/tumor antioxidant levels. Histopathological evaluation of fermented mung bean treated tumor revealed lower event of mitotic division. On the other hand, antioxidant and nitric oxide levels that were significantly increased in the untreated mice were inhibited in the fermented mung bean treated groups. These results suggested that fermented mung bean has potential cancer chemoprevention effects through the stimulation of immunity, lipid peroxidation, and anti-inflammation.

  18. Effects of fermented soya bean on digestion, absorption and diarrhoea

    OpenAIRE

    Kiers, J.L.

    2001-01-01

    For many centuries Asian people have consumed soya beans in various forms of traditional fermented soya bean foods. Major desirable aspects of fermented soya bean foods are their attractive flavour and texture, certain nutritional properties, and possible health promoting effects. This study describes effects of fermented soya beans on gastrointestinal physiology and addresses digestion, absorption and diarrhoea.Using an in vitro digestion model it appeared that fermentation increased solubil...

  19. On the Specification of Components - the JavaBeans Example

    OpenAIRE

    Heisel, Maritta; Santen, Thomas; Souquières, Jeanine

    2002-01-01

    We specify the JavaBean component model and concrete beans using a combination of UML class diagrams, an extension of Object-Z, and life sequence charts. We extend Object-Z by keywords that allow one to concisely describe the interface of a bean by an Object-Z class specification. The component model specification provides specification templates consisting of class diagrams, Object-Z fragments, and life sequence charts that precisely capture the functional behavior of beans in general, inclu...

  20. Dry Heat and Radiation Combination Effects on Aspergillus Flavus Link. Infecting Cocoa Beans

    International Nuclear Information System (INIS)

    The paper deals with the effect of heat and radiation combination treatments on the control of microbial spoilage of cocoa beans caused by toxigenic Aspergillus flavus Link. The heat and radiation sources were from dry air oven heat and 60Co gammaceli 220 irradiator, respectively. The radiation doses used were either 0, 50, 100, 150 or 200 krad, with combined heat temperatures of 30, 60 or 90°C. At each temperature level three different exposure time intervals of either 15 min, 30 min or 60 min respectively, were used. Two reversible sequential heat/radiation combination effects were evaluated.. The first sequence involved cocoa beans inoculated with A. flavus spores exposed first to dry heat at pre-determined temperature heat exposure time, followed by radiation treatment, then retention of samples in a constant humidity environmental chamber set at 80% for daily observation up to forty days post-treatment. The second sequence involved exposure of the inoculated beans first to radiation, then to heat before retention under fixed RH for observation. From their results, the authors arrive at four conclusions: first, that there is a critical radiation/heat combination range (200, 150 and 100 krad/90°C for 15 min) that significantly decontaminates (less than 5% mouldiness) A. flavus infected cocoa beans even under high relative humidity (80% RH) environment; second, that a temperature level of 90°C combined with 200, 150 or 100 krad maximizes such effect but the heat exposure time is a major factor; third, that low heat temperature ranges of 30 or 60°C, combined with low radiation dosages of 150 krad or below, enhance the rate of A. flavus spoilage effects of cocoa beans; and, lastly, that the sequence of exposure of the inoculated cocoa beans to heat/radiation combination influenced the spore germination; exposure to heat before radiation would sensitize the spores (200 krad/90°C) but results in an increased radioresistance. (author)

  1. Dry heat and radiation combination effects on Aspergillus flavus Link. infecting cocoa beans

    International Nuclear Information System (INIS)

    The paper deals with the effect of heat and radiation combination treatments on the control of microbial spoilage of cocoa beans caused by toxigenic Aspergillus flavus Link. The heat and radiation sources were from dry air oven heat and 60Co gammacell 220 irradiator, respectively. The radiation doses used were either 0, 50, 100, 150 or 200 krad, with combined heat temperatures of 30, 60 or 900C. At each temperature level three different exposure time intervals of either 15 min, 30 min or 60 min respectively, were used. Two reversible sequential heat/radiation combination effects were evaluated. The first sequence involved cocoa beans inoculated with A. flavus spores exposed first to dry heat at pre-determined temperature heat exposure time, followed by radiation treatment, then retention of samples in a constant humidity environmental chamber set at 80% for daily observation up to forty days post-treatment. The second sequence involved exposure of the inoculated beans first to radiation, then to heat before retention under fixed RH for observation. From their results, the authors arrive at four conclusions: first, that there is a critical radiation/heat combination range (200, 150 and 100 krad/900C for 15 min) that significantly decontaminates (less than 5% mouldiness) A. flavus infected cocoa beans even under high relative humidity (80% RH) environment; second, that a temperature level of 900C combined with 200, 150 or 100 krad maximizes such effect but the heat exposure time is a major factor; third, that low heat temperature ranges of 30 or 600C, combined with low radiation dosages of 150 krad or below, enhance the rate of A. flavus spoilage effects of cocoa beans; and, lastly, that the sequence of exposure of the inoculated cocoa beans to heat/radiation combination influenced the spore germination; exposure to heat before radiation would sensitize the spores (200 krad/900C) but results in an increased radioresistance. (author)

  2. Growth characteristics of mung beans and water convolvuluses exposed to 425-MHz electromagnetic fields.

    Science.gov (United States)

    Jinapang, Peeraya; Prakob, Panida; Wongwattananard, Pongtorn; Islam, Naz E; Kirawanich, Phumin

    2010-10-01

    Effects of high-frequency, continuous wave (CW) electromagnetic fields on mung beans (Vigna radiata L.) and water convolvuluses (Ipomoea aquatica Forssk.) were studied at different growth stages (pre-sown seed and early seedling). Specifically, the effects of the electromagnetic source's power and duration (defined as power-duration level) on the growth of the two species were studied. Mung beans and water convolvuluses were exposed to electromagnetic fields inside a specially designed chamber for optimum field absorption, and the responses of the seeds to a constant frequency at various power levels and durations of exposure were monitored. The frequency used in the experiments was 425 MHz, the field strengths were 1 mW, 100 mW, and 10 W, and the exposure durations were 1, 2, and 4 h. Results show that germination enhancement is optimum for the mung beans at 100 mW/1 h power-duration level, while for water convolvuluses the optimum germination power-duration level was 1 mW/2 h. When both seed types were exposed at the early sprouting phase with their respective optimum power-duration levels for optimum seed growth, water convolvuluses showed growth enhancement while mung bean sprouts showed no effects. Water content analysis of the seeds suggests thermal effects only at higher field strength. PMID:20564175

  3. Statins Enhance Formation of Phagocyte Extracellular Traps

    OpenAIRE

    Chow, Ohn A.; von Köckritz-Blickwede, Maren; Bright, A. Taylor; Hensler, Mary E.; Zinkernagel, Annelies S; Cogen, Anna L.; Gallo, Richard L.; Monestier, Marc; Wang, Yanming; Glass, Christopher K.; Nizet, Victor

    2010-01-01

    Statins are inhibitors of 3-hydroxy 3-methylglutaryl coenzyme A (HMG-CoA) reductase, the rate-limiting enzyme in cholesterol biosynthesis. Several recent clinico-epidemiologic studies have revealed that patients receiving statin therapy have reduced mortality associated with severe bacterial infection. Here we study pharmacological effect of statins on the innate immune capacity of phagocytic cells, focusing on the leading human bacterial pathogen Staphylococcus aureus. These studies revealed...

  4. Evaluation of the recycle of nitrogen in a succession bean - corn -bean By means of the isotopic method

    International Nuclear Information System (INIS)

    To determine the recycle of Nitrogen in a succession bean - corn - bean a was developed I experience under field conditions, on Red Ferralitic soils (Rhodic Ferrasols) with the one I use of the stable isotope 15 Nitrogen

  5. 21 CFR 582.7343 - Locust bean gum.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Locust bean gum. 582.7343 Section 582.7343 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... bean gum. (a) Product. Locust (carob) bean gum. (b) Conditions of use. This substance is...

  6. Effects of fermented soya bean on digestion, absorption and diarrhoea

    NARCIS (Netherlands)

    Kiers, J.L.

    2001-01-01

    For many centuries Asian people have consumed soya beans in various forms of traditional fermented soya bean foods. Major desirable aspects of fermented soya bean foods are their attractive flavour and texture, certain nutritional properties, and possible health promoting effects. This study describ

  7. Methyl bromide residues in fumigated cocoa beans

    International Nuclear Information System (INIS)

    The 14C activity in unroasted [14C]-methyl bromide fumigated cocoa beans was used to study the fate and persistence of CH3Br in the stored beans. About 70% of the residues occurred in the shells. Unchanged CH3Br could not be detected, all the sorbed CH3Br having reacted with bean constituents apparently to form 14C-methylated derivatives and inorganic bromide. No 14C activity was found in the lipid fraction. Roasting decreased the bound (non-volatile) residues, with corresponding changes in the activities and amounts of free sugars, free and protein amino acids. Roasted nibs and shells showed a two-fold increase in the volatile fraction of the 14C residue. This fraction may be related to the volatile aroma compounds formed by Maillard-type reactions. (author)

  8. Stem Anatomy of Country Bean

    Directory of Open Access Journals (Sweden)

    M. Touhidul Islam

    2003-01-01

    Full Text Available Anatomical investigation has been made on the stem of country bean (Lablab purpureus (L. Sweet at different stages of growth following the standard paraffin method of microtechnique. The epidermis is single layered with multicellular hairs and glandular trichomes. Beneath the epidermis there are 5-10 layers of cortical cells. The primary vascular tissue appears after the elongation of the first internode of the stem. The vascular bundles are collateral and arranged in a ring. There are two types of vascular bundles, large and small. There are one or more small vascular bundles in between two large bundles. The large vascular bundle contains xylem and phloem but small bundle may or may not contain both xylem and phloem. There are several poles of primary phloem outside the primary xylem. The pericycle is discontinuous. Two adjacent groups of sclerenchyma are connected by one or two layers of sclerenchymatous cells. The cambium initiates in the primary vascular bundle between xylem and phloem at the basal part of the stem of 4 days old plant. Gradually it extends towards the upper part. The cambium is at first confined to the fascicular region. Subsequently it extends into the interfascicular region forming a complete cambial ring. After the formation of the fascicular cambium it gives rise to the secondary xylem adaxially and secondary phloem abaxially. In the mature stem, most of the vessels are multiple, some are paired while the others are solitary. Most of the fibre cells in the phloem region are found in groups. The fibre cells are arranged in such a way that the structure looks like a pyramid. Tannin cells are present in the phloem region of younger and mature stem. The secretory cells devoid of tanniniferous contents have been observed in the secondary phloem region of the mature stem. The phellogen appears in the deeper cortex and produces periderm with lenticel. The periderm consists of 3-5 layers of cork cells abaxially and 2-3 layers

  9. White and dark kidney beans reduce colonic mucosal damage and inflammation in response to dextran sodium sulfate.

    Science.gov (United States)

    Monk, Jennifer M; Zhang, Claire P; Wu, Wenqing; Zarepoor, Leila; Lu, Jenifer T; Liu, Ronghua; Pauls, K Peter; Wood, Geoffrey A; Tsao, Rong; Robinson, Lindsay E; Power, Krista A

    2015-07-01

    Common beans are a rich source of nondigestible fermentable components and phenolic compounds that have anti-inflammatory effects. We assessed the gut-health-promoting potential of kidney beans in healthy mice and their ability to attenuate colonic inflammation following dextran sodium sulphate (DSS) exposure (via drinking water, 2% DSS w/v, 7 days). C57BL/6 mice were fed one of three isocaloric diets: basal diet control (BD), or BD supplemented with 20% cooked white (WK) or dark red kidney (DK) bean flour for 3 weeks. In healthy mice, anti-inflammatory microbial-derived cecal short chain fatty acid (SCFA) levels (acetate, butyrate and propionate), colon crypt height and colonic Mucin 1 (MUC1) and Resistin-like Molecule beta (Relmβ) mRNA expression all increased in WK- and DK-fed mice compared to BD, indicative of enhanced microbial activity, gut barrier integrity and antimicrobial defense response. During colitis, both bean diets reduced (a) disease severity, (b) colonic histological damage and (c) increased mRNA expression of antimicrobial and barrier integrity-promoting genes (Toll-like Receptor 4 (TLR4), MUC1-3, Relmβ and Trefoil Factor 3 (TFF3)) and reduced proinflammatory mediator expression [interleukin (IL)-1β, IL-6, interferon (IFN)γ, tumor necrosis factor (TNF)α and monocyte chemoattractant protein-1], which correlated with reduced colon tissue protein levels. Further, bean diets exerted a systemic anti-inflammatory effect during colitis by reducing serum levels of IL-17A, IFNγ, TNFα, IL-1β and IL-6. In conclusion, both WK and DK bean-supplemented diets enhanced microbial-derived SCFA metabolite production, gut barrier integrity and the microbial defensive response in the healthy colon, which supported an anti-inflammatory phenotype during colitis. Collectively, these data demonstrate a beneficial colon-function priming effect of bean consumption that mitigates colitis severity. PMID:25841250

  10. Integration of sunflower (Helianthus annuus residues with a pre-plant herbicide enhances weed suppression in broad bean (Vicia faba Integração de resíduos de girassol (Helianthus annuus com herbicida pré-emergente na supressão de plantas daninhas na cultura da fava (Vicia faba

    Directory of Open Access Journals (Sweden)

    I.S Alsaadawi

    2011-12-01

    Full Text Available Field trial was conducted with the aim of utilizing allelopathic crop residues to reduce the use of synthetic herbicides in broad bean (Vicia faba fields. Sunflower residue at 600 and 1,400 g m-2 and Treflan (trifluralin at 50, 75 and 100% of recommended dose were incorporated into the soil alone or in combination with each other. Untreated plots were maintained as a control. Herbicide application in plots amended with sunflower residue had the least total weed count and biomass, which was even better than herbicide used alone. Integration of recommended dose of Treflan with sunflower residue at 1,400 g m-² produced maximum (987.5 g m-2 aboveground biomass of broad bean, which was 74 and 36% higher than control and recommended herbicide dose applied alone, respectively. Combination of herbicide and sunflower residue appeared to better enhance pod number and yield per unit area than herbicide alone. Application of 50% dose of Treflan in plots amended with sunflower residue resulted in similar yield advantage as was noticed with 100% herbicide dose. Chromatographic analysis of residue-infested field soil indicated the presence of several phytotoxic compounds of phenolic nature. Periodic data revealed that maximum suppression in weed density and dry weight synchronized with peak values of phytotoxins observed 4 weeks after incorporation of sunflower residues. Integration of sunflower residues with lower herbicide rates can produce effective weed suppression without compromising yield as a feasible and environmentally sound approach in broad bean fields.O experimento foi realizado com o objetivo de utilizar resíduos agrícolas com potencial alelopático para reduzir o uso de herbicidas sintéticos em fava (Vicia faba. Resíduos de girassol (600 e 1,400 g m-2 e Treflan (50, 75 e 100% da dose recomendada foram incorporados ao solo isoladamente ou em combinação uns com os outros. Parcelas não tratadas foram mantidas como controle. A aplicação de

  11. Extracellular vesicles are the Trojan horses of viral infection.

    Science.gov (United States)

    Altan-Bonnet, Nihal

    2016-08-01

    Extracellular vesicles have recently emerged as a novel mode of viral propagation exploited by both enveloped and non-enveloped viruses. In particular non-enveloped viruses utilize the hosts' production of extracellular vesicles to exit from cells non-lytically and to hide and manipulate the immune system. Moreover, challenging the long held idea that viruses behave as independent genetic units, extracellular vesicles enable multiple viral particles and genomes to collectively traffic in and out of cells, which can promote genetic cooperativity among viral quasispecies and enhance the fitness of the overall viral population. PMID:27232382

  12. Nitrogen mineralization in soils amended with sunnhemp, velvet bean and common bean residues

    Directory of Open Access Journals (Sweden)

    Ambrosano Edmilson José

    2003-01-01

    Full Text Available Nitrogen (15N released from sunnhemp (Crotalaria juncea, velvet bean (Mucuna aterrima and from Phaseolus bean residues was evaluated after incubation of the plant material in an Eutrudox and a Paleudalf, in a greenhouse experiment with pots containing 6 kg of air dried soil. Dry matter equivalent to 13 Mg ha-1 of Phaseolus bean residues and the same amount of above ground parts of the leguminous species, associated to 2.7 and 2.2 Mg ha-1 of roots of sunnhemp and velvet bean respectively, were incorporated into the soil. A completely randomized experimental design was adopted, with treatments arranged in a 2 3 + 1 factorial, replicated three times. The treatments were the following: two soils (Eutrudox and Paleudalf and three plant materials: two green-manures (sunnhemp or velvet bean, and Phaseolus bean residues, besides one control without plant incorporation into the soil. For the green-manure treatments there were two sub-treatments for each legume species, with 15N labeling of either shoots or roots. Soil moisture was maintained relatively constant during the experiment al period and the treatments were sampled weekly during 49 days. Total mineral nitrogen in the soil, as well as that derived from the legume plants were determined by isotope dilution. Nitrogen from the velvet bean accounted for a greater proportion of the soil inorganic N; shoots were responsible for most of N accumulated. Dry bean residues caused immobilization of inorganic N. The leguminous species added were intensively and promptly mineralized preserving the soil native nitrogen. Mineralization of the legume plant N was greater in the Paleudalf soil than in the Eutrudox.

  13. Nitrogen mineralization in soils amended with sunnhemp, velvet bean and common bean residues

    International Nuclear Information System (INIS)

    Nitrogen (15N) released from sunnhemp (Crotalaria juncea), velvet bean (Mucuna aterrima) and from Phaseolus bean residues was evaluated after incubation of the plant material in an Eutrudox and a Paleudalf, in a greenhouse experiment with pots containing 6 kg of air dried soil. Dry matter equivalent to 13 Mg ha-1 of Phaseolus bean residues and the same amount of above ground arts of the leguminous species, associated to 2.7 and 2.2 Mg ha-1 of roots of sunnhemp and velvet bean respectively, were incorporated into the soil. A completely randomized experimental design was adopted, with treatments arranged in a 2 x 3 + 1 factorial, replicated three times. The treatments were the following: two soils (Eutrudox and Paleudalf) and three plant materials: two green-manures (sunnhemp or velvet bean), and Phaseolus bean residues, besides one control without plant incorporation into the soil. For the green-manure treatments there were two sub-treatments for each legume species, with 15N labeling of either shoots or roots. Soil moisture was maintained relatively constant during the experimental period and the treatments were sampled weekly during 49 days. Total mineral nitrogen in the soil, as well as that derived from the legume plants were determined by isotope dilution. Nitrogen from the velvet bean accounted for a greater proportion of the soil inorganic N; shoots were responsible for most of N accumulated. Dry bean residues caused immobilization of inorganic N. The leguminous species added were intensively and promptly mineralized preserving the soil native nitrogen. Mineralization of the legume plant N was greater in the Paleudalf soil than in the Eutrudox. (author)

  14. Virus diseases of peas, beans, and faba bean in the Mediterranean region.

    Science.gov (United States)

    Makkouk, Khaled; Pappu, Hanu; Kumari, Safaa G

    2012-01-01

    In the Mediterranean region, pea, bean, and faba bean production is affected by around 17 major viruses. These viruses do not have the same ecology and consequently require a variety of different preventive measures to control them. Some of these viruses have a narrow host range, such as Faba bean necrotic yellows virus (FBNYV), and others, such as Alfalfa mosaic virus (AMV) and Cucumber mosaic virus (CMV), a very wide host range. Such features are important when identifying sources of virus inoculum in a region, and the vectors can transmit viruses from natural reservoirs to the crop plants. Some of these viruses are seed borne and, consequently, can be disseminated long distances through infected seeds. Crop losses caused by these viruses are variable, depending on the sensitivity and susceptibility of the crop to infection. Host resistance genes have been identified for some of these viruses, but in others, such as FBNYV, no resistance genes in faba bean have been identified yet. Significant progress was made in developing precise methods for the identification of these viruses, and new virus problems are being identified every year. This chapter is not intended to be a review for pea, bean, and faba bean viruses, but rather focuses on the major viruses which affect these crops in the Mediterranean basin with focus on the progress made over the past two decades. PMID:22682174

  15. Genetic divergence of common bean cultivars.

    Science.gov (United States)

    Veloso, J S; Silva, W; Pinheiro, L R; Dos Santos, J B; Fonseca, N S; Euzebio, M P

    2015-01-01

    The aim of this study was to evaluate genetic divergence in the 'Carioca' (beige with brown stripes) common bean cultivar used by different institutions and in 16 other common bean cultivars used in the Rede Cooperativa de Pesquisa de Feijão (Cooperative Network of Common Bean Research), by using simple sequence repeats associated with agronomic traits that are highly distributed in the common bean genome. We evaluated 22 polymorphic loci using bulks containing DNA from 30 plants. There was genetic divergence among the Carioca cultivar provided by the institutions. Nevertheless, there was lower divergence among them than among the other cultivars. The cultivar used by Instituto Agronômico do Paraná was the most divergent in relation to the Carioca samples. The least divergence was observed among the samples used by Universidade Federal de Lavras and by Embrapa Arroz e Feijão. Of all the cultivars, 'CNFP 10104' and 'BRSMG Realce' showed the greatest dissimilarity. The cultivars were separated in two groups of greatest similarity using the Structure software. Genetic variation among cultivars was greater than the variation within or between the groups formed. This fact, together with the high estimate of heterozygosity observed and the genetic divergence of the samples of the Carioca cultivar in relation to the original provided by Instituto Agronômico de Campinas, indicates a mixture of cultivars. The high divergence among cultivars provides potential for the utilization of this genetic variability in plant breeding. PMID:26400359

  16. Healthy food trends -- beans and legumes

    Science.gov (United States)

    ... beans (15 oz.) ½ medium onion 2 garlic cloves 2 tablespoons vegetable oil ½ teaspoon cumin (ground) ½ teaspoon salt ¼ ... pieces. Set the onions aside. Peel the garlic cloves and mince ... heat your cooking oil over medium high heat. Add the onions and ...

  17. Castor bean response to zinc fertilization

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Henrique Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Zinc is a trace element and it is absolutely essential for the normal healthy growth of plants. This element plays a part of several enzyme systems and other metabolic functions in the plants. Castor beans (Ricinus communis L.) crop is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor beans yield, few researches has been made on this issue, mainly on the use of zinc. In order to evaluate the effects of zinc on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Zn (0; 2; 4; 6 and 8 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Under conditions that the experiment was carried out the results showed that the Zn levels used, did not affect the castor bean plants growth. (author)

  18. Common bean and cowpea improvement in Angola

    Science.gov (United States)

    During 2014 and 2015, the Instituto de Investigação Agronómica (IIA) evaluated the performance of common bean (Phaselolus vulgaris L.) breeding lines and improved cowpea (Vigna unguiculata L. Walp.) varieties. The field experiments were planted in the lowlands at Mazozo and in the highlands at Chian...

  19. Seed coat darkening in Cowpea bean

    Science.gov (United States)

    Seed coat of cowpea bean (Vigna unguiculata L. Walp) slowly browns to a darker color during storage. High temperature and humidity during storage might contribute to this color change. Variation in browning rate among seeds in a lot leads to a mixture of seed colors creating an unacceptable product...

  20. Registration of ‘Eldorado’ pinto bean

    Science.gov (United States)

    ‘Eldorado’ (Reg. No. CV-302, PI 665012) pinto bean (Phaseolus vulgaris L.), which was developed by Michigan State University AgBioResearch, was released in 2012 as an upright, full-season,disease-resistant cultivar. Eldorado, tested as MSU breeding line P07863, was developed using the single-seed-de...

  1. Biochemical Properties of Pectate Lyases Produced by Three Different Bacillus Strains Isolated from Fermenting Cocoa Beans and Characterization of Their Cloned Genes▿ †

    OpenAIRE

    Ouattara, Honoré G.; Reverchon, Sylvie; Niamke, Sébastien L.; Nasser, William

    2010-01-01

    Pectinolytic enzymes play an important role in cocoa fermentation. In this study, we characterized three extracellular pectate lyases (Pels) produced by bacilli isolated from fermenting cocoa beans. These enzymes, named Pel-22, Pel-66, and Pel-90, were synthesized by Bacillus pumilus BS22, Bacillus subtilis BS66, and Bacillus fusiformis BS90, respectively. The three Pels were produced under their natural conditions and purified from the supernatants using a one-step chromatography method. The...

  2. Extracellular Control of Limb Regeneration

    Science.gov (United States)

    Calve, S.; Simon, H.-G.

    Adult newts possess the ability to completely regenerate organs and appendages. Immediately after limb loss, the extracellular matrix (ECM) undergoes dramatic changes that may provide mechanical and biochemical cues to guide the formation of the blastema, which is comprised of uncommitted stem-like cells that proliferate to replace the lost structure. Skeletal muscle is a known reservoir for blastema cells but the mechanism by which it contributes progenitor cells is still unclear. To create physiologically relevant culture conditions for the testing of primary newt muscle cells in vitro, the spatio-temporal distribution of ECM components and the mechanical properties of newt muscle were analyzed. Tenascin-C and hyaluronic acid (HA) were found to be dramatically upregulated in the amputated limb and were co-expressed around regenerating skeletal muscle. The transverse stiffness of muscle measured in situ was used as a guide to generate silicone-based substrates of physiological stiffness. Culturing newt muscle cells under different conditions revealed that the cells are sensitive to both matrix coating and substrate stiffness: Myoblasts on HA-coated soft substrates display a rounded morphology and become more elongated as the stiffness of the substrate increases. Coating of soft substrates with matrigel or fibronectin enhanced cell spreading and eventual cell fusion.

  3. Phytohemagglutinin derived from red kidney bean (Phaseolus vulgaris): a cause for intestinal malabsorption associated with bacterial overgrowth in the rat.

    Science.gov (United States)

    Banwell, J G; Boldt, D H; Meyers, J; Weber, F L

    1983-03-01

    Plant lectins or carbohydrate binding proteins interact with membrane receptors on cellular surfaces but their antinutritional effects are poorly defined. Studies were conducted to determine the effects of phytohemagglutinin, a lectin derived from raw red kidney bean (Phaseolus vulgaris), on small intestinal absorptive function and morphology, and on the intestinal microflora. Phytohemagglutinin was isolated in purified form by thyroglobulin-sepharose 4B affinity chromatography. Red kidney bean and phytohemagglutinin (6% and 0.5%, respectively, of dietary protein) were fed in a purified casein diet to weanling rats for up to 21 days. Weight loss, associated with malabsorption of lipid, nitrogen, and vitamin B12, developed in comparison with animals pair-fed isonitrogenous casein diets. Antinutritional effects of red kidney bean were reversible on reinstitution of a purified casein diet. An increase in bacterial colonization of the jejunum and ileum occurred in red kidney bean- and phytohemagglutin-fed animals. When antibiotics were included in the diet, malabsorption of [3H]triolein and 57Co-vitamin B12 in red kidney bean-fed animals was partially reversed and, in germ-free animals, purified phytohemagglutinin had no demonstrable antinutritional effect. Mucosal disaccharidase activity was reduced in red kidney bean- and phytohemagglutinin-fed animals, but intestinal mucosal morphology was unchanged. Dietary administration of phytohemagglutinin, alone or as a component of red kidney bean, caused intestinal dysfunction, which was associated with, and dependent upon, small intestinal bacterial overgrowth. Adherence of enteric bacteria to the mucosal surface was enhanced by phytohemagglutinin which may have facilitated small intestinal bacterial overgrowth. PMID:6822324

  4. Site-specific distribution and competitive ability of indigenous bean-nodulating rhizobia isolated from organic fields in Minnesota.

    Science.gov (United States)

    Wongphatcharachai, Manoosak; Wang, Ping; Staley, Christopher; Chun, Chan Lan; Ferguson, John A; Moncada, Kristine M; Sheaffer, Craig C; Sadowsky, Michael J

    2015-11-20

    Organic dry bean production systems have received increasing interest in many regions of the US, including Minnesota. Thus, improving biological N2 fixation would be highly beneficial for organic crop production. To date, only limited work has been done to select efficient N2-fixing rhizobia for organic dry bean production. In this study, soil samples from 25 organic fields in Minnesota, with a previous cropping history of dry beans, soybeans or both, were collected during May to July 2012. Genetic diversity of indigenous dry bean-rhizobia (511 isolates) was determined by using horizontal, fluorophore-enhanced, repetitive, extragenic, and palindromic-PCR (HFERP) DNA fingerprinting and isolates were classified as belonging to 58 different genotypes. The more abundant rhizobia isolated from bean nodules comprised 35.6% of the population. None of the isolates were identical to commonly-used commercial strains used in the U.S., including Rhizobium tropici CIAT899. Seventeen predominant genotypes were shown to represent two main species, Rhizobium leguminosarum bv. phaseoli (67.1%) and Rhizobium etli (30.2%). One of the indigenous strains, orgK9, displayed efficient N2-fixation and competitive ability relative to the commercial strains tested. The lack of large numbers of indigenous dry bean-rhizobia at most study sites will be useful to avoid competition problems between inoculant strains and indigenous rhizobia. This will allow inoculation with highly effective N2-fixing rhizobia, thus resulting in improved crop productivity. Our results highlight the existence of site-specific rhizobial genotypes in different organic fields and identify strains that may prove useful as novel inoculants for organic dry bean production systems. PMID:26403588

  5. Zinc supplementation, production and quality of coffee beans

    Directory of Open Access Journals (Sweden)

    Herminia Emilia Prieto Martinez

    2013-04-01

    Full Text Available Besides its importance in the coffee tree nutrition, there is almost no information relating zinc nutrition and bean quality. This work evaluated the effect of zinc on the coffee yield and bean quality. The experiment was conducted with Coffea arabica L. in "Zona da Mata" region, Minas Gerais, Brazil. Twelve plots were established at random with 4 competitive plants each. Treatments included plants supplemented with zinc (eight plots and control without zinc supplementation (four plots. Plants were subjected to two treatments: zinc supplementation and control. Yield, number of defective beans, beans attacked by berry borers, bean size, cup quality, beans zinc concentration, potassium leaching, electrical conductivity, color index, total tritable acidity, pH, chlorogenic acids contents and ferric-reducing antioxidant activity of beans were evaluated. Zinc positively affected quality of coffee beans, which presented lower percentage of medium and small beans, lower berry borer incidence, lower potassium leaching and electrical conductivity, higher contents of zinc and chlorogenic acids and higher antioxidant activity in comparison with control beans.

  6. Irrigation water demand of common bean on field and regional scale under varying climatic conditions

    Directory of Open Access Journals (Sweden)

    Michael Wagner

    2016-09-01

    Full Text Available Crop irrigation plays an important role in the world's food production and its role is expected to increase still further. For policy makers, the quantification of the irrigation water demand and the water availability on a regional scale is crucial. In the project ‘SAPHIR’, a new stochastic framework was developed to upscale crop yield and crop water demand from irrigation experiments with common bean to the regional scale using the one-dimensional mechanistic crop model Daisy. The crop model parameters – derived based on a comprehensive experimental data collection and a sound calibration of the crop model – were used to simulate potential bean yield, yield reduction due to drought stress, and crop water demand in mid and northern Saxony, Eastern Germany, using the dominant soil characteristics. The stochastic relationship between irrigated water and crop yield (stochastic crop water production function enabled the prediction of the crop productivity on a regional scale. Furthermore, the available water resources for irrigation on the catchment scale were compared to the predicted irrigation water requirements to estimate the degree of local water self sufficiency. The simulation results show that an irrigation of common bean has high yield effects especially in locations with low precipitation during the growing season or for soils with a low water storage capacity. Especially in the drier northern parts of Saxony with its lower soil water storage capability, a decrease in non-irrigated fresh matter bean yield up to 40 % is predicted for the future. Irrigation and the projected increasing temperature can enhance the bean yield in southern Saxony. However, the required amount of irrigation water in northern Saxony can only be delivered by down to 20 % and less from the local precipitation. The presented framework enables policy makers to compare water demand and available water which allows a precise estimation of relevant

  7. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    International Nuclear Information System (INIS)

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 μW cm-2; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H2O2) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at ≥2 h), and radicle and plumule growths (≥1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H2O2 accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  8. Bean Common Mosaic Virus and Bean Common Mosaic Necrosis Virus: Relationships, Biology, and Prospects for Control.

    Science.gov (United States)

    Worrall, Elizabeth A; Wamonje, Francis O; Mukeshimana, Gerardine; Harvey, Jagger J W; Carr, John P; Mitter, Neena

    2015-01-01

    The closely related potyviruses Bean common mosaic virus (BCMV) and Bean common mosaic necrosis virus (BCMNV) are major constraints on common bean (Phaseolus vulgaris) production. Crop losses caused by BCMV and BCMNV impact severely not only on commercial scale cultivation of this high-value crop but also on production by smallholder farmers in the developing world, where bean serves as a key source of dietary protein and mineral nutrition. In many parts of the world, progress has been made in combating BCMV through breeding bean varieties possessing the I gene, a dominant gene conferring resistance to most BCMV strains. However, in Africa, and in particular in Central and East Africa, BCMNV is endemic and this presents a serious problem for deployment of the I gene because this virus triggers systemic necrosis (black root disease) in plants possessing this resistance gene. Information on these two important viruses is scattered throughout the literature from 1917 onward, and although reviews on resistance to BCMV and BCMNV exist, there is currently no comprehensive review on the biology and taxonomy of BCMV and BCMNV. In this chapter, we discuss the current state of our knowledge of these two potyviruses including fundamental aspects of classification and phylogeny, molecular biology, host interactions, transmission through seed and by aphid vectors, geographic distribution, as well as current and future prospects for the control of these important viruses. PMID:26111585

  9. Safety assessment of the biogenic amines in fermented soya beans and fermented bean curd.

    Science.gov (United States)

    Yang, Juan; Ding, Xiaowen; Qin, Yingrui; Zeng, Yitao

    2014-08-01

    To evaluate the safety of biogenic amines, high performance liquid chromatography (HPLC) was used to evaluate the levels of biogenic amines in fermented soya beans and fermented bean curd. In fermented soya beans, the total biogenic amines content was in a relatively safe range in many samples, although the concentration of histamine, tyramine, and β-phenethylamine was high enough in some samples to cause a possible safety threat, and 8 of the 30 samples were deemed unsafe. In fermented bean curd, the total biogenic amines content was more than 900 mg/kg in 19 white sufu amples, a level that has been determined to pose a safety hazard; putrescine was the only one detected in all samples and also had the highest concentration, which made samples a safety hazard; the content of tryptamine, β-phenethylamine, tyramine, and histamine had reached the level of threat to human health in some white and green sufu samples, and that may imply another potential safety risk; and 25 of the 33 samples were unsafe. In conclusion, the content of biogenic amines in all fermented soya bean products should be studied and appropriate limits determined to ensure the safety of eating these foods. PMID:25029555

  10. Antioxidant activity of black bean (Phaseolus vulgaris L. protein hydrolysates

    Directory of Open Access Journals (Sweden)

    Jarine Amaral do EVANGELHO

    2016-01-01

    Full Text Available Abstract The objective of this work was to study the effect of enzymatic hydrolysis of black bean protein concentrate using different enzymes. Bean proteins were extracted and hydrolyzed over a period of 120 min using the enzymes pepsin or alcalase. The protein hydrolysates’ molecular weight was assayed by electrophoresis and the antioxidant activity was evaluated by the capturing methods of free radicals ABTS●+ and DPPH. Electrophoretic results showed that the bands above 50 kDa disappeared, when the beans protein was subjected to hydrolysis with pepsin. The bean protein hydrolysate obtained by hydrolysis with alcalase enzyme, showed higher antioxidant activity for inhibition of the radical ABTS●+. However, the hydrolysates obtained by hydrolysis with pepsin had higher antioxidant activity for inhibition of the radical DPPH. The use of pepsin and alcalase enzymes, under the same reaction time, produced black bean protein hydrolysates with different molecular weight profiles and superior antioxidant activity than the native bean protein.

  11. Ion beam analysis of ground coffee and roasted coffee beans

    International Nuclear Information System (INIS)

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans

  12. Ion beam analysis of ground coffee and roasted coffee beans

    Energy Technology Data Exchange (ETDEWEB)

    Debastiani, R., E-mail: rafa_debas@yahoo.com.br; Santos, C.E.I. dos; Yoneama, M.L.; Amaral, L.; Dias, J.F.

    2014-01-01

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans.

  13. Removal of antinutritional factors from bean (Phaseolus vulgaris L.) seeds

    OpenAIRE

    Bollini R.; Carnovale E.; Campion B.

    1999-01-01

    Phytohemagglutinin and the lectin-related proteins present in bean seeds are toxic to monogastric animals and lower the nutritional value of beans. Since these antimetabolites are present in substantial amounts, a breeding program aimed to the removal ofphytohemagglutinin was developed. The character ""absence of phytohemagglutinin"" was transferred into a bean cultivar by backcrossing. The lines obtained maintained the agronomic performance of the recurrent parent. Preliminary results show t...

  14. Two distinct nanovirus species infecting faba bean in Morocco

    OpenAIRE

    Abraham, Adane; Bencharki, Bouchaib; Torok, Valeria; Katul, Lina; Varrelmann, Mark; Josef Vetten, H.

    2009-01-01

    Using monoclonal antibodies raised against a Faba bean necrotic yellows virus (FBNYV) isolate from Egypt and a Faba bean necrotic stunt virus (FBNSV) isolate from Ethiopia, a striking serological variability among nanovirus isolates from faba bean in Morocco was revealed. To obtain a better understanding of this nanovirus variability in Morocco, the entire genomes of two serologically contrasting isolates referred to as Mor5 and Mor23 were sequenced. The eight circular ssDNA components, each ...

  15. Biology of the Coconut Bug, Pseudotheraptus wayi, on French Beans

    OpenAIRE

    Egonyu, James Peter; Ekesi, Sunday; Kabaru, Jacques; Irungu, Lucy

    2014-01-01

    The coconut bug, Pseudotheraptus wayi Brown (Heteroptera: Coreidae), is a major pest of a wide range of economically important crops in Eastern and Southern Africa. The suitability of French beans, Phaseolus vulgaris L. (Fabales: Fabaceae) as an alternative food for mass rearing of P. wayi was determined by elucidating its development, survival, and reproduction on French bean pods in the laboratory. Development and survival of immatures on French beans was comparable to what is reported with...

  16. Castor Bean Organelle Genome Sequencing and Worldwide Genetic Diversity Analysis

    OpenAIRE

    Rivarola, Maximo; Foster, Jeffrey T.; Chan, Agnes P.; Williams, Amber L.; Rice, Danny W; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M. J.; Khouri, Hoda M.; Beckstrom-Sternberg, Stephen M.; Allan, Gerard J; Keim, Paul; Ravel, Jacques

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and for...

  17. Intermittent drying of beans in a spouted bed

    OpenAIRE

    de Oliveira, C A; S.C.S. Rocha

    2007-01-01

    Carioca beans are a highly nutritious grain, in terms of the amount of protein, iron and potassium as well as carbohydrates and fiber and as a source of vitamins. The moisture content of recently picked beans is too high for good preservation and storage, resulting in the need for drying before packaging. In this work, the drying of Carioca beans in a laboratory scale spouted bed under intermittent conditions of the drying air was experimentally analyzed. Experiments carried out consisted of ...

  18. Effect of bean polyphenols on iron absorption in humans

    International Nuclear Information System (INIS)

    Iron deficiency and iron deficiency anaemia are major public health problems in many developing countries. Common beans are a staple food in various Eastern African countries. Beans contain high amounts of iron, but the iron is poorly absorbed due to the presence of the iron absorption inhibitors polyphenols and phytic acid. With the overall aim of increasing the intake of bioavailable iron from beans by plant breeding strategies, this study evaluates the importance bean polyphenols on iron absorption. In common beans the polyphenols are concentrated in the bean hulls. Therefore bean hulls were used as a source of natural bean polyphenols and added in three different amounts to a non-inhibitory test meal (phytic acid free bread rolls). Iron absorption from the test meals was measured in three groups of 16 apparently healthy female volunteers using stable iron isotope techniques. Each volunteer consumed a test meal with and a test meal without bean polyphenols extrinsically labeled with 57Fe and 58Fe respectively. Iron absorption was determined based on the incorporation of iron stable isotopes into red blood cells 14 days after administration. Isotopic analysis was performed by thermal ionization mass spectrometry. The results of the absorption studies showed a dose dependent negative effect of bean polyphenols on iron absorption in humans. At the lowest polyphenol content tested (20 mg per test meal) no impact on iron absorption was found (p 0.92). A polyphenol content of 50 mg reduced the mean iron absorption significantly from 20.3% to 17.3% (p 0.044). The highest polyphenol content of 200 mg significantly reduced the mean iron absorption from 14.3% to 7.9% (p 0.0001). Further studies are planned to evaluate the relative effect of polyphenols and phytic acid on iron absorption from beans to provide guidance for breeding beans with improved iron bioavailability. (author)

  19. Crushing of roasted arabica coffee beans

    Czech Academy of Sciences Publication Activity Database

    Nedomová, Š.; Trnka, Jan; Severa, L.; Stoklasová, Pavla; Buchar, J.

    Vol. 1. Nitra: Slovak University of Agriculture in Nitra, 2010 - (Vozárová, V.). s. 24-25 ISBN 978-80-552-0463-5. [International Conference on Food Physics ICFP 2010 /9./. 20.10.2010-21.10.2010, Nitra] R&D Projects: GA AV ČR(CZ) IAA201990701 Institutional research plan: CEZ:AV0Z20760514 Keywords : strain gauges * impactor * roasted beans Subject RIV: GM - Food Processing

  20. Marker-based linkage map of Andean common bean (Phaseolus vulgaris L. and mapping of QTLs underlying popping ability traits

    Directory of Open Access Journals (Sweden)

    Yuste-Lisbona Fernando J

    2012-08-01

    Full Text Available Abstract Background Nuña bean is a type of ancient common bean (Phaseolus vulgaris L. native to the Andean region of South America, whose seeds possess the unusual property of popping. The nutritional features of popped seeds make them a healthy low fat and high protein snack. However, flowering of nuña bean only takes place under short-day photoperiod conditions, which means a difficulty to extend production to areas where such conditions do not prevail. Therefore, breeding programs of adaptation traits will facilitate the diversification of the bean crops and the development of new varieties with enhanced healthy properties. Although the popping trait has been profusely studied in maize (popcorn, little is known about the biology and genetic basis of the popping ability in common bean. To obtain insights into the genetics of popping ability related traits of nuña bean, a comprehensive quantitative trait loci (QTL analysis was performed to detect single-locus and epistatic QTLs responsible for the phenotypic variance observed in these traits. Results A mapping population of 185 recombinant inbred lines (RILs derived from a cross between two Andean common bean genotypes was evaluated for three popping related traits, popping dimension index (PDI, expansion coefficient (EC, and percentage of unpopped seeds (PUS, in five different environmental conditions. The genetic map constructed included 193 loci across 12 linkage groups (LGs, covering a genetic distance of 822.1 cM, with an average of 4.3 cM per marker. Individual and multi-environment QTL analyses detected a total of nineteen single-locus QTLs, highlighting among them the co-localized QTLs for the three popping ability traits placed on LGs 3, 5, 6, and 7, which together explained 24.9, 14.5, and 25.3% of the phenotypic variance for PDI, EC, and PUS, respectively. Interestingly, epistatic interactions among QTLs have been detected, which could have a key role in the genetic control of

  1. Pb-210 in beans grown in normal background environments

    Energy Technology Data Exchange (ETDEWEB)

    Mingote, Raquel M.; Nogueira, Regina A., E-mail: mingote@cnen.gov.br, E-mail: rnogueira@cnen.gov.br [Centro Regional de Ciencias Nucleares do Centro-Oeste (CRCN-CO/CNEN-GO), Abadia de Goias, GO (Brazil)

    2013-07-01

    A survey was carried out on the activity concentration of {sup 210}Pb in common beans (Phaseolus vulgaris L.) grown in normal background environments in Brazil. The Carioca beans and the black type were analyzed, which contribute with 90% of the Brazilian market share of the common beans. To this study 18 bean samples sowing in the Middle-Western and Southern regions of Brazil during the years 2010-2011 were analyzed. The proportion per bean type was similar to the national production: most of the Carioca beans (n=13; 72%) and black beans (n=5; 28%). Other 17 values of {sup 210}Pb activity concentration in beans grown in Southeastern region available in the GEORAD, a dataset of radioactivity in Brazil, were added to the statistic analysis of the data. Considering the information contained in censored observations (60%), representative value of {sup 210}Pb activity concentration in beans was estimated by using robust ROS, a censored data analysis method. The value 0.047 Bq kg{sup -1} fresh wt. obtained here is according to {sup 210}Pb activity concentration in grains reported by UNSCEAR 0.05 Bq kg{sup -1}. (author)

  2. The Effective Design of Bean Bag as a Vibroimpact Damper

    Directory of Open Access Journals (Sweden)

    A.Q. Liu

    2000-01-01

    Full Text Available The technique of a bean bag damper has been effectively applied in many engineering fields to control the vibroimpact of a structural system. In this study, the basic parameters responsible for the design of an effective bean bag: the size of beans, the mass ratio of the bean bag to the structure to which it is attached, the clearance distance and the position of the bag, are studied by both theoretical and experimental analyses. These will provide a better understanding of the performance of the bean bag for optimisation of damper design. It was found that reducing the size of beans would increase the exchange of momentum in the system due to the increase in the effective contact areas. Within the range of mass ratios studied, the damping performance of the damper was found to improve with higher mass ratios. There was an optimum clearance for any specific damper whereby the maximum attenuation could be achieved. The position of the bag with respect to nodes and antipodes of the primary structure determined the magnitude of attenuation attainable. Furthermore, the limitations of bean bags have been identified and a general criteria for the design of a bean bag damper has been formulated based on the study undertaken. It was shown that an appropriately configured bean bag damper was capable of reducing the amplitude of vibration by 80% to 90%.

  3. Elemental characterization of Brazilian beans using neutron activation analysis

    International Nuclear Information System (INIS)

    Beans are important for many developing countries as a source of protein and mineral nutrients. Here, ten commercial types of Brazilian beans, from the species Phaseolus vulgaris (common beans) and Vigna unguiculata (cowpeas), were analyzed by neutron activation analysis for the determination of Br, Ca, Co, Cs, Fe, K, Mo, Na, Rb, Sc and Zn. There were statistical differences (p/0.05) amongst the commercial types, except for Br, Rb and Sc. In general, non-essential elements showed high variability, indicating that the origin of beans had a strong influence on the mass fraction of such elements. (author)

  4. Antinutritional factors in anasazi and other pinto beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Weder, J K; Telek, L; Vozári-Hampe, M; Saini, H S

    1997-01-01

    Antinutritional factors of anasazi bean were compared to traditional pinto bean (Phaseolus vulgaris L.). Anasazi beans contained less (p0.05) in stachyose and raffinose content were found between the two bean types; verbascose was not detected at all. Significant (plectin content were observed between anasazi and pinto bean. The lectins of anasazi beans were classified as non toxic and those of the pinto beans as toxic types. No differences (p>0.05) in inhibitor activity against human and bovine trypsin and chymotrypsin were found between the two bean types. PMID:9527344

  5. Export and Competitiveness of Indonesian Coffee Bean in International Market: Strategic Implication for the Development of Organic Coffee Bean

    OpenAIRE

    Bambang Drajat; Adang Agustian; Ade Supriatna

    2007-01-01

    The performance of Indonesian coffee bean export from 1995 to 2004was not satisfactory. This implied that there were problems of the competitiveness of Indonesian coffee bean export. This study was expected to come up withsome views related with the problem. This study was aimed to analyze the competitiveness of Indonesian coffee bean export in international markets. Somepolicy implication would be derived following the conclusions. In addition,this study was aimed to deliver some arguments r...

  6. Susceptibility of pea, horse bean and bean to viruses in dependence on the age of the inoculated plants

    OpenAIRE

    Władysław Błaszczak; Grażyna Ellmann-Wąsik; Renata Lesiak-Jerzyk

    2013-01-01

    Three cultivars of pea did not differ in their susceptibility to Cucumber Mosaic Virus (CMV) notwithstanding the age of the inoculated plants. But their susceptibility to infection with Bean Yellow Mosaic Virus (BYMV) differed. Horse bean cultivars 'Nadwiślański' and 'Major' proved to be less susceptible to Broad Bean True Mosaic Virus (BBTMV) when older plants were-inoculated. Two bean cultivars 'Złota Saxa' and 'Earle' appeared to be susceptible to BBTMV only in the phase of developing prim...

  7. Multielemental fingerprinting as a tool for authentication of organic wheat, barley, faba bean, and potato.

    Science.gov (United States)

    Laursen, Kristian H; Schjoerring, Jan K; Olesen, Jørgen E; Askegaard, Margrethe; Halekoh, Ulrich; Husted, Søren

    2011-05-11

    The multielemental composition of organic and conventional winter wheat, spring barley, faba bean, and potato was analyzed with inductively coupled plasma-optical emission spectrometry (ICP-OES) and -mass spectrometry (ICP-MS). The crops were cultivated in two years at three geographically different field locations, each accommodating one conventional and two organic cropping systems. The conventional system produced the highest harvest yields for all crops except the nitrogen-fixing faba bean, whereas the dry matter content of each crop was similar across systems. No systematic differences between organic and conventional crops were found in the content of essential plant nutrients when statistically analyzed individually. However, chemometric analysis of multielemental fingerprints comprising up to 14 elements allowed discrimination. The discrimination power was further enhanced by analysis of up to 25 elements derived from semiquantitative ICP-MS. It is concluded that multielemental fingerprinting with semiquantitative ICP-MS and chemometrics has the potential to enable authentication of organic crops. PMID:21417209

  8. Effects of Atmospheric-Pressure N2, He, Air, and O2 Microplasmas on Mung Bean Seed Germination and Seedling Growth

    Science.gov (United States)

    Zhou, Renwu; Zhou, Rusen; Zhang, Xianhui; Zhuang, Jinxing; Yang, Size; Bazaka, Kateryna; (Ken) Ostrikov, Kostya

    2016-01-01

    Atmospheric-pressure N2, He, air, and O2 microplasma arrays have been used to investigate the effects of plasma treatment on seed germination and seedling growth of mung bean in aqueous solution. Seed germination and growth of mung bean were found to strongly depend on the feed gases used to generate plasma and plasma treatment time. Compared to the treatment with atmospheric-pressure O2, N2 and He microplasma arrays, treatment with air microplasma arrays was shown to be more efficient in improving both the seed germination rate and seedling growth, the effect attributed to solution acidification and interactions with plasma-generated reactive oxygen and nitrogen species. Acidic environment caused by air discharge in water may promote leathering of seed chaps, thus enhancing the germination rate of mung bean, and stimulating the growth of hypocotyl and radicle. The interactions between plasma-generated reactive species, such as hydrogen peroxide (H2O2) and nitrogen compounds, and seeds led to a significant acceleration of seed germination and an increase in seedling length of mung bean. Electrolyte leakage rate of mung bean seeds soaked in solution activated using air microplasma was the lowest, while the catalase activity of thus-treated mung bean seeds was the highest compared to other types of microplasma. PMID:27584560

  9. Effects of Atmospheric-Pressure N2, He, Air, and O2 Microplasmas on Mung Bean Seed Germination and Seedling Growth.

    Science.gov (United States)

    Zhou, Renwu; Zhou, Rusen; Zhang, Xianhui; Zhuang, Jinxing; Yang, Size; Bazaka, Kateryna; Ken Ostrikov, Kostya

    2016-01-01

    Atmospheric-pressure N2, He, air, and O2 microplasma arrays have been used to investigate the effects of plasma treatment on seed germination and seedling growth of mung bean in aqueous solution. Seed germination and growth of mung bean were found to strongly depend on the feed gases used to generate plasma and plasma treatment time. Compared to the treatment with atmospheric-pressure O2, N2 and He microplasma arrays, treatment with air microplasma arrays was shown to be more efficient in improving both the seed germination rate and seedling growth, the effect attributed to solution acidification and interactions with plasma-generated reactive oxygen and nitrogen species. Acidic environment caused by air discharge in water may promote leathering of seed chaps, thus enhancing the germination rate of mung bean, and stimulating the growth of hypocotyl and radicle. The interactions between plasma-generated reactive species, such as hydrogen peroxide (H2O2) and nitrogen compounds, and seeds led to a significant acceleration of seed germination and an increase in seedling length of mung bean. Electrolyte leakage rate of mung bean seeds soaked in solution activated using air microplasma was the lowest, while the catalase activity of thus-treated mung bean seeds was the highest compared to other types of microplasma. PMID:27584560

  10. The effect of lactic acid bacteria on cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2015-07-16

    Cocoa beans (Theobroma cacao L.) are the raw material for chocolate production. Fermentation of cocoa pulp by microorganisms is crucial for developing chocolate flavor precursors. Yeasts conduct an alcoholic fermentation within the bean pulp that is essential for the production of good quality beans, giving typical chocolate characters. However, the roles of bacteria such as lactic acid bacteria and acetic acid bacteria in contributing to the quality of cocoa bean and chocolate are not fully understood. Using controlled laboratory fermentations, this study investigated the contribution of lactic acid bacteria to cocoa bean fermentation. Cocoa beans were fermented under conditions where the growth of lactic acid bacteria was restricted by the use of nisin and lysozyme. The resultant microbial ecology, chemistry and chocolate quality of beans from these fermentations were compared with those of indigenous (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii, Kluyveromyces marxianus and Saccharomyces cerevisiae, the lactic acid bacteria Lactobacillus plantarum, Lactobacillus pentosus and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in control fermentations. In fermentations with the presence of nisin and lysozyme, the same species of yeasts and acetic acid bacteria grew but the growth of lactic acid bacteria was prevented or restricted. These beans underwent characteristic alcoholic fermentation where the utilization of sugars and the production of ethanol, organic acids and volatile compounds in the bean pulp and nibs were similar for beans fermented in the presence of lactic acid bacteria. Lactic acid was produced during both fermentations but more so when lactic acid bacteria grew. Beans fermented in the presence or absence of lactic acid bacteria were fully fermented, had similar shell weights and gave acceptable chocolates with no differences

  11. IRON, ZINC, AND FERRITIN ACCUMULATION IN COMMON BEANS

    DEFF Research Database (Denmark)

    Urbanski, Dorian Fabian; Sørensen, Kirsten; Jurkiewicz, Anna Malgorzata;

    common beans. We used micro-PIXE (Particle Induced X-ray Emission) and proton backscattering analysis to localize and quantify zinc and iron in mature bean seeds. In addition the iron distribution in different P. vulgaris genotypes was studied using Perl's Prussian blue staining. We show  that the...

  12. Root rots of common and tepary beans in Puerto Rico

    Science.gov (United States)

    Root rots are a disease complex affecting common bean and can be severe in bean growing areas in the tropics and subtropics. The presence of several pathogens makes it difficult to breed for resistance because of the synergistic effect of the pathogens in the host and the interaction of soil factors...

  13. Evaluation of Genetic Diversity of Castor Bean for Biodiesel Utilization

    Science.gov (United States)

    Castor bean (Ricinus communis L., 2n=20) is a cross-pollinated diploid species belonging to the family Euphorbiaceae instead of the Leguminosae. It is a native of Africa but may have originated in India. Castor bean plants grow as annual or perennial, depending on geographical locations, climate a...

  14. The composition of wax and oil in green coffee beans

    NARCIS (Netherlands)

    Folstar, P.

    1976-01-01

    Methods for the isolation of wax and oil from green coffee beans were studied and a method for the quantitative extraction of coffee oil from the beans was introduced. Coffee wax, coffee oil and wax-free coffee oil as well as the unsaponifiable matter prepared from each were fractionated by column c

  15. Diversity for cooking time in Andean dry beans

    Science.gov (United States)

    Dry beans (Phaseolus vulgaris L) are a nutrient dense, low cost food and therefore are an excellent value for consumers (Drewnowski and Rehm, 2013). In spite of this value, long cooking times limit bean consumption. This is true in developing countries where cooking fuel is sometimes scarce and in d...

  16. Biology of the coconut bug, Pseudotheraptus wayi, on French beans.

    Science.gov (United States)

    Egonyu, James Peter; Ekesi, Sunday; Kabaru, Jacques; Irungu, Lucy

    2014-01-01

    The coconut bug, Pseudotheraptus wayi Brown (Heteroptera: Coreidae), is a major pest of a wide range of economically important crops in Eastern and Southern Africa. The suitability of French beans, Phaseolus vulgaris L. (Fabales: Fabaceae) as an alternative food for mass rearing of P. wayi was determined by elucidating its development, survival, and reproduction on French bean pods in the laboratory. Development and survival of immatures on French beans was comparable to what is reported with two hosts previously used for rearing this species, namely coconut and cashew. Adults survived thrice longer and laid almost twice more eggs on the French beans than was reported for the two hosts above. These findings suggest that French beans are more suitable for mass rearing of this species than coconut and cashew, which have been used previously but can be scarce and too costly. PMID:25373191

  17. Biology of the Coconut Bug, Pseudotheraptus wayi, on French Beans

    Science.gov (United States)

    Egonyu, James Peter; Ekesi, Sunday; Kabaru, Jacques; Irungu, Lucy

    2014-01-01

    The coconut bug, Pseudotheraptus wayi Brown (Heteroptera: Coreidae), is a major pest of a wide range of economically important crops in Eastern and Southern Africa. The suitability of French beans, Phaseolus vulgaris L. (Fabales: Fabaceae) as an alternative food for mass rearing of P. wayi was determined by elucidating its development, survival, and reproduction on French bean pods in the laboratory. Development and survival of immatures on French beans was comparable to what is reported with two hosts previously used for rearing this species, namely coconut and cashew. Adults survived thrice longer and laid almost twice more eggs on the French beans than was reported for the two hosts above. These findings suggest that French beans are more suitable for mass rearing of this species than coconut and cashew, which have been used previously but can be scarce and too costly. PMID:25373191

  18. Occurrence and distribution of viruses infecting the bean in Serbia

    Directory of Open Access Journals (Sweden)

    Petrović Dragana

    2010-01-01

    Full Text Available This work describes the incidence and distribution of the most important bean viruses in Serbia: Bean common mosaic virus (BCMV, Bean common mosaic necrosis virus (BCMNV, Bean yellow mosaic virus (BYMV, Cucumber mosaic virus (CMV and Alfalfa mosaic virus (AMV. The viral isolates were characterized serologically and biologically. BCMV was found in the largest number of plants (30.53%, followed by BCMNV (2.67%, CMV (5.34%, and AMV (3.41%, since BYMV was not determined. Mixed viral infections were found in several samples. The RT-PCR method was used to prove that the tested isolates belong to the BCMV, family Potyviridae and strains Russian and NL-3 D. Results obtained in this work will enable further studies of the genetic variability of bean virus isolates from Serbia. .

  19. Antioxidant Activity of Phenolic Compounds from Fava Bean Sprouts.

    Science.gov (United States)

    Okumura, Koharu; Hosoya, Takahiro; Kawarazaki, Kai; Izawa, Norihiko; Kumazawa, Shigenori

    2016-06-01

    Fava beans are eaten all over the world and recently, marketing for their sprouts began in Japan. Fava bean sprouts contain more polyphenols and l-3,4-dihydroxyphenylalanine (l-DOPA) than the bean itself. Our antioxidant screening program has shown that fava bean sprouts also possess a higher antioxidant activity than other commercially available sprouts and mature beans. However, the individual constituents of fava bean sprouts are not entirely known. In the present study, we investigated the phenolic compounds of fava bean sprouts and their antioxidant activity. Air-dried fava bean sprouts were treated with 80% methanol and the extract was partitioned in water with chloroform and ethyl acetate. HPLC analysis had shown that the ethyl acetate-soluble parts contained phenolic compounds, separated by preparative HPLC to yield 5 compounds (1-5). Structural analysis using NMR and MS revealed that the compounds isolated were kaempferol glycosides. All isolated compounds had an α-rhamnose at the C-7 position with different sugars attached at the C-3 position. Compounds 1-5 had β-galactose, β-glucose, α-rhamnose, 6-acetyl-β-galactose and 6-acetyl-β-glucose, respectively, at the C-3 position. The amount of l-DOPA in fava bean sprouts was determined by the quantitative (1) H NMR technique. The l-DOPA content was 550.45 mg ± 11.34 /100 g of the raw sprouts. The antioxidant activities of compounds 2-5 and l-DOPA were evaluated using the 2,2-diphenyl-1-picrylhydrazyl scavenging assay. l-DOPA showed high antioxidant activity, but the isolated kaempferol glycosides showed weak activity. Therefore, it can be suggested that l-DOPA contributed to the antioxidant activity of fava bean sprouts. PMID:27155370

  20. Immunochromatographic purification of Bean Yellow Mosaic Virus.

    Science.gov (United States)

    Bujarski, J J; Wiatroszak, I

    1981-01-01

    The method of immunoadsorptional purification of Bean Yellow Mosaic Virus has been worked out. Immunosorbents were obtained by coupling the antibody (IgG) fraction isolated from anti-BYMV and anti-pea leaf protein antisera with CNBr-activated 1% agarose beads. Conditions for preparation of immunosorbents, for BYMV adsorption and elution as well as the method of plant protein separation from BYMV were pointed out. The purity of BYMV was checked by double immunodiffusion as well as by SDS-acrylamide gel electrophoresis. Also biological activity was determined. TMV was used as the model virus for further BYMV studies. PMID:7025790

  1. Effects of bioprocessed antinutritional factors on bean protein quality, with special emphasis on Phaseolus vulgaris L.

    NARCIS (Netherlands)

    Savelkoul, F.H.M.G.

    1994-01-01

    Legumes, e.g. beans and peas, can contain antinutritional factors. Some varieties of faba beans (Vicia faba), soya beans (Glycine max ) and white kidney beans (Phaseolus vulgaris) can contain in their raw state antinutritional factors such as tannins, trypsin inhibitors and lectins respectively whic

  2. Proteomic analysis of common bean (Phaseolus vulgaris) by two-dimensional gel electrophoresis and mass spectrometry

    Science.gov (United States)

    The modern cultivated common bean (Phaseolus vulgaris) has evolved from wild common beans distributed in Central America, Mexico and the Andean region of South America. It has been reported that wild common bean accessions have higher levels of protein content than the domesticated dry bean cultiva...

  3. The Optical Absorption Coefficient of Bean Seeds Investigated Using Photoacoustic Spectroscopy

    Science.gov (United States)

    Sanchez-Hernandez, G.; Hernandez-Aguilar, C.; Dominguez-Pacheco, A.; Cruz-Orea, A.; Perez-Reyes, M. C. J.; Martinez, E. Moreno

    2015-06-01

    A knowledge about seed optical parameters is of great relevance in seed technology practice. Such parameters provide information about its absorption and reflectance, which could be useful for biostimulation processes, by light sources, in early stages of seed germination. In the present research photoacoustic spectroscopy (PAS) and the Rosencwaig and Gersho model were used to determine the optical absorption coefficient () of five varieties of bean seeds ( Phaseolus vulgaris L.), of different productive cycles; the seeds were biostimulated by laser treatment to evaluate the effects of biostimulation pre-sowing. It was found that the bean varieties V1, V2, V4, and V5 were optically opaque in the visible spectrum; in the case of the V3 variety, this sample was optically transparent from 680 nm. The varieties of the studied bean seeds showed significant statistical differences in sizes and also in their optical absorption spectra. The biostimulation effects showed that the seed samples with a higher optical penetration length had a positive biostimulation, in the percentage of germination, obtaining an enhancement of 47 % compared to the control sample. The utility of PAS for the optical characterization of seeds has been demonstrated in this study of the laser biostimulation process of this kind of samples.

  4. Reduction in flatulence factors in mung beans (Vigna radiata) using low-dose gamma-irradiation

    International Nuclear Information System (INIS)

    Mungbeans (Vigna radiata), control and gamma-irradiated at insect disinfestation dose levels (0.25 and 0.75 kGy) were germinated (0-6 Bays) and the qualitative and quantitative changes in soluble carbohydrates were studied in detail. The key flatulence-producing raffinose family oligosaccharides inmungbeans were degraded in the irradiated samples at the onset of the germination (0-2 days) compared to the control where it occurred much later (>4days). However, the reducing sugars, mainly glucose, fructose and galactose, which are metabolised easily, were enhanced in the irradiated samples. At low dose (0.25 kGy), irradiation had no effect on germination and sprout length, indicating that irradiated beans are suitable for use as sprouted beans. These observations clearly indicate that gamma-irradiation at insect disinfestation dose levels improved the digestibility and nutritional quality of mung beans by reducing the content of oligosaccharides responsible for intestinal gas production. (C) 1999 Society of Chemical Industry

  5. Variability of Colletotrichum spp in common bean.

    Science.gov (United States)

    Mota, S F; Barcelos, Q L; Dias, M A; Souza, E A

    2016-01-01

    The Colletotrichum genus presents large genetic variability, as demonstrated by the occurrence of several pathogenic races and phenotypic traits. The objective of this study was to characterize 22 strains of C. lindemuthianum and Colletotrichum spp recovered from anthracnose lesions and bean scab, and to verify the relationship between species of the Colletotrichum genus, which inhabit anthracnose and scab lesions. Colony morphology, conidium size, the presence of septa, germination, sporulation, and mycelium growth rates, were analyzed in addition to the presence of mating-type genes, IRAP markers, and pathogenicity. Strains of Colletotrichum spp presented wide variation for all evaluated traits, indicating the presence of different species. Pathogenicity tests verified that the severity of the disease caused by strains of Colletotrichum spp must be evaluated 17 days after inoculation. Molecular analysis showed that only the C. lindemuthianum strains were grouped by the IRAP markers. For the physiological traits, we observed that C. lindemuthianum mycelium growth is slower than that of Colletotrichum spp strains. The information generated in this study confirms variability in the evaluated species of Colletotrichum and may direct future basic and applied studies aiming to control these diseases in common bean. PMID:27173211

  6. Extracellular enzymes of Legionella pneumophila.

    OpenAIRE

    Thorpe, T C; Miller, R. D.

    1981-01-01

    All strains of Legionella pneumophila tested produced detectable levels of extracellular protease, phosphatase, lipase, deoxyribonuclease, ribonuclease, and beta-lactamase activity. Weak starch hydrolysis was also demonstrated for all strains. Elastase, collagenase, phospholipase C, hyaluronidase, chondroitinase, neuraminidase, or coagulase were not detected in any of these laboratory-maintained strains.

  7. Enhancing the Processing Characteristics of Edible Beans Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Advanced life-support systems, which use chemical, physical, and biological processes, are being developed to support future long-term human planetary exploration....

  8. Low-Income US Women Under-informed of the Specific Health Benefits of Consuming Beans

    OpenAIRE

    Winham, Donna M; Armstrong Florian, Traci L.; Thompson, Sharon V.

    2016-01-01

    Background Bean consumption can reduce chronic disease risk and improve nutrition status. Consumer knowledge of bean health benefits could lead to increased intakes. Low-income women have poorer health and nutrition, but their level of knowledge about bean health benefits is unknown. Beans are a familiar food of reasonable cost in most settings and are cultural staples for Hispanics and other ethnicities. Study objectives were to assess awareness of bean health benefits among low-income women...

  9. Effect of gamma-radiation on major aroma compounds and vanillin glucoside of cured vanilla beans (Vanilla planifolia)

    International Nuclear Information System (INIS)

    Radiation processing of food materials by gamma-radiation is a well established method for microbial decontamination and insect disinfestation. Irradiation of spices at doses ranging from 10 to 30 kGy has been reported to result in complete elimination of microorganisms with negligible changes in the flavour quality. The effect of gamma-radiation on microflora and vanillin content of cured vanilla beans in the dose range of 5-50 kGy has been investigated, but its effect on other major aroma compounds and vanillin glucoside (vanillin aroma precursor) remaining after curing have not been studied so far. Vanillin (4-hydroxy-3-methoxybenzaldehyde) is one such compound used as a flavouring agent and as a dietary component. It is the major component of natural vanilla, which is one of the most widely used and important flavouring materials throughout the world. Vanillin is an antioxidant capable of protecting membrane against lipid peroxidation and DNA against strand breaks induced by reactive oxygen species. The present work was aimed to study the effect of gamma-radiation processing on the major aroma compounds of cured vanilla beans and also to investigate possible enhancement in vanillin content by the radiolytic breakdown of vanillin glucoside present already. Cured vanilla beans were irradiated (5, 10, 15, 20 and 30 kGy) and the vanillin content of control and irradiated samples were analysed, respectively for a possible enhancement of vanillin content by radiolysis of vanillin glucoside. Radiolytic breakdown of glycosidic precursors of aroma constituents and consequent release of free aroma was shown to result in the enhancement of aroma quality of these products. Since a considerable amount of vanillin exists as its glycosidic precursor in cured vanilla pods, a possible enhancement in yield of vanillin by radiation processing is thus expected. Hence the highly stable oxygen-carbon linkage between vanillin and glucose limits the possible enhancement of aroma

  10. Diversification and population structure in common beans (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Matthew W Blair

    Full Text Available Wild accessions of crops and landraces are valuable genetic resources for plant breeding and for conserving alleles and gene combinations in planta. The primary genepool of cultivated common beans includes wild accessions of Phaseolus vulgaris. These are of the same species as the domesticates and therefore are easily crossable with cultivated accessions. Molecular marker assessment of wild beans and landraces is important for the proper utilization and conservation of these important genetic resources. The goal of this research was to evaluate a collection of wild beans with fluorescent microsatellite or simple sequence repeat markers and to determine the population structure in combination with cultivated beans of all known races. Marker diversity in terms of average number of alleles per marker was high (13 for the combination of 36 markers and 104 wild genotypes that was similar to the average of 14 alleles per marker found for the 606 cultivated genotypes. Diversity in wild beans appears to be somewhat higher than in cultivated beans on a per genotype basis. Five populations or genepools were identified in structure analysis of the wild beans corresponding to segments of the geographical range, including Mesoamerican (Mexican, Guatemalan, Colombian, Ecuadorian-northern Peruvian and Andean (Argentina, Bolivia and Southern Peru. The combined analysis of wild and cultivated accessions showed that the first and last of these genepools were related to the cultivated genepools of the same names and the penultimate was found to be distinct but not ancestral to the others. The Guatemalan genepool was very novel and perhaps related to cultivars of race Guatemala, while the Colombian population was also distinct. Results suggest geographic isolation, founder effects or natural selection could have created the different semi-discrete populations of wild beans and that multiple domestications and introgression were involved in creating the diversity of

  11. Removal of antinutritional factors from bean (Phaseolus vulgaris L. seeds

    Directory of Open Access Journals (Sweden)

    Bollini R.

    1999-01-01

    Full Text Available Phytohemagglutinin and the lectin-related proteins present in bean seeds are toxic to monogastric animals and lower the nutritional value of beans. Since these antimetabolites are present in substantial amounts, a breeding program aimed to the removal ofphytohemagglutinin was developed. The character ""absence of phytohemagglutinin"" was transferred into a bean cultivar by backcrossing. The lines obtained maintained the agronomic performance of the recurrent parent. Preliminary results show that removal of phytohemagglutinin results in a higher true protein digestibility. Further modification in the composition of the lectin-related protein family is now under way.

  12. The Paleobiolinguistics of the Common Bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Cecil H. Brown

    2014-10-01

    Full Text Available Paleobiolinguistics is used to determine when and where the common bean (Phaseolus vulgaris L. developed significance for prehistoric groups of Native America. Dates and locations of proto-languages for which common bean terms reconstruct generally accord with crop-origin and dispersal information from plant genetics and archaeobotany. Paleobiolinguistic and other lines of evidence indicate that human interest in the common bean became significant primarily with the widespread development of a village‐farming way of life in the New World rather than earlier when squash and maize and a few other crops became important.

  13. Advances in Faba Bean Genetics and Genomics.

    Science.gov (United States)

    O'Sullivan, Donal M; Angra, Deepti

    2016-01-01

    Vicia faba L, is a globally important grain legume whose main centers of diversity are the Fertile Crescent and Mediterranean basin. Because of its small number (six) of exceptionally large and easily observed chromosomes it became a model species for plant cytogenetics the 70s and 80s. It is somewhat ironic therefore, that the emergence of more genomically tractable model plant species such as Arabidopsis and Medicago coincided with a marked decline in genome research on the formerly favored plant cytogenetic model. Thus, as ever higher density molecular marker coverage and dense genetic and even complete genome sequence maps of key crop and model species emerged through the 1990s and early 2000s, genetic and genome knowledge of Vicia faba lagged far behind other grain legumes such as soybean, common bean and pea. However, cheap sequencing technologies have stimulated the production of deep transcriptome coverage from several tissue types and numerous distinct cultivars in recent years. This has permitted the reconstruction of the faba bean meta-transcriptome and has fueled development of extensive sets of Simple Sequence Repeat and Single Nucleotide Polymorphism (SNP) markers. Genetics of faba bean stretches back to the 1930s, but it was not until 1993 that DNA markers were used to construct genetic maps. A series of Random Amplified Polymorphic DNA-based genetic studies mainly targeted at quantitative loci underlying resistance to a series of biotic and abiotic stresses were conducted during the 1990's and early 2000s. More recently, SNP-based genetic maps have permitted chromosome intervals of interest to be aligned to collinear segments of sequenced legume genomes such as the model legume Medicago truncatula, which in turn opens up the possibility for hypotheses on gene content, order and function to be translated from model to crop. Some examples of where knowledge of gene content and function have already been productively exploited are discussed. The

  14. Extracellular enzyme kinetics scale with resource availability

    Science.gov (United States)

    Microbial community metabolism relies on external digestion, mediated by extracellular enzymes that break down complex organic matter into molecules small enough for cells to assimilate. We analyzed the kinetics of 40 extracellular enzymes that mediate the degradation and assimi...

  15. Extracellular nicotinamide phosphoribosyltransferase, a new cancer metabokine.

    Science.gov (United States)

    Grolla, Ambra A; Travelli, Cristina; Genazzani, Armando A; Sethi, Jaswinder K

    2016-07-01

    In this review, we focus on the secreted form of nicotinamide phosphoribosyltransferase (NAMPT); extracellular NAMPT (eNAMPT), also known as pre-B cell colony-enhancing factor or visfatin. Although intracellular NAMPT is a key enzyme in controlling NAD metabolism, eNAMPT has been reported to function as a cytokine, with many roles in physiology and pathology. Circulating eNAMPT has been associated with several metabolic and inflammatory disorders, including cancer. Because cytokines produced in the tumour micro-environment play an important role in cancer pathogenesis, in part by reprogramming cellular metabolism, future improvements in cancer immunotherapy will require a better understanding of the crosstalk between cytokine action and tumour biology. In this review, the knowledge of eNAMPT in cancer will be discussed, focusing on its immunometabolic function as a metabokine, its secretion, its mechanism of action and possible roles in the cancer micro-environment. PMID:27128025

  16. Extracellular Matrix Molecules Facilitating Vascular Biointegration

    Directory of Open Access Journals (Sweden)

    Martin K.C. Ng

    2012-08-01

    Full Text Available All vascular implants, including stents, heart valves and graft materials exhibit suboptimal biocompatibility that significantly reduces their clinical efficacy. A range of biomolecules in the subendothelial space have been shown to play critical roles in local regulation of thrombosis, endothelial growth and smooth muscle cell proliferation, making these attractive candidates for modulation of vascular device biointegration. However, classically used biomaterial coatings, such as fibronectin and laminin, modulate only one of these components; enhancing endothelial cell attachment, but also activating platelets and triggering thrombosis. This review examines a subset of extracellular matrix molecules that have demonstrated multi-faceted vascular compatibility and accordingly are promising candidates to improve the biointegration of vascular biomaterials.

  17. Heat-Induced Structural Changes in Faba Bean Starch Paste: The Effect of Steaming Faba Bean Seeds

    OpenAIRE

    Kaczynska, B.; Autio, K.; J. Fornal

    1993-01-01

    Heat-induced structural changes of faba bean starch dispersions were examined at a concentration range of 8-10% as a function of heat treatment. Faba bean starch was isolated from raw (RF-starch) and steamed (SF-starch) faba bean seeds. Hydrothermal treatment resulted in an increase in the amount of non-starch components in the isolated starch. Microstructure of low-sheared 8% starch suspensions heated at 75, 90 and 98°C (for 10 minutes) was studied by light microscopy. Heating induced huge s...

  18. Effect of Culture Filtrate of Fungi in the Control of Meloidogyne javacnica, Root Knot Nematodes on Okra and Broad Bean

    Directory of Open Access Journals (Sweden)

    Amer-Zareen

    1999-01-01

    Full Text Available Fungal cell free filtrates were used in two different doses, enhanced plant growth and root knot nematodes infection was reduced where high doses of filtrate (100% concentration were applied, in all test fungal filtrates. Culture filtrates of Paecilomyces lilacinus and Verticillium chlamydosporium at 100 percent concentration showed significant reduction in Meloidogyne javanica root knot infection on okra and broad bean as compared to Trichoderma harzianum, T. koningii, T. viride, Aspergillus restrictus and Aspergillus sp., which found less effective.

  19. Dietary Adherence and Satisfaction with a Bean-Based High-Fiber Weight Loss Diet: A Pilot Study

    OpenAIRE

    Patrick M. O'Neil; Susan Pechon; Malcolm, Robert J.; Strickland, William D.; Nance, Laura M.; Turner, Tonya F.

    2013-01-01

    Objective. Dietary fiber can reduce hunger and enhance satiety, but fiber intake during hypocaloric weight loss diets typically falls short of recommended levels. We examined the nutritional effects and acceptability of two high-fiber hypocaloric diets differing in sources of fiber: (a) beans or (b) fruits, vegetables, and whole grains. Methods. Subjects were 2 men, 18 women, mean age = 46.9, and mean BMI = 30.6. Subjects completed 3-day food diaries in each of the two baseline weeks. Subject...

  20. Extracellular metalloproteinases in Phytomonas serpens.

    Science.gov (United States)

    Vermelho, Alane B; Almeida, Flávia V S; Bronzato, Leandro S; Branquinha, Marta H

    2003-03-01

    The detection of extracellular proteinases in Phytomonas serpens, a trypanosomatid isolated from tomato fruits, is demonstrated in this paper. Maximal production occurred at the end of the logarithmic phase of growth. These enzymes exhibited selective substrate utilization in SDS-PAGE, being more active with gelatin; hemoglobin and bovine serum albumin were not degraded. Three proteinases were detected in SDS-PAGE-gelatin, with apparent molecular masses between 94 and 70 kDa. The proteolytic activity was completely blocked by 1,10-phenanthroline and strongly inhibited by EDTA, whereas a partial inhibition was observed with trans-epoxysuccinyl-L-leucylamido-(4-guanidino) butane (E-64) and soybean trypsin inhibitor; phenylmethylsulfonyl fluoride weakly inhibited the enzymes. This inhibition profile indicated that these extracellular proteinases belong to the metalloproteinase class. PMID:12795409

  1. Extracellular matrix in ovarian follicles.

    Science.gov (United States)

    Rodgers, R J; Irving-Rodgers, H F; van Wezel, I L

    2000-05-25

    A lot is known about the control of the development of ovarian follicles by growth factors and hormones, but less is known about the roles of extracellular matrix in the control of follicular growth and development. In this review we focus on the specialized extracellular matrix of the basal laminas that are present in ovarian follicles. These include the follicular basal lamina itself, the Call-Exner bodies of the membrana granulosa, the subendothelial and arteriole smooth muscle basal laminas in the theca, and the basal lamina-like material of the thecal matrix. We discuss the evidence that during follicle development the follicular basal lamina changes in composition, that many of its components are produced by the granulosa cells, and that the follicular basal laminas of different follicles have different ultrastructural appearances, linked to the shape of the aligning granulosa cells. All these studies suggest that the follicular basal lamina is extremely dynamic during follicular development. PMID:10963877

  2. Carotenemia associated with green bean ingestion.

    Science.gov (United States)

    Sale, Tanya A; Stratman, Erik

    2004-01-01

    Carotenemia is a condition characterized by yellow discoloration of the skin and elevated blood carotene levels. Excessive and prolonged ingestion of carotene-rich, yellow- or orange-colored foods such as carrots and winter squash is the most common cause, but more rarely it may be associated with consumption of other foods as well as with hypothyroidism, diabetes mellitus, anorexia nervosa, liver disease, or kidney disease. Though not uncommon in children, there are few reports in the pediatric literature since its early descriptions in the late 1800s and early 1900s. Awareness of carotenemia can help the provider resolve confusion with jaundice and avoid unnecessary worry and costly tests. Herein we describe carotenemia in an 8-month-old Caucasian girl secondary to increased consumption of commercial infant food green beans. PMID:15575851

  3. Emulsification properties of soy bean protein

    Directory of Open Access Journals (Sweden)

    WENPU CHEN

    2014-12-01

    Full Text Available Chen W, Li X, Rahman MRT, Al-Hajj NQM, Dey KC, Raqib SM. 2014. Emulsification properties of soy bean protein. Nusantara Bioscience 6: 196-202. Emulsion stability and emulsifying ability are two important factors in food industry. Soy protein has the great of interest because of its amphilic structure. β-Conglycinnin and glycinin are main components in soy protein which can be used as emulsifiers in food processing. However, due to its size and molecular weight, the emulsifying ability of soy protein is limited. By chemical, physical and enzymatic modification, the emulsifying ability of soy protein can be improved. The addition of polysaccharides in emulsion is common. The interaction of polysaccharides and proteins are being discussed in this review. In some complex food emulsion, the function of soy protein molecules and emulsifier at the interface need to be investigated in the future study.

  4. Induced mutants in beans and peas resistant to rust

    International Nuclear Information System (INIS)

    Beans (Phaseolus vulgaris) and peas (Pisum sativum) are important leguminous vegetable crops in Egypt. The area planted with beans is about 40,000 acres and peas 22,000 acres. These crops suffer from several diseases, particularly rusts, (Uromyces phaseoli/Uromyces pisi), which are mainly spread in northern Egypt. In our mutation induction programme we used 60 Co gamma rays and ethyl methane sulphonate (EMS). Bean and pea seeds were soaked in water for two hours before exposure to 8, 10 and 12 krad. For chemical treatments, bean and pea seeds were soaked in water for eight hours and then treated with 0.5 and 1.5% EMS for four hours. The M1 was cultivated in 1978

  5. Simulated radiation disinfestation of infested cocoa beans in Ghana

    International Nuclear Information System (INIS)

    Four major insect pests persistently affect the cocoa industry in Ghana, the world's leading exporter of cocoa, despite the conventional methods of chemical control in practice. The Ghana Atomic Energy Commission currently is investigating the possible use of radiation for the control of both insect attack and microbial spoilage of cocoa beans in storage. Radiation response studies of the four major insect pests that significantly affect the quality of dried cocoa beans in storage have been evaluated. Results herein reported were based on simulated bulk infestation radiation disinfestation of dried cocoa under field and laboratory conditions at ambient temperature (25 to 320C). The comparative efficiency of locally available packaging materials best suited for bagging of the dried cocoa beans at and after irradiation have been assessed concurrently. The author concludes by identifying and discussing possible factors that could affect the technology of radiation disinfestation of cocoa beans under the Ghanaian context. (author)

  6. The onset of faba bean farming in the Southern Levant

    Science.gov (United States)

    Caracuta, Valentina; Barzilai, Omry; Khalaily, Hamudi; Milevski, Ianir; Paz, Yitzhak; Vardi, Jacob; Regev, Lior; Boaretto, Elisabetta

    2015-10-01

    Even though the faba bean (Vicia faba L.) is among the most ubiquitously cultivated crops, very little is known about its origins. Here, we report discoveries of charred faba beans from three adjacent Neolithic sites in the lower Galilee region, in the southern Levant, that offer new insights into the early history of this species. Biometric measurements, radiocarbon dating and stable carbon isotope analyses of the archaeological remains, supported by experiments on modern material, date the earliest farming of this crop to ~10,200 cal BP. The large quantity of faba beans found in these adjacent sites indicates intensive production of faba beans in the region that can only have been achieved by planting non-dormant seeds. Selection of mutant-non-dormant stock suggests that the domestication of the crop occurred as early as the 11th millennium cal BP. Plant domestication| Vicia faba L.| Pre-Pottery Neolithic B| radiocarbon dating| Δ13C analysis.

  7. Intermittent drying of beans in a spouted bed

    Directory of Open Access Journals (Sweden)

    C. A. Oliveira

    2007-12-01

    Full Text Available Carioca beans are a highly nutritious grain, in terms of the amount of protein, iron and potassium as well as carbohydrates and fiber and as a source of vitamins. The moisture content of recently picked beans is too high for good preservation and storage, resulting in the need for drying before packaging. In this work, the drying of Carioca beans in a laboratory scale spouted bed under intermittent conditions of the drying air was experimentally analyzed. Experiments carried out consisted of two types of intermittent regime: intermittence in the spout regime, referred to as spouted/fixed bed and intermittence of the air supply to the bed, called spouted bed/rest. The results were compared to those for bean drying in a spouted bed dryer without intermittence.

  8. Effectiveness of rapid neutrons on small hoarse bean seed

    International Nuclear Information System (INIS)

    The small hoarse bean seeds were irradiated. The radiation doses 100-300 rads were used. The obtained mutants were applied in the breeding. The use of fast neutrons was successful and shortened the breeding cycle. (A.S.)

  9. Insects diversity in lima bean (Phaseolus lunatus

    Directory of Open Access Journals (Sweden)

    WIWIN SETIAWATI

    2005-10-01

    Full Text Available Lima bean (Phaseolus lunatus is a vegetable which usually made as a home yard plant for Indonesian people to fulfill their daily needs. This plant has not been produced in the large number by the farmer. So it is hard to find in the market. Lima bean is light by many kind of insect. Inventory, identification and the study of insect taxon to this plant is being done to collect some information about the insect who life in the plant. The research was done in Balitsa experiment garden in the district of Lembang in Bandung regency on November 2003-February 2004, the experiment start at 4 weeks age, at the height of 1260 m over the sea level. The observation was made systematically by absolute method (D-vac macine and relative method (sweeping net. The research so that there were 26 species of phytofagous insect, 9 species of predator insect, 6 species of parasitoid insect, 4 species of pollinator and 14 species of scavenger insect. According to the research the highest species number was got in the 8th week (3rd sampling, which had 27 variety of species, so the highest diversity was also got in this with 2,113 point. Aphididae and Cicadellidae was the most insect found in roay plant. The research also had high number of species insect so the diversity of insect and evenness become high. A community will have the high stability if it is a long with the high diversity. High evenness in community that has low species dominance and high species number of insect so the high of species richness.

  10. Magnet systems for ''Bean-Shaped'' tokamak

    International Nuclear Information System (INIS)

    Bean-shaping of tokamak plasmas offers a method of reaching stable operation at (beta) > 10%. In order to establish the indentation of the ''bean'', a set of high- current ''pushing coils'' (> 5 MA in a reactor) must be located at the midplane as close as possible to the inboard edge of the plasma. If located in the bore of the TF coils, then maintenance of the pushing coils may be impossible, and the interlocking coils may prevent reactor modularity. If located outside, the required pushing-coil current may be unacceptably large. This dilemma is overcome with a unique TF coil design in which the inboard leg is bent outward in the form of an arc. The pushing coils are housed in the midplane indentation of this arc, just outside the TF coils but adequately close to the plasma. The arched coil transfers forces to the top and bottom legs, where it can be reacted by a clamp structure if necessary. This technique would allow demountable joints to be placed near the inoard leg (for copper TF coils). Another design approach to the pushing coils is to use liquid Li or Na as the conductor and coolant. The liquid metal ''coils'' can be placed immediately adjacent to the plasma, giving optimal control of the plasma shape with minimal coil current, although modularity of the reactor may have to be surrendered. Conceptual designs are presented of PF and TF coil systems for an ignition test reactor with about 14% and for a full-scale demonstration reactor with about 20%, both using copper TF coils

  11. Effects of extrusion cooking on the chemical composition and functional properties of dry common bean powders.

    Science.gov (United States)

    Ai, Yongfeng; Cichy, Karen A; Harte, Janice B; Kelly, James D; Ng, Perry K W

    2016-11-15

    The impact of extrusion cooking on the chemical composition and functional properties of bean powders from four common bean varieties was investigated. The raw bean powders were extruded under eight different conditions, and the extrudates were then dried and ground (particle size⩽0.5mm). Compared with corresponding non-extruded (raw) bean powders (particle size⩽0.5mm), the extrusion treatments did not substantially change the protein and starch contents of the bean powders and showed inconsistent effects on the sucrose, raffinose and stachyose contents. The extrusion cooking did cause complete starch gelatinization and protein denaturation of the bean powders and thus changed their pasting properties and solvent-retention capacities. The starch digestibilities of the cooked non-extruded and cooked extruded bean powders were comparable. The extruded bean powders displayed functional properties similar to those of two commercial bean powders. PMID:27283664

  12. Quinclorac-habituation of bean (Phaseolus vulgaris) cultured cells is related to an increase in their antioxidant capacity.

    Science.gov (United States)

    Largo-Gosens, Asier; de Castro, María; Alonso-Simón, Ana; García-Angulo, Penélope; Acebes, José L; Encina, Antonio; Álvarez, Jesús M

    2016-10-01

    The habituation of bean cells to quinclorac did not rely on cell wall modifications, contrary to what it was previously observed for the well-known cellulose biosynthesis inhibitors dichlobenil or isoxaben. The aim of the present study was to investigate whether or not the bean cells habituation to quinclorac is related to an enhancement of antioxidant activities involved in the scavenging capacity of reactive oxygen species. Treating non-habituated bean calluses with 10 μM quinclorac reduced the relative growth rate and induced a two-fold increase in lipid peroxidation. However, the exposition of quinclorac-habituated cells to a concentration of quinclorac up to 30 μM neither affected their growth rate nor increased their lipid peroxidation levels. Quinclorac-habituated calluses had significantly higher constitutive levels of three antioxidant activities (class-III peroxidase, glutathione reductase, and superoxide dismutase) than those observed in non-habituated calluses, and the treatment of habituated calluses with 30 μM quinclorac significantly increased the level of class III-peroxidase and superoxide dismutase. The results reported here indicate that the process of habituation to quinclorac in bean callus-cultured cells is related, at least partially, to the development of a stable antioxidant capacity that enables them to cope with the oxidative stress caused by quinclorac. Class-III peroxidase and superoxide dismutase activities could play a major role in the quinclorac-habituation. Changes in the antioxidant status of bean cells were stable, since the increase in the antioxidant activities were maintained in quinclorac-dehabituated cells. PMID:27318799

  13. Weed Control in White Bean with Various Halosulfuron Tankmixes

    OpenAIRE

    Nader Soltani; Robert E. Nurse; Christy Shropshire; Peter H. Sikkema

    2014-01-01

    Four field trials were conducted over a three-year period (2011–2013) in southwestern Ontario to evaluate the level of weed control provided by various halosulfuron tankmixes applied preplant incorporated (PPI) in white bean. Trifluralin, s-metolachlor, halosulfuron, and imazethapyr applied alone or in combination caused 4% or less visible injury 1 and 4 weeks after emergence (WAE) in white bean. Trifluralin, s-metolachlor, halosulfuron, and imazethapyr applied PPI provided 80–96%, 84–95%, 83...

  14. Zinc supplementation, production and quality of coffee beans

    OpenAIRE

    Herminia Emilia Prieto Martinez; Yonara Poltronieri; Adriana Farah; Daniel Perrone

    2013-01-01

    Besides its importance in the coffee tree nutrition, there is almost no information relating zinc nutrition and bean quality. This work evaluated the effect of zinc on the coffee yield and bean quality. The experiment was conducted with Coffea arabica L. in "Zona da Mata" region, Minas Gerais, Brazil. Twelve plots were established at random with 4 competitive plants each. Treatments included plants supplemented with zinc (eight plots) and control without zinc supplementation (four plots). Pla...

  15. Antioxidant activity of black bean (Phaseolus vulgaris L.) protein hydrolysates

    OpenAIRE

    Jarine Amaral do EVANGELHO; Jose de J. BERRIOS; Vânia Zanella PINTO; Mariana Dias ANTUNES; Nathan Levien VANIER; Elessandra da Rosa ZAVAREZE

    2016-01-01

    Abstract The objective of this work was to study the effect of enzymatic hydrolysis of black bean protein concentrate using different enzymes. Bean proteins were extracted and hydrolyzed over a period of 120 min using the enzymes pepsin or alcalase. The protein hydrolysates’ molecular weight was assayed by electrophoresis and the antioxidant activity was evaluated by the capturing methods of free radicals ABTS●+ and DPPH. Electrophoretic results showed that the bands above 50 kDa disappeared,...

  16. Watershed responses to Amazon soya bean cropland expansion and intensification

    OpenAIRE

    Neill, Christopher; Coe, Michael T.; Riskin, Shelby H.; Krusche, Alex V.; Elsenbeer, Helmut; Macedo, Marcia N.; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A.; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A.

    2013-01-01

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compar...

  17. The polyphenolic profiles of common bean (Phaseolus vulgaris L.)

    OpenAIRE

    Lin, Long-Ze; HARNLY, JAMES M.; Pastor-Corrales, Marcial S.; Luthria, Devanand L.

    2008-01-01

    Based on the phenolic profiles obtained by high performance liquid chromatography-electrospray ionization mass spectrometry (HPLC-DAD-ESI/MS), 24 common bean samples, representing 17 varieties and 7 generic off-the-shelf items, belonging to ten US commercial market classes can be organized into six different groups. All of them contained the same hydroxycinnaminic acids, but the flavonoid components showed distinct differences. Black beans contained primarily the 3-O-glucosides of delphinidin...

  18. Toxicity of ricin present in castor bean seeds

    OpenAIRE

    Nayanna Brunna da Silva Fonseca; Benito Soto-Blanco

    2014-01-01

    The castor bean (Ricinus communis) is a bush from Euphorbiacea family cultivated for obtaining oil from the seeds. This oil has broad industrial employment, particularly for biodiesel. However, castor bean seeds exhibit a potent toxin, ricin. It is a glycoprotein with highly toxic action of inactivating ribosomes. The toxic action of ricin is due to inhibition of protein synthesis in eukaryotic cells, causing cell death. Only one molecule of ricin that enters the cytosol is able to inactivate...

  19. Watershed responses to Amazon soya bean cropland expansion and intensification.

    Science.gov (United States)

    Neill, Christopher; Coe, Michael T; Riskin, Shelby H; Krusche, Alex V; Elsenbeer, Helmut; Macedo, Marcia N; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A

    2013-06-01

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compared with forest. However, the deep and highly permeable soils on the broad plateaus on which much of the soya bean cultivation has expanded buffer small soya bean watersheds against increased stormflows. Concentrations of nitrate and phosphate do not differ between forest or soya bean watersheds because fixation of phosphorus fertilizer by iron and aluminium oxides and anion exchange of nitrate in deep soils restrict nutrient movement. Despite resistance to biogeochemical change, streams in soya bean watersheds have higher temperatures caused by impoundments and reduction of bordering riparian forest. In larger rivers, increased water flow, current velocities and sediment flux following deforestation can reshape stream morphology, suggesting that cumulative impacts of deforestation in small watersheds will occur at larger scales. PMID:23610178

  20. 76 FR 68057 - Importation of French Beans and Runner Beans From the Republic of Kenya Into the United States

    Science.gov (United States)

    2011-11-03

    ... (76 FR 16700-16703, Docket No. APHIS-2010-0101) a proposal \\1\\ to amend the regulations by allowing... (Phaseolus vulgaris L.) and runner beans (Phaseolus coccineus L.) may be imported into the United States...

  1. Biological nitrogen fixation in common bean and faba bean using N-15 methodology and two reference crops

    International Nuclear Information System (INIS)

    A field was conducted on a Typic ustropepts soil located at 'La Tola', the experimental campus of the Agricultural Sciences Faculty at Tumbaco, Ecuador. The objectives were to quantify faba bean (Vicia faba) and common bean (Phaseolus vulgaris) biological nitrogen fixation, using quinoa (chenopodium quinoa) and maize (Zea mays) as reference crops. The average values were 80 and 70 per cent for faba bean and 42 and 14 per cent for common bean, respectively. It was assumed that nitrogen use eficiency was the same for fixing crops but observed that a crop with high nitrogen use efficiency overestimates legume biological nitrogen fixation. Results suggests that greater caution is needed when selecting reference crops for legumes with nitrogen fixation

  2. Effect of various fertilization levels on the crack resistance of horse beans

    Directory of Open Access Journals (Sweden)

    Gorzelany J.

    1999-06-01

    Full Text Available Static compression tests were carried out on horse bean seeds within the scope of tests on micro tensile tester, Model Zwick 1425. The maximum value of force [N] causing bean crack and sample deformation [mm] up to the bean crack moment, were determined. The variation of predetermined mechanical indicators was analysed depending on the mode of varied fertilization, bean moisture content and loading direction. It was shown that varied fertilizer dose has significant effect on value of force causing bean damage and bean deformation up to crack.

  3. Susceptibility of pea, horse bean and bean to viruses in dependence on the age of the inoculated plants

    Directory of Open Access Journals (Sweden)

    Władysław Błaszczak

    2013-12-01

    Full Text Available Three cultivars of pea did not differ in their susceptibility to Cucumber Mosaic Virus (CMV notwithstanding the age of the inoculated plants. But their susceptibility to infection with Bean Yellow Mosaic Virus (BYMV differed. Horse bean cultivars 'Nadwiślański' and 'Major' proved to be less susceptible to Broad Bean True Mosaic Virus (BBTMV when older plants were-inoculated. Two bean cultivars 'Złota Saxa' and 'Earle' appeared to be susceptible to BBTMV only in the phase of developing primary leaves and the age-dependent resistance to infection increased faster in plants of the cv. 'Złota Saxa'. Both cultivars of bean showed also age-dependent resistance to infection by BYMV. All these viruses restricted growth and yield of plants. The decreases were greater when younger plants were inoculated. These dependences appeared most distinctly in pea cv. 'Sześciotygodniowy' infected with CMV and in two cultivars of bean infected with BYMV.

  4. Isolation and purification of fungal pathogen (Macrophomina phaseolina induced chitinase from moth beans (Phaseolus aconitifolius

    Directory of Open Access Journals (Sweden)

    Neelima Garg

    2010-01-01

    Full Text Available Objective : Chitinase (EC 3.2.1.14 is one of the major pathogenesis-related proteins, which is a polypeptide that accumulates extracellularly in infected plant tissue. An attempt was made to isolate and purify the chitanase enzyme using moth beans as an enzyme source. Materials and Method : The enzyme was isolated and purified from moth beans against the fungal pathogen Macrophomina phaseolina strain 2165. The isolation and purification was done in both in vitro and in vivo conditions. Purification of chitinase was carried out to obtain three fractions, viz. 50°C heated, ammonium sulfate precipitated and sephadex G-25 column-eluted fractions. The molecular mass of Chitinase was directly estimated by sodium dodecyl sulfate-polyacryamide gel electroresis (SDS-PAGE. Result : The yield is sufficient for initial characterization studies of the enzyme. The molecular study of the enzyme shows the possibility of generating the defense mechanism in plants in which it cannot occur. Chitinase was purified by gel filtration chromatography with 20.75-fold and 32.78-fold purification in the in vitro and in vivo conditions, respectively. The enzyme shows a maximum activity after 90 min with 0.1 ml of colloidal chitin as a substrate and 0.4 ml of crude chitinase extract. The optimum pH of 5.0 and an optimum temperature of 40°C was found for maximal activity. The molecular weight of purified chitinase was estimated to be 30 kDa by SDS-PAGE. Conclusion : The chitinase isolated in both in vitro and in vivo conditions is stable andactive.

  5. Nutritional response of growing rats to faba beans (Vicia faba L., minor) and faba bean fractions.

    Science.gov (United States)

    Rubio, L A; Grant, G; Bardocz, S; Dewey, P; Pusztai, A

    1991-11-01

    The effects of raw faba bean (Vicia faba L., minor) meal (VFM) and its fractions on the growth and nitrogen utilization of rats have been determined in two experiments. Two commercial varieties of VFM were tested, local VFM (409-439 g/kg diet) and Troy VFM (439 g/kg diet). The bean fractions tested were V. faba lectin-depleted protein (VFDP), V. faba lectin (VFL) and V. faba cotyledon residue (VFCR). All diets were supplemented with amino acids to target requirements. Body-weight, body N and lipid contents of rats fed on VFM were reduced significantly in comparison with control rats fed on lactalbumin. This was due, in part, to the lower digestibility of the protein, lipid and dry matter (DM) of VFM diets. As a result, net protein utilization (NPU) and biological value (BV) of faba bean proteins were less than expected. Urine and urea-N outputs of the VFM-fed rats were also elevated in both experiments. Increasing the energy content of local VFM diets led to significantly higher dry body-weight, body N and lipid contents, with the result that the NPU and BV values of the protein also increased. However, the NPU values for VFM-fed rats were still significantly lower than those for the controls in both experiments. In contrast, true N, lipid and DM digestibilities in rats given local VFM were not significantly affected by the difference in the energy content of the diets. The replacement of two-thirds of the lactalbumin in the diet with VFDP (65 g/kg) reduced dry body-weight, N and lipid contents, NPU and BV compared with the control rats, even though N, lipid and DM digestibilities were not significantly different. The nutritional performance of rats fed on lactalbumin-based diets containing 7 g VFL/kg was similar to that of the controls. Similarly, the inclusion of the cotyledon residue (237 g VFCR/kg diet) had no appreciable effect on any of the variables studied. As VFL and VFCR had no antinutritional effects in these rats, it appears that the low nutritional

  6. Tumorigenic potential of extracellular matrix metalloproteinase inducer.

    Science.gov (United States)

    Zucker, S; Hymowitz, M; Rollo, E E; Mann, R; Conner, C E; Cao, J; Foda, H D; Tompkins, D C; Toole, B P

    2001-06-01

    Extracellular matrix metalloproteinase inducer (EMMPRIN), a glycoprotein present on the cancer cell plasma membrane, enhances fibroblast synthesis of matrix metalloproteinases (MMPs). The demonstration that peritumoral fibroblasts synthesize most of the MMPs in human tumors rather than the cancer cells themselves has ignited interest in the role of EMMPRIN in tumor dissemination. In this report we have demonstrated a role for EMMPRIN in cancer progression. Human MDA-MB-436 breast cancer cells, which are tumorigenic but slow growing in vivo, were transfected with EMMPRIN cDNA and injected orthotopically into mammary tissue of female NCr nu/nu mice. Green fluorescent protein was used to visualize metastases. In three experiments, breast cancer cell clones transfected with EMMPRIN cDNA were considerably more tumorigenic and invasive than plasmid-transfected cancer cells. Increased gelatinase A and gelatinase B expression (demonstrated by in situ hybridization and gelatin substrate zymography) was demonstrated in EMMPRIN-enhanced tumors. In contrast to de novo breast cancers in humans, human tumors transplanted into mice elicited minimal stromal or inflammatory cell reactions. Based on these experimental studies and our previous demonstration that EMMPRIN is prominently displayed in human cancer tissue, we propose that EMMPRIN plays an important role in cancer progression by increasing synthesis of MMPs. PMID:11395366

  7. The progesterone-induced enhancement of object recognition memory consolidation involves activation of the extracellular signal-regulated kinase (ERK) and mammalian target of rapamycin (mTOR) pathways in the dorsal hippocampus

    OpenAIRE

    Orr, Patrick T.; Rubin, Amanda J.; Fan, Lu; Kent, Brianne A.; Frick, Karyn M.

    2012-01-01

    Although much recent work has elucidated the biochemical mechanisms underlying the modulation of memory by 17β-estradiol, little is known about the signaling events through which progesterone (P) regulates memory. We recently demonstrated that immediate post-training infusion of P into the dorsal hippocampus enhances object recognition memory consolidation in young ovariectomized female mice (Orr et al., 2009). The goal of the present study was to identify the biochemical alterations that mig...

  8. The Evolution of Extracellular Matrix

    Science.gov (United States)

    Özbek, Suat; Balasubramanian, Prakash G.; Chiquet-Ehrismann, Ruth; Tucker, Richard P.

    2010-01-01

    We present a perspective on the molecular evolution of the extracellular matrix (ECM) in metazoa that draws on research publications and data from sequenced genomes and expressed sequence tag libraries. ECM components do not function in isolation, and the biological ECM system or “adhesome” also depends on posttranslational processing enzymes, cell surface receptors, and extracellular proteases. We focus principally on the adhesome of internal tissues and discuss its origins at the dawn of the metazoa and the expansion of complexity that occurred in the chordate lineage. The analyses demonstrate very high conservation of a core adhesome that apparently evolved in a major wave of innovation in conjunction with the origin of metazoa. Integrin, CD36, and certain domains predate the metazoa, and some ECM-related proteins are identified in choanoflagellates as predicted sequences. Modern deuterostomes and vertebrates have many novelties and elaborations of ECM as a result of domain shuffling, domain innovations and gene family expansions. Knowledge of the evolution of metazoan ECM is important for understanding how it is built as a system, its roles in normal tissues and disease processes, and has relevance for tissue engineering, the development of artificial organs, and the goals of synthetic biology. PMID:21160071

  9. Extracellular matrix components direct porcine muscle stem cell behavior

    International Nuclear Information System (INIS)

    In muscle tissue, extracellular matrix proteins, together with the vasculature system, muscle-residence cells and muscle fibers, create the niche for muscle stem cells. The niche is important in controlling proliferation and directing differentiation of muscle stem cells to sustain muscle tissue. Mimicking the extracellular muscle environment improves tools exploring the behavior of primary muscle cells. Optimizing cell culture conditions to maintain muscle commitment is important in stem cell-based studies concerning toxicology screening, ex vivo skeletal muscle tissue engineering and in the enhancement of clinical efficiency. We used the muscle extracellular matrix proteins collagen type I, fibronectin, laminin, and also gelatin and Matrigel as surface coatings of tissue culture plastic to resemble the muscle extracellular matrix. Several important factors that determine myogenic commitment of the primary muscle cells were characterized by quantitative real-time RT-PCR and immunofluorescence. Adhesion of high PAX7 expressing satellite cells was improved if the cells were cultured on fibronectin or laminin coatings. Cells cultured on Matrigel and laminin coatings showed dominant integrin expression levels and exhibited an activated Wnt pathway. Under these conditions both stem cell proliferation and myogenic differentiation capacity were superior if compared to cells cultured on collagen type I, fibronectin and gelatin. In conclusion, Matrigel and laminin are the preferred coatings to sustain the proliferation and myogenic differentiation capacity of the primary porcine muscle stem cells, when cells are removed from their natural environment for in vitro culture.

  10. Extracellular matrix components direct porcine muscle stem cell behavior

    Energy Technology Data Exchange (ETDEWEB)

    Wilschut, Karlijn J. [Department of Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, 3584 CM, Utrecht (Netherlands); Haagsman, Henk P. [Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 1, 3584 CL, Utrecht (Netherlands); Roelen, Bernard A.J., E-mail: b.a.j.roelen@uu.nl [Department of Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, 3584 CM, Utrecht (Netherlands)

    2010-02-01

    In muscle tissue, extracellular matrix proteins, together with the vasculature system, muscle-residence cells and muscle fibers, create the niche for muscle stem cells. The niche is important in controlling proliferation and directing differentiation of muscle stem cells to sustain muscle tissue. Mimicking the extracellular muscle environment improves tools exploring the behavior of primary muscle cells. Optimizing cell culture conditions to maintain muscle commitment is important in stem cell-based studies concerning toxicology screening, ex vivo skeletal muscle tissue engineering and in the enhancement of clinical efficiency. We used the muscle extracellular matrix proteins collagen type I, fibronectin, laminin, and also gelatin and Matrigel as surface coatings of tissue culture plastic to resemble the muscle extracellular matrix. Several important factors that determine myogenic commitment of the primary muscle cells were characterized by quantitative real-time RT-PCR and immunofluorescence. Adhesion of high PAX7 expressing satellite cells was improved if the cells were cultured on fibronectin or laminin coatings. Cells cultured on Matrigel and laminin coatings showed dominant integrin expression levels and exhibited an activated Wnt pathway. Under these conditions both stem cell proliferation and myogenic differentiation capacity were superior if compared to cells cultured on collagen type I, fibronectin and gelatin. In conclusion, Matrigel and laminin are the preferred coatings to sustain the proliferation and myogenic differentiation capacity of the primary porcine muscle stem cells, when cells are removed from their natural environment for in vitro culture.

  11. Results of preliminary investigations at radio sensitivity of bean (Vicia faba L.) on fast neutrons

    International Nuclear Information System (INIS)

    The seeds of bean (Vicia faba L.) were irradiated with fast neutrons. The radiation doses applied ranged from 40 to 600 rads. Then irradiated seeds were sowed. During bean vegetation radiation effects were observed. (A.S.)

  12. Irradiation disinfestation of stored cocoa beans

    International Nuclear Information System (INIS)

    The relationship between effective dosages to induce mortality and sterility in several important storage beetles was investigated. To induce 100% mortality, doses ranging from 0.05 to 0.1 kGy require 4-7 weeks, 0.2-1.0 kGy need 1.5-3 weeks and 2.0 kGy require 1 week for Tribolium castaneum, Oryzaephilus surinamensis and Lasioderma serricorne, respectively. Only at 5.0 kGy did instant mortality occur in the insects tested. Total prevention of F1 progeny was achieved at the lowest dosage (0.05 kGy) for T. castaneum and O. surinamensis; for L. serricorne, the sterility level achieved was 92-99% for doses ranging from 0.05 to 1.0 kGy. Semi-pilot scale tests (12 months) were carried out to evaluate the efficacy of gamma irradiation to control insects (artificially infested L. serricorne and T. castaneum) and moulds in cocoa beans packed in either jute or laminated polypropylene or unlaminated polypropylene bags. Good control against insect infestations was achieved for the whole duration of storage. Laminated polypropylene afforded the best protection against insect reinfestation. Other than a change in moisture content, no changes in the physicochemical properties were observed in the flavour or in the total protein, soluble protein, amino acid and free fatty acid contents. 15 refs, 10 tabs

  13. Melhoramento do feijoeiro Breeding of dry beans

    Directory of Open Access Journals (Sweden)

    Ibrahim O. Abrahão

    1960-01-01

    Full Text Available Os ensaios de variedades e linhagens de feijão, realizados no período de 1948 a 1957 pelo Seção de Genética e resumidamente aqui apresentados, vieram indicar que as variedades e linhagens do grupo Mulatinho e Chumbinho eram as mais produtivas. A partir dêste ano agrícola, novos ensaios comparativos de produção foram realizados, a fim de verificar o comportamento das variedades e linhagens existentes com as variedades recém-introduzidas e as novas linhagens selecionadas. As variedades comerciais e suas linhagens, estudadas neste trabalho, foram classificadas em oito grupos, com base nas observações realizadas principalmente sôbre o tipo de planta e característicos dos sementes, o saber: Mulatinho, Chumbinho, Rosinha, Roxinho, Manteiga, Prêto, Bico-de-Ouro e diversos. Dos oito ensaios analisados em detalhes e realizados em Campinas, chegou-se à conclusão de que as variedades dos grupos Prêta e Rosinha são as de maior capacidade produtiva, devendo ser intensificado o aproveitamento dêsses grupos no plano de melhoramento em execução. As do grupo Roxinho apresentam-se menos produtivas. A comparação das análises dos ensaios como látice e blocos ao acaso revelou uma eficiência média de ordem de 30% para o tipo látice nos oito ensaios analisados. A fim de observar se o pêso total de plantas por ocasião da colheita mostra correlação com a produção de grãos, determinou-se, para cada grupo, o índice entre essas duas variáveis. Observou-se que êstes índices são proporcionais à produção, servindo, assim, para melhor caracterizar os diversos grupos de variedades e linhagens de feijão.In spite of the fact that dry beans (Phaseolus vulgaris are one of the main sources of protein in the State of São Paulo, Brazil, they are considered a secondary crop and grown only in small patches or intercropped with coffee, sugar cane, or corn. The development of high yielding strains resistant to the most prevailing diseases, has

  14. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Directory of Open Access Journals (Sweden)

    Daniel Ambachew

    2015-08-01

    Full Text Available Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM. The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i water deficit at mid-pod fill, or ii unprotected against bean fly; iii irrigated, well watered conditions, or iv bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  15. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel Ambachew; Firew Mekbib; Asrat Asfaw; Stephen E. Beebe; Matthew W. Blaird

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly;iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  16. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel; Ambachew; Firew; Mekbib; Asrat; Asfaw; Stephen; E.Beebe; Matthew; W.Blair

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot(BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly; iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress.In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  17. Effects of bioprocessed antinutritional factors on bean protein quality, with special emphasis on Phaseolus vulgaris L.

    OpenAIRE

    Savelkoul, F.H.M.G.

    1994-01-01

    Legumes, e.g. beans and peas, can contain antinutritional factors. Some varieties of faba beans (Vicia faba), soya beans (Glycine max ) and white kidney beans (Phaseolus vulgaris) can contain in their raw state antinutritional factors such as tannins, trypsin inhibitors and lectins respectively which negatively effect the protein digestibility by nonruminants e.g. pigs. Also the storage protein is not easily digested by nonruminants. The main aim of the present study was to find a reasonable ...

  18. Reduction of Microbe Contamination through Steaming Process to Cocoa Beans Using Steaming Chamber

    OpenAIRE

    Hendy Firmanto

    2014-01-01

    Dry cocoa bean quality is also determined by its microbe contamination level. Steaming process for dried cocoa beans as a pretreatment process was selected because of less effect on organic compound inside the dried cocoa bean. This experiment aim was to study microbial contamination level of cocoa beans using steaming process, determining its microbial population and evaluate its chemical changes. Experiment was carried out in Postharvest Laboratory of Indonesian Coffee and Cocoa Research In...

  19. Draft genome sequence of the ricin-producing oilseed castor bean

    OpenAIRE

    Chan, Agnes P.; Crabtree, Jonathan; Zhao, Qi; Lorenzi, Hernan; Orvis, Joshua; Puiu, Daniela; Melake-Berhan, Admasu; Kristine M Jones; Redman, Julia; Chen, Grace; Cahoon, Edgar B.; Gedil, Melaku; Stanke, Mario; Haas, Brian J.; Wortman, Jennifer R

    2010-01-01

    Castor bean (Ricinus communis) is an oil crop that belongs to the spurge (Euphorbiaceae) family. Its seeds are the source of castor oil, used for the production of high-quality lubricants due to its high proportion of the unusual fatty acid ricinoleic acid. Castor bean seeds also produce ricin, a highly toxic ribosome inactivating protein, making castor bean relevant for biosafety. We report here the 4.6X draft genome sequence of castor bean, representing the first reported Euphorbiaceae geno...

  20. Effect of toasting field beans and of grass-clover

    DEFF Research Database (Denmark)

    Mogensen, Lisbeth; Vestergaard, Jannie Steensig; Fretté, Xavier; Lund, Peter; Weisbjerg, Martin Riis; Kristensen, Troels

    The effect of toasting field beans and of grass-clover: maize silage ratio on milk production, milk composition and the sensory quality of the milk was investigated in a 2   2 factorial experiment. Toasting of field beans resulted in lower milk contents of both fat (44.2 versus 46.1 g/kg, P = 0.......02) and protein (33.5 versus 34.2 g/kg, P = 0.008), whereas milk production, urea and somatic cell contents were unaffected compared with the untreated field beans. Increasing the proportion of maize silage (from 9 to 21% of DM) in the ration decreased the content of urea in milk (P = 0.002), whereas milk......-β-carotene (P = 0.04) and β-carotene (P = 0.05). Toasting of field beans compared with untreated field beans did not affect the milk content of carotenoids and had only small effects on fatty acid composition. Regarding the sensory quality, the four treatments resulted in milk being characterized by a...

  1. Analysis of extracellular RNA by digital PCR

    Directory of Open Access Journals (Sweden)

    Kenji eTakahashi

    2014-06-01

    Full Text Available The transfer of extracellular RNA is emerging as an important mechanism for intracellular communication. The ability for the transfer of functionally active RNA molecules from one cell to another within vesicles such as exosomes enables a cell to modulate cellular signaling and biological processes within recipient cells. The study of extracellular RNA requires sensitive methods for the detection of these molecules. In this methods article, we will describe protocols for the detection of such extracellular RNA using sensitive detection technologies such as digital PCR. These protocols should be valuable to researchers interested in the role and contribution of extracellular RNA to tumor cell biology.

  2. Extracellular Molecules Involved in Cancer Cell Invasion

    Energy Technology Data Exchange (ETDEWEB)

    Stivarou, Theodora; Patsavoudi, Evangelia, E-mail: epatsavoudi@pasteur.gr [Department of Biochemistry, Hellenic Pasteur Institute, Athens 11521 (Greece); Technological Educational Institute of Athens, Egaleo, Athens 12210 (Greece)

    2015-01-26

    Nowadays it is perfectly clear that understanding and eradicating cancer cell invasion and metastasis represent the crucial, definitive points in cancer therapeutics. During the last two decades there has been a great interest in the understanding of the extracellular molecular mechanisms involved in cancer cell invasion. In this review, we highlight the findings concerning these processes, focusing in particular on extracellular molecules, including extracellular matrix proteins and their receptors, growth factors and their receptors, matrix metalloproteinases and extracellular chaperones. We report the molecular mechanisms underlying the important contribution of this pool of molecules to the complex, multi-step phenomenon of cancer cell invasion.

  3. Navy bean flour particle size and protein content affect cake baking and batter quality

    Science.gov (United States)

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to three levels with navy bean starch. The effect...

  4. Comparative study of the chemical composition of wild and cultivated beans (Phaseolus vulgaris).

    Science.gov (United States)

    Sotelo, A; Sousa, H; Sánchez, M

    1995-02-01

    Five wild Phaseolus vulgaris beans were compared with five cultivated Phaseolus vulgaris beans in proximate composition, total (true) protein, amino acid composition, and toxic and antinutritional factors. The wild beans contained more protein (25.5% vs. 21.7%), ash (5.15 vs. 4.15%), crude fiber (7.08% vs. 5.04%) compared to cultivated beans while the former contained less fat (0.56 vs. 0.89%) and carbohydrates (61.64 vs. 68.05%). Sulfur amino acids were found to be limiting in both groups of bean as expected; however, the cultivated beans had a higher content of the limiting amino acids. Therefore, the cultivated beans showed a better amino acid profile than the wild beans. Toxic factors were not found in either type of bean; the determinations included saponins, alkaloids, and cyanogenic glycosides. The antinutritional factors investigated were hemagglutinins (lectins) and trypsin inhibitors. The wild beans presented a higher content of trypsin inhibitors (28 TUI per mg) and lectins (9.6) than the cultivated beans did (21 TUI per mg and 7 respectively). From the chemical point of view, domestication seems to be positive; however, the better protein nutritive quality of the cultivated beans should be further confirmed by biological assays. PMID:7792267

  5. Effects of extrusion cooking on the chemical composition and functional properties of dry bean powders

    Science.gov (United States)

    This study aimed to investigate the impacts of extrusion cooking on the chemical composition and functional properties of bean powders from four bean varieties. The raw bean powders were extruded under eight different conditions, and the extrudates were then dried and ground (particle size = 0.5 mm)...

  6. Snap beans (Phaseolus vulgaris L.) quality profile by sensory descriptive analysis

    OpenAIRE

    Vilanova de la Torre, María del Mar; Rodiño Míguez, Ana Paula; González Fernández, Ana María; Canosa Rodríguez, Pilar; Rodríguez Vega, Iria; Riveiro, Manuel; Santalla Ferradás, Marta

    2014-01-01

    Sensory quality of snap beans (Phaseolus vulgaris L.) influence consumer preferences. The application of sensory descriptive analysis (SDA) for snap bean quality is shown in this work. SDA has allowed generatin gdescriptors for appearance, aroma, flavor and texture, which could be used to characterize snap bean varieties.

  7. Extracellular modulators of Wnt signalling.

    Science.gov (United States)

    Malinauskas, Tomas; Jones, E Yvonne

    2014-12-01

    Wnt morphogens are secreted signalling proteins that play leading roles in embryogenesis and tissue homeostasis throughout life. Wnt signalling is controlled by multiple mechanisms, including posttranslational modification of Wnts, antagonist binding (to Wnts or their receptors), and regulation of the availability of Wnt receptors. Recent crystallographic, structure-guided biophysical and cell-based studies have advanced our understanding of how Wnt signalling is regulated at the cell surface. Structures include Wnt in complex with the cysteine-rich domain (CRD) of Frizzled, extracellular fragments of Wnt co-receptor LRP6, LRP6-binding antagonists Dickkopf and Sclerostin, antagonists 5T4/WAIF1 and Wnt inhibitory factor 1 (WIF-1), as well as Frizzled-ubiquitin ligases ZNRF3/RNF43 (in isolation and in complexes with Wnt signalling promoters R-spondins and LGR5). We review recent discoveries and remaining questions. PMID:25460271

  8. Hyperspectral imaging for differentiation of foreign materials from pinto beans

    Science.gov (United States)

    Mehrubeoglu, Mehrube; Zemlan, Michael; Henry, Sam

    2015-09-01

    Food safety and quality in packaged products are paramount in the food processing industry. To ensure that packaged products are free of foreign materials, such as debris and pests, unwanted materials mixed with the targeted products must be detected before packaging. A portable hyperspectral imaging system in the visible-to-NIR range has been used to acquire hyperspectral data cubes from pinto beans that have been mixed with foreign matter. Bands and band ratios have been identified as effective features to develop a classification scheme for detection of foreign materials in pinto beans. A support vector machine has been implemented with a quadratic kernel to separate pinto beans and background (Class 1) from all other materials (Class 2) in each scene. After creating a binary classification map for the scene, further analysis of these binary images allows separation of false positives from true positives for proper removal action during packaging.

  9. Streptococcus mutans-derived extracellular matrix in cariogenic oral biofilms.

    Science.gov (United States)

    Klein, Marlise I; Hwang, Geelsu; Santos, Paulo H S; Campanella, Osvaldo H; Koo, Hyun

    2015-01-01

    Biofilms are highly structured microbial communities that are enmeshed in a self-produced extracellular matrix. Within the complex oral microbiome, Streptococcus mutans is a major producer of extracellular polymeric substances including exopolysaccharides (EPS), eDNA, and lipoteichoic acid (LTA). EPS produced by S. mutans-derived exoenzymes promote local accumulation of microbes on the teeth, while forming a spatially heterogeneous and diffusion-limiting matrix that protects embedded bacteria. The EPS-rich matrix provides mechanical stability/cohesiveness and facilitates the creation of highly acidic microenvironments, which are critical for the pathogenesis of dental caries. In parallel, S. mutans also releases eDNA and LTA, which can contribute with matrix development. eDNA enhances EPS (glucan) synthesis locally, increasing the adhesion of S. mutans to saliva-coated apatitic surfaces and the assembly of highly cohesive biofilms. eDNA and other extracellular substances, acting in concert with EPS, may impact the functional properties of the matrix and the virulence of cariogenic biofilms. Enhanced understanding about the assembly principles of the matrix may lead to efficacious approaches to control biofilm-related diseases. PMID:25763359

  10. Streptococcus mutans-derived extracellular matrix in cariogenic oral biofilms

    Directory of Open Access Journals (Sweden)

    Marlise eKlein

    2015-02-01

    Full Text Available Biofilms are highly structured microbial communities that are enmeshed in a self-produced extracellular matrix. Within the complex oral microbiome, Streptococcus mutans is a major producer of extracellular polymeric substances including exopolysaccharides (EPS, eDNA and lipoteichoic acid (LTA. EPS produced by S. mutans-derived exoenzymes promote local accumulation of microbes on the teeth, while forming a spatially heterogeneous and diffusion-limiting matrix that protects embedded bacteria. The EPS-rich matrix provides mechanical stability/cohesiveness and facilitates the creation of highly acidic microenvironments, which are critical for the pathogenesis of dental caries. In parallel, S. mutans also releases eDNA and LTA, which can contribute with matrix development. eDNA enhances EPS (glucan synthesis locally, increasing the adhesion of S. mutans to saliva-coated apatitic surfaces and the assembly of highly cohesive biofilms. eDNA and other extracellular substances, acting in concert with EPS, may impact the functional properties of the matrix and the virulence of cariogenic biofilms. Enhanced understanding about the assembly principles of the matrix may lead to efficacious approaches to control biofilm-related diseases.

  11. Root exudates drive interspecific facilitation by enhancing nodulation and N2 fixation.

    Science.gov (United States)

    Li, Bai; Li, Yu-Ying; Wu, Hua-Mao; Zhang, Fang-Fang; Li, Chun-Jie; Li, Xue-Xian; Lambers, Hans; Li, Long

    2016-06-01

    Plant diversity in experimental systems often enhances ecosystem productivity, but the mechanisms causing this overyielding are only partly understood. Intercropping faba beans (Vicia faba L.) and maize (Zea mays L.) result in overyielding and also, enhanced nodulation by faba beans. By using permeable and impermeable root barriers in a 2-y field experiment, we show that root-root interactions between faba bean and maize significantly increase both nodulation and symbiotic N2 fixation in intercropped faba bean. Furthermore, root exudates from maize promote faba bean nodulation, whereas root exudates from wheat and barley do not. Thus, a decline of soil nitrate concentrations caused by intercropped cereals is not the sole mechanism for maize promoting faba bean nodulation. Intercropped maize also caused a twofold increase in exudation of flavonoids (signaling compounds for rhizobia) in the systems. Roots of faba bean treated with maize root exudates exhibited an immediate 11-fold increase in the expression of chalcone-flavanone isomerase (involved in flavonoid synthesis) gene together with a significantly increased expression of genes mediating nodulation and auxin response. After 35 d, faba beans treated with maize root exudate continued to show up-regulation of key nodulation genes, such as early nodulin 93 (ENOD93), and promoted nitrogen fixation. Our results reveal a mechanism for how intercropped maize promotes nitrogen fixation of faba bean, where maize root exudates promote flavonoid synthesis in faba bean, increase nodulation, and stimulate nitrogen fixation after enhanced gene expression. These results indicate facilitative root-root interactions and provide a mechanism for a positive relationship between species diversity and ecosystem productivity. PMID:27217575

  12. Rhizosphere acidification of faba bean, soybean and maize

    International Nuclear Information System (INIS)

    Interspecific facilitation on phosphorus uptake was observed in faba bean/maize intercropping systems in previous studies. The mechanism behind this, however, remained unknown. Under nitrate supply, the difference in rhizosphere acidification potential was studied by directly measuring pH of the solution and by visualizing and quantifying proton efflux of roots between faba bean (Vicia faba L. cv. Lincan No.5), soybean (Glycine max L. cv. Zhonghuang No. 17) and maize (Zea mays L. cv. Zhongdan No.2) in monoculture and intercrop, supplied without or with 0.2 mmol L-1 P as KH2PO4. The pH of the nutrient solution grown faba bean was lower than initial pH of 6.0 from day 1 to day 22 under P deficiency, whereas the pH of the solution with maize was declined from day 13 after treatment. Growing soybean increased solution pH irrespective of P supply. Under P deficiency, the proton efflux of faba bean both total (315.25 nmol h-1 plant-1) and specific proton efflux (0.47 nmol h-1 cm-1) was greater than that those of soybean (21.80 nmol h-1 plant-1 and 0.05 nmol h-1 cm-1, respectively). Faba bean had much more ability of rhizosphere acidification than soybean and maize. The result can explain partly why faba bean utilizes sparingly soluble P more effectively than soybean and maize do, and has an important implication in understanding the mechanism behind interspecific facilitation on P uptake by intercropped species.

  13. Rhizosphere acidification of faba bean, soybean and maize

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, L.L. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences, Peking Union Medical College, Beijing, 100094 (China); Cao, J. [School of Life Science, Key Laboratory of Arid and Grassland Ecology, Lanzhou University, Lanzhou 730000 (China); Zhang, F.S. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Li, L., E-mail: lilong@cau.edu.cn [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China)

    2009-07-01

    Interspecific facilitation on phosphorus uptake was observed in faba bean/maize intercropping systems in previous studies. The mechanism behind this, however, remained unknown. Under nitrate supply, the difference in rhizosphere acidification potential was studied by directly measuring pH of the solution and by visualizing and quantifying proton efflux of roots between faba bean (Vicia faba L. cv. Lincan No.5), soybean (Glycine max L. cv. Zhonghuang No. 17) and maize (Zea mays L. cv. Zhongdan No.2) in monoculture and intercrop, supplied without or with 0.2 mmol L{sup -1} P as KH{sub 2}PO{sub 4}. The pH of the nutrient solution grown faba bean was lower than initial pH of 6.0 from day 1 to day 22 under P deficiency, whereas the pH of the solution with maize was declined from day 13 after treatment. Growing soybean increased solution pH irrespective of P supply. Under P deficiency, the proton efflux of faba bean both total (315.25 nmol h{sup -1} plant{sup -1}) and specific proton efflux (0.47 nmol h{sup -1} cm{sup -1}) was greater than that those of soybean (21.80 nmol h{sup -1} plant{sup -1} and 0.05 nmol h{sup -1} cm{sup -1}, respectively). Faba bean had much more ability of rhizosphere acidification than soybean and maize. The result can explain partly why faba bean utilizes sparingly soluble P more effectively than soybean and maize do, and has an important implication in understanding the mechanism behind interspecific facilitation on P uptake by intercropped species.

  14. Green coffee bean extract improves human vasoreactivity.

    Science.gov (United States)

    Ochiai, Ryuji; Jokura, Hiroko; Suzuki, Atsushi; Tokimitsu, Ichiro; Ohishi, Mitsuru; Komai, Norio; Rakugi, Hiromi; Ogihara, Toshio

    2004-10-01

    Our previous study revealed the antihypertensive effects of green coffee bean extract (GCE) ingestion in spontaneously hypertensive rats. We suggested that this antihypertensive action was due to the fact that GCE contains chlorogenic acid (CQA) as a major phenolic compound, and CQA in turn contains ferulic acid as a metabolic component that acts on nitric oxide (NO) derived from the vascular endothelium. In this study, the effects of GCE on blood vessels were evaluated in healthy males. The subjects were 20 healthy males with reduced vasodilation responses measured by strain gauge plethysmograms (SPG) to ischemic reactive hyperemia. Of the 20 subjects, 10 (mean age, 37.2 years) ingested a test drink containing GCE (CQA: 140 mg/day), and the other 10 (mean age, 34.8 years) ingested a placebo drink for 4 months. During the ingestion period, SPG, pulse wave velocity (PWV), and serum biochemical parameters were measured, and acceleration plethysmograms (APG) were taken. The reactive hyperemia ratio (RHR) in the test drink group began to increase after ingestion for 1 month and was significantly higher (p <0.05) than that in the placebo group after ingestion for 3 months and 4 months. In addition, after ingestion for 4 months, the test drink group showed a significant decrease (p <0.01) in the plasma total homocysteine level compared with the pre-ingestion level. However, there were no significant differences in PWV or APG between the test drink group and the placebo drink group. The improvement in RHR after ingestion of a drink containing GCE suggested an improvement in vasoreactivity by this component. PMID:15785008

  15. Medical image of the week: coffee bean and whirlpool signs

    Directory of Open Access Journals (Sweden)

    Bartolome B

    2016-01-01

    Full Text Available A 79-year-old woman with a history of Parkinson’s disease presented with altered mental status, poor oral intake, and multiple episodes of nausea and vomiting. An abdominal x-ray demonstrated dilated loops of bowel and the coffee bean sign concerning for sigmoid volvulus (Figure 1. The coffee bean sign occurs when a thick “inner wall” represents the double wall thickness of opposed loops of bowel while the thinner outer walls due single thickness. A contrast CT abdomen showed dilated sigmoid loop and whirlpool sign confirming sigmoid volvulus (Figure 2. She underwent a total colectomy with ileorectal anastomosis and full recovery.

  16. Technique of irradiation sterilization of local flavor bean products

    International Nuclear Information System (INIS)

    Local flavor bean products were packed with 0.07 - 0.10 mm nylon-polythene plastic bags, vacuumed, sealed and irradiated by 60Co γ-rays of 5 - 10 kGy and stored for 30 days at normal temperature (25 degree C) and for 90 days at (2 - 7) degree C, respectively. The results show that the bacteria number of irradiated bean products accords with the national standard and the protein and fat contents have no obvious change compared with the CK

  17. EXTRACELLULAR HSPs: The Complicated Roles of Extracellular HSPs in Immunity.

    Directory of Open Access Journals (Sweden)

    Stuart Keith Calderwood

    2016-04-01

    Full Text Available Extracellular heat shock proteins (HSPs interact with the immune system in a very complex manner. Many such HSPs exert powerful effects on the immune response, playing both stimulatory and regulatory roles. However, the influence of the HSPs on immunity appears to be black or white in nature - rarely neutral. Thus the HSPs can act as dominant antigens and can comprise key components of anti-tumor vaccines. They can also function as powerful immunoregulatory agents and, as such are employed to treat inflammatory diseases or to extend the lifespan of tissue transplants. Small modifications in the cellular milieu have been shown to flip the allegiances of HSPs from immunoregulatory agents towards a potent inflammatory alignment. These mutable properties of HSPs may be related to the ability of these proteins to interact with multiple receptors often with mutually confounding properties in immune cells. Therefore, understanding the complex immune properties of HSPs may help us to harness their potential in treatment of a range of conditions.

  18. Changes in Biochemical and Physico-chemical Qualities during Drying of Pulp Preconditioned and Fermented Cocoa (Theobroma cacao Beans

    Directory of Open Access Journals (Sweden)

    Emmanuel Ohene Afoakwa

    2014-04-01

    Full Text Available This study investigated the effects of post-harvest pod storage as a means of pulp preconditioning on the souring production, flavour precursors development and free fatty acids during drying of fermented Ghanaian cocoa beans. A 4 x 4 full factorial experiment was conducted with pod storage (0, 7, 14, 21 days and drying times (0, 2, 4 and 6 days as the principal factors. The souring/acidification indices (pH and titratable acidity, total sugar, total nitrogen and free fatty acids (FFA were studied using standard analytical methods. The results showed that titratable acidity, total sugars and total nitrogen in cocoa beans decreased during drying and with increasing pod storage durations probably due to their participation in Maillard non-enzymatic reactions to form flavour volatiles and colour pigments as Amadori intermediates. By contrast, FFAs and pH increased during drying and with increasing pod storage durations. Pod storage for up to 7 days followed by 6 days of fermentation and drying respectively produced beans with acceptable FFA values below 1.75% whilst enhancing the flavour precursors development and reductions in nib acidity. However, these observed changes were more dependent on pod storage than on drying.

  19. THE ROLE OF BACTERIAL SYMBIONTS IN AMINO ACID COMPOSITION OF BLACK BEAN APHIDS

    Institute of Scientific and Technical Information of China (English)

    MingGan; De-ChengDing; Xue-xiaMiao

    2003-01-01

    To evaluate the role of bacterial symbionts ( Buchnera spp. ) in the black bean aphids ( Aphis craccivora Koch), the aphids were treated with the antibiotic, rifampicin, to eliminate their intracellular symbiotic bacteria. Analysis of protein and amino acid concentration in 7-day-old of aposymbiotic aphids showed that the total protein content per mg fresh weight was significantly reduced by 29 %, but free amino acid titers were increased by 17% . The ratio of the essential amino acids was in general only around 20% essential amino acids in phloem sap of broad bean, whereas it was 44% and 37% in symbiotic and aposymbiotic aphids, respectively,suggesting that the composition of the free amino acids was unbalanced. For example, the essential amino acid,threonine represented 21. 6% of essential amino acids in symbiotic aphids, but it was only 16.7% in aposymbiotic aphids. Likewise, two nonessential amino acids, tyrosine and serine, represented 8.9% and 5.6% of total amino acids in symbiontic aphids, respectively, but they enhanced to 21.1% and 13.6% in aposymbiotic aphids. It seems likely that the elevated free amino acid concentration in aposymbiotic aphids was caused by the limited protein anabolism as the result of the unbalanced amino acid composition.

  20. The Effect of Humic Acid on Nutrient Composition in Broad Bean (Vicia faba L. Roots

    Directory of Open Access Journals (Sweden)

    Sener AKINCI

    2009-12-01

    Full Text Available Humic acids promote the conversion of mineral nutrients into forms available to plants. It also stimulates seed germination and viability, and its main effect usually being more prominent in the roots. The objective of this study was to determine of the influence of humic acid on broad bean (Vicia faba L. cultivar �Eresen 87� on root growth and development as well as nutrient uptake, during investigation in a pot experiment. Treatment with leonardite, as humic acid source positively affected both germination and harvesting, enhancing root length and biomass. Humic acid (HA caused significant increase of fresh (RFW and dry (RDW weights by 30.1% and 56.6% of broad bean roots, respectively. Flame photometer and atomic absorption spectrophotometry analyses revealed that K content was major nutrient among the tested elements. Humic acid increased the contents of Na and K significantly. The content of Ca and Fe was not significantly increased whereas Cu, Mn and Zn content decreased under HA treatment.

  1. Influences of the radiation supply on assimilation rate and grain yield of broad bean

    International Nuclear Information System (INIS)

    During 3 years a field experiment was carried out at two sites with different soil conditions to study distribution of 14CO2 labelled assimilation products in single plants of broad bean. One part of the plants was shaded to simulate the light conditions within a stand of broad beans. The plant tops remained always free of shading. (1) The shedding of influorescences and young pods was reduced on the more favourable soil conditions corresponding to a higher grain yield. The assimilation rate of the plants on the better soil was increased too. (2) Shading reduced the assimilation rates at the two sites on the average by 48%, enhanced the shedding of inflorescences and young pods and decreased the mean yield by 41%. (3) The assimilation products of the plant top moved predominantly into the generative organs. However, leaves below the top did not supply an essential amount of assimilates to the top. (4) Inflorescences and young pods, organs endangered to be dropped, received assimilates in particular from the adjoining leaves. (5) It seems that the shedding of inflorescences and pods depends on the assimilation capacity of these leaves

  2. Virtual SceneBean: a Learning Object Model for Collaborative Virtual Learning Environment

    Directory of Open Access Journals (Sweden)

    Jinan FIAIDHI

    2004-10-01

    Full Text Available It is commonly agreed that a well-balanced mix of collaboration, training and simulation eventually produce a superior learner. Today's collaborative design and learning environments integrate variety of interactive objects as well as many technological aspects to achieve such balance. Unfortunately, the actual profit of the resulting learning systems is largely reduced by poorly represented interactive objects as well as poor interlinking between such objects. In particular, such objects appear isolated: they neither can be modified sufficiently (e.g., by choosing parameters or enhancing functionality nor be interlinked properly with their context (e.g., by synchronizing with a guided tour or metadata. We are presenting in this article a model for representing virtual and 3D scenes as learning objects. The model utilizes notions and techniques based on Scene Graphs, X3D, Java3D, and SceneBeans. The prototype accompanied with a simple client-server protocol for exchanging and viewing the 3D SceneBeans. This research aims to extend this protocol by utilizing Sun JXTA primitives to link to the POOL of other learning objects repositories.

  3. Effects of water blanching on polyphenol reaction kinetics and quality of cocoa beans

    Science.gov (United States)

    Menon, A. S.; Hii, C. L.; Law, C. L.; Suzannah, S.; Djaeni, M.

    2015-12-01

    Several studies have been reported on the potential health benefits of cocoa polyphenols. However, drying has an inhibitory effect on the substantial recovery of cocoa polyphenols. This is majorly because of the high degradation of polyphenol compounds as well as the enhanced activity of polyphenol oxidases; a pre-cursor for browning of polyphenols during drying. Pre-treatment technique such as water blanching (80° and 90°C for 5 min, 10 min and 15 min exposure times respectively) can inactivate the polyphenol oxidases enzyme and promote high percent of the polyphenol recovery in dried cocoa bean. The degradation kinetics of cocoa polyphenols during hot water blanching are analyzed; The rate constant for the polyphenol degradation after blanching was found to be ranging from 0.0208 to 0.0340 /min. The results for dried fresh cocoa beans showed an optimal level of polyphenol recovery (118 mg GAE/g) when blanched at 90°C for 5 minutes duration. The antioxidant activity is also analyzed using DPPH scavenging assay.

  4. Antioxidant properties of the mung bean flavonoids on alleviating heat stress.

    Directory of Open Access Journals (Sweden)

    Dongdong Cao

    Full Text Available BACKGROUND: It is a widespread belief in Asian countries that mung bean soup (MBS may afford a protective effect against heat stress. Lack of evidence supports MBS conferring a benefit in addition to water. RESULTS: Here we show that vitexin and isovitexin are the major antioxidant components in mungbean (more than 96% of them existing in the bean seed coat, and both of them could be absorbed via gavage into rat plasma. In the plasma of rats fed with mungbean coat extract before or after exposure to heat stress, the levels of malonaldehyde and activities of lactate dehydrogenase and nitric oxide synthase were remarkably reduced; the levels of total antioxidant capacity and glutathione (a quantitative assessment of oxidative stress were significantly enhanced. CONCLUSIONS: Our results demonstrate that MBS can play additional roles to prevent heat stress injury. Characterization of the mechanisms underlying mungbean beneficial effects should help in the design of diet therapy strategies to alleviate heat stress, as well as provide reference for searching natural medicines against oxidative stress induced diseases.

  5. Carbon monoxide-induced adventitious rooting of hypocotyl cuttings from mung bean seedling

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this paper, the regulatory role of exogenous carbon monoxide (CO) during the generation and development of adventitious roots in mung bean (Phaseolus radiatus L. cv. Mingguang) hypocotyl cuttings was surveyed. The results indicated that, like nitric oxide (NO), CO donor Hematin induced adventitious rooting in dose- and time-de- pendent manners. These responses were also prov- en by the addition of gaseous CO aqueous solution with different concentrations. Additionally, the above CO-mediated effect was differently reversed when CO scavenger hemoglobin (Hb), CO specific synthetic inhibitor ZnPPIX, the auxin transport inhibitor NPA and nitric oxide synthase (NOS) inhibitor L-NAME were added with Hematin, respectively. Furthermore, after being treated with CO for 36 h, NO fluorescence was significantly enhanced and mainly distributed in the zone of vascular bundles whereas the specific NO scavenger cPTIO significantly inhibited NO fluorescence induced by CO, indicating that CO induces adventitious rooting of hypocotyl cuttings from mung bean seedling probably mediated by NO/NOS pathway.

  6. Determination of trace elements in various kinds of bean by X-ray spectrometric techniques (1995-96)

    International Nuclear Information System (INIS)

    Various kinds of bean such as Peanut, Gram Whole, Black Eye Bean, Small Red Bean, Lab Lab Bean, Green Mung Bean, Filed Pea, Seasame Seed, Sultani, Maize, Butter Bean, Dolichos Lab Lab, Toor Whole, Small Yellow Bean, Cow Pea have been collected and analysed by EDXRF analysis for trace elements. The measurement system consists of a Cd-109 annual excitation source, a Si (Li) detector, H V power supply, a spectrometry amplifier, a multichannel analyser and a personal computer. The samples were prepared as pressed pellets and measured by Emission Transmission Technique. The accuracy was determined by analysing standard reference material, SOIL-7 form IAEA. (author)

  7. Biofortified red mottled beans (Phaseolus vulgaris L. in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus and an in vitro digestion/Caco-2 model

    Directory of Open Access Journals (Sweden)

    Glahn Raymond P

    2011-10-01

    Full Text Available Abstract Background Our objective was to compare the capacities of biofortified and standard colored beans to deliver iron (Fe for hemoglobin synthesis. Two isolines of large-seeded, red mottled Andean beans (Phaseolus vulgaris L., one standard ("Low Fe" and the other biofortified ("High Fe" in Fe (49 and 71 μg Fe/g, respectively were used. This commercial class of red mottled beans is the preferred varietal type for most of the Caribbean and Eastern and Southern Africa where almost three quarters of a million hectares are grown. Therefore it is important to know the affect of biofortification of these beans on diets that simulate human feeding studies. Methods Maize-based diets containing the beans were formulated to meet the nutrient requirements for broiler except for Fe (Fe concentrations in the 2 diets were 42.9 ± 1.2 and 54.6 ± 0.9 mg/kg. One day old chicks (Gallus gallus were allocated to the experimental diets (n = 12. For 4 wk, hemoglobin, feed-consumption and body-weights were measured. Results Hemoglobin maintenance efficiencies (HME (means ± SEM were different between groups on days 14 and 21 of the experiment (P In-vitro analysis showed lower iron bioavailability in cells exposed to standard ("Low Fe" bean based diet. Conclusions We conclude that the in-vivo results support the in-vitro observations; biofortified colored beans contain more bioavailable-iron than standard colored beans. In addition, biofortified beans seems to be a promising vehicle for increasing intakes of bioavailable Fe in human populations that consume these beans as a dietary staple. This justifies further work on the large-seeded Andean beans which are the staple of a large-region of Africa where iron-deficiency anemia is a primary cause of infant death and poor health status.

  8. Physicochemical properties and antioxidant capacity of raw, roasted and puffed cacao beans.

    Science.gov (United States)

    Hu, SuJung; Kim, Byung-Yong; Baik, Moo-Yeol

    2016-03-01

    The antioxidant capacity and attributable bioactive compounds of puffed cacao beans were investigated. Roasting was carried out at 190°C for 15min and puffing was performed at 4-7kgf/cm(2). Cacao beans puffed at 4kgf/cm(2) showed the highest total polyphenols (23.16mgGAE/gsample) and total flavonoids (10.65mgCE/gsample) (pcacao beans reflected the total polyphenols and flavonoids measured. The quantities of theobromine, catechin, epicatechin, and procyanidin B2 were higher in cacao beans puffed at 4kgf/cm(2) than in roasted cacao beans. Puffed cacao beans received a good sensory score in flavor, but sourness increased as puffing pressure increased. Thus, these results suggest that, in cacao bean processing, puffing could be an alternative to roasting, which provide a rich taste and high antioxidant capacity. PMID:26471657

  9. Pinto Beans (Phaseolus vulgaris L. as a Functional Food: Implications on Human Health

    Directory of Open Access Journals (Sweden)

    Vicki Schlegel

    2013-02-01

    Full Text Available Most foods are considered functional in terms of providing nutrients and energy to sustain daily life, but dietary systems that are capable of preventing or remediating a stressed or diseased state are classified as functional foods. Dry beans (Phaseolus vulgaris L. contain high levels of chemically diverse components (phenols, resistance starch, vitamins, fructooligosaccharides that have shown to protect against such conditions as oxidative stress, cardiovascular disease, diabetes, metabolic syndrome, and many types of cancer, thereby positioning this legume as an excellent functional food. Moreover, the United States has a rich dry bean history and is currently a top producer of dry beans in the world with pinto beans accounting for the vast majority. Despite these attributes, dry bean consumption in the US remains relatively low. Therefore, the objective of this manuscript is to review dry beans as an important US agricultural crop and as functional food for the present age with an emphasis on pinto beans.

  10. Immunotherapeutic potential of extracellular vesicles

    Directory of Open Access Journals (Sweden)

    Bin eZhang

    2014-10-01

    Full Text Available Extracellular vesicles or EVs is a term that encompasses all classes of secreted lipid membrane vesicles. Despite being scientific novelties, EVs are gaining importance as a mediator of important physiological and pathological intercellular activities possibly through the transfer of their cargo of protein and RNA between cells. In particular, exosomes the currently best characterized EVs have been notable for their in vitro and in vivo immunomodulatory activities. Exosomes are nanometer-sized endosome-derived vesicles secreted by many cell types and their immunomodulatory potential is independent of their cell source. Besides immune cells such as dendritic cells, macrophages and T cells, cancer and stem cells also secrete immunologically active exosomes that could influence both physiological and pathological processes. The immunological activities of exosomes affect both innate and adaptive immunity and include antigen presentation, T cell activation, T cell polarisation to Tregs, immune suppression and anti-inflammation. As such, exosomes carry much immunotherapeutic potential as a therapeutic agent and a therapeutic target.

  11. Low-fat sodium-reduced sausages: Effect of the interaction between locust bean gum, potato starch and κ-carrageenan by a mixture design approach.

    Science.gov (United States)

    García-García, Elizabeth; Totosaus, Alfonso

    2008-04-01

    A mixture design approach was used to evaluate interactions between potato starch, locust bean gum and κ-carrageenan and their effect on cooking yield, expressible moisture, texture and color in low-fat sodium-reduced sausages formulated with potassium and calcium chloride. Starch had a notable influence on cooking yield and texture, increasing product hardness and resilience as starch proportion increased. The added salt did not allow complete starch granule gelatinization and swelling, which negatively affected water retention, cohesiveness and lightness. Locust bean gum and κ-carrageenan improved cooking yield and reduced expressible moisture in formulations containing higher proportions of potato starch. The presence of other ions could have enhanced κ-carrageenan functionality and its synergistic interaction with locust bean gum, improving texture and water retention, with only minor effects on sausage color. At the lower tested proportions starch can be used as an extender in low-fat cooked meat products if κ-carrageenan and locust bean gum are included in similar proportions. PMID:22062459

  12. Germination test for identification of gamma-irradiated bean seeds

    International Nuclear Information System (INIS)

    The feasibility of germination test for the practical detection of irradiated beans has not been investigated. The objective of this study was to determine if the relationship between the root growth rate and radiation dose could be used to produce a rapid analytical method for identification of irradiated beans. Such detection method could be potentially used for both (a) identification of irradiated food, and (b) for quarantine inspection (to certify that the agricultural product has been irradiated, and the pests present in it do not pose a quarantine risk). Results presented in this paper indicate that the germination test is not always capable of discriminating satisfactorily between irradiated and unirradiated samples of bean seeds, because the sensitivity of the test is often higher than the low doses which are suggested for disinfestation purposes. However, using the germination test, an unexperienced person can easily discriminate untreated bean seeds from those irradiated with 0.3-1.5 kGy doses of gamma radiation. (orig./vhe)

  13. Evaluation of essential minerals in carioquinha beans by EDXRF

    International Nuclear Information System (INIS)

    In this study, the levels of essential minerals in the carioquinha beans were analyzed by Energy Dispersive X-ray Fluorescence technique (EDXRF), searching determine the possible minerals, quantities and the correlation among different sources of same variety and the possible contribution of each to the human diet

  14. Microbiological safety of kinema: a fermented soya bean food.

    NARCIS (Netherlands)

    Nout, M.J.R.; Bakshi, D.; Sarkar, P.K.

    1998-01-01

    Kinema is a fermented soya bean food of Nepal and the hilly regions of Northeastern States of India. Generally, the fermentation is dominated by Bacillus spp. that often cause alkalinity and desirable stickiness in the product. The present study was undertaken in a limited number of commercial (mark

  15. Allelopathic potential of a noxious weed on mung bean

    Directory of Open Access Journals (Sweden)

    Parthapratim Maiti

    2013-10-01

    Full Text Available Eupatorium odoratum have invaded the waste lands of South West Bengal, India. A field study indicated a gradual and also significant increase in Eupatorium odoratum accompanied with significant decrease in other coexisting species. Considering the above in mind, a study was undertaken to evaluate the existence of inhibitory effect of leaf extracts and leaf leachates noxious weed Eupatorium odoratum using fully viable seeds of mung bean (Vigna radiata as the bioassay material. The study showed the reduced the percentage germination and TTC stainability along with extended T50 values of mung bean seeds. The levels of protein, DNA and RNA, activities of dehydrogenase and catalase enzymes were significantly retarded in pretreated seed samples. Amino acid and sugar levels were increased in the leachates of seeds pretreated with leaf extracts and leaf leachates. Thus, from the overall results it can be concluded that various inhibitors present in E. odoratum can impart strong inhibitory effect on mung bean. The study suggests that the leaves of E. odoratum possess phytotoxic or allelopathic chemicals which potentially rendered the inhibitory action on mung bean seeds.

  16. Detection of radiation treatment of beans using DNA comet assay

    International Nuclear Information System (INIS)

    A simple technique of microgel electrophoresis of single cells (DNA Comet Assay) enabled a quick detection of radiation treatment of several kinds of leguminous beans (azuki, black, black eye, mung, pinto, red kidney and white beans). Each variety was exposed to radiation doses of 0.5, 1 and 5 kGy covering the permissible limits for insect disinfestation. The cells or nuclei from beans were extracted in cold PBS, embedded in agarose on microscope slides, lysed between 15 and 60 min in 2.5% SDS and electrophoresis was carried out at a voltage of 2 V/cm for 2-2.5 min. After silver staining, the slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA stretched towards the anode and the damaged cells appeared as a comet. The density of DNA in the tails increased with increasing radiation dose. However, in non-irradiated samples, the large molecules of DNA remained relatively intact and there was only minor or no migration of DNA; the cells were round or had very short tails only. Hence, the DNA comet assay provides an inexpensive, rapid and relatively simple screening method for the detection of irradiated beans

  17. Detection of radiation treatment of beans using DNA comet assay

    Science.gov (United States)

    Khan, Ashfaq A.; Khan, Hasan M.; Delincée, Henry

    2002-03-01

    A simple technique of microgel electrophoresis of single cells (DNA Comet Assay) enabled a quick detection of radiation treatment of several kinds of leguminous beans (azuki, black, black eye, mung, pinto, red kidney and white beans). Each variety was exposed to radiation doses of 0.5, 1 and 5kGy covering the permissible limits for insect disinfestation. The cells or nuclei from beans were extracted in cold PBS, embedded in agarose on microscope slides, lysed between 15 and 60min in 2.5% SDS and electrophoresis was carried out at a voltage of 2V/cm for 2-2.5min. After silver staining, the slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA stretched towards the anode and the damaged cells appeared as a comet. The density of DNA in the tails increased with increasing radiation dose. However, in non-irradiated samples, the large molecules of DNA remained relatively intact and there was only minor or no migration of DNA; the cells were round or had very short tails only. Hence, the DNA comet assay provides an inexpensive, rapid and relatively simple screening method for the detection of irradiated beans.

  18. Uptake studies of environmentally hazardous 51Cr in Mung beans

    International Nuclear Information System (INIS)

    Attempt has been made to study the accumulation behaviour of a common plant, Mung bean (Vigna radiata) towards Cr(III) and Cr(VI) to have an insight on the migration and bio-magnification of Cr. For this purpose healthy germinated Mung bean seeds were sown in the sand in the presence of Hoagland's nutrient solution containing measured amount of K251Cr2O7 and 51Cr(NO3)3.9H2O. Growth rate was also studied in the presence and absence of phosphate salts in the medium. It has been found that the transfer of chromium from soil to plant is significantly low (maximum 5% for both Cr(III) and Cr(VI)). Maximum accumulation of Cr occurs in the root with respect to the total chromium accumulation by the plant. Other parts of the Mung bean plant, e.g. cotyledons, shoot and leaves, show negligible accumulation. Therefore, the chance of direct intake of Cr through food as well as through the grazing animals to human body is less. - The chance of bio-magnification of Cr(III) or Cr(VI) to human body via direct or indirect intake of Mung bean is negligible

  19. Phenolic compound in beans as protection against mycotoxins.

    Science.gov (United States)

    Telles, Annie Campello; Kupski, Larine; Furlong, Eliana Badiale

    2017-01-01

    Phenolic compounds, their inhibitory activity against fungal amylase and the occurrence of aflatoxins were determined in edible beans. The free, conjugated and bounded phenolic compounds and their phenolic acid profiles were determined in ten bean varieties. A method for aflatoxin B1, B2, G1 and G2 determination and confirmation by LC-MS/MS was validated. The red and carioca beans presented the highest total phenolic content (1.8 and 1.2mg.g(-1), respectively); the fradinho and white beans the lowest (0.18 and 0.19mg.g(-1), respectively). In the free and conjugated forms, chlorogenic acid was present in 60% of the samples, while in the bounded phenolic, ferulic acid was in 90% of the samples. The phenolic extracts were able to inhibit fungal amylase, and the PCA analysis confirmed that the relation between the chlorogenic and gallic acids is important to this effect. The absence of aflatoxins in samples confirm the protector effects of these phenolic compounds. PMID:27507478

  20. Utilization of half-embryo test to identify irradiated beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Mancini-Filho, Jorge [Sao Paulo Univ., SP (Brazil). Faculdade de Ciencias Farmaceuticas; Delincee, Henry [Federal Research Centre for Nutrition - BFE, Karlsruhe (Germany)

    1996-07-01

    Germination tests were carried out in irradiated and non-irradiated bean seeds which allow to observe characteristically variations on the shoots and roots. The methodology used in this work, is based upon biological changes which occur in two Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macacar, irradiated in a {sup 60} Co source, with doses of 0,0.5, 1.0, 2.5, 5.0 and 10.0 kGy. The shoots and roots were observed during 3 days of culturing period under specified conditions. The differences observed in these two varieties were analysed immediately after irradiation and after 6 months of storage period at room temperature. Irradiated half-embryos showed markedly reduced root grow and almost totally retarded shoot elongation. Differences between irradiated and nonirradiated half-embryo could be observed after irradiation when different beans and storage time were varied. The shoots of half-embryos irradiated with more than 2.5 kGy did not undergo any elongation, whereas, the shoots of non-irradiated or those beans irradiated under 1.0 kGy elongated significantly within the 3 day test period. (author)

  1. Performance Evaluation of Rotating Cylinder Type Coffee Bean Roaster

    Directory of Open Access Journals (Sweden)

    Sutarsi

    2010-04-01

    Full Text Available One strategy attempts to reduce dependence on primary commodity markets are overseas market expansion and development of secondary products. In the secondary product processing coffee beans is required of supporting equipment to facilitate these efforts. Research Center for Indonesian Coffee and Cocoa has developed coffee bean roaster. However, there are still many people who do not know about the technical aspects of roaster machine type of rotating cylinder so that more people use traditional ways to roast coffee beans. In order for the benefits of this machine is better known society it is necessary to study on the technical aspects. The purpose of this research is to evaluate the technical performance of the coffee beans roaster machine type of rotating cylinder. These include the technical aspects of work capacity of the machine, roasting technical efficiency, fuel requirements, and power requirements of using roaster machine. Research methods are including data collection, calculation and analysis. The results showed that the roaster machine type of a rotating cylinder has capacity of 12.3 kg/hour. Roasting efficiency is 80%. Fuel consumption is 0.6 kg. The calculated amount of the used power of current measurement is the average of 0.616 kW.

  2. 21 CFR 184.1343 - Locust (carob) bean gum.

    Science.gov (United States)

    2010-04-01

    ... ingredient meets the specifications of the “Food Chemicals Codex,” 3d Ed. (1981), pp. 174-175, which is... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Locust (carob) bean gum. 184.1343 Section 184.1343 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED)...

  3. Diversity for cooking time in Andean dry bean

    Science.gov (United States)

    A diversity panel of 250 dry bean lines from the Andean gene pool was evaluated for cooking time. Cooking time ranged from 17 to 90 min with an average of 36 min. A faster cooking time was also correlated with a number of other seed characteristics, most notably, higher levels of boron and potassium...

  4. Studies on interference between newly defined bean-infecting potyviruses.

    NARCIS (Netherlands)

    Khan, J.A.

    1993-01-01

    Bean common mosaic virus (BCMV) and blackeye cowpea mosaic virus (BICMV) belonging to the genus Potyvirus of the plant virus family Potyviridae (Barnett, 1991, 1992) are of great economic importance. A large number of strains of BCMV and BlCMV are found to occur in nature, either in single or in mix

  5. Effect of Robusta coffee beans ointment on full thickness wound healing

    Directory of Open Access Journals (Sweden)

    Yorinta Putri Kenisa

    2012-03-01

    Full Text Available Background: Traumatic lesions, whether chemical, physical, or thermal in nature, are among the most common lesion in the mouth. Wound healing is essential for the maintenance of normal structure, function, and survival of organisms. Experiments of Robusta coffee powder on rat-induced alloxan incision wound, clinically demonstrated similar healing rate with the povidone iodine 10%. No studies that look directly the effect of coffee extract in ointment form when viewed in terms of histopathology. Robusta coffee bean (Coffea canephora consists of chlorogenic acid (CGA and caffeic acid which are belived to act as antioxidant and take part in wound healing process. Purpose: The aim of this study was to identify the enhancement of healing process of full-thickness skin wound after Robusta coffee beans extract ointment application. Methods: Sample consisted of 20 Cavia cabaya treated with full-thickness with wounds and was given Robusta coffee beans extract ointment concentration range of 22.5%, 45%, and 90% except the control group which was given ointment base material. Animals were then harvested on the fourth day and made for histopathological preparations. Data were calculated and compared by one-way ANOVA test and LSD test. Results: The study showed that Robusta coffee bean extract ointment can increase the number of lymphocytes, plasma cells, macrophages, fibroblasts, and blood vessels by the presence of chlorogenic acid (CGA and Caffeic acid. Conclusion: In conclusion Robusta coffee bean extract ointment enhance the healing process of fullthickness skin wound of Cavia cabaya.Latar belakang: Lesi traumatik, baik akibat rangsang kimia, fisik, atau termal, merupakan lesi yang paling umum terjadi di dalam rongga mulut. Penyembuhan luka yang terjadi ini penting untuk pemeliharaan struktur normal, fungsi, dan kelangsungan hidup organisme. Percobaan pemberian bubuk kopi Robusta terhadap luka sayatan pada tikus yang diinduksi aloksan, secara klinis

  6. Extracellular DNA metabolism in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    ScottChimileski

    2014-02-01

    Full Text Available Extracellular DNA is found in all environments and is a dynamic component of the micro-bial ecosystem. Microbial cells produce and interact with extracellular DNA through many endogenous mechanisms. Extracellular DNA is processed and internalized for use as genetic information and as a major source of macronutrients, and plays several key roles within prokaryotic biofilms. Hypersaline sites contain some of the highest extracellular DNA con-centrations measured in nature–a potential rich source of carbon, nitrogen and phosphorus for halophilic microorganisms. We conducted DNA growth studies for the halophilic archaeon Haloferax volcanii DS2 and show that this model Halobacteriales strain is capable of using exogenous double-stranded DNA as a nutrient. Further experiments with varying medium composition, DNA concentration and DNA types revealed that DNA is utilized primarily as a phosphorus source, that growth on DNA is concentration-dependent and that DNA isolated from different sources is metabolized selectively, with a bias against highly divergent methylated DNA sources. Additionally, fluorescence microscopy experiments showed that labeled DNA colocalized with Haloferax volcanii cells. The gene Hvo_1477 was also identified using a comparative genomic approach as a factor likely to be involved in extracellular DNA processing at the cell surface, and deletion of Hvo_1477 created an H. volcanii strain deficient in its ability to grow on extracellular DNA. Widespread distribution of Hvo_1477 homologs in archaea suggests metabolism of extracellular DNA may be of broad ecological and physiological relevance in this domain of life.

  7. WATER NEEDS FOR WINTER BEAN CROP

    Directory of Open Access Journals (Sweden)

    A.E. Klar

    1997-09-01

    Full Text Available A study of water use by bean winter crop (Phaseolus vulgaris, L., cv. Carioca was carried out in a Red Yellow Latosol, clay texture. A furrow irrigation system maintained soil water potentials higher than -40 KPa. Two broadcast nitrogen treatments (0 and 30 kg N/ha were applied 25 days after planting. The major objectives were to study the nitrogen and evapotranspiration interaction and measure the crop coefficients (Kc. The maximum average evapotranspiration (ETm was 1.71 mm/day, or 157.16 mm over 92 days of observations; the ETm values for the vegetative (1, flowering (2 and pod formation (3 phases were 1.48, 2.35, and 1.50 mm/day, respectively, for the 30 kg/ha nitrogen treatment, and 1.48, 1.88 and 1.45 mm/day for the no nitrogen treatment. The crop coefficients (Kc = ETm / ETo were 0.62 and 0.78 for the phase 1, 0.80 and 1.10 for the phase 2, 0.45 and 0.55 for the phase 3 and 0.61 and 0.80 for the entire cycle, based on the FAO-Penman and Class A Pan reference methods (ETo, respectively. The latter one was the best approach to estimate maximum water use by winter bean crop. Nitrogen treatments did not affect evapotranspiration significantly. However, the measured evapotranspiration obtained from the water balance method was 59.78 and 27.12% higher in the flowering than in the vegetative phase, respectively, under 30 and 0 kg N/ha.Um estudo sobre o uso de água do feijoeiro de inverno (Phaseolus vulgaris L. cv. Carioca foi realizado num solo Latossol Vermelho Amarelo de textura argilosa. Um sistema de sulcos de infiltração foi usado para proceder a irrigação com o intuito de manter o solo em potenciais de água superiores a -40,0 KPa. Duas doses de aplicação de N em cobertura (0 a 30 Kg N/ha foram colocados 25 dias após o plantio. Os principais objetivos do estudo foram: avaliar a interação entre as duas doses de N com a evapotranspiração e medir os coeficientes de cultura (Kc. A evapotranspiração média máxima (ETm foi 1,71 mm

  8. Nutritional composition and cooking characteristics of tepary bean (Phaseolus acutifolius Gray) in comparison with common bean (Phaseolus vulgaris L.)

    Science.gov (United States)

    Tepary bean is a highly abiotic stress tolerant orphan crop, however, there has been limited research on its nutritional value and cooking characteristics, key aspects when considering the potential for broader adoption globally. The goal of this study was to evaluate a large set of seed composition...

  9. AGRICULTURAL PRACTICES, MORPHOLOGIC, PROTEINIC AND CULINARY DESCRIPTION OF THE GRAIN OF BEAN CULTIVARS SOWED IN THE REGION OF TLATZALA, GUERRERO

    Directory of Open Access Journals (Sweden)

    Fausto Solano Cervantes

    2009-08-01

    Full Text Available The research had for object describe the productive process of the of bean culture in the community of Tlatzala, Guerrero and the species diversity by means of the morphologic characteristics of the grain, protein content and the culinary quality. 30 questionnaires were applied to bean producers and 20 varieties of bean were collected from which the morphologic characters of the grain, protein content and the culinary characters were obtained. The production cycle of bean initiates in May and finishes in October. The technology used is traditional, characterized by the use of the yoke in the labors of the culture that demands workforce to realize the activities of manual form. The biological cycle of the varieties begins in June, the variation at time is determinated for the cultivated genotype. The determinate or indeterminate bush beans are predominant (65 %. The sowing systems are intercalated (50 % and associated with maize (30 % and monoculture (20 %. The varieties Rojito and Blanco have special uses, the first one has the attribute of being consumed as green-bean all the year around and the second one is used to prepare the dish called Chile-ajo. The Black beans were the most frequent (45 % followed by the Red beans (35 % and the least frequent were the Striped one (5 % and Muddy-like (5 %. The kidney shape of grain was the most abundant (85 % and the oval one was the least frequent (5 %. The grain weight changed from 14.4 up to 38.5 g. The sizes of grains founded were medium (50 % and small (50 %. The protein content registered was: White beans 24.68 %, Red bean 24.64 %, Black beans 23.5 % and Striped beans of guide 22.27 %. The Rojito Enano had the major protein content (27.6 %. The cooking times were: Red beans 73 minutes, Striped of guide bean 65.5, Blacks bean 64.6 and Whites bean 59. The Black bean Enano-1 used less time (54 minutes. The Striped of guide bean registered the major amount of solid (0.32 %, followed by the Black beans

  10. Export and Competitiveness of Indonesian Coffee Bean in International Market: Strategic Implication for the Development of Organic Coffee Bean

    Directory of Open Access Journals (Sweden)

    Bambang Drajat

    2007-07-01

    Full Text Available The performance of Indonesian coffee bean export from 1995 to 2004was not satisfactory. This implied that there were problems of the competitiveness of Indonesian coffee bean export. This study was expected to come up withsome views related with the problem. This study was aimed to analyze the competitiveness of Indonesian coffee bean export in international markets. Somepolicy implication would be derived following the conclusions. In addition,this study was aimed to deliver some arguments referring to organic coffee development as an alternative export development. Data used in this study wastime series data ranging from 1995 to 2004 supported with some primary data.The export data were analyzed descriptively and the Revealed ComparativeAdvantage (RCA Index employed to analyze the competitiveness of Indonesian coffee bean export. The results of the analysis gave some conclusions, asfollows : (1 The export of Indonesian coffee bean was product oriented notmarket oriented. (2 The Indonesian coffee bean export was characterized withlow quality with no premium price, different from that of Vietnam coffee export. (3 Besides quality, the uncompetitive Indonesian coffee export was related to market hegemony by buyers, emerging issue of Ochratoxin A. contamination and high cost economy in export. (4 The competitiveness of Indonesian coffee export was lower than those other countries, such as Columbia,Honduras, Peru, Brazil, and Vietnam. (5 Indonesia still held opportunity todevelop organic coffee for export. Some policy implications emerged from thediscussion were as follows : (1 The Government should facilitate market development through the provisions of market information and export incentives.(2 The Government should develop and applied national standard of coffeebean referring to that of international, as well as, improve processing technology equipments in the farm level for both wet and dry process. (3 Besides improving quality, the improvement

  11. Role of extracellular exopolymers on biological phosphorus removal

    Institute of Scientific and Technical Information of China (English)

    LIU Ya-nan; XUE Gang; YU Shui-li; ZHAO Fang-bo

    2006-01-01

    Three sequencing batch reactors supplied with different carbon sources were investigated. The system supplied with glucose gained the best enhanced biological phosphorus removal although all of the three reactors were seeded from the same sludge. With the measurement of poly-β-hydroxyalkanoate (PHA) concentration, phosphorus content in sludge and extracellular exopolymers (EPS) with scanning electron microscopy (SEM) combined with energy dispersive spectrometry (EDS), it was found that the biosorption effect of EPS played an important role in phosphorus removal and that the amount of PHA at the end of anaerobic phase was not the only key factor to determine the following phosphorus removal efficiency.

  12. Gene expression in gut symbiotic organ of stinkbug affected by extracellular bacterial symbiont.

    Directory of Open Access Journals (Sweden)

    Ryo Futahashi

    Full Text Available The bean bug Riptortus pedestris possesses a specialized symbiotic organ in a posterior region of the midgut, where numerous crypts harbor extracellular betaproteobacterial symbionts of the genus Burkholderia. Second instar nymphs orally acquire the symbiont from the environment, and the symbiont infection benefits the host by facilitating growth and by occasionally conferring insecticide resistance. Here we performed comparative transcriptomic analyses of insect genes expressed in symbiotic and non-symbiotic regions of the midgut dissected from Burkholderia-infected and uninfected R. pedestris. Expression sequence tag analysis of cDNA libraries and quantitative reverse transcription PCR identified a number of insect genes expressed in symbiosis- or aposymbiosis-associated patterns. For example, genes up-regulated in symbiotic relative to aposymbiotic individuals, including many cysteine-rich secreted protein genes and many cathepsin protease genes, are likely to play a role in regulating the symbiosis. Conversely, genes up-regulated in aposymbiotic relative to symbiotic individuals, including a chicken-type lysozyme gene and a defensin-like protein gene, are possibly involved in regulation of non-symbiotic bacterial infections. Our study presents the first transcriptomic data on gut symbiotic organ of a stinkbug, which provides initial clues to understanding of molecular mechanisms underlying the insect-bacterium gut symbiosis and sheds light on several intriguing commonalities between endocellular and extracellular symbiotic associations.

  13. Phenotypic Variability and Diversity Analysis of Bean Traits of Some Cocoa Hybrids in Nigeria

    Directory of Open Access Journals (Sweden)

    A.V. Oyedokun

    2011-03-01

    Full Text Available It is essential to understand the economic potential and superiority among cocoa hybrids. Therefore, the present study aims at detecting variability among cocoa hybrids for bean index in Nigeria. Dried bean of fourteen genotypes of cocoa were evaluated for their bean values. Analysis of variance (ANOVA was used to understand the variability among the fourteen genotypes and Principal Component Analysis (PCA was employed to identify distinguishing traits and the grouping of the genotypes based on similarities. The fourteen cocoa genotypes were significantly (p≤0.05 different from each other with respect to weight of one bean, bean length, width, thickness, 100 bean weight, bean length to width, length to thickness and width to thickness ratio. All the studied morphometric characters exhibited high (>70% broad sense heritability. G8, the hybrid between T53/5 and N38 was the most superior genotype for bean weight and some other bean characteristics. The mass of seventy-four dried cocoa bean of G8 approximated 100 g. The first three Principal Component axes explained 91% of the total variation and the PCA grouped the fourteen genotypes into four distinct clusters. Genotypes could be selected for specific traits and improvement of traits seemed to be genetically reliable.

  14. Influence of the environment in 40K concentration in Brazilian common beans

    International Nuclear Information System (INIS)

    The consumption of beans constitutes an important dietary habit in many Latin American, Asian and African countries. Carioca beans and the black type stand out among the many consumed common beans in Brazil. 40K was used as a natural radiotracer to evaluate the influence of the season growing and the bean type in the potassium content into grain. The activity concentrations of 40K and 137Cs were evaluated on samples of beans by γ-ray spectrometry. 137Cs was less than 1.3 Bq kg-1. The highest potassium content in the grain were observed in the dry and winter seasons. The black beans showed higher potassium content than the carioca type. The potassium levels were compared with that of beans grown and consumed in other regions of the world. A method to estimate the bean consumption rates in Brazil independently of the location of the meal is proposed. The ingestion of common beans was estimated in 14.6 kg year-1 per person. The two regions with the highest consumption are the Southeast (19.2 kg year-1) and the Middle West (18.7 kg year-1), whose account for about 60 % of the intake of common beans is related to consumption out home. (author)

  15. Effect of Botrytis cinerea infection and elicitation on ß-1,3-glucanase and chitinase activity in bean leaves and cell cultures

    OpenAIRE

    Elżbieta Kuźniak; Henryk Urbanek; Aneta Michalak; Katarzyna Herka

    2013-01-01

    The activity of ß-1,3-glucanase and chitinase in bean plants treated with B. cinerea products or/and infected and in cell cultures after application of fungal products has been studied. Botrytis cinerea infection and culture filtrates, ethanol precipitates, glucan and conidial extract treatment markedly enhanced the activity of both hydrolases. Cell cultures treated with B.cinerea products reacted similarly to intact plants. In plants pretreated with 2-day culture filtrate and conidial extrac...

  16. APPLICATION OF PLANT GROWTH-PROMOTING RHIZOBACTERIA TO RUNNER BEAN INCREASES SEED CARBOHYDRATE AND PROTEIN YIELD

    Directory of Open Access Journals (Sweden)

    Marius Stefan

    2013-08-01

    Full Text Available The potential of two rhizobacterial strains with plant growth promoting capabilities (mineral phosphate solubilization and IAA production traits to influence the nutritive value of runner bean grains was assessed on plants cultivated in organic crop system. Seed inoculation with rhizobacterial strains improve the nutritive value of the harvested grains by enhancing the soluble protein content up to 11.97 % and total reducing carbohydrates content up to 28.97%. The number of fractions detected by SDS-PAGE analysis in the all extracts was around 20, without any significant differences between the control and the inoculated samples. Our study suggests that the two PGPR strains may be used as biofertilizer for vegetable production in sustainable and ecological agricultural systems.

  17. COMBINED EFFECTS OF PLANT GROWTH PROMOTING RHIZOBACTERIA AND FUNGI ON MUNG BEAN (VIGNA RADIATA L.

    Directory of Open Access Journals (Sweden)

    Ravi Kumar Gangwar, Gaurav Bhushan Jaspal Singh *, Sudhir K. Upadhyay and A.P. Singh

    2013-11-01

    Full Text Available In the present study, screened PGPR and Fungi were influence the growth of Mung bean (Vigna radiata plant in the pot. Two rhizobacteria viz. Rhizobium sp., Pseudomonas putida and three fungi Aspergillus niger, Rhizopus sp. and Trichoderma viride were isolated and purified. The effect of inoculation of different strains of bacteria and fungus on growth responses of Vigna radiata under pot condition was enumerated. The result revealed that the single and dual inoculation of these microbial strains enhances the plant growth in terms of root and shoot length and dry-biomass. The maximum increase in root length (up to 86.57%, shoot length (up to 56.91%, root dry weight (up to 94.42%, and shoot dry weight (up to 56.09% was observed in response to dual inoculation of Pseudomonas putida with Trichoderma viride compared to uninoculated control.

  18. Alternative methods for characterization of extracellular vesicles

    Directory of Open Access Journals (Sweden)

    Fatemeh eMomen-Heravi

    2012-09-01

    Full Text Available Extracellular vesicles are nano-sized vesicles released by all cells in vitro as well as in vivo. Their role has been implicated mainly in cell-cell communication, but also in disease biomarkers and more recently in gene delivery. They represent a snapshot of the cell status at the moment of release and carry bioreactive macromolecules such as nucleic acids, proteins and lipids. A major limitation in this emerging new field is the availability/awareness of techniques to isolate and properly characterize Extracellular vesicles. The lack of gold standards makes comparing different studies very difficult and may potentially hinder some Extracellular vesicles -specific evidence. Characterization of Extracellular vesicles has also recently seen many advances with the use of Nanoparticle Tracking Analysis (NTA, flow cytometry, cryo-EM instruments and proteomic technologies. In this review, we discuss the latest developments in translational technologies involving characterization methods including the facts in their support and the challenges they face.

  19. Ciliary extracellular vesicles: Txt msg orgnlls

    OpenAIRE

    WANG, Juan; Barr, Maureen M.

    2016-01-01

    Cilia are sensory organelles that protrude from cell surfaces to monitor the surrounding environment. In addition to its role as sensory receiver, the cilium also releases extracellular vesicles (EVs). The release of sub-micron sized EVs is a conserved form of intercellular communication used by all three kingdoms of life. These extracellular organelles play important roles in both short and long range signaling between donor and target cells and may coordinate systemic responses within an or...

  20. Optical ATP Biosensor for Extracellular ATP Measurement

    OpenAIRE

    Wang, C; Huang, C.-Y.C.; Lin, W-C

    2013-01-01

    Extracellular Adenosine-5′-triphosphate (ATP) is an important multi-functional molecule which can mediate numerous physiological activities by activating purinergic P2 receptors. The objective of this study was to develop a novel optical ATP sensor for in-situ extracellular ATP measurement in biological tissues. The optical ATP sensor was made by applying two layers of sol-gel coating to the end of an optical fiber probe end. The first layer contained ruthenium complex for sensing changes in ...

  1. Extracellular acid proteases produced by Saccharomycopsis lipolytica.

    OpenAIRE

    T. Yamada; Ogrydziak, D M

    1983-01-01

    Saccharomycopsis lipolytica CX161-1B produced at least three extracellular acid proteases during exponential growth in medium containing glycerol, Difco Proteose Peptone, and mineral salts at pH 3.4 (Difco Laboratories, Detroit, Mich.). Little extracellular acid protease activity was produced with glutamic acid as the sole nitrogen source, somewhat higher levels were obtained with peptone, and much higher levels were obtained with Difco Proteose Peptone. The relative amounts of the three prot...

  2. Role of extracellular adenosine in Drosophila

    OpenAIRE

    FENCKOVÁ, Michaela

    2011-01-01

    This thesis describes several aspects of the role for extracellular adenosine in Drosophila. Reverse genetic, molecular and microscopic methods together with the most forefront Drosophila research techniques have been applied to elucidate the role of adenosine signaling in the regulation of development, physiology and metabolism of Drosophila larvae. The thesis helps to establish the model for extracellular adenosine as a stress-signal for the release of energy stores. It also describes the e...

  3. Changes of sour taste and the composition of carboxylic acids induced in brewed coffee by γ-irradiation on green beans and storage of roast beans

    International Nuclear Information System (INIS)

    Brazil santos green coffee beans were irradiated with 60Co-γ rays at doses of 0, 0.05, 0.5 and 1.5 Mrad respectively and changes of the composition of carboxylic acids in roast beans were analyzed by means of GLC together with those of the organoleptic properties of roast beans during storage by use of the cup testing. The total acid content immediately after roasting was about 6,000 mg/100 g (roast beans) and the composition of carboxylic acids was as follows. Chlorogenic acid: hydroxy-carboxylic acids: mono-carboxylic acid: others = 73 : 18 : 7 : 2. Fresh coffee flavour was influenced markedly especially in acid taste by both irradiation of γ-rays on green beans and storage of roast beans, because of the change of above acids composition. On γ-ray irradiation, the change of the acid composition were more clear than that of stored roast beans. Therefore, the quality of γ-irradiated coffee beans seems to be closely associated with the ratio of hydroxy-carboxylic acids mg/ monocarboxylic acids mg, but little with total acid content. (author)

  4. Interactions Between QTL SAP6 and SU91 on Resistance to Common Bacterial Blight in Red Kidney Bean and Pinto Bean Populations

    Science.gov (United States)

    Resistance to common bacterial blight in common bean is a complex trait that is quantitatively inherited. We examined the interaction between two independent QTL, SAP6 and SU91, which condition resistance to CBB.The QTL were studied in a pinto bean F2 population a cross between Othello (sap6 sap6 //...

  5. Distinction of Ecuadorian varieties of fermented cocoa beans using Raman spectroscopy.

    Science.gov (United States)

    Vargas Jentzsch, Paul; Ciobotă, Valerian; Salinas, Wilson; Kampe, Bernd; Aponte, Pedro M; Rösch, Petra; Popp, Jürgen; Ramos, Luis A

    2016-11-15

    Cocoa (Theobroma cacao) is a crop of economic importance. In Ecuador, there are two predominant cocoa varieties: National and CCN-51. The National variety is the most demanded, since its cocoa beans are used to produce the finest chocolates. Raman measurements of fermented, dried and unpeeled cocoa beans were performed using a handheld spectrometer. Samples of the National and CCN-51 varieties were collected from different provinces and studied in this work. For each sample, 25 cocoa beans were considered and each bean was measured at 4 different spots. The most important Raman features of the spectra were assigned and discussed. The spectroscopic data were processed using chemometrics, resulting in a distinction of varieties with 91.8% of total accuracy. Differences in the average Raman spectra of cocoa beans from different sites but within the same variety can be attributed to environmental factors affecting the cocoa beans during the fermentation and drying processes. PMID:27283632

  6. Use of BABA and INA As Activators of a Primed State in the Common Bean (Phaseolus vulgaris L.)

    Science.gov (United States)

    Martínez-Aguilar, Keren; Ramírez-Carrasco, Gabriela; Hernández-Chávez, José Luis; Barraza, Aarón; Alvarez-Venegas, Raúl

    2016-01-01

    To survive in adverse conditions, plants have evolved complex mechanisms that “prime” their defense system to respond and adapt to stresses. Their competence to respond to such stresses fundamentally depends on its capacity to modulate the transcriptome rapidly and specifically. Thus, chromatin dynamics is a mechanism linked to transcriptional regulation and enhanced defense in plants. For example, in Arabidopsis, priming of the SA-dependent defense pathway is linked to histone lysine methylation. Such modifications could create a memory of the primary infection that is associated with an amplified gene response upon exposure to a second stress-stimulus. In addition, the priming status of a plant for induced resistance can be inherited to its offspring. However, analyses on the molecular mechanisms of generational and transgenerational priming in the common bean (Phaseolus vulagris L.), an economically important crop, are absent. Here, we provide evidence that resistance to P. syringae pv. phaseolicola infection was induced in the common bean with the synthetic priming activators BABA and INA. Resistance was assessed by evaluating symptom appearance, pathogen accumulation, changes in gene expression of defense genes, as well as changes in the H3K4me3 and H3K36me3 marks at the promoter-exon regions of defense-associated genes. We conclude that defense priming in the common bean occurred in response to BABA and INA and that these synthetic activators primed distinct genes for enhanced disease resistance. We hope that an understanding of the molecular changes leading to defense priming and pathogen resistance will provide valuable knowledge for producing disease-resistant crop varieties by exposing parental plants to priming activators, as well as to the development of novel plant protection chemicals that stimulate the plant's inherent disease resistance mechanisms. PMID:27242854

  7. Use of BABA and INA As Activators of a Primed State in the Common Bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Martínez-Aguilar, Keren; Ramírez-Carrasco, Gabriela; Hernández-Chávez, José Luis; Barraza, Aarón; Alvarez-Venegas, Raúl

    2016-01-01

    To survive in adverse conditions, plants have evolved complex mechanisms that "prime" their defense system to respond and adapt to stresses. Their competence to respond to such stresses fundamentally depends on its capacity to modulate the transcriptome rapidly and specifically. Thus, chromatin dynamics is a mechanism linked to transcriptional regulation and enhanced defense in plants. For example, in Arabidopsis, priming of the SA-dependent defense pathway is linked to histone lysine methylation. Such modifications could create a memory of the primary infection that is associated with an amplified gene response upon exposure to a second stress-stimulus. In addition, the priming status of a plant for induced resistance can be inherited to its offspring. However, analyses on the molecular mechanisms of generational and transgenerational priming in the common bean (Phaseolus vulagris L.), an economically important crop, are absent. Here, we provide evidence that resistance to P. syringae pv. phaseolicola infection was induced in the common bean with the synthetic priming activators BABA and INA. Resistance was assessed by evaluating symptom appearance, pathogen accumulation, changes in gene expression of defense genes, as well as changes in the H3K4me3 and H3K36me3 marks at the promoter-exon regions of defense-associated genes. We conclude that defense priming in the common bean occurred in response to BABA and INA and that these synthetic activators primed distinct genes for enhanced disease resistance. We hope that an understanding of the molecular changes leading to defense priming and pathogen resistance will provide valuable knowledge for producing disease-resistant crop varieties by exposing parental plants to priming activators, as well as to the development of novel plant protection chemicals that stimulate the plant's inherent disease resistance mechanisms. PMID:27242854

  8. Total phenolic content, antioxidant and antimicrobial activities of stink bean (Parkia speciosa Hassk.) pod extracts

    OpenAIRE

    Suchanuch Wonghirundecha; Soottawat Benjakul; Punnanee Sumpavapol

    2014-01-01

    Parkia speciosa Hassk. is a stink bean known as “Sataw”. This bean is popular in the Southern part of Thailand and believed by the locals to have the medical properties. Stink bean pod, regarded as waste material, was reported to possess various biological activities. The aim of the present study was to investigate the total phenolic content, antioxidant and antimicrobial activities of Sataw-Khao and Sataw-Dan pod extracts. It was found that the extraction yield, total phenolic and ...

  9. Research on Development Strategy of Industry of Edible Beans in West China

    OpenAIRE

    Zhu, Zhou-ping; Xie, Song-feng; Li, Hai-ju; Zhou, Tao; Liu, Yun-hua; Zhang, Bao-jun

    2011-01-01

    The West China is main producing region and advantageous producing region of edible beans. Developing industry of edible beans in West China has prominent regional advantage, production advantage, quality advantage, market advantage, and price advantage. We analyze the problems existing in the process of development of industry of edible beans in West China as follows: the cognition is insufficient; fund for scientific research is short; the basic research is weak; the planting is sparse; the...

  10. Viruses of faba bean (Vicia faba L.) in Morocco; surveying, identification, and ecological aspects.

    OpenAIRE

    Fortass, M

    1993-01-01

    A systematic virus survey covering the main areas where faba bean ( Viciafaba L.) is grown in Morocco was conducted in 1988 and 1990. From the 240 leaf samples collected on the basis of symptoms suggestive of virus infection from 52 fields, the following viruses were detected by means of electron microscopy, biological indexing, and serology, and their incidence and geographical distribution were assessed: alfalfa mosaic virus (AMV), bean yellow mosaic virus (BYMV), broad bean mottle virus (B...

  11. Italian Common Bean Landraces: History, Genetic Diversity and Seed Quality

    Directory of Open Access Journals (Sweden)

    Angela R. Piergiovanni

    2010-05-01

    Full Text Available The long tradition of common bean cultivation in Italy has allowed the evolution of many landraces adapted to restricted areas. Nowadays, in response to market demands, old landraces are gradually being replaced by improved cultivars. However, landraces still survive in marginal areas of several Italian regions. Most of them appear severely endangered with risk of extinction due to the advanced age of the farmers and the socio-cultural context where they are cultivated. The present contribution is an overview of the state of the art about the knowledge of Italian common bean germplasm, describing the most important and recent progresses made in its characterization, including genetic diversity and nutritional aspects.

  12. ALIMENTARY ALLERGY AND HYPERSENSIVITY TO SOYA BEAN PROTEINS

    Directory of Open Access Journals (Sweden)

    V. B. Gervazieva

    2014-07-01

    Full Text Available Abstract. In connection with the increasing number of allergic diseases in Russia and in the world, the exogenic factor responsible for the development of food allergy in children have been discussed. The main types of alimentary allergens have been determined; their biochemical features, as well as aggravation of the food allergy clinical symptoms to the extent of anaphylaxis, have been reported. With the development of genetic engineering food products, the special attention has been paid to hypersensitivity to soya bean proteins. The major and minor allergens of soya beans, their homologues in other vegetable allergens, e.g. birch pollen allergens, have been described. (Med. Immunol., 2005, vol.7, № 1, pp. 15520

  13. Formaldehyde exposure affects growth and metabolism of common bean

    International Nuclear Information System (INIS)

    Recent state and federal directives have slated a substantial increase in the use of methanol as an alternative to gasoline in both fleet and private vehicles in the coming decade. The incomplete combustion of methanol produces formaldehyde vapor, and catalytic converter technology that completely oxidizes formaldehyde has yet to be developed. The approach of this study was to use a range of methanol concentrations encompassing levels currently found or that may occur in the future in the ambient air of some heavily polluted areas to test the potential phytotoxicity of formaldehyde. The study had the following objectives: (1) design and build a formaldehyde vapor generator with sufficient capacity for long-term plant fumigations; (2) determine growth response of common bean to formaldehyde; (3) evaluate physiological and biochemical changes of bean plants associated with formaldehyde exposures. 20 refs., 2 figs., 2 tabs

  14. BEANS - a software package for distributed Big Data analysis

    CERN Document Server

    Hypki, Arkadiusz

    2016-01-01

    BEANS software is a web based, easy to install and maintain, new tool to store and analyse data in a distributed way for a massive amount of data. It provides a clear interface for querying, filtering, aggregating, and plotting data from an arbitrary number of datasets. Its main purpose is to simplify the process of storing, examining and finding new relations in the so-called Big Data. Creation of BEANS software is an answer to the growing needs of the astronomical community to have a versatile tool to store, analyse and compare the complex astrophysical numerical simulations with observations (e.g. simulations of the Galaxy or star clusters with the Gaia archive). However, this software was built in a general form and it is ready to use in any other research field or open source software.

  15. Effects of Companion Crops (Bean, Soybean and Mungbean) on Uptake of Cadmium from Soil by Corn and Sunflower as the Main Crops

    OpenAIRE

    A. Hassanpour; M Zahedi; A. H. Khoshgoftarmanesh

    2014-01-01

    In a pot experiment, the effect of soybeans, mung beans and beans on the corn and sunflowers in a cadmium contaminated soil was studied in a completely randomized design with three replications. The treatments consisted of intercropping of corn and mung bean corn and beans, corn and soybean, sunflower and mung bean, sunflower and beans, sunflower and soybean monoculture of corn, and monoculture of sunflower. There were significant effects of cocropping of companion crops on shoot dry weigh, t...

  16. FLEXIBLE, RISK-ORIENTED MARKETING STRATEGIES FOR PINTO BEAN PRODUCERS

    OpenAIRE

    King, Robert P.; Lybecker, Donald W.

    1983-01-01

    A model designed to identify preferred postharvest marketing strategies for pinto bean producers is presented. The model evaluates flexible strategies that use current market information to determine whether or not storage should continue. Explicit consideration is given to price uncertainty and risk preferences. The results indicate that nearly all decision makers prefer flexible strategies to fixed strategies that call for a predetermined pattern of sales. They also show that the choice of ...

  17. Protein determination in soya bean by fast neutron activation analysis

    International Nuclear Information System (INIS)

    For a non-destructive determination of the protein content in soya bean samples, 14-MeV neutron activation analysis was applied. To check the method, the results obtained by X-ray fluorescence analysis and the Kjeldahl procedure were compared. For pressed pellet samples of about 1 g with 15 min irradiation and 10 min measuring times the accuracy of the protein determination was found to be 15%. (author) 7 refs.; 4 figs.; 3 tabs

  18. Co-application of herbicides and insecticides in dry bean

    OpenAIRE

    Peter H. Sikkema; Christy Shropshire; Robert E. Nurse; Nader Soltani

    2012-01-01

    Eight field trials were conducted from 2006 to 2008 at various locations in Ontario to evaluate the co-application of postemergence herbicides with cyhalothrin-lambda or dimethoate insecticides in cranberry and white bean. At 2 weeks after treatment, the addition of cyhalothrin-lambda or dimethoate insecticides to sethoxydim, quizalofop-p-ethyl, bentazon, fomesafen and bentazon plus fomesafen did not increase injury at the Exeter and Ridgetown locations except for bentazon plus dimethoate whi...

  19. Radiation disinfestation of dry leaf tobacco and coffee beans

    International Nuclear Information System (INIS)

    Preliminary tests conducted to determine the effect of gamma radiation in Araecerus fasciculatus De Geer indicated little differences in the mortality of insects exposed to 0.10-0.40 kGy. Other insects in the 2 kg bean lots were minimally affected by a dose of 0.05 kGy, but doses of 0.10-0.40 kGy resulted in nearly complete mortality. In 60 kg jute bags of export coffee exposed to 0.665-0.958 kGy, all the insects were dead when examined 1 month after irradiation. At 6 months, most of the untreated beans were damaged. In 15 kg tin cans, all the insects in both the irradiated and untreated cans were dead within 1 month; the insects in the untreated cans probably died from lack of oxygen and an increase in carbon dioxide. Irradiation had no detectable effect on the caffeine, fat and moisture contents, or on the pH. No moisture was gained by the coffee beans in cans, while the moisture in beans in jute bags increased from 9.6% to about 13.7% within 1 month. Export bales of leaf tobacco (about 100 kg, 100 cm x 75 cm x 40 cm) were artificially infested with Lasioderma serricorne (F.) and irradiated with 0.30-0.60 kGy at a rate of 0.5-1.0 kGy per hour. The bales were repositioned 12 times to provide thorough exposure to the gamma rays. There was no increase in the number of insects during the 6 months of storage; however, live insects were found at 2 months. Live insects found at the initial examination in phosphine fumigated bales indicated inadequate fumigation. A dose of 5 kGy had no effect on the nicotine content, the volatile oil content or composition, or the pH. (author). 11 refs, 3 figs, 10 tabs

  20. Two distinct nanovirus species infecting faba bean in Morocco.

    Science.gov (United States)

    Abraham, Adane D; Bencharki, Bouchaib; Torok, Valeria; Katul, Lina; Varrelmann, Mark; Josef Vetten, H

    2010-01-01

    Using monoclonal antibodies raised against a Faba bean necrotic yellows virus (FBNYV) isolate from Egypt and a Faba bean necrotic stunt virus (FBNSV) isolate from Ethiopia, a striking serological variability among nanovirus isolates from faba bean in Morocco was revealed. To obtain a better understanding of this nanovirus variability in Morocco, the entire genomes of two serologically contrasting isolates referred to as Mor5 and Mor23 were sequenced. The eight circular ssDNA components, each identified from Mor5- and Mor23-infected tissues and thought to form the complete nanovirus genome, ranged in size from 952 to 1,005 nt for Mor5 and from 980 to 1,004 nt for Mor23 and were structurally similar to previously described nanovirus DNAs. However, Mor5 and Mor23 differed from each other in overall nucleotide and amino acid sequences by 25 and 26%, respectively. Mor23 was most closely related to typical FBNYV isolates described earlier from Egypt and Syria, with which it shared a mean amino acid sequence identity of about 94%. On the other hand, Mor5 most closely resembled a FBNSV isolate from Ethiopia, with which it shared a mean amino acid sequence identity of approximately 89%. The serological and genetic differences observed for Mor5 and Mor23 were comparable to those observed earlier for FBNYV, FBNSV, and Milk vetch dwarf virus. Following the guidelines on nanovirus species demarcation, this suggests that Mor23 and Mor5 represent isolates of FBNYV and FBNSV, respectively. This is the first report not only on the presence of FBNSV in a country other than Ethiopia but also on the occurrence and complete genome sequences of members of two nanovirus species in the same country, thus providing evidence for faba bean crops being infected by members of two distinct nanovirus species in a restricted geographic area. PMID:20069400

  1. Microstructural Differences Among Adzuki Bean (Vigna Angularis) Cultivars

    OpenAIRE

    Engquist, Anup; Swanson, Barry G.

    1992-01-01

    Scanning electron microscopy (SEM) was used to study microstructural differences among five adzuki bean cultivars: Erimo, Express, Hatsune, Takara and VBSC. Seed coat surfaces showed different patterns of cracks, pits and deposits . Cross-sections of the seed coats revealed well organized layers of elongated palisade cells followed by many layers of amorphous parenchyma cells. Typical sub-epidermal layers of organized columnar, hour-glass cells were characteristica11y absent in the five culti...

  2. 力争第二的Coffee Bean

    Institute of Scientific and Technical Information of China (English)

    蔡正蓁

    2003-01-01

    一个小雨的午后,在新加坡繁华的Orchard大街上的连锁咖啡店“Coffee Bean & Tea Leaf”里,维克多·沙宣从他的座位上一跃而起,脱口而出:“下雨了,我得把屋顶打开。”短短几秒钟之内,在天井上方。

  3. Water infiltration in an ultisol after cultivation of common bean

    OpenAIRE

    Maria Aparecida do Nascimento dos Santos; Elói Panachuki; Teodorico Alves Sobrinho; Paulo Tarso Sanches de Oliveira; Dulce Buchala Bicca Rodrigues

    2014-01-01

    Water infiltration in the soil is an important hydrological process that occurs at the interface of the soil-atmosphere system; thus, the soil management practice used has a strong influence on this process. The aim of this study was to evaluate water infiltration in the soil and compare equations for estimating the water infiltration rate in an Ultisol after harvesting common bean (Phaseolus vulgaris L.) under simulated rainfall. Field tests with a rainfall simulator were carried out in thre...

  4. The cholesterol-raising factor from coffee beans.

    OpenAIRE

    Urgert, R.; Katan, M B

    1996-01-01

    Coffee beans and some types of coffee brew - not the regular types of coffee prepared with a paper filter or with soluble coffee granules - contain the diterpenes cafestol and kahweol. Cafestol and kahweol raise the serum concentration of cholesterol and triglycerides in humans, and they also appear mildly to affect the integrity of liver cells. Both effects are transient after withdrawal of the diterpenes, and it is as yet unsure whether these effects are associated. Patients at increased ri...

  5. Trichoderma spp. decrease Fusarium root rot in common bean

    Directory of Open Access Journals (Sweden)

    Hudson Teixeira

    2012-12-01

    Full Text Available The effectiveness of six Trichoderma-based commercial products (TCP in controlling Fusarium root rot (FRR in common bean was assessed under field conditions. Three TCP, used for seed treatment or applied in the furrow, increased seedling emergence as much as the fungicide fludioxonil. FRR incidence was not affected, but all TCP and fludioxonil reduced the disease severity, compared to control. Application of Trichoderma-based products was as effective as that of fludioxonil in FRR management.

  6. An extracellular subtilase switch for immune priming in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Vicente Ramírez

    Full Text Available In higher eukaryotes, induced resistance associates with acquisition of a priming state of the cells for a more effective activation of innate immunity; however, the nature of the components for mounting this type of immunological memory is not well known. We identified an extracellular subtilase from Arabidopsis, SBT3.3, the overexpression of which enhances innate immune responses while the loss of function compromises them. SBT3.3 expression initiates a durable autoinduction mechanism that promotes chromatin remodeling and activates a salicylic acid(SA-dependent mechanism of priming of defense genes for amplified response. Moreover, SBT3.3 expression-sensitized plants for enhanced expression of the OXI1 kinase gene and activation of MAP kinases following pathogen attack, providing additional clues for the regulation of immune priming by SBT3.3. Conversely, in sbt3.3 mutant plants pathogen-mediated induction of SA-related defense gene expression is drastically reduced and activation of MAP kinases inhibited. Moreover, chromatin remodeling of defense-related genes normally associated with activation of an immune priming response appear inhibited in sbt3.3 plants, further indicating the importance of the extracellular SBT3.3 subtilase in the establishment of immune priming. Our results also point to an epigenetic control in the regulation of plant immunity, since SBT3.3 is up-regulated and priming activated when epigenetic control is impeded. SBT3.3 represents a new regulator of primed immunity.

  7. The cocoa bean fermentation process: from ecosystem analysis to starter culture development.

    Science.gov (United States)

    De Vuyst, L; Weckx, S

    2016-07-01

    Cocoa bean fermentation is still a spontaneous curing process to facilitate drying of nongerminating cocoa beans by pulp removal as well as to stimulate colour and flavour development of fermented dry cocoa beans. As it is carried out on farm, cocoa bean fermentation is subjected to various agricultural and operational practices and hence fermented dry cocoa beans of variable quality are obtained. Spontaneous cocoa bean fermentations carried out with care for approximate four days are characterized by a succession of particular microbial activities of three groups of micro-organisms, namely yeasts, lactic acid bacteria (LAB) and acetic acid bacteria (AAB), which results in well-fermented fully brown cocoa beans. This has been shown through a plethora of studies, often using a multiphasic experimental approach. Selected strains of several of the prevailing microbial species have been tested in appropriate cocoa pulp simulation media to unravel their functional roles and interactions as well as in small plastic vessels containing fresh cocoa pulp-bean mass to evaluate their capacity to dominate the cocoa bean fermentation process. Various starter cultures have been proposed for successful fermentation, encompassing both cocoa-derived and cocoa nonspecific strains of (hybrid) yeasts, LAB and AAB, some of which have been implemented on farms successfully. PMID:26743883

  8. Tannins, trypsin inhibitors and lectin cytotoxicity in tepary (Phaseolus acutifolius) and common (Phaseolus vulgaris) beans.

    Science.gov (United States)

    De Mejia, Elvira Gonzalez; Del Carmen Valadez-Vega, Maria; Reynoso-Camacho, Rosalia; Loarca-Pina, Guadalupe

    2005-09-01

    This study compared the levels of antinutritional components and cytotoxic effect of extracts, from tepary (Phaseolus acutifolius) and common (Phaseolus vulgaris) beans. Antinutritional factors were evaluated by determining their effect on the viability of epithelial cells isolated from rat small intestine. The protein and carbohydrates content were similar in all the genotypes studied (20 and 60%, respectively). Common beans presented higher content of trypsin inhibitors, tannins and lectins than tepary beans. There was not a significant correlation between tannins and cooking time. However, water absorption and cooking time correlated significantly (p lectin activity (1302-18161 Ul/mg) of extracts from different beans. Tannins, lectins, trypsin inhibitors and fat content differed between bean varieties whereas protein content was similar. The percent cellularity on rat epithelial cells was significantly different among protein extracts from different bean cultivars and ranged between 53.5% and 87.4% (p < 0.05). These results suggest that the incorporation of tepary beans in the diet would not alter the current nutritional contribution of common beans or introduce adverse toxic effects. The agronomic characteristics of tepary beans make them attractive for cultivation. However, the harder to cook phenomenon may be a limiting factor that needs further consideration. PMID:16187017

  9. Impact of Molecular Technologies on Faba Bean (Vicia faba L. Breeding Strategies

    Directory of Open Access Journals (Sweden)

    Tao Yang

    2012-07-01

    Full Text Available Faba bean (Vicia faba L. is a major food and feed legume because of the high nutritional value of its seeds. The main objectives of faba bean breeding are to improve yield, disease resistance, abiotic stress tolerance, seed quality and other agronomic traits. The partial cross-pollinated nature of faba bean introduces both challenges and opportunities for population development and breeding. Breeding methods that are applicable to self-pollinated crops or open-pollinated crops are not highly suitable for faba bean. However, traditional breeding methods such as recurrent mass selection have been established in faba bean and used successfully in breeding for resistance to diseases. Molecular breeding strategies that integrate the latest innovations in genetics and genomics with traditional breeding strategies have many potential applications for future faba bean cultivar development. Hence, considerable efforts have been undertaken in identifying molecular markers, enriching genetic and genomic resources using high-throughput sequencing technologies and improving genetic transformation techniques in faba bean. However, the impact of research on practical faba bean breeding and cultivar release to farmers has been limited due to disconnects between research and breeding objectives and the high costs of research and implementation. The situation with faba bean is similar to other small crops and highlights the need for coordinated, collaborative research programs that interact closely with commercially focused breeding programs to ensure that technologies are implemented effectively.

  10. Navy Bean Flour Particle Size and Protein Content Affect Cake Baking and Batter Quality(1).

    Science.gov (United States)

    Singh, Mukti; Byars, Jeffrey A; Liu, Sean X

    2015-06-01

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to 3 levels with navy bean starch. The effect of navy bean flour and its fractions at 3 levels of protein on cake batter rheology and cake quality was studied and compared with wheat flour samples. Batters prepared from navy bean flour and its fractions had higher viscosity than the cake flour. Reducing the protein content by addition of starch significantly lowered the viscosity of cake batters. The whole navy bean flour and coarse bean fraction cakes were softer than cakes made with wheat flour but had reduced springiness. Principal component analysis showed a clear discrimination of cakes according to protein. It also showed that low protein navy bean flour cakes were similar to wheat flour cakes. Navy bean flour with protein content adjusted to the level of cake (wheat) flour has potential as a healthy alternative in gluten-free cakes. PMID:25922214

  11. Enrichment of ACE inhibitory peptides in navy bean (Phaseolus vulgaris) using lactic acid bacteria.

    Science.gov (United States)

    Rui, Xin; Wen, Delan; Li, Wei; Chen, Xiaohong; Jiang, Mei; Dong, Mingsheng

    2015-02-01

    The present study was conducted to explore a novel strategy to enhance angiotensin I-converting enzyme (ACE) inhibitory activities of navy bean by preparation of navy bean milk (NBM) which was then subjected to fermentation of four lactic acid bacteria (LAB) strains, namely, Lactobacillus bulgaricus, Lactobacillus helveticus MB2-1, Lactobacillus plantarum B1-6, and Lactobacillus plantarum 70810. With the exception of L. helveticus MB2-1, the other three selected strains had good growth performances in NBM with viable counts increased to log 8.30-8.39 cfu ml(-1) during 6 h of fermentation, and thus were selected for the following investigations. Protein contents of NBM significantly reduced when treated with L. bulgaricus and L. plantarum B1-6, and the electrophoresis patterns showed the preferable proteins for LAB strains to hydrolyze were α- and β-type phaseolins, whereas γ-type phaseolin was resistant to hydrolysis. RP-HPLC analysis demonstrated all fermented NBM had higher intensities of peaks with retention times between 2.5 and 3.5 min indicative of formation of small peptides. All fermented NBM showed higher ACE inhibitory activity compared to the unfermented ones, for which 2 h, 3 h, and 5 h were found to be the optimum fermentation periods for respectively L. plantarum 70810, L. plantarum B1-6 and L. bulgaricus, with IC50 values of 109 ± 5.1, 108 ± 1.1, and 101 ± 2.2 μg protein ml(-1). The subsequent in vitro gastrointestinal simulation afforded all fermented extracts reduced IC50 values and the extracts fermented by L. plantarum B1-6 exerted the lowest IC50 value of 21 ± 2.1 μg protein ml(-1). The research has broadened our knowledge bases on the effect of LAB fermentation on the degradation of navy bean proteins and the capacity to release ACE inhibitory peptides. The approach was promising to obtain probiotic products with potential to serve as functional ingredients targeting hypertension. PMID:25536445

  12. Changes in flavour and taste of irradiated coffee beans

    International Nuclear Information System (INIS)

    The possibility of changes in the smell and taste of coffee from beans submitted to irradiation for preservation is a significant gap in the programme devoted to increasing the product life time with such a process. Therefore, the main objective of the paper was to evaluate changes in aroma and flavour that can be noticed by the consumer. Coffee beans were given disinfestation doses of 50krad, producing an insect mortality rate of 98.33% +-2.89 in Araecerus fasciculatus (adult stage). The samples, provided by IBC, were from the same crop and free from pesticides. Some of the material was kept by that Institute for organoleptic tests. The remainder was sent to the National Institute of Technology for gas-chromatographic analysis. Should any significant changes be noticed, it could be assumed that the gamma-irradiation process would be rejected by the consumer. However, no significant change was observed in the most important characteristics, flavour and aroma, that might induce the consumer to reject irradiated coffee beans. (author)

  13. Changes in Flavour and Taste of Irradiated Coffee Beans

    International Nuclear Information System (INIS)

    The possibility of changes in the smell and taste of coffee from beans submitted to irradiation for preservation is a significant gap in the programme devoted to increasing the product life time with such a process. Therefore, the main objective of the paper was to evaluate changes in aroma and flavour that can be noticed by the consumer. Coffee beans were given disinfestation doses of 50 krad, producing an insect mortality rate of 98.33% ± 2.89 in Araecerus fasciculatus (adult stage). The samples, provided by IBC, were from the same crop and free from pesticides. Some of the material was kept by that Institute for organoleptic tests. The remainder was sent to the National Institute of Technology for gas-chromatographic analysis. Should any significant changes be noticed, it could be assumed that the gamma-irradiation process would be rejected by the consumer. However, no significant change was observed in the most important characteristics, flavour and aroma, that might induce the consumer to reject irradiated coffee beans. (author)

  14. Proteases decode the extracellular matrix cryptome.

    Science.gov (United States)

    Ricard-Blum, Sylvie; Vallet, Sylvain D

    2016-03-01

    The extracellular matrix is comprised of 1100 core-matrisome and matrisome-associated proteins and of glycosaminoglycans. This structural scaffold contributes to the organization and mechanical properties of tissues and modulates cell behavior. The extracellular matrix is dynamic and undergoes constant remodeling, which leads to diseases if uncontrolled. Bioactive fragments, called matricryptins, are released from the extracellular proteins by limited proteolysis and have biological activities on their own. They regulate numerous physiological and pathological processes such as angiogenesis, cancer, diabetes, wound healing, fibrosis and infectious diseases and either improve or worsen the course of diseases depending on the matricryptins and on the molecular and biological contexts. Several protease families release matricryptins from core-matrisome and matrisome-associated proteins both in vitro and in vivo. The major proteases, which decrypt the extracellular matrix, are zinc metalloproteinases of the metzincin superfamily (matrixins, adamalysins and astacins), cysteine proteinases and serine proteases. Some matricryptins act as enzyme inhibitors, further connecting protease and matricryptin fates and providing intricate regulation of major physiopathological processes such as angiogenesis and tumorigenesis. They strengthen the role of the extracellular matrix as a key player in tissue failure and core-matrisome and matrisome-associated proteins as important therapeutic targets. PMID:26382969

  15. Effect of Gamma Radiation and Electron Beam on Microbiological Quality and Protein Patterns of 4 Selected Beans

    International Nuclear Information System (INIS)

    The aim of the present study was to evaluate the effect of gamma ray and electron beam on microbiological quality and protein pattern of four selected beans: mung beans, soy beans, peanuts and black beans. All beans samples were exposed to irradiation at doses of 0, 0.5, 1, and 2 kGy before evaluated for their microbiological quality using AOAC method and protein analysis by gel electrophoresis. Results showed that the amount of bacteria, yeast and mold of irradiated mung beans and peanuts were reduced, whereas these microbiological quality values remained relatively the same for irradiated soy beans and black beans compared to non-irradiated samples. In terms of protein analysis, the protein patterns of the irradiated beans were of the same quality as the non-irradiated samples. To further tested the effect of irradiation on the bean's protein at higher doses, all four selected beans were exposed to gamma ray at 10, 50, 100, 150 and 200 kGy. We found that the protein patterns of mung beans, peanuts and black beans were altered at doses above 50 kGy.

  16. Extracellular fibrils of pathogenic yeast Cryptococcus gattii are important for ecological niche, murine virulence and human neutrophil interactions.

    Directory of Open Access Journals (Sweden)

    Deborah J Springer

    Full Text Available Cryptococcus gattii, an emerging fungal pathogen of humans and animals, is found on a variety of trees in tropical and temperate regions. The ecological niche and virulence of this yeast remain poorly defined. We used Arabidopsis thaliana plants and plant-derived substrates to model C. gattii in its natural habitat. Yeast cells readily colonized scratch-wounded plant leaves and formed distinctive extracellular fibrils (40-100 nm diameter x500-3000 nm length. Extracellular fibrils were observed on live plants and plant-derived substrates by scanning electron microscopy (SEM and by high voltage- EM (HVEM. Only encapsulated yeast cells formed extracellular fibrils as a capsule-deficient C. gattii mutant completely lacked fibrils. Cells deficient in environmental sensing only formed disorganized extracellular fibrils as apparent from experiments with a C. gattii STE12alpha mutant. C. gattii cells with extracellular fibrils were more virulent in murine model of pulmonary and systemic cryptococcosis than cells lacking fibrils. C. gattii cells with extracellular fibrils were also significantly more resistant to killing by human polymorphonuclear neutrophils (PMN in vitro even though these PMN produced elaborate neutrophil extracellular traps (NETs. These observations suggest that extracellular fibril formation could be a structural adaptation of C. gattii for cell-to-cell, cell-to-substrate and/or cell-to- phagocyte communications. Such ecological adaptation of C. gattii could play roles in enhanced virulence in mammalian hosts at least initially via inhibition of host PMN- mediated killing.

  17. [Role of Bacterial Adhesin RAPA1 in Formation of Efficient Symbiosis of Rhizobium leguminosarum with Bean Plants].

    Science.gov (United States)

    Nigmatullina, L R; Lavina, A M; Vershinina, Z R; Baimiev, Al Kh

    2015-01-01

    Bacterial adhesins, the proteins responsible for attachment of plant growth-promoting rhizobacteria to plant roots, are involved in formation of stable associative symbioses. In the present work enhanced expression of the rapA1 adhesin gene in Rhizobium leguminosarum PVu5 was shown to improve the efficiency of nodulation on bean roots inoculated with the modified strain. The rapA1 gene was cloned into the pJN105Turbo plasmid, this construct was used for transformation of R. leguminosarum PVu5, bean plants were inoculated by this transgenic strain, and efficiency of root nodule formation was determined. In the plants treated with rapA1-transgenic rhizobia, the number of root nodules was on average two times higher than in the plants inoculated with the original strain. Aggregation of R. leguminosarum was achieved when the rapA1 gene expression was enhanced either in rhizobia or in the co-cultured modified strain E. coli pJN105TurboRapA1. PMID:26964360

  18. Exposure of cerium oxide nanoparticles to kidney bean shows disturbance in the plant defense mechanisms

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • Kidney bean roots uptake nCeO2 primarily without biotransformation. • Cerium reached the root vascular tissues through gaps in the Casparian strip. • On longer exposure to high concentration, roots demonstrate stress response. • In leaves, guaiacol peroxidase plays a major role in ROS scavenging. - Abstract: Overwhelming use of engineered nanoparticles demands rapid assessment of their environmental impacts. The transport of cerium oxide nanoparticles (nCeO2) in plants and their impact on cellular homeostasis as a function of exposure duration is not well understood. In this study, kidney bean plants were exposed to suspensions of ∼8 ± 1 nm nCeO2 (62.5 to 500 mg/L) for 15 days in hydroponic conditions. Plant parts were analyzed for cerium accumulation after one, seven, and 15 days of nCeO2 exposure. The primary indicators of stress like lipid peroxidation, antioxidant enzyme activities, total soluble protein and chlorophyll contents were studied. Cerium in tissues was localized using scanning electron microscopy and synchrotron μ-XRF mapping, and the chemical forms were identified using μ-XANES. In the root epidermis, cerium was primarily shown to exist as nCeO2, although a small fraction (12%) was biotransformed to Ce(III) compound. Cerium was found to reach the root vascular tissues and translocate to aerial parts with time. Upon prolonged exposure to 500 mg nCeO2/L, the root antioxidant enzyme activities were significantly reduced, simultaneously increasing the root soluble protein by 204%. In addition, leaf's guaiacol peroxidase activity was enhanced with nCeO2 exposure in order to maintain cellular homeostasis

  19. Exposure of cerium oxide nanoparticles to kidney bean shows disturbance in the plant defense mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Majumdar, Sanghamitra [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Peralta-Videa, Jose R. [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Bandyopadhyay, Susmita [Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Castillo-Michel, Hiram [European Synchrotron Radiation Facility, B.P. 220-38043 Grenoble, Cedex (France); Hernandez-Viezcas, Jose-Angel [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Sahi, Shivendra [Department of Biology, Western Kentucky University, Bowling Green, KY 42101 (United States); Gardea-Torresdey, Jorge L., E-mail: jgardea@utep.edu [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States)

    2014-08-15

    Graphical abstract: - Highlights: • Kidney bean roots uptake nCeO{sub 2} primarily without biotransformation. • Cerium reached the root vascular tissues through gaps in the Casparian strip. • On longer exposure to high concentration, roots demonstrate stress response. • In leaves, guaiacol peroxidase plays a major role in ROS scavenging. - Abstract: Overwhelming use of engineered nanoparticles demands rapid assessment of their environmental impacts. The transport of cerium oxide nanoparticles (nCeO{sub 2}) in plants and their impact on cellular homeostasis as a function of exposure duration is not well understood. In this study, kidney bean plants were exposed to suspensions of ∼8 ± 1 nm nCeO{sub 2} (62.5 to 500 mg/L) for 15 days in hydroponic conditions. Plant parts were analyzed for cerium accumulation after one, seven, and 15 days of nCeO{sub 2} exposure. The primary indicators of stress like lipid peroxidation, antioxidant enzyme activities, total soluble protein and chlorophyll contents were studied. Cerium in tissues was localized using scanning electron microscopy and synchrotron μ-XRF mapping, and the chemical forms were identified using μ-XANES. In the root epidermis, cerium was primarily shown to exist as nCeO{sub 2}, although a small fraction (12%) was biotransformed to Ce(III) compound. Cerium was found to reach the root vascular tissues and translocate to aerial parts with time. Upon prolonged exposure to 500 mg nCeO{sub 2}/L, the root antioxidant enzyme activities were significantly reduced, simultaneously increasing the root soluble protein by 204%. In addition, leaf's guaiacol peroxidase activity was enhanced with nCeO{sub 2} exposure in order to maintain cellular homeostasis.

  20. Populational survey of arthropods on transgenic common bean expressing the rep gene from Bean golden mosaic virus.

    Science.gov (United States)

    Pinheiro, Patrícia V; Quintela, Eliane D; Junqueira, Ana Maria R; Aragão, Francisco J L; Faria, Josias C

    2014-01-01

    Genetically modified (GM) crops is considered the fastest adopted crop technology in the history of modern agriculture. However, possible undesirable and unintended effects must be considered during the research steps toward development of a commercial product. In this report we evaluated effects of a common bean virus resistant line on arthropod populations, considered as non-target organisms. This GM bean line (named M1/4) was modified for resistance against Bean golden mosaic virus (BGMV) by expressing a mutated REP protein, which is essential for virus replication. Biosafety studies were performed for a period of three years under field conditions. The abundance of some species was significantly higher in specific treatments in a particular year, but not consistently different in other years. A regular pattern was not observed in the distribution of insects between genetically modified and conventional treatments. Data analyses showed that minor differences observed can be attributed to random variation and were not consistent enough to conclude that the treatments were different. Therefore the present study indicates that the relative abundance of species are similar in transgenic and non-transgenic fields. PMID:24922280

  1. Evaluation of the tepary bean (Phaseolus acutifolius) diversity panel for response to the NL 3 strain of Bean Common Mosaic Necrosis Virus (BCMNV) and for biological nitrogen fixation with Bradyrhizobium strains

    Science.gov (United States)

    Aphid-transmitted Bean Common Mosaic Necrosis Virus (BCMNV) and Bean Common Mosaic Virus (BCMV) are potyviruses that are seed transmitted in tepary bean. Developing resistance to these viruses will be critical for expanding production in areas where they are endemic. Biological nitrogen fixation (BN...

  2. Detecção do Southern bean mosaic virus no Paraná, e separação do Bean rugose mosaic virus em feijoeiro Detection of Southern bean mosaic virus in the State of Paraná and separation from Bean rugose mosaic virus in bean

    Directory of Open Access Journals (Sweden)

    Marcos D. G. Gasparin

    2005-02-01

    Full Text Available Em lavouras de feijoeiro (Phaseolus vulgaris da cultivar Carioca Comum, no município de Londrina, Estado do Paraná, foram encontradas plantas com sintomas de necrose da haste, mosaico clorótico leve e porte reduzido, semelhantes aos sintomas causados por infecção viral. Exames de microscopia eletrônica revelaram a presença de partículas isométricas. Em testes de imunodifusão dupla em gel de ágar os extratos foliares de plantas infetadas reagiram positivamente com anti-soro específico para o Southern bean mosaic virus (SBMV. O vírus foi purificado e a massa molecular de sua proteína capsidial foi estimada em 30 kDa, valor esperado para proteínas do capsídeo de vírus do gênero Sobemovirus. A gama de hospedeiras do SBMV isolado no Paraná foi restrita ao feijoeiro e a algumas cultivares de soja (Glycine max. A separação de dois vírus isométricos comuns em infecções mistas no feijoeiro foi possível através da reação de imunidade ao SBMV apresentada por Crotalaria sp, Chenopodium quinoa e Mucuna deeringiana, e da reação de susceptibilidade dessas mesmas hospedeiras ao Bean rugose mosaic virus (BRMV.Plants of bean (Phaseolus vulgaris, showing symptoms of stunt, stem necrosis and chlorotic mosaic, similar to those induced by virus infection were found in a bean field in Londrina, Paraná. Electron microscopy examinations showed isometric virus particles in the cell cytoplasm. Double immunodifusion serological tests with antiserum for Southern bean mosaic virus (SBMV gave positive results when tested against plant sap from infected bean plants. The virus was purified and the molecular mass of its coat protein was estimated as 30 kDa, the expected value for the coat protein of viruses from the genus Sobemovirus. The host range of the virus was restricted to bean and some soybean (Glycine max cultivars. It was possible to separate two isometric viruses commonly found in bean based on the immunity reaction of Crotalaria sp

  3. Extracellular calmodulin: A polypeptide signal in plants?

    Institute of Scientific and Technical Information of China (English)

    孙大业; 唐文强; 马力耕

    2001-01-01

    Traditionally, calmodulin (CaM) was thought to be a multi-functional receptor for intracellular Ca2+ signals. But in the last ten years, it was found that CaM also exists and acts extracellularly in animal and plant cells to regulate many important physiological functions. Laboratory studies by the authors showed that extracellular CaM in plant cells can stimulate the proliferation of suspension cultured cell and protoplast; regulate pollen germination and pollen tube elongation,and stimulate the light-independent gene expression of Rubisco small subunit (rbcS). Furthermore,we defined the trans-membrane and intracellular signal transduction pathways for extracellular CaM by using a pollen system. The components in this pathway include heterotrimeric G-protein,phospholipase C, IP3, calcium signal and protein phosphorylation etc. Based on our findings, we suggest that extracellular CaM is a polypeptide signal in plants. This idea strongly argues against the traditional concept that there is no intercellular polypeptide signal in plants.

  4. Identification of quantitative trait loci associated with fructose, glucose and sucrose concentration in snap bean (Phaseolus Vulgaris L.) pods

    Science.gov (United States)

    Sugars, including fructose, glucose, and sucrose contribute significantly to the flavor and consumer acceptance of snap beans (Phaseolus vulgaris L.). Differences between dry and snap bean cultivars and among snap bean cultivars in the patterns of accumulation of sugars have been observed. In ‘Eagle...

  5. 78 FR 25623 - Importation of Fresh Beans, Shelled or in Pods, From Jordan Into the Continental United States

    Science.gov (United States)

    2013-05-02

    ... distributed within the United States. Currently, we do not allow the importation of fresh beans (Phaseolus... accessing Regulations.gov ). The PRA, titled ``Importation of Fresh Beans (Phaseolus vulgaris L.), Shelled... allow the importation of commercial shipments of fresh beans (Phaseolus vulgaris L.), shelled or in...

  6. Effect of partial genetic resistance on efficacy of Topsin fungicide for control of white mold disease in pinto bean

    Science.gov (United States)

    Pinto bean is the most important dry bean market class grown in the U.S., but is one of the most susceptible to white mold disease. Developing pinto bean with partial resistance is a major goal of plant breeders, but the effect of partial resistance on efficacy of fungicide application for disease m...

  7. A new method to select the drought resistance azuki bean germplasm

    Institute of Scientific and Technical Information of China (English)

    Chen Xin; Peerasak Srinives

    2006-01-01

    120 azuki bean germplasms from different regions of China were selected for drought-resistance. Results showed that there is a significant positive correlation between drought-resistance and photooxidation-resistance. So, the detecting technique for photooxidation-resistance should be suggested as a reference method to select the drought-resistance germplasms in azuki bean.

  8. Iron and zinc bioavailabilities to pigs from red and white beans (Phaseolus vulgaris L.) are similar

    Science.gov (United States)

    Common beans contain relatively high concentrations of iron (Fe) and zinc (Zn) but are also high in polyphenols and phytates, factors that may inhibit Fe and Zn absorption. In vitro (Caco-2 cells) and in vivo (pigs) models were used to compare Fe and Zn bioavailabilities between red and white beans,...

  9. Effect of fungal infection on phenolic compounds during the storage of coffee beans

    Directory of Open Access Journals (Sweden)

    Amal, A. A.

    2013-12-01

    Full Text Available Aims: This work was undertaken to study the effect of Aspergillus infection on phenolic compounds in beans from four cultivars of the coffee plant (Coffea arabica L.. The effects of storage conditions of the coffee beans were also examined. Methodology and results: Beans from four varieties of coffee were artificially infected with three species of Aspergillus: A. niger, A. melleus and A. alliacus, and stored at 0, 8 and 25 ± 2 °C. After 3, 6 and 9 months, the contents of phenolic compounds in the beans were determined using high performance liquid chromatography (HPLC. Conclusion, significance and impact study: The results of this study showed that phenolic compounds were qualitatively and quantitatively higher in the inoculated beans as compared with the uninfected control beans, reflecting a possible induced defense mechanism in the infected beans. Increased storage periods resulted in higher levels of phenols, but the average total, bound and free phenols did not differ between the cultivars tested. Effective control of Apergillus infection in coffee beans can prevent such changes in phenolics that may affect their commercial value.

  10. Evaluation of tolerance to Bacillus thuringiensis toxins among laboratory-reared western bean cutworm (Lepidoptera: Noctuidae)

    Science.gov (United States)

    The Western bean cutworm (WBC), Striacosta albicosta, is a destructive insect pest of dry beans within its native range of western Nebraska and eastern Colorado. However, starting in the early 1990s, a range expansion of S. albicosta has resulted in damage to corn crops through the Midwest and more...

  11. Evaluation of common bean (Phaseolus vulgaris L.) collection for agromorphological and seed mineral concentration

    Science.gov (United States)

    A collection of common bean comprising totally 223 genotypes of which 176 genotypes from the USDA, 37 common bean landraces and 10 commercial cultivars from Turkey, evaluated for several agromorphological plant characters and mineral concentrations in seeds. There were wide range of variations for t...

  12. Visualization of resistance responses in Phaseolus vulgaris using reporter tagged clones of Bean common mosaic virus

    DEFF Research Database (Denmark)

    Naderpour, Masoud; Johansen, Ida Elisabeth

    2011-01-01

    Reporter tagged virus clones can provide detailed information on virus–host interactions. In Phaseolus vulgaris (bean), four recessive and one dominant gene are known to control infection by strains of the potyvirus species Bean common mosaic virus (BCMV). To study the interactions between BCMV and...

  13. Genetic Diversity of North American Wild kidney bean (Phaseolus polystachios) in the Eastern US

    Science.gov (United States)

    North American wild kidney bean or thicket bean (Phaseolus polystachios (L.) Britton, Sterns, & Poggenb) is a perennial vine found in the eastern United States from Texas to Connecticut. It is the only Phaseolus species native to temperate North America. Its closest cultivated relative is P. lunatus...

  14. Yields and quality of Phaseolus bean cultivars under farmers’ conditions in eastern and southern Africa

    DEFF Research Database (Denmark)

    Jensen, Henning Høgh; Kamalongo, Donwell; Ngwira, Amos;

    2014-01-01

    Common bean (Phaseolus vulgaris L.) is a dominant grain legume in eastern and southern Africa, where it constitutes a major source of protein and microminerals in peoples’ diet. The current studies aimed at determining how initially promising genotypes of bean responded in terms of yield and grai...

  15. Registration of Drought Tolerant, Rust Resistant, High Yielding Pinto Bean Germplasm Line CO46348

    Science.gov (United States)

    Drought stress reduces dry bean (Phaseolus vulgaris L.) yield in more than 60 % of the production regions worldwide. The release of CO465348 will provide plant breeders with drought tolerant, pinto bean germplasm that takes advantage of full-growing season (95 to 98 d), has high yield potential, exc...

  16. Pinto Bean Hull Extract Supplementation Favorably Affects Markers of Bone Metabolism and Bone Structure in Mice

    Science.gov (United States)

    Dry edible beans (Phaseolus vulgaris) have many health benefits attributed to their high content of protein, non-digestible starches, fiber, and other bioactive components. Hulls from dry beans are rich in phenolics known to possess antioxidant activity that is beneficial to human health. The object...

  17. Selenium from Pinto Beans is Bioavailable to Support Bone Structure in Mice

    Science.gov (United States)

    Deficiency of selenium (Se), an essential trace mineral for animals and humans, has been shown to induce growth retardation and to impair bone metabolism. The objective of the study was to determine whether Se from pinto beans (SeBean) is as bioavailable as Se from selenomethionine (SeMet) to suppor...

  18. Draft Genome Sequence of Arthrobacter chlorophenolicus Strain Mor30.16, Isolated from the Bean Rhizosphere

    OpenAIRE

    Miranda-Ríos, José Antonio; Ramírez-Trujillo, José Augusto; Nova-Franco, Bárbara; Lozano-Aguirre Beltrán, Luis Fernando; Iturriaga, Gabriel; Suárez-Rodríguez, Ramón

    2015-01-01

    Bacteria of the genus Arthrobacter are commonly found in the soil and plant rhizosphere. In this study we report the draft genome of Arthrobacter chlorophenolicus strain Mor30.16 that was isolated from rhizosphere of beans grown in Cuernavaca Morelos, Mexico. This strain promotes growth and ameliorates drought stress in bean plants.

  19. Phenotype and seed production among hyacinth bean (Lablab purpureus L. Sweet) accessions rescued using hydroponic techniques

    Science.gov (United States)

    Hyacinth bean, Lablab purpureus L. (Sweet) is a legume used as a vegetable, forage, and in home gardens as an ornamental plant. Many accessions do not flower during their juvenile period in Byron, GA. Other hyacinth bean accessions produce few seed when regenerated in the field. This study was condu...

  20. Selection of markers for mapping and cloning disease resistance in common bean

    Science.gov (United States)

    Infestation of diseases is one of the major constraints of subsistence production and economic yield of common bean. Genetic resistance is an important component of integrated strategies to combat problematic diseases in common bean and development of cultivars with improved resistance to pest and d...

  1. A reference genome for common bean and genome wide analysis of dual domestications

    Science.gov (United States)

    Common bean (Phaseolus vulgaris) is the single most important grain legume for human consumption and, due to its ability to fix atmospheric nitrogen via symbioses with soil-borne microorganisms, has a valuable place in sustainable agriculture. We assembled 473 Mb of the common bean genome and geneti...

  2. Characterization of a Panela cheese with added probiotics and fava bean starch

    Science.gov (United States)

    Twenty Lactobacillus spp. and eight Bifidobacterium spp. were screened for their ability to ferment fava bean starch. B. breve ATCC 15700 and L. rhamnosus GG ATCC 53103 were selected as probiotics for use in fresh style Panela cheese. Two types of fresh cheese (with and without 3% fava bean starch) ...

  3. Response of Andean and Mesoamerican common bean genotypes to inoculation with rhizobium strains.

    Science.gov (United States)

    In most common bean (Phaseolus vulgaris L.) production regions of Latin America, inoculants are rarely used by farmers in spite of several studies that demonstrate the importance of Rhizobium inoculation on commercial production of legume crops. This study investigated specific bean host plant-Rhizo...

  4. Variation and inheritance of iron reductase activity in the roots of common bean (Phaseolus vulgaris L. and association with seed iron accumulation QTL

    Directory of Open Access Journals (Sweden)

    Fernandez Andrea C

    2010-10-01

    under iron limited conditions may be useful in environments where beans are grown in alkaline soils, while the QTL for iron reductase under sufficiency conditions may be useful for selecting for enhanced seed nutritional quality.

  5. Inhibitory effect of green coffee bean extract on fat accumulation and body weight gain in mice

    Directory of Open Access Journals (Sweden)

    Aitani Michio

    2006-03-01

    Full Text Available Abstract Background An epidemiological study conducted in Italy indicated that coffee has the greatest antioxidant capacity among the commonly consumed beverages. Green coffee bean is rich in chlorogenic acid and its related compounds. The effect of green coffee bean extract (GCBE on fat accumulation and body weight in mice was assessed with the objective of investigating the effect of GCBE on mild obesity. Methods Male ddy mice were fed a standard diet containing GCBE and its principal constituents, namely, caffeine and chlorogenic acid, for 14 days. Further, hepatic triglyceride (TG level was also investigated after consecutive administration (13 days of GCBE and its constituents. To examine the effect of GCBE and its constituents on fat absorption, serum TG changes were evaluated in olive oil-loaded mice. In addition, to investigate the effect on hepatic TG metabolism, carnitine palmitoyltransferase (CPT activity in mice was evaluated after consecutive ingestion (6 days of GCBE and its constituents (caffeine, chlorogenic acid, neochlorogenic acid and feruloylquinic acid mixture. Results It was found that 0.5% and 1% GCBE reduced visceral fat content and body weight. Caffeine and chlorogenic acid showed a tendency to reduce visceral fat and body weight. Oral administration of GCBE (100 and 200 mg/kg· day for 13 days showed a tendency to reduce hepatic TG in mice. In the same model, chlorogenic acid (60 mg/kg· day reduced hepatic TG level. In mice loaded with olive oil (5 mL/kg, GCBE (200 and 400 mg/kg and caffeine (20 and 40 mg/kg reduced serum TG level. GCBE (1%, neochlorogenic acid (0.028% and 0.055% and feruloylquinic acid mixture (0.081% significantly enhanced hepatic CPT activity in mice. However, neither caffeine nor chlorogenic acid alone was found to enhance CPT activity. Conclusion These results suggest that GCBE is possibly effective against weight gain and fat accumulation by inhibition of fat absorption and activation of fat

  6. Further characterization of Renibacterium salmoninarum extracellular products.

    Science.gov (United States)

    Barton, T A; Bannister, L A; Griffiths, S G; Lynch, W H

    1997-10-01

    Renibacterium salmoninarum, the agent of bacterial kidney disease in salmonids, releases high concentrations of extracellular protein in tissues of infected fish. The extracellular protein consists almost entirely of a 57-kDa protein and derivatives of degradation and aggregation of the same molecule. The 57-kDa protein and its derivatives were fractionated into defined ranges of molecular mass. Separated fractions continued to produce degradation and aggregation products. One-dimensional electrophoretic separation of extracellular protein revealed a number of proteolytically active bands from > 100 to approximately 18 kDa associated with various 57-kDa protein derivatives in the different molecular mass fractions. Two-dimensional separation of extracellular protein showed that continued degradation and aggregation, similar both in location and behavior to some of the 57-kDa protein derivatives, was also displayed by the proteolytically active bands after their separation. Effects of reducing agents and sulfhydryl group proteinase inhibitors indicated a common mechanism for the proteolytically active polypeptides characteristic of a thiol proteinase. The results suggested that the 57-kDa protein and some of its derivatives undergo autolytic cleavage, releasing a proteolytically active polypeptide(s) of at least 18 kDa. Soluble polysaccharide-like material also was detected in extracellular products and tissue from infected fish. Antiserum to the polysaccharide-like material cross-reacted with O-polysaccharide of the fish pathogen Aeromonas salmonicida, suggesting some structural similarity between these polysaccharides. The polysaccharide and the proteolytic activity associated with the 57-kDa protein derivatives should be investigated with respect to the pathogenesis of R. salmoninarum infections. PMID:9480644

  7. Extracellular calmodulin: A polypeptide signal in plants?

    Institute of Scientific and Technical Information of China (English)

    SUN; Daye(

    2001-01-01

    [1]Cheng. W. Y., Cyclic 3', 5'-nucleotide phosphodiestrase: demonstration of an activator, Biochm. Biophys. Res. Commun.,1970, 38: 533-538.[2]Boynton, A. L., Whitfield, J. F., MacManus, J. P., Calmodulin stimulates DNA synthesis by rat liver cells, BBRC.1980,95(2): 745-749.[3]Gorbacherskaya, L. V., Borovkova, T. V., Rybin, U. O. et al., Effect of exogenous calmodulin on lymphocyte proliferation in normal subjects, Bull Exp. Med. Biol., 1983, 95: 361-363.[4]Wong, P. Y.-K., Lee, W. H., Chao, PH.-W., The role of calmodulin in prostaglandin metabolism, Ann. NY Acad. Sci.,1980, 356: 179-189.[5]Mac Neil, S., Dawson, R. A., Crocker, G. et al., Effects of extracellular calmodulin and calmodulin antagonists on B16 melanoma cell growth, J. Invest. Dermatol., 1984, 83: 15-19.[6]Crocker, D. G., Dawson, R. A., Mac Neil, S. et al., An extracellular role for calmodulin-like activity in cell proliferation,Biochem. J., 1988, 253: 877-884.[7]Polito. V. S., Calmodulin and calmodulin inhibitors: effect on pollen germination and tube growth, in Pollen: Biology and Implications for Plant Breeding (eds. Mulvshy, D. L., Ottaviaro, E.), New York: Elsevier, 1983.53-60.[8]Biro, R. L., Sun, D. Y., Roux, S. J.et al., Characterization of oat calmodulin and radioimmunoassay of its subcellular distribution, Plant Physiol., 1984,75: 382-386.[9]Terry, M. E., Bonner, B. A., An examination of centrifugation as a method of extracting an extracellular solution from peas, and its use for the study of IAA-induced growth, Plant Physiol., 1980, 66: 321-325.[10]Josefina, H. N., Aldasars, J. J., Rodriguez, D., Localization of calmodulin on embryonic Cice aricium L, in Molecular and Cellular Aspects of Calcium in Plant Development (ed. Trewavas, A. J.), New York, London: Plenum Press, 1985, 313.[11]Dauwalder, M., Roux, S. J., Hardison, L., Distribution of calmodulin in pea seedling: immunocytochemical localization in plumules and root apices, Planta, 1986, 168: 461

  8. Effect of sunflower climbing bean intercroping system on insect pest incidence and crop productivity

    International Nuclear Information System (INIS)

    Intercropping of sunflower and climping beans were evaluated for pest incidence and yield advantages during the main season of 2000/2001 at KARI-NPBRC, Njoro. Three sunflower varieties, Fedha, Record, PAN-7553 and three climbing beans varieties, Puebla, Omukingi and Flora were laid out in a complete randomised block design with four replications. Sunflower was spaced at 75 x 30 cm while the climbing beans were spaced at 50 x 37.5 cm. Assessment of pest damage on various treatments commenced 17 days after planting. Results showed that low plant germination was mainly a result of dry weather and taht cutworm damage was insignificant. There was a sunflower x climbing bean variety interaction, which regulated the aphid infestation of the climbing beans. Sunflower variety PAN-7553 recorded significantly (P<0.01) more pecked heads than the other two varieties. (author)

  9. Effect of 60Co-γ ray irradiation on green coffee beans, 1

    International Nuclear Information System (INIS)

    Green coffee beans were irradiated with 60Co-γ rays at doses of 0, 0.05, 0.5, 5.0 and 10.0 Mrad and the changes of general components in green and roast coffee beans were investigated together with those of the organoleptic properties of roast beans during storage according to the cup testing. In case of Brazil santos beans, irradiation of some 0.05 Mrad 60Co-γ ray gave rather favourable mild flavour and no harmful influence on the quality of coffee, and moreover, would tend to extend the shelf life of roast beans. But influence of irradiation on the quality of coffee differed somewhat between two cultivars, Brazil santos and Colombia. (auth.)

  10. Uncertainty measurement in the homogenization and sample reduction in the physical classification of rice and beans

    Directory of Open Access Journals (Sweden)

    Dieisson Pivoto

    2016-04-01

    Full Text Available ABSTRACT: The study aimed to i quantify the measurement uncertainty in the physical tests of rice and beans for a hypothetical defect, ii verify whether homogenization and sample reduction in the physical classification tests of rice and beans is effective to reduce the measurement uncertainty of the process and iii determine whether the increase in size of beans sample increases accuracy and reduces measurement uncertainty in a significant way. Hypothetical defects in rice and beans with different damage levels were simulated according to the testing methodology determined by the Normative Ruling of each product. The homogenization and sample reduction in the physical classification of rice and beans are not effective, transferring to the final test result a high measurement uncertainty. The sample size indicated by the Normative Ruling did not allow an appropriate homogenization and should be increased.

  11. Mineral composition of some varieties of beans from Mediterranean and Tropical areas.

    Science.gov (United States)

    Di Bella, Giuseppa; Naccari, Clara; Bua, Giuseppe Daniel; Rastrelli, Luca; Lo Turco, Vincenzo; Potortì, Angela Giorgia; Dugo, Giacomo

    2016-01-01

    In this study has been evaluated the mineral composition (Cd, Pb, As, Hg, Ba, Cr, Co, Ni, Se, Sb, V, Cu, Fe, Zn, Mo, Na, K, Ca, Mg) of some varieties of bean (Phaseolus vulgaris, Vigna unguiculata and V. angularis) from Mediterranean and Tropical areas of the world (Italy, Mexico, India, Japan, Ghana and Ivory Coast); the correlation between beans mineral composition in micro and macroelements and botanical and/or geographical origin; trace elements dietary intake by beans consumption. The results showed a correlation between beans mineral composition and their geographical origin, with higher values in Ivory Coast samples. Moreover, minerals content found confirmed the importance of these legumes in the diet for the significant content of essential micro and macroelements and a safe consumption of beans for the low residual levels of toxic metals. PMID:26940501

  12. Phosphorus Use Efficiency by Brazilian Common Bean Genotypes Assessed by the 32P Dilution Technique

    International Nuclear Information System (INIS)

    The objectives of this work were to identify the most efficient common bean (Phaseolus vulgaris L.) genotypes on phosphorus (P) utilization, and verify if P from the seed affects the classification of common bean genotypes on P uptake efficiency when the 32P isotopic dilution technique is used. The experiment was conducted in a greenhouse, and plants were grown in pots with surface samples of a dystrophic Typic Haplustox. The treatments consisted of 50 common bean genotypes and two standard plant species, efficient or inefficient in P uptake. The results were assessed through correlation and cluster analysis (multivariate). Sangue de Boi, Rosinha, Thayu, Grafite, Horizonte, Pioneiro and Jalo Precoce common bean genotypes were the most efficient on P uptake, and Carioca 80, CNF 10, Perola, IAPAR 31, Roxao EEP, Apore, Pioneiro, Pontal, Timbo and Ruda were the most efficient in P utilization. The P derived from seed influences the identification of common bean genotypes for P uptake efficiency. (author)

  13. Marker-assisted selection in common beans and cassava

    International Nuclear Information System (INIS)

    Marker-assisted selection (MAS) in common beans (Phaseolus vulgaris L.) and cassava (Manihot esculenta) is reviewed in relation to the breeding system of each crop and the breeding goals of International Agricultural Research Centres (IARCs) and National Agricultural Research Systems (NARS). The importance of each crop is highlighted and examples of successful use of molecular markers within selection cycles and breeding programmes are given for each. For common beans, examples are given of gene tagging for several traits that are important for bean breeding for tropical environments and aspects considered that contribute to successful application of MAS. Simple traits that are tagged with easy-to-use markers are discussed first as they were the first traits prioritized for breeding at the International Center for Tropical Agriculture (CIAT) and with NARS partners in Central America, Colombia and eastern Africa. The specific genes for MAS selection were the bgm-1 gene for bean golden yellow mosaic virus (BGYMV) resistance and the bc-3 gene for bean common mosaic virus (BCMV) resistance. MAS was efficient for reducing breeding costs under both circumstances as land and labour savings resulted from eliminating susceptible individuals. The use of markers for other simply inherited traits in marker-assisted backcrossing and introgression across Andean and Mesoamerican gene pools is suggested. The possibility of using MAS for quantitative traits such as low soil phosphorus adaptation is also discussed as are the advantages and disadvantages of MAS in a breeding programme. For cassava, the use of multiple flanking markers for selection of a dominant gene, CMD2 for cassava mosaic virus (CMV) resistance at CIAT and the International Institute of Tropical Agriculture (IITA) as well as with NARS partners in the United Republic of Tanzania using a participatory plant breeding scheme are reviewed. MAS for the same gene is important during introgression of cassava green mite

  14. Microbial extracellular electron transfer and its relevance to iron corrosion.

    Science.gov (United States)

    Kato, Souichiro

    2016-03-01

    Extracellular electron transfer (EET) is a microbial metabolism that enables efficient electron transfer between microbial cells and extracellular solid materials. Microorganisms harbouring EET abilities have received considerable attention for their various biotechnological applications, including bioleaching and bioelectrochemical systems. On the other hand, recent research revealed that microbial EET potentially induces corrosion of iron structures. It has been well known that corrosion of iron occurring under anoxic conditions is mostly caused by microbial activities, which is termed as microbiologically influenced corrosion (MIC). Among diverse MIC mechanisms, microbial EET activity that enhances corrosion via direct uptake of electrons from metallic iron, specifically termed as electrical MIC (EMIC), has been regarded as one of the major causative factors. The EMIC-inducing microorganisms initially identified were certain sulfate-reducing bacteria and methanogenic archaea isolated from marine environments. Subsequently, abilities to induce EMIC were also demonstrated in diverse anaerobic microorganisms in freshwater environments and oil fields, including acetogenic bacteria and nitrate-reducing bacteria. Abilities of EET and EMIC are now regarded as microbial traits more widespread among diverse microbial clades than was thought previously. In this review, basic understandings of microbial EET and recent progresses in the EMIC research are introduced. PMID:26863985

  15. Species of phosphorus in the extracellular polymeric substances of EBPR sludge.

    Science.gov (United States)

    Zhang, Hai-Ling; Fang, Wei; Wang, Yong-Peng; Sheng, Guo-Ping; Xia, Cheng-Wang; Zeng, Raymond J; Yu, Han-Qing

    2013-08-01

    In this study, the species of extracellular phosphorus and their transformation during extracellular polymeric substances (EPS) extraction were explored by using (31)P nuclear magnetic resonance spectroscopy. Results show that the extraction methods had a substantial influence on the phosphorus species in the extracted EPS. Cation exchange resin method was more appropriate for extracting EPS from the enhanced biological phosphorus removal (EBPR) sludge. Orthophosphate, pyrophosphate and polyphosphate were the main species of phosphorus found to be present in the EPS, which together accounted for about 6.6-10.5% of the total phosphorus in the EBPR sludge. The high percentage of extracellular phosphorus and their diverse species might reveal a new insight into the characteristics of the phosphorus in EPS in EBPR system. PMID:23751808

  16. Apple Latent Spherical Virus Vector as Vaccine for the Prevention and Treatment of Mosaic Diseases in Pea, Broad Bean, and Eustoma Plants by Bean Yellow Mosaic Virus

    OpenAIRE

    Nozomi Satoh; Tatsuya Kon; Noriko Yamagishi; Tsubasa Takahashi; Tomohide Natsuaki; Nobuyuki Yoshikawa

    2014-01-01

    We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV) harboring a segment of the Bean yellow mosaic virus (BYMV) genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic sym...

  17. Gene-based SNP discovery in tepary bean (Phaseolus acutifolius) and common bean (P. vulgaris) for diversity analysis and comparative mapping

    OpenAIRE

    Gujaria-Verma, Neha; Ramsay, Larissa; Sharpe, Andrew G; Sanderson, Lacey-Anne; Daniel G. Debouck; Tar’an, Bunyamin; Bett, Kirstin E.

    2016-01-01

    Background Common bean (Phaseolus vulgaris) is an important grain legume and there has been a recent resurgence in interest in its relative, tepary bean (P. acutifolius), owing to this species’ ability to better withstand abiotic stresses. Genomic resources are scarce for this minor crop species and a better knowledge of the genome-level relationship between these two species would facilitate improvement in both. High-throughput genotyping has facilitated large-scale single nucleotide polymor...

  18. Reduction of viral load in whitefly (Bemisia tabaci Gen.) feeding on RNAi-mediated bean golden mosaic virus resistant transgenic bean plants.

    Science.gov (United States)

    de Paula, Nayhanne T; de Faria, Josias C; Aragão, Francisco J L

    2015-12-01

    The RNAi concept was explored to silence the rep gene from the bean golden mosaic virus (BGMV) and a genetically modified (GM) bean immune to the virus was previously generated. We investigated if BGMV-viruliferous whiteflies would reduce viral amount after feeding on GM plants. BGMV DNA amount was significantly reduced in whiteflies feeding in GM-plants (compared with insects feeding on non-GM plants) for a period of 4 and 8 days in 52% and 84% respectively. PMID:26297125

  19. Short term toxicity studies of irradiated black beans (P. vulgaris)

    International Nuclear Information System (INIS)

    In 1980, we presented a paper on irradiated black beans with the dose levels of 0.2 and 0.5 kGy to verify the mutagenic potentiality, using male mice. The dose level required for insect disinfestation of the legume referred to is 0.1 kGy. At this time, we resolved to repeat the dominant lethal test with the same product and kind of animals, but with increasing dose levels to appraise its effects on the reproduction of these animals. In this study we carried out work related to the evaluation of the mutagenic potential of the irradiated black beans with 0, 1.0, 5.0, 10.0, 15.0 and 20.0 kGy, and the biological value evaluation of the same irradiated legume with 0, 0.5, 5.0 and 10.0 kGy respectively, in male mice and rats. For the dominant lethal test, the following parameters were analysed: body weight (only males), pregnancy rates, total implants, live implants, dead implants, distribution of sexes and abnormality in foetuses. In general, the variations found cannot be considered as being the result of radiation. This can be verified through the outcome from the groups which were fed non-irradiated and irradiated black beans, and commercial rations. For biological protein value, the following parameters were tested: alimentary efficacy ratio, protein efficacy ratio, net protein utilization, biological value and digestibility. We observed small variations in the results obtained. These small differences were considered not significant and not attributable to the irradiation treatment. (author)

  20. Gamma Radiosensitivity Study on Long Bean (Vigna sesquipedalis

    Directory of Open Access Journals (Sweden)

    Ellyfa Kon

    2007-01-01

    Full Text Available This study was conducted to determine the LD50 and effect of gamma ray on germination percentage, plant height, survival percentage, root length, root dry weight and shoot dry weight of seedlings derived from seeds of long bean (Vigna sesquipedalis. Seeds of this crop were treated with 300, 400, 500, 600 and 800 Gy gamma rays at Malaysian Institute of Nuclear Technology (MINT. The treated seeds including control were sown in sand beds in size 4.6 x 0.7 m2 in a greenhouse at Horticulture Unit, Universiti Putra Malaysia Bintulu Campus (UPMKB. After germination, plants were transferred into polybags. Each polybag contained 1.2 kg blended growth medium with top soil, sand, and processed chicken dung ratio of 3:2:1. Standard procedures were used to observe and record the variables studied in this research. The experiment was designed as a 4 x 6 factorial Completely Randomized Design with 3 replications. Lethal dose 50 % of population (LD50 was assayed. The study revealed that germination percentage, plant height, survival percentage, root length, root dry weight and shoot dry weight decreased with increasing dose of gamma ray. The 800 Gy gamma ray dose in particular had a pronounced effect on these morphological characteristics probably because of injury it might have caused to the seeds of the long bean. As a result, poor growth and development was noticed. The LD50 for survival and height ranged between 600-800 Gy and 400-500 Gy, respectively. Generally, higher gamma ray doses particularly 800 Gy significantly affected the morphological characteristics of long bean seedlings obtained from irradiated seeds.

  1. THE OCCURRENCE OF INSECTS, FUNGI AND ORGANOLEPTIC CHARACTERISTICS IN STORED COFFEE BEANS IN LAMPUNG

    Directory of Open Access Journals (Sweden)

    OKKY s. DHARMAPUTRA

    1999-01-01

    Full Text Available A survey on postharvest handling and technology processing of coffee beans at farmer, trader and exporter levels was conducted in West Lampung a nd Tanggamus regencies of Lampung province during harvest time (July 1998. Interviews and sampling of coffee beans were carried out during the survey. The number of respondents at farmer, trader and exporter levels was 22, 20 and 4, respectively, while the number of samples collected from each level was 20. All samples were analyzed for moisture content, physical quality, insect and fungal infestation, reducing sugar content, and coffee cupping. The results of the interviews indicated that posth arvest handling and technol ogy processing became better from farmers to exporters. Moisture contents of coffee beans collected from farmers and traders were higher than the tolerable limit recommended by SNI (13%. Physical quality of coffee beans collected from exporters was higher than that collected from farmers and traders. Insects were found on coffee beans collected from farmers, traders and exporters, but the number of species and the percentage of samples infested by insects from each level were relatively low. The predominant species was Liposcelis entomophila. The number of fungal species on coffee beans collected from farmers was higher than that collected from traders and exporters. The predominant species at the three levels was Aspergillus niger, but the lowest percentage of beans infected by this fungus was found on coffee beans collected from expo rters. The lowest percentage of samples infected by all fungi was also found on coffee beans collected from exporters. Reducing sugar content of coffee beans collected from exporters was lower than that from farmers and traders. Aroma and flavor values tended to increase from farmers through traders to exporters, while the body decreased. Some off-flavors (i.e. earthy, mouldy, fermented and woody were encountered in a few coffee samples from farmers as

  2. Variability of root traits in common bean genotypes at different levels of phosphorus supply and ontogenetic stages

    Directory of Open Access Journals (Sweden)

    Roberto dos Santos Trindade

    2014-08-01

    Full Text Available Selection of common bean (Phaseolus vulgaris L. cultivars with enhanced root growth would be a strategy for increasing P uptake and grain yield in tropical soils, but the strong plasticity of root traits may compromise their inclusion in breeding programs. The aim of this study was to evaluate the magnitude of the genotypic variability of root traits in common bean plants at two ontogenetic stages and two soil P levels. Twenty-four common bean genotypes, comprising the four growth habits that exist in the species and two wild genotypes, were grown in 4 kg pots at two levels of applied P (20 and 80 mg kg-1 and harvested at the stages of pod setting and early pod filling. Root area and root length were measured by digital image analysis. Significant genotype × P level and genotype × harvest interactions in analysis of variance indicate that the genotypic variation of root traits depended on soil nutrient availability and the stage at which evaluation was made. Genotypes differed for taproot mass, basal and lateral root mass, root area and root length at both P levels and growth stages; differences in specific root area and length were small. Genotypes with growth habits II (upright indeterminate and III (prostrate indeterminate showed better adaptation to limited P supply than genotypes of groups I (determinate and IV (indeterminate climbing. Between the two harvests, genotypes of groups II and III increased the mass of basal and lateral roots by 40 and 50 %, respectively, whereas genotypes of groups I and IV by only 7 and 19 %. Values of the genotypic coefficient of determination, which estimates the proportion of phenotypic variance resulting from genetic effects, were higher at early pod filling than at pod setting. Correlations between shoot mass and root mass, which could indicate indirect selection of root systems via aboveground biomass, were higher at early pod filling than at pod setting. The results indicate that selection for root

  3. Studies on semi-technical separation of Mung bean starch

    Energy Technology Data Exchange (ETDEWEB)

    Haase, N.U.; Tegge, G.; Thu, N.M. (Bundesforschungsanstalt fuer Getreide- und Kartoffelverarbeitung, Detmold (Germany, F.R.))

    1991-02-01

    Starch of mung beans is the raw material for high grade glass noodles, but until now industrial starch separation is often less efficient. For testing new fields of commercial use it is of benerfit to experiment with very pure starches. Regarding this, possibilities of starch isolation on a semi-technical scale are described, which resulted in most pure starches. Crude protein content could be lowered down to 0.3% and crude fibre content down to 0.5% dry matter base. (orig.).

  4. Use of 32P in aluminum sensibility tests with bean

    International Nuclear Information System (INIS)

    Four greenhouse experiments were conducted to study the possibility of using 32P in aluminium tolerance tests of bean (Phaseolus vulgaris L.). The cultivars were previously classified according to dry matter yield date by regression analysis as aluminium tolerant (C20-Mulatinho Paulista; C26-Ricobaio 1014 and C33-Roxo 750) and aluminium sensitive (C17-Jamapa; C28-Rio Tibagi and C34-Tambo). Chopped roots from plant grown in a complete nutrient solution during 30 days and submerged in another solution containing aluminium showed to be a reliable indicator of 32P absorption efficiency to aluminium tolerant and sensitive cultivars. (M.A.C.)

  5. Drought resistance characters of induced mung bean mutants

    International Nuclear Information System (INIS)

    The induced mung bean mutants were studied at three stages (the seedling stage, the flower and pod stage, the filling stage) by the means of synthetical indexes and the theory of grey systems. An excellent mutant with better drought resistance character than CK1 in all three stages and than CK2 in the seedling and the filling stages was found. As the orders of the drought resistance varied with the growth period, the drought resistance of one period can not replace that of the whole life period

  6. Response of Dry Bean to Sulfentrazone Plus Imazethapyr

    OpenAIRE

    Nader Soltani; Christy Shropshire; Peter H. Sikkema

    2014-01-01

    Field studies were conducted in 2010 and 2011 at the Huron Research Station, Exeter, Ontario and from 2009 to 2011 at the University of Guelph Ridgetown Campus, Ridgetown, Ontario to evaluate the sensitivity of four market classes of dry bean to sulfentrazone applied preemergence at 105, 140, and 280 g ai/ha alone and in combination with imazethapyr at 37.5 g ai/ha. At 1 week after emergence (WAE), sulfentrazone alone or in combination with imazethapyr at all doses evaluated caused no signifi...

  7. Osmoregulation and nutritional relationships between Orobanche foetida and faba bean

    OpenAIRE

    Abbes, Zouhaier; Kharrat, Mohamed; Delavault, Philippe; Chaïbi, Wided; Simier, Philippe

    2009-01-01

    The present study aims at comparing the phloem composition of the tolerant XBJ90.03-16-1-1-1 and the susceptible Bachaar genotypes and the impact of the faba bean genotype on the levels of the major solutes and invertase activities in the parasite Orobanche foetida. In comparison to Bachaar, the XBJ90.03-161-1-1 genotype limited the growth of orobanche tubercles under in vitro conditions. The limited growth was due to low soluble invertase activity, low osmotic potential of the infected roots...

  8. Texture losses of green beans along frozen storage

    OpenAIRE

    R.C. Martins; Silva, C. L. M.

    2000-01-01

    The texture loss of frozen green beans ( Phaseolus vulgaris, L., variety Bencanta) was macroscopically evaluated by a puncture test, using the INSTRON (Universal Testing Machine, model 4500) with a 4,85 mm diameter plunger, along 250 days of isothermal storage at -7, -15 and -30°C. The force deformation curves were recorded for data analysis of: i) Energy - the area below the force deformation curve, as a measurement of the resistance to compression by the plunger, ii) Stress at the fai...

  9. Induced mutations for a determinate habit in rice bean

    International Nuclear Information System (INIS)

    Induced mutation techniques were used to create polygenic variability in rice bean (Vigna umbellata). Dry seeds of the genotype (sel. I) were irradiated with 40-80 kR of gamma rays at 10 kR intervals. A wide variation in quantitative characters was induced in both the M2 and M3 generations. Some mutants were isolated that showed a determinate growth habit, earliness, a high yield and photoinsensitivity. These mutants were found to be breeding true. (author). 5 refs, 1 tab

  10. Effect of chemical stress on germination of cv Dalia bean (Phaseolus vularis L.) as an alternative to increase antioxidant and nutraceutical compounds in sprouts.

    Science.gov (United States)

    Mendoza-Sánchez, Magdalena; Guevara-González, Ramón G; Castaño-Tostado, Eduardo; Mercado-Silva, Edmundo M; Acosta-Gallegos, Jorge A; Rocha-Guzmán, Nuria E; Reynoso-Camacho, Rosalía

    2016-12-01

    The aim of this study was to determine the effect of chitosan (CH), salicylic acid (SA) and hydrogen peroxide (H2O2) at different concentrations on the antinutritional and nutraceutical content, as well as the antioxidant capacity of bean sprouts (cv Dalia). All elicitors at medium and high concentrations reduced the antinutritional content of lectins (48%), trypsin inhibitor (57%), amylase inhibitor (49%) and phytic acid (56%). Sprouts treated with CH, SA and H2O2 (7μM; 1 and 2mM, and 30mM respectively) increased the content of phenolic compounds (1.8-fold), total flavonoids (3-fold), saponins (1.8-fold) and antioxidant capacity (37%). Furthermore, the UPLC-ESI-MS/MS analysis showed an increase of several nutraceutical compounds in bean sprouts treated with SA such as coumaric (8.5-fold), salicylic (115-fold), gallic (25-fold) and caffeic (1.7-fold) acids, as well as epigallocatechin (63-fold), rutin (41-fold) and quercetin (16.6-fold) flavonoids. The application of elicitors in bean seed during sprouting enhances their nutraceutical properties. PMID:27374516

  11. Mapping proteolytic cancer cell-extracellular matrix interfaces.

    NARCIS (Netherlands)

    Wolf, K.A.; Friedl, P.H.A.

    2009-01-01

    For cancer progression and metastatic dissemination, cancer cells migrate and penetrate through extracellular tissues. Cancer invasion is frequently facilitated by proteolytic processing of components of the extracellular matrix (ECM). The cellular regions mediating proteolysis are diverse and depen

  12. Involvement of extracellular matrix constituents in breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Lochter, Andre; Bissell, Mina J

    1995-06-01

    It has recently been established that the extracellular matrix is required for normal functional differentiation of mammary epithelia not only in culture, but also in vivo. The mechanisms by which extracellular matrix affects differentiation, as well as the nature of extracellular matrix constituents which have major impacts on mammary gland function, have only now begun to be dissected. The intricate variety of extracellular matrix-mediated events and the remarkable degree of plasticity of extracellular matrix structure and composition at virtually all times during ontogeny, make such studies difficult. Similarly, during carcinogenesis, the extracellular matrix undergoes gross alterations, the consequences of which are not yet precisely understood. Nevertheless, an increasing amount of data suggests that the extracellular matrix and extracellular matrix-receptors might participate in the control of most, if not all, of the successive stages of breast tumors, from appearance to progression and metastasis.

  13. An antifungal peptide from Phaseolus vulgaris cv. brown kidney bean

    Institute of Scientific and Technical Information of China (English)

    Yau Sang Chan; Jack Ho Wong; Evandro Fei Fang; Wen Liang Pan; Tzi Bun Ng

    2012-01-01

    A 5.4-kDa antifungal peptide,with an N-terminal sequence highly homologous to defensins and inhibitory activity against Mycosphaerella arachidicola (IC5o=3 μM),Setospaeria turcica and Bipolaris maydis,was isolated from the seeds of Phaseolus vulgaris cv.brown kidney bean.The peptide was purified by employing a protocol that entailed adsorption on Affi-gel blue gel and Mono S and finally gel filtration on Superdex 75.The antifungal activity of the peptide against M.arachidicola was stable in the pH range 3-12 and in the temperature range 0℃ to 80℃.There was a slight reduction of the antifungal activity at pH 2 and 13,and the activity was indiscernible at pH 0,1,and 14.The activity at 90℃ and 100℃ was slightly diminished.Deposition of Congo red at the hyphal tips of M.arachidicola was induced by the peptide indicating inhibition of hyphal growth.The lack of antiproliferative activity of brown kidney bean antifungal peptide toward tumor cells,in contrast to the presence of such activity of other antifungal peptides,indicates that different domains are responsible for the antifungal and antiproliferative activities.

  14. Improvement of tuber yield in yam bean by mutation induction

    International Nuclear Information System (INIS)

    Full text: The genus Pachyrrhizus, a native of Mexico and Central America is now widely distributed throughout the tropics. Pachyrrhizus erosus (L.) Urb., commonly known as the yam bean is cultivated in many parts of India for its edible tubers. The young tubers have a crisp and juicy flesh and can be eaten raw or cooked. Genetic variability for agronomically important characters is rare. It was therefore felt desirable to increase it by mutation induction. Seeds of a locally adapted variety were subjected to gamma irradiation (10, 15, 20 and 25 kR). Evaluation of the M3 raised from the different treatments unveiled mutants possessing significantly higher yields than the control. While the control plants showed a mean tuber yield of 168 g, one of the higher yielding mutants from the progenies of 10 kR treatment recorded 415 g. Two other mutants selected from the 25 kR treatment showed yields of 401 and 411 g. These mutants, first identified in M2, were found to breed true in M3-M5 generations. Yield trials conducted in M5 generation showed more than two-fold increase in yield by the mutants. Apparently there are remarkable possibilities of improving the yield potential in yam bean by mutation induction. (author)

  15. Molecular assessment of genetic diversity in mung bean germplasm

    Indian Academy of Sciences (India)

    G. Roopa Lavanya; Jyoti Srivastava; Shirish A. Ranade

    2008-04-01

    RAPD profiles were used to identify the extent of diversity among 54 accessions of mung bean that included both improved and local land races. Out of the 40 primers screened, seven primers generated 174 amplification products with an average of 24.85 bands per primer. The RAPD profiles were analysed for Jaccard’s similarity coefficients that was found to be in the range from 0 to 0.48, indicating the presence of wide range of genetic diversity at molecular level. Cluster analysis was carried out based on distances (1-similarity coefficient) using neighbour-joining method in Free Tree package. The dendrogram resolved all the accessions into two major clusters, I (with 11 accessions) and II (with 43 accessions). However, the cluster was further divided into four subclusters (II A with six, II B with nine, II C with 15 and II D with 13 accessions). The distribution of the accessions in different clusters and subclusters appeares to be related to their performance in field conditions for 10 morphological traits that were scored. This study indicated that the RAPD profiles provide an easy and simple technique for preliminary genetic diversity assessment of mung bean accessions that may reflect morphological trait differences among them.

  16. Effect of copper on castor bean (Ricinus communis L.) growth

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Castor beans crop (Ricinus communis L.) is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor yield, few research has been made on this issue, mainly on the use de copper. In order to evaluate the effects of copper on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Cu (0; 1; 2; 3 and 4 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Copper levels used, in general, did not affect the plant height, stem diameter and leaf area, however they influenced the leaves and shoot biomass dry mass and the quadratic trend was the best to show the behavior of these. (author)

  17. Faba bean hulls as a potential source of pectin.

    Science.gov (United States)

    Korish, Mohamed

    2015-09-01

    This study aimed for the first time to assess the potential use of faba bean hulls as a source of pectin. The study involved extracting pectin under various conditions of pH, temperature and extraction time and determining how these conditions affected pectin yield and its characteristics. The maximum yield of extracted pectin did not coincide with the highest degree of esterification since the maximum yield (15.75 %) was recorded at pH 1.5 and at a temperature of 85 °C for an 80-min extraction period and solid to liquid (1: 25) ratio, while the highest degree of esterification (54.62 %) occurred at pH 2.5 and at temperature of 90 °C for a 60-min extraction period. The composition of the pectin varied according to the extraction conditions: the neutral sugars galactose, arabinose and rhamnose increased under milder extraction conditions while glucose, mannose and xylose sugars predominated under harsher extraction conditions. The results indicated that faba bean hulls contains adequate amount of pectin, suitable for commercial utilization. PMID:26345029

  18. Breeding common bean populations for traits using selection index

    Directory of Open Access Journals (Sweden)

    Dayane Cristina Lima

    2015-02-01

    Full Text Available A common bean (Phaseolus vulgarisL. cultivar must combine desirable genotypes for several traits in order to be accepted by producers and consumers. This study aimed to evaluate selection efficiency when segregating bean populations for traits, by means of a selection index, in order to obtain superior progenies for traits considered. A total of 16 populations from the F4 and F5generations were evaluated in 2011 and 2012, respectively. The traits evaluated were plant architecture, plant disease, grain type and yield. Using standard scores (Z, the sum of the four traits (∑Z was obtained and, based on this information, the best populations were identified. The evaluation of selection effectiveness was performed on 31 progenies from each population. The 496 progenies plus eight controls were evaluated in the F5:6and F5:7 generations for the same traits in July and November 2012, respectively. The selection, using the index based on the sum of standardized variables (∑Z, was efficient for identifying populations with superior progenies for all the traits considered.

  19. Biological treatment to bean seeds before sowing them.

    Directory of Open Access Journals (Sweden)

    Silvano Edel Castro Mayo

    2013-09-01

    Full Text Available Even in some bibliography about the bean cultivation is recommended the use of Rhizobium which association with the cultivation is very advantageous for the fixation of the atmospheric nitrogen, as well as the employment of the antagonistic mushroom Trichoderma spp., for the control of fungous illnesses of the floor and knowing that the cultivation has its fertilization demands and of the plagues control and illnesses that are in definitive the causes that limit the yields of the cultivation, these practices are not used. We proceeded to the disinfection of bean seeds with the resulting solution of the laundry of 1Kg of Trichoderma harzianum of the stock A-34 with 2 liters of water and the mixture of this fluid with 1 Kg of Rhizobium, more a package (134 grams of Gaucho PS 70 for 45.35 kg (100 pounds of t seed. The disinfection of the seed was made by hand, 12 hour before sowing them and the results were very encouraging, so much in the delay of days in appearing the illnesses and the plagues and its low attack intensity as the increase of the yields with relationship to the not treated seed.

  20. Effect of gamma irradiation on antinutritional factors in broad bean

    International Nuclear Information System (INIS)

    The effect of gamma irradiation on the level of antinutritional factors (trypsin inhibitor (TI), phytic acid and oligosaccharides) of broad bean was investigated. The seeds were subjected to gamma irradiation at 0, 2.5, 5, 7.5 and 10 kGy, respectively using cobalt-60 gamma radiation with a dose rate 2.37 kGy/h. TI activity was reduced by 4.5%, 6.7%, 8.5% and 9.2% at 2.5, 5, 7.5 and 10 kGy, respectively. Meanwhile, irradiation at 10.2, 12.3, 15.4 and 18.2 kGy reduced the phytic acid content. The flatulence causing oligosaccharides were decreased as the radiation dose increased. The chemical composition (protein, oil, ash and total carbohydrates) of the tested seeds was determined. Gamma radiation seems to be a good procedure to improve the quality of broad bean from the nutritional point of view

  1. Effect of gamma irradiation on antinutritional factors in broad bean

    Science.gov (United States)

    Al-Kaisey, Mahdi T.; Alwan, Abdul-Kader H.; Mohammad, Manal H.; Saeed, Amjed H.

    2003-06-01

    The effect of gamma irradiation on the level of antinutritional factors (trypsin inhibitor (TI), phytic acid and oligosaccharides) of broad bean was investigated. The seeds were subjected to gamma irradiation at 0, 2.5, 5, 7.5 and 10 kGy, respectively using cobalt-60 gamma radiation with a dose rate 2.37 kGy/h. TI activity was reduced by 4.5%, 6.7%, 8.5% and 9.2% at 2.5, 5, 7.5 and 10 kGy, respectively. Meanwhile, irradiation at 10.2, 12.3, 15.4 and 18.2 kGy reduced the phytic acid content. The flatulence causing oligosaccharides were decreased as the radiation dose increased. The chemical composition (protein, oil, ash and total carbohydrates) of the tested seeds was determined. Gamma radiation seems to be a good procedure to improve the quality of broad bean from the nutritional point of view.

  2. Agronomic performance of velvet bean at different spatial arrangement

    International Nuclear Information System (INIS)

    The objective of this work was to evaluate the effect of different plant spatial arrangements on agronomic performance of velvet-bean (Mucuna pruriens var. utilis). The experiment was performed with eight treatments, distributed in a randomized complete block design in a 2x4 factorial arrangement, with four replicates. The treatments were velvet bean sowing at two spacings between furrows (0.5 and 1.0 m) and four plant densities (2, 4, 8 and 16 plants m-1). Determinations were made for the soil covering and biological nitrogen fixation (BNF) rates, and for the dry matter yield and N accumulation in the plant shoots. Total soil cover was accomplished at 50 days after sowing at 16 plants m-1 density and 0.5 m spacing between furrows. The combination of 16 plants m-11density with the 1.0 m spacing between furrows provided the greatest dry matter yield and accumulated most N in the plant shoots. Irrespective of the plant spatial arrangement, the estimation of BNF in this species shows that about 70% N present in the shoot is derived from the atmosphere. (author)

  3. Sunning as a technique for disinfecting stored beans

    International Nuclear Information System (INIS)

    The effectiveness of sunning (solar heating) as a small farm technique for controlling the bean bruchids Zabrotes subfasciatus (Boheman) and Acanthoscelides obtectus (Say) was investigated. Bean seeds infested with mixed-stage larvae were placed on clear or black polyethylene sheets or inside polyethylene pouches with clear upper and black lower surfaces and exposed to the sun for five hours each day for 0, 3 and 5 successive days. No live insects emerged from seeds heated in the pouches while the few that emerged from seeds on the black sheets resulted in damage to less than 1% of the seeds. Of the three polyethylene systems used, the clear sheet was the least useful, while the pouches even for only 3 days, were the most effective in eliminating infestations. These studies demonstrated that effective bruchid control can be achieved with daily 5-h exposure periods of seeds for a successive 5-day duration. However, the success of the method of control may be influenced by the time of the year and prevailing environmental conditions

  4. Decellularized musculofascial extracellular matrix for tissue engineering

    OpenAIRE

    Wang, Lina; Johnson, Joshua A; Chang, David W.; Zhang, Qixu

    2013-01-01

    Ideal scaffolds that represent native extracellular matrix (ECM) properties of musculofascial tissues have great importance in musculofascial tissue engineering. However, detailed characterization of musculofascial tissues’ ECM (particularly, of fascia) from large animals is still lacking. In this study, we developed a decellularization protocol for processing pig composite musculofascial tissues. Decellularized muscle (D-muscle) and decellularized fascia (D-fascia), which are two important c...

  5. Design of Artificial Modular Extracellular Matrices

    OpenAIRE

    Gräter, Stefan V. W.

    2006-01-01

    Cellular functions such as cell growth, adhesion and differentiation are essentially controlled by the surrounding extracellular matrix (ECM). The mechanical, chemical and structural properties of the ECM are consequently crucial for the selection of cells at interfaces and the formation of tissues. The objective of this thesis was to develop an artificial ECM to determine and control the parameters influencing the crosstalk between cells and their surroundings on a molecular level. Artificia...

  6. Extracellular Matrix Turnover and Outflow Resistance

    OpenAIRE

    Kate E Keller; Mini, Aga; Bradley, John M.; Kelley, Mary J.; Acott, Ted S.

    2008-01-01

    Normal homeostatic adjustment of elevated intraocular pressure (IOP) involves remodeling the extracellular matrix (ECM) of the trabecular meshwork (TM). This entails sensing elevated IOP, releasing numerous activated proteinases to degrade existing ECM and concurrent biosynthesis of replacement ECM components. To increase or decrease IOP, the quantity, physical properties and/or organization of new components should be somewhat different from those replaced in order to modify outflow resistan...

  7. Extracellular proteases as targets for drug development

    OpenAIRE

    Cudic, Mare; Fields, Gregg B.

    2009-01-01

    Proteases constitute one of the primary targets in drug discovery. In the present review, we focus on extracellular proteases (ECPs) because of their differential expression in many pathophysiological processes, including cancer, cardiovascular conditions, and inflammatory, pulmonary, and periodontal diseases. Many new ECP inhibitors are currently under clinical investigation and a significant increase in new therapies based on protease inhibition can be expected in the coming years. In addit...

  8. Airway and Extracellular Matrix Mechanics in COPD

    OpenAIRE

    Bidan, Cécile M.; Veldsink, Annemiek C.; Meurs, Herman; Gosens, Reinoud

    2015-01-01

    Chronic obstructive pulmonary disease (COPD) is one of the most common lung diseases worldwide, and is characterized by airflow obstruction that is not fully reversible with treatment. Even though airflow obstruction is caused by airway smooth muscle contraction, the extent of airway narrowing depends on a range of other structural and functional determinants that impact on active and passive tissue mechanics. Cells and extracellular matrix in the airway and parenchymal compartments respond b...

  9. Extracellular Aldonolactonase from Myceliophthora thermophila▿ †

    OpenAIRE

    Beeson, William T.; Iavarone, Anthony T.; Hausmann, Corinne D.; Cate, Jamie H.D.; Marletta, Michael A.

    2010-01-01

    Fungi secrete many different enzymes to deconstruct lignocellulosic biomass, including several families of hydrolases, oxidative enzymes, and many uncharacterized proteins. Here we describe the isolation, characterization, and primary sequence analysis of an extracellular aldonolactonase from the thermophilic fungus Myceliophthora thermophila (synonym Sporotrichum thermophile). The lactonase is a 48-kDa glycoprotein with a broad pH optimum. The enzyme catalyzes the hydrolysis of glucono-δ-lac...

  10. Extracellular enzymes of Fusarium graminearum isolates

    OpenAIRE

    Gisele Eleonora Kikot; Roque Alberto Hours; Teresa María Alconada

    2010-01-01

    Fusarium graminearum isolates from three different agroecological regions in Argentina were examined according to the production of different extracellular enzyme activities of potential biotechnological interest: pectinases (PGase: polygalacturonase and PMGase: polymethylgalacturonase), cellulase (CMCase: carboxymethylcellulase) and hemicellulase (xylanase). The isolates were grown in minimum salt medium supplemented with 0.25% glucose, 0.125% citric pectin and 0.125% oat bran as carbon sour...

  11. Extracellular TG2: emerging functions and regulation

    OpenAIRE

    Belkin, Alexey M.

    2011-01-01

    Tissue transglutaminase (TG2) is a ubiquitously expressed member of the transglutaminase family of Ca2+-dependent cross-linking enzymes. Unlike other family members, TG2 is a multifunctional protein, which has several other well documented enzymatic and non-enzymatic functions. A significant body of evidence accumulated over the last decade reveals multiple and complex activities of this protein on the cell surface and in the extracellular matrix (ECM), including its role in the regulation of...

  12. Aquaporins in Urinary Extracellular Vesicles (Exosomes)

    OpenAIRE

    Sayaka Oshikawa; Hiroko Sonoda; Masahiro Ikeda

    2016-01-01

    Since the successful characterization of urinary extracellular vesicles (uEVs) by Knepper’s group in 2004, these vesicles have been a focus of intense basic and translational research worldwide, with the aim of developing novel biomarkers and therapeutics for renal disease. Along with these studies, there is growing evidence that aquaporins (AQPs), water channel proteins, in uEVs have the potential to be diagnostically useful. In this review, we highlight current knowledge of AQPs in uEVs fro...

  13. A constant current source for extracellular microiontophoresis.

    Science.gov (United States)

    Walker, T; Dillman, N; Weiss, M L

    1995-12-01

    A sophisticated constant-current source suitable for extracellular microiontophoresis of tract-tracing substances, such as Phaseolus vulgaris leucoagglutinin, Biocytin or Fluoro-Gold, is described. This design uses a flyback switched-mode power supply to generate controllable high-voltage and operational amplifier circuitry to regulate current and provide instrumentation. Design features include a fast rise time, +/- 2000 V supply (stable output in current and voltage monitoring, and separate pumping and holding current settings. Three features of this constant-current source make it especially useful for extracellular microiontophoresis. First, the output voltage monitor permits one to follow changes in the microelectrode resistance during current injection. Second, the voltage-limit (or out-of-compliance) indicator circuitry will sound an alarm when the iontophoretic pump is unable to generate the desired current, such as when the micropipette is blocked. Third, the high-compliance voltage power supply insures up to +/- 20 microA of current through 100 M omega resistance. This device has proven itself to be a reliable constant-current source for extracellular microiontophoresis in the laboratory. PMID:8788057

  14. Identification of extracellularly phosphorylated membrane proteins.

    Science.gov (United States)

    Burghoff, Sandra; Willberg, Wibke; Schrader, Jürgen

    2015-10-01

    Ecto-protein kinases phosphorylate extracellular membrane proteins and exhibit similarities to casein kinases and protein kinases A and C. However, the identification of their protein substrates still remains a challenge because a clear separation from intracellular phosphoproteins is difficult. Here, we describe a straightforward method for the identification of extracellularly phosphorylated membrane proteins in human umbilical vein endothelial cells (HUVECs) and K562 cells which used the protease bromelain to selectively remove ectoproteins from intact cells and combined this with the subsequent analysis using IMAC and LC-MS/MS. A "false-positive" strategy in which cells without protease treatment served as controls was applied. Using this approach we identified novel phosphorylation sites on five ectophosphoproteins (NOTCH1, otopetrin 1, regulator of G-protein signalling 13 (RGS13), protein tyrosine phosphatase receptor type D isoform 3 (PTPRD), usherin isoform B (USH2A)). Use of bromelain appears to be a reliable technique for the further identification of phosphorylated surface-exposed peptides when extracellular adenosine-5'-triphosphate is elevated during purinergic signalling. PMID:26152529

  15. EXTRACELLULAR VESICLES: CLASSIFICATION, FUNCTIONS AND CLINICAL RELEVANCE

    Directory of Open Access Journals (Sweden)

    A. V. Oberemko

    2014-12-01

    Full Text Available This review presents a generalized definition of vesicles as bilayer extracellular organelles of all celular forms of life: not only eu-, but also prokaryotic. The structure and composition of extracellular vesicles, history of research, nomenclature, their impact on life processes in health and disease are discussed. Moreover, vesicles may be useful as clinical instruments for biomarkers, and they are promising as biotechnological drug. However, many questions in this area are still unresolved and need to be addressed in the future. The most interesting from the point of view of practical health care represents a direction to study the effect of exosomes and microvesicles in the development and progression of a particular disease, the possibility of adjusting the pathological process by means of extracellular vesicles of a particular type, acting as an active ingredient. Relevant is the further elucidation of the role and importance of exosomes to the surrounding cells, tissues and organs at the molecular level, the prospects for the use of non-cellular vesicles as biomarkers of disease.

  16. Autocrine signal transmission with extracellular ligand degradation

    International Nuclear Information System (INIS)

    Traveling waves of cell signaling in epithelial layers orchestrate a number of important processes in developing and adult tissues. These waves can be mediated by positive feedback autocrine loops, a mode of cell signaling where binding of a diffusible extracellular ligand to a cell surface receptor can lead to further ligand release. We formulate and analyze a biophysical model that accounts for ligand-induced ligand release, extracellular ligand diffusion and ligand–receptor interaction. We focus on the case when the main mode for ligand degradation is extracellular and analyze the problem with the sharp threshold positive feedback nonlinearity. We derive expressions that link the speed of propagation and other characteristics of traveling waves to the parameters of the biophysical processes, such as diffusion rates, receptor expression level, etc. Analyzing the derived expressions we found that traveling waves in such systems can exhibit a number of unusual properties, e.g. non-monotonic dependence of the speed of propagation on ligand diffusivity. Our results for the fully developed traveling fronts can be used to analyze wave initiation from localized perturbations, a scenario that frequently arises in the in vitro models of epithelial wound healing, and guide future modeling studies of cell communication in epithelial layers

  17. Induced drought tolerance through wild and mutant bacterial strain Pseudomonas simiae in mung bean (Vigna radiata L.).

    Science.gov (United States)

    Kumari, Sarita; Vaishnav, Anukool; Jain, Shekhar; Varma, Ajit; Choudhary, Devendra Kumar

    2016-01-01

    The present study focused on the overproducing mutant of a plant growth promoting rhizobacterium (PGPR) Pseudomonas simiae strain AU (MTCC-12057) for significant drought tolerance in mung bean plants. Five mutants namely AU-M1, AU-M2, AU-M3, AU-M4 and AU-M5 were made after treatment of wild type strain with N-methyl-N-nitro-N-nitrosoguanidine. Mutant strain AU-M4 was recorded for enhanced ACC deaminase (ACC-D) activity, indole acetic acid (IAA) production and inorganic phosphate (Pi) solubilization compared to wild strain and other four mutant strains under drought condition. AU-M4 showed higher phosphate solubilization index (8.17) together with higher ACC-D activity (98 nmol/mg/h) and IAA concentration (69.35 µg/ml) compared with the wild type P. simiae strain AU ACC-D activity (79 nmol/mg/h) and IAA concentration (38.98 µg/ml) respectively. In this report, we investigated the effect of both wild and mutant type bacterial strain on mung bean plants under drought stress. Results showed that mutant AU-M4 and wild type strain AU inoculated plants exhibited superior tolerance against drought stress, as shown by their enhanced plant biomass (fresh weight), higher water content, higher proline accumulation and lower osmotic stress injury. Mutant AU-M4 and wild strain AU inoculated plants reduced the ethylene level by 59 and 45% respectively, compared to the control under stress condition. Furthermore, bacterial inoculated plants showed enhanced induced systemic drought tolerance by reducing stomata size and net photosynthesis resulting higher water content in mung bean plants that may help in survival of plants during drought condition. To mitigate the effects of drought stress, use of PGPR will be needed to ensure sufficient production of food from crop plants. Taking current leads available, concerted future research is needed in this area, particularly on field evaluation with application of potential microorganisms. PMID:26712619

  18. Micro-fracture enhanced by autologous bone marrow mesenchymal stem cells extracellular matrix scaffold to treat articular cartilage defects in the knee of pigs%微骨折与自体骨髓间充质干细胞外基质支架修复猪膝关节软骨缺损

    Institute of Scientific and Technical Information of China (English)

    李祥全; 唐成; 宋科荣; 金成哲

    2014-01-01

    BACKGROUND:Micro-fracture surgery method is simple, easy to operate, which is an effective way to treat articular cartilage defects, but there are stil some problems such as regenerated fibrocartilage and regenerated cartilage degradation. Scholars have focused on the use of various methods to improve the micro-fracture effect on repairing cartilage defects. OBJECTIVE:To explore the effects of micro-fracture enhanced by autologous bone marrow mesenchymal stem cells extracellular matrix (aBMSC-dECM) scaffold for treating cartilage defects in minipig models. METHODS:Bone marrow was extracted from the minipigs and bone marrow mesenchymal stem cells were obtained. aBMSC-dECM membranes were col ected. Cross-linking and freeze-drying technology were used to make the three-dimensional porous aBMSC-dECM scaffold. Ful thickness cartilage defects, 2 mm in depth and 6 mm in diameter, were created on the femoral condyles and trochlea grooves of the two knees of the minipigs. The right knees were treated with micro-fracture as control and the left were treated with micro-fracture enhanced by aBMSC-dECM scaffold. Six months later, histological examination and Wakitani score were used to evaluate the cartilage regeneration, and glycosaminoglycans and DNA contents in the regenerative tissue were determined. RESULTS AND CONCLUSION:After 6 months, the tissue treated by micro-fracture enhanced by aBMSC-dECM scaffold got better surface and integrated with the surrounding cartilage. Safranin O and fast green staining and Masson staining showed that the regenerated cartilage of the left knee, with abundant matrix and dense bone trabeculae, was better than that of the right. Wakitani score of the left knee was higher than that of the right. Glycosaminoglycans content of the left knee was much more than that of the right, while the DNA content was lower in the left knee than the right knee. Better results were observed in the left knee undergoing micro-fracture enhanced by a

  19. Diversity and the role of yeast in spontaneous cocoa bean fermentation from Southeast Sulawesi, Indonesia

    Directory of Open Access Journals (Sweden)

    JAMILI

    2016-06-01

    Full Text Available Abstract. Jamili, Yanti NA, Susilowati PE. 2016. Diversity and the role of yeast in spontaneous cocoa bean fermentation from Southeast Sulawesi, Indonesia. Biodiversitas 17: 90-95. Yeast is one of the microbial group which is role in the process of cocoa spontaneously fermentation. The objective of this study was to determinate and to know the diversity of yeast that role on cocoa bean fermentation. Yeast was isolated by pour plate method from cocoa bean that was naturally fermented by a cocoa farmer in Kolaka District, Southeast Sulawesi using yeast mannitol agar (YMA media. Yeast was characterized and identified using phenotypic characters based on numeric-phenetic analysis. Yeast isolates applied to cocoa bean to determine its role in cocoa bean fermentation. The result was obtained seven isolates the dominant yeast during cocoa bean fermentation in Kolaka District, Southeast Sulawesi. The result of numerical-phenetic analysis based on phenotypic characters to seven yeast isolates showed that 1 isolates (Klk1 identical with Candida krusei. Three isolates (Klk4, Klk5 and Klk7 identical with Candida tropicalis, one isolate (Klk2 identical with Saccharomycopsis fibuligera, one isolate (Klk3 identical with Kloeckera sp. and one isolate (Klk6 identical with Saccharomyces cerevisiae. The result also showed that fermentation of cocoa with seeding of yeast inoculums served to increase the quality of cocoa beans than spontaneous fermentation. Therefore, the seven yeast isolates potentially be used as an inoculum to improve the cocoa quality.

  20. Effect of Radiation processing on sensory and chemical characteristics of broad beans (Giza,2)(Vicia Faba)

    International Nuclear Information System (INIS)

    Broad bean is the important leguminous protein consumed in egypt as a source of protein diet. The most popular way of preparing beans is the stewd form (Fool Medames). However, great losses due to insect infestation occur during storage. To combat these losses radiation processing has been used as an effective alternative of chemical fumigants to combat insect pets. The beans were irradiated at 25.5, 10 and kgy. The effects of treatments were investigated on sensory and chemical characteristics and on the solubility of broad beans protein, the amino acids content and on the nutritive value of bean protein from the view of its amino acids profile. The results of study indicate that the sensory evaluation of sewed irradiated 2.5 and 5 kGy samples revealed no significantdiffference in hardness, gumminess and acceptability. moreover, no significant changes in adhesivess, between samples irradiated at 5, 10 and 20 KGy, irradiation up to 20 KGy was found to improve the hardness of stewed broad bean which would improve the quality of broad of bean

  1. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    International Nuclear Information System (INIS)

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macacar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g-1 dry basis, 1.8 mg g-1 dry basis and 13.5 μmol g-1 dry basis in the raw non-irradiated Carioca beans and 0.30 mg g-1 dry basis, 0.42 mg g-1 dry basis and 7.5 μmol g-1 dry basis in the raw non-irradiated Macacar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macacar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties

  2. Hydration properties and texture fingerprints of easy- and hard-to-cook bean varieties.

    Science.gov (United States)

    Kinyanjui, Peter K; Njoroge, Daniel M; Makokha, Anselimo O; Christiaens, Stefanie; Ndaka, Daniel S; Hendrickx, Marc

    2015-01-01

    The objective of this study was to understand the factors that affect the hydration and cooking profiles of different bean varieties. During this study, nine bean varieties were classified as either easy-to-cook (ETC) or hard-to-cook (HTC) based on a subjective finger pressing test and an objective cutting test. Rose coco, Red haricot, and Zebra beans were classified as ETC, while Canadian wonder, Soya fupi, Pinto, non-nodulating, Mwezi moja, Gwaku, and New mwezi moja were HTC. The effect of different soaking (pre)-treatments on the cooking behavior and/or water absorption of whole or dehulled beans was investigated. Dehulling, soaking in high pH and monovalent salt solutions reduced the cooking time of beans, while soaking in low pH and CaCl2 solutions increased the cooking time. Moisture uptake was faster in ETC and dehulled beans. Soaking at high temperatures also increased the hydration rate. The results point to pectin-related aspects and the rate of water uptake as possible factors that influence the cooking rate of beans. PMID:25650021

  3. Influence of relative humidity on radiosensitivity of Aspergillus flavus Link. infecting cocoa beans

    International Nuclear Information System (INIS)

    The first part of this paper deals with the moisture sorption isotherms of dried cocoa beans under different relative humidities of 55, 65, 75, 85 or 95%. The second part evaluates the effects of relative humidity (RH), initial moisture content (m.c.) of cocoa beans, and different radiation exposure doses (0, 250, 350, 450, 500 or 550 krad) on Aspergillus flavus spore inoculated cocoa beans kept in fixed RH environmental chamber of 75 or 85% RH post-irradiation for forty days. The results discussed suggest that the m.c. of beans increased from an initial level of 6.4% to 7, 7.8 and 8.9% at 55, 65, and 75% respectively, after a storage period of 6-8 days. However, beans stored under 85% or 95% RH continued to absorb moisture from their respective environments indefinitely during the 64-day storage period. Furthermore, the ambient relative humidity to which the beans are subjected before or after irradiation significantly affect the radiosensitivity of toxigenic A. flavus; the differences in such radiosensitivity are influenced by either the available moisture or the initial m.c. of the beans to the inoculum. The authors conclude from their study that high environmental RH increased the radio-resistance of A. flavus spores making it difficult to establish a radiation decontamination level of practical value under a tropical environment with high ambient relative humidity. (author)

  4. Influence of Relative Humidity on Radiosensitivity of Aspergillus Flavus Link Infecting Cocoa Beans

    International Nuclear Information System (INIS)

    The first part of this paper deals with the moisture sorption isotherms of dried cocoa beans under different relative humidities of 55, 65, 75, 85 or 95%. The second part evaluates the effects of relative humidity (RH), initial moisture content (m.c.) of cocoa beans, and different radiation exposure doses (0, 250, 350, 450, 500 or 550 krad) on Aspergillus flavus spore inoculated cocoa beans kept in fixed RH environmental chamber of 75 or 85% RH postirradiation for forty days. The results discussed suggest that the m.c. of beans increased from an initial level of 6.4% to 7, 7.8 and 8.9% at 55, 65, and 75% respectively, after a storage period of 6-8 days. However, beans stored under 85% or 95% RH continued to absorb moisture from their respective environments indefinitely during the 64-day storage period. Furthermore, the ambient relative humidity to which the beans are subjected before or after irradiation significantly affect the radiosensitivity of toxigenic A. flavus; the differences in such radiosensitivity are influenced by either the available moisture or the initial m.c. of the beans to the inoculum. The authors conclude from their study that high environmental RH increased the radio-resistance of A. flavus spores making it difficult to establish a radiation decontamination level of practical value under a tropical environment with high ambient relative humidity. (author)

  5. Effect of edible coating on the aromatic attributes of roasted coffee beans.

    Science.gov (United States)

    Rattan, Supriya; Parande, A K; Ramalakshmi, K; Nagaraju, V D

    2015-09-01

    Coffee is known throughout the world for its distinct aroma and flavour which results from a number of volatile compounds present in it. It is very difficult to arrest the aromatic compounds once the roasting process is complete and it becomes even more challenging to store the beans for a longer time with the retained volatiles as these compounds are easily lost during industrialized processing such as the grinding of roasted coffee beans and storage of ground coffee. Thus, an attempt was made to minimise the loss of volatile from roasted coffee beans by coating with Carboxymethyl cellulose (CMC), Hydroxypropylmethyl cellulose (HPMC) and Whey protein concentrate. Coffee volatiles were analysed by Gas chromatography and 14 major compounds were identified and compared in this study. Results showed an increase in the relative area of major volatile compounds in coated roasted coffee beans when compared with unroasted coffee beans for consecutive two months. Moreover, effect of coating on textural properties and non-volatiles were also analysed. The results have indicated that edible coatings preserve the sensory properties of roasted coffee beans for a longer shelf life and cellulose derivatives, as an edible coating, exhibited the best protecting effect on roasted coffee beans. PMID:26344962

  6. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Science.gov (United States)

    Villavicencio, Anna Lucia C. H.; Mancini-Filho, Jorge; Delincée, Henry; Greiner, Ralf

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macaçar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g -1 dry basis, 1.8 mg g -1 dry basis and 13.5 μmol g -1 dry basis in the raw non-irradiated Carioca beans and 0.30 mg g -1 dry basis, 0.42 mg g -1 dry basis and 7.5 μmol g -1 dry basis in the raw non-irradiated Macaçar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macaçar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  7. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. E-mail: villavic@net.ipen.br; Mancini-Filho, Jorge E-mail: jmancini@usp.br; Delincee, Henry; Greiner, Ralf E-mail: ralf.greiner@bfe.uni-karlsruhe.de

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macacar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g{sup -1} dry basis, 1.8 mg g{sup -1} dry basis and 13.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Carioca beans and 0.30 mg g{sup -1} dry basis, 0.42 mg g{sup -1} dry basis and 7.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Macacar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macacar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  8. Relationship between Physiological Characteristic and Bean Quality on Some Cocoa Clones (Theobroma cacao L.

    Directory of Open Access Journals (Sweden)

    Indah Anita Sari

    2015-12-01

    Full Text Available Photosynthesis is one of the physiological process that influence the bean weight and this process related with the efectiveness of the stomata character and chlorophyll content in the leaves. The research was conducted at Kaliwining Research Station, Indonesian Coffee and Cocoa Research Institute. Design of experiment was randomized complete block design (RCBD consisted of six clones as treatment were Sulawesi 1, Sulawesi 2, Sca 6, ICS 60, TSH 858, ICCRI 03, PA 300. Each treatment was replicated three times.  Stomata resistance diffusion, tranpiration,the content of chlorophyll a, chlorophyll b, chlorophyll total (a+b, bean number and bean weight were observed. The resuts  of experiment showed that  difference in chlorophyll a, chlorophyll b, chlorophyll total (a+b, stomata resistance diffusion, bean number and bean weight existed within  six clones tested. Transpiration rate did not show the significantly different between six clones tested. Sulawesi 1 showed the highest content of chlorophyll a and  ICS 60 and ICCRI 03 showed higher content of chlorophyll b than the other clones. Chlorophyll a, b and total (a+b showed positively influence on bean number and bean weight. Transpiration rate had negatively influence to bean number per pod, on the otherhand it showed positively influence to bean weight. Chlorophyll total (a+b showed high genetic variance (σg2, high phenotypic variance (σf2  and high estimated value of heritability (H.  The chlorophyll a,b had moderate genetic variance, moderate phenotypic variance and high of estimated value of heritability.  Chlorophyll total (a+b could be used a selection criteria based on the value of correlation, genetic variance, phenotypic variance and estimated value of heritability would give high opportunity in selection process. 

  9. Bean responds to Endospor 33® at reduced dose of Nitrogen and

    Directory of Open Access Journals (Sweden)

    Juan Manuel Sanchez-Yañez

    2014-06-01

    Full Text Available Bean is a legume its production requires nitrogen (N combined as ammonium (NH4 or nitrate (NO3 and phosphates (NPF, its indiscriminate application causes soil lost productivity. An alternative solution for reducing and optimizing NPF is applying mixed inoculant which could be improved by plant growth promoting bacteria (PGPB and mycohrrizae. The objective of this research was to analyze the response of beans to mixed inoculant Endospor 33® at 50% reduced dose of NPF. In that sense a red ferralitic soil poor in N and organic matter was used. By experimental design: 5 treatments and 6 replications. Results showed a positive bean responds achieving 100% germination at 20mg/seed with Endospor 33® at 50% NPF dose. At seedling level bean was 6.63g of total fresh weight (TFW and 0.66g total dry weight (TDW with the same Endospor 33® dose compared to 0.28g of TDW of bean used as relative control (RC at 100% NPF dose. At flowering with 30 mg/plant got 1.5 g of TDW compared to 1.0g TDW of bean as CR. At physiological maturity bean with 30mg/plant had 34.83g/100 grains compared to 20.39g/grains of bean as CR. Those data supporting that Endopre 33® is an excellent choice in bean’s production at NPF 50% dose but not adverse effect on bean growth and yield in protected agriculture.

  10. In vitro starch digestibility and predicted glycemic index of corn tortilla, black beans, and tortilla-bean mixture: effect of cold storage.

    Science.gov (United States)

    Sáyago-Ayerdi, S G; Tovar, Juscelino; Osorio-Díaz, P; Paredes-López, Octavio; Bello-Pérez, Luis A

    2005-02-23

    People in the rural areas of Mexico consume corn tortillas and beans as basic components of their diet. However, little is known about the nutritionally relevant features of starch present in such combined meals. The objective of the present study was to evaluate the in vitro bioavailability of starch in tortilla-bean mixtures stored at 4 degrees C for different times, as compared to that of corn tortilla and boiled black beans kept separately under the same conditions. Available starch (AS), resistant starch (RS), and retrograded resistant starch (RRS) contents were measured. The in vitro starch hydrolysis indices (HI) of freshly cooked and cold-stored samples were evaluated using a chewing/dialysis digestion protocol. HIs were used to predict glycemic indices (pGI) of the samples. AS in tortilla and beans decreased between 3 and 6% after 48-72 h, whereas values in the mixture fell by 3% after 48 h, with no further change by 72 h. Only minor rises in RS contents (1.5-1.6%) were recorded for tortilla and beans after 72 h of storage, and a lower increase (0.4%) was recorded in the mixture. Judging from RRS values, an important proportion of RS is due to starch retrogradation. The HI and pGI were higher in tortilla than in bean and the mixture. Hydrolysis rate values decreased in the stored samples, a pattern that corresponded with RS and RRS changes. The slow digestion features of common beans are largely retained by the legume-tortilla combination. Data support the perceived health beneficial properties of starch in this traditional cereal-legume food. PMID:15713053

  11. Extracellular acidification induces connective tissue growth factor production through proton-sensing receptor OGR1 in human airway smooth muscle cells

    International Nuclear Information System (INIS)

    Highlights: → The involvement of extracellular acidification in airway remodeling was investigated. → Extracellular acidification alone induced CTGF production in human ASMCs. → Extracellular acidification enhanced TGF-β-induced CTGF production in human ASMCs. → Proton-sensing receptor OGR1 was involved in acidic pH-stimulated CTGF production. → OGR1 may play an important role in airway remodeling in asthma. -- Abstract: Asthma is characterized by airway inflammation, hyper-responsiveness and remodeling. Extracellular acidification is known to be associated with severe asthma; however, the role of extracellular acidification in airway remodeling remains elusive. In the present study, the effects of acidification on the expression of connective tissue growth factor (CTGF), a critical factor involved in the formation of extracellular matrix proteins and hence airway remodeling, were examined in human airway smooth muscle cells (ASMCs). Acidic pH alone induced a substantial production of CTGF, and enhanced transforming growth factor (TGF)-β-induced CTGF mRNA and protein expression. The extracellular acidic pH-induced effects were inhibited by knockdown of a proton-sensing ovarian cancer G-protein-coupled receptor (OGR1) with its specific small interfering RNA and by addition of the Gq/11 protein-specific inhibitor, YM-254890, or the inositol-1,4,5-trisphosphate (IP3) receptor antagonist, 2-APB. In conclusion, extracellular acidification induces CTGF production through the OGR1/Gq/11 protein and inositol-1,4,5-trisphosphate-induced Ca2+ mobilization in human ASMCs.

  12. Antimicrobial Effects of Ionizing Radiation on Artificially and Naturally Contaminated Cacao Beans

    OpenAIRE

    Restaino, L; Myron, J. J. J.; Lenovich, L M; Bills, S.; Tscherneff, K.

    1984-01-01

    With an initial microbial level of ca. 107 microorganisms per g of Ivory Coast cacao beans, 5 kGy of gamma radiation under an atmosphere of air reduced the microflora per g by 2.49 and 3.03 logs at temperatures of 35 and 50°C, respectively. Bahia cacao beans were artificially contaminated with dried spores of Aspergillus flavus and Penicillium citrinum, giving initial fungal levels of 1.9 × 104 and 1.4 × 103 spores per g of whole Bahia cacao beans, respectively. The average D10 values for A. ...

  13. Electron spin resonance (ESR) studies on irradiated cocoa beans and niger seeds

    International Nuclear Information System (INIS)

    Electron spin resonance (ESR) spectra of irradiated (10kGy) and unirradiated cocoa beans and niger seeds have been compared. Unirradiated cocoa beans failed to give any ESR signal, whereas after irradiation (10kGy) an ESR signal at g = 2.0042 was observed. However, ESR signals are given by both irradiated and unirradiated niger seeds. The intensity of signal was found to be dose-dependent up to 10kGy for both seeds. The signals were stable up to 180 days in both cases. The results indicate the possibility of using ESR for distinguishing between irradiated and unirradiated cocoa beans but not for niger seeds

  14. Seed borne mycoflora of castor bean (ricinus communis l.) from pakistan

    International Nuclear Information System (INIS)

    Castor bean seeds were analyzed by using ISTA (International seed testing association) for the detection of seed borne mycoflora. Thirty one fungal species belonging to 15 genera were isolated from 12 samples of castor bean seeds collected from different areas of Pakistan. Fusarium solani, Alternaria alternata, Cephaliophora tropica were most predominant fungal species isolated while the saprophytic fungi like A. niger, A. flavus were common in all samples of castor bean seed tested. Blotter method was considered to be better technique which gave maximum number of fungi followed by agar plate and deep freezing methods. (author)

  15. Pendimethalin Residues from Weed Management in Dry Bean Can Cause Injury in Autumn Seeded Winter Wheat

    OpenAIRE

    Nader Soltani; Christy Shropshire; Peter H. Sikkema

    2015-01-01

    There is little information on effect of pendimethalin residues in the soil used for weed management in dry bean, on winter wheat seeded 3 to 4 months after application in Ontario. A total of four field experiments were conducted over a four-year period (2008-2011) in Ontario to evaluate the effect of pendimethalin residues on winter wheat injury and yield grown in rotation with dry bean. Pendimethalin, applied PPI in dry bean, at 1080 and 2160 g ai ha-1 caused 1% to 3%...

  16. Hydration properties and texture fingerprints of easy- and hard-to-cook bean varieties

    OpenAIRE

    Kinyanjui, Peter; Njoroge, Daniel; Makokha, Anselimo; Christiaens, Stefanie; Sila, Daniel Ndaka; Hendrickx, Marc

    2014-01-01

    The objective of this study was to understand the factors that affect the hydration and cooking profiles of different bean varieties. During this study, nine bean varieties were classified as either easy-to-cook (ETC) or hard-to-cook (HTC) based on a subjective finger pressing test and an objective cutting test. Rose coco, Red haricot, and Zebra beans were classified as ETC, while Canadian wonder, Soya fupi, Pinto, non-nodulating, Mwezi moja, Gwaku, and New mwezi moja were HTC. The effect of ...

  17. Impact of Market Information System (E-Soko) on Beans Markets Integration: Case of Rwanda

    OpenAIRE

    Bizimana, Jean-Claude; Bessler, David A.; Angerer, Jay P.

    2013-01-01

    The goal of this study was to analyze the impact of a newly introduced market information system “E-Soko”, on beans markets integration by comparing the period before and after the system was implemented in Rwanda. Beans, both bush and climbing, are the most important traded crop in rural areas of Rwanda, and third most important in urban areas in terms of value. Bi-weekly prices on beans were analyzed for the two time periods: one before the introduction of the market information system “E-S...

  18. On the Peirce's "balancing reasons rule" failure in his "large bag of beans" example

    CERN Document Server

    D'Agostini, G

    2010-01-01

    Take a large bag of black and white beans, with all possible proportions considered initially equally likely, and imagine to make random extractions with reintroduction. Twenty consecutive observations of black make us highly confident that the next bean will be black too. On the contrary, the observation of 1010 black beans and 990 white ones leads us to judge the two possible outcomes about equally probable. According to C.S. Peirce this reasoning violates what he called "rule of balancing reasons", because the difference of "arguments" in favor and against the outcome of black is 20 in both cases. Why? (I.e. why does that rule not apply here?)

  19. The Pseudomonas aeruginosa extracellular secondary metabolite, Paerucumarin, chelates iron and is not localized to extracellular membrane vesicles.

    Science.gov (United States)

    Qaisar, Uzma; Kruczek, Cassandra J; Azeem, Muhammed; Javaid, Nasir; Colmer-Hamood, Jane A; Hamood, Abdul N

    2016-08-01

    Proteins encoded by the Pseudomonas aeruginosa pvcA-D operon synthesize a novel isonitrile functionalized cumarin termed paerucumarin. The pvcA-D operon enhances the expression of the P. aeruginosa fimbrial chaperone/usher pathway (cup) genes and this effect is mediated through paerucumarin. Whether pvcA-D and/or paerucumarin affect the expression of other P. aeruginosa genes is not known. In this study, we examined the effect of a mutation in pvcA-D operon the global transcriptome of the P. aeruginosa strain PAO1-UW. The mutation reduced the expression of several ironcontrolled genes including pvdS, which is essential for the expression of the pyoverdine genes. Additional transcriptional studies showed that the pvcA-D operon is not regulated by iron. Exogenously added paerucumarin enhanced pyoverdine production and pvdS expression in PAO1-UW. Iron-chelation experiments revealed that purified paerucumarin chelates iron. However, exogenously added paerucumarin significantly reduced the growth of a P. aeruginosa mutant defective in pyoverdine and pyochelin production. In contrast to other secondary metabolite, Pseudomonas quinolone signal (PQS), paerucumarin is not localized to the P. aeruginosa membrane vesicles. These results suggest that paerucumarin enhances the expression of iron-controlled genes by chelating iron within the P. aeruginosa extracellular environment. Although paerucumarin chelates iron, it does not function as a siderophore. Unlike PQS, paerucumarin is not associated with the P. aeruginosa cell envelope. PMID:27480638

  20. A comparison of antioxidative and anti-inflammatory activities of sword beans and soybeans fermented with Bacillus subtilis.

    Science.gov (United States)

    Han, Seon Su; Hur, Sun Jin; Lee, Si Kyung

    2015-08-01

    This study was conducted to determine the antioxidative and anti-inflammatory activities of non-fermented or Bacillus subtilis-fermented soybeans and sword beans (red and white). The total flavonoid content in both sword bean types was higher (1.9-2.5-fold) than that in soybeans. The total phenolic content in fermented red sword beans was 2.5-fold greater than that in non-fermented red sword beans. HPLC profiles revealed that gallic acid, methyl gallate, and ellagic acid were major phenolic components of non-fermented/fermented red sword beans. DPPH radical scavenging activity and ferric-reducing antioxidant power were higher in fermented red sword beans than in other beans. Non-fermented/fermented red sword beans had higher nitrite scavenging activity than butylated hydroxytoluene and non-fermented/fermented soybeans. The hyaluronidase inhibitory activity of non-fermented/fermented red sword beans was higher (1.5-2.6-fold) than that of non-fermented/fermented soybeans. These results suggest that B. subtilis-fermented sword beans are potential natural antioxidant sources and anti-inflammatory agents for the food industry. PMID:26149963

  1. Review: The Potential of the Common Bean (Phaseolus vulgaris as a Vehicle for Iron Biofortification

    Directory of Open Access Journals (Sweden)

    Nicolai Petry

    2015-02-01

    Full Text Available Common beans are a staple food and the major source of iron for populations in Eastern Africa and Latin America. Bean iron concentration is high and can be further increased by biofortification. A major constraint to bean iron biofortification is low iron absorption, attributed to inhibitory compounds such as phytic acid (PA and polyphenol(s (PP. We have evaluated the usefulness of the common bean as a vehicle for iron biofortification. High iron concentrations and wide genetic variability have enabled plant breeders to develop high iron bean varieties (up to 10 mg/100 g. PA concentrations in beans are high and tend to increase with iron biofortification. Short-term human isotope studies indicate that iron absorption from beans is low, PA is the major inhibitor, and bean PP play a minor role. Multiple composite meal studies indicate that decreasing the PA level in the biofortified varieties substantially increases iron absorption. Fractional iron absorption from composite meals was 4%–7% in iron deficient women; thus the consumption of 100 g biofortified beans/day would provide about 30%–50% of their daily iron requirement. Beans are a good vehicle for iron biofortification, and regular high consumption would be expected to help combat iron deficiency (ID.

  2. Expression of a methionine-rich storage albumin from the Brazil nut (Bertholletia excelsa H.B.K., Lecythidaceae in transgenic bean plants (Phaseolus vulgaris L., Fabaceae

    Directory of Open Access Journals (Sweden)

    Aragão F.J.L.

    1999-01-01

    Full Text Available Bean (Phaseolus vulgaris, an important component in the diet of people in developing countries, has low levels of the essential amino acid, methionine. We have attempted to correct this deficiency by introducing a transgene coding for a methionine-rich storage albumin from the Brazil nut via biolistic methods. The transgene's coding sequence was driven by a doubled 35S CaMV promoter and AMV enhancer sequences. The transgene was stable and correctly expressed in homozygous R2 to R5 seeds. In two of the five transgenic lines the methionine content was significantly increased (14 and 23% over the values found in untransformed plants.

  3. Effect of Botrytis cinerea infection and elicitation on ß-1,3-glucanase and chitinase activity in bean leaves and cell cultures

    Directory of Open Access Journals (Sweden)

    Elżbieta Kuźniak

    2013-12-01

    Full Text Available The activity of ß-1,3-glucanase and chitinase in bean plants treated with B. cinerea products or/and infected and in cell cultures after application of fungal products has been studied. Botrytis cinerea infection and culture filtrates, ethanol precipitates, glucan and conidial extract treatment markedly enhanced the activity of both hydrolases. Cell cultures treated with B.cinerea products reacted similarly to intact plants. In plants pretreated with 2-day culture filtrate and conidial extract and then infected, ß-1,3-glucanase and chitinase were induced stronger than after infection without pretreatment.

  4. Protein profiles and organoleptic properties of bread from wheat flour and full-fat or defatted fermented cocoa bean powder.

    Science.gov (United States)

    Aremu, C Y; Agiang, M A; Ayatse, J O

    1995-12-01

    This study has shown that the protein in bread may be quantitatively increased significantly by addition of full-fat or defatted cocoa powder to white flour. The recipe in which white flour is incorporated with up to 10 percent defatted cocoa powder gives bread that is nearly as well accepted as white bread, but with a significantly higher protein content than the latter. However, organoleptic acceptability drops with increasing percentage of cocoa supplementation. The bitter taste of theobromine, which is normally present in high amounts in cocoa bean, is thought to be responsible for this problem of poor acceptability of high cocoa breads. This problem will have to be addressed in order to enhance the scope of increasing bread protein by cocoa supplementation. PMID:8882367

  5. Viability and stability of biological control agents on cotton and snap bean seeds.

    Science.gov (United States)

    Elliott, M L; Des Jardin, E A; Batson, W E; Caceres, J; Brannen, P M; Howell, C R; Benson, D M; Conway, K E; Rothrock, C S; Schneider, R W; Ownley, B H; Canaday, C H; Keinath, A P; Huber, D M; Sumner, D R; Motsenbocker, C E; Thaxton, P M; Cubeta, M A; Adams, P D; Backman, P A; Fajardo, J; Newman, M A; Pereira, R M

    2001-08-01

    Cotton and snap bean were selected for a multi-year, multi-state regional (south-eastern USA) research project to evaluate the efficacy of both commercial and experimental bacterial and fungal biological control agents for the management of damping-off diseases. The goal for this portion of the project was to determine the viability and stability of biological agents after application to seed. The biological seed treatments used included: (1) Bacillaceae bacteria, (2) non-Bacillaceae bacteria, (3) the fungus Trichoderma and (4) the fungus Beauveria bassiana. Seed assays were conducted to evaluate the following application factors: short-term (seed treatment; quality (i.e. isolate purity); compatibility with chemical pesticides and other biocontrol agents; application uniformity between years and plant species. For the bacterial treatments, the Bacillaceae genera (Bacillus and Paenibacillus) maintained the greatest population of bacteria per seed, the best viability over time and the best application uniformity across years and seed type. The non-Bacillaceae genera Burkholderia and Pseudomonas had the least viability and uniformity. Although Beauveria bassiana was only evaluated one year, the seed fungal populations were high and uniform. The seed fungal populations and uniformity for the Trichoderma isolates were more variable, except for the commercial product T-22. However, this product was contaminated with a Streptomyces isolate in both the years that it was evaluated. The study demonstrated that Bacillaceae can be mixed with Trichoderma isolates or with numerous pesticides to provide an integrated pest control/growth enhancement package. PMID:11517723

  6. Salt Effect on the Antioxidant Activity of Red Microalgal Sulfated Polysaccharides in Soy-Bean Formula

    Directory of Open Access Journals (Sweden)

    Ariela Burg

    2015-10-01

    Full Text Available Sulfated polysaccharides produced by microalgae, which are known to exhibit various biological activities, may potentially serve as natural antioxidant sources. To date, only a few studies have examined the antioxidant bioactivity of red microalgal polysaccharides. In this research, the effect of different salts on the antioxidant activities of two red microalgal sulfated polysaccharides derived from Porphyridium sp. and Porphyridium aerugineum were studied in a soy bean-based infant milk formula. Salt composition and concentration were both shown to affect the polysaccharides’ antioxidant activity. It can be postulated that the salt ions intefer with the polysaccharide chains’ interactions and alter their structure, leading to a new three-dimensional structure that better exposes antiooxidant sites in comparison to the polysaccharide without salt supplement. Among the cations that were studied, Ca2+ had the strongest enhancement effect on antioxidant activities of both polysaccharides. Understanding the effect of salts on polysaccharides’ stucture, in addition to furthering knowledge on polysaccharide bioactivities, may also shed light on the position of the antioxidant active sites.

  7. Nitrate regulates rhizobial and mycorrhizal symbiosis in common bean (Phaseolus vulgaris L.)

    Institute of Scientific and Technical Information of China (English)

    Kalpana Nanjareddy; Lourdes Blanco; Manoj-Kumar Arthikala; Xochitl Alvarado Affantrange; Federico Snchez; Miguel Lara

    2014-01-01

    Nitrogen-limited conditions are considered to be a prerequisite for legume-rhizobial symbiosis, but the effects of nitrate-rich conditions on symbiotic status remain poorly understood. We addressed this issue by examining rhizobial (Rhizobim tropici) and arbusclar mycorrhizal (Glomus intraradices) symbiosis in Phaseolus vulgaris L. cv. Negro Jamapa under nitrate pre-incubation and continuous nitrate conditions. Our results indicate that nitrate pre-incubation, independent of the concentration, did not affect nodule development. However, the continuous supply of nitrate at high concentrations impaired nodule maturation and nodule numbers. Low nitrate conditions, in addition to positively regulating nodule number, biomass, and nitrogenase activity, also extended the span of nitrogen-fixing activity. By contrast, for arbuscular mycorrhizae, continuous 10 and 50 mmol/L nitrate increased the percent root length colonization, concomitantly reduced arbuscule size, and en-hanced ammonia transport without affecting phosphate transport. Therefore, in this manuscript, we have proposed the importance of nitrate as a positive regulator in promoting both rhizobial and mycorrhizal symbiosis in the common bean.

  8. Neutrophil extracellular traps in sheep mastitis.

    Science.gov (United States)

    Pisanu, Salvatore; Cubeddu, Tiziana; Pagnozzi, Daniela; Rocca, Stefano; Cacciotto, Carla; Alberti, Alberto; Marogna, Gavino; Uzzau, Sergio; Addis, Maria Filippa

    2015-01-01

    Neutrophil extracellular traps (NETs) are structures composed of DNA, histones, and antimicrobial proteins that are released extracellularly by neutrophils and other immune cells as a means for trapping and killing invading pathogens. Here, we describe NET formation in milk and in mammary alveoli of mastitic sheep, and provide a dataset of proteins found in association to these structures. Nucleic acid staining, immunomicroscopy and fluorescent in-situ hybridization of mastitic mammary tissue from sheep infected with Streptococcus uberis demonstrated the presence of extranuclear DNA colocalizing with antimicrobial proteins, histones, and bacteria. Then, proteomic analysis by LTQ-Orbitrap Velos mass spectrometry provided detailed information on protein abundance changes occurring in milk upon infection. As a result, 1095 unique proteins were identified, of which 287 being significantly more abundant in mastitic milk. Upon protein ontology classification, the most represented localization classes for upregulated proteins were the cytoplasmic granule, the nucleus, and the mitochondrion, while function classes were mostly related to immune defence and inflammation pathways. All known NET markers were massively increased, including histones, granule proteases, and antimicrobial proteins. Of note was the detection of protein arginine deiminases (PAD3 and PAD4). These enzymes are responsible for citrullination, the post-translational modification that is known to trigger NET formation by inducing chromatin decondensation and extracellular release of NETs. As a further observation, citrullinated residues were detected by tandem mass spectrometry in histones of samples from mastitic animals. In conclusion, this work provides novel microscopic and proteomic information on NETs formed in vivo in the mammary gland, and reports the most complete database of proteins increased in milk upon bacterial mastitis. PMID:26088507

  9. Anomalous extracellular diffusion in rat cerebellum.

    Science.gov (United States)

    Xiao, Fanrong; Hrabe, Jan; Hrabetova, Sabina

    2015-05-01

    Extracellular space (ECS) is a major channel transporting biologically active molecules and drugs in the brain. Diffusion-mediated transport of these substances is hindered by the ECS structure but the microscopic basis of this hindrance is not fully understood. One hypothesis proposes that the hindrance originates in large part from the presence of dead-space (DS) microdomains that can transiently retain diffusing molecules. Because previous theoretical and modeling work reported an initial period of anomalous diffusion in similar environments, we expected that brain regions densely populated by DS microdomains would exhibit anomalous extracellular diffusion. Specifically, we targeted granular layers (GL) of rat and turtle cerebella that are populated with large and geometrically complex glomeruli. The integrative optical imaging (IOI) method was employed to evaluate diffusion of fluorophore-labeled dextran (MW 3000) in GL, and the IOI data analysis was adapted to quantify the anomalous diffusion exponent dw from the IOI records. Diffusion was significantly anomalous in rat GL, where dw reached 4.8. In the geometrically simpler turtle GL, dw was elevated but not robustly anomalous (dw = 2.6). The experimental work was complemented by numerical Monte Carlo simulations of anomalous ECS diffusion in several three-dimensional tissue models containing glomeruli-like structures. It demonstrated that both the duration of transiently anomalous diffusion and the anomalous exponent depend on the size of model glomeruli and the degree of their wrapping. In conclusion, we have found anomalous extracellular diffusion in the GL of rat cerebellum. This finding lends support to the DS microdomain hypothesis. Transiently anomalous diffusion also has a profound effect on the spatiotemporal distribution of molecules released into the ECS, especially at diffusion distances on the order of a few cell diameters, speeding up short-range diffusion-mediated signals in less permeable

  10. Extracellular Signatures as Indicators of Processing Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wahl, Karen L.

    2012-01-09

    As described in other chapters within this volume, many aspects of microbial cells vary with culture conditions and therefore can potentially be analyzed as forensic signatures of growth conditions. In addition to changes or variations in components of the microbes themselves, extracellular materials indicative of production processes may remain associated with the final bacterial product. It is well recognized that even with considerable effort to make pure products such as fine chemicals or pharmaceuticals, trace impurities from components or synthesis steps associated with production processes can be detected in the final product. These impurities can be used as indicators of production source or methods, such as to help connect drugs of abuse to supply chains. Extracellular residue associated with microbial cells could similarly help to characterize production processes. For successful growth of microorganisms on culture media there must be an available source of carbon, nitrogen, inorganic phosphate and sulfur, trace metals, water and vitamins. The pH, temperature, and a supply of oxygen or other gases must also be appropriate for a given organism for successful culture. The sources of these components and the range in temperature, pH and other variables has adapted over the years with currently a wide range of possible combinations of media components, recipes and parameters to choose from for a given organism. Because of this wide variability in components, mixtures of components, and other parameters, there is the potential for differentiation of cultured organisms based on changes in culture conditions. The challenge remains how to narrow the field of potential combinations and be able to attribute variations in the final bacterial product and extracellular signatures associated with the final product to information about the culture conditions or recipe used in the production of that product.

  11. Effects of sleep deprivation on extracellular serotonin in hippocampus and frontal cortex of the rat

    OpenAIRE

    2002-01-01

    Sleep deprivation improves the mood of depressed patients, but the exact mechanism behind this effect is unclear. An enhancement of serotonergic neurotransmission has been suggested. In this study, we used in vivo microdialysis to monitor extracellular serotonin in the hippocampus and the frontal cortex of rats during an 8 h sleep deprivation period. These brain regions were selected since both have been implicated in depression. The behavioral state of the animal was continuously monitored b...

  12. Bromelain Surface Modification Increases the Diffusion of Silica Nanoparticles in the Tumor Extracellular Matrix

    OpenAIRE

    Parodi, Alessandro; Haddix, Seth G.; Taghipour, Nima; Scaria, Shilpa; Taraballi, Francesca; Cevenini, Armando; Yazdi, Iman K.; Corbo, Claudia; Palomba, Roberto; Khaled, Sm Z.; Martinez, Jonathan O.; Brown, Brandon S.; Isenhart, Lucas; Tasciotti, Ennio

    2014-01-01

    Tumor extracellular matrix (ECM) represents a major obstacle to the diffusion of therapeutics and drug delivery systems in cancer parenchyma. This biological barrier limits the efficacy of promising therapeutic approaches including the delivery of siRNA or agents intended for thermoablation. After extravasation due to the enhanced penetration and retention effect of tumor vasculature, typical nanotherapeutics are unable to reach the nonvascularized and anoxic regions deep within cancer parenc...

  13. Aquaporins in Urinary Extracellular Vesicles (Exosomes)

    Science.gov (United States)

    Oshikawa, Sayaka; Sonoda, Hiroko; Ikeda, Masahiro

    2016-01-01

    Since the successful characterization of urinary extracellular vesicles (uEVs) by Knepper’s group in 2004, these vesicles have been a focus of intense basic and translational research worldwide, with the aim of developing novel biomarkers and therapeutics for renal disease. Along with these studies, there is growing evidence that aquaporins (AQPs), water channel proteins, in uEVs have the potential to be diagnostically useful. In this review, we highlight current knowledge of AQPs in uEVs from their discovery to clinical application. PMID:27322253

  14. Extracellular polymeric bacterial coverages as minimal surfaces

    CERN Document Server

    Saa, A; Saa, Alberto; Teschke, Omar

    2005-01-01

    Surfaces formed by extracellular polymeric substances enclosing individual and some small communities of {\\it Acidithiobacillus ferrooxidans} on plates of hydrophobic silicon and hydrophilic mica are analyzed by means of atomic force microscopy imaging. Accurate nanoscale descriptions of such coverage surfaces are obtained. The good agreement with the predictions of a rather simple but realistic theoretical model allows us to conclude that they correspond, indeed, to minimal area surfaces enclosing a given volume associated with the encased bacteria. This is, to the best of our knowledge, the first shape characterization of the coverage formed by these biomolecules, with possible applications to the study of biofilms.

  15. Biogenesis, delivery, and function of extracellular RNA

    Directory of Open Access Journals (Sweden)

    James G. Patton

    2015-08-01

    Full Text Available The Extracellular RNA (exRNA Communication Consortium was launched by the National Institutes of Health to focus on the extent to which RNA might function in a non-cell-autonomous manner. With the availability of increasingly sensitive tools, small amounts of RNA can be detected in serum, plasma, and other bodily fluids. The exact mechanism(s by which RNA can be secreted from cells and the mechanisms for the delivery and uptake by recipient cells remain to be determined. This review will summarize current knowledge about the biogenesis and delivery of exRNA and outline projects seeking to understand the functional impact of exRNA.

  16. Extracellular matrix of the developing ovarian follicle.

    Science.gov (United States)

    Irving-Rodgers, Helen F; Rodgers, Raymond J

    2006-09-01

    There are many different types of extracellular matrices in the different follicle compartments. These have different roles in follicle development and atresia, and they change in composition during these processes. This review focuses on basal lamina matrix in particular, and considers follicular fluid, the newly identified focimatrix, and thecal matrices. When follicles commence growing, the follicular basal lamina changes in its composition from containing all six alpha chains of type IV collagen to only alpha1 and alpha2. Perlecan and nidogen-1 and -2 subsequently become components of the follicular basal lamina, and there is an increase in the amount of laminin chains alpha1, beta2, and gamma1, in the bovine at least. Late in follicular development and on atresia some follicles contain laminin alpha2. On atresia the follicular basal lamina is not degraded, as occurs in ovulation, but can be breached by cells from the thecal layer when it is not aligned by granulosa cells. A novel type of basal lamina-like matrix, called focimatrix (abbreviated from focal intraepithelial matrix), develops between the cells of the membrana granulosa as aggregates of basal lamina material. It does not envelop cells and so cannot perform functions of basal lamina as currently understood. It is hypothesized that focimatrix assists or initiates depolarization of the membrana granulosa necessary for the transformation into luteal cells. The largest osmotically active molecules in follicular fluid are hyaluronan and chondroitin sulfate proteoglycans, including versican and inter-alpha trypsin inhibitor. It has been suggested that these might be responsible for the formation of follicular fluid by creating an osmotic gradient across the follicular wall. The formation, development, and then either ovulation or regression of follicles requires considerable tissue remodeling, cellular replication, and specialization. The expectation of researchers is that extracellular matrix will be

  17. Aquaporins in Urinary Extracellular Vesicles (Exosomes).

    Science.gov (United States)

    Oshikawa, Sayaka; Sonoda, Hiroko; Ikeda, Masahiro

    2016-01-01

    Since the successful characterization of urinary extracellular vesicles (uEVs) by Knepper's group in 2004, these vesicles have been a focus of intense basic and translational research worldwide, with the aim of developing novel biomarkers and therapeutics for renal disease. Along with these studies, there is growing evidence that aquaporins (AQPs), water channel proteins, in uEVs have the potential to be diagnostically useful. In this review, we highlight current knowledge of AQPs in uEVs from their discovery to clinical application. PMID:27322253

  18. Effect of γ-irradiation on soya bean proteins

    International Nuclear Information System (INIS)

    The properties of soya beans proteins following γ-irradiation (5-20 kGy) were investigated in connection with protein denaturation. Irradiation doses above 10 kGy caused a decrease in 7S and 11S components and an increase in 2S and 15S components (P < 0.05). However, subunit patterns determined by electrophoresis were not changed appreciably over the entire irradiation dose range. In the differential scanning calorimetry thermogram, the denaturation temperatures of 11S and 7S components were not affected by γ-irradiation, while increased irradiation dose caused a decrease in the enthalpy values of 11S and 7S components due to protein denaturation. Changes in the circular dichroism spectra and tryptophan fluorescence intensity (P < 0.05) were observed only at 20 kGy. (author)

  19. Three mimic mutants for reclining foliage in common bean

    International Nuclear Information System (INIS)

    Two new mutants for the reclining foliage (RF) character were induced by treating seed of dry bean (Phaseolus vulgaris L.) breeding lines B-351 and 182-1 with 20 krad of .gamma.-radiation. These two mutants were shown to be monogenic and recessive. Allelism tests between the common RF gene rf and the two new mimic mutants for RF indicated that each of the three mutants has an independent locus. The symbols rf2 and rf3 were given to the new mutants. F2 data from the allelism tests showed that the rf2 stock carries a recessive epistatic gene in that does not affect rf2 but suppresses expression of rf and rf3. The rf locus was shown to be independent of the Sur locus for RF in linkage group VII

  20. NOTE - Contribution of components of production on snap bean yield

    Directory of Open Access Journals (Sweden)

    Rogério Figueiredo Daher

    2012-09-01

    Full Text Available Aiming to estimate the path coefficients among morphological traits and effects of production components on the yield of grains and pods, thirty snap bean genotypes (27 lines and three commercial controls were evaluated in Bom Jesus of Itabapoana-RJ. The experiments were carried out in a randomized block design, with four replications, from May to June, in 2009 and 2010. Eight traits were evaluated and the number of pods per plant, associated with high genetic correlation, is the character with the most significant direct effect on productivity. There is a high rate of genotypic association between the yields of pods and grains, as well as direct effects of high magnitude and positive signal between them, indicating that the selection for increased pod yield allows increased grain yield.

  1. Water dynamics in a bean crop (Phaseolus vulgaris)

    International Nuclear Information System (INIS)

    The dynamics of water was studied at 'La Tola', Experimental Teaching Center of the Central University of Ecuador, in a Sandy-Ioan, typic Haplustoll soil, in wich beans were growing. All the components of the crop water balance were determined. Real evapotranspiration was in direct relation to the growth of the crop, reaching its maximum value of 4.9 mm day-1, at pod setting, then decreasing slowly until maturation of the kernels. Up to 1 meter depth, water loss by drainage depended on rainfall, reaching up to 24% of the total water loss: the soil layer supplying most of the water for the use of the crop was between 0-40 cm, where the root activity was greatest

  2. Early selection of agronomic traits in segregating black bean populations

    Directory of Open Access Journals (Sweden)

    Juliano Garcia Bertoldo

    2010-01-01

    Full Text Available This study evaluated the agronomic performance of six segregating populations of black bean (BRS Supremo x CHP 97-01, BRS Supremo x CHP 97-04, BRS Supremo x CHP 97-05-16, BRS Supremo x CHP 97-26, BRS Supremo x IPR Graúna and BRS Supremo x Uirapuru IPR in the F3 generation, conducted by the bulk method. Populations and parents were evaluated in the 2007/08 growing season in a randomized block design with four replications. Results show promising traits of the segregating population BRS Supremo x CHP 97-04, which was superior to parent BRS Supremo, indicating the line for further selection. The segregating populations and their parents were grouped by Ward’s method, indicating the similarity of the selected lines.

  3. Confirmation of bean leaf beetle, Cerotoma trifurcata, feeding on cucurbits

    Directory of Open Access Journals (Sweden)

    R.L. Koch

    2004-02-01

    Full Text Available The objective of these studies was to assess the degree to which bean leaf beetle, Cerotoma trifurcata (Forster, will feed on cucurbits. In 2003, we documented an infestation of C. trifurcata in a commercial pumpkin field near Rosemount, MN, USA. To evaluate C. trifurcata feeding on cucurbits, we conducted laboratory no-choice and choice test feeding studies. In the laboratory, C. trifurcata fed most heavily on cotyledon-stage cucumber plants, followed by pumpkin and squash. With soybean plants present, C. trifurcata still fed on cucumber plants. However, C. trifurcata appeared to prefer soybeans until the quality of the soybean plants was diminished through feeding damage. This is the first known report of C. trifurcata feeding on cucurbits. The pest potential of C. trifurcata in cucurbit cropping systems should be further evaluated.

  4. Fate of labelled allitin in bean plant and mosquito

    International Nuclear Information System (INIS)

    Allitin, the insecticidal principle of garlic (Allium sativum L) is a mixture of diallyl di- and tri-sulfides. 35S-labelled allitin has been synthesised using different methods and used for the evaluation of its persistence in water. Results of these experiments showed that allitin has low persistence; more than 80% of the initial radioactivity was lost in 24 hr. when an aqueous emulsion of labelled allitin was exposed under the laboratory conditions. Fate of labelled allitin was studied in larvae and pupae of mosquitoes, Culex pipiens quinquefasciatus Say. Assimilation of allitin was found to be faster in larva compared to pupa. Intake of allitin by bean plant was also studied. Implications of the results obtained in the above experiments will be discussed. (author)

  5. Antimicrobial effects of ionizing radiation on artificially and naturally contaminated cacao beans

    International Nuclear Information System (INIS)

    With an initial microbial level of ca. 107 microorganisms per g of Ivory Coast cacao beans, 5 kGy of gamma radiation from a Co60 source under an atmosphere of air reduced the microflora per g by 2.49 and 3.03 logs at temperatures of 35 and 500C, respectively. Bahia cacao beans were artificially contaminated with dried spores of Aspergillus flavus and Penicillium citrinum, giving initial fungal levels of 1.9 x 104 and 1.4 x 103 spores per g of whole Bahia cacao beans, respectively. The average D10 values for A. flavus and P. citrinum spores on Bahia cacao beans were 0.66 and 0.88 kGy, respectively. 12 references

  6. Transcriptome Sequencing of Lima Bean (Phaseolus lunatus to Identify Putative Positive Selection in Phaseolus and Legumes

    Directory of Open Access Journals (Sweden)

    Fengqi Li

    2015-07-01

    Full Text Available The identification of genes under positive selection is a central goal of evolutionary biology. Many legume species, including Phaseolus vulgaris (common bean and Phaseolus lunatus (lima bean, have important ecological and economic value. In this study, we sequenced and assembled the transcriptome of one Phaseolus species, lima bean. A comparison with the genomes of six other legume species, including the common bean, Medicago, lotus, soybean, chickpea, and pigeonpea, revealed 15 and 4 orthologous groups with signatures of positive selection among the two Phaseolus species and among the seven legume species, respectively. Characterization of these positively selected genes using Non redundant (nr annotation, gene ontology (GO classification, GO term enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analyses revealed that these genes are mostly involved in thylakoids, photosynthesis and metabolism. This study identified genes that may be related to the divergence of the Phaseolus and legume species. These detected genes are particularly good candidates for subsequent functional studies.

  7. Crop physiological analysis of seed quality variation in common bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Muasya, R.M.

    2001-01-01

    Keywords : Physiological maturity, harvest maturity, earliness, common bean, Phaseolus vulgaris L., morphological markers, variation, moisture content, dry weight, viability, vigour, electrical conductivity, tetrazolium, seed lot, seed filling, maturation drying, temperature, rainfa

  8. Analysis of Determinants of Productivity and Technical Efficiency among Smallholder Common Bean Farmers in Eastern Uganda

    Directory of Open Access Journals (Sweden)

    K.W. Sibiko

    2013-09-01

    Full Text Available The study evaluated factors influencing bean productivity and technical efficiency among smallholder farmers in Eastern Uganda, using a stochastic frontier model and a Tobit model. Findings showed that bean productivity was significantly influenced by plot-size, seeds and planting fertilizer; mean technical efficiency for sampled farms was 48.2%. The Tobit model estimation revealed that technical efficiency was positively influenced by value of assets (at 1% level, extension service and group membership (at 5% level; while age and distance to the factor market negatively influenced technical efficiency at 10 and 5% levels respectively. Hence the study recommended the need for increased provision of extension service and training on correct input application and improved farming technologies to increase bean productivity. It also suggested the need for policy to discourage land fragmentation, develop road and market infrastructure in rural areas and encourage further formation of well managed farmer groups to improve production efficiency of bean farms.

  9. Nutritional analyses for proteins and amino acids in beans (Phaseolus sp.

    Directory of Open Access Journals (Sweden)

    Wathelet B.

    1999-01-01

    Full Text Available The chemical index is a good estimator of seed protein quality of Phaseolus beans. In order to estimate this value, a protein hydrolysis and amino acid quantification are realised. The problems inherent to these techniques are presented.

  10. INFLUENCE OF ROOT COLONIZING BACTERIA ON THE DEFENSE RESPONSES OF BEAN

    Science.gov (United States)

    Colonization of plant roots by fluorescent pseudomonads has been correlated with disease suppression. ne mechanism may involve altered defense responses in the plant upon colonization. ltered defense responses were observed in bean (Phaseolus vulgaris) inoculated with fluorescent...

  11. Research on Development Strategy of Industry of Edible Beans in West China

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The West China is main producing region and advantageous producing region of edible beans. Developing industry of edible beans in West China has prominent regional advantage, production advantage, quality advantage, market advantage, and price advantage. We analyze the problems existing in the process of development of industry of edible beans in West China as follows: the cognition is insufficient; fund for scientific research is short; the basic research is weak; the planting is sparse; the industrialization is not sound; the information is restricted. Corresponding suggestions are put forward in this paper as follows, in order to ensure the healthy development of industry of edible beans in China: formulate preferential policies; establish high-quality edible producing bases; promote the brand effect; pay attention to post-production development; develop the idea of new agricultural planting and cultivation.

  12. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos; Frisvad, Jens Christian; Samson, Robert A.

    2008-01-01

    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles) and...

  13. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  14. Fumonisin B2 production by Aspergillus niger in Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, P.; Mahakarnchanaku, W.; Nielsen, Kristian Fog;

    2009-01-01

    During 2006 and 2007, a total of 64 Thai dried coffee bean samples (Coffea arabica) from two growing sites in Chiangmai Province and 32 Thai dried coffee bean samples (Coffea canephora) from two growing sites in Chumporn Province, Thailand, were collected and assessed for fumonisin contamination...... by black Aspergilli. No Fusarium species known to produce fumonisin were detected, but black Aspergilli had high incidences on both Arabica and Robusta Thai coffee beans. Liquid chromatography (LC) with high-resolution mass spectrometric (HRMS) detection showed that 67% of Aspergillus niger isolates from...... coffee beans were capable of producing fumonisins B2 (FB2) and B4 when grown on Czapek Yeast Agar with 5% NaCl. Small amounts (1-9.7 ng g-1) of FB2 were detected in seven of 12 selected coffee samples after ion-exchange purification and LC-MS/MS detection. Two samples also contained FB4...

  15. The effect of bean origin and temperature on grinding roasted coffee

    Science.gov (United States)

    Uman, Erol; Colonna-Dashwood, Maxwell; Colonna-Dashwood, Lesley; Perger, Matthew; Klatt, Christian; Leighton, Stephen; Miller, Brian; Butler, Keith T.; Melot, Brent C.; Speirs, Rory W.; Hendon, Christopher H.

    2016-04-01

    Coffee is prepared by the extraction of a complex array of organic molecules from the roasted bean, which has been ground into fine particulates. The extraction depends on temperature, water chemistry and also the accessible surface area of the coffee. Here we investigate whether variations in the production processes of single origin coffee beans affects the particle size distribution upon grinding. We find that the particle size distribution is independent of the bean origin and processing method. Furthermore, we elucidate the influence of bean temperature on particle size distribution, concluding that grinding cold results in a narrower particle size distribution, and reduced mean particle size. We anticipate these results will influence the production of coffee industrially, as well as contribute to how we store and use coffee daily.

  16. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos;

    2008-01-01

    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles...

  17. Toxic metabolities of disulfoton: behavior in bean-seedlings, in soil, and in nutrient solution

    International Nuclear Information System (INIS)

    The absorption, translocation and degradation in bean-seedlings of three toxic metabolites of the pesticide 14C- disulfoton from nutrient solution or three different types of Brazilian soils is studied. (M.A.C.)

  18. Stem Rot on Adzuki Bean (Vigna angularis) Caused by Rhizoctonia solani AG 4 HGI in China.

    Science.gov (United States)

    Sun, Suli; Xia, Changjian; Zhang, Jiqing; Duan, Canxing; Wang, Xiaoming; Wu, Xiaofei; Lee, Suk-Ha; Zhu, Zhendong

    2015-03-01

    During late August and early September 2011, stem rot symptoms were observed on adzuki bean plants (Vigna angularis) growing in fields located in Beijing and Hebei Province, China, respectively. In this study, four isolates were obtained from infected stems of adzuki bean plants. Based on their morphology, and sequence and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analyses of the ribosomal DNA internal transcribed spacers (rDNA-ITS) region, the four isolates were identified as Rhizoctonia solani in anastomosis group (AG) 4 HGI. Pathogenicity tests showed that all isolates were strongly pathogenic to adzuki bean and resulted in serious wilt symptoms which was similar to observations in the fields. Additionally, the isolates infected several other crops and induced related rot on the roots and basal stems. To our knowledge, this is the first report of Rhizoctonia solani AG 4 HGI causing stem rot on adzuki bean. PMID:25774112

  19. Black bean (Phaseolus vulgaris L.) protein hydrolysates: Physicochemical and functional properties.

    Science.gov (United States)

    Evangelho, Jarine Amaral do; Vanier, Nathan Levien; Pinto, Vânia Zanella; Berrios, Jose J De; Dias, Alvaro Renato Guerra; Zavareze, Elessandra da Rosa

    2017-01-01

    Black bean protein hydrolysates obtained from pepsin and alcalase digestions until 120min of hydrolysis were evaluated by gel electrophoresis, relative fluorescence intensity, emulsifying properties, light micrograph of emulsions and in vitro antioxidant activity. The emulsion stability of the bean protein hydrolysates were evaluated during 30days of storage. The pepsin-treated bean protein hydrolysates presented higher degree of hydrolysis than the alcalase-treated protein hydrolysates. The alcalase-treated bean protein hydrolysates showed higher surface hydrophobicity. Moreover, the protein hydrolysates obtained with alcalase digestion presented higher emulsion stability during 30-days than those obtained from pepsin digestion. The protein concentrate and especially the hydrolysates obtained from alcalase digestion had good emulsion stability and antioxidant activity. Thus, they could be exploited as protein supplements in the diet as nutritional and bioactive foods. PMID:27507499

  20. [Comparison of green coffee beans volatiles chemical composition of Hainan main area].

    Science.gov (United States)

    Hu, Rong-Suo; Chu, Zhong; Gu, Feng-Lin; Lu, Min-Quan; Lu, Shao-Fang; Wu, Gui-Ping; Tan, Le-He

    2013-02-01

    Chemical component of Hainan green coffee beans was analyzed with solid phase microextraction-gas chromatography-mass spectrometry, and the discrepancy between two green coffee beans was differentiated through the spectrum database retrieval and retention index of compound characterization. The experimental results show that: the chemical composition of Wanning coffee beans and Chengmai coffee beans is basically the same. The quantity of analyzed compound in Wanning area coffee is 91, and in Chengmai area coffee is 106, the quantity of the same compound is 66, and the percent of the same component is 75.52%. The same compounds accounted for 89.86% of the total content of Wanning area coffee, and accounted for 85.70% of the total content of Chengmai area coffee. PMID:23697152