WorldWideScience

Sample records for bead based immunoassay

  1. Magnetic Bead Based Immunoassay for Autonomous Detection of Toxins

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Y; Hara, C A; Knize, M G; Hwang, M H; Venkatesteswaran, K S; Wheeler, E K; Bell, P M; Renzi, R F; Fruetel, J A; Bailey, C G

    2008-05-01

    As a step towards toward the development of a rapid, reliable analyzer for bioagents in the environment, we are developing an automated system for the simultaneous detection of a group of select agents and toxins. To detect toxins, we modified and automated an antibody-based approach previously developed for manual medical diagnostics that uses fluorescent eTag{trademark} reporter molecules and is suitable for highly multiplexed assays. Detection is based on two antibodies binding simultaneously to a single antigen, one of which is labeled with biotin while the other is conjugated to a fluorescent eTag{trademark} through a cleavable linkage. Aqueous samples are incubated with the mixture of antibodies along with streptavidin-coated magnetic beads coupled to a photo-activatable porphyrin complex. In the presence of antigen, a molecular complex is formed where the cleavable linkage is held in proximity to the photoactivable group. Upon excitation at 680 nm, free radicals are generated, which diffuse and cleave the linkage, releasing the eTags{trademark}. Released eTags{trademark} are analyzed using capillary gel electrophoresis with laser-induced fluorescence detection. Limits of detection for ovalbumin and botulinum toxoid individually were 4 ng/mL (or 80 pg) and 16 ng/mL (or 320 pg), respectively, using the manual assay. In addition, we demonstrated the use of pairs of antibodies from different sources in a single assay to decrease the rate of false positives. Automation of the assay was demonstrated on a flow-through format with higher LODs of 125 ng/mL (or 2.5 ng) each of a mixture of ovalbumin and botulinum toxoid. This versatile assay can be easily modified with the appropriate antibodies to detect a wide range of toxins and other proteins.

  2. Single-bead arrays for fluorescence-based immunoassays on capillary-driven microfluidic chips

    Science.gov (United States)

    Temiz, Yuksel; Lim, Michel; Delamarche, Emmanuel

    2016-03-01

    We report a concept for the simple fabrication of easy-to-use chips for immunoassays in the context of point-of-care diagnostics. The chip concept comprises mainly three features: (1) the efficient integration of reagents using beads functionalized with receptors, (2) the generation of capillary-driven liquid flows without using external pumps, and (3) a high-sensitivity detection of analytes using fluorescence microscopy. We fabricated prototype chips using dry etching of Si wafers. 4.5-μm-diameter beads were integrated into hexagonal arrays by sedimentation and removing the excess using a stream of water. We studied the effect of different parameters and showed that array occupancies from 30% to 50% can be achieved by pipetting a 250 nL droplet of 1% bead solution and allowing the beads sediment for 3 min. Chips with integrated beads were sealed using a 50-μm-thick dry-film resist laminated at 45 °C. Liquids pipetted to loading pads were autonomously pulled by capillary pumps at a rate of 0.35 nL s-1 for about 30 min. We studied ligand-receptor interactions and binding kinetics using time-lapse fluorescence microscopy and demonstrated a 5 pM limit of detection (LOD) for an anti-biotin immunoassay. As a clinically-relevant example, we implemented an immunoassay to detect prostate specific antigen (PSA) and showed an LOD of 108 fM (i.e. 3.6 pg mL-1). While a specific implementation is provided here for the detection of PSA, we believe that combining capillary-driven microfluidics with arrays of single beads and fluorescence readout to be very flexible and sufficiently sensitive for the detection of other clinically-relevant analytes.

  3. Magnetic-bead-based sub-femtomolar immunoassay using resonant Raman scattering signals of ZnS nanoparticles.

    Science.gov (United States)

    Ding, Yadan; Cong, Tie; Chu, Xueying; Jia, Yan; Hong, Xia; Liu, Yichun

    2016-07-01

    Highly sensitive, specific, and selective immunoassays are of great significance for not only clinical diagnostics but also food safety, environmental monitoring, and so on. Enzyme-linked immunosorbent assays and fluorescence-based and electrochemical immunoassays are important intensively investigated immunoassay techniques. However, they might suffer from low sensitivity or false-positive results. In this work, a simple, reliable, and ultrasensitive magnetic-bead-based immunoassay was performed using biofunctionalized ZnS semiconductor nanocrystals as resonant Raman probes. The resonant Raman scattering of ZnS nanocrystals displays evenly spaced multi-phonon resonant Raman lines with narrow bandwidths and has strong resistance to environmental variation due to the nature of the electron-phonon interaction, thus rendering reliable signal readout in the immunoassays. The superparamagnetic Fe3O4 nanoparticles facilitated greatly the separation, purification, and concentration processes. It is beneficial for both reducing the labor intensity and amplifying the detection signals. The immobilization of antibodies on the surface of magnetic beads, the preparation of resonant Raman probes, and the immunological recognition between the antibody and analyte all occurred in the liquid phase, which minimized the diffusion barriers and boundary layer constraints. All these factors contributed to the ultralow detection limit of human IgG, which was determined to be about 0.5 fM (∼0.08 pg/ml). It is nearly the highest sensitivity obtained for IgG detection. This work shall facilitate the design of nanoplatforms for ultrasensitive detections of proteins, DNAs, bacteria, explosives, and so on. Graphical abstract An ultrasensitive magnetic-bead-based immunoassay was performed using multi-phonon resonant Raman lines of ZnS nanoparticles as detection signals. PMID:27173389

  4. Bead-based microarray immunoassay for lung cancer biomarkers using quantum dots as labels.

    Science.gov (United States)

    Liu, Lifen; Wu, Simin; Jing, Fengxiang; Zhou, Hongbo; Jia, Chunping; Li, Gang; Cong, Hui; Jin, Qinghui; Zhao, Jianlong

    2016-06-15

    In this study, we developed a multiplex immunoassay system that combines the suspension and planar microarray formats within a single layer of polydimethylsiloxane (PDMS) using soft lithography technology. The suspension format was based on the target proteins forming a sandwich structure between the magnetic beads and the quantum dot (QD) probes through specific antibody-antigen interactions. The planar microarray format was produced by fabricating an array of micro-wells in PDMS. Each micro-well was designed to trap a single microbead and eventually generated a microbead array within the PDMS chamber. The resultant bead-based on-chip assay could be used for simultaneously detecting three lung cancer biomarkers-carcinoembryonic antigen (CEA), fragments of cytokeratin 19 (CYFRA21-1) and neuron-specific enolase (NSE)-in 10 μl of human serum, with a wide linear dynamic range (1.03-111 ng/mL for CEA and CYFRA21-1; 9.26-1000 ng/ml for NSE) and a low detection limit (CEA: 0.19 ng/ml; CYFRA21-1: 0.97 ng/ml; NSE: 0.37 ng/ml; S/N=3). Our micro-well chip does not require complex e-beam lithography or the reactive ion etching process as with existing micro-well systems, which rely on expensive focused ion beam (FIB) milling or optical fiber bundles. Furthermore, the current approach is easy to operate without extra driving equipment such as pumps, and can make parallel detection for multiplexing with rapid binding kinetics, small reagent consumption and low cost. This work has demonstrated the importance of the successful application of on-chip multiplexing sandwich assays for the detection of biomarker proteins. PMID:26852198

  5. Establishment of magnetic beads-based enzyme immunoassay for detection of chloramphenicol in milk.

    Science.gov (United States)

    Xu, Jing; Yin, Weiwei; Zhang, Yuanyang; Yi, Jian; Meng, Meng; Wang, Yabin; Xue, Huyin; Zhang, Taichang; Xi, Rimo

    2012-10-15

    In this research, magnetic beads-based enzyme immunoassays were investigated for rapid analysis of chloramphenicol (CAP) in milk. To improve sensitivity of CAP determination, two kinds of immunomagnetic separation methods were designed and compared. Magnetic polystyrene microspheres were conjugated with anti-CAP antibody (Method I) or goat-anti-mouse IgG (Method II). The whole determination could be finished in 1.25 h. Both methods showed high sensitivity to CAP in buffer, and obtained an IC(50) value of 0.05 ng mL(-1) for Method I and 0.4 ng mL(-1) for Method II. The methods showed high specificity, only showing a little cross-reaction towards CAP succinate. The two methods were applied to detect CAP in milk. The recovery rates were 80-106% and the coefficients of variation (CVs) were 4.7-15%. The immunomagnetic assay showed promising potential in rapid screening field for CAP analysis. Between the two methods, Method I is more sensitive, and Method II is more suitable for producing a general assay by changing a primary antibody for another analyte. PMID:23442720

  6. Development of a multiplexed bead-based immunoassay for the simultaneous detection of antibodies to 17 pneumococcal proteins.

    Science.gov (United States)

    Shoma, S; Verkaik, N J; de Vogel, C P; Hermans, P W M; van Selm, S; Mitchell, T J; van Roosmalen, M; Hossain, S; Rahman, M; Endtz, H Ph; van Wamel, W J B; van Belkum, A

    2011-04-01

    Presently, several pneumococcal proteins are being evaluated as potential vaccine candidates. Here, we gather novel insights in the immunogenicity of PLY, PsaA, PspA, PspC, NanA, Hyl, PpmA, SlrA, Eno, IgA1-protease, PdBD, BVH-3, SP1003, SP1633, SP1651, SP0189 and SP0376. We developed a multiplex bead-based immunoassay (xMAP(®) Technology, Luminex Corporation) to simultaneously quantify antibodies against these 17 pneumococcal proteins in serum. The median fluorescence intensity (MFI) values obtained for human pooled serum with the multiplex assay were between 82% and 111% (median 94%) of those obtained with the singleplex assays. For IgG, the coefficient of variation (CV) in serum ranged from 2% to 9%, for IgA, the CV ranged from 3% to 14% and for IgM, the CV ranged from 11% to 15%. Using this immunoassay, we showed that anti-pneumococcal antibody levels exhibited extensive inter-individual variability in young children suffering from invasive pneumococcal disease. All proteins, including the proteins with, as yet, unknown function, were immunogenic. In conclusion, the multiplex Streptococcus pneumoniae immunoassay based on proteins is reproducible. This assay can be used to monitor anti-S. pneumoniae antibody responses in a material- and time-saving manner. PMID:21086008

  7. Droplet-based magnetic bead immunoassay using microchannel-connected multiwell plates (μCHAMPs) for the detection of amyloid beta oligomers.

    Science.gov (United States)

    Park, Min Cheol; Kim, Moojong; Lim, Gun Taek; Kang, Sung Min; An, Seong Soo A; Kim, Tae Song; Kang, Ji Yoon

    2016-06-21

    Multiwell plates are regularly used in analytical research and clinical diagnosis but often require laborious washing steps and large sample or reagent volumes (typically, 100 μL per well). To overcome such drawbacks in the conventional multiwell plate, we present a novel microchannel-connected multiwell plate (μCHAMP) that can be used for automated disease biomarker detection in a small sample volume by performing droplet-based magnetic bead immunoassay inside the plate. In this μCHAMP-based immunoassay platform, small volumes (30-50 μL) of aqueous-phase working droplets are stably confined within each well by the simple microchannel structure (200-300 μm in height and 0.5-1 mm in width), and magnetic beads are exclusively transported into an adjacent droplet through the oil-filled microchannels assisted by a magnet array aligned beneath and controlled by a XY-motorized stage. Using this μCHAMP-based platform, we were able to perform parallel detection of synthetic amyloid beta (Aβ) oligomers as a model analyte for the early diagnosis of Alzheimer's disease (AD). This platform easily simplified the laborious and consumptive immunoassay procedure by achieving automated parallel immunoassay (32 assays per operation in 3-well connected 96-well plate) within 1 hour and at low sample consumption (less than 10 μL per assay) with no cumbersome manual washing step. Moreover, it could detect synthetic Aβ oligomers even below 10 pg mL(-1) concentration with a calculated detection limit of ∼3 pg mL(-1). Therefore, the μCHAMP and droplet-based magnetic bead immunoassay, with the combination of XY-motorized magnet array, would be a useful platform in the diagnosis of human disease, including AD, which requires low consumption of the patient's body fluid sample and automation of the entire immunoassay procedure for high processing capacity. PMID:27185215

  8. Rapid bead-based immunoassay for measurement of mannose-binding lectin

    DEFF Research Database (Denmark)

    Bay, J T; Garred, P

    2009-01-01

    Mannose-binding lectin (MBL) is a serum protein, which functions as an opsonin and initiator of the lectin pathway of complement. The serum concentration of MBL shows great interindividual variation because of common polymorphisms in the MBL2 gene. Although several quantitative MBL immunoassays...

  9. Streptavidin Capture and Detection Using Individual Agarose Bead-based Microfluidic Immunoassay Devices

    Institute of Scientific and Technical Information of China (English)

    Xiaoguang Du

    2009-01-01

    @@ A single microwell on polycarbonate substratc was fabricated using hot embossing by silicon master.The silicon master (85 μm in top,100 μm in bottom,53 μm in height) and 0.25 mm-thick polycarbonate substrate were sandwiched between two glass plates in hot embossing system.The system was heated to 155-160℃ and pressed with a force of 300 psi for 10-30 s.The single microwell was stampted on polycarbonate substrate.Apply a~0.2 μL aliquot of agarose beads to the single microwell.

  10. A disposable bio-nano-chip using agarose beads for high performance immunoassays

    OpenAIRE

    Du, Nan; Chou, Jie; Kulla, Eliona; Floriano, Pierre N.; Christodoulides, Nicolaos; McDevitt, John T.

    2011-01-01

    This article reports on the fabrication of a disposable bio-nano-chip (BNC), a microfluidic device composed of polydimethylsiloxane (PDMS) and thiolene-based optical epoxy which is both cost-effective and suitable for high performance immunoassays. A novel room temperature (RT) bonding technique was utilized so as to achieve irreversible covalent bonding between PDMS and thiolene-based epoxy layers, while at the same time being compatible with the insertion of agarose bead sensors, selectivel...

  11. A disposable bio-nano-chip using agarose beads for high performance immunoassays.

    Science.gov (United States)

    Du, Nan; Chou, Jie; Kulla, Eliona; Floriano, Pierre N; Christodoulides, Nicolaos; McDevitt, John T

    2011-10-15

    This article reports on the fabrication of a disposable bio-nano-chip (BNC), a microfluidic device composed of polydimethylsiloxane (PDMS) and thiolene-based optical epoxy which is both cost-effective and suitable for high performance immunoassays. A novel room temperature (RT) bonding technique was utilized so as to achieve irreversible covalent bonding between PDMS and thiolene-based epoxy layers, while at the same time being compatible with the insertion of agarose bead sensors, selectively arranged in an array of pyramidal microcavities replicated in the thiolene thin film layer. In the sealed device, the bead-supporting epoxy film is sandwiched between two PDMS layers comprising of fluidic injection and drain channels. The agarose bead sensors used in the device are sensitized with anti-C-reactive protein (CRP) antibody, and a fluorescent sandwich-type immunoassay was run to characterize the performance of this device. Computational fluid dynamics (CFD) was used based on the device specifications to model the bead penetration. Experimental data revealed analyte penetration of the immunocomplex to 100 μm into the 280 μm diameter agarose beads, which correlated well with the simulation. A dose-response curve was obtained and the linear dynamic range of the assay was established over 1 ng/mL to 50 ng/mL with a limit of detection less than 1 ng/mL. PMID:21852104

  12. Electrochemical immunoassay using magnetic beads for the determination of zearalenone in baby food: An anticipated analytical tool for food safety

    Energy Technology Data Exchange (ETDEWEB)

    Hervas, Miriam; Lopez, Miguel Angel [Departamento Quimica Analitica, Universidad de Alcala, Ctra. Madrid-Barcelona, Km. 33600, E-28871 Alcala de Henares, Madrid (Spain); Escarpa, Alberto, E-mail: alberto.escarpa@uah.es [Departamento Quimica Analitica, Universidad de Alcala, Ctra. Madrid-Barcelona, Km. 33600, E-28871 Alcala de Henares, Madrid (Spain)

    2009-10-27

    In this work, electrochemical immunoassay involving magnetic beads to determine zearalenone in selected food samples has been developed. The immunoassay scheme has been based on a direct competitive immunoassay method in which antibody-coated magnetic beads were employed as the immobilisation support and horseradish peroxidase (HRP) was used as enzymatic label. Amperometric detection has been achieved through the addition of hydrogen peroxide substrate and hydroquinone as mediator. Analytical performance of the electrochemical immunoassay has been evaluated by analysis of maize certified reference material (CRM) and selected baby food samples. A detection limit (LOD) of 0.011 {mu}g L{sup -1} and EC{sub 50} 0.079 {mu}g L{sup -1} were obtained allowing the assessment of the detection of zearalenone mycotoxin. In addition, an excellent accuracy with a high recovery yield ranging between 95 and 108% has been obtained. The analytical features have shown the proposed electrochemical immunoassay to be a very powerful and timely screening tool for the food safety scene.

  13. Hydrogel nanoparticle based immunoassay

    Science.gov (United States)

    Liotta, Lance A; Luchini, Alessandra; Petricoin, Emanuel F; Espina, Virginia

    2015-04-21

    An immunoassay device incorporating porous polymeric capture nanoparticles within either the sample collection vessel or pre-impregnated into a porous substratum within fluid flow path of the analytical device is presented. This incorporation of capture particles within the immunoassay device improves sensitivity while removing the requirement for pre-processing of samples prior to loading the immunoassay device. A preferred embodiment is coreshell bait containing capture nanoparticles which perform three functions in one step, in solution: a) molecular size sieving, b) target analyte sequestration and concentration, and c) protection from degradation. The polymeric matrix of the capture particles may be made of co-polymeric materials having a structural monomer and an affinity monomer, the affinity monomer having properties that attract the analyte to the capture particle. This device is useful for point of care diagnostic assays for biomedical applications and as field deployable assays for environmental, pathogen and chemical or biological threat identification.

  14. Multiplex bead-array competitive immunoassay for simultaneous detection of three pesticides in vegetables

    International Nuclear Information System (INIS)

    We report on a multiplex bead-based competitive immunoassay using suspension array technology for the simultaneous detection of the pesticides triazophos, carbofuran and chlorpyrifos. Three hapten-protein conjugates were covalently bound to carboxylated fluorescent microspheres to serve as probes. The amount of conjugates and antibodies were optimized. The new multi-analyte assay has dynamic ranges of 0.02-50 ng mL-1, 0.5-500 ng mL-1 and 1.0-1000 ng mL-1 for triazophos, carbofuran and chlorpyrifos, respectively, and the detection limits are 0.024, 0.93 and 1.68 ng mL-1. This new multiplex assay is superior to the traditional ELISA in possessing a wider detection range, better reproducibility and the feature of multi-target detection. Cross-reactivity studies indicated that the bead-array method is highly selective for the three target pesticides, and that individual analyses have no significant influence between each other, also without cross-reactions from other structurally related pesticides. The method was applied to analyze vegetables spiked with the three pesticides, and the recoveries were in ranges of 78.5-112.1 %, 72.2-120.2 % and 70.2-112.8 %, respectively, with mean coefficients of variation of <15 %. (author)

  15. Microfluidic Platform for Enzyme-Linked and Magnetic Particle-Based Immunoassay

    Directory of Open Access Journals (Sweden)

    Dorota G. Pijanowska

    2013-06-01

    Full Text Available This article presents design and testing of a microfluidic platform for immunoassay. The method is based on sandwiched ELISA, whereby the primary antibody is immobilized on nitrocelluose and, subsequently, magnetic beads are used as a label to detect the analyte. The chip takes approximately 2 h and 15 min to complete the assay. A Hall Effect sensor using 0.35-μm BioMEMS TSMC technology (Taiwan Semiconductor Manufacturing Company Bio-Micro-Electro-Mechanical Systems was fabricated to sense the magnetic field from the beads. Furthermore, florescence detection and absorbance measurements from the chip demonstrate successful immunoassay on the chip. In addition, investigation also covers the Hall Effect simulations, mechanical modeling of the bead–protein complex, testing of the microfluidic platform with magnetic beads averaging 10 nm, and measurements with an inductor-based system.

  16. Immunoassays

    Science.gov (United States)

    Hsieh, Y.-H. Peggy

    Immunochemistry is a relatively new science that has developed rapidly in the last few decades. One of the most useful analytical developments associated with this new science is immunoassay. Originally immunoassays were developed in medical settings to facilitate the study of immunology, particularly the antibody-antigen interaction. Immunoassays now are finding widespread applications outside the clinical field because they are appropriate for a wide range of analytes ranging from proteins to small organic molecules. In the food analysis area, immunoassays are widely used for chemical residue analysis, identification of bacteria and viruses, and detection of proteins in food and agricultural products. Protein detection is important for determination of allergens and meat species content, seafood species identification, and detection of genetically modified plant tissues. While immunoassays of all formats are too numerous to cover completely in this chapter, there are several procedures that have become standard for food analysis because of their specificity, sensitivity, and simplicity.

  17. Single bead-based electrochemical biosensor

    OpenAIRE

    LIU, CHANGCHUN; Schrlau, Michael G.; Bau, Haim H.

    2009-01-01

    A simple, robust, single bead-based electrochemical biosensor was fabricated and characterized. The sensor’s working electrode consists of an electrochemically-etched platinum wire, with a nominal diameter of 25 μm, hermetically heat-fusion sealed in a pulled glass capillary (micropipette). The sealing process does not require any epoxy or glue. A commercially available, densely functionalized agarose bead was mounted on the tip of the etched platinum wire. The use of a pre-functionalized bea...

  18. Viral RNA testing and automation on the bead-based CBNE detection microsystem.

    Energy Technology Data Exchange (ETDEWEB)

    Galambos, Paul C.; Bourdon, Christopher Jay; Farrell, Cara M.; Rossito, Paul (University of California at Davis); McClain, Jaime L.; Derzon, Mark Steven; Cullor, James Sterling (University of California at Davis); Rahimian, Kamayar

    2008-09-01

    We developed prototype chemistry for nucleic acid hybridization on our bead-based diagnostics platform and we established an automatable bead handling protocol capable of 50 part-per-billion (ppb) sensitivity. We are working towards a platform capable of parallel, rapid (10 minute), raw sample testing for orthogonal (in this case nucleic acid and immunoassays) identification of biological (and other) threats in a single sensor microsystem. In this LDRD we developed the nucleic acid chemistry required for nucleic acid hybridization. Our goal is to place a non-cell associated RNA virus (Bovine Viral Diarrhea, BVD) on the beads for raw sample testing. This key pre-requisite to showing orthogonality (nucleic acid measurements can be performed in parallel with immunoassay measurements). Orthogonal detection dramatically reduces false positives. We chose BVD because our collaborators (UC-Davis) can supply samples from persistently infected animals; and because proof-of-concept field testing can be performed with modification of the current technology platform at the UC Davis research station. Since BVD is a cattle-prone disease this research dovetails with earlier immunoassay work on Botulinum toxin simulant testing in raw milk samples. Demonstration of BVD RNA detection expands the repertoire of biological macromolecules that can be adapted to our bead-based detection. The resources of this late start LDRD were adequate to partially demonstrate the conjugation of the beads to the nucleic acids. It was never expected to be adequate for a full live virus test but to motivate that additional investment. In addition, we were able to reduce the LOD (Limit of Detection) for the botulinum toxin stimulant to 50 ppb from the earlier LOD of 1 ppm. A low LOD combined with orthogonal detection provides both low false negatives and low false positives. The logical follow-on steps to this LDRD research are to perform live virus identification as well as concurrent nucleic acid and

  19. Development of a flow cytometric bead immunoassay and its assessment as a possible aid to potency evaluation of enterotoxaemia vaccines

    Directory of Open Access Journals (Sweden)

    Angela Buys

    2014-02-01

    Full Text Available Enterotoxaemia, an economically important disease of sheep, goats and calves, is caused by systemic effects of the epsilon toxin produced by the anaerobic bacterium Clostridium perfringens type D. The only practical means of controlling the occurrence of enterotoxaemia is to immunise animals by vaccination. The vaccine is prepared by deriving a toxoid from the bacterial culture filtrate and the potency of the vaccine is tested with the in vivo mouse neutralisation test (MNT. Due to ethical, economic and technical reasons, alternative in vitro assays are needed. In this study an indirect cytometric bead immunoassay (I-CBA was developed for use in vaccine potency testing and the results were compared with those obtained using an indirect enzyme-linked immunosorbent assay (I-ELISA and the MNT. Sera were collected from guinea pigs immunised with three different production batches of enterotoxaemia vaccine and the levels of anti-epsilon toxin antibodies were determined. Although the intra- and inter-assay variability was satisfactory, epsilon antitoxin levels determined by both the I-ELISA and indirect cytometric bead immunoassay (I-CBA tests were higher than those of the MNT assay. In contrast to the MNT, all of the serum samples were identified as having antitoxin levels above the required minimum (not less than 5 U/mL. These results indicate that the respective in vitro tests in their current formats are not yet suitable alternatives to the in vivo MNT. The growing demand for a more humane, cost-effective and efficient method for testing the potency of enterotoxaemia vaccines, however, provides a strong impetus for further optimisation and standardisation of the I-CBA assay but further analytical research is required.

  20. Development of a flow cytometric bead immunoassay and its assessment as a possible aid to potency evaluation of enterotoxaemia vaccines.

    Science.gov (United States)

    Buys, Angela; Macdonald, Raynard; Crafford, Jannie; Theron, Jacques

    2014-01-01

    Enterotoxaemia, an economically important disease of sheep, goats and calves, is caused by systemic effects of the epsilon toxin produced by the anaerobic bacterium Clostridium perfringens type D. The only practical means of controlling the occurrence of enterotoxaemia is to immunise animals by vaccination. The vaccine is prepared by deriving a toxoid from the bacterial culture filtrate and the potency of the vaccine is tested with the in vivo mouse neutralisation test (MNT). Due to ethical, economic and technical reasons, alternative in vitro assays are needed. In this study an indirect cytometric bead immunoassay (I-CBA) was developed for use in vaccine potency testing and the results were compared with those obtained using an indirect enzyme-linked immunosorbent assay (I-ELISA) and the MNT. Sera were collected from guinea pigs immunised with three different production batches of enterotoxaemia vaccine and the levels of anti-epsilon toxin antibodies were determined. Although the intra- and inter-assay variability was satisfactory, epsilon antitoxin levels determined by both the I-ELISA and indirect cytometric bead immunoassay (I-CBA) tests were higher than those of the MNT assay. In contrast to the MNT, all of the serum samples were identified as having antitoxin levels above the required minimum (not less than 5 U/mL). These results indicate that the respective in vitro tests in their current formats are not yet suitable alternatives to the in vivo MNT. The growing demand for a more humane, cost-effective and efficient method for testing the potency of enterotoxaemia vaccines, however, provides a strong impetus for further optimisation and standardisation of the I-CBA assay but further analytical research is required. PMID:24832497

  1. An integrated microfluidic biochemical detection system for protein analysis with magnetic bead-based sampling capabilities.

    Science.gov (United States)

    Choi, Jin-Woo; Oh, Kwang W; Thomas, Jennifer H; Heineman, William R; Halsall, H Brian; Nevin, Joseph H; Helmicki, Arthur J; Henderson, H Thurman; Ahn, Chong H

    2002-02-01

    This paper presents the development and characterization of an integrated microfluidic biochemical detection system for fast and low-volume immunoassays using magnetic beads, which are used as both immobilization surfaces and bio-molecule carriers. Microfluidic components have been developed and integrated to construct a microfluidic biochemical detection system. Magnetic bead-based immunoassay, as a typical example of biochemical detection and analysis, has been successfully performed on the integrated microfluidic biochemical analysis system that includes a surface-mounted biofilter and electrochemical sensor on a glass microfluidic motherboard. Total time required for an immunoassay was less than 20 min including sample incubation time, and sample volume wasted was less than 50 microl during five repeated assays. Fast and low-volume biochemical analysis has been successfully achieved with the developed biofilter and immunosensor, which is integrated to the microfluidic system. Such a magnetic bead-based biochemical detection system, described in this paper, can be applied to protein analysis systems. PMID:15100857

  2. Lab-on-a-Chip Magneto-Immunoassays: How to Ensure Contact between Superparamagnetic Beads and the Sensor Surface

    Directory of Open Access Journals (Sweden)

    Andreas Hütten

    2013-09-01

    Full Text Available Lab-on-a-chip immuno assays utilizing superparamagnetic beads as labels suffer from the fact that the majority of beads pass the sensing area without contacting the sensor surface. Different solutions, employing magnetic forces, ultrasonic standing waves, or hydrodynamic effects have been found over the past decades. The first category uses magnetic forces, created by on-chip conducting lines to attract beads towards the sensor surface. Modifications of the magnetic landscape allow for additional transport and separation of different bead species. The hydrodynamic approach uses changes in the channel geometry to enhance the capture volume. In acoustofluidics, ultrasonic standing waves force µm-sized particles onto a surface through radiation forces. As these approaches have their disadvantages, a new sensor concept that circumvents these problems is suggested. This concept is based on the granular giant magnetoresistance (GMR effect that can be found in gels containing magnetic nanoparticles. The proposed design could be realized in the shape of paper-based test strips printed with gel-based GMR sensors.

  3. Detection of Avian Influenza Virus by Fluorescent DNA Barcode-based Immunoassay with Sensitivity Comparable to PCR

    DEFF Research Database (Denmark)

    Cao, Cuong; Dhumpa, Raghuram; Bang, Dang Duong;

    2010-01-01

    In this paper, a coupling of fluorophore-DNA barcode and bead-based immunoassay for detecting avian influenza virus (AIV) with PCR-like sensitivity is reported. The assay is based on the use of sandwich immunoassay and fluorophore-tagged oligonucleotides as representative barcodes. The detection...... involves the sandwiching of the target AIV between magnetic immunoprobes and barcode-carrying immunoprobes. Because each barcode-carrying immunoprobe is functionalized with a multitude of fluorophore-DNA barcode strands, many DNA barcodes are released for each positive binding event resulting in...

  4. Electrochemical coding for multiplexed immunoassays of biomarkers based on bio-based polymer-nanotags

    International Nuclear Information System (INIS)

    Highlights: • Electrochemical coding for multiplexed immunoassays was designed for simultaneous detection of biomarkers. • Encoded polymer-nanotags were developed for signal amplification based on Apo nanotags modified on PLL-Au composite. • Apo nanoparticles with a high coding capacity with cadmium and lead ions were used as distinguishable tracer labels. • The polymer-nanotags were simply prepared and environment-friendly by self-assemble technology without coupling agents. - Abstract: A novel sandwich-type electrochemical multiplexed immunoassay was designed for simultaneous determination of alpha-fetoprotein (AFP) and carcinoembryonic antigen (CEA) cancer biomarkers by using bio-based polymer-nanotags as signal probes and dual antibodies labeled magnetic beads as capture probes. This signal probes were prepared by co-immobilizing encoded metallic apoferritin (Cd-Apo and Pb-Apo) and primary antibodies (anti-AFP and anti-CEA) on poly-L-lysine (PLL) via gold nanoparticles (AuNPs). The preparation procedures were through self-assembly technology without using coupling agent. After a sandwich-type immunoreaction, the polymer-nanotags were captured to the surface of Dynabeads. The subsequent electrochemical stripping analysis of the metal components from the nanocomposite provide a means for discriminating dual targets based on the peak potential of Cd and Pb. The currents of Cd and Pb were proportional to the concentration of AFP and CEA, respectively. Experimental results showed the immunoassay enabled the simultaneous determination of AFP and CEA in a single run with dynamic ranges of 0.01-50 ng mL−1. And the detection limits of AFP and CEA were 4 pg mL−1 (S/N = 3), respectively. This proposed multiplexed immunoassay is simple, sensitive and environment-friendly. More importantly, this proposal was employed in real serum samples to detect two tumor markers at the same time. It can be applied for clinical screening of biomarkers

  5. Polystyrene Based SPR Biosensor Chip for Use in Immunoassay

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    Biosensors are widely used in immunoassay.The biosensor chip carries a receptor which is used in immunoassay and the chip properties have an important influence on the detecting sensitivity of the biosensor.This paper describes a polystyrene-based biosensor chip developed and used as part of a surface plasmon resonance (SPR) biosensor.The SPR biosensor has a much higher detecting sensitivity than enzyme-linked immunoserbent assay (ELISA).

  6. Magnetic immunoassay platform based on the planar frequency mixing magnetic technique.

    Science.gov (United States)

    Kim, Chang-Beom; Lim, Eul-Gyoon; Shin, Sung Woong; Krause, Hans Joachim; Hong, Hyobong

    2016-09-15

    We represent the experimental results of our planar-frequency mixing magnetic detection (p-FMMD) technique to obtain 2D superparamagnetic images for magnetic immunoassay purpose. The imaging of magnetic beads is based on the nonlinear magnetic characteristics inherent in superparamagnetic materials. The p-FMMD records the sum-frequency components originating from both a high and a low frequency magnetic field incident on the magnetically nonlinear nanoparticles. In this study, we apply the p-FMMD technique to 2D scanning imaging of superparamagnetic iron oxide nanoparticles (SPIONs) in a microfluidic platform. Our p-FMMD system enables to acquire planar images of SPIONs filled in a microchannel as narrow as 30µm in width. The minimum detectable amount is ~1.0×10(8) beads of 100nm size. The system shows a spatial resolution enabling to distinguish between two distinct channels even 2mm apart from each other. Our p-FMMD system as a magnetic immunoassaying system has permitted the detection of amyloid beta 42 (Aβ42), a promising biomarker of Alzheimer's disease, at the minimum concentration of 23.8pg/ml. This may enable the identification of the Aβ42 levels for the early-stage of Alzheimer's disease with the assistance of the MPI using p-FMMD technique. The results show that the deployment of the p-FMMD can be an alternative to conventional biosensing analytical methods, and can be used as a fast and portable screening method. PMID:27135936

  7. Non-constrictive bead immobilization leading to decreased and uniform shear stress in microfluidic bead-based ELISA

    CERN Document Server

    Mitra, Kinshuk; Chidambaram, Preethi; Maharry, Aaron P; Xu, Ronald X; Tweedle, Michael F

    2014-01-01

    Microfluidic biosensors have been utilized for sensing a wide range of antigens using numerous configurations. Bead based microfluidic sensors have been a popular modality due to the plug and play nature of analyte choice and the favorable geometry of spherical sensor scaffolds. While constriction of beads against fluid flow remains a popular method to immobilize the sensor, it results in poor fluidic regimes and shear conditions around sensor beads that can affect sensor performance. We present an alternative means of sensor bead immobilization using poly-carbonate membrane. This system results in several orders of magnitude lower variance of flow radially around the sensor bead. Shear stress experienced by our non-constrictive immobilized bead was three orders of magnitude lower. We demonstrate ability to quantitatively sense EpCAM protein, a marker for cancer stem cells and operation under both far-red and green wavelengths with no auto-fluorescence.

  8. Digital microfluidic magnetic separation for particle-based immunoassays.

    Science.gov (United States)

    Ng, Alphonsus H C; Choi, Kihwan; Luoma, Robert P; Robinson, John M; Wheeler, Aaron R

    2012-10-16

    We introduce a new format for particle-based immunoassays relying on digital microfluidics (DMF) and magnetic forces to separate and resuspend antibody-coated paramagnetic particles. In DMF, fluids are electrostatically controlled as discrete droplets (picoliters to microliters) on an array of insulated electrodes. By applying appropriate sequences of potentials to these electrodes, multiple droplets can be manipulated simultaneously and various droplet operations can be achieved using the same device design. This flexibility makes DMF well-suited for applications that require complex, multistep protocols such as immunoassays. Here, we report the first particle-based immunoassay on DMF without the aid of oil carrier fluid to enable droplet movement (i.e., droplets are surrounded by air instead of oil). This new format allowed the realization of a novel on-chip particle separation and resuspension method capable of removing greater than 90% of unbound reagents in one step. Using this technique, we developed methods for noncompetitive and competitive immunoassays, using thyroid stimulating hormone (TSH) and 17β-estradiol (E2) as model analytes, respectively. We show that, compared to conventional methods, the new DMF approach reported here reduced reagent volumes and analysis time by 100-fold and 10-fold, respectively, while retaining a level of analytical performance required for clinical screening. Thus, we propose that the new technique has great potential for eventual use in a fast, low-waste, and inexpensive instrument for the quantitative analysis of proteins and small molecules in low sample volumes. PMID:23013543

  9. Fenton reaction-based colorimetric immunoassay for sensitive detection of brevetoxin B.

    Science.gov (United States)

    Lai, Wenqiang; Wei, Qiaohua; Zhuang, Junyang; Lu, Minghua; Tang, Dianping

    2016-06-15

    We designed a new colorimetric immunoassay for sensitive monitoring of brevetoxin B (BTB) using enzyme-controlled Fenton reaction with a high-resolution 3,3',5,5'-tetramethylbenzidine (TMB)-based visual colored system. Upon addition of hydrogen peroxide (H2O2), the equivalent iron(II) could be first converted into iron(III) and free hydroxyl radical (•OH) via the classical Fenton reaction. Then the as-produced iron(III) and •OH could cause a perceptible change from colorless to blue with the increasing H2O2 concentration in the presence of TMB. Based on Fenton reaction-triggered visual colored system, a novel competitive-type colorimetric enzyme immunoassay was developed for the quantitative screening of target BTB on the bovine serum albumin-BTB-modified magnetic bead using glucose oxidase/anti-BTB antibody-labeled gold nanoparticle as the signal-transduction tag. Upon target BTB introduction, the analyte competed with the conjugated BTB on the magnetic bead for anti-BTB antibody on gold nanoparticle. The carried glucose oxidase with the gold nanoparticle could implement the oxidation of glucose to produce H2O2, and the generated H2O2 promoted the above-mentioned Fenton reaction for color development. Under the optimal conditions, the absorbance decreased with the increasing target BTB in the range from 0.1 to 150 ng kg(-1) with a low detection limit (LOD) of 0.076 ng kg(-1). The LOD was 500-fold lower than that of commercialized Abraxis BTB ELISA kit. Non-specific adsorption was not observed. The precision, reproducibility and specificity were acceptable. Finally, the method accuracy was also validated for monitoring spiked seafood samples, giving results well matched with the referenced brevetoxin ELISA kit. PMID:26851583

  10. History of inductively coupled plasma mass spectrometry-based immunoassays

    International Nuclear Information System (INIS)

    The analysis of biomolecules requires highly sensitive and selective detection methods capable of tolerating a complex, biological matrix. First applications of biomolecule detection by ICP-MS relied on the use of heteroelements as a label for quantification. However, the combination of immunoassays and ICP-MS facilitates multiparametric analyses through elemental tagging, and provides a powerful alternative to common bioanalytical methods. This approach extends the detection of biomarkers in clinical diagnosis, and has the potential to provide a deeper understanding of the investigated biological system. The results might lead to the detection of diseases at an early stage, or guide treatment plans. Immunoassays are well accepted and established for diagnostic purposes, albeit ICP-MS is scarcely applied for the detection of immune-based assays. However, the screening of biomarkers demands high throughput and multiplex/multiparametric techniques, considering the variety of analytes to be queried. Finally, quantitative information on the expression level of biomarkers is highly desirable to identify abnormalities in a given organism. Thus, it is the aim of this review to introduce the fundamentals, and to discuss the enormous strength of ICP-MS for the detection of different immunoassays on the basis of selected applications, with a special focus on LA‐ICP‐MS. - Highlights: ► We discuss the fundamentals of elemental tagging for ICP‐MS applications. ► We propose a definition for the expressions “label” and “tag”. ► We highlight LA‐ICP‐MS‐based heteroelement detection. ► We give an historic overview on ICP-MS and LA‐ICP‐MS-based immunoassays. ► In a personal outlook, we discuss future improvements realistically attainable.

  11. Five-Antigen Fluorescent Bead-Based Assay for Diagnosis of Lyme Disease.

    Science.gov (United States)

    Embers, Monica E; Hasenkampf, Nicole R; Barnes, Mary B; Didier, Elizabeth S; Philipp, Mario T; Tardo, Amanda C

    2016-04-01

    The systematically difficult task of diagnosing Lyme disease can be simplified by sensitive and specific laboratory tests. The currently recommended two-tier test for serology is highly specific but falls short in sensitivity, especially in the early acute phase. We previously examined serially collected serum samples fromBorrelia burgdorferi-infected rhesus macaques and defined a combination of antigens that could be utilized for detection of infection at all phases of disease in humans. The fiveB. burgdorferiantigens, consisting of OspC, OspA, DbpA, OppA2, and the C6 peptide, were combined into a fluorescent cytometric bead-based assay for the detection ofB. burgdorferiantigen-specific IgG antibodies. Samples from Lyme disease patients and controls were used to determine the diagnostic value of this assay. Using this sample set, we found that our five-antigen multiplex IgG assay exhibited higher sensitivity (79.5%) than the enzyme immunoassay (EIA) (76.1%), the two-tier test (61.4%), and the C6 peptide enzyme-linked immunosorbent assay (ELISA) (77.2%) while maintaining specificity over 90%. When detection of IgM was added to the bead-based assay, the sensitivity improved to 91%, but at a cost of reduced specificity (78%). These results indicate that the rational combination of antigens in our multiplex assay may offer an improved serodiagnostic test for Lyme disease. PMID:26843487

  12. An ultrasensitive electrogenerated chemiluminescence-based immunoassay for specific detection of Zika virus

    Science.gov (United States)

    Acharya, Dhiraj; Bastola, Pradip; Le, Linda; Paul, Amber M.; Fernandez, Estefania; Diamond, Michael S.; Miao, Wujian; Bai, Fengwei

    2016-01-01

    Zika virus (ZIKV) is a globally emerging mosquito-transmitted flavivirus that can cause severe fetal abnormalities, including microcephaly. As such, highly sensitive, specific, and cost-effective diagnostic methods are urgently needed. Here, we report a novel electrogenerated chemiluminescence (ECL)-based immunoassay for ultrasensitive and specific detection of ZIKV in human biological fluids. We loaded polystyrene beads (PSB) with a large number of ECL labels and conjugated them with anti-ZIKV monoclonal antibodies to generate anti-ZIKV-PSBs. These anti-ZIKV-PSBs efficiently captured ZIKV in solution forming ZIKV-anti-ZIKV-PSB complexes, which were subjected to measurement of ECL intensity after further magnetic beads separation. Our results show that the anti-ZIKV-PSBs can capture as little as 1 PFU of ZIKV in 100 μl of saline, human plasma, or human urine. This platform has the potential for development as a cost-effective, rapid and ultrasensitive assay for the detection of ZIKV and possibly other viruses in clinical diagnosis, epidemiologic and vector surveillance, and laboratory research. PMID:27554037

  13. An ultrasensitive electrogenerated chemiluminescence-based immunoassay for specific detection of Zika virus.

    Science.gov (United States)

    Acharya, Dhiraj; Bastola, Pradip; Le, Linda; Paul, Amber M; Fernandez, Estefania; Diamond, Michael S; Miao, Wujian; Bai, Fengwei

    2016-01-01

    Zika virus (ZIKV) is a globally emerging mosquito-transmitted flavivirus that can cause severe fetal abnormalities, including microcephaly. As such, highly sensitive, specific, and cost-effective diagnostic methods are urgently needed. Here, we report a novel electrogenerated chemiluminescence (ECL)-based immunoassay for ultrasensitive and specific detection of ZIKV in human biological fluids. We loaded polystyrene beads (PSB) with a large number of ECL labels and conjugated them with anti-ZIKV monoclonal antibodies to generate anti-ZIKV-PSBs. These anti-ZIKV-PSBs efficiently captured ZIKV in solution forming ZIKV-anti-ZIKV-PSB complexes, which were subjected to measurement of ECL intensity after further magnetic beads separation. Our results show that the anti-ZIKV-PSBs can capture as little as 1 PFU of ZIKV in 100 μl of saline, human plasma, or human urine. This platform has the potential for development as a cost-effective, rapid and ultrasensitive assay for the detection of ZIKV and possibly other viruses in clinical diagnosis, epidemiologic and vector surveillance, and laboratory research. PMID:27554037

  14. An embedded microretroreflector-based microfluidic immunoassay platform.

    Science.gov (United States)

    Raja, Balakrishnan; Pascente, Carmen; Knoop, Jennifer; Shakarisaz, David; Sherlock, Tim; Kemper, Steven; Kourentzi, Katerina; Renzi, Ronald F; Hatch, Anson V; Olano, Juan; Peng, Bi-Hung; Ruchhoeft, Paul; Willson, Richard

    2016-04-26

    We present a microfluidic immunoassay platform based on the use of linear microretroreflectors embedded in a transparent polymer layer as an optical sensing surface, and micron-sized magnetic particles as light-blocking labels. Retroreflectors return light directly to its source and are highly detectable using inexpensive optics. The analyte is immuno-magnetically pre-concentrated from a sample and then captured on an antibody-modified microfluidic substrate comprised of embedded microretroreflectors, thereby blocking reflected light. Fluidic force discrimination is used to increase specificity of the assay, following which a difference imaging algorithm that can see single 3 μm magnetic particles without optical calibration is used to detect and quantify signal intensity from each sub-array of retroreflectors. We demonstrate the utility of embedded microretroreflectors as a new sensing modality through a proof-of-concept immunoassay for a small, obligate intracellular bacterial pathogen, Rickettsia conorii, the causative agent of Mediterranean Spotted Fever. The combination of large sensing area, optimized surface chemistry and microfluidic protocols, automated image capture and analysis, and high sensitivity of the difference imaging results in a sensitive immunoassay with a limit of detection of roughly 4000 R. conorii per mL. PMID:27025227

  15. Highly sensitive SERS-based immunoassay of aflatoxin B1 using silica-encapsulated hollow gold nanoparticles.

    Science.gov (United States)

    Ko, Juhui; Lee, Chankil; Choo, Jaebum

    2015-03-21

    Aflatoxin B1 (AFB1) is a well-known carcinogenic contaminant in foods. It is classified as an extremely hazardous compound because of its potential toxicity to the human nervous system. AFB1 has also been extensively used as a biochemical marker to evaluate the degree of food spoilage. In this study, a novel surface-enhanced Raman scattering (SERS)-based immunoassay platform using silica-encapsulated hollow gold nanoparticles (SEHGNs) and magnetic beads was developed for highly sensitive detection of AFB1. SEHGNs were used as highly stable SERS-encoding nano tags, and magnetic beads were used as supporting substrates for the high-density loading of immunocomplexes. Quantitative analysis of AFB1 was performed by monitoring the intensity change of the characteristic peaks of Raman reporter molecules. The limit of detection (LOD) of AFB1, determined by this SERS-based immunoassay, was determined to be 0.1 ng/mL. This method has some advantages over other analytical methods with respect to rapid analysis (less than 30 min), good selectivity, and reproducibility. The proposed method is expected to be a new analytical tool for the trace analysis of various mycotoxins. PMID:25462866

  16. Micromotor-based lab-on-chip immunoassays

    Science.gov (United States)

    García, Miguel; Orozco, Jahir; Guix, Maria; Gao, Wei; Sattayasamitsathit, Sirilak; Escarpa, Alberto; Merkoçi, Arben; Wang, Joseph

    2013-01-01

    Here we describe the first example of using self-propelled antibody-functionalized synthetic catalytic microengines for capturing and transporting target proteins between the different reservoirs of a lab-on-a-chip (LOC) device. A new catalytic polymer/Ni/Pt microtube engine, containing carboxy moieties on its mixed poly(3,4-ethylenedioxythiophene) (PEDOT)/COOH-PEDOT polymeric outermost layer, is further functionalized with the antibody receptor to selectively recognize and capture the target protein. The new motor-based microchip immunoassay operations are carried out without any bulk fluid flow, replacing the common washing steps in antibody-based protein bioassays with the active transport of the captured protein throughout the different reservoirs, where each step of the immunoassay takes place. A first microchip format involving an `on-the-fly' double-antibody sandwich assay (DASA) is used for demonstrating the selective capture of the target protein, in the presence of excess of non-target proteins. A secondary antibody tagged with a polymeric-sphere tracer allows the direct visualization of the binding events. In a second approach the immuno-nanomotor captures and transports the microsphere-tagged antigen through a microchannel network. An anti-protein-A modified microengine is finally used to demonstrate the selective capture, transport and convenient label-free optical detection of a Staphylococcus aureus target bacteria (containing proteinA in its cell wall) in the presence of a large excess of non-target (Saccharomyces cerevisiae) cells. The resulting nanomotor-based microchip immunoassay offers considerable potential for diverse applications in clinical diagnostics, environmental and security monitoring fields.Here we describe the first example of using self-propelled antibody-functionalized synthetic catalytic microengines for capturing and transporting target proteins between the different reservoirs of a lab-on-a-chip (LOC) device. A new catalytic

  17. Sandwich immunoassay for alpha-fetoprotein in human sera using gold nanoparticle and magnetic bead labels along with resonance Rayleigh scattering readout

    International Nuclear Information System (INIS)

    We describe a sensitive sandwich immunoassay for alpha-fetoprotein (AFP). It is making use of gold nanoparticles (GNPs) and magnetic beads (MBs) as labels, and of resonance Rayleigh scattering for detection. Two antibodies were labeled with GNPs and MBs, respectively, and MB-antigen-GNP complexes were formed in the presence of antigens. The MB labels also serve as solid phase carriers that can be used to magnetically separate the immuno complex. The GNP labels are used as optical probes, and Rayleigh scattering was used to determine the concentration of free GNPs-antibody after separation of the MB-antigen-GNP complexes. The concentration of AFP is related to the intensity of light scattered by free GNPs in the 13.6 pM to 436 pM concentration range, and the limit of detection is 13.6 pM. The method was applied to the determination of AFP in sera of cancer patients, and the results agree well with those obtained by conventional ELISA. (author)

  18. Allergen Micro-Bead Array for IgE Detection: A Feasibility Study Using Allergenic Molecules Tested on a Flexible Multiplex Flow Cytometric Immunoassay

    OpenAIRE

    Debora Pomponi; Maria Livia Bernardi; Marina Liso; Paola Palazzo; Lisa Tuppo; Chiara Rafaiani; Mario Santoro; Alexis Labrada; Maria Antonietta Ciardiello; Adriano Mari; Enrico Scala

    2012-01-01

    BACKGROUND: Allergies represent the most prevalent non infective diseases worldwide. Approaching IgE-mediated sensitizations improved much by adopting allergenic molecules instead of extracts, and by using the micro-technology for multiplex testing. OBJECTIVE AND METHODS: To provide a proof-of-concept that a flow cytometric bead array is a feasible mean for the detection of specific IgE reactivity to allergenic molecules in a multiplex-like way. A flow cytometry Allergenic Molecule-based micr...

  19. Nanoparticle-based immunosensors and immunoassays for aflatoxins.

    Science.gov (United States)

    Wang, Xu; Niessner, Reinhard; Tang, Dianping; Knopp, Dietmar

    2016-03-17

    Aflatoxins are naturally existing mycotoxins produced mainly by Aspergillus flavus and Aspergillus parasiticus, present in a wide range of food and feed products. Because of their extremely high toxicity and carcinogenicity, strict control of maximum residue levels of aflatoxins in foodstuff is set by many countries. In daily routine, different chromatographic methods are used almost exclusively. As supplement, in several companies enzyme immunoassay-based sample testing as primary screening is performed. Recently, nanomaterials such as noble metal nanoparticles, magnetic particles, carbon nanomaterials, quantum dots, and silica nanomaterials are increasingly utilized for aflatoxin determination to improve the sensitivity and simplify the detection. They are employed either as supports for the immobilization of biomolecules or as electroactive or optical labels for signal transduction and amplification. Several nanoparticle-based electrochemical, piezoelectric, optical, and immunodipstick assays for aflatoxins have been developed. In this review, we summarize these recent advances and illustrate novel concepts and promising applications in the field of food safety. PMID:26920768

  20. A capillary based chemiluminscent multi-target immunoassay.

    Science.gov (United States)

    Cao, Yuan-Cheng

    2015-05-01

    Renewed interest in capillary format immunoassays has lead to increasingly costly and complex approaches to preparation and readout. This study describes a simple multi-target method based on a capillary platform using horseradish peroxidase (HRP) labelled IgG to visualize an antibody antigen complex. When goat-anti-human IgG was employed as the probe and human IgG as target, the system allowed detection of target to less than 1 ng/mL using a standard detection approach. The capillaries were read visually or with a commercial grade CCD camera. Multi-target detection was demonstrated using a model system of rat-anti-mouse, goat-anti-human and mouse-anti-rat IgG. These probes were encoded to different locations in the capillary, providing a simple inexpensive approach to achieve multi-target assays. PMID:25731812

  1. Defect detection of the weld bead based on electromagnetic sensing

    International Nuclear Information System (INIS)

    Characterization of flaws of weld bead is imperative for high-quality welding. Methods of weld bead inspection include radiographic, ultrasonic and vision inspection. However, such methods are costly and time consuming. The proposed sensor is light, low-cost and fast. This paper summarizes our work on weld bead monitoring and defect detection using an electromagnetic sensor. Measurements are acquired in the form of S-Parameters, specifically measuring changes in the reflected coefficient S11. The weld bead is scanned using the sensor and any form of weld bead defection such as undercutting and excessive penetration is detected and identified.

  2. Multiplex competitive microbead-based flow cytometric immunoassay using quantum dot fluorescent labels

    International Nuclear Information System (INIS)

    Highlights: ► First time, duplex competitive bead-based flow cytometric immunoassay was developed using ODs. ► Antibody-coated QD detection probes and antigen-immobilized microspheres were synthesized. ► The two model target analytes were low molecular weight compounds of microbial and chemical origin. ► The determination of different water types was possible after simple filtration of samples. - Abstract: In answer to the ever-increasing need to perform the simultaneous analysis of environmental hazards, microcarrier-based multiplex technologies show great promise. Further integration with biofunctionalized quantum dots (QDs) creates new opportunities to extend the capabilities of multicolor flow cytometry with their unique fluorescence properties. Here, we have developed a competitive microbead-based flow cytometric immunoassay using QDs fluorescent labels for simultaneous detection of two analytes, bringing the benefits of sensitive, rapid and easy-of-manipulation analytical tool for environmental contaminants. As model target compounds, the cyanobacterial toxin microcystin-LR and the polycyclic aromatic hydrocarbon compound benzo[a]pyrene were selected. The assay was carried out in two steps: the competitive immunological reaction of multiple targets using their exclusive sensing elements of QD/antibody detection probes and antigen-coated microsphere, and the subsequent flow cytometric analysis. The fluorescence of the QD-encoded microsphere was thus found to be inversely proportional to target analyte concentration. Under optimized conditions, the proposed assay performed well within 30 min for the identification and quantitative analysis of the two environmental contaminants. For microcystin-LR and benzo[a]pyrene, dose–response curves with IC50 values of 5 μg L−1 and 1.1 μg L−1 and dynamic ranges of 0.52–30 μg L−1 and 0.13–10 μg L−1 were obtained, respectively. Recovery was 92.6–106.5% for 5 types of water samples like bottled

  3. Bioelectrochemical Immunoassay of Polychlorinated Biphenyl

    International Nuclear Information System (INIS)

    A simple, rapid, and highly sensitive bioelectrochemical immunoassay method based on magnetic beads (MBs) and disposable screen-printed electrodes (SPE) has been developed to detect polychlorinated biphenyls (PCBs). The principle of this bioassay is based on a direct competitive enzyme-linked immunosorbent assay using PCB-antibody-coated MBs and horseradish peroxidase (HRP)-labeled PCB (HRP-PCB). A magnetic process platform was used to mix and shake the samples during the immunoreactions and to separate free and unbound reagents after the liquid-phase competitive immunoreactions among PCB-antibody-coated MBs, PCB analyte, and HRP-PCB. After a complete immunoassay, the HRP tracers attached to MBs were transferred to a substrate solution containing o-aminophenol and hydrogen peroxide for electrochemical detection. The different parameters, including the amount of HRP-PCB conjugates, immunoreaction time, and the concentration of substrate that governs the analytical performance of the immunoassay have been studied in detail and optimized. The detection limit of 5 pg mL-1 was obtained under optimum experimental conditions. The performance of this bioelectrochemical immunoassay was successfully evaluated with untreated river water spiked with PCBs, and the results were validated by commercial PCB enzyme-linked immunosorbent assay kit, indicating that this convenient and sensitive technique offers great promise for decentralized environmental application and trace PCBs monitoring

  4. Evaluation of enzyme immunoassay for hepatitis B virus DNA based on anti-double-stranded DNA.

    OpenAIRE

    F. Garcia(Helsinki U); Bernal, M.C.; Leyva, A.; Piedrola, G.; Maroto, M C

    1995-01-01

    We have evaluated a new enzyme immunoassay technology to detect the products of PCR-based amplification that may be applicable to routine testing of hepatitis B virus (HBV) DNA. Two hundred eight serum samples were studied: 73 were basal samples and 135 were sequential serum samples from patients with chronic hepatitis, some of whom were being treated with alpha interferon. We compared the new detection method (PCR-DNA enzyme immunoassay [DEIA]) with dot blot hybridization performed without p...

  5. Allergen micro-bead array for IgE detection: a feasibility study using allergenic molecules tested on a flexible multiplex flow cytometric immunoassay.

    Directory of Open Access Journals (Sweden)

    Debora Pomponi

    Full Text Available BACKGROUND: Allergies represent the most prevalent non infective diseases worldwide. Approaching IgE-mediated sensitizations improved much by adopting allergenic molecules instead of extracts, and by using the micro-technology for multiplex testing. OBJECTIVE AND METHODS: To provide a proof-of-concept that a flow cytometric bead array is a feasible mean for the detection of specific IgE reactivity to allergenic molecules in a multiplex-like way. A flow cytometry Allergenic Molecule-based micro-bead Array system (ABA was set by coupling allergenic molecules with commercially available micro-beads. Allergen specific polyclonal and monoclonal antibodies, as well as samples from 167 allergic patients, characterized by means of the ISAC microarray system, were used as means to show the feasibility of the ABA. Three hundred and thirty-six sera were tested for 1 or more of the 16 selected allergens, for a total number of 1,519 tests on each of the two systems. RESULTS: Successful coupling was initially verified by detecting the binding of rabbit polyclonal IgG, mouse monoclonal, and pooled human IgE toward three allergens, namely nDer s 1, nPen m 1, and nPru p 3. The ABA assay showed to detect IgE to nAct d 1, nAct d 11, rAln g 1, nAmb a 1, nArt v 3, rBet v 1, rCor a 1, nCup a 1, nDer p 1, nDer s 1, rHev b 5, nOle e 1, rPar j 2, nPen m 1, rPhl p 1, and nPru p 3. Results obtained by ABA IgE testing were highly correlated to ISAC testing (r = 0.87, p<0.0001. No unspecific binding was recorded because of high total IgE values. CONCLUSION: The ABA assay represents a useful and flexible method for multiplex IgE detection using allergenic molecules. As also shown by our initial experiments with monoclonals and polyclonals, ABA is suitable for detecting other human and non-human immunoglobulins.

  6. A Compact Immunoassay Platform Based on a Multicapillary Glass Plate

    Directory of Open Access Journals (Sweden)

    Shuhua Xue

    2014-05-01

    Full Text Available A highly sensitive, rapid immunoassay performed in the multi-channels of a micro-well array consisting of a multicapillary glass plate (MCP and a polydimethylsiloxane (PDMS slide is described. The micro-dimensions and large surface area of the MCP permitted the diffusion distance to be decreased and the reaction efficiency to be increased. To confirm the concept of the method, human immunoglobulin A (h-IgA was measured using both the proposed immunoassay system and the traditional 96-well plate method. The proposed method resulted in a 1/5-fold decrease of immunoassay time, and a 1/56-fold cut in reagent consumption with a 0.05 ng/mL of limit of detection (LOD for IgA. The method was also applied to saliva samples obtained from healthy volunteers. The results correlated well to those obtained by the 96-well plate method. The method has the potential for use in disease diagnostic or on-site immunoassays.

  7. Automated microfluidic platform of bead-based electrochemical immunosensor integrated with bioreactor for continual monitoring of cell secreted biomarkers

    Science.gov (United States)

    Riahi, Reza; Shaegh, Seyed Ali Mousavi; Ghaderi, Masoumeh; Zhang, Yu Shrike; Shin, Su Ryon; Aleman, Julio; Massa, Solange; Kim, Duckjin; Dokmeci, Mehmet Remzi; Khademhosseini, Ali

    2016-04-01

    There is an increasing interest in developing microfluidic bioreactors and organs-on-a-chip platforms combined with sensing capabilities for continual monitoring of cell-secreted biomarkers. Conventional approaches such as ELISA and mass spectroscopy cannot satisfy the needs of continual monitoring as they are labor-intensive and not easily integrable with low-volume bioreactors. This paper reports on the development of an automated microfluidic bead-based electrochemical immunosensor for in-line measurement of cell-secreted biomarkers. For the operation of the multi-use immunosensor, disposable magnetic microbeads were used to immobilize biomarker-recognition molecules. Microvalves were further integrated in the microfluidic immunosensor chip to achieve programmable operations of the immunoassay including bead loading and unloading, binding, washing, and electrochemical sensing. The platform allowed convenient integration of the immunosensor with liver-on-chips to carry out continual quantification of biomarkers secreted from hepatocytes. Transferrin and albumin productions were monitored during a 5-day hepatotoxicity assessment in which human primary hepatocytes cultured in the bioreactor were treated with acetaminophen. Taken together, our unique microfluidic immunosensor provides a new platform for in-line detection of biomarkers in low volumes and long-term in vitro assessments of cellular functions in microfluidic bioreactors and organs-on-chips.

  8. Simultaneous Determination of the Main Peanut Allergens in Foods Using Disposable Amperometric Magnetic Beads-Based Immunosensing Platforms

    Directory of Open Access Journals (Sweden)

    Víctor Ruiz-Valdepeñas Montiel

    2016-06-01

    Full Text Available In this work, a novel magnetic beads (MBs-based immunosensing approach for the rapid and simultaneous determination of the main peanut allergenic proteins (Ara h 1 and Ara h 2 is reported. It involves the use of sandwich-type immunoassays using selective capture and detector antibodies and carboxylic acid-modified magnetic beads (HOOC-MBs. Amperometric detection at −0.20 V was performed using dual screen-printed carbon electrodes (SPdCEs and the H2O2/hydroquinone (HQ system. This methodology exhibits high sensitivity and selectivity for the target proteins providing detection limits of 18.0 and 0.07 ng/mL for Ara h 1 and Ara h 2, respectively, with an assay time of only 2 h. The usefulness of the approach was evaluated by detecting the endogenous content of both allergenic proteins in different food extracts as well as trace amounts of peanut allergen (0.0001% or 1.0 mg/kg in wheat flour spiked samples. The developed platform provides better Low detection limits (LODs in shorter assay times than those claimed for the allergen specific commercial ELISA kits using the same immunoreagents and quantitative information on individual food allergen levels. Moreover, the flexibility of the methodology makes it readily translate to the detection of other food-allergens.

  9. Opportunities for bead-based multiplex assays in veterinary diagnostic laboratories

    Science.gov (United States)

    Bead based multiplex assays (BBMA) also referred to as Luminex, MultiAnalyte Profiling or cytometric bead array (CBA) assays, are applicable for high throughput, simultaneous detection of multiple analytes in solution (from several, up to 50-500 analytes within a single, small sample volume). Curren...

  10. Magnetic bead detection using domain wall-based nanosensor

    International Nuclear Information System (INIS)

    We investigate the effect of a single magnetic bead (MB) on the domain wall (DW) pinning/depinning fields of a DW trapped at the corner of an L-shaped magnetic nanodevice. DW propagation across the device is investigated using magnetoresistance measurements. DW pinning/depinning fields are characterized in as-prepared devices and after placement of a 1 μm-sized MB (Dynabeads® MyOne™) at the corner. The effect of the MB on the DW dynamics is seen as an increase in the depinning field for specific orientations of the device with respect to the external magnetic field. The shift of the depinning field, ΔBdep = 4.5–27.0 mT, is highly stable and reproducible, being significantly above the stochastic deviation which is about 0.5 mT. The shift in the deppinning field is inversely proportional to the device width and larger for small negative angles between the device and the external magnetic field. Thus, we demonstrate that DW-based devices can be successfully used for detection of single micron size MB

  11. A disposable immunomagnetic electrochemical sensor based on functionalised magnetic beads and carbon-based screen-printed electrodes (SPCEs) for the detection of polychlorinated biphenyls (PCBs)

    International Nuclear Information System (INIS)

    A disposable immunomagnetic electrochemical sensor involving magnetic particles and carbon-based screen-printed electrodes (SPCEs) was developed and applied for the detection of polychlorinated biphenyls (PCBs). The sensor was based on a direct competitive immunoassay scheme in which antibody-coated magnetic beads were used as solid phase; then SPCEs were employed as transducers for the evaluation of the extent of the immunochemical reaction using an alkaline phosphatase (AP) labelled tracer. The α-naphthyl phosphate was used as enzymatic substrate and the α-naphthol produced during the enzymatic reaction was detected using differential pulse voltammetry (DPV). A detection limit of 0.4 ng/mL for Aroclor 1248 PCB mixture was obtained. The performance of the sensor was successfully evaluated on marine sediment extracts and soil samples spiked with different Aroclor mixtures indicating that this new and sensitive technique offers great promise for decentralized environmental applications

  12. Highly sensitive immunoassay based on E. coli with autodisplayed Z-domain

    Energy Technology Data Exchange (ETDEWEB)

    Jose, Joachim [Institute of Pharmaceutical Chemistry, Heinrich Heine University, Duesseldorf (Germany); Park, Min [School of Materials and Sciences, College of Engineering, Yonsei University, 134 Shin-chon-dong, Seo-dae-mun-gu, Seoul 120-749 (Korea, Republic of); Pyun, Jae-Chul, E-mail: jcpyun@yonsei.ac.kr [School of Materials and Sciences, College of Engineering, Yonsei University, 134 Shin-chon-dong, Seo-dae-mun-gu, Seoul 120-749 (Korea, Republic of)

    2010-05-14

    The Z-domain of protein A has been known to bind specifically to the F{sub c} region of antibodies (IgGs). In this work, the Z-domain of protein A was expressed on the outer membrane of Escherichia coli by using 'Autodisplay' technology as a fusion protein of autotransport domain. The E. coli with autodisplayed Z-domain was applied to the sandwich-type immunoassay as a solid-support of detection-antibodies against a target analyte. For the feasibility demonstration of the E. coli based immunoassay, C-reactive protein (CRP) assay was carried out by using E. coli with autodisplayed Z-domain. The limit of detection (LOD) and binding capacity of the E. coli based immunoassay were estimated to be far more sensitive than the conventional ELISA. Such a far higher sensitivity of E. coli based immunoassay than conventional ELISA was explained by the orientation control of immobilized antibodies and the mobility of E. coli in assay matrix. From the test results of 45 rheumatoid arthritis (RA) patients' serum and 15 healthy samples, a cut-off value was established to have optimal sensitivity and selectivity values for RA. The CRP test result of each individual sample was compared with ELISA which is the reference method for RA diagnosis. From this work, the E. coli with Z-domain was proved to be feasible for the medical diagnosis based on sandwich-type immunoassay.

  13. A bacteria-based bead for possible self-healing marine concrete applications

    Science.gov (United States)

    Palin, D.; Wiktor, V.; Jonkers, H. M.

    2016-08-01

    This work presents a bacteria-based bead for potential self-healing concrete applications in low-temperature marine environments. The bead consisting of calcium alginate encapsulated bacterial spores and mineral precursor compounds was assessed for: oxygen consumption, swelling, and its ability to form a biocomposite in a simulative marine concrete crack solution (SMCCS) at 8 °C. After six days immersion in the SMCCS the bacteria-based beads formed a calcite crust on their surface and calcite inclusions in their network, resulting in a calcite–alginate biocomposite. Beads swelled by 300% to a maximum diameter of 3 mm, while theoretical calculations estimate that 0.112 g of the beads were able to produce ∼1 mm3 of calcite after 14 days immersion; providing the bead with considerable crack healing potential. The bacteria-based bead shows great potential for the development of self-healing concrete in low-temperature marine environments, while the formation of a biocomposite healing material represents an exciting avenue for self-healing concrete research.

  14. REVIEW: CHITOSAN BASED HYDROGEL POLYMERIC BEADS – AS DRUG DELIVERY SYSTEM

    Directory of Open Access Journals (Sweden)

    Manjusha Rani

    2010-11-01

    Full Text Available Chitosan obtained by alkaline deacetylation of chitin is a non-toxic, biocompatible, and biodegradable natural polymer. Chitosan-based hydrogel polymeric beads have been extensively studied as micro- or nano-particulate carriers in the pharmaceutical and medical fields, where they have shown promise for drug delivery as a result of their controlled and sustained release properties, as well as biocompatibility with tissue and cells. To introduce desired properties and enlarge the scope of the potential applications of chitosan, graft copolymerization with natural or synthetic polymers on it has been carried out, and also, various chitosan derivatives have been utilized to form beads. The desired kinetics, duration, and rate of drug release up to therapeutical level from polymeric beads are limited by specific conditions such as beads material and their composition, bead preparation method, amount of drug loading, drug solubility, and drug polymer interaction. The present review summarizes most of the available reports about compositional and structural effects of chitosan-based hydrogel polymeric beads on swelling, drug loading, and releasing properties. From the studies reviewed it is concluded that chitosan-based hydrogel polymeric beads are promising drug delivery systems.

  15. Enzyme immunoassay of pancreatic oncofetal antigen (POA) as a marker of pancreatic cancer.

    OpenAIRE

    Nishida, K; Sugiura, M; Yoshikawa, T; Kondo, M

    1985-01-01

    For the quantitative measurement of pancreatic oncofetal antigen (POA), an enzyme immunoassay for POA has been developed, and is based on the sandwich method using antibody-coupled glass beads and enzyme (peroxidase)-labelled antibody. Serum POA concentrations were increased significantly in patients with pancreatic cancer, but not in those with chronic pancreatitis or other miscellaneous diseases, or in normal subjects. It is concluded that the enzyme immunoassay could be used for the assay ...

  16. Nitrocellulose membrane-based enzyme-linked immunoassay for dengue serotype-1 IgM detection

    International Nuclear Information System (INIS)

    To evaluate the sensitivity and specifity of a nitrocellulose membrane-based immunoassay for dengue IgM, with respect to capture enzyme immunoassay, for the diagnosis of dengue virus infection. 101 serum samples were processed and divided into 2 groups: 53 from dengue serotype 1 (DEN1) infected patients, and 48 from healthy subjects. Both groups were tested with a nitrocellulose membrane-based IgM capture enzyme immunoassay (NMB-EIA) and also with an ELISA as referential pattern. NMB-EIA testing detected IgM anti-DEN1 in 94,34% of samples from infected patients, and in 14,58% of control samples, whereas ELISA fails to report false positive or false negative results: NMB-EIA appears to be a good alternative for dengue infection diagnosis. (authors)

  17. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Henriksen, Anders Dahl;

    2014-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the...... differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface....... The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature...

  18. Effects of Sample Delivery on Analyte Capture in Porous Bead Sensors

    OpenAIRE

    Chou, Jie; Li, Luanyi E.; Kulla, Eliona; Christodoulides, Nicolaos; Floriano, Pierre N.; McDevitt, John T.

    2012-01-01

    Sample delivery is a crucial aspect of point-of-care applications where sample volumes need to be low and assay times need to be short, while providing high analytical and clinical sensitivity. In this paper, we explore the influence of the factors surrounding sample delivery on analyte capture in an immunoassay-based sensor array manifold of porous beads resting in individual wells. We model using computational fluid dynamics and a flow-through device containing beads sensitized specifically...

  19. A novel biosensor based on competitive SERS immunoassay and magnetic separation for accurate and sensitive detection of chloramphenicol.

    Science.gov (United States)

    Yang, Kang; Hu, Yongjun; Dong, Ning

    2016-06-15

    The accurate and sensitive detection of chloramphenicol (CAP) is particularly imperative to public health and safety. Here, we present a novel sensor for residual CAP detection based on competitive surface-enhanced Raman scattering (SERS) immunoassay and magnetic separation. In this nanosensor, functionalized Au nanoparticles (AuNPs) were labeled with the Raman reporter molecule (e.g. 4,4'-dipyridyl). With the addition of free CAP, a competitive immune reaction was initiated between free CAP and above AuNPs for conjugating with CAP antibody-modified magnetic nanoparticles (MNPs). Instead of the solid substrate, the antibody conjugated-magnetic beads were used as supporting materials and separation tools in the present sensor. With the aid of a magnet, the mixture was removed from the supernatant for concentration effects. This caused obvious change of SERS signal intensity obtained from supernatant. The SERS signals were collected from the supernatant directly, which made the SERS measurements more stable, repeatable and reliable. The proposed SERS-based magnetic immunosensor allows us to detect CAP in a fast, selective and sensitive (1.0 pg/mL) manner over a wide concentration range ( 1-1 × 10(4)pg/mL). In addition, these results demonstrate that this immunosensor holds great potential for the detection of antibiotics in real aquatic environment, which is crucial to our life. PMID:26866562

  20. Rapid determination of recent cocaine use with magnetic particles-based enzyme immunoassays in serum, saliva, and urine fluids.

    Science.gov (United States)

    Vidal, Juan C; Bertolín, Juan R; Bonel, Laura; Asturias, Laura; Arcos-Martínez, M Julia; Castillo, Juan R

    2016-06-01

    Cocaine is one of the most worldwide used illicit drugs. We report a magnetic particles-based enzyme-linked immunoassay (mpEIA) method for the rapid and sensitive determination of cocaine (COC) in saliva, urine and serum samples. Under optimized conditions, the limits of detections were 0.09ngmL(-1) (urine), 0.15ngmL(-1) (saliva), and 0.06ngmL(-1) COC (human serum). Sensitivities were in the range EC50=0.6-2.5ngmL(-1) COC. The cross-reactivity with the principal metabolite benzoylecgonine (BZE) was only 1.6%. Recovering percentages of doped samples (0, 10, 50, and 100ngmL(-1) of COC) ranged from about 86-111%. Some advantages of the developed mpEIA over conventional ELISA kits are faster incubations, improved reproducibility, and consumption of lower amounts of antibody and enzyme conjugates due to the use of magnetic beads. The reported method was validated following the guidelines on bioanalytical methods of the European Medicines Agency (2011). Unmetabolized COC detection has a great interest in pharmacological, pharmacokinetics, and toxicokinetics studies, and can be used to detect a very recent COC use (1-6h). PMID:27003120

  1. PicoMolar level detection of protein biomarkers based on electronic sizing of bead aggregates: theoretical and experimental considerations.

    Science.gov (United States)

    Lin, Z; Cao, X; Xie, P; Liu, M; Javanmard, Mehdi

    2015-12-01

    We demonstrate a novel method for electronically detecting and quantifying protein biomarkers using microfluidic impedance cytometry. Our biosensor, which consists of gold electrodes micro-fabricated in a microchannel, detects the differences between bead aggregates of varying sizes in a micro-pore sandwiched between two micro channels. We perform a sandwich immunoassay, where the complementary antibody pairs are immobilized on two different bead types, and the presence of antigen results in bead aggregation, the amount of which depends on antigen quantity. When single beads or bead aggregates pass through the impedance sensor, differences in impedance change are detected. In this manuscript, we perform a comprehensive theoretical study on the limits imposed on sensitivity of this technique due to electronic noise and also mass transfer and reaction limits. We also experimentally characterize the performance of this technique by validating the technique on an IgG detection assay. A detection limit at the picoMolar level is demonstrated, thus comparable in sensitivity to a sandwich ELISA. PMID:26589228

  2. Monoclonal antibody-based enzyme immunoassay for Giardia lamblia antigen in human stool.

    OpenAIRE

    Stibbs, H H

    1989-01-01

    A visually readable monoclonal antibody-based antigen-capture enzyme immunoassay for the detection of Giardia lamblia antigen in human stool specimens was developed and found to be 97% (30 of 31 stool specimens) sensitive for formalinized stools and 82% (49 of 60 stool specimens) sensitive for unfixed stool specimens by visual reading. The storage of specimens in 10% Formalin resulted in increased absorbance in 20 of 26 G. lamblia-positive specimens tested as both formalinized and unfixed spe...

  3. Online measurement of bead geometry in GMAW-based additive manufacturing using passive vision

    International Nuclear Information System (INIS)

    Additive manufacturing based on gas metal arc welding is an advanced technique for depositing fully dense components with low cost. Despite this fact, techniques to achieve accurate control and automation of the process have not yet been perfectly developed. The online measurement of the deposited bead geometry is a key problem for reliable control. In this work a passive vision-sensing system, comprising two cameras and composite filtering techniques, was proposed for real-time detection of the bead height and width through deposition of thin walls. The nozzle to the top surface distance was monitored for eliminating accumulated height errors during the multi-layer deposition process. Various image processing algorithms were applied and discussed for extracting feature parameters. A calibration procedure was presented for the monitoring system. Validation experiments confirmed the effectiveness of the online measurement system for bead geometry in layered additive manufacturing. (paper)

  4. A Novel Magnetic Bead-based Biosensor Using Flip Chip Bonding Techniques

    Institute of Scientific and Technical Information of China (English)

    Bin Wang; Xiang Chen; Qinghui Jin; Jianlong Zhao; Yuansen Xu

    2006-01-01

    Based on flip-chip packaging, a novel approach towards integrated magnetic bio-separator was designed. The magnetic field and the force on the bead were simulated and analyzed, leading to the optimization of the fabrication parameters of the micro-magnetic unit. The planar coil as an electromagnet was fabricated through electroplating on a single seed layer.The PDMS microfluidic channel was bonded on the inverse side after Si etching. The results presented in this paper provide a novel design and fabrication to approach a microfluidic bio-separation system with magnetic beads.

  5. Automated Solid-Phase Subcloning Based on Beads Brought into Proximity by Magnetic Force

    DEFF Research Database (Denmark)

    Hudson, Elton P.; Nikoshkov, Andrej; Uhlén, Mathias;

    2012-01-01

    gene are immobilized to separate paramagnetic beads and brought into proximity by magnetic force. Ligation events were directly evaluated using fluorescent-based microscopy and flow cytometry. The highest ligation efficiencies were obtained when gene- and vector-coated beads were brought into close...... contact by application of a magnet during the ligation step. An automated procedure was developed using a laboratory workstation to transfer genes into various expression vectors and more than 95% correct clones were obtained in a number of various applications. The method presented here is suitable for...

  6. Accelerated surface-enhanced Raman spectroscopy (SERS)-based immunoassay on a gold-plated membrane.

    Science.gov (United States)

    Penn, Michelle A; Drake, David M; Driskell, Jeremy D

    2013-09-17

    A rapid and simple SERS-based immunoassay has been developed to overcome diffusion-limited binding kinetics that often impedes rapid analysis in conventional heterogeneous immunoassays. This paper describes the development of an antibody-modified membrane as a flow-through capture substrate for a nanoparticle-enabled SERS immunoassay to enhance antibody-antigen binding kinetics. A thin layer of gold is plated onto polycarbonate track-etched nanoporous membranes via electroless deposition. Capture antibody is immobilized onto the surface of a gold-plated membrane via thiolate coupling chemistry to serve as a capture substrate. A syringe is then used to actively transport the analyte and extrinsic Raman labels to the capture substrate. The fabrication of the gold-plated membrane is thoroughly investigated and established as a viable capture substrate for a SERS-based immunoassay in the absence of sample/SERS label flow. A syringe pump is used to systematically investigate the effect of flow rate on antibody-antigen binding kinetics and demonstrate that active transport to the capture membrane surface expedites antibody-antigen binding. Mouse IgG and goat anti-mouse IgG are selected as a model antigen-antibody system to establish proof of principle. It is demonstrated that the assay for mouse IgG is reduced from 24 h to 10 min and a 10-fold improvement in detection limit is achieved with the flow assay developed herein relative to the passive, i.e., no flow, assay. Moreover, mouse serum is directly analyzed and IgG level is determined using the flow assay. PMID:23972208

  7. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    International Nuclear Information System (INIS)

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor

  8. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    Energy Technology Data Exchange (ETDEWEB)

    Rizzi, Giovanni, E-mail: giori@nanotech.dtu.dk; Østerberg, Frederik W.; Henriksen, Anders D.; Dufva, Martin; Hansen, Mikkel F., E-mail: mikkel.hansen@nanotech.dtu.dk

    2015-04-15

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor.

  9. Facile Fabrication of Polymerizable Ionic Liquid Based-Gel Beads via Thiol-ene Chemistry.

    Science.gov (United States)

    Taghavikish, Mona; Subianto, Surya; Dutta, Naba Kumar; Choudhury, Namita Roy

    2015-08-12

    Multipurpose gel beads prepared from natural or synthetic polymers have received significant attention in various applications such as drug delivery, coatings, and electrolytes because of their versatility and unique performance as micro- and nanocontainers.1 However, comparatively little work has been done on poly(ionic liquid)-based materials despite their unique ionic characteristics. Thus, in this contribution we report the facile preparation of polymerizable ionic liquid-based gel beads using thiol-ene click chemistry. This novel system incorporates pentaerythritol tetra (3-mercaptopropionate) (PETKMP) and 1,4-di(vinylimidazolium) butane bisbromide in a thiol-ene-based photopolymerization to fabricate the gel beads. Their chemical structure, thermal and mechanical properties have been investigated using Fourier transform infrared spectroscopy (FTIR), differential scanning calorimetry (DSC), thermogravimetric analysis (TGA), and dynamic mechanical analysis (DMA). The gel beads possess low Tg and their ionic functionalities attribute self-healing properties and their ability to uptake small molecules or organic compounds offers their potential use as pH sensing material and macrocontainers. PMID:26171715

  10. Blu-ray optomagnetic measurement based competitive immunoassay for Salmonella detection.

    Science.gov (United States)

    Tian, Bo; Bejhed, Rebecca S; Svedlindh, Peter; Strömberg, Mattias

    2016-03-15

    A turn-on competitive immunoassay using a low-cost Blu-ray optomagnetic setup and two differently sized magnetic particles (micron-sized particles acting as capture particles and nano-sized particles acting as detection particles) is here presented. For Salmonella detection, a limit of detection of 8×10(4)CFU/mL is achieved within a total assay time of 3h. The combination of a competitive strategy and an optomagnetic setup not only enables a turn-on read-out format, but also results in a sensitivity limit about a factor of 20 times lower than of volumetric magnetic stray field detection device based immunoassays. The improvement of sensitivity is enabled by the formation of immuno-magnetic aggregates providing steric hindrance protecting the interior binding sites from interaction with the magnetic nanoparticle labels. The formation of immuno-magnetic aggregates is confirmed by fluorescence microscopy. The system exhibits no visible cross-reaction with other common pathogenic bacteria, even at concentrations as high as 10(7)CFU/mL. Furthermore, we present results when using the setup for a qualitative and homogeneous biplex immunoassay of Escherichia coli and Salmonella typhimurium. PMID:26386328

  11. A flow cytometric assay technology based on quantum dots-encoded beads

    International Nuclear Information System (INIS)

    A flow cytometric detecting technology based on quantum dots (QDs)-encoded beads has been described. Using this technology, several QDs-encoded beads with different code were identified effectively, and the target molecule (DNA sequence) in solution was also detected accurately by coupling to its complementary sequence probed on QDs-encoded beads through DNA hybridization assay. The resolution of this technology for encoded beads is resulted from two longer wavelength fluorescence identification signals (yellow and red fluorescent signals of QDs), and the third shorter wavelength fluorescence signal (green reporting signal of fluorescein isothiocyanate (FITC)) for the determination of reaction between probe and target. In experiment, because of QDs' unique optical character, only one excitation light source was needed to excite the QDs and probe dye FITC synchronously comparing with other flow cytometric assay technology. The results show that this technology has present excellent repeatability and good accuracy. It will become a promising multiple assay platform in various application fields after further improvement

  12. A magnetic bead-based ligand binding assay to facilitate human kynurenine 3-monooxygenase drug discovery.

    Science.gov (United States)

    Wilson, Kris; Mole, Damian J; Homer, Natalie Z M; Iredale, John P; Auer, Manfred; Webster, Scott P

    2015-02-01

    Human kynurenine 3-monooxygenase (KMO) is emerging as an important drug target enzyme in a number of inflammatory and neurodegenerative disease states. Recombinant protein production of KMO, and therefore discovery of KMO ligands, is challenging due to a large membrane targeting domain at the C-terminus of the enzyme that causes stability, solubility, and purification difficulties. The purpose of our investigation was to develop a suitable screening method for targeting human KMO and other similarly challenging drug targets. Here, we report the development of a magnetic bead-based binding assay using mass spectrometry detection for human KMO protein. The assay incorporates isolation of FLAG-tagged KMO enzyme on protein A magnetic beads. The protein-bound beads are incubated with potential binding compounds before specific cleavage of the protein-compound complexes from the beads. Mass spectrometry analysis is used to identify the compounds that demonstrate specific binding affinity for the target protein. The technique was validated using known inhibitors of KMO. This assay is a robust alternative to traditional ligand-binding assays for challenging protein targets, and it overcomes specific difficulties associated with isolating human KMO. PMID:25296660

  13. Optimizing a waveguide-based sandwich immunoassay for tumor biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini [Los Alamos National Laboratory; Swanson, Basil I [Los Alamos National Laboratory; Xie, Hongzhi [Los Alamos National Laboratory; Anderson, Aaron S [Los Alamos National Laboratory; Grace, W Kevin [Los Alamos National Laboratory; Shively, John E [NON LANL

    2008-01-01

    The sensor team at the Los Alamos National Laboratory has developed a waveguide-based optical biosensor for the detection of biomarkers associated with the disease. We have previously demonstrated the application of this technology to the sensitive detection of carcinoembryonic antigen in serum and nipple aspirate fluid from breast cancer patients. In this publication, we report improvements to this technology that will facilitate transition to a point-of-care diagnostic system and/or robust research tool.

  14. FRET-Based Quantum Dot Immunoassay for Rapid and Sensitive Detection of Aspergillus amstelodami

    Directory of Open Access Journals (Sweden)

    Michele D. Kattke

    2011-06-01

    Full Text Available In this study, a fluorescence resonance energy transfer (FRET-based quantum dot (QD immunoassay for detection and identification of Aspergillus amstelodami was developed. Biosensors were formed by conjugating QDs to IgG antibodies and incubating with quencher-labeled analytes; QD energy was transferred to the quencher species through FRET, resulting in diminished fluorescence from the QD donor. During a detection event, quencher-labeled analytes are displaced by higher affinity target analytes, creating a detectable fluorescence signal increase from the QD donor. Conjugation and the resulting antibody:QD ratios were characterized with UV-Vis spectroscopy and QuantiT protein assay. The sensitivity of initial fluorescence experiments was compromised by inherent autofluorescence of mold spores, which produced low signal-to-noise and inconsistent readings. Therefore, excitation wavelength, QD, and quencher were adjusted to provide optimal signal-to-noise over spore background. Affinities of anti-Aspergillus antibody for different mold species were estimated with sandwich immunoassays, which identified A. fumigatus and A. amstelodami for use as quencher-labeled- and target-analytes, respectively. The optimized displacement immunoassay detected A. amstelodami concentrations as low as 103 spores/mL in five minutes or less. Additionally, baseline fluorescence was produced in the presence of 105 CFU/mL heat-killed E. coli O157:H7, demonstrating high specificity. This sensing modality may be useful for identification and detection of other biological threat agents, pending identification of suitable antibodies. Overall, these FRET-based QD-antibody biosensors represent a significant advancement in detection capabilities, offering sensitive and reliable detection of targets with applications in areas from biological terrorism defense to clinical analysis.

  15. Sequential injection chemiluminescence immunoassay for anionic surfactants using magnetic microbeads immobilized with an antibody.

    Science.gov (United States)

    Zhang, Ruiqi; Hirakawa, Koji; Seto, Daisuke; Soh, Nobuaki; Nakano, Koji; Masadome, Takashi; Nagata, Kazumi; Sakamoto, Kazuhira; Imato, Toshihiko

    2005-12-15

    A rapid and sensitive immunoassay for the determination of linear alkylbenzene sulfonates (LAS) is described. The method involves a sequential injection analysis (SIA) system equipped with a chemiluminescence detector and a neodymium magnet. Magnetic beads, to which an anti-LAS monoclonal antibody was immobilized, were used as a solid support in an immunoassay. The introduction, trapping and release of the magnetic beads in the flow cell were controlled by means of a neodymium magnet and adjusting the flow of the carrier solution. The immunoassay was based on an indirect competitive immunoreaction of an anti-LAS monoclonal antibody on the magnetic beads and the LAS sample and horseradish peroxidase (HRP)-labeled LAS, and was based on the subsequent chemiluminscence reaction of HRP with hydrogen peroxide and p-iodophenol, in a luminol solution. The anti-LAS antibody was immobilized on the beads by coupling the antibody with the magnetic beads after activation of a carboxylate moiety on the surface of magnetic beads that had been coated with a polylactic acid film. The antibody immobilized magnetic beads were introduced, and trapped in the flow cell equipped with the neodymium magnet, an LAS solution containing HRP-labeled LAS at constant concentration and the luminol solution were sequentially introduced into the flow cell based on an SIA programmed sequence. Chemiluminescence emission was monitored by means of a photon counting unit located at the upper side of the flow cell by collecting the emitted light with a lens. A typical sigmoid calibration curve was obtained, when the logarithm of the concentration of LAS was plotted against the chemiluminescence intensity using various concentrations of standard LAS samples (0-500ppb) under optimum conditions. The time required for analysis is less than 15min. PMID:18970310

  16. Development of a new passive sampler based on diffusive milligel beads for copper analysis in water

    Energy Technology Data Exchange (ETDEWEB)

    Perez, M.; Reynaud, S.; Lespes, G.; Potin-Gautier, M. [Université de Pau et des Pays de l’Adour/CNRS UMR IPREM 5254, Hélioparc, 2 av. du Président Angot, 64053 Pau (France); Mignard, E. [CNRS-Solvay-Université Bordeaux, UMR5258, Laboratoire du Futur, 178 Avenue du Dr. A. Schweitzer, 33608 Pessac Cedex (France); Chéry, P. [Bordeaux Science Agro, 1 cours du Général De Gaulle, Gradignan, 33175 (France); Schaumlöffel, D. [Université de Pau et des Pays de l’Adour/CNRS UMR IPREM 5254, Hélioparc, 2 av. du Président Angot, 64053 Pau (France); Grassl, B., E-mail: bruno.grassl@univ-pau.fr [Université de Pau et des Pays de l’Adour/CNRS UMR IPREM 5254, Hélioparc, 2 av. du Président Angot, 64053 Pau (France)

    2015-08-26

    A new passive sampler was designed and characterized for the determination of free copper ion (Cu{sup 2+}) concentration in aqueous solution. Each sampling device was composed of a set of about 30 diffusive milligel (DMG) beads. Milligel beads with incorporated cation exchange resin (Chelex) particles were synthetized using an adapted droplet-based millifluidic process. Beads were assumed to be prolate spheroids, with a diameter of 1.6 mm and an anisotropic factor of 1.4. The milligel was controlled in chemical composition of hydrogel (monomer, cross-linker, initiator and Chelex concentration) and characterized in pore size. Two types of sampling devices were developed containing 7.5% and 15% of Chelex, respectively, and 6 nm pore size. The kinetic curves obtained demonstrated the accumulation of copper in the DMG according to the process described in the literature as absorption (and/or adsorption) and release following the Fick's first law of diffusion. For their use in water monitoring, the typical physico-chemical characteristics of the samplers, i.e. the mass-transfer coefficient (k{sub 0}) and the sampler-water partition coefficient (K{sub sw}), were determined based on a static exposure design. In order to determine the copper concentration in the samplers after their exposure, a method using DMG bead digestion combined to Inductively Coupled Plasma – Atomic Emission Spectrometry (ICP-AES) analysis was developed and optimized. The DMG devices proved to be capable to absorb free copper ions from an aqueous solution, which could be accurately quantified with a mean recovery of 99% and a repeatability of 7% (mean relative uncertainty). - Highlights: • Controlled geometry of new passive sampler with ellipsoidal shape. • Original manufacturing process based on droplet-based millifluidic device. • Pore size characterization of the sampler. • Mass-transfer and sampler-water partitioning coefficients by static exposure experiments.

  17. Immunoassays based on enzymes and fluorescence for serodiagnosis of livestock infections

    International Nuclear Information System (INIS)

    The limitations and advantages of non-isotopic assays in the serodiagnosis of infections are discussed. The relative merits of enzyme immunoassays, immunoenzymometric assays and their fluorometric counterparts are emphasized. Particular attention is given to the factors which may introduce systematic and random error at the various steps in each assay type. Great strides have been made in developing the relatively new enzyme-based immunoassays. Under proper control, they achieve levels of sensitivity and specificity of their isotopic analogues. Limitations in enzyme-based assays occur most often either when reagents are used improperly or when conditions of the assay are not sufficiently controlled. The computer-assisted kinetics-based enzyme-linked assay (KELA) is given as an example of a system which provides for many relevant controls not included in most other systems. A simplified fluorometric assay system (Track XI), currently under commercial development, shows promise for field and laboratory applications. The efficiency of this assay type is similar to that of isotopic and enzymatic assays. The instrumentation is less expensive, however, and will come with a battery-operated option. Early clinical trials are encouraging; this emergent technology is conducive to use in the tropics as an aid in animal disease diagnosis. (author)

  18. Highly Sensitive Homogeneous Immunoassays Based on Construction of Silver Triangular Nanoplates-Quantum Dots FRET System

    Science.gov (United States)

    Zeng, Qinghui; Li, Qin; Ji, Wenyu; Bin, Xue; Song, Jie

    2016-05-01

    With growing concerns about health issues worldwide, elegant sensors with high sensitivity and specificity for virus/antigens (Ag) detection are urgent to be developed. Homogeneous immunoassays (HIA) are an important technique with the advantages of small sample volumes requirement and pretreatment-free process. HIA are becoming more favorable for the medical diagnosis and disease surveillance than heterogeneous immunoassays. An important subset of HIA relies on the effect of fluorescence resonance energy transfer (FRET) via a donor-acceptor (D–A) platform, e.g., quantum dots (QDs) donor based FRET system. Being an excellent plasmonic material, silver triangular nanoplates (STNPs) have unique advantages in displaying surface plasmon resonance in the visible to near infrared spectral region, which make them a better acceptor for pairing with QDs in a FRET-based sensing system. However, the reported STNPs generally exhibited broad size distributions, which would greatly restrict their application as HIA acceptor for high detection sensitivity and specificity purpose. In this work, uniform STNPs and red-emitting QDs are firstly applied to construct FRET nanoplatform in the advanced HIA and further be exploited for analyzing virus Ag. The uniform STNPs/QDs nanoplatform based medical sensor provides a straightforward and highly sensitive method for Ag analysis in homogeneous form.

  19. Porous Bead-Based Diagnostic Platforms: Bridging the Gaps in Healthcare

    Directory of Open Access Journals (Sweden)

    John McDevitt

    2012-11-01

    Full Text Available Advances in lab-on-a-chip systems have strong potential for multiplexed detection of a wide range of analytes with reduced sample and reagent volume; lower costs and shorter analysis times. The completion of high-fidelity multiplexed and multiclass assays remains a challenge for the medical microdevice field; as it struggles to achieve and expand upon at the point-of-care the quality of results that are achieved now routinely in remote laboratory settings. This review article serves to explore for the first time the key intersection of multiplexed bead-based detection systems with integrated microfluidic structures alongside porous capture elements together with biomarker validation studies. These strategically important elements are evaluated here in the context of platform generation as suitable for near-patient testing. Essential issues related to the scalability of these modular sensor ensembles are explored as are attempts to move such multiplexed and multiclass platforms into large-scale clinical trials. Recent efforts in these bead sensors have shown advantages over planar microarrays in terms of their capacity to generate multiplexed test results with shorter analysis times. Through high surface-to-volume ratios and encoding capabilities; porous bead-based ensembles; when combined with microfluidic elements; allow for high-throughput testing for enzymatic assays; general chemistries; protein; antibody and oligonucleotide applications.

  20. A novel multiplex bead-based platform highlights the diversity of extracellular vesicles

    Directory of Open Access Journals (Sweden)

    Nina Koliha

    2016-02-01

    Full Text Available The surface protein composition of extracellular vesicles (EVs is related to the originating cell and may play a role in vesicle function. Knowledge of the protein content of individual EVs is still limited because of the technical challenges to analyse small vesicles. Here, we introduce a novel multiplex bead-based platform to investigate up to 39 different surface markers in one sample. The combination of capture antibody beads with fluorescently labelled detection antibodies allows the analysis of EVs that carry surface markers recognized by both antibodies. This new method enables an easy screening of surface markers on populations of EVs. By combining different capture and detection antibodies, additional information on relative expression levels and potential vesicle subpopulations is gained. We also established a protocol to visualize individual EVs by stimulated emission depletion (STED microscopy. Thereby, markers on single EVs can be detected by fluorophore-conjugated antibodies. We used the multiplex platform and STED microscopy to show for the first time that NK cell–derived EVs and platelet-derived EVs are devoid of CD9 or CD81, respectively, and that EVs isolated from activated B cells comprise different EV subpopulations. We speculate that, according to our STED data, tetraspanins might not be homogenously distributed but may mostly appear as clusters on EV subpopulations. Finally, we demonstrate that EV mixtures can be separated by magnetic beads and analysed subsequently with the multiplex platform. Both the multiplex bead-based platform and STED microscopy revealed subpopulations of EVs that have been indistinguishable by most analysis tools used so far. We expect that an in-depth view on EV heterogeneity will contribute to our understanding of different EVs and functions.

  1. Rapid lateral-flow immunoassay for the quantum dot-based detection of puerarin.

    Science.gov (United States)

    Qu, Huihua; Zhang, Yue; Qu, Baoping; Kong, Hui; Qin, Gaofeng; Liu, Shuchen; Cheng, Jinjun; Wang, Qingguo; Zhao, Yan

    2016-07-15

    In this study, a rapid (within 10min) quantitative lateral-flow immunoassay using a quantum dots (QDs)-antibody probe was developed for the analysis of puerarin (PUE) in water and biological samples. The competitive immunoassay was based on anti-PUE monoclonal antibody conjugated with QDs (detection reagent). Secondary antibody was immobilized on one end of a nitrocellulose membrane (control line) and PUE-bovine serum albumin conjugate was immobilized on the other end (test line). In the quantitative experiment, the detection results were scanned using a membrane strip reader and a detection curve (regression equation: y=-0.11ln(x)+0.979, R(2)=0.9816) representing the averages of the scanned data was obtained. This curve was linear from 1 to 10μg/mL. The IC50 value was 75.58ng/mL and the qualitative detection limit of PUE was 5.8ng/mL. The recovery of PUE added to phosphate-buffered saline and biological samples was in the range of 97.38-116.56%. To our knowledge, this is the first report of the quantitative detection of a natural product by QDs-based immunochromatography, which represents a powerful tool for rapidly screening PUE in plant materials and other biological samples. PMID:26991602

  2. Streptococcus suis II immunoassay based on thorny gold nanoparticles and surface enhanced Raman scattering.

    Science.gov (United States)

    Chen, Kun; Han, Heyou; Luo, Zhihui

    2012-03-01

    An immunoassay based on surface enhanced Raman scattering (SERS) spectroscopy was developed to detect muramidase released protein (MRP) antibody against Streptococcus suis II (SS2) utilizing thorny gold nanoparticles (tAuNPs) as SERS substrates. Initially, tAuNPs with multi-branches were prepared by the seed-mediated growth method in the absence of templates and surfactants, facilitating p-mercaptobenzoic acid (pMBA) conjugation covalently onto the tAuNPs through S-Au bonds. The obtained immuno-SERS tag affording strong Raman signals made it possible to establish an application of indirect detection of the MRP antibody against SS2 with a sandwich assay at a highly sensitive level. The Raman intensity at 1588 cm(-1) was proportional to the logarithm of the concentration of MRP antibody in the range of 10 pg mL(-1) to 0.1 μg mL(-1). The detection sensitivity was significantly improved to 0.1 pg mL(-1) by using the immuno-SERS tags. Furthermore, the proposed SERS approach was applied to detect MRP antibody in pig serum samples, and the results agreed well with those of ELISA, indicating great potential for clinical application in diagnostic immunoassays. PMID:22282767

  3. Highly sensitive immunoassay of protein molecules based on single nanoparticle fluorescence detection in a nanowell

    Science.gov (United States)

    Han, Jin-Hee; Kim, Hee-Joo; Lakshmana, Sudheendra; Gee, Shirley J.; Hammock, Bruce D.; Kennedy, Ian M.

    2011-03-01

    A nanoarray based-single molecule detection system was developed for detecting proteins with extremely high sensitivity. The nanoarray was able to effectively trap nanoparticles conjugated with biological sample into nanowells by integrating with an electrophoretic particle entrapment system (EPES). The nanoarray/EPES is superior to other biosensor using immunoassays in terms of saving the amounts of biological solution and enhancing kinetics of antibody binding due to reduced steric hindrance from the neighboring biological molecules. The nanoarray patterned onto a layer of PMMA and LOL on conductive and transparent indium tin oxide (ITO)-glass slide by using e-beam lithography. The suspension of 500 nm-fluorescent (green emission)-carboxylated polystyrene (PS) particles coated with protein-A followed by BDE 47 polyclonal antibody was added to the chip that was connected to the positive voltage. The droplet was covered by another ITO-coated-glass slide and connected to a ground terminal. After trapping the particles into the nanowells, the solution of different concentrations of anti-rabbit- IgG labeled with Alexa 532 was added for an immunoassay. A single molecule detection system could quantify the anti-rabbit IgG down to atto-mole level by counting photons emitted from the fluorescent dye bound to a single nanoparticle in a nanowell.

  4. Aggregation-induced emissive nanoparticles for fluorescence signaling in a low cost paper-based immunoassay.

    Science.gov (United States)

    Engels, Jan F; Roose, Jesse; Zhai, Demi Shuang; Yip, Ka Man; Lee, Mei Suet; Tang, Ben Zhong; Renneberg, Reinhard

    2016-07-01

    Low cost paper based immunoassays are receiving interest due to their fast performance and small amounts of biomolecules needed for developing an immunoassay complex. In this work aggregation-induced emissive (AIE) nanoparticles, obtained from a diastereoisomeric mixture of 1,2-di-(4-hydroxyphenyl)-1,2-diphenylethene (TPEDH) in a one-step top-down method, are characterized through Dynamic Light Scattering (DLS), Scanning Electron Microscopy (SEM), and Zeta potential. By measuring the Zeta potential before and after labeling the nanoparticles with antibodies we demonstrate that the colloidal system is stable in a wide pH-range. The AIE-active nanoparticles are deposited on chitosan and glutaraldehyde modified paper pads overcoming the common aggregation-caused quenching (ACQ) effect. Analyte concentrations from 1000ng and below are applied in a model immunocomplex using Goat anti-Rabbit IgG and Rabbit IgG. In the range of 7.81ng-250ng, linear trends with a high R(2) are observed, which leads to a strong increase of the blue fluorescence from the TPEDH nanoparticles. PMID:27037781

  5. Fully Automated Quantification of Insulin Concentration Using a Microfluidic-Based Chemiluminescence Immunoassay.

    Science.gov (United States)

    Yao, Ping; Liu, Zhu; Tung, Steve; Dong, Zaili; Liu, Lianqing

    2016-06-01

    A fully automated microfluidic-based detection system for the rapid determination of insulin concentration through a chemiluminescence immunoassay has been developed. The microfluidic chip used in the system is a double-layered polydimethylsiloxane device embedded with interconnecting micropumps, microvalves, and a micromixer. At a high injection rate of the developing solution, the chemiluminescence signal can be excited and measured within a short period of time. The integral value of the chemiluminescence light signal is used to determine the insulin concentration of the samples, and the results indicate that the measurement is accurate in the range from 1.5 pM to 391 pM. The entire chemiluminescence assay can be completed in less than 10 min. The fully automated microfluidic-based insulin detection system provides a useful platform for rapid determination of insulin in clinical diagnostics for diabetes, which is expected to become increasingly important for future point-of-care applications. PMID:25824205

  6. Optimization of Weld Bead Parameters of Nickel Based Overlay Deposited by Plasma Transferred Arc Surfacing with Adequacy Test

    OpenAIRE

    Bhaskarananda Dasgupta; Pinaky Bhadury

    2014-01-01

    Plasma Transferred Arc surfacing is a kind of Plasma Transferred Arc Welding process. Plasma Transferred Arc surfacing (PTA) is increasingly used in applications where enhancement of wear, corrosion and heat resistance of materials surface is required. The shape of weld bead geometry affected by the PTA Welding process parameters is an indication of the quality of the weld. In this paper the analysis and optimization of weld bead parameters, during deposition of a Nickel based...

  7. Bead-based suspension array for simultaneous differential detection of five major swine viruses.

    Science.gov (United States)

    Chen, Ru; Yu, Xiao-Lu; Gao, Xiao-Bo; Xue, Cun-Yi; Song, Chang-Xu; Li, Yan; Cao, Yong-Chang

    2015-01-01

    A novel multiplex detection array based on Luminex xMAP technology was developed and validated for simultaneous detection of five major viruses causing swine reproductive diseases. By combining one-step asymmetric multiplex reverse transcription polymerase chain reaction (RT-PCR) with xMAP bead-based hybridization and flow cytometry analysis, the resulting multiplex assay was capable of detecting single and mixed infections of PRRSV, PCV-2, PRV, CSFV, and PPV in a single reaction. The assay accurately detected and differentiated 23 viral strains used in this study. The low detection limit was determined as 2.2-22 copies/μL (corresponding to 0.5-6.8 fg/μL DNA template) on plasmid constructs containing viral fragments. The intra-assay and inter-assay variances (CV%) were low that ranged from 2.5 to 5.4 % and 4.1 to 7.6 %, respectively. The assay was applied to test field samples and detected single and mixed viral infections. The detection rate was higher than that of uniplex conventional PCR and RT-PCR methods. The detection of PRRSV by the bead-based multiplex assay was comparable with a commercially available real time RT-PCR kit. The test procedure on purified DNA or RNA samples could be completed within 2 h. In conclusion, the bead-based suspension array presented here proved to be a high-throughput practical tool that provided highly specific and sensitive identification of single and multiple infections of five major viruses in pigs and boar semen. PMID:25557628

  8. Immunoassay techniques.

    Science.gov (United States)

    Wheeler, Michael J

    2013-01-01

    No other development has had such a major impact on the measurement of hormones as immunoassay. Reagents and assay kits can now be bought commercially but not for the more esoteric or new hormones. This chapter explains the basics of the immunoassay reaction and gives simple methods for immunoassays and immunometric assays and for the production of reagents for both antigenic and hapten hormones. Alternative methods are given for the preparation of labeled hormones as well as several possible separation procedures. The methods described here have been previously used in a wide range of assays and have stood the test of time. They will allow the production of usable immunoassays in a relatively short period of time. PMID:23996355

  9. Luminex-Based Triplex Immunoassay for the Simultaneous Detection of Soy, Pea and Soluble Wheat proteins in Milk Powder

    NARCIS (Netherlands)

    Haasnoot, W.; Pre, du J.G.

    2007-01-01

    An automated fluorescent microsphere-based flow cytometric triplex immunoassay, using the Luminex 100 flow analyzer with MultiAnalyte Profiling (xMAP) technology, was developed for the simultaneous detection of proteins from three vegetable sources as potential fraudulent adulterants in milk powder.

  10. Development of a bead-based multiplex genotyping method for diagnostic characterization of HPV infection.

    Directory of Open Access Journals (Sweden)

    Mee Young Chung

    Full Text Available The accurate genotyping of human papillomavirus (HPV is clinically important because the oncogenic potential of HPV is dependent on specific genotypes. Here, we described the development of a bead-based multiplex HPV genotyping (MPG method which is able to detect 20 types of HPV (15 high-risk HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68 and 5 low-risk HPV types 6, 11, 40, 55, 70 and evaluated its accuracy with sequencing. A total of 890 clinical samples were studied. Among these samples, 484 were HPV positive and 406 were HPV negative by consensus primer (PGMY09/11 directed PCR. The genotyping of 484 HPV positive samples was carried out by the bead-based MPG method. The accuracy was 93.5% (95% CI, 91.0-96.0, 80.1% (95% CI, 72.3-87.9 for single and multiple infections, respectively, while a complete type mismatch was observed only in one sample. The MPG method indiscriminately detected dysplasia of several cytological grades including 71.8% (95% CI, 61.5-82.3 of ASCUS (atypical squamous cells of undetermined significance and more specific for high grade lesions. For women with HSIL (high grade squamous intraepithelial lesion and SCC diagnosis, 32 women showed a PPV (positive predictive value of 77.3% (95% CI, 64.8-89.8. Among women >40 years of age, 22 women with histological cervical cancer lesions showed a PPV of 88% (95% CI, 75.3-100. Of the highest risk HPV types including HPV-16, 18 and 31 positive women of the same age groups, 34 women with histological cervical cancer lesions showed a PPV of 77.3% (95% CI, 65.0-89.6. Taken together, the bead-based MPG method could successfully detect high-grade lesions and high-risk HPV types with a high degree of accuracy in clinical samples.

  11. Reconfigurable and resettable arithmetic logic units based on magnetic beads and DNA

    Science.gov (United States)

    Zhang, Siqi; Wang, Kun; Huang, Congcong; Sun, Ting

    2015-12-01

    Based on the characteristics of magnetic beads and DNA, a simple and universal platform was developed for the integration of multiple logic gates to achieve resettable half adder and half subtractor functions. The signal reporter was composed of a split G-quadruplex DNAzyme and AuNP-surface immobilized molecular beacon molecule. The novel feature of the designed system is that the inputs (split G-quadruplexes) can interact with hairpin-modified Au NPs linked to magnetic particles. Another novel feature is that the logic operations can be reset by heating the output system and by using the magnetic separation of the computing modules. Moreover, the developed half adder and half subtractor are realized on a simple DNA/magnetic bead platform in an enzyme-free system and share a constant threshold setpoint. Due to the diversity and design flexibility of DNA, these investigations may provide a new method for the development of resettable DNA-based arithmetic operations.Based on the characteristics of magnetic beads and DNA, a simple and universal platform was developed for the integration of multiple logic gates to achieve resettable half adder and half subtractor functions. The signal reporter was composed of a split G-quadruplex DNAzyme and AuNP-surface immobilized molecular beacon molecule. The novel feature of the designed system is that the inputs (split G-quadruplexes) can interact with hairpin-modified Au NPs linked to magnetic particles. Another novel feature is that the logic operations can be reset by heating the output system and by using the magnetic separation of the computing modules. Moreover, the developed half adder and half subtractor are realized on a simple DNA/magnetic bead platform in an enzyme-free system and share a constant threshold setpoint. Due to the diversity and design flexibility of DNA, these investigations may provide a new method for the development of resettable DNA-based arithmetic operations. Electronic supplementary information

  12. Specific T-cell epitopes for immunoassay-based diagnosis of Mycobacterium tuberculosis infection

    DEFF Research Database (Denmark)

    Brock, I; Weldingh, K; Leyten, EM; Arend, SM; Ravn, Pernille; Andersen, P

    2004-01-01

    Specific T-cell epitopes for immunoassay-based diagnosis of Mycobacterium tuberculosis infection.Brock I, Weldingh K, Leyten EM, Arend SM, Ravn P, Andersen P. Department of Infectious Disease Immunology, Statens Serum Institute, Artillerivej 5, DK-2300 Copenhagen S, Denmark. The currently used...... method for immunological detection of tuberculosis infection, the tuberculin skin test, has low specificity. Antigens specific for Mycobacterium tuberculosis to replace purified protein derivative are therefore urgently needed. We have performed a rigorous assessment of the diagnostic potential of four...... recently identified antigens (Rv2653, Rv2654, Rv3873, and Rv3878) from genomic regions that are lacking from the Mycobacterium bovis bacillus Calmette-Guerin (BCG) vaccine strains as well as from the most common nontuberculous mycobacteria. The fine specificity of potential epitopes in these molecules was...

  13. Optimization of Weld Bead Parameters of Nickel Based Overlay Deposited by Plasma Transferred Arc Surfacing with Adequacy Test

    Directory of Open Access Journals (Sweden)

    Bhaskarananda Dasgupta

    2014-07-01

    Full Text Available Plasma Transferred Arc surfacing is a kind of Plasma Transferred Arc Welding process. Plasma Transferred Arc surfacing (PTA is increasingly used in applications where enhancement of wear, corrosion and heat resistance of materials surface is required. The shape of weld bead geometry affected by the PTA Welding process parameters is an indication of the quality of the weld. In this paper the analysis and optimization of weld bead parameters, during deposition of a Nickel based alloy Colmonoy on stainless steel plate by plasma transferred arc surfacing, are made and values of process parameters to produce optimal weld bead geometry are estimated. The experiments are conducted based on a five input process parameters and mathematical models are developed using multiple regression technique. The direct effects of input process parameters on weld bead geometry are discussed using graphs. Finally, optimization of the weld bead parameters, that is minimization of penetration and maximization of reinforcement and weld bead width, are made with a view to economize the input process parameters to achieve the desirable welding joint.

  14. Development and Application of a Gel-Based Immunoassay for the Rapid Screening of Salbutamol and Ractopamine Residues in Pork.

    Science.gov (United States)

    Li, Chenglong; Li, Jingya; Jiang, Wenxiao; Zhang, Suxia; Shen, Jianzhong; Wen, Kai; Wang, Zhanhui

    2015-12-01

    Salbutamol (SAL) and ractopamine (RAC) have been illegally used to promote protein synthesis and to increase the feed conversion rate in livestock. However, the residues of SAL and RAC could cause potential hazards for human health. The Ministry of Agriculture of China banned the use of SAL and RAC as growth promoters. In this paper, we provide detailed information on developing a rapid and sensitive gel-based immunoassay for on-site screening of SAL and RAC residues in pork. The detection time was shortened to 20 min. The limits of detection were 0.5 μg/kg for both SAL and RAC by visual detection, whereas the quantitative gel-based immunoassay enabled the detection of SAL (0.051 μg/kg) and RAC (0.020 μg/kg) in spiked pork samples. The gel-based immunoassay showed promise as a multiplexed immunoassay for on-site surveilling of SAL and RAC residues in pork. PMID:26595169

  15. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL−1 and 50 μg mL−1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  16. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    Full Text Available Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3 to 5×10(8 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6, 14×10(6, and 8×10(6 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  17. A New Microsphere-Based Immunoassay for Measuring the Activity of Transcription Factors

    Directory of Open Access Journals (Sweden)

    Tsai Chueh-Jen

    2010-01-01

    Full Text Available Abstract There are several traditional and well-developed methods for analyzing the activity of transcription factors, such as EMSA, enzyme-linked immunosorbent assay, and reporter gene activity assays. All of these methods have their own distinct disadvantages, but none can analyze the changes in transcription factors in the few cells that are cultured in the wells of 96-well titer plates. Thus, a new microsphere-based immunoassay to measure the activity of transcription factors (MIA-TF was developed. In MIA-TF, NeutrAvidin-labeled microspheres were used as the solid phase to capture biotin-labeled double-strand DNA fragments which contain certain transcription factor binding elements. The activity of transcription factors was detected by immunoassay using a transcription factor-specific antibody to monitor the binding with the DNA probe. Next, analysis was performed by flow cytometry. The targets hypoxia-inducible factor-1α (HIF-1α and nuclear factor-kappa B (NF-κB were applied and detected in this MIA-TF method; the results that we obtained demonstrated that this method could be used to monitor the changes of NF-κB or HIF within 50 or 100 ng of nuclear extract. Furthermore, MIA-TF could detect the changes in NF-κB or HIF in cells that were cultured in wells of a 96-well plate without purification of the nuclear protein, an important consideration for applying this method to high-throughput assays in the future. The development of MIA-TF would support further progress in clinical analysis and drug screening systems. Overall, MIA-TF is a method with high potential to detect the activity of transcription factors.

  18. Specificity of immunoassays. Pt. 2

    International Nuclear Information System (INIS)

    Practical aspects of the measurement of the specificity of immunoassay are reviewed. Antibody heterogeneity in an antiserum makes a pragmatic rather than a theoretical approach necessary. A new method for the measurement of immunoassay specificity is described. This method is based on the errors caused by the cross-reacting antigens and is directly relevant to the validity of results obtained by immunoassay methods. The effect of selectively blocking the least specific antibodies in antisera raised against steroid haptens is tested. The practical consequences of these considerations are tested using steroid radioimmunoassay and enzyme-immunoassay. (orig.)

  19. Electrochemical magnetic beads-based immunosensing platform for the determination of α-lactalbumin in milk.

    Science.gov (United States)

    Ruiz-Valdepeñas Montiel, Víctor; Campuzano, Susana; Torrente-Rodríguez, Rebeca M; Reviejo, A Julio; Pingarrón, José M

    2016-12-15

    Alpha-lactalbumin (α-LA) is one of the whey proteins in cows' milk that has been identified as allergenic. In this work, we present, for the first time, a very sensitive magnetic beads (MBs)-based immunosensor for the determination of α-LA. A sandwich configuration involving selective capture and horseradish peroxidase-labeled detector antibodies was implemented on carboxylic acid-modified magnetic beads, captured magnetically under the surface of a disposable screen-printed carbon electrode for amperometric detection using the hydroquinone (HQ)/H2O2 system. The α-LA immunosensor exhibited a wide linear range (37.0-5000pg/ml), a low limit of detection (LOD, 11.0pg/ml) and noteworthy selectivity against other non-target proteins. The MBs-based immunosensing platform was applied successfully for the determination of α-LA in several varieties of milk (raw and UHT cows' milk as well as human milk) and infant formulations. The results were corroborated with those obtained using a commercial ELISA method, thereby substantiating the analytical merits of this unique method. PMID:27451223

  20. Dose-response curve of a microfluidic magnetic bead-based surface coverage sandwich assay.

    Science.gov (United States)

    Cornaglia, Matteo; Trouillon, Raphaël; Tekin, H Cumhur; Lehnert, Thomas; Gijs, Martin A M

    2015-09-25

    Magnetic micro- and nanoparticles ('magnetic beads') have been used to advantage in many microfluidic devices for sensitive antigen (Ag) detection. Today, assays that use as read-out of the signal the number count of immobilized beads on a surface for quantification of a sample's analyte concentration have been among the most sensitive and have allowed protein detection lower than the fgmL(-1) concentration range. Recently, we have proposed in this category a magnetic bead surface coverage assay (Tekin et al., 2013 [1]), in which 'large' (2.8μm) antibody (Ab)-functionalized magnetic beads captured their Ag from a serum and these Ag-carrying beads were subsequently exposed to a surface pattern of fixed 'small' (1.0μm) Ab-coated magnetic beads. When the system was exposed to a magnetic induction field, the magnet dipole attractive interactions between the two bead types were used as a handle to approach both bead surfaces and assist with Ag-Ab immunocomplex formation, while unspecific binding (in absence of an Ag) of a large bead was reduced by exploiting viscous drag flow. The dose-response curve of this type of assay had two remarkable features: (i) its ability to detect an output signal (i.e. bead number count) for very low Ag concentrations, and (ii) an output signal of the assay that was non-linear with respect to Ag concentration. We explain here the observed dose-response curves and show that the type of interactions and the concept of our assay are in favour of detecting the lowest analyte concentrations (where typically either zero or one Ag is carried per large bead), while higher concentrations are less efficiently detected. We propose a random walk process for the Ag-carrying bead over the magnetic landscape of small beads and this model description explains the enhanced overall capture probability of this assay and its particular non-linear dose response curves. PMID:25817550

  1. Design, fabrication and test of a pneumatically controlled, renewable, microfluidic bead trapping device for sequential injection analysis applications

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Guocheng; Lu, Donglai; Fu, Zhifeng; Du, Dan; Ozanich, Richard M.; Wang, Wanjun; Lin, Yuehe

    2016-01-01

    This paper describes the design, fabrication, and testing of a pneumatically controlled,renewable, microfluidic device for conducting bead-based assays in an automated sequential injection analysis system. The device used a “brick wall”-like pillar array (pillar size: 20 μm length X 50 μm width X 45 μm height) with 5 μm gaps between the pillars serving as the micro filter. The flow channel where bead trapping occurred is 500 μm wide X 75 μm deep. An elastomeric membrane and an air chamber were located underneath the flow channel. By applying pressure to the air chamber, the membrane is deformed and pushed upward against the filter structure. This effectively traps beads larger than 5 μm and creates a “bed” or micro column of beads that can be perfused and washed with liquid samples and reagents. Upon completion of the assay process, the pressure is released and the beads are flushed out from underneath the filter structure to renew the device. Mouse IgG was used as a model analyte to test the feasibility of using the proposed device for immunoassay applications. Resulting microbeads from an on-chip fluorescent immunoassay were individually examined using flow cytometry. The results show that the fluorescence signal intensity distribution is fairly narrow indicating high chemical reaction uniformity among the beads population. Electrochemical onchip assay was also conducted. A detection limit of 0.1 ng/mL1 ppb was achieved and good device reliability and repeatability were demonstrated. The novel microfluidic-based beadstrapping device thus opens up a new pathway to design micro-bead based biosensor immunoassays for clinical and othervarious applications.

  2. Bifunctional 4MBA mediated recyclable SERS-based immunoassay induced by photocatalytic activity of TiO2 nanotube arrays.

    Science.gov (United States)

    Wang, Xiaolong; Zhou, Lu; Lai, Wei; Jiang, Tao; Zhou, Jun

    2016-09-14

    We first report here a novel recyclable surface-enhanced Raman scattering (SERS)-based immunoassay via the photocatalytic ability of anatase titania nanotube (TiO2-NT) arrays. In this immunoassay, an immune probe was realized by immobilizing anti-CA19-9 onto Ag@SiO2@Ag three core-shell nanoparticles (TCSNPs), which showed a much higher SERS activity than bare Ag NPs with an enhancement ratio of 1.75. Then, the vertically oriented TiO2-NT immune substrate was synthesized by ultra-fast anodic oxidation of flexible titanium foils and functionalised with 4-mercaptobenzoic acid (4MBA) molecules to link them with anti-CA19-9. The immunoassay using the above immune probe and the substrate exhibited a wide linear range from 1000 to 0.5 U mL(-1) and a low detection limit of 0.5 U mL(-1) for CA19-9 due to the excellent SERS performance of Ag@SiO2@Ag TCSNPs. More importantly, the linkage between TiO2-NTs and 4MBA was destroyed by catalyzing 4MBA into 4-sulfobenzoate upon UV irradiation in O2-saturated water. The target antigen and the immune probe were simultaneously removed leading to a recyclable immunoassay and a detection limit of 5 U mL(-1) was achieved after six cycles. The simplicity and versatility of this strategy may bridge the technology gap between academia and practical detection, which makes it promising for clinical SERS-based immunoassay. PMID:27523026

  3. Magnetic bead-based salivary peptidome profiling for periodontal-orthodontic treatment

    Directory of Open Access Journals (Sweden)

    Zhang Jieni

    2012-11-01

    Full Text Available Abstract Background Patients with periodontitis seek periodontal-orthodontic treatment to address certain functional and aesthetic problems. However, little is known of the effect of periodontitis on orthodontic treatment. Thus, we compared the differences in peptide mass fingerprints of orthodontic patients with and without periodontitis by MALDI-TOF MS using a magnetic bead-based peptidome analysis of saliva samples. In this way, we aimed to identify and explore a panel of differentially-expressed specific peptides. Results Saliva samples from 24 patients (eight orthodontic patients without periodontitis, eight with periodontitis and another eight with periodontitis but no orthodontic treatment were analyzed, and peptide mass fingerprints were created by scanning MS signals using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS combined with magnetic beads. Nine mass peaks showed significant differences. Orthodontic patients in the group without periodontal disease showed higher mass peaks for seven peptides of the nine, whereas the mass peaks for the other two peptides were higher in the periodontal-orthodontic patients. Besides, these differentially-expressed peptides were sequenced. Conclusions The elucidated candidate biomarkers indicated interactions between periodontal condition and orthodontic treatment and their contributions to the changes of saliva protein profiles. Our results provide novel insight into the altered salivary protein profile during periodontal-orthodontic treatment, and may lead to the development of a therapeutic monitoring strategy for periodontics and orthodontics.

  4. Magnetic bead-based nucleic acid purification kit: Clinical application and performance evaluation in stool specimens.

    Science.gov (United States)

    Yoon, Jihoon G; Kang, Jin Seok; Hwang, Seung Yong; Song, Jaewoo; Jeong, Seok Hoon

    2016-05-01

    Two different methods - the semi-automated magnetic bead-based kit (SK, Stool DNA/RNA Purification kit®) and the manual membrane column-based kit (QS, QIAamp® DNA Stool Mini kit) - for purifying nucleic acids from clinical stool samples were compared and evaluated. The SK kit was more user-friendly than QS due to the reduced manual processing, partial automation, and short turnaround time with half cost. Furthermore, SK produced high yields in both DNA and RNA extractions but poor purity in RNA extraction. In the assessment of rotavirus and Clostridium difficile infection, both kits had equivalent or more sensitive performance compared with the standard method. Although SK showed some interference and inhibition in nucleic acid extraction, the performance, including the repeatability, linearity, analytical sensitivity, and matrix effect, was sufficient for routine clinical use. PMID:27030641

  5. Color encoded microbeads-based flow cytometric immunoassay for polycyclic aromatic hydrocarbons in food

    International Nuclear Information System (INIS)

    Food contamination caused by chemical hazards such as persistent organic pollutants (POPs) is a worldwide public health concern and requires continuous monitoring. The chromatography-based analysis methods for POPs are accurate and quite sensitive but they are time-consuming, laborious and expensive. Thus, there is a need for validated simplified screening tools, which are inexpensive, rapid, have automation potential and can detect multiple POPs simultaneously. In this study we developed a flow cytometry-based immunoassay (FCIA) using a color-encoded microbeads technology to detect benzo[a]pyrene (BaP) and other polycyclic aromatic hydrocarbons (PAHs) in buffer and food extracts as a starting point for the future development of rapid multiplex assays including other POPs in food, such as polychlorinated biphenyls (PCBs) and polybrominated diphenyl ethers (PBDEs). A highly sensitive assay for BaP was obtained with an IC50 of 0.3 μg L-1 using a monoclonal antibody (Mab22F12) against BaP, similar to the IC50 of a previously described enzyme-linked immunosorbent assay (ELISA) using the same Mab. Moreover, the FCIA was 8 times more sensitive for BaP compared to a surface plasmon resonance (SPR)-based biosensor immunoassay (BIA) using the same reagents. The selectivity of the FCIAs was tested, with two Mabs against BaP for 25 other PAHs, including two hydroxyl PAH metabolites. Apart from BaP, the FCIAs can detect PAHs such as indenol[1,2,3-cd]pyrene (IP), benz[a]anthracene (BaA), and chrysene (CHR) which are also appointed by the European Food Safety Authority (EFSA) as suitable indicators of PAH contamination in food. The FCIAs results were in agreement with those obtained with gas chromatography-mass spectrometry (GC-MS) for the detection of PAHs in real food samples of smoked carp and wheat flour and has great potential for the future routine application of this assay in a simplex or multiplex format in combination with simplified extraction procedure which are

  6. Development of a Smartphone-based reading system for lateral flow immunoassay.

    Science.gov (United States)

    Lee, Sangdae; Kim, Giyoung; Moon, Jihea

    2014-11-01

    This study was conducted to develop and evaluate the performance of the Smartphone-based reading system for the lateral flow immunoassay (LFIA). Smartphone-based reading system consists of a Samsung Galaxy S2 Smartphone, Smartphone application, and a LFIA reader. LFIA reader is composed of the close-up lens with a focal length up to 30 mm, white LED light, lithium polymer battery, and main body. The Smartphone application for image acquisition and data analysis was developed on the Android platform. The standard curve was obtained by plotting the measured P(T)/P(c) or A(T)/A(c) ratio versus Salmonella standard concentration. The mean, standard deviation (SD), recovery, and relative standard deviation (RSD) were also calculated using additional experimental results. These data were compared with that obtained from the benchtop LFIA reader. The LOD in both systems was observed with 10(6) CFU/mL. The results show high accuracy and good reproducibility with a RSD less than 10% in the range of 10(6) to 10(9) CFU/mL. Due to the simple structure, good sensitivity, and high accuracy of the Smartphone-based reading system, this system can be substituted for the benchtop LFIA reader for point-of-care medical diagnostics. PMID:25958545

  7. Color-encoded microcarriers based on nano-silicon dioxide film for multiplexed immunoassays.

    Science.gov (United States)

    Li, Qiang; Zhang, Kaihuan; Wang, Tongzhou; Zhou, Xinying; Wang, Jia; Wang, Chen; Lin, Haixiao; Li, Xin; Lu, Ying; Huang, Guoliang

    2012-08-21

    Multiplexed analysis allows researchers to obtain high-density information with minimal assay time, sample volume and cost. Currently, microcarrier or particle-based approaches for multiplexed analysis involve complicated or expensive encoding and decoding processes. In this paper, a novel optical encoding technique based on nano-silicon dioxide film is presented. Microcarriers composed of thermally grown silicon dioxide (SiO(2)) film and monocrystalline silicon (Si) substrate were fabricated. The nano-silicon dioxide film exhibited unique surface color by low-coherence interference. Hence the colors can be used for encoding at least 100 microcarriers loaded with films of different thickness. We demonstrated that color-encoded microcarriers loaded with antigens could be used for multiplexed immunoassays to detect goat anti-human IgG, goat anti-mouse IgG and goat anti-rabbit IgG, with fluorescent detection as the interrogating approach. This microcarrier-based method also exhibited improved analytical performance compared with a microarray technique. This approach will provide new opportunities for multiplexed target assay development. PMID:22745929

  8. Dual-layered and double-targeted nanogold based lateral flow immunoassay for influenza virus

    International Nuclear Information System (INIS)

    We report on a highly sensitive lateral flow immunoassay (LFIA) for influenza A which serves as a model antigen. Gold nanoparticles conjugated to monoclonal antibodies specific to the two most abundant influenza A proteins, nucleoprotein and matrix protein, were used as detector probes. Using this approach, the nucleoprotein and matrix protein in the virion were detected simultaneously. The signal was further amplified via a signal amplification strategy that is making use of two-layered nanogold in combination with a double-targeted detection format. Under optimized conditions, the system is capable of detecting influenza A antigens in infected cells at levels as low as 47 TCID50 · mL−1 (50 % tissue culture infectious dose) within 15 min. Compared to the conventional LFIA based on single-targeted detection, the detection capability of this system is better by a factor of 8 without requiring additional steps or instruments. In addition to its simplicity and rapidity, this LFIA also can detect the target analyte in even complex biological matrix. This proof-of-principle of a dual-layered and double-targeted nanogold-based LFIA is deemed to be useful for developing single-step, rapid, and sensitive tests for screening and diagnosis. (author)

  9. Sensitive QD@SiO2-based immunoassay for triplex determination of cereal-borne mycotoxins.

    Science.gov (United States)

    Beloglazova, Natalia V; Foubert, Astrid; Gordienko, Anna; Tessier, Mickael D; Aubert, Tangi; Drijvers, Emile; Goryacheva, Irina; Hens, Zeger; De Saeger, Sarah

    2016-11-01

    A sensitive tool for simultaneous quantitative determination of three analytes in one single well of a microtiter plate is shown for the first time. The developed technique is based on use of colloidal quantum dot enrobed into a silica shell (QD@SiO2) derivatives as a highly responsive label. Silica-coated quantum dots were prepared and subsequently modified via the co-hydrolysis with tetraethylorthosilicate (TEOS) and various organosilane reagents. Different surface modification schemes were compared in terms of applicability of the obtained particles for the multiplex immunoassay, e.g. stability and simplicity of their conjugation with biomolecules. As model system a multiplex immunosorbent assay for screening of three mycotoxins (deoxynivalenol, zearalenone and aflatoxin B1) in cereal-based products was realized via a co-immobilization of three different specific antibodies (anti- deoxynivalenol, anti-zearalenone and anti-aflatoxin B1) in one single well of a microtiter plate. Mycotoxins were simultaneously determined by labelling their conjugates with QD@SiO2 emitting in different parts of the visible spectrum. The limits of detection for the simultaneous determination were 6.1 and 5.3, 5.4 and 4.1, and 2.6 and 1.9µgkg(-1) for deoxynivalenol, zearalenone and aflatoxin B1 in maize and wheat, respectively. As confirmatory method, liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) was used. PMID:27591588

  10. Microsphere-based immunoassay integrated with a microfluidic network to perform logic operations

    International Nuclear Information System (INIS)

    Lab on a chip (LOC) intelligent diagnostics can be described by molecular logic-based circuits. We report on the development of an LOC approach with logic capability for screening combinations of antigen and antibody in the same sample. A microsphere-based immunoassay was integrated with a microfluidic network device to perform the logic operations AND and INHIBIT. Using the clinically relevant biomarkers TNF-α cytokine and anti-TNF-α antibody, we obtained a fluorescent output in the presence of both inputs. This results in an AND operation, while the presence of only one specific input results in a different fluorescent signal, thereby indicating the INHIBIT operation. This approach demonstrates the effective use of molecular logic computation for developing portable, point-of-care technologies for diagnostic purposes due to fast detection times, minimal reagent consumption and low costs. This model system may be further expanded to screening of multiple disease markers, combinatorial logic applications, and developing “smart” sensors and therapeutic technologies. (author)

  11. Magnetic hydrogel beads based on PVA/sodium alginate/laponite RD and studying their BSA adsorption.

    Science.gov (United States)

    Mahdavinia, Gholam Reza; Mousanezhad, Sedigheh; Hosseinzadeh, Hamed; Darvishi, Farshad; Sabzi, Mohammad

    2016-08-20

    In this study double physically crosslinked magnetic hydrogel beads were developed by a simple method including solution mixing of sodium alginate and poly(vinyl alcohol) (PVA) containing magnetic laponite RD (Rapid Dispersion). Sodium alginate and PVA were physically crosslinked by Ca(2+) and freezing-thawing cycles, respectively. Magnetic laponite RD nanoparticles were incorporated into the system to create magnetic response and strengthen the hydrogels. All hybrids double physically crosslinked hydrogel beads were stable under different pH values without any disintegration. Furthermore, adsorption of bovine serum albumin (BSA) on the hydrogel beads was investigated on the subject of pH, ion strength, initial BSA concentration, and temperature. Nanocomposite beads exhibited maximum adsorption capacity for BSA at pH=4.5. The experimental adsorption isotherm data were well followed Langmuir model and based on this model the maximum adsorption capacity was obtained 127.3mgg(-1) at 308K. Thermodynamic parameters revealed spontaneous and monolayer adsorption of BSA on magnetic nanocomposites beads. PMID:27178944

  12. Immunoassay of antigens

    International Nuclear Information System (INIS)

    A method is described of immunoassay of an antigen in a liquid sample wherein a complex is formed between antigen contained in the said sample and two or more antibody reagents, and the said complex is bound to a solid support by non-covalent bonding as defined herein: and the amount of complex becoming bound to the support is determined; the process employing at least one monoclonal antibody reagent. Labelling methods including radioactive, fluorimetric and enzyme labelling may be used to effect determination of the binding ofthe complex to the solid support. The solid support may take the form of particles, beads, wall-coatings on the reaction vessel or an insert of large surface area. The method is particularly applicable to the assay of TSH, CEA, HCG, alphafeto protein, immunoglobulins, viruses, allergens, bacteria, toxins, drugs and vitamins. Use of monoclonal reagents improves the specificity of the process, and also decreases non-specific binding

  13. Quantitation of SPLUNC1 in saliva with an xMAP particle-based antibody capture and detection immunoassay

    OpenAIRE

    Kohlgraf, Karl G.; Ackermann, Abbey R.; Burnell, Kindra K.; Srikantha, Rupasree N.; Joly, Sophie A.; Bartlett, Jennifer; Gakhar, Lokesh; Johnson, Georgia K.; McCray, Paul B.; Guthmiller, Janet M.; Brogden, Kim A

    2011-01-01

    The short palate lung and nasal epithelial clone 1 (SPLUNC1) protein may be differentially expressed in oral infections, oral inflammatory disorders, or oral malignancies and may be involved in innate immune responses in the oral cavity. However, the actual concentration of SPLUNC1 in saliva has not previously been determined. In this study, we determined the concentrations of SPLUNC1 in saliva using a particle-based antibody capture and detection immunoassay. A commercial goat anti-rhSPLUNC1...

  14. Toward development of a surface-enhanced Raman scattering (SERS)-based cancer diagnostic immunoassay panel.

    Science.gov (United States)

    Granger, Jennifer H; Granger, Michael C; Firpo, Matthew A; Mulvihill, Sean J; Porter, Marc D

    2013-01-21

    Proteomic analyses of readily obtained human fluids (e.g., serum, urine, and saliva) indicate that the diagnosis of complex diseases will be enhanced by the simultaneous measurement of multiple biomarkers from such samples. This paper describes the development of a nanoparticle-based multiplexed platform that has the potential for simultaneous read-out of large numbers of biomolecules. For this purpose, we have chosen pancreatic adenocarcinoma (PA) as a test bed for diagnosis and prognosis. PA is a devastating form of cancer in which an estimated 86% of diagnoses resulted in death in the United States in 2010. The high mortality rate is due, in part, to the asymptomatic development of the disease and the dearth of sensitive diagnostics available for early detection. One promising route lies in the development of a serum biomarker panel that can generate a signature unique to early stage PA. We describe the design and development of a proof-of-concept PA biomarker immunoassay array coupled with surface-enhanced Raman scattering (SERS) as a sensitive readout method. PMID:23150876

  15. Fluorescent microbead-based immunoassay for anti-Erysipelothrix rhusiopathiae antibody detection in cetaceans.

    Science.gov (United States)

    Melero, Mar; Giménez-Lirola, Luis G; Rubio-Guerri, Consuelo; Crespo-Picazo, José Luis; Sierra, Eva; García-Párraga, Daniel; García-Peña, Francisco Javier; Arbelo, Manuel; Álvaro, Teresa; Valls, Mónica; Sánchez-Vizcaíno, José Manuel

    2016-01-13

    A fluorescent microbead-based immunoassay (FMIA) for detection of anti-Erysipelothrix rhusiopathiae antibodies in pigs was adapted for use in cetaceans. The FMIA was validated and adjusted using serum samples from 10 vaccinated captive bottlenose dolphins Tursiops truncatus collected between 1 and 13 mo after immunization. The technique was then used to analyze specimens from 15 free-ranging cetaceans stranded alive on the Valencian Mediterranean coast between 2006 and 2014: 11 striped dolphins Stenella coeruleoalba, 3 Risso's dolphins Grampus griseus and 1 bottlenose dolphin Tursiops truncatus. One of these wild animals was confirmed to have died from E. rhusiopathiae septicemia, but no anti-E. rhusiopathiae antibodies were detected in its serum, pericardial fluid or milk samples. Another free-ranging individual, which lacked any signs or lesions that might be indicative of E. rhusiopathiae infection, showed high fluorescence intensity similar to that measured in captive dolphins at 6-13 mo after vaccination. These results suggest that this animal underwent an E. rhusiopathiae infection several months before stranding. The findings in the present study suggest that FMIA can be useful for detecting anti-E. rhusiopathiae antibodies in cetaceans, and its application to free-ranging animals is particularly interesting because of the great value of these specimens. Furthermore, the FMIA can be multiplexed to allow the determination of up to 100 analytes per sample in a single well, thereby reducing the cost, time and sample volume needed. PMID:26758657

  16. Specific detection of Vibrio parahaemolyticus by fluorescence quenching immunoassay based on quantum dots.

    Science.gov (United States)

    Wang, Ling; Zhang, Junxian; Bai, Haili; Li, Xuan; Lv, Pintian; Guo, Ailing

    2014-07-01

    In this study, anti-Vibrio parahaemolyticus polyclonal and monoclonal antibodies were prepared through intradermal injection immune and lymphocyte hybridoma technique respectively. CdTe quantum dots (QDs) were synthesized at pH 9.3, 98 °C for 1 h with stabilizer of 2.7:1. The fluorescence intensity was 586.499, and the yield was 62.43%. QD probes were successfully prepared under the optimized conditions of pH 7.4, 37 °C for 1 h, 250 μL of 50 mg/mL EDC · HCl, 150 μL of 4 mg/mL NHS, buffer system of Na2HPO4-citric acid, and 8 μL of 2.48 mg/mL polyclonal antibodies. As gold nanoparticles could quench fluorescence of quantum dots, the concentration of V. parahaemolyticus could be detected through measuring the reduction of fluorescence intensity in immune sandwich reaction composed of quantum dot probe, gold-labeled antibody, and the sample. For pure culture, fluorescence intensity of the system was proportional with logarithm concentration of antigen, and the correlation coefficient was 99.764%. The fluorescence quenching immunoassay based on quantum dots is established for the first time to detect Vibrio parahaemolyticus. This method may be used as rapid testing procedure due to its high simplicity and sensitivity. PMID:24756606

  17. Spectrum-Based Electrochemiluminescent Immunoassay with Ternary CdZnSe Nanocrystals as Labels.

    Science.gov (United States)

    Zhang, Xin; Tan, Xiao; Zhang, Bin; Miao, Wujian; Zou, Guizheng

    2016-07-01

    Conventional electrochemiluminescence (ECL) research has been performed by detecting the total photons (i.e., the ECL intensity). Herein, systematic spectral exploration on the ECL of dual-stabilizers-capped ternary CdZnSe nanocrystals (NCs) and its sensing application were carried out on a homemade ECL spectral acquiring system. The ternary CdZnSe NCs could be repeatedly injected with electrons via some electrochemical ways and then result in strong cathodic ECL with the coupling of ammonium persulfate. ECL spectrum of the CdZnSe NCs was almost identical to corresponding photoluminescence spectrum, indicating that the excited states of CdZnSe NCs in ECL were essentially the same as those in photoluminescence. Importantly, after being labeled to the probe antibody (Ab2) of α-fetal protein (AFP) antigen, the ternary NCs in the Ab2|NCs conjugates could preserve their ECL spectrum very well. A spectrum-based ECL immunoassay was consequently proposed with the CdZnSe NCs as ECL tags and AFP as target molecules. The limit of detection is 0.010 pg/mL, with a signal-to-noise (S/N) ratio of 3, indicating a sensitive ECL sensing strategy that was different from the conventional ones. This work might open a pathway to the spectrally resolved ECL analysis with even-higher S/N ratios than the fluorescent analysis. PMID:27266486

  18. A New Surface Plasmon Resonance-Based Immunoassay for Rapid, Reproducible and Sensitive Quantification of Pentraxin-3 in Human Plasma

    Directory of Open Access Journals (Sweden)

    Mara Canovi

    2014-06-01

    Full Text Available A new immunoassay based on surface plasmon resonance (SPR for the rapid, reproducible and sensitive determination of pentraxin-3 (PTX3 levels in human plasma has been developed and characterized. The method involves a 3-min flow of plasma over a sensor chip pre-coated with a monoclonal anti-PTX3 antibody (MNB4, followed by a 3-min flow of a polyclonal anti-PTX3 antibody (pAb, required for specific recognition of captured PTX3. The SPR signal generated with this secondary antibody linearly correlates with the plasma PTX3 concentration, in the range of 5–1500 ng/mL, with a lowest limit of detection of 5 ng/mL. The PTX3 concentrations determined with the SPR-based immunoassay in the plasma of 21 patients with sepsis, ranging 15–1600 ng/mL, were superimposable to those found in a classic ELISA immunoassay. Since the PTX3 concentration in the plasma of healthy subjects is <2 ng/mL, but markedly rises in certain medical conditions, the method is useful to quantify pathological levels of this important biomarker, with important diagnostic applications. In comparison with the classic ELISA, the SPR-based approach is much faster (30 min versus 4–5 h and could be exploited for the development of new cost-effective SPR devices for point-of-care diagnosis.

  19. Superparamagnetic-bead Based Method: An Effective DNA Extraction from Dried Blood Spots (DBS) for Diagnostic PCR

    OpenAIRE

    Sirdah, Mahmoud Mohammed

    2014-01-01

    Introduction: Storing blood as dried spots on filter paper is a trustworthy approach used in genetic screening issues which justifies the necessity for a reliable DNA extraction method. The present work aims to investigate the effectiveness of superparamagnetic-bead based method in extracting DNA from dried blood spots (DBS).

  20. Microbead-based immunoassay using the outer membrane layer of Escherichia coli combined with autodisplayed Z-domains

    Science.gov (United States)

    Kim, Do-Hoon; Bong, Ji-Hong; Yoo, Gu; Chang, Seo-Yoon; Park, Min; Chang, Young Wook; Kang, Min-Jung; Jose, Joachim; Pyun, Jae-Chul

    2016-01-01

    The Z-domain has the potential to control the orientation of immobilized antibodies because of its binding affinity to the Fc regions of antibodies (IgGs). In this work, Z-domains were autodisplayed on the outer membrane (OM) of Escherichia coli. OM particles were isolated and coated onto microbeads with positive, neutral, or negative surface charges. Other conditions such as incubation time and initial OM concentration were also optimized for the OM coating to obtain maximum antibody-binding. Using three kinds of model proteins with different isoelectric points (pI), streptavidin (pI = 5, negative charge at pH 7), horseradish peroxidase (pI = 7, neutral charge at pH 7), and avidin (pI = 10, positive charge at pH 7), protein immobilization onto the microbeads was carried out through physical adsorption and electrostatic interactions. Using fluorescently labeled antibodies and fluorescence-activated cell sorting, it was determined that the neutral and the positively charged microbeads effectively bound antibodies while minimizing non-specific protein binding. The OM-coated microbeads with autodisplayed Z-domains were applied to C-reactive protein immunoassay. This immunoassay achieved 5-fold improved sensitivity compared to conventional immunoassay based on physical adsorption of antibodies at the cutoff concentration of medical diagnosis of inflammatory diseases (1000 ng/ml) and cardiovascular diseases (200 ng/ml).

  1. Application of a SERS-based lateral flow immunoassay strip for the rapid and sensitive detection of staphylococcal enterotoxin B

    Science.gov (United States)

    Hwang, Joonki; Lee, Sangyeop; Choo, Jaebum

    2016-06-01

    A novel surface-enhanced Raman scattering (SERS)-based lateral flow immunoassay (LFA) biosensor was developed to resolve problems associated with conventional LFA strips (e.g., limits in quantitative analysis and low sensitivity). In our SERS-based biosensor, Raman reporter-labeled hollow gold nanospheres (HGNs) were used as SERS detection probes instead of gold nanoparticles. With the proposed SERS-based LFA strip, the presence of a target antigen can be identified through a colour change in the test zone. Furthermore, highly sensitive quantitative evaluation is possible by measuring SERS signals from the test zone. To verify the feasibility of the SERS-based LFA strip platform, an immunoassay of staphylococcal enterotoxin B (SEB) was performed as a model reaction. The limit of detection (LOD) for SEB, as determined with the SERS-based LFA strip, was estimated to be 0.001 ng mL-1. This value is approximately three orders of magnitude more sensitive than that achieved with the corresponding ELISA-based method. The proposed SERS-based LFA strip sensor shows significant potential for the rapid and sensitive detection of target markers in a simplified manner.A novel surface-enhanced Raman scattering (SERS)-based lateral flow immunoassay (LFA) biosensor was developed to resolve problems associated with conventional LFA strips (e.g., limits in quantitative analysis and low sensitivity). In our SERS-based biosensor, Raman reporter-labeled hollow gold nanospheres (HGNs) were used as SERS detection probes instead of gold nanoparticles. With the proposed SERS-based LFA strip, the presence of a target antigen can be identified through a colour change in the test zone. Furthermore, highly sensitive quantitative evaluation is possible by measuring SERS signals from the test zone. To verify the feasibility of the SERS-based LFA strip platform, an immunoassay of staphylococcal enterotoxin B (SEB) was performed as a model reaction. The limit of detection (LOD) for SEB, as

  2. Automated digital microfluidic platform for magnetic-particle-based immunoassays with optimization by design of experiments.

    Science.gov (United States)

    Choi, Kihwan; Ng, Alphonsus H C; Fobel, Ryan; Chang-Yen, David A; Yarnell, Lyle E; Pearson, Elroy L; Oleksak, Carl M; Fischer, Andrew T; Luoma, Robert P; Robinson, John M; Audet, Julie; Wheeler, Aaron R

    2013-10-15

    We introduce an automated digital microfluidic (DMF) platform capable of performing immunoassays from sample to analysis with minimal manual intervention. This platform features (a) a 90 Pogo pin interface for digital microfluidic control, (b) an integrated (and motorized) photomultiplier tube for chemiluminescent detection, and (c) a magnetic lens assembly which focuses magnetic fields into a narrow region on the surface of the DMF device, facilitating up to eight simultaneous digital microfluidic magnetic separations. The new platform was used to implement a three-level full factorial design of experiments (DOE) optimization for thyroid-stimulating hormone immunoassays, varying (1) the analyte concentration, (2) the sample incubation time, and (3) the sample volume, resulting in an optimized protocol that reduced the detection limit and sample incubation time by up to 5-fold and 2-fold, respectively, relative to those from previous work. To our knowledge, this is the first report of a DOE optimization for immunoassays in a microfluidic system of any format. We propose that this new platform paves the way for a benchtop tool that is useful for implementing immunoassays in near-patient settings, including community hospitals, physicians' offices, and small clinical laboratories. PMID:23978190

  3. Monoclonal antibody-based broad-specificity immunoassay for monitoring organophosphorus pesticides in environmental water samples

    Science.gov (United States)

    The extensive use of organophosphorus pesticides (OPs) in agriculture and domestic settings can result in widespread water contamination. The development of easy-to-use and rapid-screening immunoassay methods in a class-selective manner is a topic of considerable environmental interest. In this wo...

  4. Good performance of an immunoassay based method for nevirapine measurements in human breast milk

    DEFF Research Database (Denmark)

    Salado-Rasmussen, Kirsten; Persson Theilgaard, Zahra; Chiduo, Mercy;

    2011-01-01

    Understanding the distribution of antiretro-virals in breastfeeding HIV-positive mothers is essential, both for prevention of mother-to-child HIV transmission and for research on the development of drug resistance. The ARK nevirapine (NVP)-test is an immunoassay method for nevirapine measurements...

  5. Good performance of an immunoassay based method for nevirapine measurements in human breast milk

    DEFF Research Database (Denmark)

    Salado-Rasmussen, Kirsten; Theilgaard, Zahra Persson; Chiduo, Mercy;

    2011-01-01

    Abstract Background: Understanding the distribution of antiretro-virals in breastfeeding HIV-positive mothers is essential, both for prevention of mother-to-child HIV transmission and for research on the development of drug resistance. The ARK nevirapine (NVP)-test is an immunoassay method for ne...

  6. SERS immunoassay based on the capture and concentration of antigen-assembled gold nanoparticles.

    Science.gov (United States)

    Lopez, Arielle; Lovato, Francis; Oh, Soon Hwan; Lai, Yen H; Filbrun, Seth; Driskell, Elizabeth A; Driskell, Jeremy D

    2016-01-01

    A simple, rapid, and sensitive immunoassay has been developed based on antigen-mediated aggregation of gold nanoparticles (AuNP) and surface-enhanced Raman spectroscopy (SERS). Central to this platform is the extrinsic Raman label (ERL), which consists of a gold nanoparticle modified with a mixed monolayer of a Raman active molecule and an antibody. ERLs are mixed with sample, and antigen induces the aggregation of the ERLs. A membrane filter is then used to isolate and concentrate the ERL aggregates for SERS analysis. Preliminary work to establish proof-of-principle of the platform technology utilized mouse IgG as a model antigen. The effects of membrane pore diameter and AuNP size on the analytical performance of the assay were systematically investigated, and it was determined that a pore diameter of 200 nm and AuNP diameter of 80 nm provide maximum sensitivity while minimizing signal from blank samples. Optimization of the assay provided a detection limit of 1.9 ng/mL, 20-fold better than the detection limit achieved by an ELISA employing the same antibody-antigen system. Furthermore, this assay required only 60 min compared to 24h for the ELISA. To validate this assay, mouse serum was directly analyzed to accurately quantify IgG. Collectively, these results demonstrate the potential advantages of this technology over current diagnostic tests for protein biomarkers with respect to time, simplicity, and detection limits. Thus, this approach provides a framework for prospective development of new and more powerful tools that can be designed for point-of-care diagnostic or point-of-need detection. PMID:26695280

  7. General Bioluminescence Resonance Energy Transfer Homogeneous Immunoassay for Small Molecules Based on Quantum Dots.

    Science.gov (United States)

    Yu, Xuezhi; Wen, Kai; Wang, Zhanhui; Zhang, Xiya; Li, Chenglong; Zhang, Suxia; Shen, Jianzhong

    2016-04-01

    Here, we describe a general bioluminescence resonance energy transfer (BRET) homogeneous immunoassay based on quantum dots (QDs) as the acceptor and Renilla luciferase (Rluc) as the donor (QD-BRET) for the determination of small molecules. The ratio of the donor-acceptor that could produce energy transfer varied in the presence of different concentrations of free enrofloxacin (ENR), an important small molecule in food safety. The calculated Förster distance (R0) was 7.86 nm. Under optimized conditions, the half-maximal inhibitory concentration (IC50) for ENR was less than 1 ng/mL and the linear range covered 4 orders of magnitude (0.023 to 25.60 ng/mL). The cross-reactivities (CRs) of seven representative fluoroquinolones (FQs) were similar to the data obtained by an enzyme-linked immunosorbent assay (ELISA). The average intra- and interassay recoveries from spiked milk of were 79.8-118.0%, and the relative standard deviations (RSDs) were less than 10%, meeting the requirement of residue detection, which was a satisfactory result. Furthermore, we compared the influence of different luciferase substrates on the performance of the assay. Considering sensitivity and stability, coelenterazine-h was the most appropriate substrate. The results from this study will enable better-informed decisions on the choice of Rluc substrate for QD-BRET systems. For the future, the QD-BRET immunosensor could easily be extended to other small molecules and thus represents a versatile strategy in food safety, the environment, clinical diagnosis, and other fields. PMID:26948147

  8. Ultrasensitive electrochemiluminescence immunoassay for tumor marker based on quantum dots coated carbon nanospheres

    International Nuclear Information System (INIS)

    In this work, a novel electrochemiluminescence (ECL) immunosensor based on CdTe quantum dots (QDs) coated carbon nanosphere (CN/QDs) for the detection of carcinoembryonic antigen (CEA) was developed. The carbon nanospheres (CNs) with good monodispersity and uniform structure were synthetized by a hydrothermal method using glucose as raw material. Then QDs functionized CNs were prepared and employed for signal amplification to improve the sensitivity and the detection limit of immunosensor. For this proposed immunosensor, chitosan was firstly deposited on the pretreated indium tin oxide (ITO) electrode surface, which promoted the electron transfer. Subsequently, gold nanoparticles (AuNPs) were assembled onto chitosan film modified electrode to improve the absorption capacity of antibodies. Then, primary antibodies were immobilized onto the electrode through the reaction between AuNPs and amino. At last bovine serum albumin (BSA) was employed to block the nonspecific binding sites. As a result, a novel ECL immunosensor was obtained on the prepared CN/QDs. The CEA was determined in the range of 0.005–200 ng mL−1, with a low detection limit of 1.2 pg mL−1 (S/N=3). The proposed ECL immunosensor provides a rapid, simple, and sensitive immunoassay protocol for protein detection, which could be applied in more bioanalytical systems. -- Highlights: • A sandwich-type electrochemluminence immunosensor was fabricated. • CdTe quantum dots coated carbon nanospheres were used to amplify signals. • Au–chitosan biocompatible membrane modified on ITO electrode to capture antibodies

  9. Ultrasensitive electrochemiluminescence immunoassay for tumor marker based on quantum dots coated carbon nanospheres

    Energy Technology Data Exchange (ETDEWEB)

    Li, Long; Zhang, Yan; Li, Shuai; Wang, Xiu; Li, Chen [Key Laboratory of Chemical Sensing and Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China); Ge, Shenguang [Shandong Provincial Key Laboratory of Fluorine Chemistry and Chemical Materials, University of Jinan, Jinan 250022 (China); Yu, Jinghua, E-mail: ujn.yujh@gmail.com [Key Laboratory of Chemical Sensing and Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China); Yan, Mei [Key Laboratory of Chemical Sensing and Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China); Song, Xianrang [Cancer Research Center, Shandong Tumor Hospital, Jinan 250012 (China)

    2013-12-15

    In this work, a novel electrochemiluminescence (ECL) immunosensor based on CdTe quantum dots (QDs) coated carbon nanosphere (CN/QDs) for the detection of carcinoembryonic antigen (CEA) was developed. The carbon nanospheres (CNs) with good monodispersity and uniform structure were synthetized by a hydrothermal method using glucose as raw material. Then QDs functionized CNs were prepared and employed for signal amplification to improve the sensitivity and the detection limit of immunosensor. For this proposed immunosensor, chitosan was firstly deposited on the pretreated indium tin oxide (ITO) electrode surface, which promoted the electron transfer. Subsequently, gold nanoparticles (AuNPs) were assembled onto chitosan film modified electrode to improve the absorption capacity of antibodies. Then, primary antibodies were immobilized onto the electrode through the reaction between AuNPs and amino. At last bovine serum albumin (BSA) was employed to block the nonspecific binding sites. As a result, a novel ECL immunosensor was obtained on the prepared CN/QDs. The CEA was determined in the range of 0.005–200 ng mL{sup −1}, with a low detection limit of 1.2 pg mL{sup −1} (S/N=3). The proposed ECL immunosensor provides a rapid, simple, and sensitive immunoassay protocol for protein detection, which could be applied in more bioanalytical systems. -- Highlights: • A sandwich-type electrochemluminence immunosensor was fabricated. • CdTe quantum dots coated carbon nanospheres were used to amplify signals. • Au–chitosan biocompatible membrane modified on ITO electrode to capture antibodies.

  10. Hot embossed polyethylene through-hole chips for bead-based microfluidic devices

    Science.gov (United States)

    Chou, Jie; Du, Nan; Ou, Tina; Floriano, Pierre N.; Christodoulides, Nicolaos; McDevitt, John T.

    2013-01-01

    Over the past decade, there has been a growth of interest in the translation of microfluidic systems into real-world clinical practice, especially for use in point-of-care or near patient settings. While initial fabrication advances in microfluidics involved mainly the etching of silicon and glass, the economics of scaling of these materials is not amendable for point-of-care usage where single-test applications forces cost considerations to be kept low and throughput high. As such, a materials base more consistent with point-of-care needs is required. In this manuscript, the fabrication of a hot embossed, through-hole low-density polyethylene ensembles derived from an anisotropically etched silicon wafer is discussed. This semi-opaque polymer that can be easily sterilized and recycled provides low background noise for fluorescence measurements and yields more affordable cost than other thermoplastics commonly used for microfluidic applications such as cyclic olefin copolymer (COC). To fabrication through-hole microchips from this alternative material for microfluidics, a fabrication technique that uses a high-temperature, high-pressure resistant mold is described. This aluminum-based epoxy mold, serving as the positive master mold for embossing, is casted over etched arrays of pyramidal pits in a silicon wafer. Methods of surface treatment of the wafer prior to casting and PDMS casting of the epoxy are discussed to preserve the silicon wafer for future use. Changes in the thickness of polyethylene are observed for varying embossing temperatures. The methodology described herein can quickly fabricate 20 disposable, single use chips in less than 30 minutes with the ability to scale up 4x by using multiple molds simultaneously. When coupled as a platform supporting porous bead sensors, as in the recently developed Programmable Bio-Nano-Chip, this bead chip system can achieve limits of detection, for the cardiac biomarker C-reactive protein, of 0.3 ng/mL, thereby

  11. Effects of sample delivery on analyte capture in porous bead sensors.

    Science.gov (United States)

    Chou, Jie; Li, Luanyi E; Kulla, Eliona; Christodoulides, Nicolaos; Floriano, Pierre N; McDevitt, John T

    2012-12-21

    Sample delivery is a crucial aspect of point-of-care applications where sample volumes need to be low and assay times short, while providing high analytical and clinical sensitivity. In this paper, we explore the influence of the factors surrounding sample delivery on analyte capture in an immunoassay-based sensor array manifold of porous beads resting in individual wells. We model using computational fluid dynamics and a flow-through device containing beads sensitized specifically to C-reactive protein (CRP) to explore the effects of volume of sample, rate of sample delivery, and use of recirculation vs. unilateral delivery on the effectiveness of the capture of CRP on and within the porous bead sensor. Rate of sample delivery lends to the development of a time-dependent, shrinking depletion region around the bead exterior. Our findings reveal that at significantly high rates of delivery, unique to porous bead substrates, capture at the rim of the bead is reaction-limited, while capture in the interior of the bead is transport-limited. While the fluorescence signal results from the aggregate of captured material throughout the bead, multiple kinetic regimes exist within the bead. Further, under constant pressure conditions dictated by the array architecture, we reveal the existence of an optimal flow rate that generates the highest signal, under point-of-care constraints of limited-volume and limited-time. When high sensitivity is needed, recirculation can be implemented to overcome the analyte capture limitations due to volume and time constraints. Computational simulations agree with experimental results performed under similar conditions. PMID:23117481

  12. Magnetic-particle-based, ultrasensitive chemiluminescence enzyme immunoassay for free prostate-specific antigen

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •A low-cost and rapid assay for f-PSA in serum was developed using MMP-based CLEIA. •f-PSA detection: 0.1–30 ng mL−1 concentration range; 0.1 ng mL−1 detection limit. •The proposed method showed high sensitivity, good reproducibility and stability. •The strategy showed great potential in the fabrication of MMP-based f-PSA test kits. -- Abstract: We report a magnetic-particle (MMP)-based chemiluminescence enzyme immunoassay (CLEIA) for free prostate-specific antigen (f-PSA) in human serum. In this method, the f-PSA is sandwiched between the anti-PSA antibody coated MMPs and alkaline phosphatase (ALP)-labeled anti-f-PSA antibody. The signal produced by the emitted photons from the chemiluminescent substrate (4-methoxy-4-(3-phosphatephenyl)-spiro-(1,2-dioxetane-3,2′-adamantane)) is directly proportional to the amount of f-PSA in a sample. The present MMP-based assay can detect f-PSA in the range of 0.1–30 ng mL−1 with the detection limit of 0.1 ng mL−1. The linear detection range could match the concentration range within the “diagnostic gray zone” of serum f-PSA levels (4–10 ng mL−1). The detection limit was sufficient for measuring clinically relevant f-PSA levels (>4 ng mL−1). Furthermore, the method was highly selective; it was unaffected by cross-reaction with human glandular kallikrein-2, a kallikrein-like serine protease that is 80% similar to f-PSA. The proposed method was finally applied to determine f-PSA in 40 samples of human sera. Results obtained using the method showed high correlation with those obtained using a commercially available microplate CLEIA kit (correlation coefficient, 0.9821). This strategy shows great potential application in the fabrication of diagnostic kits for determining f-PSA in serum

  13. Magnetic-particle-based, ultrasensitive chemiluminescence enzyme immunoassay for free prostate-specific antigen

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ruping [College of Electronic Information and Optical Engineering, Nankai University, Tianjin 300071 (China); Wang, Cheng [College of Electronic Information and Optical Engineering, Nankai University, Tianjin 300071 (China); Department of Mechanical Engineering, Columbia University, New York 10027 (United States); Jiang, Quan [Institute of Material Science and Engineering, Wuhan University of Technology, Wuhan 430070 (China); Zhang, Wei; Yue, Zhao [College of Electronic Information and Optical Engineering, Nankai University, Tianjin 300071 (China); Liu, Guohua, E-mail: liugh@nankai.edu.cn [College of Electronic Information and Optical Engineering, Nankai University, Tianjin 300071 (China)

    2013-11-01

    Graphical abstract: -- Highlights: •A low-cost and rapid assay for f-PSA in serum was developed using MMP-based CLEIA. •f-PSA detection: 0.1–30 ng mL{sup −1} concentration range; 0.1 ng mL{sup −1} detection limit. •The proposed method showed high sensitivity, good reproducibility and stability. •The strategy showed great potential in the fabrication of MMP-based f-PSA test kits. -- Abstract: We report a magnetic-particle (MMP)-based chemiluminescence enzyme immunoassay (CLEIA) for free prostate-specific antigen (f-PSA) in human serum. In this method, the f-PSA is sandwiched between the anti-PSA antibody coated MMPs and alkaline phosphatase (ALP)-labeled anti-f-PSA antibody. The signal produced by the emitted photons from the chemiluminescent substrate (4-methoxy-4-(3-phosphatephenyl)-spiro-(1,2-dioxetane-3,2′-adamantane)) is directly proportional to the amount of f-PSA in a sample. The present MMP-based assay can detect f-PSA in the range of 0.1–30 ng mL{sup −1} with the detection limit of 0.1 ng mL{sup −1}. The linear detection range could match the concentration range within the “diagnostic gray zone” of serum f-PSA levels (4–10 ng mL{sup −1}). The detection limit was sufficient for measuring clinically relevant f-PSA levels (>4 ng mL{sup −1}). Furthermore, the method was highly selective; it was unaffected by cross-reaction with human glandular kallikrein-2, a kallikrein-like serine protease that is 80% similar to f-PSA. The proposed method was finally applied to determine f-PSA in 40 samples of human sera. Results obtained using the method showed high correlation with those obtained using a commercially available microplate CLEIA kit (correlation coefficient, 0.9821). This strategy shows great potential application in the fabrication of diagnostic kits for determining f-PSA in serum.

  14. IFSA: a microfluidic chip-platform for frit-based immunoassay protocols

    Science.gov (United States)

    Hlawatsch, Nadine; Bangert, Michael; Miethe, Peter; Becker, Holger; Gärtner, Claudia

    2013-03-01

    Point-of-care diagnostics (POC) is one of the key application fields for lab-on-a-chip devices. While in recent years much of the work has concentrated on integrating complex molecular diagnostic assays onto a microfluidic device, there is a need to also put comparatively simple immunoassay-type protocols on a microfluidic platform. In this paper, we present the development of a microfluidic cartridge using an immunofiltration approach. In this method, the sandwich immunoassay takes place in a porous frit on which the antibodies have immobilized. The device is designed to be able to handle three samples in parallel and up to four analytical targets per sample. In order to meet the critical cost targets for the diagnostic market, the microfluidic chip has been designed and manufactured using high-volume manufacturing technologies in mind. Validation experiments show comparable sensitivities in comparison with conventional immunofiltration kits.

  15. Universal quantum dot-based sandwich-like immunoassay strategy for rapid and ultrasensitive detection of small molecules using portable and reusable optofluidic nano-biosensing platform.

    Science.gov (United States)

    Zhou, Liping; Zhu, Anna; Lou, Xuening; Song, Dan; Yang, Rong; Shi, Hanchang; Long, Feng

    2016-01-28

    A universal sandwich-like immunoassay strategy based on quantum-dots immunoprobe (QD-labeled anti-mouse IgG antibody) was developed for rapid and ultrasensitive detection of small molecules. A portable and reusable optofluidic nano-biosensing platform was applied to investigate the sandwich-like immunoassay mechanism and format of small molecules, as well as the binding kinetics between QD immunoprobe and anti-small molecule antibody. A two-step immunoassay method that involves pre-incubation mixture of different concentration of small molecule and anti-small molecule antibody, and subsequent introduction of QD immunoprobe into the optofluidic cell was conducted for small molecule determination. Compared with the one-step immunoassay method, the two-step immunoassay method can obtain higher fluorescence signal and higher sensitivity index, thus improving the nano-biosensing performance. Based on the proposed strategy, two mode targets, namely, microcystin-LR (MC-LR) and Bisphenol A (BPA) were tested with high sensitivity, rapidity, and ease of use. A higher concentration of small molecules in the sample led to less anti-small molecule antibody bound with antigen-carrier protein conjugate immobilized onto the sensor surface, and less QD immunoprobes bound with anti-small molecule antibody. This phenomenon lowered the fluorescence signal detected by nano-biosensing platform. Under optimal operating conditions, MC-LR and BPA exhibited a limit of detection of 0.003 and 0.04 μg/L, respectively. The LODs were better than those of the indirect competitive immunoassay method for small molecules via Cy5.5-labeled anti-small molecule antibody. The proposed QD-based sandwich-like immunoassay strategy was evaluated in spiked water samples, and showed good recovery, precision and accuracy without complicated sample pretreatments. All these results demonstrate that the new detection strategy could be readily applied to the other trace small molecules in real water samples

  16. A comparison of horseradish peroxidase, gold nanoparticles and quantum dots as labels in non-instrumental gel-based immunoassay

    International Nuclear Information System (INIS)

    We have developed a column gel-based immunoassays for the model analyte benzo[a]pyrene (B[a]P), and have evaluated three different kinds of labels, i. e., horseradish peroxidase, (HRP), colloidal gold (AuNPs), and quantum dots (QDs) with respect to rapid visual on-site testing. In case of HRP, a derivative of B[a]P-BA (benzo[a]pyrenebutyric acid) was directly coupled to HRP. In case of QDs and AuNPs, protein conjugates of B[a]P-BA were synthesized and used for surface functionalization. With the latter, previous coverage of the gold surface with 11-mercaptoundecanoic acid turned out to be advantageous in terms of antibody recognition and of preventing nonspecific binding to the gel layer. The assays based on the use of particle labels requires 4 consecutive working steps only, while those based on HRP require 5 additions of reagent. The lower limit of detection for B[a]P is 5 ng L-1 in case of using HPR or QDs as a label, but 25 ng L-1 when using AuNPs. We believe that the use of QDs constitutes the most promising label for qualitative and semi-quantitative gel-based immunoassays. (author)

  17. A novel bead-based assay to detect specific antibody responses against Toxoplasma gondii and Trichinella spiralis simultaneously in sera of experimentally infected swine

    Directory of Open Access Journals (Sweden)

    Bokken Gertie CAM

    2012-03-01

    Full Text Available Abstract Background A novel, bead-based flow cytometric assay was developed for simultaneous determination of antibody responses against Toxoplasma gondii and Trichinella spiralis in pig serum. This high throughput screening assay could be an alternative for well known indirect tests like ELISA. One of the advantages of a bead-based assay over ELISA is the possibility to determine multiple specific antibody responses per single sample run facilitated by a series of antigens coupled to identifiable bead-levels. Furthermore, inclusion of a non-coupled bead-level in the same run facilitates the determination of, and correction for non-specific binding. The performance of this bead-based assay was compared to one T. spiralis and three T. gondii ELISAs. For this purpose, sera from T. gondii and T. spiralis experimentally infected pigs were used. With the experimental infection status as gold standard, the area under the curve, Youden Index, sensitivity and specificity were determined through receiver operator curve analysis. Marginal homogeneity and inter-rater agreement between bead-based assay and ELISAs were evaluated using McNemar's Test and Cohen's kappa, respectively. Results Results indicated that the areas under the curve of the bead-based assay were 0.911 and 0.885 for T. gondii and T. spiralis, respectively, while that of the T. gondii ELISAs ranged between 0.837 and 0.930 and the T. spiralis ELISA was 0.879. Bead-based T. gondii assay had a sensitivity of 86% and specificity of 96%, while the ELISAs ranged between 64-84% and 93-99%, respectively. The bead-based T. spiralis assay had a sensitivity of 68% and specificity of 100% while the ELISA scored 72% and 95%, respectively. Marginal homogeneity was found between the T. gondii bead-based test and one of the T. gondii ELISAs. Moreover, in this test combination and between T. spiralis bead-based assay and respective ELISA, an excellent inter-rater agreement was found. When results of

  18. Ultrasensitive immunoassay for free prostate-specific antigen based on ferrocene carboxylate enhanced cathodic electrochemiluminescence of peroxydisulfate

    International Nuclear Information System (INIS)

    The catalytic effect of ferrocene carboxylate (FCC; in the form of nanocrystals) on the cathodic electrochemiluminescence (ECL) of peroxodisulfate was studied and applied to an ECL immunoassay to quantify free prostate-specific antigen (fPSA). The nanocrystals were entrapped in graphene previously functionalized with poly(dimethyldiallylammonium chloride) to give a solid-state nanohybrid referred to as FCC-Gr-PDDA. When cast onto a glassy carbon electrode (GCE), the ECL of peroxodisulfate is strongly enhanced. An immunoelectrode was then constructed by coating the positively charged nanohybrids matrix of FCC-Gr-PDDA with negatively charged gold nanoparticles and then immobilizing antibody against fPSA on the Au-NPs. The resulting electrode is then incubated with samples containing fPSA. An immunocomplex is formed in the presence of fPSA, and this prevents the solid-state nanohybrid film to enhance the ECL of the peroxodisulfate luminophor. The observed decrease in ECL intensity is directly related to the concentration of fPSA antigen in the range from 0.005 to 5 ng mL−1, and the detection limit is as low as 1.7 pg mL−1. The method is deemed to provide a widely applicable and general platform for ECL-based immunoassays. (author)

  19. Facile synthesis of magnetic-/pH-responsive hydrogel beads based on Fe3O4 nanoparticles and chitosan hydrogel as MTX carriers for controlled drug release.

    Science.gov (United States)

    Wu, Juan; Jiang, Wei; Tian, Renbing; Shen, Yewen; Jiang, Wei

    2016-10-01

    In the present study, methotrexate (MTX)-encapsulated magnetic-/pH-responsive hydrogel beads based on Fe3O4 nanoparticles and chitosan were successfully prepared through a one-step gelation process, which is a very facile, economic and environmentally friendly route. The developed hydrogel beads exhibited homogeneous porous structure and super-paramagnetic responsibility. MTX can be successfully encapsulated into magnetic chitosan hydrogel beads, and the drug encapsulation efficiency (%) and encapsulation content (%) were 93.8 and 6.28%, respectively. In addition, the drug release studies in vitro indicated that the MTX-encapsulated magnetic chitosan hydrogel beads had excellent pH-sensitivity, 90.6% MTX was released from the magnetic chitosan hydrogel beads within 48 h at pH 4.0. WST-1 assays in human liver hepatocellular carcinoma cells (HepG2) demonstrated that the MTX-encapsulated magnetic chitosan hydrogel beads had good cytocompatibility and high anti-tumor activity. Therefore, our results revealed that the MTX-encapsulated magnetic chitosan hydrogel beads would be a competitive candidate for controlled drug release in the area of targeted cancer therapy in the near future. PMID:27464586

  20. [Multisite-based approach to assure inter-assay system compatibility among different exclusive-typed immunoassay systems through determining exchanged calibrators].

    Science.gov (United States)

    Yamauchi, Megumi S; Yamane, Nobuhisa; Toshimitsu, Shoji; Sato, Hisatsune; Fujino, Tatsuya

    2010-01-01

    It is well known that most exclusive-typed immunoassay systems are highly precise but are poor in compatibility of their determinations. Thus, it is difficult to compare the determinations among different systems, posing problems when a patient is transferred to different hospitals or when a laboratory intends to change the system currently used. In the study, we tried to approach how to assure inter-immunoassay compatibility among four different systems through determination of the exchanged calibrators. First, determinations of total protein and albumin, and electrophoretic fractionation demonstrated marked differences among calibrators in their protein constituent. Some calibrators were prepared with human sera, but others were with inorganic or non-human albumin-based solution. Regression analysis of calibrators between the indicated concentrations by manufacturers and those actually determined by the different immunoassay systems revealed that; most slopes were closed to 1.0 for alpha-fetoprotein and prostate-specific antigen, but widely dissociated from 0.28 to 4.71 for CA19-9. In evaluation of clinical serum samples, determinations by one immunoassay system were compared with those converted based on a linear regression equation that was obtained by determination of the exchanged calibrators. However, this procedure could not improve compatibility, and positive effects of conversion varied by immunoassay systems combined, and also by test parameters. With these, we concluded that simple conversion of determinations by using the exchanged calibrators and a statistical linear regression could not provide us with the expected compatibility. Thus, standardization of target molecules or probes, and of calibrator constituent were urgent issue to assure inter-immunoassay compatibility. PMID:20169939

  1. Fluorescence-based immunoassay for human chorionic gonadotropin based on polyfluorene-coated silica nanoparticles and polyaniline-coated Fe3O4 nanoparticles

    International Nuclear Information System (INIS)

    We report on an ultrasensitive fluorescence immunoassay for human chorionic gonadotrophin antigen (hCG). It is based on the use of silica nanoparticles coated with a copolymer (prepared from a fluorene, a phenylenediamine, and divinylbenzene; PF.SiO2) that acts as a fluorescent label for the secondary monoclonal antibody to β-hCG antigen. In parallel, Fe3O4 nanoparticles were coated with polyaniline, and these magnetic particles (Fe3O4.PANI) served as a solid support for the primary monoclonal antibody to β-hCG antigen. The PF.SiO2 exhibited strong fluorescence and good dispersibility in water. A fluorescence sandwich immunoassay was developed that enables hCG concentrations to be determined in the 0.01–100 ng·mL−1 concentration range, with a detection limit of 3 pg·mL−1. (author)

  2. Automated regenerable microarray-based immunoassay for rapid parallel quantification of mycotoxins in cereals.

    Science.gov (United States)

    Oswald, S; Karsunke, X Y Z; Dietrich, R; Märtlbauer, E; Niessner, R; Knopp, D

    2013-08-01

    An automated flow-through multi-mycotoxin immunoassay using the stand-alone Munich Chip Reader 3 platform and reusable biochips was developed and evaluated. This technology combines a unique microarray, prepared by covalent immobilization of target analytes or derivatives on diamino-poly(ethylene glycol) functionalized glass slides, with a dedicated chemiluminescence readout by a CCD camera. In a first stage, we aimed for the parallel detection of aflatoxins, ochratoxin A, deoxynivalenol, and fumonisins in cereal samples in a competitive indirect immunoassay format. The method combines sample extraction with methanol/water (80:20, v/v), extract filtration and dilution, and immunodetection using horseradish peroxidase-labeled anti-mouse IgG antibodies. The total analysis time, including extraction, extract dilution, measurement, and surface regeneration, was 19 min. The prepared microarray chip was reusable for at least 50 times. Oat extract revealed itself as a representative sample matrix for preparation of mycotoxin standards and determination of different types of cereals such as oat, wheat, rye, and maize polenta at relevant concentrations according to the European Commission regulation. The recovery rates of fortified samples in different matrices, with 55-80 and 58-79%, were lower for the better water-soluble fumonisin B1 and deoxynivalenol and with 127-132 and 82-120% higher for the more unpolar aflatoxins and ochratoxin A, respectively. Finally, the results of wheat samples which were naturally contaminated with deoxynivalenol were critically compared in an interlaboratory comparison with data obtained from microtiter plate ELISA, aokinmycontrol® method, and liquid chromatography-mass spectrometry and found to be in good agreement. PMID:23620369

  3. Mass cytometry: technique for real time single cell multitarget immunoassay based on inductively coupled plasma time-of-flight mass spectrometry.

    Science.gov (United States)

    Bandura, Dmitry R; Baranov, Vladimir I; Ornatsky, Olga I; Antonov, Alexei; Kinach, Robert; Lou, Xudong; Pavlov, Serguei; Vorobiev, Sergey; Dick, John E; Tanner, Scott D

    2009-08-15

    A novel instrument for real time analysis of individual biological cells or other microparticles is described. The instrument is based on inductively coupled plasma time-of-flight mass spectrometry and comprises a three-aperture plasma-vacuum interface, a dc quadrupole turning optics for decoupling ions from neutral components, an rf quadrupole ion guide discriminating against low-mass dominant plasma ions, a point-to-parallel focusing dc quadrupole doublet, an orthogonal acceleration reflectron analyzer, a discrete dynode fast ion detector, and an 8-bit 1 GHz digitizer. A high spectrum generation frequency of 76.8 kHz provides capability for collecting multiple spectra from each particle-induced transient ion cloud, typically of 200-300 micros duration. It is shown that the transients can be resolved and characterized individually at a peak frequency of 1100 particles per second. Design considerations and optimization data are presented. The figures of merit of the instrument are measured under standard inductively coupled plasma (ICP) operating conditions ( 900 for m/z = 159, the sensitivity with a standard sample introduction system of >1.4 x 10(8) ion counts per second per mg L(-1) of Tb and an abundance sensitivity of (6 x 10(-4))-(1.4 x 10(-3)) (trailing and leading masses, respectively) are shown. The mass range (m/z = 125-215) and abundance sensitivity are sufficient for elemental immunoassay with up to 60 distinct available elemental tags. When 500) can be used, which provides >2.4 x 10(8) cps per mg L(-1) of Tb, at (1.5 x 10(-3))-(5.0 x 10(-3)) abundance sensitivity. The real-time simultaneous detection of multiple isotopes from individual 1.8 microm polystyrene beads labeled with lanthanides is shown. A real time single cell 20 antigen expression assay of model cell lines and leukemia patient samples immuno-labeled with lanthanide-tagged antibodies is presented. PMID:19601617

  4. Encapsulation of lactase (β-galactosidase) into κ-carrageenan-based hydrogel beads: Impact of environmental conditions on enzyme activity.

    Science.gov (United States)

    Zhang, Zipei; Zhang, Ruojie; Chen, Long; McClements, David Julian

    2016-06-01

    Encapsulation of enzymes in hydrogel beads may improve their utilization and activity in foods. In this study, the potential of carrageenan hydrogel beads for encapsulating β-galactosidase was investigated. Hydrogel beads were fabricated by injecting an aqueous solution, containing β-galactosidase (26 U) and carrageenan (1 wt%), into a hardening solution (5% potassium chloride). Around 63% of the β-galactosidase was initially encapsulated in the hydrogel beads. Encapsulated β-galactosidase had a higher activity than that of the free enzyme over a range of pH and thermal conditions, which was attributed to the stabilization of the enzyme structure by K(+) ions within the carrageenan beads. Release of the enzyme from the beads was observed during storage in aqueous solutions, which was attributed to the relatively large pore size of the hydrogel matrix. Our results suggest that carrageenan hydrogel beads may be useful encapsulation systems, but further work is needed to inhibit enzyme leakage. PMID:26830562

  5. A high-throughput liquid bead array-based screening technology for Bt presence in GMO manipulation.

    Science.gov (United States)

    Fu, Wei; Wang, Huiyu; Wang, Chenguang; Mei, Lin; Lin, Xiangmei; Han, Xueqing; Zhu, Shuifang

    2016-03-15

    The number of species and planting areas of genetically modified organisms (GMOs) has been rapidly developed during the past ten years. For the purpose of GMO inspection, quarantine and manipulation, we have now devised a high-throughput Bt-based GMOs screening method based on the liquid bead array. This novel method is based on the direct competitive recognition between biotinylated antibodies and beads-coupled antigens, searching for Bt presence in samples if it contains Bt Cry1 Aa, Bt Cry1 Ab, Bt Cry1 Ac, Bt Cry1 Ah, Bt Cry1 B, Bt Cry1 C, Bt Cry1 F, Bt Cry2 A, Bt Cry3 or Bt Cry9 C. Our method has a wide GMO species coverage so that more than 90% of the whole commercialized GMO species can be identified throughout the world. Under our optimization, specificity, sensitivity, repeatability and availability validation, the method shows a high specificity and 10-50 ng/mL sensitivity of quantification. We then assessed more than 1800 samples in the field and food market to prove capacity of our method in performing a high throughput screening work for GMO manipulation. Our method offers an applicant platform for further inspection and research on GMO plants. PMID:26499065

  6. Peptidomic analysis of Chinese shrimp ( Fenneropenaeus chinensis) hemolymph by magnetic bead-based MALDI-TOF MS

    Science.gov (United States)

    Wang, Baojie; Liu, Mei; Jiang, Keyong; Zhang, Guofan; Wang, Lei

    2013-03-01

    Peptides in shrimp hemolymph play an important role in the innate immune response. Analysis of hemolymph will help to detect and identify potential novel biomarkers of microbial infection. We used magnetic bead-based purification (ClinProt system) and matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) to characterize shrimp hemolymph peptides. Shrimp serum and plasma were used as the source of samples for comparative analysis, and it was found that serum was more suitable for shrimp hemolymph peptidomic analysis. To screen potential specific biomarkers in serum of immune-challenged shrimps, we applied magnetic bead-based MALDI-TOF MS to serum samples from 10 immune-challenged and 10 healthy shrimps. The spectra were analyzed using FlexAnalysis 3.0 and ClinProTools 2.1 software. Thirteen peptide peaks significantly different between the two groups were selected as candidate biomarkers of lipopolysaccharide (LPS)-infection. The diagnostic model established by genetic algorithm using five of these peaks was able to discriminate LPS-challenged shrimps from healthy control shrimps with a sensitivity of 90% and a specificity of 100%. Our approach in MALDITOF MS-based peptidomics is a powerful tool for screening bioactive peptides or biomarkers derived from hemolymph, and will help to enable a better understanding of the innate immune response of shrimps.

  7. A highly sensitive quartz crystal microbalance immunosensor based on magnetic bead-supported bienzymes catalyzed mass enhancement strategy.

    Science.gov (United States)

    Akter, Rashida; Rhee, Choong Kyun; Rahman, Md Aminur

    2015-04-15

    A highly sensitive quartz crystal microbalance (QCM) immunosensor based on magnetic bead-supported bienzyme catalyzed mass enhanced strategy was developed for the detection of human immunoglobulin G (hIgG) protein. The high sensitive detection was achieved by increasing the deposited mass on the QCM crystal through the enhanced precipitation of 4-chloro-1-naphthol (CN) using higher amounts of horseradish peroxidase (HRP) and glucose oxidase (GOx) bienzymes attached on the magnetic beads (MB). The protein A (PA) and capture antibody (monoclonal anti-human IgG antibody produced in mouse, Ab1)-based QCM probe and the detection antibody (anti-human IgG antibody produced in goat, Ab2)-based MB/HRP/GOx bienzymatic bioconjugates were characterized using scanning electron microscope, transmission electron microscope, cyclic voltammetry, and electrochemical impedance spectroscopy techniques. Under the optimized experimental condition, the linear range and the detection limit of hIgG immunosensor were determined to be 5.0pg/mL-20.0ng/mL and 5.0±0.18pg/mL, respectively. The applicability of the present hIgG immunosensor was examined in hIgG spiked human serum samples and excellent recoveries of hIgG were obtained. PMID:25506902

  8. Liquid carry-over in an injection moulded all-polymer chip system for immiscible phase magnetic bead-based solid-phase extraction

    International Nuclear Information System (INIS)

    We present an all-polymer, single-use microfluidic chip system produced by injection moulding and bonded by ultrasonic welding. Both techniques are compatible with low-cost industrial mass-production. The chip is produced for magnetic bead-based solid-phase extraction facilitated by immiscible phase filtration and features passive liquid filling and magnetic bead manipulation using an external magnet. In this work, we determine the system compatibility with various surfactants. Moreover, we quantify the volume of liquid co-transported with magnetic bead clusters from Milli-Q water or a lysis-binding buffer for nucleic acid extraction (0.1 (v/v)% Triton X-100 in 5 M guanidine hydrochloride). A linear relationship was found between the liquid carry-over and mass of magnetic beads used. Interestingly, similar average carry-overs of 1.74(8) nL/µg and 1.72(14) nL/µg were found for Milli-Q water and lysis-binding buffer, respectively. - Highlights: • We present an all-polymer mass producible passive filled microfluidic chip system. • Rapid system fabrication is obtained by injection moulding and ultrasonic welding. • The system is made for single-use nucleic acid extraction using magnetic beads. • We systematically map compatibility of the chip system with various surfactants. • We quantify the volume carry-over of magnetic beads in water and 0.1% triton-X solution

  9. Liquid carry-over in an injection moulded all-polymer chip system for immiscible phase magnetic bead-based solid-phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Kistrup, Kasper, E-mail: kkis@nanotech.dtu.dk [Department of Micro- and Nanotechnology, Technical University of Denmark, DTU Nanotech, Building 345 East, DK-2800 Kongens Lyngby (Denmark); Skotte Sørensen, Karen, E-mail: karen@nanotech.dtu.dk [Department of Micro- and Nanotechnology, Technical University of Denmark, DTU Nanotech, Building 345 East, DK-2800 Kongens Lyngby (Denmark); Center for Integrated Point of Care Technologies (CiPoC), DELTA, Venlighedsvej 4, DK-2870 Hørsholm (Denmark); Wolff, Anders, E-mail: anders.wolff@nanotech.dtu.dk [Department of Micro- and Nanotechnology, Technical University of Denmark, DTU Nanotech, Building 345 East, DK-2800 Kongens Lyngby (Denmark); Fougt Hansen, Mikkel, E-mail: mikkel.hansen@nanotech.dtu.dk [Department of Micro- and Nanotechnology, Technical University of Denmark, DTU Nanotech, Building 345 East, DK-2800 Kongens Lyngby (Denmark)

    2015-04-15

    We present an all-polymer, single-use microfluidic chip system produced by injection moulding and bonded by ultrasonic welding. Both techniques are compatible with low-cost industrial mass-production. The chip is produced for magnetic bead-based solid-phase extraction facilitated by immiscible phase filtration and features passive liquid filling and magnetic bead manipulation using an external magnet. In this work, we determine the system compatibility with various surfactants. Moreover, we quantify the volume of liquid co-transported with magnetic bead clusters from Milli-Q water or a lysis-binding buffer for nucleic acid extraction (0.1 (v/v)% Triton X-100 in 5 M guanidine hydrochloride). A linear relationship was found between the liquid carry-over and mass of magnetic beads used. Interestingly, similar average carry-overs of 1.74(8) nL/µg and 1.72(14) nL/µg were found for Milli-Q water and lysis-binding buffer, respectively. - Highlights: • We present an all-polymer mass producible passive filled microfluidic chip system. • Rapid system fabrication is obtained by injection moulding and ultrasonic welding. • The system is made for single-use nucleic acid extraction using magnetic beads. • We systematically map compatibility of the chip system with various surfactants. • We quantify the volume carry-over of magnetic beads in water and 0.1% triton-X solution.

  10. Silver-coated dye-embedded silica beads: a core material of dual tagging sensors based on fluorescence and Raman scattering.

    Science.gov (United States)

    Kim, Kwan; Lee, Hyang Bong; Choi, Jeong-Yong; Shin, Kuan Soo

    2011-02-01

    We have developed a new type of dual-tag sensor for immunoassays, operating via both fluorescence and surface-enhanced Raman scattering (SERS). A one-shot fluorescence image over the whole specimen allows us to save considerable time because any unnecessary time-consuming SERS measurements can be avoided from the signature of the fluorescence. Dye-embedded silica beads are prepared initially, and then SERS-active silver is coated onto them via a very simple electroless-plating method. The Raman markers are subsequently assembled onto the Ag-coated silica beads, after which they are stabilized by silanization via a biomimetic process in which a poly(allylamine hydrochloride) layer formed on the Raman markers by a layer-by-layer deposition method acting as a scaffold for guiding silicification. In the final stage, specific antibodies are attached to the silica surface in order to detect target antigens. The fluorescence signal of the embedded dye can be used as a fast readout system of molecular recognition, whereas the SERS signals are subsequently used as the signature of specific molecular interactions. In this way, the antibody-grafted particles were found to recognize antigens down to 1 × 10(-10) g mL(-1) solely by the SERS peaks of the Raman markers. PMID:21190360

  11. Enzyme-catalyzed reaction of voltammetric enzyme-linked immunoassay system based on OAP as substrate

    Institute of Scientific and Technical Information of China (English)

    张书圣; 陈洪渊; 焦奎

    1999-01-01

    The o-aminophenol (OAP)-H2O2-horseradish peroxidase (HRP) voltammetric enzyme-linked immunoassay new system has extremely high sensitivity. HRP can be measured with a detection limit of 6.0×10-(10) g/L and a linear range of 1.0×10-9—4.0×10-6 g/L. The pure product of H2O2 oxidizing OAP catalyzed by HRP was prepared with chemical method. The enzyme-catalyzed reaction has been investigated with electroanalytical chemistry, UV/Vis spectrum, IR spectrum, 13C NMR, 1H NMR, mass spectrum, elemental analysis, etc. Under the selected enzyme-catalyzed reaction conditions, the oxidation product of OAP with H2O2 catalyzed by HRP is 2-aminophe-noxazine-3-one. The processes of the enzyme-catalyzed reaction and the electroreduction of the product of the enzymecatalyzed reaction have been described.

  12. Silver-coated silica bead-based dual tagging sensors operating via surface-enhanced Raman scattering and metal-enhanced fluorescence

    International Nuclear Information System (INIS)

    Complete text of publication follows. We have developed a new type of dual-tag sensors, operating via both surface-enhanced Raman scattering (SERS) and metal enhanced fluorescence (MEF), for immunoassays. Initially, a very simple electroless-plating method was applied to prepare Ag-coated silica beads. After adsorbing Raman labels (benzenethiol or 4-aminobenzenethiol), poly(acrylic acid) (PAA) and poly(allylamine hydrochloride) (PAH) were deposited onto them by the layer-by-layer (LBL) method: The beads became fluorescent due to the incorporation of rhodamine B isothiocyanate (RhBITC)-grafted PAH in the latter process. In the final stage, the outermost PAH was reacted with glutaraldehyde (GA), and then either goat anti-human-IgG (anti-h-IgG) or mouse anti-rabbit-IgG (anti-r-IgG) was immobilized thereon. Thereafter, we confirmed, by monitoring the SERS peaks of benzenethiol (BT) and the confocal laser scanning microscopy (CLSM) of RhBITC, that anti-h-IgG-grafted SiO2aAg particles interact exclusively with h-IgG. Similarly, we confirmed from the SERS peaks of 4-aminobenzenethiol (4-ABT), as well as the CLSM of RhBITC, that anti-r-IgG-grafted SiO2aAg beads interact solely with r-IgG. These clearly illustrate that firstly, the binding event of the target molecule and then the specific type of antigen can be recognized consecutively by MEF and SERS, respectively. The application prospects of these materials are thus expected to be very high especially in the areas of biological sensing and recognition that rely heavily on optical and spectroscopic properties. This work was supported by the Korea Science and Engineering Foundation (Grant No. R11-2007-012-02002-0) and the Korea Research Foundation (Grant KRF-2008-313-C00390).

  13. An ultrasensitive quantum dots fluorescent polarization immunoassay based on the antibody modified Au nanoparticles amplifying for the detection of adenosine triphosphate

    International Nuclear Information System (INIS)

    Graphical abstract: A new fluorescent polarization immunoassay (FPIA) method for ATP was structured. The fluorescence polarization method has ultrahigh sensitivity and good selectivity. The method could be applied for the ATP detection in bioanalysis. -- Highlights: •A new fluorescent polarization immunoassay (FPIA) method for ATP was structured. •The fluorescence polarization method has ultrahigh sensitivity and good selectivity. •The method could be applied for the ATP detection in bioanalysis. -- Abstract: In this work, an ultrasensitive fluorescent polarization immunoassay (FPIA) method based on the quantum dot/aptamer/antibody/gold nanoparticles ensemble has been developed for the detection of adenosine triphosphate (ATP). DNA hybridization is formed when ATP is present in the PBS solution containing the DNA-conjugated quantum dots (QDs) and antibody-AuNPs. The substantial sensitivity improvement of the antibody-AuNPs-enhanced method is mainly attributed to the slower rotation of fluorescent unit when QDs-labeled oligonucleotides hybridize with antibody modified the gold nanoparticle. As a result, the fluorescent polarization (FP) values of the system increase significantly. Under the optimal conditions, a linear response with ATP concentration is ranged from 8 × 10−12 M to 2.40 × 10−4 M. The detection limit reached as low as 1.8 pM. The developed work provides a sensitive and selective immunoassay protocol for ATP detection, which could be applied in more bioanalytical systems

  14. An ultrasensitive quantum dots fluorescent polarization immunoassay based on the antibody modified Au nanoparticles amplifying for the detection of adenosine triphosphate

    Energy Technology Data Exchange (ETDEWEB)

    He, Yanlong; Tian, Jianniao, E-mail: birdtjn@sina.com; Hu, Kun; Zhang, Juanni; Chen, Sheng; Jiang, Yixuan; Zhao, Yanchun, E-mail: yanchunzh@sina.com; Zhao, Shulin

    2013-11-13

    Graphical abstract: A new fluorescent polarization immunoassay (FPIA) method for ATP was structured. The fluorescence polarization method has ultrahigh sensitivity and good selectivity. The method could be applied for the ATP detection in bioanalysis. -- Highlights: •A new fluorescent polarization immunoassay (FPIA) method for ATP was structured. •The fluorescence polarization method has ultrahigh sensitivity and good selectivity. •The method could be applied for the ATP detection in bioanalysis. -- Abstract: In this work, an ultrasensitive fluorescent polarization immunoassay (FPIA) method based on the quantum dot/aptamer/antibody/gold nanoparticles ensemble has been developed for the detection of adenosine triphosphate (ATP). DNA hybridization is formed when ATP is present in the PBS solution containing the DNA-conjugated quantum dots (QDs) and antibody-AuNPs. The substantial sensitivity improvement of the antibody-AuNPs-enhanced method is mainly attributed to the slower rotation of fluorescent unit when QDs-labeled oligonucleotides hybridize with antibody modified the gold nanoparticle. As a result, the fluorescent polarization (FP) values of the system increase significantly. Under the optimal conditions, a linear response with ATP concentration is ranged from 8 × 10{sup −12} M to 2.40 × 10{sup −4} M. The detection limit reached as low as 1.8 pM. The developed work provides a sensitive and selective immunoassay protocol for ATP detection, which could be applied in more bioanalytical systems.

  15. Rapid Detection of Ricin in Serum Based on Cu-Chelated Magnetic Beads Using Mass Spectrometry

    Science.gov (United States)

    Zhao, Yong-Qiang; Song, Jian; Wang, Hong-Li; Xu, Bin; Liu, Feng; He, Kun; Wang, Na

    2016-04-01

    The protein toxin ricin obtained from castor bean plant (Ricinus communis) seeds is a potent biological warfare agent due to its ease of availability and acute toxicity. In this study, we demonstrated a rapid and simple method to detect ricin in serum in vitro. The ricin was mixed with serum and digested by trypsin, then all the peptides were efficiently extracted using Cu-chelated magnetic beads and were detected with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The specific ricin peptides were identified by Nanoscale Ultra Performance liquid chromatography coupled to tandem mass spectrometry according to their sequences. The assay required 2.5 hours, and a characteristic peptide could be detected down to 4 ng/μl and used as a biomarker to detect ricin in serum. The high sensitivity and simplicity of the procedure makes it valuable in clinical practice.

  16. Weld pool boundary and weld bead shape reconstruction based on passive vision in P-GMAW

    Institute of Scientific and Technical Information of China (English)

    Yan Zhihong; Zhang Guangjun; Gao Hongming; Wu Lin

    2006-01-01

    A passive visual sensing system is established in this research, and clear weld pool images in pulsed gas metal arc welding ( P-GMA W) can be captured with this system. The three-dimensional weld pool geometry, especially the weld height,is not only a crucial factor in determining workpiece mechanical properties, but also an important parameter for reflecting the penetration. A new three-dimensional (3D) model is established to describe the weld pool geometry in P-GMAW. Then, a series of algorithms are developed to extract the model geometrical parameters from the weld pool images. Furthermore, the method to reconstruct the 3D shape of weld pool boundary and weld bead from the two-dimensional images is investigated.

  17. A giant magnetoresistance ring-sensor based microsystem for magnetic bead manipulation and detection

    KAUST Repository

    Gooneratne, Chinthaka P.

    2011-03-28

    In this paper a novel spin valvegiant magnetoresistance(GMR) ring-sensor integrated with a microstructure is proposed for concentrating, trapping, and detecting superparamagnetic beads (SPBs). Taking advantage of the fact that SPBs can be manipulated by an external magnetic field, a unique arrangement of conducting microrings is utilized to manipulate the SPBs toward the GMR sensing area in order to increase the reliability of detection. The microrings are arranged and activated in such a manner so as to enable the detection of minute concentrations of SPBs in a sample. Precise manipulation is achieved by applying current sequentially to the microrings. The fabricated ring-shaped GMR element is located underneath the innermost ring and has a magnetoresistance of approximately 5.9%. By the performed experiments it was shown that SPBs could be successfully manipulated toward the GMR sensing zone.

  18. Microfluidic bead-based assay for microRNAs using quantum dots as labels and enzymatic amplification

    International Nuclear Information System (INIS)

    We report on a microfluidic assay for microRNA using quantum dots as labels and capture probes immobilized in a bead array. Target microRNA flows along the microfluidic channel to hit the beads array where it hybridizes with the immobilized capture probes. Next, the hybrid is labeled by using the bound microRNAs as a primer for enzymatic elongation with biotin-labeled nucleotides. Due to the specificity of (a) the hybridization assay and (b) the enzymatic elongation step, this assay is quite selective and only the completely matched duplex can be labeled, in a final step, with streptavidin-labeled quantum dots. The method was applied to the specific detection of microRNAs that occur in the miRNA-29 family and display minute differences only in their nucleotide sequence. It does not require (a) a labeling step before hybridization and (b) no amplification. This on-chip assay for microRNA can detect concentrations as low as 0.1 pmol·L−1 (at an SNR of >3) when using synthetic microRNA. The 200-fold better sensitivity than that of an off-chip test is ascribed to the microfluidic-based signal enhancement. Other features include rapid binding kinetics, the advantages of a homogeneous assay in a suspended microbead array, the detection sensitivity resulting from the use of quantum dots, small reagent consumption, short assay time, and parallel detection. (author)

  19. 3D origami-based multifunction-integrated immunodevice: low-cost and multiplexed sandwich chemiluminescence immunoassay on microfluidic paper-based analytical device.

    Science.gov (United States)

    Ge, Lei; Wang, Shoumei; Song, Xianrang; Ge, Shenguang; Yu, Jinghua

    2012-09-01

    A novel 3D microfluidic paper-based immunodevice, integrated with blood plasma separation from whole blood samples, automation of rinse steps, and multiplexed CL detections, was developed for the first time based on the principle of origami (denoted as origami-based device). This 3D origami-based device, comprised of one test pad surrounded by four folding tabs, could be patterned and fabricated by wax-printing on paper in bulk. In this work, a sandwich-type chemiluminescence (CL) immunoassay was introduced into this 3D origami-based immunodevice, which could separate the operational procedures into several steps including (i) folding pads above/below and (ii) addition of reagent/buffer under a specific sequence. The CL behavior, blood plasma separation, washing protocol, and incubation time were investigated in this work. The developed 3D origami-based CL immunodevice, combined with a typical luminuol-H(2)O(2) CL system and catalyzed by Ag nanoparticles, showed excellent analytical performance for the simultaneous detection of four tumor markers. The whole blood samples were assayed and the results obtained were in agreement with the reference values from the parallel single-analyte test. This paper-based microfluidic origami CL detection system provides a new strategy for a low-cost, sensitive, simultaneous multiplex immunoassay and point-of-care diagnostics. PMID:22763468

  20. Diagnostic performance of line-immunoassay based algorithms for incident HIV-1 infection

    Directory of Open Access Journals (Sweden)

    Schüpbach Jörg

    2012-04-01

    Full Text Available Abstract Background Serologic testing algorithms for recent HIV seroconversion (STARHS provide important information for HIV surveillance. We have previously demonstrated that a patient's antibody reaction pattern in a confirmatory line immunoassay (INNO-LIA™ HIV I/II Score provides information on the duration of infection, which is unaffected by clinical, immunological and viral variables. In this report we have set out to determine the diagnostic performance of Inno-Lia algorithms for identifying incident infections in patients with known duration of infection and evaluated the algorithms in annual cohorts of HIV notifications. Methods Diagnostic sensitivity was determined in 527 treatment-naive patients infected for up to 12 months. Specificity was determined in 740 patients infected for longer than 12 months. Plasma was tested by Inno-Lia and classified as either incident ( Results The 10 best algorithms had a mean raw sensitivity of 59.4% and a mean specificity of 95.1%. Adjustment for overrepresentation of patients in the first quarter year of infection further reduced the sensitivity. In the preferred model, the mean adjusted sensitivity was 37.4%. Application of the 10 best algorithms to four annual cohorts of HIV-1 notifications totalling 2'595 patients yielded a mean IIR of 0.35 in 2005/6 (baseline and of 0.45, 0.42 and 0.35 in 2008, 2009 and 2010, respectively. The increase between baseline and 2008 and the ensuing decreases were highly significant. Other adjustment models yielded different absolute IIR, although the relative changes between the cohorts were identical for all models. Conclusions The method can be used for comparing IIR in annual cohorts of HIV notifications. The use of several different algorithms in combination, each with its own sensitivity and specificity to detect incident infection, is advisable as this reduces the impact of individual imperfections stemming primarily from relatively low sensitivities and

  1. Immunomagnetic concentration of antigens and detection based on a scanning force microscopic immunoassay.

    Science.gov (United States)

    Perrin, A; Theretz, A; Lanet, V; Vialle, S; Mandrand, B

    1999-04-22

    Scanning Force Microscopy has already been shown to be a convenient and rapid method for sensitive antigen detection and quantification. Here, we describe different improvement steps brought to a TSH Scanning Force Microscopic ImmunoAssay (SFMIA), each of them aiming to solve a previous limitation of the solid phase test format and leading to a significant sensitivity enhancement. First, superparamagnetic nanoparticles conjugated to monoclonal anti alphaTSH antibodies were used for the specific TSH capture step. Their magnetic properties allowed easy separation of the complexes obtained from relatively large reaction volumes by application of a High Gradient Magnetic Field System. As a consequence, complex formation could proceed in a stirred solution, which greatly enhances binding rates compared to previous 'static' conditions of solid-phase reactions. It was established that, despite their small size, magnetic complexes could be moved over short distances by a NdFeB magnet magnetic field. This property was exploited to overcome diffusion barrier and boundary layer constraints and to drive magnetic complexes through the liquid, towards anti-betaTSH antibodies immobilized on silica wafers. Finally, we significantly increased the complex number/surface area by a stepwise reduction of the biospecific solid phase area. The proposed steps permitted a 3-fold improvement in the TSH SFMIA dynamic range. Moreover, as little as 0.02 pg/ml (0.1 nIU/ml or 0.8 amol/ml) of TSH could be detected using 1 ml sample volumes. This is over 100 times more sensitive than the current performance of commercialized automated systems. PMID:10357209

  2. Coated Aerogel Beads

    Science.gov (United States)

    Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)

    2014-01-01

    Methods and apparatus for coating particulate material are provided. The apparatus includes a vessel having a top and a bottom, a vertically extending conduit having an inlet in the vessel and an outlet outside of the vessel, a first fluid inlet in the bottom of the vessel for introducing a transfer fluid, a second fluid inlet in the bottom of the vessel for introducing a coating fluid, and a fluid outlet from the vessel. The method includes steps of agitating a material, contacting the material with a coating material, and drying the coating material to produce a coated material. The invention may be adapted to coat aerogel beads, among other materials. A coated aerogel bead and an aerogel-based insulation material are also disclosed.

  3. Target-induced nano-enzyme reactor mediated hole-trapping for high-throughput immunoassay based on a split-type photoelectrochemical detection strategy.

    Science.gov (United States)

    Zhuang, Junyang; Tang, Dianyong; Lai, Wenqiang; Xu, Mingdi; Tang, Dianping

    2015-09-15

    Photoelectrochemical (PEC) detection is an emerging and promising analytical tool. However, its actual application still faces some challenges like potential damage of biomolecules (caused by itself system) and intrinsic low-throughput detection. To solve the problems, herein we design a novel split-type photoelectrochemical immunoassay (STPIA) for ultrasensitive detection of prostate specific antigen (PSA). Initially, the immunoreaction was performed on a microplate using a secondary antibody/primer-circular DNA-labeled gold nanoparticle as the detection tag. Then, numerously repeated oligonucleotide sequences with many biotin moieties were in situ synthesized on the nanogold tag via RCA reaction. The formed biotin concatamers acted as a powerful scaffold to bind with avidin-alkaline phosphatase (ALP) conjugates and construct a nanoenzyme reactor. By this means, enzymatic hydrolysate (ascorbic acid) was generated to capture the photogenerated holes in the CdS quantum dot-sensitized TiO2 nanotube arrays, resulting in amplification of the photocurrent signal. To elaborate, the microplate-based immunoassay and the high-throughput detection system, a semiautomatic detection cell (installed with a three-electrode system), was employed. Under optimal conditions, the photocurrent increased with the increasing PSA concentration in a dynamic working range from 0.001 to 3 ng mL(-1), with a low detection limit (LOD) of 0.32 pg mL(-1). Meanwhile, the developed split-type photoelectrochemical immunoassay exhibited high specificity and acceptable accuracy for analysis of human serum specimens in comparison with referenced electrochemiluminescence immunoassay method. Importantly, the system was not only suitable for the sandwich-type immunoassay mode, but also utilized for the detection of small molecules (e.g., aflatoxin B1) with a competitive-type assay format. PMID:26291091

  4. Direct friction measurement in draw bead testing

    DEFF Research Database (Denmark)

    Olsson, David Dam; Bay, Niels; Andreasen, Jan Lasson

    2005-01-01

    The application of draw beads in sheet metal stamping ensures controlled drawing-in of flange parts. Lubrication conditions in draw beads are severe due to sliding under simultaneous bending. Based on the original draw bead test design by Nine [1] comprehensive studies of friction in draw beads...... have been reported in literature. A major drawback in all these studies is that friction is not directly measured, but requires repeated measurements of the drawing force with and without relative sliding between the draw beads and the sheet material. This implies two tests with a fixed draw bead tool...... and a freely rotating tool respectively, an approach, which inevitably implies large uncertainties due to scatter in the experimental conditions. In order to avoid this problem a new draw bead test is proposed by the authors measuring the friction force acting on the tool radius directly by a build...

  5. Silver nanoparticle enhanced Raman scattering-based lateral flow immunoassays for ultra-sensitive detection of the heavy metal chromium

    International Nuclear Information System (INIS)

    We report a simple and ultra-sensitive surface enhanced Raman scattering (SERS) strip sensor based on silver nanoparticles (AgNPs) and lateral flow immunoassays (LFIAs). LFIAs are inexpensive, simple, portable and robust, thus making them commonplace in medicine, agriculture and food safety. However, their applications are limited due to the low signal intensity of the color-formation reaction based on the label accumulation. SERS is a powerful molecular spectroscopy technique for ultra-detection, which is based on the enhancement of the inelastic scattering from molecules located near nanostructured metallic surfaces when the molecules are illuminated and the surface plasmons are excited. Because of the rapidity and robustness of LFIAs and the high sensitivity of SERS, we introduce SERS into LFIAs (SERS-LFIA). Our SERS-LFIA demonstrates fast, excellent performance and is suitable for the semiquantitative examination of ultratrace analytes (Cr3+), with the limit of the detection (LOD) as low as 10−5 ng mL−1, which is 105-fold more highly sensitive than those previously used to detect Cr3+ within 15 min. (paper)

  6. Development of a Multiplexed, Bead-Based Assessment Tool for Rapid Identification and Quantitation of Microorganisms in Field Samples. Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Lowe, M.; Halden, R.

    2002-10-09

    This was the final report for DOE NABIR grant DE-FG02-01ER63264 (PI Mary Lowe). The grant was entitled ''Development of a Multiplexed Bead-Based Assessment Tool for Rapid Identification and Quantitation of Microorganisms in Field Samples.'' The grant duration was one year. The purpose was to develop a bead-based assay for measuring analyte DNAs in environmental PCR products and to apply the method to a field experiment. The primary experiment was located at the UMTRA Old Rifle site.

  7. Renewable Surface Fluorescence Sandwich Immunoassay Biosensor for Rapid Sensitive Botulinum Toxin Detection in an Automated Fluidic Format

    Energy Technology Data Exchange (ETDEWEB)

    Grate, Jay W.; Warner, Marvin G.; Ozanich, Richard M.; Miller, Keith D.; Colburn, Heather A.; Dockendorff, Brian P.; Antolick, Kathryn C.; Anheier, Norman C.; Lind, Michael A.; Lou, Jianlong; Marks, James D.; Bruckner-Lea, Cindy J.

    2009-03-05

    A renewable surface biosensor for rapid detection of botulinum toxin is described based on fluidic automation of a fluorescence sandwich immunoassay, using a recombinant fragment of the toxin heavy chain as a structurally valid simulant. Monoclonal antibodies AR4 and RAZ1 bind to separate epitopes of both this fragment and the holotoxin. The AR4 antibody was covalently bound to Sepharose beads and used as the capture antibody. A rotating rod flow cell was used to capture these beads delivered as a suspension by the sequential injection flow system, creating a 3.6 microliter column. After perfusing the bead column with sample and washing away the matrix, the column was perfused with Alexa 647 dye-labeled RAZ1 antibody as the reporter. Optical fibers coupled to the rotating rod flow cell at a 90 degree angle to one another delivered excitation light from a HeNe laser and collected fluorescent emission light for detection. After each measurement, the used sepharose beads are released and replaced with fresh beads. In a rapid screening approach to sample analysis, the toxin simulant was detected to concentrations of 10 pM in less than 20 minutes.

  8. Pre-packing of cost effective antibiotic cement beads for the treatment of traumatic osteomyelitis in the developing world - an in-vitro study based in Cambodia.

    Science.gov (United States)

    Noor, S; Gilson, A; Kennedy, K; Swanson, A; Vanny, V; Mony, K; Chaudhry, T; Gollogly, J

    2016-04-01

    The developing world often lacks the resources to effectively treat the most serious injuries including osteomyelitis following open fractures or surgical fracture treatment. Antibiotic cement beads are a widely accepted method of delivering antibiotics locally to the infected area following trauma. This study is based in Cambodia, a low income country struggling to recover from a recent genocide. The study aims to test the effectiveness of locally made antibiotic beads and analyse their effectiveness after being gas sterilised, packaged and kept in storage Different antibiotic beads were manufactured locally using bone cement and tested against MRSA bacteria grown from a case of osteomyelitis. Each antibiotic was tested before and after a process of gas sterilisation as well as later being tested after storage in packaging up to 42 days. The gentamicin, vancomycin, amikacin and ceftriaxone beads all inhibited growth of the MRSA on the TSB and agar plates, both before and after gas sterilisation. All four antibiotics continued to show similar zones of inhibition after 42 days of storage. The results show significant promise to produce beads with locally obtainable ingredients in an austere environment and improve cost effectiveness by storing them in a sterilised condition. PMID:26899719

  9. Current antibody-based immunoassay algorithm failed to confirm three late-stage AIDS cases in China: case report

    Directory of Open Access Journals (Sweden)

    Han Zhi-Gang

    2010-03-01

    Full Text Available Abstract Background Immunoassays composed of screening and confirmation are the established algorithm to confirm HIV infection in China, with a Western blot result as the final diagnosis. Case presentation In this report, three late-stage AIDS patients were initially tested HIV antibody positive using multiple screening kits, but tested indeterminate using Western blot. HIV infection diagnosis was confirmed based on nucleic acid assays, clinic manifestations and epidemiological history. Case A was identified positive at 30 months, using Western blot, Case B at 8 months, and case C remained indeterminate until he died of Kaposi's sarcoma 4 months after HAART. Conclusion The report indicates that current antibody-based testing algorithms may miss late-stage AIDS patients and therefore miss the opportunity for preventing these cases from further transmission. The report also implies that viral load assays is not easy to be universely applicated in developing country like China although it is helpful in diagnosing complicated cases of HIV infection, so the counselling before and after testing is imperative to the diagnosis of HIV infection and risk behavior survey on the examinee should be as detailed as possible.

  10. IgG/anti-IgG immunoassay based on a turn-around point long period grating

    Science.gov (United States)

    Chiavaioli, F.; Biswas, P.; Trono, C.; Giannetti, A.; Tombelli, S.; Bandyopadhyay, S.; Basumallick, N.; Dasgupta, K.; Baldini, F.

    2014-02-01

    Long period fiber gratings (LPFGs) have been proposed as label-free optical biosensor for a few years. Refractive index changes, which modify the fiber transmission spectrum, are still used for evaluating a biochemical interaction that occurs along the grating region. A turn-around point (TAP) LPFG was manufactured for enhancing the refractive index sensitivity of these devices. Considering the simplicity and the fast process with respect to the silanization procedure, the functionalization of the fiber was carried out by Eudragit L100 copolymer. An IgG/anti-IgG immunoassay was implemented for studying the antigen/antibody interaction. A limit of detection lower than 100 μg L-1 was achieved. Based on the same model assay, we compared the resonance wavelength shifts during the injection of 10 mg L-1 anti-IgG antigen between the TAP LPFG and a standard non-TAP one, in which the coupling occurs with a lower order cladding mode, as performance improvement of the LPFG-based biosensors.

  11. Analysis of in vitro lymphocyte adhesion and transendothelial migration by fluorescent-beads-based flow cytometric cell counting

    NARCIS (Netherlands)

    Molema, Ingrid; Mesander, G; Kroesen, Bart-Jan; Helfrich, Wijnand; Meijer, D.K F; de Leij, Lou

    1998-01-01

    In this report, we describe a new and simple method for flow cytometric quantitation of lymphocyte numbers in lymphocute-endothelial adhesion/transendothelial migration assays. The method exploits fluorescent flow cytometer alignment beads as a counting reference. Known amounts of beads are added to

  12. Sirtuin 1 evaluation with a novel immunoassay approach based on TiO2-Au label and hyperbranched polymer hybrid.

    Science.gov (United States)

    An, Yarui

    2016-08-15

    Accurate and highly sensitive evaluation of the sirtuin 1 (SirT1) level is becoming increasingly important for understanding the contribution of SirT1 in metabolism pathways. Here, a novel electrochemical immunoassay of SirT1 based on crosslinked hyperbranched azo-polymer decorated with gold colloids (Au-HAP) as sensing platform and titanium dioxide (TiO2)-Au nanocomposites to immobilize secondary antibody-horseradish peroxidase (Ab2-HRP) as electrochemical labels has been designed. Greatly enhanced sensitivity was achieved by exploiting the excellent conductivity of Au nanoparticle, the amplification effect of Au-HAP and TiO2-Au, and the favorable catalytic ability of HRP. The nanocomposites of Au-HAP and TiO2-Au could attach numerous capture antibodies on the surface for significant immune recognition efficiency. Meanwhile, the TiO2-Au-labeled Ab2-HRP using an HRP-thionine-H2O2 (hydrogen peroxide) detection system could further induce signal readout. Under optimal conditions, the signal intensity was linearly related to the concentration of SirT1 in the range of 1-500 ng ml(-1), and the limit of detection was 0.28 ng ml(-1). The developed biosensor exhibits attractive performance for the analysis of SirT1, with rapid response, high sensitivity, and high accuracy, and could become a promising technique for protein detection. PMID:27264194

  13. A high-throughput homogeneous immunoassay based on Förster resonance energy transfer between quantum dots and gold nanoparticles.

    Science.gov (United States)

    Qian, Jing; Wang, Chengquan; Pan, Xiaohu; Liu, Songqin

    2013-02-01

    A novel homogeneous immunoassay based on Förster resonance energy transfer for sensitive detection of tumor, e.g., marker with carcinoembryonic antigen (CEA), was proposed. The assay was consisted of polyclonal goat anti-CEA antibody labeled luminescent CdTe quantum dots (QDs) as donor and monoclonal goat anti-CEA antibody labeled gold nanoparticles (AuNPs) as acceptor. In presence of CEA, the bio-affinity between antigen and antibody made the QDs and AuNPs close enough, thus the photoluminescence (PL) quenching of CdTe QDs occurred. The PL properties could be transformed into the fluorometric variation, corresponding to the target antigen concentration, and could be easily monitored and analyzed with the home-made image analysis software. The fluorometric results indicated a linear detection range of 1-110 ng mL(-1) for CEA, with a detection limit of 0.3 ng mL(-1). The proposed assay configuration was attractive for carcinoma screening or single sample in point-of-care testing, and even field use. In spite of the limit of available model analyte, this approach could be easily extended to detection of a wide range of biomarkers. PMID:23340285

  14. Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

    Science.gov (United States)

    Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

    2012-09-01

    Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. PMID:22310206

  15. [Fluoroimmunoassay and Magnetic Lateral Flow Immunoassay for the Detection of Ractopamine].

    Science.gov (United States)

    Wang, Song-bai; Zhang, Yan; Wei, Yan-li; An, Wen-ting; Wang, Yu; Shuang, Shao-min

    2015-11-01

    A fluoroimmunoassay based on quantum dots (QDs) and a lateral flow immunoassay system based on the magnetic beads (MB) were constructed to detect ractopamine (RAG) in urine samples. The monoclonal antibody (Ab1) against RAC was conjugated with QDs or MB as detector reagent, respectively. They apply a competitive format using an immobilized RAC conjugate and free RAC present in samples. That is to say, the concentration of RAC in the sample was negative related to the fluorescense intensity of QDs or the color density of MB. Results showed that the limit of detection (LOD) of fluorescence immunoassay method is 1 ng · mL⁻¹ and analysis time is 4 h, while the visual LOD was 10 ng · mL⁻¹ and analysis time was 15 min in magnetic lateral flow immunoassay system (MFLIS). Taken into consideration of the advantages and disadvantages of the two methods, it was suitable for the trace detection of RAC using fluoroimmunoassay while it was appropriate for point-of-care tesing of RAC by MFLIS. PMID:26978917

  16. Liquid carry-over in an injection moulded all-polymer chip system for immiscible phase magnetic bead-based solid-phase extraction

    DEFF Research Database (Denmark)

    Kistrup, Kasper; Sørensen, Karen Skotte; Wolff, Anders;

    2014-01-01

    We present an all-polymer, single-use microfluidic chip system produced by injection moulding and bonded by ultrasonic welding. Both techniques are compatible with low-cost industrial mass-production. The chip is produced for magnetic bead-based solid-phase extraction facilitated by immiscible...

  17. Multi-color quantum dot-based fluorescence immunoassay array for simultaneous visual detection of multiple antibiotic residues in milk.

    Science.gov (United States)

    Song, Erqun; Yu, Mengqun; Wang, Yunyun; Hu, Weihua; Cheng, Dan; Swihart, Mark T; Song, Yang

    2015-10-15

    Antibiotic residues, which are among the most common contaminants in animal-based food products such as milk, have become a significant public health concern. Here, we combine a multicolor quantum dot (QD)-based immunofluorescence assay and an array analysis method to achieve simultaneous, sensitive and visual detection of streptomycin (SM), tetracycline (TC), and penicillin G (PC-G) in milk. Antibodies (Abs) for SM, TC and PC-G were conjugated to QDs with different emission wavelengths (QD 520 nm, QD 565 nm and QD 610 nm) to serve as detection probes (QD-Ab). Then a direct competitive fluorescent immunoassay was performed in antigen-coated microtiter plate wells for simultaneous qualitative and quantitative detection of SM, TC, and PC-G residues, based on fluorescence of the QD-Ab probes. The linear ranges for SM, TC and PC-G were 0.01-25 ng/mL, 0.01-25 ng/mL and 0.01-10 ng/mL, respectively, with detection limit of 5 pg/mL for each of them. Based on fluorescence of the QD-Ab probes, residues of the three antibiotics were determined visually and simultaneously. Compared with a commercial enzyme-linked immunosorbent assay kit, our method could achieve simultaneous analysis of multiple target antibiotics in multiple samples in a single run (high-throughput analysis) and improved accuracy and sensitivity for analysis of residues of the three antibiotics in authentic milk samples. This new analytical tool can play an important role in ameliorating the negative impact of the residual antibiotics on human health and the ecosystem. PMID:26002016

  18. Heat generation ability in AC magnetic field of nano MgFe2O4-based ferrite powder prepared by bead milling

    Science.gov (United States)

    Hirazawa, Hideyuki; Aono, Hiromichi; Naohara, Takashi; Maehara, Tsunehiro; Sato, Mitsunori; Watanabe, Yuji

    2011-03-01

    Nanosized MgFe2O4-based ferrite powder having heat generation ability in an AC magnetic field was prepared by bead milling and studied for thermal coagulation therapy applications. The crystal size and the particle size significantly decreased by bead milling. The heat generation ability in an AC magnetic field improved with the milling time, i.e. a decrease in crystal size. However, the heat generation ability decreased for excessively milled samples with crystal sizes of less than 5.5 nm. The highest heat ability (ΔT=34 °C) in the AC magnetic field (370 kHz, 1.77 kA/m) was obtained for fine MgFe2O4 powder having a ca. 6 nm crystal size (the samples were milled for 6-8 h using 0.1 mm ϕ beads). The heat generation of the samples was closely related to hysteresis loss, a B-H magnetic property. The reason for the high heat generation properties of the samples milled for 6-8 h using 0.1 mm ϕ beads was ascribed to the increase in hysteresis loss by the formation of a single domain. Moreover, the improvement in heating ability was obtained by calcination of the bead-milled sample at low temperature. In this case, the maximum heat generation (ΔT=41 °C) ability was obtained for a ca. 11 nm crystal size sample was prepared by crystal growth during the sample calcination. On the other hand, the ΔT value for Mg0.5Ca0.5Fe2O4 was synthesized using a reverse precipitation method decreased by bead milling.

  19. Immunoassays in Biotechnology

    Science.gov (United States)

    Immunoassays have broad applications for a wide variety of important biological compounds and environmental contaminants. Immunoassays can detect the presence of an antigen in the human body, a pollutant in the environment, or a critical antibody in a patient’s serum to develop a...

  20. Simple and robust antibody microarray-based immunoassay platform for sensitive and selective detection of PSA and hK2 toward accurate diagnosis of prostate cancer

    Directory of Open Access Journals (Sweden)

    S.W. Lee

    2015-03-01

    Full Text Available This paper reports the development of an easy to use antibody microarray-based immunoassay platform for sensitive and selective duplex detection of PSA (prostate specific antigen and hK2 (human kallikrein 2. Using PDMS wells in a 3 × 9 array on epoxy-coated glass slides 27 duplex immunoassays can be performed in parallel. Automated microarraying provided fast and reproducible antibody arraying in each assay well. To achieve highly sensitive and selective detection of each biomarker, we evaluated and optimized the density of each of the immobilized capture antibodies. The assay platform showed a limit of detection (LOD of each biomarker (PSA and hK2 of less than 10 pg/mL and a dynamic range of 104–105 orders of magnitude. Neither the PSA nor the hK2 antibody array showed any cross-reaction against each others target proteins or other plasma proteins. These results emphasize the importance of density optimization of capture antibody on the surface in order to achieve a sensitive and selective multiplex immunoassay.

  1. Simultaneous detection of IgG antibodies associated with viral hemorrhagic fever by a multiplexed Luminex-based immunoassay.

    Science.gov (United States)

    Wu, Wei; Zhang, Shuo; Qu, Jing; Zhang, Quanfu; Li, Chuan; Li, Jiandong; Jin, Cong; Liang, Mifang; Li, Dexin

    2014-07-17

    Viral hemorrhagic fevers (VHFs) are worldwide diseases caused by several kinds of viruses. With the emergence of new viruses, advanced diagnostic methods are urgently needed for identification of VHFs. Based on Luminex xMAP technology, a rapid, sensitive, multi-pathogen and high-throughput method which could simultaneously detect hemorrhagic fever viruses (HFVs) specific IgG antibodies was developed. Recombinant antigens of nine HFVs including Hantaan virus (HTNV), Seoul virus (SEOV), Puumala virus (PUUV), Andes virus (ANDV), Sin Nombre virus (SNV), Crimean-Congo hemorrhagic fever virus (CCHFV), Rift Valley fever virus (RVFV), Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) and dengue virus (DENV) were produced and purified from a prokaryotic expression system and the influence of the coupling amount was investigated. Cross-reactions among antigens and their rabbit immune sera were evaluated. Serum samples collected from 51 laboratory confirmed hemorrhagic fever with renal syndrome (HFRS) patients, 43 confirmed SFTS patients and 88 healthy donors were analyzed. Results showed that recombinant nucleocapsid protein of the five viruses belonging to the genus Hantavirus, had serological cross-reactivity with their corresponding rabbit immune sera, but not apparent with immune sera of other four viruses. Evaluation of this new method with clinical serum samples showed 98.04% diagnostic sensitivity for HFRS, 90.70% for SFTS detection and the specificity was ranging from 66.67% to 100.00%. The multiplexed Luminex-based immunoassay has firstly been established in our study, which provides a potentially reliable diagnostic tool for IgG antibody detection of VHFs. PMID:24631566

  2. A high-throughput homogeneous immunoassay based on Förster resonance energy transfer between quantum dots and gold nanoparticles

    International Nuclear Information System (INIS)

    Graphical abstract: A Förster resonance energy transfer system by using polyclonal goat anti-CEA antibody labeled luminescent CdTe quantum dots (QDs) as donor and monoclonal goat anti-CEA antibody labeled gold nanoparticles (AuNPs) as acceptor for sensitive detection of tumor marker was proposed. Highlights: ► A homogeneous immunosensing strategy based on FRET for detection of tumor marker was proposed. ► Close of QDs and AuNPs allow the occurrence of quenching the photoluminescence of nano-bio-probes. ► Signal quenching was monitored by a self-developed image analyzer. ► The fluorometric assay format is attractive for widespread carcinoma screening and even field use. -- Abstract: A novel homogeneous immunoassay based on Förster resonance energy transfer for sensitive detection of tumor, e.g., marker with carcinoembryonic antigen (CEA), was proposed. The assay was consisted of polyclonal goat anti-CEA antibody labeled luminescent CdTe quantum dots (QDs) as donor and monoclonal goat anti-CEA antibody labeled gold nanoparticles (AuNPs) as acceptor. In presence of CEA, the bio-affinity between antigen and antibody made the QDs and AuNPs close enough, thus the photoluminescence (PL) quenching of CdTe QDs occurred. The PL properties could be transformed into the fluorometric variation, corresponding to the target antigen concentration, and could be easily monitored and analyzed with the home-made image analysis software. The fluorometric results indicated a linear detection range of 1–110 ng mL−1 for CEA, with a detection limit of 0.3 ng mL−1. The proposed assay configuration was attractive for carcinoma screening or single sample in point-of-care testing, and even field use. In spite of the limit of available model analyte, this approach could be easily extended to detection of a wide range of biomarkers

  3. Quantitative determination of major capsaicinoids in serum by ELISA and time-resolved fluorescent immunoassay based on monoclonal antibodies.

    Science.gov (United States)

    Yang, Qingqing; Zhu, Jianguo; Ma, Fei; Li, Peiwu; Zhang, Liangxiao; Zhang, Wen; Ding, Xiaoxia; Zhang, Qi

    2016-07-15

    To monitor capsaicinoids in serum on-site, three new monoclonal antibodies (mAbs) were firstly proposed using a conjugate of 4-[(4-hydroxy-3-methoxybenzyl) amino]-4-oxobutanoic acid as the immunogen. Among them, the YQQD8 mAb showed the highest sensitivity and cross-reactivity to major capsaicinoids, such as capsaicin, dihydrocapsaicin and N-vanillylnonanamide. A competitive indirect enzyme-linked immunosorbent assay (icELISA) and a time-resolved fluorescent immunochromatographic assay (TRFICA) were established based on this mAb. The linear range was 1.1-27.0ngmL(-1) for icELISA and 1.9-62.5ngmL(-1) for TRFICA and the limit of detection (LOD) of TRFICA was 1.5ngmL(-1). To decrease the interference of sample components and increase accuracy, serum samples were diluted four times before assays. As a result, the linear range of serum samples was 4.6-107.9ngmL(-1) for icELISA and 7.6-250.0ngmL(-1) for TRFICA. Both icELISA and TRFICA showed good recoveries (91.0-112.8% for icELISA and 87.6-111.5% for TRFICA) and concordant results in spiked experiments. Overall, this is the first report of immunoassay based on the mAbs for quantitative determination of major capsaicinoids, and the results demonstrate that both methods can meet the demands of rapid on-site assay for capsaicinoids in serum samples. PMID:26954788

  4. A high-throughput homogeneous immunoassay based on Förster resonance energy transfer between quantum dots and gold nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Qian, Jing [School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China); School of Chemistry and Chemical Engineering, Jiangsu University, Zhengjiang 212013 (China); Wang, Chengquan [Changzhou College of Information Technology, Changzhou 213164 (China); Pan, Xiaohu [School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China); Liu, Songqin, E-mail: liusq@seu.edu.cn [School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China)

    2013-02-06

    Graphical abstract: A Förster resonance energy transfer system by using polyclonal goat anti-CEA antibody labeled luminescent CdTe quantum dots (QDs) as donor and monoclonal goat anti-CEA antibody labeled gold nanoparticles (AuNPs) as acceptor for sensitive detection of tumor marker was proposed. Highlights: ► A homogeneous immunosensing strategy based on FRET for detection of tumor marker was proposed. ► Close of QDs and AuNPs allow the occurrence of quenching the photoluminescence of nano-bio-probes. ► Signal quenching was monitored by a self-developed image analyzer. ► The fluorometric assay format is attractive for widespread carcinoma screening and even field use. -- Abstract: A novel homogeneous immunoassay based on Förster resonance energy transfer for sensitive detection of tumor, e.g., marker with carcinoembryonic antigen (CEA), was proposed. The assay was consisted of polyclonal goat anti-CEA antibody labeled luminescent CdTe quantum dots (QDs) as donor and monoclonal goat anti-CEA antibody labeled gold nanoparticles (AuNPs) as acceptor. In presence of CEA, the bio-affinity between antigen and antibody made the QDs and AuNPs close enough, thus the photoluminescence (PL) quenching of CdTe QDs occurred. The PL properties could be transformed into the fluorometric variation, corresponding to the target antigen concentration, and could be easily monitored and analyzed with the home-made image analysis software. The fluorometric results indicated a linear detection range of 1–110 ng mL{sup −1} for CEA, with a detection limit of 0.3 ng mL{sup −1}. The proposed assay configuration was attractive for carcinoma screening or single sample in point-of-care testing, and even field use. In spite of the limit of available model analyte, this approach could be easily extended to detection of a wide range of biomarkers.

  5. A bare-eye-based lateral flow immunoassay based on the use of gold nanoparticles for simultaneous detection of three pesticides

    International Nuclear Information System (INIS)

    We present a novel lateral flow immunoassay (LFIA) for the simultaneous detection of the pesticides imidacloprid, chlorpyrifos-methyl and isocarbophos based on three competitive immunoreactions. In contrast to previously reported LFIAs, the method is based on the use of four strips. Each has three red channels (three test lines dispensed with different capture reagent) to detect imidacloprid, chlorpyrifos-methyl and isocarbophos respectively. Different channels on each strip are the key to multi-detection, and four strips of LFIA are needed for visual and semi-quantitative read-outs. Under optimized conditions, the LFIA was applied to the determination of three pesticides. The detection time is within 7 min and the detection limits are 50, 100, and 100 μg L−1, respectively. Furthermore, the LFIA was applied to the analysis of spiked Chinese cabbage and soil samples and results were validated by HPLC. (author)

  6. Fabrication and characterization of tosyl-activated magnetic and nonmagnetic monodisperse microspheres for use in microfluic-based ferritin immunoassay

    Czech Academy of Sciences Publication Activity Database

    Reymond, F.; Vollet, Ch.; Plichta, Zdeněk; Horák, Daniel

    2013-01-01

    Roč. 29, č. 2 (2013), s. 532-542. ISSN 8756-7938 R&D Projects: GA MŠk 7E12053; GA ČR GAP503/10/0664 EU Projects: European Commission(XE) 246513 - NADINE Institutional support: RVO:61389013 Keywords : biosensors * electrochemistry * immunoassays Subject RIV: CD - Macromolecular Chemistry Impact factor: 1.883, year: 2013

  7. Nanobody-based electrochemical immunoassay for Bacillus thuringiensis Cry1Ab toxin by detecting the enzymatic formation of polyaniline

    International Nuclear Information System (INIS)

    We describe an electrochemical immunoassay for the Cry1Ab toxin that is produced by Bacillus thuringiensis. It is making use of a nanobody (a heavy-chain only antibody) that was selected from an immune phage displayed library. A biotinylated primary nanobody and a HRP-conjugated secondary nanobody were applied in a sandwich immunoassay where horseradish peroxidase (HRP) is used to produce polyaniline (PANI) from aniline. PANI can be easily detected by differential pulse voltammetry at a working voltage as low as 40 mV (vs. Ag/AgCl) which makes the assay fairly selective. This immunoassay for Cry1Ab has an analytical range from 0.1 to 1000 ng∙mL-1 and a 0.07 ng∙mL-1 lower limit of detection. The average recoveries of the toxin from spiked samples are in the range from 102 to 114 %, with a relative standard deviation of <7.5 %. The results demonstrated that the assay represented an attractive alternative to existing immunoassays in enabling affordable, sensitive, robust and specific determination of this toxin. (author)

  8. Lateral-flow colloidal gold-based immunoassay for the rapid detection of deoxynivalenol with two indicator ranges

    International Nuclear Information System (INIS)

    A lateral-flow immunoassay using a colloidal gold-labelled monoclonal antibody was developed for the rapid detection of deoxynivalenol (DON). Different parameters, such as the amount of immunoreagents, type of the materials, composition of the blocking solution and of the detector reagent mixture, were investigated to provide the optimum assay performance. The experimental results demonstrated that such a visual test had an indicator range rather than a cut-off value. Thus, tests for DON determination with two different indicator ranges of 250-500 and 1000-2000 μg kg-1 were designed. The method allowed detection of DON at low and high concentration levels, which could be useful for research and practical purposes. The assay applied to spiked wheat and pig feed samples demonstrated accurate and reproducible results. The applicability of the developed lateral-flow test was also confirmed under real field conditions. The test strips prepared in Belgium were sent to Mexico, where they were used for the screening of DON contamination in different bread wheat entries from Fusarium Head Blight inoculated plots. The results were compared with those obtained by ELISA and LC-MS/MS. A poor correlation between ELISA and LC-MS/MS was observed. Visual results of the dipstick tests were in a good agreement with the results of the LC-MS/MS method. Coupled with a simple and fast sample preparation, this qualitative one-step test based on the visual evaluation of results did not require any equipment. Results could be obtained within 10 min. The described assay format can be used as a simple, rapid, cost-effective and robust on-site screening tool for mycotoxin contamination in different agricultural commodities

  9. Lateral-flow colloidal gold-based immunoassay for the rapid detection of deoxynivalenol with two indicator ranges

    Energy Technology Data Exchange (ETDEWEB)

    Kolosova, Anna Yu. [Laboratory of Food Analysis, Faculty of Pharmaceutical Sciences, Ghent University, Harelbekestraat 72, 9000 Ghent (Belgium)], E-mail: anna_kolosova@hotmail.com; Sibanda, Liberty [TOXI-TEST NV, Industrielaan 9a, 9990 Maldegem (Belgium); Dumoulin, Frederic [Laboratory of Food Analysis, Faculty of Pharmaceutical Sciences, Ghent University, Harelbekestraat 72, 9000 Ghent (Belgium); Lewis, Janet; Duveiller, Etienne [International Maize and Wheat Improvement Center (CIMMYT), Apdo. Postal 6-641, 06600 Mexico, D.F. (Mexico); Van Peteghem, Carlos; Saeger, Sarah de [Laboratory of Food Analysis, Faculty of Pharmaceutical Sciences, Ghent University, Harelbekestraat 72, 9000 Ghent (Belgium)

    2008-06-02

    A lateral-flow immunoassay using a colloidal gold-labelled monoclonal antibody was developed for the rapid detection of deoxynivalenol (DON). Different parameters, such as the amount of immunoreagents, type of the materials, composition of the blocking solution and of the detector reagent mixture, were investigated to provide the optimum assay performance. The experimental results demonstrated that such a visual test had an indicator range rather than a cut-off value. Thus, tests for DON determination with two different indicator ranges of 250-500 and 1000-2000 {mu}g kg{sup -1} were designed. The method allowed detection of DON at low and high concentration levels, which could be useful for research and practical purposes. The assay applied to spiked wheat and pig feed samples demonstrated accurate and reproducible results. The applicability of the developed lateral-flow test was also confirmed under real field conditions. The test strips prepared in Belgium were sent to Mexico, where they were used for the screening of DON contamination in different bread wheat entries from Fusarium Head Blight inoculated plots. The results were compared with those obtained by ELISA and LC-MS/MS. A poor correlation between ELISA and LC-MS/MS was observed. Visual results of the dipstick tests were in a good agreement with the results of the LC-MS/MS method. Coupled with a simple and fast sample preparation, this qualitative one-step test based on the visual evaluation of results did not require any equipment. Results could be obtained within 10 min. The described assay format can be used as a simple, rapid, cost-effective and robust on-site screening tool for mycotoxin contamination in different agricultural commodities.

  10. Heat generation ability in AC magnetic field of nano MgFe{sub 2}O{sub 4}-based ferrite powder prepared by bead milling

    Energy Technology Data Exchange (ETDEWEB)

    Hirazawa, Hideyuki, E-mail: hirazawa@mat.niihama-nct.ac.j [Department of Environmental Materials Engineering, Niihama National College of Technology, Niihama 792-8580 (Japan); Aono, Hiromichi; Naohara, Takashi; Maehara, Tsunehiro [Graduate School of Science and Engineering, Ehime University, Matsuyama 790-8577 (Japan); Sato, Mitsunori [AdMeTech Co. Ltd., 2821-4, Minami-yoshida-cyo, Matsuyama 791-8042 (Japan); Watanabe, Yuji [Department of Surgery, Graduate School of Medicine, Ehime University, Toon 791-0295 (Japan)

    2011-03-15

    Nanosized MgFe{sub 2}O{sub 4}-based ferrite powder having heat generation ability in an AC magnetic field was prepared by bead milling and studied for thermal coagulation therapy applications. The crystal size and the particle size significantly decreased by bead milling. The heat generation ability in an AC magnetic field improved with the milling time, i.e. a decrease in crystal size. However, the heat generation ability decreased for excessively milled samples with crystal sizes of less than 5.5 nm. The highest heat ability ({Delta}T=34 {sup o}C) in the AC magnetic field (370 kHz, 1.77 kA/m) was obtained for fine MgFe{sub 2}O{sub 4} powder having a ca. 6 nm crystal size (the samples were milled for 6-8 h using 0.1 mm {phi} beads). The heat generation of the samples was closely related to hysteresis loss, a B-H magnetic property. The reason for the high heat generation properties of the samples milled for 6-8 h using 0.1 mm {phi} beads was ascribed to the increase in hysteresis loss by the formation of a single domain. Moreover, the improvement in heating ability was obtained by calcination of the bead-milled sample at low temperature. In this case, the maximum heat generation ({Delta}T=41 {sup o}C) ability was obtained for a ca. 11 nm crystal size sample was prepared by crystal growth during the sample calcination. On the other hand, the {Delta}T value for Mg{sub 0.5}Ca{sub 0.5}Fe{sub 2}O{sub 4} was synthesized using a reverse precipitation method decreased by bead milling. - Research highlights: > The crystal and particle size for MgFe{sub 2}O{sub 4} based ferrite were decreased by bead milling. > The highest heat ability was obtained for MgFe{sub 2}O{sub 4} having a ca. 6 nm crystal size. > This high heat generation ability was ascribed to the increase in hysteresis loss. > Hysteresis loss was increased by the formation of a single domain.

  11. Multiplex bead-based immunoassay for the free soluble forms of the HLA-G receptors, ILT2 and ILT4

    DEFF Research Database (Denmark)

    Wu, Ching-Lien; Svendsen, Signe Goul; Riviere, Adrien; Desgrandchamps, François; Carosella, Edgardo D; LeMaoult, Joël

    2016-01-01

    Human leukocyte antigen (HLA)-G is an immune-inhibitory molecule that exerts its function via interaction with two main inhibitory receptors: ILT2 and ILT4. This interaction is considered to be an immune checkpoint. HLA-G can be found as a soluble molecule, but it is not known if its receptors ca...

  12. Performance Improvement of the One-Dot Lateral Flow Immunoassay for Aflatoxin B1 by Using a Smartphone-Based Reading System

    OpenAIRE

    Jihea Moon; Giyoung Kim; Sangdae Lee

    2013-01-01

    This study was conducted to develop a simple, rapid, and accurate lateral flow immunoassay (LFIA) detection method for point-of-care diagnosis. The one-dot LFIA for aflatoxin B1 (AFB1) was based on the modified competitive binding format using competition between AFB1 and colloidal gold-AFB1-BSA conjugate for antibody binding sites in the test zone. A Smartphone-based reading system consisting of a Samsung Galaxy S2 Smartphone, a LFIA reader, and a Smartphone application for the image acquisi...

  13. Fluorescence energy transfer-based multiplexed hybridization assay using gold nanoparticles and quantum dot conjugates on photonic crystal beads

    International Nuclear Information System (INIS)

    A multiplexed assay strategy was developed for the detection of nucleic acid hybridization. It is based on fluorescence resonance energy transfer (FRET) between gold nanoparticles (AuNPs) and multi-sized quantum dots (QDs) deposited on the surface of silica photonic crystal beads (SPCBs). The SPCBs were first coated with a three-layer primer film formed by the alternating adsorption of poly(allylamine hydrochloride) and poly(sodium 4-styren sulfonate). Probe DNA sequences were then covalently attached to the carboxy groups at the surface of the QD-coated SPCBs. On addition of DNA-AuNPs and hybridization, the fluorescence of the donor QDs is quenched because of the close proximity of the AuNPs. However, the addition of target DNA causes a recovery of the fluorescence of the QD-coated SPCBs, thus enabling the quantitative assay of hybridized DNA. Compared to fluorescent dyes acting as acceptors, the use of AuNPs results in much higher quenching efficiency. The multiplexed assay displays a wide linear range, high sensitivity, and very little cross-reactivity. This work, where such SPCBs are used for the first time in a FRET assay, is deemed to present a new and viable approach towards high-throughput multiplexed gene assays. (author)

  14. A novel assay for screening inhibitors targeting HIV-1 integrase dimerization based on Ni-NTA magnetic agarose beads.

    Science.gov (United States)

    Zhang, Dawei; He, Hongqiu; Liu, Mengmeng; Meng, Zhixia; Guo, Shunxing

    2016-01-01

    Human immunodeficiency virus (HIV)-1 integrase (IN), which mediates integration of viral cDNA into the cellular chromosome, is a validated antiviral drug target. Three IN inhibitors, raltegravir, elvitegravir and dolutegravir, have been clinically approved since 2008. However, drug resistance have emerged in infected patients receiving treatment using these drugs which share the same mechanism of action and have a low genetic barrier for resistance. Therefore, there is an urgent need to develop drugs with novel mechanism. IN requires a precise and dynamic equilibrium between several oligomeric species for its activities. The modulation of the process which is termed as IN oligomerization, presents an interesting allosteric target for drug development. In this research, we developed a magnetic beads based approach to assay the IN dimerization. Then, using the assay we screened a library of 1000 Food and Drug Administration (FDA)-approved drugs for IN dimerization inhibitors and identified dexlansoprazole as a potential IN dimerization inhibitor. In conclusion, the assay presented here has been proven to be sensitive and specific for the detection of IN dimerization as well as for the identification of antiviral drugs targeting IN dimerization. Moreover, a FDA-approved proton-pump inhibitors, dexlansoprazole, was identified as a potential inhibitor for IN dimerization. PMID:27137477

  15. Comparative Study of Monoclonal and Recombinant Antibody-Based Immunoassays for Fungicide Analysis in Fruit juices

    OpenAIRE

    Moreno Tamarit, Mª José; PLANA ANDANI, EMMA; Manclus Ciscar, Juan José; Montoya Baides, Ángel

    2014-01-01

    [EN] A comparative study of the analytical performance of enzyme-linked immunosorbent assays (ELISAs), based on monoclonal and recombinant antibodies, for the determination of fungicide residues in fruit juices has been carried out. To this aim, three murine hybridoma cell lines secreting specific monoclonal antibodies against (RS)-2-(2,4-dichlorophenyl)-3-(1H-1,2,4-triazol-1-yl)propyl-1,1,2,2-tetrafluoroethyl ether (tetraconazole), 2-(4-triazolyl)benzimidazole (thiabendazole), and (RS)-1-(be...

  16. Specific and selective electrochemical immunoassay for Pseudomonas aeruginosa based on pectin-gold nano composite.

    Science.gov (United States)

    Krithiga, N; Viswanath, K Balaji; Vasantha, V S; Jayachitra, A

    2016-05-15

    In this report, we have successfully fabricated an immunosensor for detection of Pseudomonas aeruginosa in water. The monoclonal antibody was immobilized on the surface modified with CCLP (Calcium Cross-Linked Pectin)-Au NPs (gold nanoparticles)/Glassy Carbon Electrode. The building of the immunosensor was evaluated in each step by cyclic voltammetry (CV) and impedance spectroscopy (EIS). The electrochemical detection was done based on the anti rabbit IgG HRP (Horseradish Peroxidase) which binds to the immune complex and the response was observed using Hydro Quininone (HQ) and Hydrogen peroxide (H2O2) in PB (Phosphate Buffer) electrolyte. From the results, the sensitivity range is from 10(1) to 10(7)CFU/ml and LOD is calculated as 9×10(2)CFU/ml. The developed immunosensor also have high selectivity, stability, reproducibility and reusability. PMID:26703990

  17. Micromachining microcarrier-based biomolecular encoding for miniaturized and multiplexed immunoassay.

    Science.gov (United States)

    Zhi, Zheng-liang; Morita, Yasutaka; Hasan, Quamrul; Tamiya, Eiichi

    2003-08-15

    Micromachining techniques, which originated in the microelectronics industry, have been employed to manufacture microparticles bearing an engraved dot-type signature for biomolecular encoding. These metallic microstructures are photolithographically defined and manufactured in a highly reproducible manner. In addition, the code introduced on the particle face is a straightforward visible feature that is easily recognizable with the use of optical microscopy. The number of distinct codes theoretically could be many thousands, depending on the coding element numbers. Such microparticles are, thus, with appropriate surface organic functionalizations, ideal for encoding biomolecular libraries and serving as a platform for developing high-throughput multiplexed bioassay schemes based on suspension array technology. As proof of this statement, we demonstrated that encoded microparticles tagged with antibodies to human immunoglobulin classes are capable, using imaging detection as the interrogating approach, of high sensitivity and high specificity, as well as multiplexed detection of the respective antigens in a microliter-sample volume. PMID:14651038

  18. A quantum dot-based immunoassay for screening of tylosin and tilmicosin in edible animal tissues.

    Science.gov (United States)

    Le, Tao; Zhu, Liqian; Yang, Xian

    2015-01-01

    A rapid, indirect competitive fluorescence-linked immunosorbent assay (ic-FLISA) based on quantum dots (QDs) as the fluorescent marker was developed for the detection of tylosin and tilmicosin in edible animal tissues. The end point fluorescent detection system was carried out using QDs conjugated with goat anti-mouse secondary antibody. The limits of detection (LODs) for the determination of tylosin and tilmicosin were 0.02 and 0.04 μg kg(-1), respectively. This detection method was used to analyse spiked samples and the recoveries ranged from 83.5% to 98.7% for tylosin and from 81.8% to 98.2% for tilmicosin. In real porcine tissue sample analysis, the results of ic-FLISA were similar to those obtained from an indirect competitive enzyme-linked immunosorbent assay (ic-ELISA) to an HPLC method indicating its potential for tylosin and tilmicosin screening in edible animal tissues. PMID:25822697

  19. Radiolabelling for immunoassay

    International Nuclear Information System (INIS)

    Since the early 1960s labelled compounds employed in immunoassay techniques, both radioimmunoassay and immunoradiometric assay, have involved radioisotopes typically 3H (tritium) and 125Iodine. With the advent of increasingly stringent governmental regulations regarding usage and disposal of radioisotopes and the impetus of research towards improved immunoassay sensitivity following the discovery of monoclonal antibodies and their application to excess reagent immunometric assay methodology, radioisotopic labels are gradually being replaced by non-isotopic labels: enzyme, fluorescence and chemiluminescence

  20. Development of Immunoassay Based on Monoclonal Antibody Reacted with the Neonicotinoid Insecticides Clothianidin and Dinotefuran

    Directory of Open Access Journals (Sweden)

    Seiji Iwasa

    2012-11-01

    Full Text Available Enzyme-linked immunosorbent assay (ELISA based on a monoclonal antibody (MoAb was developed for the neonicotinoid insecticide clothianidin. A new clothianidin hapten (3-[5-(3-methyl-2-nitroguanidinomethyl-1,3-thiazol-2-ylthio] propionic acid was synthesized and conjugated to keyhole limpet hemocyanin, and was used for monoclonal antibody preparation. The resulting MoAb CTN-16A3-13 was characterized by a direct competitive ELISA (dc-ELISA. The 50% of inhibition concentration value with clothianidin was 4.4 ng/mL, and the working range was 1.5–15 ng/mL. The antibody showed high cross-reactivity (64% to dinotefuran among the structurally related neonicotinoid insecticides. The recovery examinations of clothianidin for cucumber, tomato and apple showed highly agreement with the spiked concentrations; the recovery rate was between 104% and 124% and the coefficient of variation value was between 1.8% and 15%. Although the recovery rate of the dc-ELISA was slightly higher than that of HPLC analysis, the difference was small enough to accept the dc-ELISA as a useful method for residue analysis of clothianidin in garden crops.

  1. Enzyme immunoassay for the detection of group A streptococcal antigen.

    OpenAIRE

    Knigge, K M; Babb, J L; Firca, J R; Ancell, K; Bloomster, T G; Marchlewicz, B A

    1984-01-01

    A competitive inhibition enzyme immunoassay for the detection of Streptococcus pyogenes directly from throat specimens or from solid bacteriological medium is described. Group A-specific polysaccharide adsorbed onto treated polystyrene beads, in conjunction with rabbit antibody to S. pyogenes, was used to determine the presence of the polysaccharide antigen. Inhibition values in excess of 65% were observed with 10(4) or more CFU of S. pyogenes per test. An inhibition of 25% was demonstrated w...

  2. Simple and Sensitive Detection of HBsAg by Using a Quantum Dots Nanobeads Based Dot-Blot Immunoassay

    OpenAIRE

    Zhang, Pengfei; Lu, Huiqi; Chen, Jia; HAN, HUANXING; MA, Wei

    2014-01-01

    Simple and sensitive detection of infectious disease at an affordable cost is urgently needed in developing nations. In this regard, the dot blot immunoassay has been used as a common protein detection method for detection of disease markers. However, the traditional signal reporting systems, such as those using enzymes or gold nanoparticles lack sensitivity and thus restrict the application of these methods for disease detection. In this study, we report a simple and sensitive detection meth...

  3. Evaluation of LIAISON Treponema Screen, a Novel Recombinant Antigen-Based Chemiluminescence Immunoassay for Laboratory Diagnosis of Syphilis

    OpenAIRE

    Marangoni, Antonella; Sambri, Vittorio; Accardo, Silvia; Cavrini, Francesca; D'Antuono, Antonietta; Moroni, Alessandra; Storni, Elisa; Cevenini, Roberto

    2005-01-01

    The purpose of this study was to evaluate the diagnostic performance of LIAISON Treponema Screen (DiaSorin, Saluggia, Italy), a new automated chemiluminescence immunoassay (CLIA), in comparison with that of rapid plasma reagin (RPR) and the following currently used treponemal tests: hemagglutination test (TPHA), immunoenzymatic assay (EIA), and Western blot (WB). First, a retrospective study was performed with a panel of 2,494 blood donor sera, a panel of 131 clinical and serologically charac...

  4. Rapid and simultaneous detection of ricin, staphylococcal enterotoxin B and saxitoxin by chemiluminescence-based microarray immunoassay

    OpenAIRE

    Szkola, A.; Linares, E. M.; Worbs, Sylvia; Dorner, Brigitte; R. Dietrich; Märtlbauer, E.; Niessner, R.; Seidel, Michael

    2014-01-01

    Simultaneous detection of small and large molecules on microarray immunoassays is a challenge that limits some applications in multiplex analysis. This is the case for biosecurity, where fast, cheap and reliable simultaneous detection of proteotoxins and small toxins is needed. Two highly relevant proteotoxins, ricin (60 kDa) and bacterial toxin staphylococcal enterotoxin B (SEB, 30 kDa) and the small phycotoxin saxitoxin (STX, 0.3 kDa) are potential biological warfare agents and require an a...

  5. Polyacrylamide gel electrophoresis of RNA compared with polyclonal- and monoclonal-antibody-based enzyme immunoassays for rotavirus.

    OpenAIRE

    Pacini, D L; Brady, M T; Budde, C T; Connell, M J; Hamparian, V V; Hughes, J. H.

    1988-01-01

    Polyacrylamide gel electrophoresis (PAGE) of rotaviral RNA, a sensitive and highly specific test for detecting rotavirus in stool, was compared with two commercially available enzyme immunoassays (EIAs), monoclonal (Pathfinder) and polyclonal (Rotazyme II). Stool samples from 204 children with nosocomial diarrhea were tested for rotavirus by both EIAs and by PAGE of RNA extracted from raw stools or 10% stool suspensions. Samples which tested positive by either EIA but were negative by PAGE we...

  6. A fast and simple label-free immunoassay based on a smartphone.

    Science.gov (United States)

    Giavazzi, Fabio; Salina, Matteo; Ceccarello, Erica; Ilacqua, Andrea; Damin, Francesco; Sola, Laura; Chiari, Marcella; Chini, Bice; Cerbino, Roberto; Bellini, Tommaso; Buscaglia, Marco

    2014-08-15

    Despite the continuous advancements in bio-molecular detection and fluidic systems integration, the realization of portable and high performance devices for diagnostic applications still presents major difficulties, mostly because of the need to combine adequate sensitivity with low cost of production and operational simplicity and speed. In this context, we propose a compact device composed of a smartphone and a custom-designed cradle, containing only a disposable sensing cartridge, a tiny magnetic stirrer and a few passive optical components. The detection principle is the previously proposed Reflective Phantom Interface that is based on measuring the intensity of light reflected by the surface of an amorphous fluoropolymer substrate, which has a refractive index very close to that of the aqueous sample solution and hosts various antibodies immobilized within spots. The reflectivity of dozens of spots is monitored in real time by the phone׳s camera using the embedded flash LED as the illumination source. We test the performance of the combined device targeting heterologous immunoglobulins and antigens commonly used as markers for diagnoses of hepatitis B and HIV. Target concentrations as low as a few ng/ml can be rapidly and robustly determined by comparing the rate of increase of the signal after the addition of the sample with that measured after the subsequent addition of a standard solution with known concentration. The features of the proposed system enable the realization of novel handheld biosensing devices suitable for those applications where multiple targets have to be rapidly detected even without the presence of trained personnel. PMID:24721381

  7. Isolation of prostate cancer cell subpopulations of functional interest by use of an on-chip magnetic bead-based cell separator

    International Nuclear Information System (INIS)

    This work presents the design, fabrication and characterization of a modular magnetic bead-based cell separation device developed for the sequential sorting of a heterogeneous prostate cancer (CaP) cell population. The chief aim is cell sorting carried out on the basis of surface marker expression, serially selecting cellular subpopulations for capture by the use of antibody-coated magnetic beads. The markers of interest, prostate specific membrane antigen (PSMA) and CD10 were selected for their relevance to ongoing CaP development research. The separation device was fabricated out of plastic, by the use of cyclic olefin copolymer (COC) injection molding, nickel–iron electroplating and thermoplastic fusion bonding. Effective depletion and enrichment of cell subsets based on multiple surface markers was achieved. Various flow rates and incubation times were tested for optimizing the sorting procedure

  8. Theoretical analysis of a new, efficient microfluidic magnetic bead separator based on magnetic structures on multiple length scales

    DEFF Research Database (Denmark)

    Smistrup, Kristian; Bu, Minqiang; Wolff, Anders;

    2008-01-01

    We present a theoretical analysis of a new design for microfluidic magnetic bead separation. It combines an external array of mm-sized permanent magnets with magnetization directions alternating between up and down with mu m-sized soft magnetic structures integrated in the bottom of the separation...... channel. The concept is studied analytically for simple representative geometries and by numerical simulation of an experimentally realistic system geometry. The array of permanent magnets provides long-range magnetic forces that attract the beads to the channel bottom, while the soft magnetic elements...

  9. A protein-protein binding assay using coated microtitre plates: increased throughput, reproducibility and speed compared to bead-based assays.

    Science.gov (United States)

    Craig, Tim J; Ciufo, Leonora F; Morgan, Alan

    2004-07-30

    Protein-protein interactions, and the factors affecting them, are of fundamental importance to all biological systems. Surface plasmon resonance (SPR) and isothermal titration calorimetry (ITR) are powerful methods for assaying such interactions, but are expensive to implement. In contrast, bead-based pull-down assays using affinity tags such as glutathione-S-transferase (GST), require no specialist equipment. As a result, such assays are the most popular method for analysing protein-protein interactions, despite being time-consuming and prone to variability. In respect of these problems, we have modified this form of binding assay, using glutathione-coated 96-well plates rather than glutathione-Sepharose beads to bind the primary bait protein. Quantitation of bound protein utilises ELISA for purified proteins and scintillation counting for in vitro translated proteins, rather than the SDS-PAGE-based detection methods used in traditional bead-based assays. These modifications result in an approximately 10-fold increase in the number of samples that can be assayed daily, and allow results to be obtained within hours as opposed to days. We validate the modified assay by analysing the equilibrium binding of Munc18 and syntaxin, and also demonstrate that association and dissociation kinetics may be measured using this approach. The method we describe is generally applicable to any protein-protein interaction assay based on affinity tags and is amenable to automation, and so should benefit a wide range of biochemical research. PMID:15236910

  10. Near-infrared fluorescence-based multiplex lateral flow immunoassay for the simultaneous detection of four antibiotic residue families in milk.

    Science.gov (United States)

    Chen, Yiqiang; Chen, Qian; Han, Miaomiao; Liu, Jiangyang; Zhao, Peng; He, Lidong; Zhang, Yuan; Niu, Yiming; Yang, Wenjun; Zhang, Liying

    2016-05-15

    In this study, we developed a novel near-infrared fluorescence based multiplex lateral flow immunoassay by conjugating a near-infrared label to broad-specificity monoclonal antibody/receptor as detection complexes. Different antigens were dispensed onto separate test zones of nitrocellulose membrane to serve as capture reagents. This assay format allowed the simultaneous detection of four families of antibiotics (β-lactams, tetracyclines, quinolones and sulfonamides) in milk within 20min. Qualitative and quantitative analysis of target antibiotics were realized by imaging the fluorescence intensity of the near-infrared label captured on respective test lines. For qualitative analysis, the cut-off values of β-lactams, tetracyclines, quinolones and sulfonamides were determined to be 8ng/mL, 2ng/mL, 4ng/mL and 8ng/mL respectively, which were much lower than the conventional gold nanoparticle based lateral flow immunoassay. For quantitative analysis, the detection ranges were 0.26-3.56ng/mL for β-lactams, 0.04-0.98ng/mL for tetracyclines, 0.08-2.0ng/mL for quinolones, and 0.1-3.98ng/mL for sulfonamides, with linear correlation coefficients higher than 0.97. The mean spiked recoveries ranged from 93.7% to 108.2% with coefficient of variations less than 16.3%. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening the four families of antibiotic residues in milk. PMID:26741531

  11. Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

    Science.gov (United States)

    Zhan, Fangfang; Zhou, Xiaoming

    2012-12-01

    Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

  12. On-chip, aptamer-based sandwich assay for detection of glycated hemoglobins via magnetic beads.

    Science.gov (United States)

    Li, Jinglun; Chang, Ko-Wei; Wang, Chih-Hung; Yang, Ching-Hsuan; Shiesh, Shu-Chu; Lee, Gwo-Bin

    2016-05-15

    Diabetes can be diagnosed and monitored by measurement of the cutoff ratio between glycated hemoglobins (HbA1c) and total hemoglobin (Hb), which does not require a fasting blood sample and is less influenced by biological variations. In this study, we combined the advantages of the microfluidic system and the selected low-cost, stable and specific aptamers and developed an integrated, aptamer-based microfluidic system for automatic glycated hemoglobin measurements. The detection process of human whole blood can be totally automated in this integrated microfluidic system. According to the experimental results, when compared to conventional bench-top manual assays, reagent consumption was significantly reduced by 75%, and the analysis time was reduced from 3.5h to 30min. Besides, the novelty in this research also lies in the simultaneously performed two parallel assays for detection of Hb and HbA1c in a single chip. Therefore, this sensitive and low-cost aptamer-based microfluidic system may become a promising tool for point-of -care diagnosis of diabetes. PMID:26797251

  13. Sandwich immunoassay for the hapten angiotensin II. A novel assay principle based on antibodies against immune complexes.

    Science.gov (United States)

    Towbin, H; Motz, J; Oroszlan, P; Zingel, O

    1995-04-26

    Immunoassays for haptens such as short peptides or drugs are usually based on the principle of competition for a limited number of binding sites on antibody molecules. Owing to the small size of these antigens it has been thought that two specific antibodies cannot simultaneously bind a hapten. However, antisera containing so called anti-metatypic antibodies have been reported (Voss et al. (1988) Mol. Immunol. 25, 751-759) that bind to hapten-mAb complexes in a reaction where conformational changes on the primary antibody are important. Here, we report on monoclonal antibody pairs able to form ternary complexes with the octapeptide angiotensin II. The first mAb (mAb1) is conventional and binds angiotensin II with high affinity (Kd 10(-11) M). The secondary (anti-metatypic) mAbs (mAbs2s) recognize the immune complex consisting of angiotensin II bound to mAb1, but only poorly recognize mAb1 alone. An immunization technique involving tolerization with uncomplexed mAb1 was used to generate mAb2s. None of the mAbs2s were able to bind angiotensin II by themselves but all efficiently bound the complex of angiotensin II and mAb1. All mAb2s stabilized the angiotensin II-mAb1 complex and one mAb2 distinctly improved the specificity of the assay for angiotensin II. By either labelling mAb1 and immobilizing mAb2 (or vice versa) two-site immunometric assays with detection limits of 1 pg/ml angiotensin II have been established. The kinetics of the complex formation was investigated by fiber optic biospecific interaction analysis (FOBIA), a system allowing real time observation of binding events on the surface of a glass fiber. The association rate towards the liganded conformation of mAb1 was higher than towards the free mAb1. By contrast, the mAb2s dissociated at similar rates from complexed and uncomplexed mAb1. PMID:7745246

  14. A bead-based fluorescence immunosensing technique enabled by the integration of Förster resonance energy transfer and optoelectrokinetic concentration.

    Science.gov (United States)

    Wang, Jhih-Cheng; Ku, Hu-Yao; Shieh, Dar-Bin; Chuang, Han-Sheng

    2016-01-01

    Bead-based immunosensing has been growing as a promising technology in the point-of-care diagnostics due to great flexibility. For dilute samples, functionalized particles can be used to collect dispersed analytes and act as carriers for particle manipulation. To realize rapid and visual immunosensing, Förster resonance energy transfer (FRET) was used herein to ensure only the diabetic biomarker, lipocalin 1, to be detected. The measurement was made in an aqueous droplet sandwiched between two parallel plate electrodes. With an electric field and a focused laser beam applying on the microchip simultaneously, the immunocomplexes in the droplet were further concentrated to enhance the FRET fluorescent signal. The optoelectrokinetic technique, termed rapid electrokinetic patterning (REP), has been proven to be excellent in dynamic and programmable particle manipulation. Therefore, the detection can be complete within several tens of seconds. The lower detection limit of the REP-enabled bead-based diagnosis reached nearly 5 nM. The combinative use of FRET and the optoelectrokinetic technique for the bead-based immunosensing enables a rapid measure to diagnose early stage diseases and dilute analytes. PMID:26865906

  15. Magnetic/pH-responsive beads based on caboxymethyl chitosan and κ-carrageenan and controlled drug release.

    Science.gov (United States)

    Mahdavinia, Gholam Reza; Etemadi, Hossein; Soleymani, Fatemeh

    2015-09-01

    This paper reports the synthesis of magnetic and pH-sensitive beads derived from κ-carrageenan and carboxymethyl chitosan for drug delivery. The magnetic Fe3O4 nanoparticles were synthesized inside a mixture of biopolymers by in situ method. The structural properties of hydrogel beads were characterized by TEM, SEM, XRD, and VSM techniques. The swelling ratio of beads indicated pH-dependent properties with maximum water absorbing at pH 7.4. Introducing magnetic nanoparticles caused a decrease in swelling capacity from 16.4 to 10 g/g. Drug loading and release efficiency were investigated using diclofenac sodium as a model system. The in vitro drug release studies exhibited significant behaviors on the subject of physiological simulated pHs and external alternative magnetic fields. The maximum cumulative release was around 82% at pH 7.4. The presence of magnetite nanoparticles certainly influenced the drug release patterns. The response of beads to external stimulus makes them as good candidates for novel drug delivery systems. PMID:26005146

  16. Ultrasensitive electrochemical immunoassay for carcinoembryonic antigen based on three-dimensional macroporous gold nanoparticles/graphene composite platform and multienzyme functionalized nanoporous silver label

    International Nuclear Information System (INIS)

    Graphical abstract: Three-dimensional macroporous AuNPs/graphene complex (3D-AuNPs/GN) and functionalized NPS were prepared to immobilize Ab1 and Ab2 respectively and combined to fabricate a sandwich-type ultrasensitive electro-chemical immunosensor for detecting CEA. -- Highlights: •Ultrasensitive electrochemical immunoassay for detecting CEA was developed. •3D-AuNPs/GN was employed as the carrier of primary antibodies. •Multienzyme functionalized nanoporous silver was used as signal enhancer. -- Abstract: Three-dimensional macroporous gold nanoparticles/graphene composites (3D-AuNPs/GN) were synthesized through a simple two-step process, and were used to modify working electrode sensing platform, based on which a facile electrochemical immunoassay for sensitive detection of carcinoembryonic antigen (CEA) in human serum was developed. In the proposed 3D-AuNPs/GN, AuNPs were distributed not just on the surface, but also on the inside of graphene. And this distribution property increased the area of sensing surface, resulting in capturing more primary antibodies as well as improving the electronic transmission rate. In the presence of CEA, a sandwich-type immune composite was formed on the sensing platform, and the horseradish peroxidase-labeled anti-CEA antibody (HRP-Ab2)/thionine/nanoporous silver (HRP-Ab2/TH/NPS) signal label was captured. Under optimal conditions, the electrochemical immunosensor exhibited excellent analytical performance: the detection range of CEA is from 0.001 to 10 ng mL−1 with low detection limit of 0.35 pg mL−1 and low limit of quantitation (LOQ) of 0.85 pg mL−1. The electrochemical immunosensor showed good precision, acceptable stability and reproducibility, and could be used for the detection of CEA in real samples. The proposed method provides a promising platform of clinical immunoassay for other biomolecules

  17. A Magnetic Bead Actuator

    NARCIS (Netherlands)

    Derks, R.; Prins, M.W.J.; Wimberger-Friedl, R.

    2006-01-01

    Actuation principles of superparamagnetic beads applicable on biosensing (at single beads and chain orderning) are studied in this report. This research can be used to develop new techniques that are able to accelerate bio-assays. An experimental setup containing a sub-microliter fluid volume surrou

  18. Magnetic immunoassay coupled with inductively coupled plasma mass spectrometry for simultaneous quantification of alpha-fetoprotein and carcinoembryonic antigen in human serum

    International Nuclear Information System (INIS)

    The absolute quantification of glycoproteins in complex biological samples is a challenge and of great significance. Herein, 4-mercaptophenylboronic acid functionalized magnetic beads were prepared to selectively capture glycoproteins, while antibody conjugated gold and silver nanoparticles were synthesized as element tags to label two different glycoproteins. Based on that, a new approach of magnetic immunoassay-inductively coupled plasma mass spectrometry (ICP-MS) was established for simultaneous quantitative analysis of glycoproteins. Taking biomarkers of alpha-fetoprotein (AFP) and carcinoembryonic antigen (CEA) as two model glycoproteins, experimental parameters involved in the immunoassay procedure were carefully optimized and analytical performance of the proposed method was evaluated. The limits of detection (LODs) for AFP and CEA were 0.086 μg L−1 and 0.054 μg L−1 with the relative standard deviations (RSDs, n = 7, c = 5 μg L−1) of 6.5% and 6.2% for AFP and CEA, respectively. Linear range for both AFP and CEA was 0.2–50 μg L−1. To validate the applicability of the proposed method, human serum samples were analyzed, and the obtained results were in good agreement with that obtained by the clinical chemiluminescence immunoassay. The developed method exhibited good selectivity and sensitivity for the simultaneous determination of AFP and CEA, and extended the applicability of metal nanoparticle tags based on ICP-MS methodology in multiple glycoprotein quantifications. - Highlights: • 4-Mercaptophenylboronic acid functionalized magnetic beads were prepared and characterized. • ICP-MS based magnetic immunoassay approach was developed for quantification of glycoproteins. • AFP and CEA were quantified simultaneously with Au and Ag NPs as element tags. • The developed method exhibited good selectivity and sensitivity for target glycoproteins

  19. Magnetic immunoassay coupled with inductively coupled plasma mass spectrometry for simultaneous quantification of alpha-fetoprotein and carcinoembryonic antigen in human serum

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xing; Chen, Beibei; He, Man; Zhang, Yiwen; Xiao, Guangyang; Hu, Bin, E-mail: binhu@whu.edu.cn

    2015-04-01

    The absolute quantification of glycoproteins in complex biological samples is a challenge and of great significance. Herein, 4-mercaptophenylboronic acid functionalized magnetic beads were prepared to selectively capture glycoproteins, while antibody conjugated gold and silver nanoparticles were synthesized as element tags to label two different glycoproteins. Based on that, a new approach of magnetic immunoassay-inductively coupled plasma mass spectrometry (ICP-MS) was established for simultaneous quantitative analysis of glycoproteins. Taking biomarkers of alpha-fetoprotein (AFP) and carcinoembryonic antigen (CEA) as two model glycoproteins, experimental parameters involved in the immunoassay procedure were carefully optimized and analytical performance of the proposed method was evaluated. The limits of detection (LODs) for AFP and CEA were 0.086 μg L{sup −1} and 0.054 μg L{sup −1} with the relative standard deviations (RSDs, n = 7, c = 5 μg L{sup −1}) of 6.5% and 6.2% for AFP and CEA, respectively. Linear range for both AFP and CEA was 0.2–50 μg L{sup −1}. To validate the applicability of the proposed method, human serum samples were analyzed, and the obtained results were in good agreement with that obtained by the clinical chemiluminescence immunoassay. The developed method exhibited good selectivity and sensitivity for the simultaneous determination of AFP and CEA, and extended the applicability of metal nanoparticle tags based on ICP-MS methodology in multiple glycoprotein quantifications. - Highlights: • 4-Mercaptophenylboronic acid functionalized magnetic beads were prepared and characterized. • ICP-MS based magnetic immunoassay approach was developed for quantification of glycoproteins. • AFP and CEA were quantified simultaneously with Au and Ag NPs as element tags. • The developed method exhibited good selectivity and sensitivity for target glycoproteins.

  20. An ultrasensitive quantum dots fluorescent polarization immunoassay based on the antibody modified Au nanoparticles amplifying for the detection of adenosine triphosphate.

    Science.gov (United States)

    He, Yanlong; Tian, Jianniao; Hu, Kun; Zhang, Juanni; Chen, Sheng; Jiang, Yixuan; Zhao, Yanchun; Zhao, Shulin

    2013-11-13

    In this work, an ultrasensitive fluorescent polarization immunoassay (FPIA) method based on the quantum dot/aptamer/antibody/gold nanoparticles ensemble has been developed for the detection of adenosine triphosphate (ATP). DNA hybridization is formed when ATP is present in the PBS solution containing the DNA-conjugated quantum dots (QDs) and antibody-AuNPs. The substantial sensitivity improvement of the antibody-AuNPs-enhanced method is mainly attributed to the slower rotation of fluorescent unit when QDs-labeled oligonucleotides hybridize with antibody modified the gold nanoparticle. As a result, the fluorescent polarization (FP) values of the system increase significantly. Under the optimal conditions, a linear response with ATP concentration is ranged from 8×10(-12) M to 2.40×10(-4) M. The detection limit reached as low as 1.8 pM. The developed work provides a sensitive and selective immunoassay protocol for ATP detection, which could be applied in more bioanalytical systems. PMID:24176506

  1. Development and potential applications of microarrays based on fluorescent nanocrystal-encoded beads for multiplexed cancer diagnostics

    Science.gov (United States)

    Brazhnik, Kristina; Grinevich, Regina; Efimov, Anton E.; Nabiev, Igor; Sukhanova, Alyona

    2014-05-01

    Advanced multiplexed assays have recently become an indispensable tool for clinical diagnostics. These techniques provide simultaneous quantitative determination of multiple biomolecules in a single sample quickly and accurately. The development of multiplex suspension arrays is currently of particular interest for clinical applications. Optical encoding of microparticles is the most available and easy-to-use technique. This technology uses fluorophores incorporated into microbeads to obtain individual optical codes. Fluorophore-encoded beads can be rapidly analyzed using classical flow cytometry or microfluidic techniques. We have developed a new generation of highly sensitive and specific diagnostic systems for detection of cancer antigens in human serum samples based on microbeads encoded with fluorescent quantum dots (QDs). The designed suspension microarray system was validated for quantitative detection of (1) free and total prostate specific antigen (PSA) in the serum of patients with prostate cancer and (2) carcinoembryonic antigen (CEA) and cancer antigen 15-3 (CA 15-3) in the serum of patients with breast cancer. The serum samples from healthy donors were used as a control. The antigen detection is based on the formation of an immune complex of a specific capture antibody (Ab), a target antigen (Ag), and a detector Ab on the surface of the encoded particles. The capture Ab is bound to the polymer shell of microbeads via an adapter molecule, for example, protein A. Protein A binds a monoclonal Ab in a highly oriented manner due to specific interaction with the Fc-region of the Ab molecule. Each antigen can be recognized and detected due to a specific microbead population carrying the unique fluorescent code. 100 and 231 serum samples from patients with different stages of prostate cancer and breast cancer, respectively, and those from healthy donors were examined using the designed suspension system. The data were validated by comparing with the results of

  2. Simple and sensitive detection of HBsAg by using a quantum dots nanobeads based dot-blot immunoassay.

    Science.gov (United States)

    Zhang, Pengfei; Lu, Huiqi; Chen, Jia; Han, Huanxing; Ma, Wei

    2014-01-01

    Simple and sensitive detection of infectious disease at an affordable cost is urgently needed in developing nations. In this regard, the dot blot immunoassay has been used as a common protein detection method for detection of disease markers. However, the traditional signal reporting systems, such as those using enzymes or gold nanoparticles lack sensitivity and thus restrict the application of these methods for disease detection. In this study, we report a simple and sensitive detection method for the detection of infectious disease markers that couples the dot-blot immunoassay with quantum dots nanobeads (QDNBs) as a reporter. First, the QDNBs were prepared by an oil-in-water emulsion-evaporation technique. Because of the encapsulation of several QDs in one particle, the fluorescent signal of reporter can be amplified with QDNBs in a one-step test and be read using a UV lamp obviating the need for complicated instruments. Detection of disease-associated markers in complex mixture is possible, which demonstrates the potential of developing QDNBs into a sensitive diagnostic kit. PMID:24505238

  3. Aptamer-based microfluidic beads array sensor for simultaneous detection of multiple analytes employing multienzyme-linked nanoparticle amplification and quantum dots labels.

    Science.gov (United States)

    Zhang, He; Hu, Xinjiang; Fu, Xin

    2014-07-15

    This study reports the development of an aptamer-mediated microfluidic beads-based sensor for multiple analytes detection and quantification using multienzyme-linked nanoparticle amplification and quantum dots labels. Adenosine and cocaine were selected as the model analytes to validate the assay design based on strand displacement induced by target-aptamer complex. Microbeads functionalized with the aptamers and modified electron rich proteins were arrayed within a microfluidic channel and were connected with the horseradish peroxidases (HRP) and capture DNA probe derivative gold nanoparticles (AuNPs) via hybridization. The conformational transition of aptamer induced by target-aptamer complex contributes to the displacement of functionalized AuNPs and decreases the fluorescence signal of microbeads. In this approach, increased binding events of HRP on each nanosphere and enhanced mass transport capability inherent from microfluidics are integrated for enhancing the detection sensitivity of analytes. Based on the dual signal amplification strategy, the developed aptamer-based microfluidic bead array sensor could discriminate as low as 0.1 pM of adenosine and 0.5 pM cocaine, and showed a 500-fold increase in detection limit of adenosine compared to the off-chip test. The results proved the microfluidic-based method was a rapid and efficient system for aptamer-based targets assays (adenosine (0.1 pM) and cocaine (0.5 pM)), requiring only minimal (microliter) reagent use. This work demonstrated the successful application of aptamer-based microfluidic beads array sensor for detection of important molecules in biomedical fields. PMID:24534576

  4. Improved Peak Capacity for Capillary Electrophoretic Separations of Enzyme Inhibitors with Activity-Based Detection Using Magnetic Bead Microreactors

    OpenAIRE

    Yan, Xiaoyan; Gilman, S. Douglass

    2010-01-01

    A technique for separating and detecting enzyme inhibitors was developed using capillary electrophoresis with an enzyme microreactor. The on-column enzyme microreactor was constructed using NdFeB magnet(s) to immobilize alkaline phosphatase-coated superparamagnetic beads (2.8 μm diameter) inside a capillary before the detection window. Enzyme inhibition assays were performed by injecting a plug of inhibitor into a capillary filled with the substrate, AttoPhos. Product generated in the enzyme ...

  5. Microfluidic bead-based multienzyme-nanoparticle amplification for detection of circulating tumor cells in the blood using quantum dots labels

    International Nuclear Information System (INIS)

    Graphical abstract: A microfluidic beads-based nucleic acid sensor for sensitive detection of circulating tumor cells (CTCs) in the blood using multienzyme-nanoparticle amplification and quantum dots labels was developed. The chip-based CTCs analysis could detect reverse transcription-polymerase chain reaction (RT-PCR) products of tumor cell as low as 1 tumor cell (e.g. CEA expressing cell) in 1 mL blood sample. This microfluidic beads-based nucleic acid sensor is a promising platform for disease-related nucleic acid molecules at the lowest level at their earliest incidence. -- Highlights: •Combination of microfluidic bead-based platform and enzyme–probe–AuNPs is proposed. •The developed nucleic acid sensor could respond to 5 fM of tumor associated DNA. •Microfluidic platform and multienzyme-labeled AuNPs greatly enhanced sensitivity. •The developed nucleic acid sensor could respond to RT-PCR products of tumor cell as low as 1 tumor cell in 1 mL blood sample. •We report a sensitive nucleic acid sensor for detection of circulating tumor cells. -- Abstract: This study reports the development of a microfluidic bead-based nucleic acid sensor for sensitive detection of circulating tumor cells in blood samples using multienzyme-nanoparticle amplification and quantum dot labels. In this method, the microbeads functionalized with the capture probes and modified electron rich proteins were arrayed within a microfluidic channel as sensing elements, and the gold nanoparticles (AuNPs) functionalized with the horseradish peroxidases (HRP) and DNA probes were used as labels. Hence, two signal amplification approaches are integrated for enhancing the detection sensitivity of circulating tumor cells. First, the large surface area of Au nanoparticle carrier allows several binding events of HRP on each nanosphere. Second, enhanced mass transport capability inherent from microfluidics leads to higher capture efficiency of targets because continuous flow within micro

  6. Microfluidic bead-based multienzyme-nanoparticle amplification for detection of circulating tumor cells in the blood using quantum dots labels

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, He, E-mail: mzhang_he@126.com; Fu, Xin; Hu, Jiayi; Zhu, Zhenjun

    2013-05-24

    Graphical abstract: A microfluidic beads-based nucleic acid sensor for sensitive detection of circulating tumor cells (CTCs) in the blood using multienzyme-nanoparticle amplification and quantum dots labels was developed. The chip-based CTCs analysis could detect reverse transcription-polymerase chain reaction (RT-PCR) products of tumor cell as low as 1 tumor cell (e.g. CEA expressing cell) in 1 mL blood sample. This microfluidic beads-based nucleic acid sensor is a promising platform for disease-related nucleic acid molecules at the lowest level at their earliest incidence. -- Highlights: •Combination of microfluidic bead-based platform and enzyme–probe–AuNPs is proposed. •The developed nucleic acid sensor could respond to 5 fM of tumor associated DNA. •Microfluidic platform and multienzyme-labeled AuNPs greatly enhanced sensitivity. •The developed nucleic acid sensor could respond to RT-PCR products of tumor cell as low as 1 tumor cell in 1 mL blood sample. •We report a sensitive nucleic acid sensor for detection of circulating tumor cells. -- Abstract: This study reports the development of a microfluidic bead-based nucleic acid sensor for sensitive detection of circulating tumor cells in blood samples using multienzyme-nanoparticle amplification and quantum dot labels. In this method, the microbeads functionalized with the capture probes and modified electron rich proteins were arrayed within a microfluidic channel as sensing elements, and the gold nanoparticles (AuNPs) functionalized with the horseradish peroxidases (HRP) and DNA probes were used as labels. Hence, two signal amplification approaches are integrated for enhancing the detection sensitivity of circulating tumor cells. First, the large surface area of Au nanoparticle carrier allows several binding events of HRP on each nanosphere. Second, enhanced mass transport capability inherent from microfluidics leads to higher capture efficiency of targets because continuous flow within micro

  7. Microfluidic bead-based multienzyme-nanoparticle amplification for detection of circulating tumor cells in the blood using quantum dots labels.

    Science.gov (United States)

    Zhang, He; Fu, Xin; Hu, Jiayi; Zhu, Zhenjun

    2013-05-24

    This study reports the development of a microfluidic bead-based nucleic acid sensor for sensitive detection of circulating tumor cells in blood samples using multienzyme-nanoparticle amplification and quantum dot labels. In this method, the microbeads functionalized with the capture probes and modified electron rich proteins were arrayed within a microfluidic channel as sensing elements, and the gold nanoparticles (AuNPs) functionalized with the horseradish peroxidases (HRP) and DNA probes were used as labels. Hence, two signal amplification approaches are integrated for enhancing the detection sensitivity of circulating tumor cells. First, the large surface area of Au nanoparticle carrier allows several binding events of HRP on each nanosphere. Second, enhanced mass transport capability inherent from microfluidics leads to higher capture efficiency of targets because continuous flow within micro-channel delivers fresh analyte solution to the reaction site which maintains a high concentration gradient differential to enhance mass transport. Based on the dual signal amplification strategy, the developed microfluidic bead-based nucleic acid sensor could discriminate as low as 5 fM (signal-to-noise (S/N)3) of synthesized carcinoembryonic antigen (CEA) gene fragments and showed a 1000-fold increase in detection limit compared to the off-chip test. In addition, using spiked colorectal cancer cell lines (HT29) in the blood as a model system, the detection limit of this chip-based approach was found to be as low as 1 HT29 in 1 mL blood sample. This microfluidic bead-based nucleic acid sensor is a promising platform for disease-related nucleic acid molecules at the lowest level at their earliest incidence. PMID:23663673

  8. Mass spectrometric immunoassay

    Science.gov (United States)

    Nelson, Randall W; Williams, Peter; Krone, Jennifer Reeve

    2007-12-04

    Rapid mass spectrometric immunoassay methods for detecting and/or quantifying antibody and antigen analytes utilizing affinity capture to isolate the analytes and internal reference species (for quantification) followed by mass spectrometric analysis of the isolated analyte/internal reference species. Quantification is obtained by normalizing and calibrating obtained mass spectrum against the mass spectrum obtained for an antibody/antigen of known concentration.

  9. In-bead screening

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to screening of one-bead-one-compound (OBOC) combinatorial libraries which is useful for the discovery of compounds displaying molecular interactions with a biological or a physicochemical system, such as substrates and inhibitors of enzymes and the like. The invention...... provides a method for screening a library of compounds for their interaction with a physico- chemical or biological system and a corresponding kit for performing the method of screening a one-bead-one-compound library of compounds....

  10. Superparamagnetic bead interactions with functionalized surfaces characterized by an immunomicroarray

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Hansen, Mikkel Fougt; Moresco, Jacob Lange;

    2010-01-01

    Magneto-resistive sensors capable of detecting superparamagnetic micro-/nano-sized beads are promising alternatives to standard diagnostic assays based on absorbance or fluorescence and streptavidin-functionalized beads are widely used as an integral part of these sensors. Here we have developed an...... SiO2 performed better than polyethylene glycol-modified surfaces Two beads, Masterbeads and M-280 beads, were found to give superior results compared with other bead types. Antibody/ antigen interactions, Illustrated by C-reactive protein, were best performed with Masterbeads The results provide...... important information concerning the surface binding properties of streptavidin-functionalized beads and the immunomicroarray can be used when optimizing the performance of bead-based biosensors....

  11. Ca2+-Regulated Photoproteins: Effective Immunoassay Reporters

    Directory of Open Access Journals (Sweden)

    Ludmila A. Frank

    2010-12-01

    Full Text Available Ca2+-regulated photoproteins of luminous marine coelenterates are of interest and a challenge for researchers as a unique bioluminescent system and as a promising analytical instrument for both in vivo and in vitro applications. The proteins are comprehensively studied as to biochemical properties, tertiary structures, bioluminescence mechanism, etc. This knowledge, along with available recombinant proteins serves the basis for development of unique bioluminescent detection systems that are “self-contained”, triggerable, fast, highly sensitive, and non-hazardous. In the paper, we focus on the use of photoproteins as reporters in binding assays based on immunological recognition element—bioluminescent immunoassay and hybridization immunoassay, their advantages and prospects.

  12. X-Aptamers: A bead-based selection method for random incorporation of drug-like moieties onto next-generation aptamers for enhanced binding

    OpenAIRE

    He, WeiGuo; Elizondo-Riojas, Miguel-Angel; LI, XIN; Lokesh, Ganesh Lakshmana Rao; Somasunderam, Anoma; Thiviyanathan, Varatharasa; Volk, David E.; Durland, Ross H.; Englehardt, Johnnie; Cavasotto, Claudio N.; Gorenstein, David G.

    2012-01-01

    By combining pseudo-random bead-based aptamer libraries with conjugation chemistry, we have created next-generation aptamers, X-aptamers (XAs). Several X ligands can be added in a directed or random fashion to the aptamers to further enhance their binding affinities to the target proteins. Here we describe the addition of a drug (N-acetyl-2,3-dehydro-2-deoxyneuraminic acid) demonstrated to bind to CD44-HABD, to a complete monothioate backbone substituted aptamer to increase its binding affini...

  13. A robust quantitative solid phase immunoassay for the acute phase protein C-reactive protein (CRP) based on cytidine 5 '-diphosphocholine coupled dendrimers

    DEFF Research Database (Denmark)

    Heegaard, Peter M. H.; Pedersen, H. G.; Jensen, A. L.; Boas, Ulrik

    2009-01-01

    C-reactive protein (CRP) is an important acute phase protein, being used as a sensitive indicator of inflammation and infection and is also associated with the risk of cardiovascular problems. The present paper describes a robust and sensitive ELISA for CRP, based on the affinity of CRP for...... phosphocholine. In this design synthetic globular polymers (dendrimers) are used as scaffolds for the multivalent display of phosphocholine molecules. CRP present in a sample binds to the phosphocholine moiety presented at high density in the coating layer and is detectable by specific antibodies. The ELISA was...... applied to determination of pig and human CRP using commercially available antibodies against human CRP. The assay was shown to be more sensitive than previously published immunoassays employing albumin-coupled cytidine diphosphocholine. The coating was stable for at least 30 days at room temperature and...

  14. Clinical test on circulating tumor cells in peripheral blood of lung cancer patients, based on novel immunomagnetic beads.

    Science.gov (United States)

    Wang, Bo; Wang, Bin; Zhang, Daoyun; Guo, Hongyin; Zhang, Lianbin; Zhou, Wenpeng

    2016-05-01

    This paper aims to establish a novel and highly sensitive method to detect circulating tumor cells (CTCs) in the peripheral blood of patients with lung cancer. This therefore enables the discovery of invisible micrometastasis in the early stage of lung cancer, leading to better prognostic assessments of lung cancer and detection of the post-operative tumor recurrence and metastasis, treatment options, and evaluation of curative effects. In this research study, various lung cancer cells were mixed with adult blood samples to simulate blood samples of tumor patients. With novel test methods, CTCs in peripheral blood of lung cancer patients were calculated, after the reaction between the cells obtained from the mix and EpCAM (epithelial cell adhesion molecule) antibodies which were marked by immunomagnetic beads. The results showed that 18 out of 42 (42.9%) lung cancer patients had a positive CTCs, which increased with tumor enlargement or metastasis. CTCs were not detected in a total of 20 blood samples from healthy volunteers. This indicated that the technology of novel immunomagnetic bead-enrichment could effectively separate and identify CTCs in peripheral blood of lung cancer patients, which is of great clinical value for prognostic assessments and treatment guidance of lung cancer. PMID:25682839

  15. Chemiluminescence immunoassay for chloramphenicol

    International Nuclear Information System (INIS)

    A simple, solid-phase chemiluminescence immunoassay (CLIA) for the measurement of Chloramphenicol(CAP) in foodstuffs is described. A rabbit anti-CAP IgG is passively adsorbed onto the walls of polypropylene plates. The labeled conjugant is horseradish peroxidase(HRP) conjugate of CAP. Luminol solution is used as the substrate of HRP. The light yield is inversely proportional to the concentration of CAP. The method has a similar sensitivity (0.05 ng/mL), specificity, precision, and accuracy to a conventional enzyme immunoassay (EIA). The intra-assay and inter-assay CVs of ten samples were <8 and <20%, respectively, and the analytical recovery of the method was 87% 100%. The experimental correlation coefficient of dilution was found to be 0.999 using milk supernatant as buffer. The assay range for the method was 0.1-10 ng/mL, and it displayed good linearity. (authors)

  16. Simultaneous detection of forbidden chemical residues in milk using dual-label time-resolved reverse competitive chemiluminescent immunoassay based on amine group functionalized surface.

    Directory of Open Access Journals (Sweden)

    Dongdong Zhang

    Full Text Available In this study, a sensitive dual-label time-resolved reverse competitive chemiluminescent immunoassay was developed for simultaneous detection of chloramphenicol (CAP and clenbuterol (CLE in milk. The strategy was performed based on the distinction of the kinetic characteristics of horseradish peroxidase (HRP and alkaline phosphatase (ALP in chemiluminesecence (CL systems and different orders of magnitude in HRP CL value for CAP and ALP CL value for CLE in the chemiluminescent immunoassay. Capture antibodies were covalently bound to the amine group functionalized chemiluminescent microtiter plate (MTP for efficient binding of detection antibodies for the enzymes labeled CAP (HRP-CAP and CLE (ALP-CLE. The CL signals were recorded at different time points by the automatic luminometers with significant distinction in the dynamic curves. When we considered the ALP CL value (about 10(5 of CLE as background for HRP CL signal value (about 10(7 of CAP, there was no interaction from ALP CL background of CLE and the differentiation of CAP and CLE can be easily achieved. The 50% inhibition concentration (IC50 values of CAP and CLE in milk samples were 0.00501 µg L(-1 and 0.0128 µg L(-1, with the ranges from 0.0003 µg L(-1 to 0.0912 µg L(-1 and from 0.00385 µg L(-1 to 0.125 µg L(-1, respectively. The developed method is more sensitive and of less duration than the commercial ELISA kits, suitable for simultaneous screening of CAP and CLE.

  17. Electrochemical Sandwich Immunoassay for the Ultrasensitive Detection of Human MUC1 Cancer Biomarker

    Directory of Open Access Journals (Sweden)

    Zahra Taleat

    2013-01-01

    Full Text Available A new electrochemical sandwich immunoassay for the ultrasensitive detection of human MUC1 cancer biomarker using protein G-functionalized magnetic beads (MBs and graphite-based screen-printed electrodes (SPEs was developed. Magnetic beads were employed as the platforms for the immobilization and immunoreaction process. A pair of primary and secondary antibodies was used to capture the MUC1 protein. After labeling with a third antibody conjugated with horseradish peroxidase (HRP, the resulting conjugate was trapped at the surface of the graphite-based SPEs and MUC1 determination was carried out by differential pulse voltammetry (DPV at 0.4 V upon H2O2 addition using acetaminophen (APAP as the redox mediator. A linear relationship was obtained for the detection of human MUC1 over a range of 0–25 ppb with the lowest detection limit of 1.34 ppb when HRP was applied as a label. Preliminary experiments were performed using disposable electrochemical sensors in order to optimize some parameters (i.e., incubation times, concentrations, and blocking agent.

  18. Method of immunoassay

    International Nuclear Information System (INIS)

    The invention relates to a method of immunoassay for prolactin using monoclonal lgG antibodies. The method preferably comprises the use of two different monoclonal antibodies which bind respectively at different antigenic sites on the prolactin molecule. One antibody is labelled and the other is immobilised on a water-insoluble carrier material, whereby an immunochemical complex comprising labelled antibody, prolactin and immobilised antibody is formed. (author)

  19. A Highly Selective and Sensitive Fluorescence Detection Method of Glyphosate Based on an Immune Reaction Strategy of Carbon Dot Labeled Antibody and Antigen Magnetic Beads.

    Science.gov (United States)

    Wang, Duo; Lin, Bixia; Cao, Yujuan; Guo, Manli; Yu, Ying

    2016-08-01

    A sensitive fluorescence detection method for glyphosate (GLY) was established based on immune reaction. First, carbon dot labeled antibodies (lgG-CDs) which were able to specifically identify glyphosate were prepared with the environmentally friendly carbon dots (CDs) and glyphosate antibody (lgG). lgG-CDs could be used to in situ visualize the distribution of glyphosate in plant tissues. In order to eliminate the effects of excess lgG-CDs on the determination of GLY, antigen magnetic beads Fe3O4-GLY based on magnetic nanoparticles Fe3O4 and glyphosate were constructed and utilized to couple with the excess lgG-CDs. After magnetic separation to remove antigen magnetic beads, there was a linear relationship between the fluorescence intensity of lgG-CDs and the logarithmic concentration of glyphosate in the range of 0.01-80 μg/mL with a detection limit of 8 ng/mL. The method was used for the detection of glyphosate in Pearl River water, tea, and soil samples with satisfactory recovery ratio between 87.4% and 103.7%. PMID:27403652

  20. An enzyme-free and resettable platform for the construction of advanced molecular logic devices based on magnetic beads and DNA.

    Science.gov (United States)

    Zhang, Siqi; Wang, Kun; Huang, Congcong; Li, Zhenyu; Sun, Ting; Han, De-Man

    2016-08-25

    A series of multiple logic circuits based on magnetic beads and DNA are constructed to perform resettable nonarithmetic functions, including a digital comparator, 4-to-2 encoder and 2-to-3 decoder, 2-to-1 encoder and 1-to-2 decoder. The signal reporter is composed of a G-quadruplex/NMM complex and a AuNP-surface immobilized molecular beacon. It is the first time that the designed DNA-based nonarithmetic nanodevices can share the same DNA platform with a reset function, which has great potential application in information processing at the molecular level. Another novel feature of the designed system is that the developed nanodevices are operated on a simple DNA/magnetic bead platform and share a constant threshold setpoint without the assistance of any negative logic conversion. The reset function is realized by heating the output system and the magnetic separation of the computing modules. Due to the biocompatibility and design flexibility of DNA, these investigations may provide a new route towards the development of resettable advanced logic circuits in biological and biomedical fields. PMID:27524500

  1. Early Diagnosis of Irkut Virus Infection Using Magnetic Bead-Based Serum Peptide Profiling by MALDI-TOF MS in a Mouse Model

    Directory of Open Access Journals (Sweden)

    Nan Li

    2014-03-01

    Full Text Available Early diagnosis is important for the prompt post-exposure prophylaxis of lyssavirus infections. To diagnose Irkut virus (IRKV infection during incubation in mice, a novel method using magnetic bead-based serum peptide profiling by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS has been established. For this test, serum peptides were concentrated by adsorption to and elution from the magnetic bead-based weak cation ion exchanger. Mass spectrograms obtained by MALDI-TOF MS were analyzed using ClinProTools bioinformatics software. Construction of the diagnostic model was performed using serum samples from mice infected with IRKV and rabies virus (RABV BD06, Flury-LEP, and SRV9 (as controls. The method accurately diagnosed sera 2, 4 and 8 days after IRKV and RABV infections. The sensitivity, specificity, and total accuracy of diagnosis were 86.7%, 95.2%, and 92.9%, respectively. However, IRKV could not be differentiated from RABV 1 day after infection. The results of the present study indicate that serum peptide profiling by MALDI-TOF MS is a promising technique for the early clinical diagnosis of lyssavirus infections and needs to be further tested in humans and farm animals.

  2. Early diagnosis of Irkut virus infection using magnetic bead-based serum peptide profiling by MALDI-TOF MS in a mouse model.

    Science.gov (United States)

    Li, Nan; Liu, Ye; Hao, Zhuo; Zhang, Shoufeng; Hu, Rongliang; Li, Jiping

    2014-01-01

    Early diagnosis is important for the prompt post-exposure prophylaxis of lyssavirus infections. To diagnose Irkut virus (IRKV) infection during incubation in mice, a novel method using magnetic bead-based serum peptide profiling by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been established. For this test, serum peptides were concentrated by adsorption to and elution from the magnetic bead-based weak cation ion exchanger. Mass spectrograms obtained by MALDI-TOF MS were analyzed using ClinProTools bioinformatics software. Construction of the diagnostic model was performed using serum samples from mice infected with IRKV and rabies virus (RABV) BD06, Flury-LEP, and SRV9 (as controls). The method accurately diagnosed sera 2, 4 and 8 days after IRKV and RABV infections. The sensitivity, specificity, and total accuracy of diagnosis were 86.7%, 95.2%, and 92.9%, respectively. However, IRKV could not be differentiated from RABV 1 day after infection. The results of the present study indicate that serum peptide profiling by MALDI-TOF MS is a promising technique for the early clinical diagnosis of lyssavirus infections and needs to be further tested in humans and farm animals. PMID:24670473

  3. A High-Performance Fluorescence Immunoassay Based on the Relaxation of Quenching, Exemplified by Detection of Cardiac Troponin I

    Directory of Open Access Journals (Sweden)

    Seung-Wan Kim

    2016-05-01

    Full Text Available The intramolecular fluorescence self-quenching phenomenon is a major drawback in developing high-performance fluorometric biosensors which use common fluorophores as signal generators. We propose two strategies involving liberation of the fluorescent molecules by means of enzymatic fragmentation of protein or dehybridization of double-stranded DNA. In the former, bovine serum albumin (BSA was coupled with the fluorescent BODIPY dye (Red BSA, and then immobilized on a solid surface. When the insolubilized Red BSA was treated with proteinase K (10 units/mL for 30 min, the fluorescent signal was significantly increased (3.5-fold compared to the untreated control. In the second case, fluorophore-tagged DNA probes were linked to gold nanoparticles by hybridization with capture DNA strands densely immobilized on the surface. The quenched fluorescence signal was recovered (3.7-fold by thermal dehybridization, which was induced with light of a specific wavelength (e.g., 530 nm for less than 1 min. We next applied the Red BSA self-quenching relaxation technique employing enzymatic fragmentation to a high-performance immunoassay of cardiac troponin I (cTnI in a microtiter plate format. The detection limit was 0.19 ng/mL cTnI, and the fluorescent signal was enhanced approximately 4.1-fold compared with the conventional method of direct measurement of the fluorescent signal from a non-fragmented fluorophore-labeled antibody.

  4. A miniaturized germanium-doped silicon dioxide-based surface plasmon resonance waveguide sensor for immunoassay detection.

    Science.gov (United States)

    Huang, Jhen-Gang; Lee, Chen-Lung; Lin, Hsueh-Min; Chuang, Tsung-Liang; Wang, Way-Seen; Juang, Rong-Huey; Wang, Ching-Ho; Lee, Chih Kung; Lin, Shi-Ming; Lin, Chii-Wann

    2006-10-15

    A surface plasmon resonance (SPR) waveguide immunosensor fabricated by germanium-doped silicon dioxide was investigated in this study. The designed waveguide sensor consisted of a 10 microm SiO(2) substrate layer (n=1.469), a 10 microm Ge-SiO(2) channel guide (n=1.492) and a 50 nm gold film layer for immobilization of biomolecules and SPR signal detection. The resultant spectral signal was measured by a portable spectrophotometer, where the sensor was aligned by a custom-designed micro-positioner. The results of the glycerol calibration standards showed that the resonance wavelength shifted from 628 to 758 nm due to changes of refractive index from 1.36 to 1.418. Flow-through immunoassay on waveguide sensors also showed the interactions of protein A, monoclonal antibody (mAb ALV-J) and avian leucosis virus (ALVs) resulted in wavelength shifting of 4.17, 3.03 and 2.18 nm, respectively. The SPR dynamic interaction could also be demonstrated successfully in 4 min as the sensor was integrated with a lateral flow nitrocellulose strip. These results suggest that SPR detection could be carried out on designed waveguide sensor, and the integration of nitrocellulose strip for sample filtering and fluid carrier would facilitate applications in point-of-care portable system. PMID:16962763

  5. A new strategy for label-free electrochemical immunoassay based on "gate-effect" of β-cyclodextrin modified electrode.

    Science.gov (United States)

    Deng, Huan; Li, Jianping; Zhang, Yun; Pan, Hongcheng; Xu, Guobao

    2016-07-01

    A novel label-free electrochemical immunoassay was developed for prostate-specific antigen (PSA) detection via using β-cyclodextrin (β-CD) assembled layer created gates for the electron transfer of probe. To construct the sensor, a gold electrode was self-assembled with monoclonal anti-PSA antibody labeled 6-mercapto-β-cyclodextrin. Interspaces among β-CD molecules in the layer were automatically formed on gold electrode, which act as the channel of the electron transfer of [Fe(CN)6](3-/4-) probe. When PSA bind with anti-PSA, it can block these channels on the electrode surface due to their steric hindrance effect, resulting in the decrease in redox current of the probe. Through such a gate-controlled effect, ultra trace amount of PSA may make the currents change greatly after the immunoreaction, which enhanced the signal-to-noise ratio to achieve the amplification effect. By evaluating the logarithm of PSA concentrations, the immunosensor had a good linear response to the current changes with a detection limit of 0.3 pg/mL (S/N = 3) when PSA concentration ranged from 1.0 pg/mL to 1.0 ng/mL. The label-free immunosensor exhibited satisfactory performances in sensitivity, repeatability as well as specificity. PMID:27216392

  6. Strip-based immunoassay for the simultaneous detection of the neonicotinoid insecticides imidacloprid and thiamethoxam in agricultural products.

    Science.gov (United States)

    Xu, Ting; Xu, Qi Gong; Li, Hao; Wang, Jia; Li, Qing X; Shelver, Weilin L; Li, Ji

    2012-11-15

    A semiquantitative strip immunoassay was developed for the rapid detection of imidacloprid and thiamethoxam in agricultural products using specific nanocolloidal gold-labeled monoclonal antibodies. The conjugates of imidacloprid-BSA, thiamethoxam-BSA and goat anti-mouse IgG were coated on the nitro-cellulose membrane of the strip, serving as test lines and control line, respectively. The flow of the complexes of gold labeled antibodies and insecticides along the strip resulted in intensive color formed on the test lines inversely proportional to the concentrations of imidacloprid and thiamethoxam. The visual detection limits of imidacloprid and thiamethoxam in assay buffer were 0.5 and 2 ng mL(-1), respectively. Matrix interference of cucumber, tomato, lettuce, apple, and orange on the strip assay could be eliminated by diluting sample extracts with assay buffer. The strip analysis of imidacloprid and thiamethoxam in these samples was compared to liquid chromatography-mass spectrometry and the results were in good agreement. The strip was stable for storage more than 5 months at 4 °C. The strip assay is a rapid and simple method for the simultaneous screening of imidacloprid and thiamethoxam in agricultural products. PMID:23158295

  7. One-step detection of pathogens and cancer biomarkers by the naked eye based on aggregation of immunomagnetic beads

    Science.gov (United States)

    Chen, Yiping; Xianyu, Yunlei; Sun, Jiashu; Niu, Yajing; Wang, Yu; Jiang, Xingyu

    2015-12-01

    This report shows that immunomagnetic beads (IMBs) can act as the optical readout for assays, in addition to serving as the carrier for purification/separation. Under the influence of an external magnet, IMBs are attracted to coat one side of a test tube. IMBs specifically bound to targets can form a narrow brown stripe, whereas free IMBs will form a diffuse, yellow coating on the side of the test tube. Target analytes can aggregate initially dispersed IMBs in a sample concentration-dependent manner, yielding a color change from yellow to brown that can be seen with the naked eye. This assay combines the convenience of a lateral flow assay, allowing a one-step assay to finish within 15 min, with the sensitivity of an enzyme-linked immonosorbent assay.This report shows that immunomagnetic beads (IMBs) can act as the optical readout for assays, in addition to serving as the carrier for purification/separation. Under the influence of an external magnet, IMBs are attracted to coat one side of a test tube. IMBs specifically bound to targets can form a narrow brown stripe, whereas free IMBs will form a diffuse, yellow coating on the side of the test tube. Target analytes can aggregate initially dispersed IMBs in a sample concentration-dependent manner, yielding a color change from yellow to brown that can be seen with the naked eye. This assay combines the convenience of a lateral flow assay, allowing a one-step assay to finish within 15 min, with the sensitivity of an enzyme-linked immonosorbent assay. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07044a

  8. A half-ring GMR sensor for detection of magnetic beads immobilized on a circular micro-trap

    KAUST Repository

    Gooneratne, Chinthaka Pasan

    2011-11-01

    Utilizing magnetic principles in biological immunoassays is an attractive option given its ability to remotely and non-invasively manipulate and detect cells tagged with micro/nano size superparamagnetic type beads and due to the fact that even the most complex biological immunoassays will have very little magnetic effect. The presence of magnetic beads can be detected by a magnetic sensor which quantifies the amount of target cells present in the immunoassay. In order to increase the detection rate a circular conducting micro-trap is employed to attract, trap and transport the magnetic beads to the sensing area. In this research we propose a half-ring spin valve type giant magnetoresistance (GMR) sensor for the measurement of stray fields produced by 2 μm magnetic beads which are around the circular micro-trap. A couple of half-ring GMR sensors can be used to cover the entire circular border width, in order to detect the majority of the immobilized magnetic beads. Analytical and numerical analysis leading towards the fabrication of the half-ring GMR sensor are presented. DC characterization of the fabricated sensor showed a magnetoresistance of 5.9 %. Experimental results showed that the half-ring GMR sensor detected the presence of 2 μm magnetic beads. Hence, half-ring GMR sensors integrated with a circular micro-trap have great potential to be used as an effective disease diagnostic device. © 2011 IEEE.

  9. A photoacoustic immunoassay for biomarker detection.

    Science.gov (United States)

    Zhao, Yunfei; Cao, Mingfeng; McClelland, John F; Shao, Zengyi; Lu, Meng

    2016-11-15

    Challenges in protein biomarker analysis include insufficient sensitivity for detecting low-abundance biomarkers, poor measurement reproducibility, and the high costs and large footprints of detection systems. To address these issues, a new detection modality was developed for analyzing protein biomarkers based on the plasmon-enhanced photoacoustic (PA) effect. The detection modality employed a heterogeneous immunoassay scheme and used gold nanoparticles (AuNPs) as the signal reporter. Due to their localized plasmon resonance, AuNPs can strongly interact with intensity-modulated laser excitation and generate strong PA signals, which are subsequently sensed and quantified using a microphone. As an example, the performance of the PA immunoassay was evaluated by detecting the human interleukin 8 chemokine. The PA immunoassay provided approximately 143× lower limit of detection (LOD) than observed with the gold standard enzyme-linked immunosorbent assay - a decrease from 23pg/mL to 0.16pg/mL. In addition to the significant performance improvement in terms of the LOD, the PA immunoassay also offers advantages in terms of compatibility with low-cost instruments and the long-term stability of assay results. PMID:27183276

  10. Self-concentrating buoyant glass microbubbles for high sensitivity immunoassays.

    Science.gov (United States)

    Juang, Duane S; Hsu, Chia-Hsien

    2016-02-01

    Here, we report the novel application of a material with self-concentrating properties for enhancing the sensitivity of immunoassays. Termed as glass microbubbles, they are antibody functionalized buoyant hollow glass microspheres that simultaneously float and concentrate into a dense monolayer when dispensed in a liquid droplet. This self-concentrating charactaristic of the microbubbles allow for autonomous signal localization, which translates to a higher sensitivity compared to other microparticle-based immunoassays. We then demonstrated a "microbubble array" platform consisting of the glass microbubbles floating in a microfluidic liquid hemisphere array for performing multiplex immunoassays. PMID:26620967

  11. Interference in immunoassay

    International Nuclear Information System (INIS)

    Interfering factors are evident in both limited reagent (radioimmunoassay) and excess reagent (immunometric assay) technologies and should be suspected whenever there is a discrepancy between analytical results and clinical findings in the investigation of particular diseases. The overall effect of interference in immunoassay is analytical bias in result, either positive or negative of variable magnitude. The interference maybe caused by a wide spectrum of factors from poor sample collection and handling to physiological factors e.g. lipaemia, heparin treatment, binding protein abnormalities, autoimmunity and drug treatments. The range of interfering factors is extensive and difficult to discuss effectively in a short review

  12. Automated separation for heterogeneous immunoassays

    OpenAIRE

    Truchaud, A.; Barclay, J; Yvert, J. P.; Capolaghi, B.

    1991-01-01

    Beside general requirements for modern automated systems, immunoassay automation involves specific requirements as a separation step for heterogeneous immunoassays. Systems are designed according to the solid phase selected: dedicated or open robots for coated tubes and wells, systems nearly similar to chemistry analysers in the case of magnetic particles, and a completely original design for those using porous and film materials.

  13. Enzyme immunoassay for human ferritin

    International Nuclear Information System (INIS)

    We described an enzyme immunoassay with use of β-D-galactosidase for quantitation of ferritin in human serum. The minimum detectable ferritin concentration is 0.25 μg/L of serum, which is comparable to results obtained by radioimmunoassay. The correlation coefficient between values determined by enzyme immunoassay and radioimmunoassay was 0.95

  14. Performance improvement of the one-dot lateral flow immunoassay for aflatoxin B1 by using a smartphone-based reading system.

    Science.gov (United States)

    Lee, Sangdae; Kim, Giyoung; Moon, Jihea

    2013-01-01

    This study was conducted to develop a simple, rapid, and accurate lateral flow immunoassay (LFIA) detection method for point-of-care diagnosis. The one-dot LFIA for aflatoxin B1 (AFB1) was based on the modified competitive binding format using competition between AFB1 and colloidal gold-AFB1-BSA conjugate for antibody binding sites in the test zone. A Smartphone-based reading system consisting of a Samsung Galaxy S2 Smartphone, a LFIA reader, and a Smartphone application for the image acquisition and data analysis. The detection limit of one-dot LFIA for AFB1 is 5 μg/kg. This method provided semi-quantitative analysis of AFB1 samples in the range of 5 to 1,000 μg/kg. Using combination of the one-dot LFIA and the Smartphone-based reading system, it is possible to conduct a more fast and accurate point-of-care diagnosis. PMID:23598499

  15. Performance Improvement of the One-Dot Lateral Flow Immunoassay for Aflatoxin B1 by Using a Smartphone-Based Reading System

    Directory of Open Access Journals (Sweden)

    Jihea Moon

    2013-04-01

    Full Text Available This study was conducted to develop a simple, rapid, and accurate lateral flow immunoassay (LFIA detection method for point-of-care diagnosis. The one-dot LFIA for aflatoxin B1 (AFB1 was based on the modified competitive binding format using competition between AFB1 and colloidal gold-AFB1-BSA conjugate for antibody binding sites in the test zone. A Smartphone-based reading system consisting of a Samsung Galaxy S2 Smartphone, a LFIA reader, and a Smartphone application for the image acquisition and data analysis. The detection limit of one-dot LFIA for AFB1 is 5 μg/kg. This method provided semi-quantitative analysis of AFB1 samples in the range of 5 to 1,000 μg/kg. Using combination of the one-dot LFIA and the Smartphone-based reading system, it is possible to conduct a more fast and accurate point-of-care diagnosis.

  16. An immunoassay for dibutyl phthalate based on direct hapten linkage to the polystyrene surface of microtiter plates.

    Directory of Open Access Journals (Sweden)

    Chenxi Wei

    Full Text Available BACKGROUND: Dibutyl phthalate (DBP is predominantly used as a plasticizer inplastics to make them flexible. Extensive use of phthalates in both industrial processes and other consumer products has resulted in the ubiquitous presence of phthalates in the environment. In order to better determine the level of pollution in the environment and evaluate the potential adverse effects of exposure to DBP, immunoassay for DBP was developed. METHODOLOGY/PRINCIPAL FINDINGS: A monoclonal antibody specific to DBP was produced from a stable hybridoma cell line generated by lymphocyte hybridoma technique. An indirect competitive enzyme-linked immunosorbent assay (icELISA employing direct coating of hapten on polystyrene microtiter plates was established for the detection of DBP. Polystyrene surface was first oxidized by permanganate in dilute sulfuric acid to generate carboxyl groups. Then dibutyl 4-aminophthalate, which is an analogue of DBP, was covalently linked to the carboxyl groups of polystyrene surface with 1-ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride (EDC. Compared with conjugate coated format (IC(50=106 ng/mL, the direct hapten coated format (IC(50=14.6 ng/mL improved assay sensitivity after careful optimization of assay conditions. The average recovery of DBP from spiked water sample was 104.4% and the average coefficient of variation was 9.95%. Good agreement of the results obtained by the hapten coated icELISA and gas chromatography-mass spectrometry further confirmed the reliability and accuracy of the icELISA for the detection of DBP in certain plastic and cosmetic samples. CONCLUSIONS/SIGNIFICANCE: The stable and efficient hybridoma cell line obtained is an unlimited source of sensitive and specific antibody to DBP. The hapten coated format is proposed as generally applicable because the carboxyl groups on modified microtiter plate surface enables stable immobilization of aminated or hydroxylated hapten with EDC. The developed

  17. Polyelectrolyte-based electrochemiluminescence enhancement for Ru(bpy){sub 3}{sup 2+} loaded by SiO{sub 2} nanoparticle carrier and its high sensitive immunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Ge, Zhi-Li; Song, Tian-Mei; Chen, Zhe [College of Pharmaceutical Science, Soochow University, Suzhou 215123 (China); Guo, Wu-Run [College of Pharmaceutical Science, Soochow University, Suzhou 215123 (China); College of Chemistry and Chemical Engineering, China West Normal University, Nanchong 637002 (China); Xie, Hong-Ping, E-mail: hpxie@suda.edu.cn [College of Pharmaceutical Science, Soochow University, Suzhou 215123 (China); Xie, Lian, E-mail: xielian@suda.edu.cn [College of Pharmaceutical Science, Soochow University, Suzhou 215123 (China)

    2015-03-03

    Highlights: • Preparation of strong ECL nanoparticles PAA–Ru@SiO{sub 2}/[PAA⋯Ru&Nafion⋯Ru]. • Ion-pair macromolecule PAA–Ru formed to greatly increase the doping amount. • PAA&Nafion membrane increased the amount of ion-exchanged Ru(bpy){sub 3}{sup 2+}. • PAA&Nafion membrane enhanced the ability of electron transfer. • Realized antibody labeling and established a high-sensitive immunoassay. - Abstract: In this paper the strong electrochemiluminescence (ECL) nanoparticles have been prepared based on the anionic polyelectrolyte sodium polyacrylate (PAA)-ECL enhancement for Ru(bpy){sub 3}{sup 2+}, which were loaded by the carrier of SiO{sub 2} nanoparticle. There were two kinds of Ru(bpy){sub 3}{sup 2+} for the as-prepared nanoparticles, the doped one and the exchanged one. The former was loaded inside the ECL nanoparticles by doping, in a form of ion-pair macromolecules PAA–Ru(bpy){sub 3}{sup 2+}. The corresponding ECL was enhanced about 2 times owing to the doping increase of Ru(bpy){sub 3}{sup 2+}. The latter was loaded on the PAA-doped Nafion membrane by ion exchange. The corresponding ECL was enhanced about 3 times owing to the ion-exchanging increase of Ru(bpy){sub 3}{sup 2+}. At the same time, ECL intensity of the doped-inside Ru(bpy){sub 3}{sup 2+} was further enhanced 13 times because polyelectrolyte PAA in the doped membrane could obviously enhance electron transfer between the doped Ru(bpy){sub 3}{sup 2+} and the working electrode. Furthermore, based on hydrophobic regions of the doped membrane antibody labeling could be easily realized by the as-prepared nanoparticles and then a high sensitive ECL immunoassay for HBsAg was developed. The linear range was between 1.0 and 100 pg mL{sup −1} (R{sup 2} = 0.9912). The detection limit could be as low as 0.11 pg mL{sup −1} (signal-to-noise ratio = 3)

  18. Procedures for Sensitive Immunoassay

    International Nuclear Information System (INIS)

    Sensitive immunoassay methods should be applied to small molecules of biological importance, which are non-immunogenic by themselves, such as small peptide hormones (e.g. bradykinin), plant hormones (e.g. indoleacetic acid), nucleotides and other small molecules. Methods of binding these small molecules, as haptens, to immunogenic carriers by various cross-linking agents are described (dicyclohexylcarbodiimide, tolylene-diisocyanate and glutaraldehyde), and the considerations involved in relation to the methods of binding and the specificity of the antibodies formed are discussed. Some uses of antibody bound to bromoacetyl cellulose as an immuno adsorbent convenient for assay of immunoglobulins are described. Finally, the sensitive immunoassay method of chemically modified phage is described. This includes methods of binding small molecules (such as the dinitrophenyl group, penicillin, indoleacetic acid) or proteins (such as insulin, immunoglobulins) to phages. Methods of direct chemical conjugation, or an indirect binding via anti-phage Fab, are described. The phage inactivation method by direct plating and its modifications (such as decision technique and complex inactivation) are compared with the more simple end-point titration method. The inhibition of phage inactivation has some advantages as it does not require radioactive material, or expensive radioactive counters, and avoids the need for separation between bound and unbound antigen. Hence, if developed, it could be used as an alternative to radioimmunoassay. (author)

  19. A two-channel detection method for autofluorescence correction and efficient on-bead screening of one-bead one-compound combinatorial libraries using the COPAS fluorescence activated bead sorting system

    International Nuclear Information System (INIS)

    One-bead one-compound combinatorial library beads exhibit varying levels of autofluorescence after solid phase combinatorial synthesis. Very often this causes significant problems for automated on-bead screening using TentaGel beads and fluorescently labeled target proteins. Herein, we present a method to overcome this limitation when fluorescence activated bead sorting is used as the screening method. We have equipped the COPAS bead sorting instrument with a high-speed profiling unit and developed a spectral autofluorescence correction method. The correction method is based on a simple algebraic operation using the fluorescence data from two detection channels and is applied on-the-fly in order to reliably identify hit beads by COPAS bead sorting. Our method provides a practical tool for the fast and efficient isolation of hit beads from one-bead one-compound library screens using either fluorescently labeled target proteins or biotinylated target proteins. This method makes hit bead identification easier and more reliable. It reduces false positives and eliminates the need for time-consuming pre-sorting of library beads in order to remove autofluorescent beads. (technical note)

  20. Evaluation of recombinant outer membrane protein C based indirect enzyme-linked immunoassay for the detection of Salmonella antibodies in poultry

    Directory of Open Access Journals (Sweden)

    Jinu Manoj

    2015-08-01

    Full Text Available Aim: To evaluate the efficacy of recombinant outer membrane proteinC (rOmpC based enzyme-linked immunoassay (ELISA for the diagnosis of salmonellosis in poultry. Materials and Methods: Three antigens were prepared, and the indirect ELISA was standardized using the antigens and the antiserum raised in chicken against Omp and rOmpC. Sera were collected from a total of 255 apparently healthy field chickens and screened for the presence of Salmonella antibodies by this ELISA. Results: The sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of Omp revealed major polypeptides at 36, 42 and 52 kDa, and the rOmpC was evident by a single protein band of 43 kDa. The Omp and rOmpC antigen revealed an optimum concentration of 78 and 156 ng, respectively, in the assay, while the whole cell antigen gave an optimum reaction at a concentration of 106 organisms/ml. The test was found to be specific as it did not react with any of the antisera of seven other organisms. The developed ELISA detected Salmonella antibodies from 22 (8.62% samples with rOmpC antigen, while 24 (9.41% samples gave a positive reaction with both Omp and whole cell antigens. Conclusion: We suggest rOmpC based indirect ELISA as a suitable screening tool for serological monitoring of poultry flocks.

  1. AN ENVIRONMENTAL TECHNOLOGY VERIFICATION (ETV) TESTING OF THREE IMMUNOASSAY TEST KITS FOR ANTHRAX, BOTULINUM TOXIN AND RICIN

    Science.gov (United States)

    Immunoassay test kits are based on immunoassay methods, where specific antibodies are used to detect and measure the contaminants of interest. Immunoassay test kits rely on the reaction of a contaminant or antigen with a selective antibody to give a product that can be measures....

  2. Multiplexed magnetic microsphere immunoassays for detection of pathogens in foods

    OpenAIRE

    Kim, Jason S.; Taitt, Chris R.; Frances S. Ligler; Anderson, George P.

    2010-01-01

    Foodstuffs have traditionally been challenging matrices for conducting immunoassays. Proteins, carbohydrates, and other macromolecules present in food matrices may interfere with both immunoassays and PCR-based tests, and removal of particulate matter may also prove challenging prior to analyses. This has been found true when testing for bacterial contamination of foods using the standard polystyrene microspheres utilized with Luminex flow cytometers. Luminex MagPlex microspheres are encoded ...

  3. A capillary flow immunoassay microchip utilizing inkjet printing-based antibody immobilization onto island surfaces—toward sensitive and reproducible determination of carboxyterminal propeptide of type I procollagen

    Science.gov (United States)

    Fuchiwaki, Yusuke; Tanaka, Masato; Takaoka, Hiroki; Goya, Kenji

    2016-04-01

    A capillary-flow-driven microchip system requires no external power and has no moving off-chip components, in contrast with most microfluidic-based immunoassay systems which are complicated to operate and require external components. To accelerate the sensitive and reproducible determination of analytes required for practical point-of-care applications, we formed island microchannel surfaces on a microcapillary channel to allow stable antibody immobilization. The island surface was surrounded by a circular groove 10 μm deep and 150 μm wide and allowed uniform inkjet printing of antibody spots, complete bio-reagent replacement, and sensitive detection of luminescence intensity. Quantitative analysis of carboxyterminal propeptide of type I procollagen (PICP) concentrations using this microchannel was demonstrated between 0-600 ng·ml-1, which is adequate for the clinical estimation of PICP concentrations in the blood. This microchip system holds promise as a model diagnostic platform that is readily adaptable to hands-free operation.

  4. EQCM Immunoassay for Phosphorylated Acetylcholinesterase as a Biomarker for Organophosphate Exposures Based on Selective Zirconia Adsorption and Enzyme-Catalytic Precipitation

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hua; Wang, Jun; Choi, Daiwon; Tang, Zhiwen; Wu, Hong; Lin, Yuehe

    2009-03-01

    A zirconia (ZrO2) adsorption-based immunoassay by electrochemical quartz crystal microbalance (EQCM) has been initially developed, aiming at the detection of phosphorylated acetylcholinesterase (AChE) as a potential biomarker for bio-monitoring exposures to organophosphate (OP) pesticides and chemical warfare agents. Hydroxyl-derivatized monolayer was preferably chosen to modify the crystal serving as the template for directing the electro-deposition of ZrO2 film with uniform nanostructures. The resulting ZrO2 film was utilized to selectively capture phosphorylated AChE from the sample media. Horseradish peroxidase (HRP)-labeled anti-AChE antibodies were further employed to recognize the captured phosphorylated protein. Enzyme-catalytic oxidation of the benzidine substrate resulted in the accumulation of insoluble product on the functionalized crystal. Ultrasensitive EQCM quantification by mass-amplified frequency responses as well as rapid qualification by visual color changes of product could be thus achieved. Moreover, 4-chloro-1-naphthol (CN) was comparably studied as an ideal chromogenic substrate for the enzyme-catalytic precipitation. Experimental results show that the developed EQCM technique can allow for the detection of phosphorylated AChE in human plasma. Such an EQCM immunosensing format opens a new door towards the development of simple, sensitive, and field-applicable biosensor for biologically monitoring low-level OP exposures.

  5. Lateral flow test strip based on colloidal selenium immunoassay for rapid detection of melamine in milk, milk powder, and animal feed

    Science.gov (United States)

    Wang, Zhizeng; Zhi, Dejuan; Zhao, Yang; Zhang, Hailong; Wang, Xin; Ru, Yi; Li, Hongyu

    2014-01-01

    Although high melamine (MEL) intake has been proven to cause serious health problems, MEL is sometimes illegally added to milk products and animal feed, arousing serious food safety concerns. A satisfactory method of detecting MEL in onsite or in-home testing is in urgent need of development. This work aimed to explore a rapid, convenient, and cost-effective method of identifying MEL in milk products or other food by colloidal selenium-based lateral flow immunoassay. Colloidal selenium was synthesized by L-ascorbic acid to reduce seleninic acid at room temperature. After conjugation with a monoclonal antibody anti-MEL, a test strip was successfully prepared. The detection limit of the test strip reached 150 μg/kg, 1,000 μg/kg, and 800 μg/kg in liquid milk, milk powder, and animal feed, respectively. No cross-reactions with homologues cyanuric acid, cyanurodiamide, or ammelide were found. Moreover, the MEL test strip can remain stable after storage for 1 year at room temperature. Our results demonstrate that the colloidal selenium MEL test strip can detect MEL in adulterated milk products or animal feed conveniently, rapidly, and sensitively. In contrast with a colloidal gold MEL test strip, the colloidal selenium MEL test strip was easy to prepare and more cost-efficient. PMID:24729705

  6. Electrochemical immunoassay for the protein biomarker mucin 1 and for MCF-7 cancer cells based on signal enhancement by silver nanoclusters

    International Nuclear Information System (INIS)

    An electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 (MUC-1) and of breast cancer cells of type MCF-7 where MUC-1 is over expressed. The method is based on the use of silver nanoclusters (Ag-NCs) acting as a signalling probe. The Ag-NCs were synthesized via chemical reduction in the presence of a DNA strand with the sequence of 5′-GCAGTTGATCCTTTGGATACCCTGG-C12-3′. The strand contains mucin 1 aptamer (GCAGTTGATCCTTTGGATACCCTGG) that can specifically bind to MUC1 and the template (C12) for synthesis of Ag-NCs. The assay involves the following steps: (1) Construction of an immunosensor by immobilizing the antibody against MUC-1 on a glassy carbon electrode; (2) addition of sample containing MUC-1; (3) addition of Ag-NCs; (4) signal amplification via silver enhancement process (deposition of metal silver on Ag-NCs); (5) measurement via square wave voltammetry. The current measured at a potential of 0.11 V (vs. SCE) is logarithmically related to the concentration of MUC-1 in the 1 to 500 nM range, with a detection limit of 0.5 nM. We also demonstrate that MCF-7 cancer cells can be detected by this method with high sensitivity (50 cells per mL) due to the presence of MUC-1 proteins on the cell surface. (author)

  7. Mass Spectrometric Immunoassays in Characterization of Clinically Significant Proteoforms

    Directory of Open Access Journals (Sweden)

    Olgica Trenchevska

    2016-03-01

    Full Text Available Proteins can exist as multiple proteoforms in vivo, as a result of alternative splicing and single-nucleotide polymorphisms (SNPs, as well as posttranslational processing. To address their clinical significance in a context of diagnostic information, proteoforms require a more in-depth analysis. Mass spectrometric immunoassays (MSIA have been devised for studying structural diversity in human proteins. MSIA enables protein profiling in a simple and high-throughput manner, by combining the selectivity of targeted immunoassays, with the specificity of mass spectrometric detection. MSIA has been used for qualitative and quantitative analysis of single and multiple proteoforms, distinguishing between normal fluctuations and changes related to clinical conditions. This mini review offers an overview of the development and application of mass spectrometric immunoassays for clinical and population proteomics studies. Provided are examples of some recent developments, and also discussed are the trends and challenges in mass spectrometry-based immunoassays for the next-phase of clinical applications.

  8. Immunoassay separation technique

    International Nuclear Information System (INIS)

    A method for effecting the immunoassay of a multiplicity of samples, each possibly containing an antigen or an antibody to be assayed, is discussed. Each sample is incubated with a solution containing a detectable antigen or antibody to form a multiplicity of mixtures, each mixture containing as components antigen-antibody, non-complexed antigen and non-complexed antibody. At least one of the components of the said mixture is separated by adsorption. There after, quantity of detectable antigen or antibody is detected in one of the non-adsorbed portions of the mixture. An improvement, compared to other techniques, is the continuous and sequential separation of at least one component, which is intended to be separated from each said multiplicity of mixtures

  9. Immunoassay for petroleum hydrocarbons

    International Nuclear Information System (INIS)

    Petroleum hydrocarbon contamination of soil and ground water has become a serious environmental problem. Since the 1940s, it has been a common practice to bury fuel tanks underground to guard against fire and explosions. The leakage of petroleum fuel from these aging tanks creates a long term threat to human health. In order to location and identify these sources of contamination, an on-site screening test is very desirable. A simple, inexpensive petroleum hydrocarbon immunoassay has been developed for this purpose. The EnviroGard Petroleum Hydrocarbon test kit is designed for qualitative or semiquantitative analysis of petroleum hydrocarbon fuel in soil and ground water. The assay can be easily used on-site and takes 15 minutes to perform. Following a 2 minute methanol extraction, the test is performed in polystyrene tubes and can detect gasoline, diesel fuel, kerosene, home heating oil and other major fuels at ppm levels in soil and sub-ppm levels in water samples

  10. Highly sensitive electroluminescence immunoassay for Hg(II) ions based on the use of CdSe quantum dots, the methylmercury-6-mercaptonicotinic acid-ovalbumin conjugate, and a specific monoclonal antibody

    International Nuclear Information System (INIS)

    We have designed a rapid and ultrasensitive electrochemiluminescent (ECL) competitive immunoassay for the determination of mercury(II) ion. It is based on the use of CdSe quantum dots (QDs), methylmercury-6-mercaptonicotinic acid-ovalbumin as coating antigen and specific monoclonal antibodies (mAbs) against Hg(II). The latter is quite selective for Hg(II). The coating antigen was immobilized on the surface of a gold electrode via reaction between the functional groups of cysteamine and glutaraldehyde. The mercury(II) ions in a sample and the coating antigen compete for binding sites of QD-labeled monoclonal antibody which binds specifically to Hg(II) ions. The ECL of the system decreases with increasing concentration of Hg(II) because less QD-labeled mAbs are present on the surface of the electrode. Under optimal conditions, the decrease of ECL intensity is linearly related to the logarithm of the Hg(II) concentration in the range from 0.02 to 100 ng mL−1, with a detection limit of 6.2 pg mL−1. As far as we know, this is the first report on an ECL immunoassay for Hg(II) based on a specific monoclonal antibody. The favorable results obtained when this method was applied to real samples indicate that this detection scheme can widely enlarge the applicability of detecting heavy metal ions by exploiting the ECL of QDs for immunoassays. (author)

  11. Study of Spatio-Temporal Immunofluorescence on Bead Patterns in a Microfluidic Channel

    Science.gov (United States)

    Sivagnanam, Venkataragavalu; Yang, Hui; Gijs, Martin A. M.

    2010-12-01

    We performed a direct immunoassay inside a microfluidic channel on patterned streptavidin-coated beads, which captured fluorescently-labeled biotin target molecules from a continuous flow. We arranged the beads in a dot array at the bottom of the channel and demonstrated their position- and flow rate-dependent fluorescence. As the target analyte gets gradually depleted from the flow when passing downstream the channel, the highest fluorescence intensity was observed on the most upstream positioned dot patterns. We propose a simple analytical convection model to explain this spatio-temporal fluorescence.

  12. A ready-to-use, versatile, multiplex-able three-dimensional scaffold-based immunoassay chip for high throughput hepatotoxicity evaluation.

    Science.gov (United States)

    Yan, Xiaojun; Wang, Jingyu; Zhu, Lu; Lowrey, Jonathan Joseph; Zhang, Yuanyuan; Hou, Wei; Dong, Jiahong; Du, Yanan

    2015-06-21

    Hydrogel as three-dimensional (3D) substrate has been employed in miniaturized high throughput protein detection platforms to increase the number of effective antibodies and signal augmentation. However, the high water content of the hydrogel can dilute samples and create barrier to mass transfer, limiting hydrogel height to several microns in most platforms. Moreover, these platforms cannot achieve widespread use in common laboratories as they usually rely heavily on expensive robotic liquid handlers and custom-built components. Here we developed a ready-to-use, easy to store and handle, versatile and multiplex-able 3D scaffold-based immunoassay chip (3D immunoChip) possible for high throughput protein quantification using bench-top equipment in common laboratories. Sample dilution, mass transfer, signal scattering and storage problems can be avoided by using dry scaffolds that regain transparency upon rehydration. When combined with hydrophilic-hydrophobic patterned reagent loading slides, manual high throughput handling of samples can be achieved. As these micro-scaffolds are patterned without barriers in between, simultaneous and effortless washing of all the reaction zones is possible in a Petri dish. Such features aid the 3D immunoChip in saving up to 100 times reagent and about 6 times labour. The 3D immunoChip is able to detect albumin (ALB), as a model analyte, from 5 ng mL(-1) to 1000 ng mL(-1), making it comparable to the commercialized ELISA kit based on a 96-well plate (0.22-400 ng mL(-1)). This thus enables the 3D immunoChip to directly detect ALB secreted by HepaRG cells cultured in a 3D cell culture array chip for high throughput drug hepatotoxicity evaluation, which could potentially accelerate drug screening. PMID:25987291

  13. Rapid Wuchereria bancrofti-Specific Antigen Wb123-Based IgG4 Immunoassays as Tools for Surveillance following Mass Drug Administration Programs on Lymphatic Filariasis

    Science.gov (United States)

    Steel, Cathy; Golden, Allison; Kubofcik, Joseph; LaRue, Nicole; de los Santos, Tala; Domingo, Gonzalo J.

    2013-01-01

    The Global Programme to Eliminate Lymphatic Filariasis has an urgent need for rapid assays to detect ongoing transmission of lymphatic filariasis (LF) following multiple rounds of mass drug administration (MDA). Current WHO guidelines support using the antigen card immunochromatographic test (ICT), which detects active filarial infection but does not detect early exposure to LF. Recent studies found that antibody-based assays better serve this function. In the present study, two tests, a rapid IgG4 enzyme-linked immunosorbent assay (ELISA) and a lateral-flow strip immunoassay, were developed based on the highly sensitive and specific Wuchereria bancrofti antigen Wb123. A comparison of W. bancrofti-infected and -uninfected patients (with or without other helminth infections) demonstrated that both tests had high sensitivities and specificities (93 and 97% [ELISA] and 92 and 96% [strips], respectively). When the W. bancrofti-uninfected group was separated into those with other filarial/helminth infections (i.e., onchocerciasis, loiasis, and strongyloidiasis) and those who were parasite uninfected, the specificities of the assays varied between 91 and 100%. In addition, the geometric mean response by ELISA of W. bancrofti-infected patients was significantly higher than the response of those without W. bancrofti infection (P < 0.0001). Furthermore, the Wb123 ELISA and the lateral-flow strips had high positive and negative predictive values, giving valuable information on the size of survey population needed to be reasonably certain whether or not transmission is ongoing. These highly sensitive and specific IgG4 tests to the W. bancrofti Wb123 protein give every indication that they will serve as useful tools for post-MDA monitoring. PMID:23740923

  14. Polyelectrolyte-based electrochemiluminescence enhancement for Ru(bpy)₃²⁺ loaded by SiO₂ nanoparticle carrier and its high sensitive immunoassay.

    Science.gov (United States)

    Ge, Zhi-Li; Song, Tian-Mei; Chen, Zhe; Guo, Wu-Run; Xie, Hong-Ping; Xie, Lian

    2015-03-01

    In this paper the strong electrochemiluminescence (ECL) nanoparticles have been prepared based on the anionic polyelectrolyte sodium polyacrylate (PAA)-ECL enhancement for Ru(bpy)3(2+), which were loaded by the carrier of SiO2 nanoparticle. There were two kinds of Ru(bpy)3(2+) for the as-prepared nanoparticles, the doped one and the exchanged one. The former was loaded inside the ECL nanoparticles by doping, in a form of ion-pair macromolecules PAA-Ru(bpy)3(2+). The corresponding ECL was enhanced about 2 times owing to the doping increase of Ru(bpy)3(2+). The latter was loaded on the PAA-doped Nafion membrane by ion exchange. The corresponding ECL was enhanced about 3 times owing to the ion-exchanging increase of Ru(bpy)3(2+). At the same time, ECL intensity of the doped-inside Ru(bpy)3(2+) was further enhanced 13 times because polyelectrolyte PAA in the doped membrane could obviously enhance electron transfer between the doped Ru(bpy)3(2+) and the working electrode. Furthermore, based on hydrophobic regions of the doped membrane antibody labeling could be easily realized by the as-prepared nanoparticles and then a high sensitive ECL immunoassay for HBsAg was developed. The linear range was between 1.0 and 100 pg mL(-1) (R(2)=0.9912). The detection limit could be as low as 0.11 pg mL(-1) (signal-to-noise ratio=3). PMID:25682425

  15. Development and Validation of a Fluorescent Multiplexed Immunoassay for Measurement of Transgenic Proteins in Cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yeaman, Grant R; Paul, Sudakshina; Nahirna, Iryna; Wang, Yongcheng; Deffenbaugh, Andrew E; Liu, Zi Lucy; Glenn, Kevin C

    2016-06-22

    In order to provide farmers with better and more customized alternatives to improve yields, combining multiple genetically modified (GM) traits into a single product (called stacked trait crops) is becoming prevalent. Trait protein expression levels are used to characterize new GM products and establish exposure limits, two important components of safety assessment. Developing a multiplexed immunoassay capable of measuring all trait proteins in the same sample allows for higher sample throughput and savings in both time and expense. Fluorescent (bead-based) multiplexed immunoassays (FMI) have gained wide acceptance in mammalian research and in clinical applications. In order to facilitate the measurement of stacked GM traits, we have developed and validated an FMI assay that can measure five different proteins (β-glucuronidase, neomycin phosphotransferase II, Cry1Ac, Cry2Ab2, and CP4 5-enolpyruvyl-shikimate-3-phosphate synthase) present in cotton leaf from a stacked trait product. Expression levels of the five proteins determined by FMI in cotton leaf tissues have been evaluated relative to expression levels determined by enzyme-linked immunosorbent assays (ELISAs) of the individual proteins and shown to be comparable. The FMI met characterization requirements similar to those used for ELISA. Therefore, it is reasonable to conclude that FMI results are equivalent to those determined by conventional individual ELISAs to measure GM protein expression levels in stacked trait products but with significantly higher throughput, reduced time, and more efficient use of resources. PMID:27177195

  16. 125I-labeled protein A as a general tracer in immunoassay: suitability of goat and sheep antibodies

    International Nuclear Information System (INIS)

    The immunoassay method in which 125I-labeled staphylococcal Protein A ([125I]PA) serves as a general tracer has been extended to include goat and sheep IgG antibodies. Goat and sheep IgG normally do not react significantly with PA. However, once IgG antibody is bound to immobilized antigen or hapten, binding of [125I]PA is enhanced markedly. Binding efficiencies of [125I]PA to immune complexed goat anti-human IgM, human IgE, methotrexate and sheep anti-IgE were determined and compared quantitatively to rabbit IgG with the corresponding specificity. Immunoassays were developed based on the inhibition of [125I]PA binding as a measure of antibody inhibition by fluid-phase homologous ligand. Goat antibody to the monovalent hapten methotrexate behaved anomalously: for each concentration of IgG tested, there was an optimal amount of methotrexate beads that gave maximum binding of [125I]PA. In the other immune systems, for each antibody concentration maximum binding of tracer was a function only of the amount of immobilized anitgen added. In contrast to the results obtained with solid-phase antigen, solutions containing antibody and amounts of antigen ranging from large antigen excess to antibody excess failed to react significantly with PA or [125I]PA. (Auth.)

  17. Integration of Multiplex Bead Assays for Parasitic Diseases into a National, Population-Based Serosurvey of Women 15-39 Years of Age in Cambodia

    Science.gov (United States)

    Priest, Jeffrey W.; Jenks, M. Harley; Moss, Delynn M.; Mao, Bunsoth; Buth, Sokhal; Wannemuehler, Kathleen; Soeung, Sann Chan; Lucchi, Naomi W.; Udhayakumar, Venkatachalam; Gregory, Christopher J.; Huy, Rekol; Muth, Sinuon; Lammie, Patrick J.

    2016-01-01

    Collection of surveillance data is essential for monitoring and evaluation of public health programs. Integrated collection of household-based health data, now routinely carried out in many countries through demographic health surveys and multiple indicator surveys, provides critical measures of progress in health delivery. In contrast, biomarker surveys typically focus on single or related measures of malaria infection, HIV status, vaccination coverage, or immunity status for vaccine-preventable diseases (VPD). Here we describe an integrated biomarker survey based on use of a multiplex bead assay (MBA) to simultaneously measure antibody responses to multiple parasitic diseases of public health importance as part of a VPD serological survey in Cambodia. A nationally-representative cluster-based survey was used to collect serum samples from women of child-bearing age. Samples were tested by MBA for immunoglobulin G antibodies recognizing recombinant antigens from Plasmodium falciparum and P. vivax, Wuchereria bancrofti, Toxoplasma gondii, Taenia solium, and Strongyloides stercoralis. Serologic IgG antibody results were useful both for generating national prevalence estimates for the parasitic diseases of interest and for confirming the highly focal distributions of some of these infections. Integrated surveys offer an opportunity to systematically assess the status of multiple public health programs and measure progress toward Millennium Development Goals. PMID:27136913

  18. Integration of Multiplex Bead Assays for Parasitic Diseases into a National, Population-Based Serosurvey of Women 15-39 Years of Age in Cambodia.

    Science.gov (United States)

    Priest, Jeffrey W; Jenks, M Harley; Moss, Delynn M; Mao, Bunsoth; Buth, Sokhal; Wannemuehler, Kathleen; Soeung, Sann Chan; Lucchi, Naomi W; Udhayakumar, Venkatachalam; Gregory, Christopher J; Huy, Rekol; Muth, Sinuon; Lammie, Patrick J

    2016-05-01

    Collection of surveillance data is essential for monitoring and evaluation of public health programs. Integrated collection of household-based health data, now routinely carried out in many countries through demographic health surveys and multiple indicator surveys, provides critical measures of progress in health delivery. In contrast, biomarker surveys typically focus on single or related measures of malaria infection, HIV status, vaccination coverage, or immunity status for vaccine-preventable diseases (VPD). Here we describe an integrated biomarker survey based on use of a multiplex bead assay (MBA) to simultaneously measure antibody responses to multiple parasitic diseases of public health importance as part of a VPD serological survey in Cambodia. A nationally-representative cluster-based survey was used to collect serum samples from women of child-bearing age. Samples were tested by MBA for immunoglobulin G antibodies recognizing recombinant antigens from Plasmodium falciparum and P. vivax, Wuchereria bancrofti, Toxoplasma gondii, Taenia solium, and Strongyloides stercoralis. Serologic IgG antibody results were useful both for generating national prevalence estimates for the parasitic diseases of interest and for confirming the highly focal distributions of some of these infections. Integrated surveys offer an opportunity to systematically assess the status of multiple public health programs and measure progress toward Millennium Development Goals. PMID:27136913

  19. A High-Throughput SU-8Microfluidic Magnetic Bead Separator

    DEFF Research Database (Denmark)

    Bu, Minqiang; Christensen, T. B.; Smistrup, Kristian;

    2007-01-01

    We present a novel microfluidic magnetic bead separator based on SU-8 fabrication technique for high through-put applications. The experimental results show that magnetic beads can be captured at an efficiency of 91 % and 54 % at flow rates of 1 mL/min and 4 mL/min, respectively. Integration of s...... soft magnetic elements in the chip leads to a slightly higher capturing efficiency and a more uniform distribution of captured beads over the separation chamber than the system without soft magnetic elements.......We present a novel microfluidic magnetic bead separator based on SU-8 fabrication technique for high through-put applications. The experimental results show that magnetic beads can be captured at an efficiency of 91 % and 54 % at flow rates of 1 mL/min and 4 mL/min, respectively. Integration of...

  20. Lateral flow test strip based on colloidal selenium immunoassay for rapid detection of melamine in milk, milk powder, and animal feed

    Directory of Open Access Journals (Sweden)

    Wang ZZ

    2014-04-01

    Full Text Available Zhizeng Wang,1 Dejuan Zhi,2 Yang Zhao,1 Hailong Zhang,2 Xin Wang,2 Yi Ru,1 Hongyu Li1,2 1MOE Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou, People's Republic of China; 2Institute of Microbiology and Biochemical Pharmacy, School of Pharmaceutics, Lanzhou University, Lanzhou, People's Republic of China Abstract: Although high melamine (MEL intake has been proven to cause serious health problems, MEL is sometimes illegally added to milk products and animal feed, arousing serious food safety concerns. A satisfactory method of detecting MEL in onsite or in-home testing is in urgent need of development. This work aimed to explore a rapid, convenient, and cost-effective method of identifying MEL in milk products or other food by colloidal selenium-based lateral flow immunoassay. Colloidal selenium was synthesized by L-ascorbic acid to reduce seleninic acid at room temperature. After conjugation with a monoclonal antibody anti-MEL, a test strip was successfully prepared. The detection limit of the test strip reached 150 µg/kg, 1,000 µg/kg, and 800 µg/kg in liquid milk, milk powder, and animal feed, respectively. No cross-reactions with homologues cyanuric acid, cyanurodiamide, or ammelide were found. Moreover, the MEL test strip can remain stable after storage for 1 year at room temperature. Our results demonstrate that the colloidal selenium MEL test strip can detect MEL in adulterated milk products or animal feed conveniently, rapidly, and sensitively. In contrast with a colloidal gold MEL test strip, the colloidal selenium MEL test strip was easy to prepare and more cost-efficient. Keywords: melamine, selenium nanoparticles, test strip, milk, animal feed, dairy food

  1. Determination of human IgG by solid substrate room temperature phosphorescence immunoassay based on an antibody labeled with nanoparticles containing dibromofluorescein luminescent molecules

    International Nuclear Information System (INIS)

    Luminescent silicon dioxide nano-particles with size of 20 nm, which containing dibromofluorescein (D) were synthesized by sol-gel method (symbolized by D-SiO2).The particles can emit intense and stable room temperature phosphorescence signal on polyamide membrane when Pb(Ac)2 was used as a heavy atom perturber. The λexmax/λemmax was 457/622 nm. Our research indicated that the specific immune reaction between goat-anti-human IgG antibody labeled with D-SiO2 and human IgG could be carried out on polyamide membrane quantitatively, and the phosphorescence intensity of the particle was enhanced after the immunoreactions. Thus a new method of solid substrate room temperature phosphorescence immunoassay (SS-RTP-IA) for the determination of human IgG was established basing on antibody labeled with the D-SiO2 nanoparticles. The linear range of this method was 0.0624-20.0 pg human IgG spot-1 (corresponding concentration: 0.156-50.0 ng ml-1, the sample volume: 0.40 μl spot-1) with a limit of detection (LD) as 0.018 pg spot-1, and the regression equation of working curve was ΔIp = 7.201 mIgG (pg spot-1) + 82.57. Samples containing 0.156 and 50.0 ng ml-1 of IgG were measured repeatedly for 11 times and R.S.D.s were 4.1 and 3.4%, respectively. Results showed that this method had the merits as sensitive, accurate and precise

  2. Determination of human IgG by solid substrate room temperature phosphorescence immunoassay based on an antibody labeled with nanoparticles containing Rhodamine 6G luminescent molecules

    Science.gov (United States)

    Jia-Ming, Liu; hui, Zhu Guo; Aihong, Wu; Pingping, Li; Huanhuan, Xu; Li, Long-Di; Liu, Zhen-bo

    2005-03-01

    Luminescent silicon dioxide nanoparticles (R-SiO 2) with size of 50 nm containing Rhodamine 6G (R) were synthesized by sol-gel method. In the presence of Pb(Ac) 2 as a heavy atom perturber, the particle can emit intense and stable room temperature phosphorescence signal of R, respectively, on polyamide membrane, with the λexmax/λemmax=470/635 nm for R. Our research indicates that the specific immune reaction between goat-anti-human IgG antibody labeled with R-SiO 2 and human IgG can be carried on polyamide membrane quantitatively, and the phosphorescence intensity was enhanced after the immunoreactions. Thus, a new method of solid substrate room temperature phosphorescence immunoassay (SS-RTP-IA) for the determination of human IgG was established basing on antibody labeled with the nanoparticles containing binary luminescent molecules. The linear range of this method is 0.0624-20.0 pg spot -1 of human IgG (corresponding concentration, 0.156-50.0 ng mL -1; sample volume, 0.40 μL spot -1). The regression equations of working curves are Δ Ip = 88.16. + 16.79m IgG (pg spot -1) (485/646 nm, r = 0.9997). Detection limits calculated by 3Sb/k are 0.017 pg spot -1. For samples containing 0.156 and 50.0 ng mL -1 of IgG, we measured repeatedly for 11 times, RSDs are 3.9 and 2.8%, respectively. This method is sensitive, accurate and of high precision.

  3. RADIOCHEMICAL STUDIES ON ALPHA FETOPROTEIN RADIOIMMUNOASSAY SOLID PHASE COATED BEADS

    International Nuclear Information System (INIS)

    Alpha fetoprotein (AFP) is a marker for hepatocellular and germ cell carcinoma. There are many different techniques used for measuring AFP in blood where the most accurate one is the immunoassay technique. The aim of the present study was to evaluate, optimize and prepare anti-AFP solid phase coated beads and use it for the determination of AFP in serum. The anti-AFP polyclonal antibodies were prepared by immunization of five rats with a highly purified AFP antigen and the anti-sera obtained were used for coating polystyrene beads to obtain the solid phase coated beads. Also, the AFP antigen was labelled with 125 I using chloramin-T (Ch-T) as oxidizing agent and the tracer obtained was purified using sephadex G-25 (PD-10) chromatography. The assay was performed using a set of AFP standards prepared by diluting the cord blood. The suitable conditions for coating process were obtained which include pH 8, molarity of coating buffer 0.05 M, volume of coating buffer 100 ml and dilution of antibody 1:1000 for coating 1000 beads. Because the coated beads prepared using borate buffer is more suitable than prepared using carbonate or phosphate buffers, they were chosen to complete the optimization and validation study. The optimization and characterization of the assay were performed to evaluate the quality of the proposed system. The system prepared proved a low cost, simple, sensitive and accurate results. The prepared system can be used to evaluate AFP in the blood and this will be helpful in diagnosing some diseases such as hepatocellular carcinoma and neural tube defects

  4. Microfabricated Passive Magnetic Bead separators

    DEFF Research Database (Denmark)

    Hansen, Mikkel Fougt; Lund-Olesen, Torsten; Smistrup, Kristian;

    2006-01-01

    The use and manipulation of functionalized magnetic beads for bioanalysis in lab-on-a-chip systems is receiving growing interest. We have developed microfluidic systems with integrated magnetic structures for the capture and release of magnetic beads. The systems are fabricated in silicon by deep...

  5. A NOVEL APPROACH TO SYNTHESIZE CHITOSAN BEADS CROSSLINKED BY EPICHLOROHYDRIN

    Institute of Scientific and Technical Information of China (English)

    WANG Yongjian; BAI Shu; SUN Yan

    2001-01-01

    The present investigation describes a novel method for preparing spherical chitosan particles based on crosslinking with epichlorohydrin. Certain amount of pre-crosslinking agent was added to form chitosan gels by traditional inverse phase suspension polymerization. Then the gels were crosslinked by epichlorohydrin at basic condition to obtain chitosan beads. The effects of reaction conditions, such as crosslinking time, the amount of crosslinking agent and the NaOtt concentration,on the physical properties of the chitosan beads were investigated. The beads were found to have more amino groups in the polymer chains than the beads crosslinked by glutaraldehyde. The capacity for copper ions is as high as 40mg/g. The beads have good mechanical strength and can be reused.

  6. A NOVEL APPROACH TO SYNTHESIZE CHITOSAN BEADS CROSSLINKED BY EPICHLOROHYDRIN

    Institute of Scientific and Technical Information of China (English)

    WANGYongjina; BAIShu; 等

    2001-01-01

    The present investigation describes a novel method for preparing spherical chitosan particles based on crosslinking with epichlorohydrin.Certain amount of pre-crosslinking agent was added to form chitosan gels by traditional inverse phase suspension polymerization.Then the gels were crosslinked by epichlorohydrin at basic condition to obtain chitosan beads.The effects of reaction conditions,such as crosslinking time,the amount of crosslinking agent and the NaOH concentration,on the physical properties of the chitosan beads were investigated.The beads were found to have more amino groups in the polymer chains than the beads crosslinked by glutaraldehyde.The capacity for copper ions in as high as 40mg/g,The beads have good mechanical strength and can be reused.

  7. Design of systems for handling radioactive ion exchange resin beads

    International Nuclear Information System (INIS)

    The flow of slurries in pipes is a complex phenomenon. There are little slurry data available on which to base the design of systems for radioactive ion exchange resin beads and, as a result, the designs vary markedly in operating plants. With several plants on-line, the opportunity now exists to evaluate the designs of systems handling high activity spent resin beads. Results of testing at Robbins and Meyers Pump Division to quantify the behavior of resin bead slurries are presented. These tests evaluated the following slurry parameters; resin slurry velocity, pressure drop, bead degradation, and slurry concentration effects. A discussion of the general characteristics of resin bead slurries is presented along with a correlation to enable the designer to establish the proper flowrate for a given slurry composition and flow regime as a function of line size. Guidelines to follow in designing a resin handling system are presented

  8. Protective T Cell and Antibody Immune Responses against Hepatitis C Virus Achieved Using a Biopolyester-Bead-Based Vaccine Delivery System.

    Science.gov (United States)

    Martínez-Donato, G; Piniella, B; Aguilar, D; Olivera, S; Pérez, A; Castañedo, Y; Alvarez-Lajonchere, L; Dueñas-Carrera, S; Lee, J W; Burr, N; Gonzalez-Miro, M; Rehm, B H A

    2016-04-01

    Hepatitis C virus (HCV) infection is a major worldwide problem. Chronic hepatitis C is recognized as one of the major causes of cirrhosis, hepatocellular carcinoma, and liver failure. Although new, directly acting antiviral therapies are suggested to overcome the low efficacy and adverse effects observed for the current standard of treatment, an effective vaccine would be the only way to certainly eradicate HCV infection. Recently, polyhydroxybutyrate beads produced by engineeredEscherichia colishowed efficacy as a vaccine delivery system. Here, an endotoxin-freeE. colistrain (ClearColi) was engineered to produce polyhydroxybutyrate beads displaying the core antigen on their surface (Beads-Core) and their immunogenicity was evaluated in BALB/c mice. Immunization with Beads-Core induced gamma interferon (IFN-γ) secretion and a functional T cell immune response against the HCV Core protein. With the aim to target broad T and B cell determinants described for HCV, Beads-Core mixed with HCV E1, E2, and NS3 recombinant proteins was also evaluated in BALB/c mice. Remarkably, only three immunization with Beads-Core+CoE1E2NS3/Alum (a mixture of 0.1 μg Co.120, 16.7 μg E1.340, 16.7 μg E2.680, and 10 μg NS3 adjuvanted in aluminum hydroxide [Alum]) induced a potent antibody response against E1 and E2 and a broad IFN-γ secretion and T cell response against Core and all coadministered antigens. This immunological response mediated protective immunity to viremia as assessed in a viral surrogate challenge model. Overall, it was shown that engineered biopolyester beads displaying foreign antigens are immunogenic and might present a particulate delivery system suitable for vaccination against HCV. PMID:26888185

  9. Facile fabrication of an electrochemical aptasensor based on magnetic electrode by using streptavidin modified magnetic beads for sensitive and specific detection of Hg(2.).

    Science.gov (United States)

    Wu, Dan; Wang, Yaoguang; Zhang, Yong; Ma, Hongmin; Pang, Xuehui; Hu, Lihua; Du, Bin; Wei, Qin

    2016-08-15

    In this work, a novel electrochemical aptasensor was developed for sensitive and specific detection of Hg(2+) based on thymine-Hg(2+)-thymine (T-Hg(2+)-T) structure via application of thionine (Th) as indicator signal. For the fabrication of the aptasensor, streptavidin modified magnetic beads (Fe3O4-SA) was firmly immobilized onto the magnetic glassy carbon electrode (MGCE) benefited from its magnetic character. Then biotin labeled T-riched single stranded DNA (Bio-ssDNA) connected with Fe3O4-SA specifically and steadily because of the specific binding capacity between streptavidin and biotin. The stable structure of T-Hg(2+)-T formed in the present of Hg(2+) provided convenience for the intercalation of Th. The detection of Hg(2+) was achieved by recording the differential pulse voltammetry (DPV) signal of Th. Under optimal experimental conditions, the linear range of the fabricated electrochemical aptasensor was 1-200nmol/L, with a detection limit of 0.33nmol/L. Furthermore, the proposed aptasensor may find a potential application for the detection of Hg(2+) in real water sample analysis. PMID:27031185

  10. The impact of functionalized CNT in the network of sodium alginate-based nanocomposite beads on the removal of Co(II) ions from aqueous solutions.

    Science.gov (United States)

    Karkeh-Abadi, Fatemeh; Saber-Samandari, Samaneh; Saber-Samandari, Saeed

    2016-07-15

    Significant efforts have been made to develop highly efficient adsorbents to remove radioactive Co(II) ion pollutants from medical and industrial wastewaters. In this study, amide group functionalized multi-walled carbon nanotube (CNT-CONH2) imprinted in the network of sodium alginate containing hydroxyapatite, and new nanocomposite beads were synthesized. Then, they were characterized using Fourier transform infrared spectroscopy (FTIR), X-ray diffraction analysis (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM) and energy dispersive spectroscopy (EDS). The prepared nanocomposite beads were used as an adsorbent of Co(II) ions from an aqueous solution. The presence and distribution of Co(II) ions in the surface of the nanocomposite beads was confirmed using FESEM, EDS and metal mapping analysis. The effect of various experimental conditions such as time, pH, and initial concentration of the adsorbate solution and temperature on the adsorption capacity of the nanocomposite beads were explored. The maximum Co(II) ions adsorption capacity of the prepared nanocomposite beads with the largest surface area of 163.4m(2)g(-1) was 347.8mgg(-1) in the optimized condition. The adsorption mechanism followed a pseudo-second-order kinetic model. Furthermore, the Freundlich appears to produce better fit than the Langmuir adsorption isotherm. Finally, thermodynamic studies suggest that endothermic adsorption process of Co(II) ions is spontaneous and thermodynamically favorable. PMID:27037477

  11. Development and validation of a genotype 3 recombinant protein-based immunoassay for hepatitis E virus serology in swine

    Directory of Open Access Journals (Sweden)

    W.H.M. van der Poel

    2014-04-01

    Full Text Available Hepatitis E virus (HEV is classified within the family Hepeviridae, genus Hepevirus. HEV genotype 3 (Gt3 infections are endemic in pigs in Western Europe and in North and South America and cause zoonotic infections in humans. Several serological assays to detect HEV antibodies in pigs have been developed, at first mainly based on HEV genotype 1 (Gt1 antigens. To develop a sensitive HEV Gt3 ELISA, a recombinant baculovirus expression product of HEV Gt3 open reading frame-2 was produced and coated onto polystyrene ELISA plates. After incubation of porcine sera, bound HEV antibodies were detected with anti-porcine anti-IgG and anti-IgM conjugates. For primary estimation of sensitivity and specificity of the assay, sets of sera were used from pigs experimentally infected with HEV Gt3. For further validation of the assay and to set the cutoff value, a batch of 1100 pig sera was used. All pig sera were tested using the developed HEV Gt3 assay and two other serologic assays based on HEV Gt1 antigens. Since there is no gold standard available for HEV antibody testing, further validation and a definite setting of the cutoff of the developed HEV Gt3 assay were performed using a statistical approach based on Bayes' theorem. The developed and validated HEV antibody assay showed effective detection of HEV-specific antibodies. This assay can contribute to an improved detection of HEV antibodies and enable more reliable estimates of the prevalence of HEV Gt3 in swine in different regions.

  12. Luminol/antibody labeled gold nanoparticles for chemiluminescence immunoassay of carcinoembryonic antigen

    International Nuclear Information System (INIS)

    A facile strategy by loading luminol and secondary antibody on gold nanoparticles (Au NPs) was described in the present work. The as-prepared luminol/antibody labeled Au NPs conjugates (LAAu NPs) were used as the chemiluminescent probe for the detection of carcinoembryonic antigen (CEA) in serum. The LAAu NPs were characterized by transmission electron microscopy (TEM), UV-vis spectrophotometry (UV-vis), and chemiluminescent method. Stable and efficient chemiluminescence (CL) was obtained when luminol molecules and secondary antibodies were coimmobilized on the Au NPs by using hydrogen peroxide (H2O2) as an oxidant, horseradish peroxidase (HRP) as a catalyst, and 4-(4'-iodo)phenylphenol (IPP) as an enhancer. The LAAu NPs were further evaluated via a sandwich-type CL immunoassay of CEA in serum. In this protocol, the CEA analyte was captured by the primary antibody immobilized on the surface of magnetic beads, and then was sandwiched by the secondary antibody loaded on luminol-labeled Au NPs. The chemiluminescent intensity was proportional to the concentration of CEA over the range of 5.0 x 10-10 to 5.0 x 10-8 g mL-1 and 5.0 x 10-9 to 2.0 x 10-8 g mL-1 by using HRP and Co2+ as catalysts, respectively. The present chemiluminescent immunoassay based on the luminol/antibody labeled Au NPs conjugates has offered great promise for simple, highly biocompatible, and cost-effective analysis of biological samples.

  13. Immunoassays in monitoring biotechnological drugs.

    Science.gov (United States)

    Gygax, D; Botta, L; Ehrat, M; Graf, P; Lefèvre, G; Oroszlan, P; Pfister, C

    1996-08-01

    For the evaluation and interpretation of pharmacokinetic data reliable quantitative determinations are a requirement that can only be met by well-characterized and fully validated analytical methods. To cope with these requirements a method is being established that is based on an integrated and automated fiber-optic biospecific interaction analysis system (FOBIA) for immunoassays. Performance characteristics of this system used in monitoring of recombinant hirudin (CGP 39 393) are presented. Recombinant hirudin is a highly potent and selective inhibitor of human thrombin. Owing to its size and charge, recombinant hirudin is mainly eliminated by glomerular filtration. But only a fraction of the hirudin dose seems to be reabsorbed at the proximal tubule by luminal endocytosis and hydrolyzed by lysosomal enzymes, leaving approximately 50% of the dose to be extracted in the urine. Thus, renal clearance of recombinant hirudin in the absence of renal insufficiency appears to depend primarily on the glomerular filtration rate. During a 3-month i.v. tolerability study in dogs, some of the dogs developed antibodies against recombinant hirudin. The hirudin-antibody complex accumulated in plasma and apparent hirudin plasma concentrations were therefore much higher than expected from single-dose kinetics. Hirudin captured by antibodies showed an extended half-life and the hirudin-antibody complex is still pharmacologically active, as demonstrated by the observed increase in thrombin time. In conclusion, only appropriate analytical methods allow adequate monitoring and pharmacokinetic characterization of biotechnology drugs in biological materials. PMID:8857560

  14. TiO2–graphene complex nanopaper for paper-based label-free photoelectrochemical immunoassay

    International Nuclear Information System (INIS)

    Graphical abstract: - Abstract: A novel strategy was reported for the preparation of TiO2 nanobelts by the acid-assisted hydrothermal method. Complex nanopaper based on the TiO2 nanobelts and graphene was fabricated via a modified paper-making process. The as-prepared TiO2–graphene structure inherited the excellent electron transport of graphene and facilitated the spatial separation of photo-generated charge carrier, therefore resulting in the enhanced photocurrent, and making it a promising candidate for developing photoelectrochemical (PEC) biosensors. Thus, an advanced PEC biosensing platform for the detection of carcinoembryonic antigen was proposed at relatively low applied potential on screen-printed working paper-electrode using the as-prepared TiO2–graphene complex nanopaper. The complex nanopaper with good biocompatibility showed high PEC intensity and satisfactory stability, all of which held great promise for the fabrication of PEC biosensors with improved sensitivity. Furthermore, the TiO2–graphene complex nanopaper based PEC biosensor in this study was anticipated to provide the chance for the design of high-performance PEC biosensors for the detection of other enzymes and biomolecules

  15. Fluorescence fluctuation immunoassay.

    Science.gov (United States)

    Elings, V B; Nicoli, D F; Briggs, J

    1983-01-01

    The homogeneous fluorescent immunoassay described above allows one to measure the brightness of fluorescently tagged carrier particles that are suspended in a background of free, unbound fluorescent sources. We have demonstrated the feasibility of our technique using a gentamicin competitive assay as well as idealized model systems. We have seen that the fluctuation-correlation method is able to discriminate against free background sources because each fluorescing particle in solution contributes to the correlation peak [Eq. (4)] with a weighting equal to the square of its respective intensity. Hence, a few very bright sources contribute disproportionately to the "signal" relative to many weak ones. To take advantage of this property, one would therefore design an assay that uses relatively larger carrier particles, each of which is capable of binding on the order of 10(3) to 10(4) tagged antibodies or antigens. Unfortunately, the nonlinear dependence of the correlation peak on the brightness of the fluorescing species causes the technique to be perturbed by carrier particle aggregation; the apparent bound fluorescence intensity increases with the extent of aggregation. The latter may be an unavoidable consequence of performing assays using raw blood serum, for example. The ultimate usefulness of this method will depend on its sensitivity and speed when applied to "real" assays of clinical significance. These characteristics will be influenced by a number of technical details. Given our limited experience with the method thus far, it would appear that its principal drawback is its relatively slow speed. In order to decrease the time needed for a reliable measurement, one must average the random fluctuations in the fluorescent intensity to zero more quickly. In principle, this can be accomplished by decreasing the shot noise by collecting a larger fraction of the fluorescent light, and increasing the sampling rate. The method requires rather complicated

  16. Development of nanogold-based lateral flow immunoassay for the detection of ochratoxin A in buffer systems.

    Science.gov (United States)

    Moon, Jihea; Kim, Giyoung; Lee, Sangdae

    2013-11-01

    Ochratoxin A (OTA), classified as a possible human renal carcinogen (group 2B), is a potent toxin as to cause the nephropathy. Many methods have been proposed and reviewed for OTA determination in food and agricultural products. However, current analytical procedures of mycotoxin are based on the time-delayed analysis. To reduce the contamination of OTA during distribution and storage of food and feeds, a rapid and easy-to-use detection method is required. The strip assay is an easy and fast detection method that is very reliable and cheap in production. The purpose of this study was to improve the sensitivity of strip sensor by simplifying the manufacturing steps and detection reading. Feasibility of strip assay detection of OTA was determined by color appearance of test line that was produced by the binding between OTA-BSA conjugates and gold antibody particles. However, in this study, strip assays were improved the efficacy of detection by conjugating with nanoparticles and OTA-BSA conjugates, instead of antibody. By different optimization steps in strip manufacturing and the application of the label on the strips, an increase in sensitivity and applicability was accomplished. The method uses a low cost test device consisting of a conjugation pad, membrane, sample pad, and absorbent pad. OTA-BSA and their conjugates with colloidal gold nanoparticles were prepared. The detection was based on the competition of OTA in a sample and an OTA-BSA on the colloidal particle surfaces for the binding to antibody of OTA immobilized on a membrane. It allows direct analysis of sample containing 10% methanol in phosphate buffered saline. The limit of detection obtained was 10 ng/ml for OTA. The cross reactivity of OTA strip assays with Aflatoxin B1 (AFB1) was examined. When 10, 100 ng/ml of AFB1 was tested, non-specific binding was not observed in the test strip. PMID:24245237

  17. A robust electrochemiluminescence immunoassay for carcinoembryonic antigen detection based on a microtiter plate as a bridge and Au@Pd nanorods as a peroxidase mimic.

    Science.gov (United States)

    Zhang, Yong; Pang, Xuehui; Wu, Dan; Ma, Hongmin; Yan, Zhaoqing; Zhang, Jiatao; Du, Bin; Wei, Qin

    2016-01-01

    The common drawbacks of most traditional electrochemiluminescence (ECL) immunoassays are the strict storage conditions for the ECL electrode and the steric hindrance caused by bovine serum albumin and antigen. The strict storage conditions require that the modified electrode must be stored at 4 °C before measurement, which may cause the degradation of protein molecules and low reproducibility as the time goes by. The steric hindrance can hinder electron transfer between the electrode and the electrochemical active substance unable to transmit proteins on the electrode surface. The current study takes a 96-well microtiter plate (MTP) as a bridge for analyte pre-treatment and Au@Pd nanorods as a peroxidase mimic to assemble a simple and robust ECL immunoassay. Advantages of such assay include not only high sensitivity but also robust detection circumstance. We demonstrated the method by detecting carcinoembryonic antigen from human serum and obtained a good detection limit of 3 fg mL(-1). PMID:26609799

  18. Chip-Based Measurements of Brownian Relaxation of Magnetic Beads Using a Planar Hall Effect Magnetic Field Sensor

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Dalslet, Bjarke Thomas; Snakenborg, Detlef;

    2010-01-01

    We present a simple 'click-on' fluidic system with integrated electrical contacts, which is suited for electrical measurements on chips in microfluidic systems. We show that microscopic magnetic field sensors based on the planar Hall effect can be used for detecting the complex magnetic response...

  19. Development of an improved immunoassay for detection of sorLA in cells and biological samples

    DEFF Research Database (Denmark)

    Andersen, Olav Michael; Thakurta, Ishita Guha; West, Mark J.

    bead releases singlet oxygen which triggers a series of chemical reactions in the acceptor beads causing a sharp peak of light emission at 615 nm. A series of experiments were designed to optimize the assay by conjugation of the beads to various anti-sorLA antibodies, cross titrations of the antibodies......, spike and recovery experiments to check matrix interference, signal to noise ratio determined for the counts, and comparison of our novel immunoassay in terms of sensitivity with existing methods. Results: Our results show that as compared to traditional methods, AlphaLISA is a sensitive and rapid assay......, which can be automated suitably for determination of sorLA in large sample batches. It also shows high recovery and signal to noise ratio. Conclusions: The results support the development of an improved method for measuring sorLA quantitatively, which could further prove as an important tool in...

  20. Qualitative evaluation of in-house immunoassays of T3 and T4 and TSH based on bulk reagents

    International Nuclear Information System (INIS)

    Increase in cost of RIA (radioimmunoassay) kit assays has led to our attempts to seek cheaper alternates. Assays based on bulk reagents were started in 1988. Statistical and quality control data on 50,51 and 52 assay batches of T3,T4 and TSH respectively has been collected from the beginning. Cumulative assay parameters show that T3 and T4 assays are almost equally precise. TSH assay is most imprecise in the group especially at low concentration levels. The working ranges of T3 and T4 assays defined at 10% error limit are quite wide and cover low, medium and high levels of hormones. In TSH the assay working range does not cover levels below 10 micro lU/ml. The variability of curve parameters is similar in this group of assays. Quality control results are most reproducible in T4 assays with a batch variability of 11.9% T3 and TSH assay results are equally reproducible. Overall within assay drift is low in all assays. IQC charts of these assays show occasional significant positive or negative shift of results from mean which might be related to methodological variations of quality among various distributions of reagents. The reproducibility and precision of results could be further improved by harmonizing distributions of reagents. (author)

  1. Suspension column for recovery and separation of substances using ultrasound-assisted retention of bead sorbents.

    Science.gov (United States)

    Spivakov, Boris Ya; Shkinev, Valeriy M; Danilova, Tatiana V; Knyazkov, Nikolai N; Kurochkin, Vladimir E; Karandashev, Vasiliy K

    2012-12-15

    A novel approach to sorption recovery and separation of different substances is proposed which is based on the use of suspended bead sorbents instead of conventional packed beds of such sorbents. This makes it possible to employ small-sized beads which are trapped in a low-pressure column due to ultrasound-assisted retention, without any frits to hold the sorption material. A flow system including a separation mini-column, named herein a suspension column, has been developed and tested by the studies of solid phase extraction (SPE) of trace metals from bi-distilled water and sea water using a 150-μL column with a silica-based sorbent containing iminodiacetic groups (DIAPAK IDA) and having a grain size of 6 μm. The adsorption properties of DIAPAK IDA suspension (9.5mg) were evaluated through adsorption/desorption experiments, where the effect of solution pH and eluent on the SPE of trace metals were examined by ICP-MS or ICP-AES measurements. When sample solution was adjusted to pH 8.0 and 1 mol L(-1) nitric acid was used as eluent, very good recoveries of more than 90% were obtained for a number of elements in a single-step extraction. To demonstrate the versatility of the approach proposed and to show another advantage of ultrasonic field (acceleration of sorbate/sorbent interaction), a similar system was used for heterogeneous immunoassays of some antigens in ultrasonic field using agarose sorbents modified by corresponding antibodies. It has been shown that immunoglobulins, chlamidia, and brucellos bacteria can be quantitatively adsorbed on 15-μm sorbent (15 particles in 50 μL) and directly determined in a 50-μL mini-chamber using fluorescence detection. PMID:23182579

  2. Gastroretentive delivery systems: hollow beads.

    Science.gov (United States)

    Talukder, R; Fassihi, R

    2004-04-01

    The objective of this study was to develop a floatable multiparticulate system with potential for intragastric sustained drug delivery. Cross-linked beads were made by using calcium and low methoxylated pectin (LMP), which is an anionic polysaccharide, and calcium, LMP, and sodium alginate. Beads were dried separately in an air convection type oven at 40 degrees C for 6 hours and in a freeze dryer to evaluate the changes in bead characteristics due to process variability. Riboflavin (B-2), tetracycline (TCN), and Methotrexate (MTX) were used as model drugs for encapsulation. Ionic and nonionic excipients were added to study their effects on the release profiles of the beads. The presence of noncross linking agents in low amounts (less than 2%) did not significantly interfere with release kinetics. For an amphoteric drug like TCN, which has pH dependent solubility, three different pHs (1.5, 5.0, and 8.0) of cross-linking media were used to evaluate the effects of pH on the drug entrapment capacity of the beads. As anticipated, highest entrapment was possible when cross-linking media pH coincided with least drug solubility. Evaluation of the drying process demonstrated that the freeze-dried beads remained buoyant over 12 hours in United States Pharmacopeia (USP) hydrochloride buffer at pH 1.5, whereas the air-dried beads remained submerged throughout the release study. Confocal laser microscopy revealed the presence of air-filled hollow spaces inside the freeze dried beads, which was responsible for the flotation property of the beads. However, the release kinetics from freeze dried beads was independent of hydrodynamic conditions. Calcium-pectinate-alginate beads released their contents at much faster rates than did calcium-pectinate beads (100% in 10 hours vs. 50% in 10 hours). It appears that the nature of cross-linking, drying method, drug solubility, and production approach are all important and provide the opportunity and potential for development of a

  3. Selective collection and detection of MCF-7 breast cancer cells using aptamer-functionalized magnetic beads and quantum dots based nano-bio-probes

    Energy Technology Data Exchange (ETDEWEB)

    Hua, Xin [State Key Laboratory of Bioelectronics, School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China); Zhou, Zhenxian [Nanjing Second Hospital, Nanjing 210083 (China); Yuan, Liang [State Key Laboratory of Bioelectronics, School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China); Liu, Songqin, E-mail: liusq@seu.edu.cn [State Key Laboratory of Bioelectronics, School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China)

    2013-07-25

    Graphical abstract: -- Highlights: •Aptamer–cell affinity interaction was employed for selective collection and detection of MCF-7. •CdTe QDs and aptamer were coated on SiO{sub 2} NPs for bio-labeling. •Good sensitivity was achieved due to the signal amplification of SiO{sub 2} NPs. -- Abstract: A novel strategy for selective collection and detection of breast cancer cells (MCF-7) based on aptamer–cell interaction was developed. Mucin 1 protein (MUC1) aptamer (Apt1) was covalently conjugated to magnetic beads to capture MCF-7 cell through affinity interaction between Apt1 and MUC1 protein that overexpressed on the surface of MCF-7 cells. Meanwhile, a nano-bio-probe was constructed by coupling of nucleolin aptamer AS1411 (Apt2) to CdTe quantum dots (QDs) which were homogeneously coated on the surfaces of monodispersed silica nanoparticles (SiO{sub 2} NPs). The nano-bio-probe displayed similar optical and electrochemical performances to free CdTe QDs, and remained high affinity to nucleolin overexpressed cells through the interaction between AS1411 and nucleolin protein. Photoluminescence (PL) and square-wave voltammetric (SWV) assays were used to quantitatively detect MCF-7 cells. Improved selectivity was obtained by using these two aptamers together as recognition elements simultaneously, compared to using any single aptamer. Based on the signal amplification of QDs coated silica nanoparticles (QDs/SiO{sub 2}), the detection sensitivity was enhanced and a detection limit of 201 and 85 cells mL{sup −1} by PL and SWV method were achieved, respectively. The proposed strategy could be extended to detect other cells, and showed potential applications in cell imaging and drug delivery.

  4. An ultrasensitive electrochemiluminescent immunoassay for aflatoxin M1 in milk, based on extraction by magnetic graphene and detection by antibody-labeled CdTe quantumn dots-carbon nanotubes nanocomposite.

    Science.gov (United States)

    Gan, Ning; Zhou, Jing; Xiong, Ping; Hu, Futao; Cao, Yuting; Li, Tianhua; Jiang, Qianli

    2013-05-01

    An ultrasensitive electrochemiluminescent immunoassay (ECLIA) for aflatoxins M1 (ATM1) in milk using magnetic Fe3O4-graphene oxides (Fe-GO) as the absorbent and antibody-labeled cadmium telluride quantum dots (CdTe QDs) as the signal tag is presented. Firstly, Fe3O4 nanoparticles were immobilized on GO to fabricate the magnetic nanocomposites, which were used as absorbent to ATM1. Secondly, aflatoxin M1 antibody (primary antibody, ATM1 Ab1), was attached to the surface of the CdTe QDs-carbon nanotubes nanocomposite to form the signal tag (ATM1 Ab1/CdTe-CNT). The above materials were characterized. The optimal experimental conditions were obtained. Thirdly, Fe-GO was employed for extraction of ATM1 in milk. Results indicated that it can adsorb ATM1 efficiently and selectively within a large extent of pH from 3.0 to 8.0. Adsorption processes reached 95% of the equilibrium within 10 min. Lastly, the ATM1 with a serial of concentrations absorbed on Fe-GO was conjugated with ATM1 Ab1/CdTe-CNT signal tag based on sandwich immunoassay. The immunocomplex can emit a strong ECL signal whose intensity depended linearly on the logarithm of ATM1 concentration from 1.0 to 1.0 × 10(5) pg/mL, with the detection limit (LOD) of 0.3 pg/mL (S/N = 3). The method was more sensitive for ATM1 detection compared to the ELISA method. Finally, ten samples of milk were tested based on the immunoassay. The method is fast and requires very little sample preparation, which was suitable for high-throughput screening of mycotoxins in food. PMID:23628784

  5. An Ultrasensitive Electrochemiluminescent Immunoassay for Aflatoxin M1 in Milk, Based on Extraction by Magnetic Graphene and Detection by Antibody-Labeled CdTe Quantumn Dots-Carbon Nanotubes Nanocomposite

    Directory of Open Access Journals (Sweden)

    Ning Gan

    2013-04-01

    Full Text Available An ultrasensitive electrochemiluminescent immunoassay (ECLIA for aflatoxins M1 (ATM1 in milk using magnetic Fe3O4-graphene oxides (Fe-GO as the absorbent and antibody-labeled cadmium telluride quantum dots (CdTe QDs as the signal tag is presented. Firstly, Fe3O4 nanoparticles were immobilized on GO to fabricate the magnetic nanocomposites, which were used as absorbent to ATM1. Secondly, aflatoxin M1 antibody (primary antibody, ATM1 Ab1, was attached to the surface of the CdTe QDs-carbon nanotubes nanocomposite to form the signal tag (ATM1 Ab1/CdTe-CNT. The above materials were characterized. The optimal experimental conditions were obtained. Thirdly, Fe-GO was employed for extraction of ATM1 in milk. Results indicated that it can adsorb ATM1 efficiently and selectively within a large extent of pH from 3.0 to 8.0. Adsorption processes reached 95% of the equilibrium within 10 min. Lastly, the ATM1 with a serial of concentrations absorbed on Fe-GO was conjugated with ATM1 Ab1/CdTe-CNT signal tag based on sandwich immunoassay. The immunocomplex can emit a strong ECL signal whose intensity depended linearly on the logarithm of ATM1 concentration from 1.0 to 1.0 × 105 pg/mL, with the detection limit (LOD of 0.3 pg/mL (S/N = 3. The method was more sensitive for ATM1 detection compared to the ELISA method. Finally, ten samples of milk were tested based on the immunoassay. The method is fast and requires very little sample preparation, which was suitable for high-throughput screening of mycotoxins in food.

  6. Microfluidic paper-based analytical device for photoelectrochemical immunoassay with multiplex signal amplification using multibranched hybridization chain reaction and PdAu enzyme mimetics.

    Science.gov (United States)

    Lan, Feifei; Sun, Guoqiang; Liang, Linlin; Ge, Shenguang; Yan, Mei; Yu, Jinghua

    2016-05-15

    Combining multibranched hybridization chain reaction (mHCR), the photoelectrochemical (PEC) immunosensor was fabricated with a microfluidic paper-based analytical devices using different sizes of CdTe quantum dots (QDs) sensitized flower-like 3D ZnO superstructures as photoactive materials. Firstly, 4-aminothiophenol (PATP) functioned ZnO was anchored on gold-paper working electrode. With the aid of PATP, large-sized CdTe-COOH QDs (QDs1) were conjugated onto the ZnO surface because of the formation of a strong bond (Zn-S) between the thiol of PATP molecule and the ZnO, and the remaining amino group formed an amide bond with carboxylic acid group capping CdTe. Then the small-sized CdTe-NH2 QDs (QDs2) were modified on the QDs1 by forming amide bond, which leaded to a very strong photocurrent response because of the formation of cosensitized structure. The designed mHCR produced long products with multiple branched arms, which could attached multiple PdAu nanoparticles and catalyze the oxidation of hydroquinone (HQ) using H2O2 as anoxidant. Double strands DNA with multiple branched arms (mdsDNA) was formed by mHCR. In the presence of carcinoembryonic antigen (CEA), PdAu-mdsDNA conjugates-labeled CEA antibody was captured. The concentrations of CEA were measured through the decrease in photocurrent intensity resulting from the increase in steric hindrance of the immunocomplex and the polymeric oxidation product of HQ. In addition, the oxidation product of HQ deposited on the as-obtained electrode, which could efficiently inhibit the photoinduced electron transfer. Under optimal conditions, the PEC immunosensor exhibited excellent analytical performance: the detection range of CEA was from 0.001 to 90ngmL(-1) with low detection limit of 0.33pgmL(-1). The as-obtained immunosensor exhibited excellent precision, prominent specificity, acceptable stability and reproducibility, and could be used for the detection of CEA in real samples. The proposed assay opens a promising

  7. A disposable immunomagnetic electrochemical sensor based on functionalised magnetic beads on gold surface for the detection of atrazine

    International Nuclear Information System (INIS)

    A disposable immunomagnetic electrochemical sensor involving magnetic particles was developed and applied for the detection of atrazine. The sensor was based on a magnetic monolayer of magnetic particles coated with streptavidin, formed on a gold electrode after application of a magnetic field. The magnetic monolayer was characterized using faradaic impedance spectroscopy, cyclic voltammetry and atomic force microscopy (AFM) techniques. The magnetic monolayer formation leads to an important change in constant phase element due to a change in thickness. AFM images show that the magnetic monolayer is formed and is very dense. The atrazine interacts with biotinyl-Fab fragment K47 and the immunoreaction was characterized by impedance spectroscopy. A decrease in electron transfer resistance was observed which could be attributed to rearrangements in the magnetic monolayer. This approach leads to a sensitive detection of atrazine, acting as an antigen, with a good linear response in the range 10-600 ng/ml

  8. Microstructure-based calculations and experimental results for sound absorbing porous layers of randomly packed rigid spherical beads

    Science.gov (United States)

    Zieliński, Tomasz G.

    2014-07-01

    Acoustics of stiff porous media with open porosity can be very effectively modelled using the so-called Johnson-Champoux-Allard-Pride-Lafarge model for sound absorbing porous media with rigid frame. It is an advanced semi-phenomenological model with eight parameters, namely, the total porosity, the viscous permeability and its thermal analogue, the tortuosity, two characteristic lengths (one specific for viscous forces, the other for thermal effects), and finally, viscous and thermal tortuosities at the frequency limit of 0 Hz. Most of these parameters can be measured directly, however, to this end specific equipment is required different for various parameters. Moreover, some parameters are difficult to determine. This is one of several reasons for the so-called multiscale approach, where the parameters are computed from specific finite-element analyses based on some realistic geometric representations of the actual microstructure of porous material. Such approach is presented and validated for layers made up of loosely packed small identical rigid spheres. The sound absorption of such layers was measured experimentally in the impedance tube using the so-called two-microphone transfer function method. The layers are characterised by open porosity and semi-regular microstructure: the identical spheres are loosely packed by random pouring and mixing under the gravity force inside the impedance tubes of various size. Therefore, the regular sphere packings were used to generate Representative Volume Elements suitable for calculations at the micro-scale level. These packings involve only one, two, or four spheres so that the three-dimensional finite-element calculations specific for viscous, thermal, and tortuous effects are feasible. In the proposed geometric packings, the spheres were slightly shifted in order to achieve the correct value of total porosity which was precisely estimated for the layers tested experimentally. Finally, in this paper some results based on

  9. Using permalloy based planar hall effect sensors to capture and detect superparamagnetic beads for lab on a chip applications

    International Nuclear Information System (INIS)

    Experimental studies have been carried out on planar Hall effect (PHE) sensors used to detect magnetic nanoparticles employed as labels for biodetection applications. Disk shaped sensors, 1 mm diameter, were structured on Permalloy film, 20 nm thick. To control the sensor magnetisation state and thus the field sensitivity and linearity, a DC biasing field has been applied parallel to the driving current. Maghemite nanoparticles (10 nm) functionalised with Polyethylene glycol (PEG) 6000 were immobilised over the sensor surface using particular magnetisation state and applied magnetic fields. In order to obtain a higher response from the magnetic nanoparticles, it was used a detection setup which allows the application of magnetic fields larger than 100 Oe but avoiding saturation of the PHE signal. Based on this setup, two field scanning methods are presented in this paper. During our experiments, low magnetic moments, of about 1.87×10−5 emu, have been easily detected. This value corresponds to a mass of 9.35 µg of maghemite nanoparticles functionalised with PEG 6000. The results suggest that this type of structure is feasible for building low cost micrometer sized PHE sensors to be used for high-resolution bio sensing applications. - Highlights: • Disk-shaped Permalloy planar Hall effect sensors have been obtained and tested. • Two field scanning methods have been proposed. • The magnetic nanoparticles can be trapped on the sensor surface. • High detection sensitivity has been obtained

  10. Improvement of immunoassay detection system by using alternating current magnetic susceptibility

    Science.gov (United States)

    Kawabata, R.; Mizoguchi, T.; Kandori, A.

    2016-03-01

    A major goal with this research was to develop a low-cost and highly sensitive immunoassay detection system by using alternating current (AC) magnetic susceptibility. We fabricated an improved prototype of our previously developed immunoassay detection system and evaluated its performance. The prototype continuously moved sample containers by using a magnetically shielded brushless motor, which passes between two anisotropic magneto resistance (AMR) sensors. These sensors detected the magnetic signal in the direction where each sample container passed them. We used the differential signal obtained from each AMR sensor's output to improve the signal-to-noise ratio (SNR) of the magnetic signal measurement. Biotin-conjugated polymer beads with avidin-coated magnetic particles were prepared to examine the calibration curve, which represents the relation between AC magnetic susceptibility change and polymer-bead concentration. For the calibration curve measurement, we, respectively, measured the magnetic signal caused by the magnetic particles by using each AMR sensor installed near the upper or lower part in the lateral position of the passing sample containers. As a result, the SNR of the prototype was 4.5 times better than that of our previous system. Moreover, the data obtained from each AMR sensor installed near the upper part in the lateral position of the passing sample containers exhibited an accurate calibration curve that represented good correlation between AC magnetic susceptibility change and polymer-bead concentration. The conclusion drawn from these findings is that our improved immunoassay detection system will enable a low-cost and highly sensitive immunoassay.

  11. A High-Throughput SU-8Microfluidic Magnetic Bead Separator

    OpenAIRE

    Bu, Minqiang; Christensen, T. B.; Smistrup, Kristian; Wolff, Anders; Hansen, Mikkel Fougt

    2007-01-01

    We present a novel microfluidic magnetic bead separator based on SU-8 fabrication technique for high through-put applications. The experimental results show that magnetic beads can be captured at an efficiency of 91 % and 54 % at flow rates of 1 mL/min and 4 mL/min, respectively. Integration of soft magnetic elements in the chip leads to a slightly higher capturing efficiency and a more uniform distribution of captured beads over the separation chamber than the system without soft magnetic el...

  12. Development and characterization of a magnetic bead-quantum dot nanoparticles based assay capable of Escherichia coli O157:H7 quantification

    International Nuclear Information System (INIS)

    The development and characterization of a magnetic bead (MB)-quantum dot (QD) nanoparticles based assay capable of quantifying pathogenic bacteria is presented here. The MB-QD assay operates by having a capturing probe DNA selectively linked to the signaling probe DNA via the target genomic DNA (gDNA) during DNA hybridization. The signaling probe DNA is labeled with fluorescent QD565 which serves as a reporter. The capturing probe DNA is conjugated simultaneously to a MB and another QD655, which serve as a carrier and an internal standard, respectively. Successfully captured target gDNA is separated using a magnetic field and is quantified via a spectrofluorometer. The use of QDs (i.e., QD565/QD655) as both a fluorescence label and an internal standard increased the sensitivity of the assay. The passivation effect and the molar ratio between QD and DNA were optimized. The MB-QD assay demonstrated a detection limit of 890 zeptomolar (i.e., 10-21 mol L-1) concentration for the linear single stranded DNA (ssDNA). It also demonstrated a detection limit of 87 gene copies for double stranded DNA (dsDNA) eaeA gene extracted from pure Escherichia coli (E. coli) O157:H7 culture. Its corresponding dynamic range, sensitivity, and selectivity were also presented. Finally, the bacterial gDNA of E. coli O157:H7 was used to highlight the MB-QD assay's ability to detect below the minimum infective dose (i.e., 100 organisms) of E. coli O157:H7 in water environment.

  13. An Ultrasensitive Electrochemiluminescence Immunoassay for Carbohydrate Antigen 19-9 in Serum Based on Antibody Labeled Fe3O4 Nanoparticles as Capture Probes and Graphene/CdTe Quantum Dot Bionanoconjugates as Signal Amplifiers

    Directory of Open Access Journals (Sweden)

    Ning Gan

    2013-05-01

    Full Text Available The CdTe quantum dots (QDs, graphene nanocomposite (CdTe-G and dextran–Fe3O4 magnetic nanoparticles have been synthesized for developing an ultrasensitive electrochemiluminescence (ECL immunoassay for Carcinoembryonic antigen 19-9 (CA 19-9 in serums. Firstly, the capture probes (CA 19-9 Ab1/Fe3O4 for enriching CA 19-9 were synthesized by immobilizing the CA 19-9’s first antibody (CA 19-9 Ab1 on magnetic nanoparticles (dextran-Fe3O4. Secondly, the signal probes (CA 19-9 Ab2/CdTe-G, which can emit an ECL signal, were formed by attaching the secondary CA 19-9 antibody (CA 19-9 Ab2 to the surface of the CdTe-G. Thirdly, the above two probes were used for conjugating with a serial of CA 19-9 concentrations. Graphene can immobilize dozens of CdTe QDs on their surface, which can emit stronger ECL intensity than CdTe QDs. Based on the amplified signal, ultrasensitive antigen detection can be realized. Under the optimal conditions, the ECL signal depended linearly on the logarithm of CA 19-9 concentration from 0.005 to 100 pg/mL, and the detection limit was 0.002 pg/mL. Finally, five samples of human serum were tested, and the results were compared with a time-resolved fluorescence assay (TRFA. The novel immunoassay provides a stable, specific and highly sensitive immunoassay protocol for tumor marker detection at very low levels, which can be applied in early diagnosis of tumor.

  14. A Universal Approach for Selective Trace Metal Determinations via Sequential Injection-Bead Injection-Lab-on-Valve (SI-BI-LOV) Using Renewable Reagent-loaded Hydrophobic Beads

    DEFF Research Database (Denmark)

    Long, Xiangbao; Miró, Manuel; Hansen, Elo Harald

    A new sample pretreatment approach is presented for selective and sensitive determination of trace metals via electrothermal atomic absorption spectrometry (ETAAS) based on the principle of bead injection (BI) with renewable reagent-loaded hydrophobic beads in a Sequential Injection...

  15. Development and Clinical Evaluation of a Recombinant-Antigen-Based Cytomegalovirus Immunoglobulin M Automated Immunoassay Using the Abbott AxSYM Analyzer

    OpenAIRE

    Maine, G T; Stricker, R; Schuler, M.; Spesard, J.; Brojanac, S.; Iriarte, B.; Herwig, K.; Gramins, T.; Combs, B.; Wise, J.; Simmons, H.; Gram, T.; Lonze, J.; Ruzicki, D.; Byrne, B

    2000-01-01

    A new microparticle enzyme immunoassay (MEIA), the Cytomegalovirus (CMV) Immunoglobulin M (IgM) test, was developed on the Abbott AxSYM analyzer. This test uses recombinant CMV antigens derived from portions of four structural and nonstructural proteins of CMV: pUL32 (pp150), pUL44 (pp52), pUL83 (pp65), and pUL80a (pp38). A total of 1,608 specimens from random volunteer blood donors (n = 300), pregnant women (n = 1,118), transplant recipients (n = 6), and patients with various clinical condit...

  16. Application of immunoassays in parasitic diseases

    International Nuclear Information System (INIS)

    Radioimmunoassay has proved to be extremely valuable in the detection of low levels of particular antigens or antibodies in complex mixtures but it is not convenient for most field uses. Recently, highly sensitive RIA methods for detecting schistosomal antibody and malarial parasitaemia have been described. Enzyme immunoassay based on the Enzyme-Linked Immunosorbent Assay (ELISA), in which enzyme-labelled antibodies are used to generate a coloured substrate product, have been enthusiastically received by parasitologists. These assays, especially the indirect method using enzyme-labelled anti-species globulin, have been employed to detect antibodies in virtually all parasitic diseases. The only requirement is that a suitable soluble antigen be available for attachment to the solid-phase surface. The ELISA is already accepted as the best immunoassay for the epidemiological study of trichinosis, schistosomiasis and Chagas disease, to name but a few. The merits of simplicity and sensitivity and ease of mass processing of samples is the reason for this. These tests have also been shown to be useful immunodiagnostic methods for toxocariasis, echinococcus, leishmaniasis, trypanosomiasis, toxoplasmosis and amoebiasis. Until very recently the mainstay of parasitic immunodiagnosis was the indirect fluorescent antibody test (IFA). IFA has been the reference test for the immunodiagnosis of amoebiasis, Chagas disease, trypanosomiasis, toxoplasmosis and malaria for many years. It is especially suitable for rapid diagnosis where only a few samples are to be tested. This brief review indicates the wide potential of labelled reagent immunoassays which currently dominate the immunodiagnosis and sero-epidemiology of parasitic diseases. It is clear that these methods are contributing greatly to the rapid detection and changes in parasitic disease patterns, information which is vital to the control of these scourges of the third world

  17. Multiplex Immunoassay of Plasma Cytokine Levels in Men with Alcoholism and the Relationship to Psychiatric Assessments

    Science.gov (United States)

    Manzardo, Ann M.; Poje, Albert B.; Penick, Elizabeth C.; Butler, Merlin G.

    2016-01-01

    Chronic alcohol use alters adaptive immunity and cytokine activity influencing immunological and hormone responses, inflammation, and wound healing. Brain cytokine disturbances may impact neurological function, mood, cognition and traits related to alcoholism including impulsiveness. We examined the relationship between plasma cytokine levels and self-rated psychiatric symptoms in 40 adult males (mean age 51 ± 6 years; range 33–58 years) with current alcohol dependence and 30 control males (mean age 48 ± 6 years; range 40–58 years) with no history of alcoholism using multiplex sandwich immunoassays with the Luminex magnetic-bead based platform. Log-transformed cytokine levels were analyzed for their relationship with the Symptom Checklist-90R (SCL-90R), Barratt Impulsivity Scales (BIS) and Alcoholism Severity Scale (ASS). Inflammatory cytokines (interferon γ-induced protein-10 (IP-10); monocyte chemoattractant protein-1 (MCP1); regulated on activation, normal T cell expressed and secreted (RANTES)) were significantly elevated in alcoholism compared to controls while bone marrow-derived hematopoietic cytokines and chemokines (granulocyte-colony stimulating factor (GCSF); soluble CD40 ligand (sCD40L); growth-related oncogene (GRO)) were significantly reduced. GRO and RANTES levels were positively correlated with BIS scales; and macrophage-derived chemokine (MDC) levels were positively correlated with SCL-90R scale scores (p phobia. The novel association between RANTES and GRO and impulsivity phenotype in alcoholism should be further investigated in alcoholism and psychiatric conditions with core impulsivity and anxiety phenotypes lending support for therapeutic intervention. PMID:27043532

  18. Evaluation of an immunoassay for determination of plasma efavirenz concentrations in resource-limited settings

    DEFF Research Database (Denmark)

    Abdissa, Alemseged; Wiesner, Lubbe; McIlleron, Helen;

    2014-01-01

    be implemented in resource-limited settings. This study evaluated a commercially available immunoassay for measurement of plasma efavirenz. METHODS: The immunoassay-based method was applied to measure efavirenz using a readily available Humastar 80 chemistry analyzer. We compared plasma efavirenz...... concentrations measured by the immunoassay with liquid chromatography tandem mass spectrometry (LC-MS/MS) (reference method) in 315 plasma samples collected from HIV patients on treatment. Concentrations were categorized as suboptimal<1 µg/ml, normal 1-4 µg/ml or high>4 µg/ml. Agreement between results of the...... agreement assessed by Bland-Altman plots were -2.54; 1.70 µg/ml. Although immunoassay underestimated high concentrations, it had good agreement for classification into low, normal or high concentrations (K=0.74). CONCLUSIONS: The immunoassay is a feasible alternative to determine efavirenz in areas with...

  19. Optimization of GMAW process of AA 6063-T5 aluminum alloy butt joints based on the response surface methodology and on the bead geometry

    International Nuclear Information System (INIS)

    The geometry of the weld beads is characterized by the overhead, the width and the penetration. These values are indices of the behavior of the welded joint and therefore, they can be considered as factors that control the process. This work is performed to optimize the GMAW process of the aluminum alloy AA 6063-T5 by means of the response surface methodology (RSM). The variables herein considered are the arc voltage, the welding speed, the wire feed speed and the separation between surfaces in butt joints. The response functions that are herein studied are the overhead, the width, the penetration and the angle of the bead. The obtained results by RSM show high grade of agreement with the experimental values. The procedure is experimentally validated by welding for the theoretically obtained optimized technological conditions and a wide agreement between theoretical and experimental values is found. (Author) 16 refs.

  20. Magnetic manipulation and sensing of beads for bioapplications

    DEFF Research Database (Denmark)

    Henriksen, Anders Dahl

    . It was found that a symmetric geometry with equal stripe width and spacing was optimal, and that the stripe period should be thrice the bead radius. Magnetophoretic bead velocities of 300 μm/s were measured, and selective separation based on differences in magnetophoretic mobility was hypothesized. However......, the fabricated magnetophoresis systems had two major limitations. First, protein-coated magnetic beads had a tendency to stick to the surface, even though multiple surface blockings and modifications were tried. Second, as the systems are fabricated using a single UV lithography step, the stripe width has...... measurements and is optimized for detecting small amounts of surface bound beads. The next study analyzes the thermal properties of the chip and setup. General methods for measuring or calculating the effective heat conductivity are given, along with a discussion on how to optimize this to facilitate the use...

  1. Archaeological study of ostrich eggshell beads collected from SDG site

    Institute of Scientific and Technical Information of China (English)

    WANG ChunXue; ZHANG Yue; GAO Xing; ZHANG XiaoLing; WANG HuiMin

    2009-01-01

    Ostrich eggshell beads and fragments collected from SDG site reflect primordial art and a kind of symbolic behavior of modern humans.Based on stratigraphic data and OSL dating,these ostrich eggshell beads are probably in Early Holocene (<10 ka BP).Two different prehistoric manufacturing pathways are usually used in the manufacture of ostrich eggshell beads in Upper Paleolithic.According to statistic analysis of the characteristics of ostrich eggshell beads,Pathway 1 is identified from these collections.In pathway 1,blanks are drilled prior to being trimmed to rough discs.They exhibit great potential for the study of the origin of primordial art and the development of ancient cultures and provide important data for studying behavioral options adopted by hominids in SDG area.In addition,they bear important implications for the origin of modern humans in East Asia.

  2. Spray drying of bead resins: feasibility tests

    International Nuclear Information System (INIS)

    Rockwell International has developed a volume reduction system for low-level reactor wastes based on drying the wastes in a heated-air spray dryer. The drying of slurries of sodium sulfate, boric acid, and powdered ion exchange resins was demonstrated in previous tests. The drying of bead ion exchange resins can be especially difficult due to the relatively large size of bead resins (about 500 to 800 microns) and their natural affinity for water. This water becomes part of the pore structure of the resins and normally comprises 50 t 60 wt % of the resin weight. A 76-cm-diameter spray dryer was used for feasibility tests of spray drying of cation and anion bead resins. These resins were fed to the dryer in the as-received form (similar to dewatered resins) and as slurries. A dry, free-flowing product was produced in all the tests. The volume of the spray-dried product was one-half to one-third the volume of the as-received material. An economic analysis was made of the potential cost savings that can be achieved using the Rockwel spray dryer system. In-plant costs, transportation costs, and burial costs of spray-dried resins were compared to similar costs for disposal of dewatered resins. A typical utility producing 170 m3 (6,000 ft3) per year of dewatered resins can save $600,000 to $700,000 per year using this volume reduction system

  3. Fabrication of multiwalled carbon nanotubes-magnetite nanocomposite as an effective ultra-sensing platform for the early screening of nasopharyngeal carcinoma by luminescence immunoassay.

    Science.gov (United States)

    Liu, Chia-Ching; Sadhasivam, S; Savitha, S; Lin, Feng-Huei

    2014-05-01

    The hybrid nanocomposite that consists of multiwalled carbon nanotubes (MWCNTs) and magnetite (Fe₃O4) was fabricated by chemical co-precipitation method. Briefly, CNTs were oxidized with acids to form carboxylic group and then co-precipitated with Fe₃O4 to form CNT-Fe₃O4 nanocomposites. The nanocomposites were characterized by SEM, HRTEM, XRD, FTIR X-ray photoelectron spectrometry (XPS) and SQUID. The XRD results indicated the high crystallinity of Fe₃O₄ nanoparticles with spinel structure and the transmission electron microscope images depicted the intercalated iron oxide magnetic particles on the surface of CNTs. The MWCNTs-Fe₃O₄ was applied as a sensing interface to perform luminescence enzyme immunoassays. Firstly, EBNA-1 antigen was immobilized onto the carboxyl group functionalized MWCNTs-Fe₃O₄, followed by binding with anti-EBNA-1 IgA antibodies. The diluted secondary antibodies (anti-human IgA-HRP) were then added to the CNTs/Fe₃O₄-PEG-EBNA-1-anti-EBV IgA ab complex and act as a catalyst to produce a visible light upon reaction with the substrate luminol. The formed RLU is proportional to the amount of IgA anti-EBV antiobodies on the MWCNTs. The detection limit of proposed CNTs/Fe₃O₄ based luminescence enzyme immunoassay was in the order of 0.00128 EU/mL (1:100,000 fold dilution) for the detection of anti-EBV IgA antibodies, whereas the commercial ELISA and magnetic beads' assay was accounted for up to the dilution fold of 1000 (i.e., 0.128 EU/mL). The initial findings showed that CNTs/Fe₃O₄ nanocomposites have a great potential in luminescent enzyme immunoassays and could be used as a sensing platform for the early screening of nasopharyngeal carcinoma. PMID:24720983

  4. Fluorescence Polarization Immunoassay of Mycotoxins: A Review

    OpenAIRE

    Maragos, Chris

    2009-01-01

    Immunoassays are routinely used in the screening of commodities and foods for fungal toxins (mycotoxins). Demands to increase speed and lower costs have lead to continued improvements in such assays. Because many reported mycotoxins are low molecular weight (below 1 kDa), immunoassays for their detection have generally been constructed in competitive heterogeneous formats. An exception is fluorescence polarization immunoassay (FPIA), a homogeneous format that does not require the separation o...

  5. Hyaluronidase treatment of synovial fluid to improve assay precision for biomarker research using multiplex immunoassay platforms.

    Science.gov (United States)

    Jayadev, Chethan; Rout, Raj; Price, Andrew; Hulley, Philippa; Mahoney, David

    2012-12-14

    Synovial fluid (SF) is a difficult biological matrix to analyse due to its complex non-Newtonian nature. This can result in poor assay repeatability and potentially inefficient use of precious samples. This study assessed the impact of SF treatment by hyaluronidase and/or dilution on intra-assay precision using the Luminex and Meso Scale Discovery (MSD) multiplex platforms. SF was obtained from patients with knee osteoarthritis at the time of joint replacement surgery. Aliquots derived from the same sample were left untreated (neat), 2-fold diluted, 4-fold diluted or treated with 2mg/ml testicular hyaluronidase (with 2-fold dilution). Preparation methods were compared in a polysterene-bead Luminex 10-plex (N=16), magnetic-bead Luminex singleplex (N=7) and MSD 4-plex (N=7). Each method was assessed for coefficient of variation (CV) of replicate measurements, number of bead events (for Luminex assays) and dilution-adjusted analyte concentration. Percentage recovery was calculated for dilutions and HAse treatment. Hyaluronidase treatment significantly increased the number of wells with satisfactory bead events/region (95%) compared to neat (48%, pmagnetic-bead Luminex assay achieved ≥50 bead events irrespective of treatment method. Hyaluronidase treatment resulted in lower intra-assay CVs for detectable ligands (group average CVmagnetic-bead Luminex assays. In addition, measured sample concentrations were higher and recovery was poor (elevated) after hyaluronidase treatment. In the MSD 4-plex, within-group comparison of the intra-assay CV or concentration was not conclusively influenced by SF preparation. However, only hyaluronidase treatment resulted in CV<25% for all samples for TNF-α. There was no effect on analyte concentrations or recovery. Hyaluronidase treatment can improve intra-assay precision and assay signal of SF analysis by multiplex immunoassays and should be recommended for SF biomarker research, particularly using the Luminex platform. PMID:22955210

  6. A Highly Sensitive Porous Silicon (P-Si-Based Human Kallikrein 2 (hK2 Immunoassay Platform toward Accurate Diagnosis of Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Sang Wook Lee

    2015-05-01

    Full Text Available Levels of total human kallikrein 2 (hK2, a protein involved the pathology of prostate cancer (PCa, could be used as a biomarker to aid in the diagnosis of this disease. In this study, we report on a porous silicon antibody immunoassay platform for the detection of serum levels of total hK2. The surface of porous silicon has a 3-dimensional macro- and nanoporous structure, which offers a large binding capacity for capturing probe molecules. The tailored pore size of the porous silicon also allows efficient immobilization of antibodies by surface adsorption, and does not require chemical immobilization. Monoclonal hK2 capture antibody (6B7 was dispensed onto P-Si chip using a piezoelectric dispenser. In total 13 × 13 arrays (169 spots were spotted on the chip with its single spot volume of 300 pL. For an optimization of capture antibody condition, we firstly performed an immunoassay of the P-Si microarray under a titration series of hK2 in pure buffer (PBS at three different antibody densities (75, 100 and 145 µg/mL. The best performance of the microarray platform was seen at 100 µg/mL of the capture antibody concentration (LOD was 100 fg/mL. The platform then was subsequently evaluated for a titration series of serum-spiked hK2 samples. The developed platform utilizes only 15 µL of serum per test and the total assay time is about 3 h, including immobilization of the capture antibody. The detection limit of the hK2 assay was 100 fg/mL in PBS buffer and 1 pg/mL in serum with a dynamic range of 106 (10−4 to 102 ng/mL.

  7. Sensitive magnetic nanoparticle-based immunoassay of phosphorylated acetylcholinesterase using protein cage templated lead phosphate for signal amplification with graphite furnace atomic absorption spectrometry detection

    Science.gov (United States)

    Liang, Pei; Kang, Caiyan; Yang, Enjian; Ge, Xiaoxiao; Du, Dan; Lin, Yuehe

    2016-01-01

    We developed a new magnetic nanoparticles sandwich-like immunoassay using protein cage nanoparticles (PCN) for signal amplification together with graphite furnace atomic absorption spectrometry (GFAAS) for quantification of organophosphorylated acetylcholinesterase adduct (OP-AChE), the biomarker of exposure to organophosphate pesticides (OPs) and nerve agents. OP-AChE adducts were firstly captured by titanium dioxide coated magnetic nanoparticles (TiO2-MNPs) from the sample matrixes through metal chelation with phospho-moieties, and then selectively recognized by anti-AChE antibody labeled on PCN which was packed with lead phosphate in its cavity (PCN-anti-AChE). The sandwich-like immunoreaction was performed among TiO2-MNPs, OP-AChE and PCN-anti-AChE to form TiO2-MNPs/OP-AChE/PCN-anti-AChE immunocomplex. The complex could be easily isolated from the sample solution with the help of magnet, and the released lead ions from PCN were detected by GFAAS for the quantification of OP-AChE. Greatly enhanced sensitivity was achieved because PCN increased the amount of metal ions in the cavity of each apoferritin. The proposed immunoassay yielded a linear response over a broad OP-AChE concentrations from 0.01 nM to 2 nM, with a detection limit of 2 pM, which has enough sensitivity for monitoring of low-dose exposure to OPs. This new method showed an acceptable stability and reproducibility and was validated with OP-AChE spiked human plasma. PMID:26953358

  8. Selective nanomanipulation of fluorescent polystyrene nano-beads and single quantum dots at gold nanostructures based on the AC-dielectrophoretic force

    Science.gov (United States)

    Kim, Jinsik; Hwang, Kyo Seon; Lee, Sangyoup; Park, Jung Ho; Shin, Hyun-Joon

    2015-11-01

    We introduced the selective manipulation of polystyrene (PS) nano-beads and single quantum dots (QDs) at a gold nanostructure by using the AC-dielectrophoretic (DEP) force. Manipulation in three degrees of freedom (end-facet, side, and position-selective manipulation) was accomplished in gold nanostructures between microelectrodes. A 10 μm gap between the microelectrodes, which has a 100 nm-wide nanowire and 200 nm-wide vortex nanostructures at the inside of the gap, was fabricated, and nanostructures were not connected with the electrodes. We also performed theoretical calculations to verify the selective manipulation through the floating AC-DEP force. A sufficiently high gradient of the square of the electric field (∇|E|2, ~1019 V2 m-3) was accomplished and controlled for achieving a strong attaching force of nanoparticles using the gap between microelectrodes and nanostructures as well as the rotation of structures. Fluorescent PS nano-beads and QDs were attached at the designed end facet, side, and position of nanostructures with high selectivity. A single QD attachment was also realized at gold nanostructures, and the attached QDs were verified as single using optical ``blinking'' measurements.We introduced the selective manipulation of polystyrene (PS) nano-beads and single quantum dots (QDs) at a gold nanostructure by using the AC-dielectrophoretic (DEP) force. Manipulation in three degrees of freedom (end-facet, side, and position-selective manipulation) was accomplished in gold nanostructures between microelectrodes. A 10 μm gap between the microelectrodes, which has a 100 nm-wide nanowire and 200 nm-wide vortex nanostructures at the inside of the gap, was fabricated, and nanostructures were not connected with the electrodes. We also performed theoretical calculations to verify the selective manipulation through the floating AC-DEP force. A sufficiently high gradient of the square of the electric field (∇|E|2, ~1019 V2 m-3) was accomplished and

  9. Enhanced immunoassay for porcine circovirus type 2 antibody using enzyme-loaded and quantum dots-embedded shell–core silica nanospheres based on enzyme-linked immunosorbent assay

    International Nuclear Information System (INIS)

    Boosting the detection sensitivity of enzyme-linked immunosorbent assay (ELISA) is significant to the early clinical diagnosis of various diseases. Here, we developed a versatile immunosensor using silica nanospheres as carriers for sensitive detection of porcine circovirus type 2 (PCV2) antibody. With HRP enzyme covalently immobilized on the silica nanospheres and CdSe nanocrystals embedded inside, these signal probes were successfully utilized in the sensitive detection of PCV2 antibody by ELISA, fluorometry and square-wave voltammetry (SWV). To further demonstrate the performance of the immunosensor, Human IgG (HIgG) was used as a model analyte. Since more HRP and CdSe QDs were loaded, 5-, 200- and 400-fold enhancements in amplified ELISA, fluorometry and voltammetry responses for HIgG could be achieved compared to conventional ELISA. The respective detection limits of theses methods for HIgG were 3.9, 0.1 and 0.05 ng mL−1 with a RSD below 5% for amplified ELISA, fluorescence and SWV measurements. Additionally, a 100-fold improvement was obtained in the detection sensitivity for PCV2 antibody immunoassay. The versatile immunosensor exhibits good sensitivity, stability and reproducibility, suggesting its potential applications in clinical diagnostics. - Highlights: • A versatile ELISA-based immunoassay for PCV2 antibody was developed. • Enzyme and CdSe QDs modified SiO2 particles were used to improve sensitivity. • The simultaneous three ELISA-based techniques enhanced the detection reliability. • The biosensors strategy could provide a new avenue to ELISA-based sensors

  10. Enhanced immunoassay for porcine circovirus type 2 antibody using enzyme-loaded and quantum dots-embedded shell–core silica nanospheres based on enzyme-linked immunosorbent assay

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Long; Li, Xuepu; Shao, Kang; Ye, Shiyi; Liu, Chen; Zhang, Chenjun; Han, Heyou, E-mail: hyhan@mail.hzau.edu.cn

    2015-08-05

    Boosting the detection sensitivity of enzyme-linked immunosorbent assay (ELISA) is significant to the early clinical diagnosis of various diseases. Here, we developed a versatile immunosensor using silica nanospheres as carriers for sensitive detection of porcine circovirus type 2 (PCV2) antibody. With HRP enzyme covalently immobilized on the silica nanospheres and CdSe nanocrystals embedded inside, these signal probes were successfully utilized in the sensitive detection of PCV2 antibody by ELISA, fluorometry and square-wave voltammetry (SWV). To further demonstrate the performance of the immunosensor, Human IgG (HIgG) was used as a model analyte. Since more HRP and CdSe QDs were loaded, 5-, 200- and 400-fold enhancements in amplified ELISA, fluorometry and voltammetry responses for HIgG could be achieved compared to conventional ELISA. The respective detection limits of theses methods for HIgG were 3.9, 0.1 and 0.05 ng mL{sup −1} with a RSD below 5% for amplified ELISA, fluorescence and SWV measurements. Additionally, a 100-fold improvement was obtained in the detection sensitivity for PCV2 antibody immunoassay. The versatile immunosensor exhibits good sensitivity, stability and reproducibility, suggesting its potential applications in clinical diagnostics. - Highlights: • A versatile ELISA-based immunoassay for PCV2 antibody was developed. • Enzyme and CdSe QDs modified SiO{sub 2} particles were used to improve sensitivity. • The simultaneous three ELISA-based techniques enhanced the detection reliability. • The biosensors strategy could provide a new avenue to ELISA-based sensors.

  11. Glass bead cultivation of fungi

    DEFF Research Database (Denmark)

    Droce, Aida; Sørensen, Jens Laurids; Giese, H.;

    2013-01-01

    Production of bioactive compounds and enzymes from filamentous fungi is highly dependent on cultivation conditions. Here we present an easy way to cultivate filamentous fungi on glass beads that allow complete control of nutrient supply. Secondary metabolite production in Fusarium graminearum...

  12. Preparation and characterization of chitosan/cashew gum beads loaded with Lippia sidoides essential oil

    International Nuclear Information System (INIS)

    Beads based on chitosan (CH) and cashew gum (CG), were prepared and loaded with an essential oil with larvicide activity (Lippia sidoides - Ls). CH and CH-CG beads were characterized by scanning electron microscopy (SEM), infrared and UV-VIS spectroscopy, thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), as well as, regarding their larvicide loading, swelling, in vitro and in vivo release kinetics. The oil encapsulation was evidenced by FTIR analysis and LS loading ranges from 2.4% to 4.4%. CH beads duly showed swelling degree (Q) values from 4.0 to 6.7, reaching equilibrium after 30 min, whereas crosslinked CH-CG beads showed lower swelling values, from 0.4 to 3.8, exhibiting a longer equilibrium time. Liquid transport parameters have revealed diffusion coefficient for CH-CG beads, as low as 2 x 10-15 m2/s. TGA and DSC revealed that CH:CG crosslinked beads are more thermally stable than CH beads. In vitro release follows a non-Fickian diffusion profile for both bead types, however, and a prolonged release being achieved only after beads crosslinking. In vivo release showed that both CH and CH-CG presented a prolonged larvicide effect. These aforesaid results, indicate that CH-CG beads loaded with LS are efficient for A. aegypti larval control.

  13. Detection of petroleum hydrocarbons in soil and water by immunoassay

    International Nuclear Information System (INIS)

    A magnetic particle based enzyme immunoassay (EIA) that detects small aromatic hydrocarbons was developed. This EIA can be used to directly test water samples or can be coupled with a simple extraction method to identify the presence of petroleum hydrocarbons in soil. This immunoassay offers several advantages over traditional testing methods (i.e. GC) including speed, cost effectiveness and portability. This assay can be performed on site in less than one hour. The assay's performance with soil and water samples was evaluated in several studies. In one study conducted on water samples from locations across the US, recoveries of spiked Total BTEX averaged greater than 99% with results ranging from 87% to 119%; one false positive (1.8%) was observed. Soil samples spiked with Total BTEX at concentrations ranging from 0.25 to 10 ppm were extracted, diluted and evaluated in the immunoassay. Recoveries averaged 113% with results ranging from 104% to 120%. In a third study, soil samples collected from various remediation sites were extracted and run in the immunoassay. The assay and recommended extraction procedure agreed well with results obtained by EPA Method 8020 in determining the presence and degree of contamination. Additional study results and data on the cross-reactivity of the assay for various small aromatic hydrocarbons and petroleum fuel mixtures (i.e. gasoline) are also presented

  14. IMMUNOASSAYS FOR METAL IONS. (R824029)

    Science.gov (United States)

    AbstractAntibodies that recognize chelated forms of metal ions have been used to construct immunoassays for Cd(II), Hg(II), Pb(II), and Ni(II). In this paper, the format of these immunoassays is described and the binding properties of three monoclonal antibodies direc...

  15. Survey of immunoassay techniques for biological analysis

    International Nuclear Information System (INIS)

    Immunoassay is a very specific, sensitive, and widely applicable analytical technique. Recent advances in genetic engineering have led to the development of monoclonal antibodies which further improves the specificity of immunoassays. Originally, radioisotopes were used to label the antigens and antibodies used in immunoassays. However, in the last decade, numerous types of immunoassays have been developed which utilize enzymes and fluorescent dyes as labels. Given the technical, safety, health, and disposal problems associated with using radioisotopes, immunoassays that utilize the enzyme and fluorescent labels are rapidly replacing those using radioisotope labels. These newer techniques are as sensitive, are easily automated, have stable reagents, and do not have a disposal problem. 6 refs., 1 fig., 2 tabs

  16. Magnetic measurements of suspended functionalised ferromagnetic beads under DC applied fields

    International Nuclear Information System (INIS)

    In this work, a simple technique to obtain the hysteresis loops of magnetic beads (Spherotech Inc.) in liquid suspension is presented. The magnetic measurements were taken in a DC Magnetic Property Measurement System (MPMS-SQUID sensor). Samples were based on ferromagnetic beads (surface-functionalized NH2, mean diameter 4.32 μm) prepared in three conditions: dry, suspended in sucrose solution and in suspension after functionalization with fluorophore. Special small containers (1.3 cm long) made of non magnetic plastic were designed to hold the beads in liquid. The results indicate that the bead's remnant magnetization is half of the value at maximum applied field in all cases. However, due to the additional degrees of rotational freedom, beads suspended in a liquid do not present coercivity. The use of ferromagnetic beads and magnetic elements of different architectures for applications in bioassays is also discussed.

  17. Magnetic measurements of suspended functionalised ferromagnetic beads under DC applied fields

    Energy Technology Data Exchange (ETDEWEB)

    De Los Santos V, Luis [Cavendish Laboratory, University of Cambridge, J.J Thomson Avenue, Cambridge CB3 0HE (United Kingdom)], E-mail: luisitodv@yahoo.es; Llandro, Justin; Lee, Dongwook; Mitrelias, Thanos; Palfreyman, Justin J.; Hayward, Thomas J.; Cooper, Jos; Bland, J.A.C.; Barnes, Crispin H.W. [Cavendish Laboratory, University of Cambridge, J.J Thomson Avenue, Cambridge CB3 0HE (United Kingdom); Arroyo C, Juan L. [Facultad de Quimica e Ingenieria Quimica, Universidad Nacional Mayor de San Marcos, Avenue Venezuela S/N, Lima 1 (Peru); Lees, Martin [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom)

    2009-07-15

    In this work, a simple technique to obtain the hysteresis loops of magnetic beads (Spherotech Inc.) in liquid suspension is presented. The magnetic measurements were taken in a DC Magnetic Property Measurement System (MPMS-SQUID sensor). Samples were based on ferromagnetic beads (surface-functionalized NH{sub 2}, mean diameter 4.32 {mu}m) prepared in three conditions: dry, suspended in sucrose solution and in suspension after functionalization with fluorophore. Special small containers (1.3 cm long) made of non magnetic plastic were designed to hold the beads in liquid. The results indicate that the bead's remnant magnetization is half of the value at maximum applied field in all cases. However, due to the additional degrees of rotational freedom, beads suspended in a liquid do not present coercivity. The use of ferromagnetic beads and magnetic elements of different architectures for applications in bioassays is also discussed.

  18. Horseradish peroxidase and antibody labeled gold nanoparticle probe for amplified immunoassay of ciguatoxin in fish samples based on capillary electrophoresis with electrochemical detection.

    Science.gov (United States)

    Zhang, Zhaoxiang; Liu, Ying; Zhang, Chaoying; Luan, Wenxiu

    2015-03-01

    This paper describes a new amplified immunoassay with horseradish peroxidase (HRP) and antibody (Ab) labeled gold nanoparticles (AuNPs) probe hyphenated to capillary electrophoresis (CE) with electrochemical (EC) detection for ultrasensitive determination of ciguatoxin CTX1B. AuNPs were conjugated with HRP and Ab, and then incubated with limited amount of CTX1B to produce immunocomplex. The immunoreactive sample was injected into capillary for CE separation and EC detection. Enhanced sensitivity was obtained by adopting the AuNPs as carriers of HRP and Ab at high HRP/Ab molar ratio. The calibration curve of CTX1B was in the range of 0.06-90 ng/mL. The detection limit was 0.045 ng/mL, which is 38-fold lower than that of HPLC-MS method for CTX1B analysis. The proposed method was successfully applied for the quantification of CTX1B in contamined fish samples by simultaneously labeling Ab and HRP on AuNPs. The amplified IA with HRP and Ab labeled AuNPs probe hyphenated to CE and EC detection provides a sensitive analytical approach for the determination of trace ciguatoxin in complex samples. PMID:25637767

  19. Optical encoding of microbeads based on silica particle encapsulated quantum dots and its applications

    International Nuclear Information System (INIS)

    A novel method concerning the coding technology of polystyrene beads with Si encapsulated quantum dot (QD) particles (Si - QDs particles) is studied in this paper. In the reverse microemulsion system containing tetraethoxysilane (TEOS), water-soluble QDs (emission peak at 600 nm) were enveloped within the silica shell, forming Si - QDs particles. The Si - QDs particles were characterized by TEM, showing good uniform size, with an average diameter of about 167.0 nm. In comparison with the pure water-soluble QDs, the encapsulation of water-soluble QDs in the silica shell led to an enhancement in anti-photobleaching by providing inert barriers for the QDs. Images presented by SEM and confocal laser scanning microscopy demonstrated that the Si - QDs particles were equably coated on the surface of carboxyl functionalized polystyrene (PS) beads. Then, with the assistance of ethyl-3-(dimethyl aminopropyl) carbodiimide/N-hydroxysuccinimide (EDC/NHS), human IgG could be successfully crosslinked to Si - QDs particle coated PS-COOH beads. Furthermore, the Si - QDs coated PS-COOH beads with human IgG were examined in immunoassay experiments, and the results indicated that these beads could be applied in the specific recognition of goat-anti-human IgG in solution. This investigation is expected to provide a new route to bead coding in the field of suspension microarrays, based on the use of QDs

  20. Developement of Spherical Polyurethane Beads

    Institute of Scientific and Technical Information of China (English)

    K. Maeda; H. Ohmori; H. Gyotoku

    2005-01-01

    @@ 1Results and Discussion We established a new method to produce the spherical polyurethane beads which have narrower distribution of particle size. This narrower distribution was achieved by the polyurethane prepolymer which contains ketimine as a blocked chain-extending agent. Firstly, the prepolymer is dispersed into the aqueous solution containing surfactant. Secondaly, water comes into the inside of prepolymer as oil phase. Thirdly, ketimine is hydrolyzed to amine, and amine reacts with prepolymer immediately to be polyurethane.Our spherical polyurethane beads are very suitable for automotive interior parts especially for instrument panel cover sheet producing under the slush molding method, because of good process ability, excellent durability to the sunlight and mechanical properties at low temperature. See Fig. 1 ,Fig. 2 and Fig. 3 (Page 820).

  1. Confined Flocculation of Ionic Pollutants by Poly(L-dopa)-Based Polyelectrolyte Complexes in Hydrogel Beads for Three-Dimensional, Quantitative, Efficient Water Decontamination.

    Science.gov (United States)

    Yu, Li; Liu, Xiaokong; Yuan, Weichang; Brown, Lauren Joan; Wang, Dayang

    2015-06-16

    The development of simple and recyclable adsorbents with high adsorption capacity is a technical imperative for water treatment. In this work, we have successfully developed new adsorbents for the removal of ionic pollutants from water via encapsulation of polyelectrolyte complexes (PECs) made from positively charged poly(allylamine hydrochloride) (PAH) and negatively charged poly(l-3,4-dihydroxyphenylalanine) (PDopa), obtained via the self-polymerization of l-3,4-dihydroxyphenylalanine (l-Dopa). Given the outstanding mass transport through the hydrogel host matrixes, the PDopa-PAH PEC guests loaded inside can effectively and efficiently remove various ionic pollutants, including heavy metal ions and ionic organic dyes, from water. The adsorption efficiency of the PDopa-PAH PECs can be quantitatively correlated to and tailored by the PDopa-to-PAH molar ratio. Because PDopa embodies one catechol group, one carboxyl group, and one amino group in each repeating unit, the resulting PDopa-PAH PECs exhibit the largest capacity of adsorption of heavy metal ions compared to available adsorbents. Because both PDopa and PAH are pH-sensitive, the PDopa-PAH PEC-loaded agarose hydrogel beads can be easily and completely recovered after the adsorption of ionic pollutants by adjusting the pH of the surrounding media. The present strategy is similar to the conventional process of using PECs to flocculate ionic pollutants from water, while in our system flocculation is confined to the agarose hydrogel beads, thus allowing easy separation of the resulting adsorbents from water. PMID:25981870

  2. Ultra-sensitive immunoassay biosensors using hybrid plasmonic-biosilica nanostructured materials

    OpenAIRE

    Yang, Jing; Zhen, Le; Ren, Fanghui; Campbell, Jeremy; Rorrer, Gregory L.; Wang, Alan X.

    2014-01-01

    We experimentally demonstrate an ultra-sensitive immunoassay biosensor using diatom biosilica with self-assembled plasmonic nanoparticles. As the nature-created photonic crystal structures, diatoms have been adopted to enhance surface plasmon resonances of metal nanoparticles on the surfaces of diatom frustules and to increase the sensitivity of surface-enhanced Raman scattering (SERS). In this study, a sandwich SERS immunoassay is developed based on the hybrid plasmonic-biosilica nano-struct...

  3. A competitive immunoassay for ultrasensitive detection of Hg(2+) in water, human serum and urine samples using immunochromatographic test based on surface-enhanced Raman scattering.

    Science.gov (United States)

    She, Pei; Chu, Yanxin; Liu, Chunwei; Guo, Xun; Zhao, Kang; Li, Jianguo; Du, Haijing; Zhang, Xiang; Wang, Hong; Deng, Anping

    2016-02-01

    An immunochromatographic test (ICT) strip was developed for ultrasensitive competitive immunoassay of Hg(2+). This strategy was achieved by combining the easy-operation and rapidity of ICT with the high sensitivity of surface-enhanced Raman scattering (SERS). Monoclonal antibody (mAb) against Hg(2+) and Raman active substance 4-mercaptobenzoic acid (MBA) dual labelled gold nanoparticles (GNPs) were prepared as an immunoprobe. The Raman scattering intensity of MBA on the test line of the ICT strip was measured for quantitative determination of Hg(2+). The ICT was able to directly detect Hg(2+) without complexing due to the specific recognition of the mAb with Hg(2+). The IC50 and limit of detection (LOD) of the assay for Hg(2+) detection were 0.12 ng mL(-1) and 0.45 pg mL(-1), respectively. There was no cross-reactivity (CR) of the assay with other nineteen ions and the ICT strips could be kept for 5 weeks without loss of activity. The recoveries of the assay for water, human serum and urine samples spiked with Hg(2+) were in range of 88.3-107.3% with the relative standard deviations (RSD) of 1.5-9.5% (n = 3). The proposed ICT was used for the detection of Hg(2+) in urine samples collected from Occupational Disease Hospital and the results were confirmed by cold-vapor atomic fluorescence spectroscopy (CV-AFS). The assay exhibited high sensitivity, selectivity, stability, precision and accuracy, demonstrating a promising method for the detection of trace amount of Hg(2+) in environmental water samples and biological serum and urine samples. PMID:26772133

  4. An amplified electrochemical proximity immunoassay for the total protein of Nosema bombycis based on the catalytic activity of Fe3O4NPs towards methylene blue.

    Science.gov (United States)

    Wang, Qin; Gan, Xianxue; Zang, Ruhua; Chai, Yaqin; Yuan, Yali; Yuan, Ruo

    2016-07-15

    A simple electrochemical proximity immunoassay (ECPA) system for the total protein of Nosema bombycis (TP N.b) detection has been developed on the basis of a new amplification strategy combined with target-induced proximity hybridization. The desirable ECPA system was achieved through following process: firstly, the methylene blue (MB) labeled hairpin DNA (MB-DNA) were immobilized on electrode through Au-S bonding. Then, the antibody labeled complementary single-stranded DNA probe (Ab1-S1) hybridized with MB-DNA to open its hairpin structure, which led to the labeled MB far away from electrode surface. After that, the presence of target biomarker (TP N.b) and antibody labeled single-stranded DNA (Ab2-S2) triggered the typical sandwich reaction and proximity hybridization, which resulted in the dissociation of Ab1-S1 from electrode and the transformation of the MB-DNA into a hairpin structure with MB approaching to electrode surface. In consequence, the hairpin-closed MB was electrocatalyzed by the modified magnetic nanoparticles (Fe3O4NPs), leading to an increased and amplified electrochemical signal for the quantitative detection of TP N.b. In the present work, Fe3O4NPs were acted as catalyst to electrocatalyze the reduction of electron mediator MB for signal amplification, which could not only overcome the drawbacks of protein enzyme in electrocatalytic signal amplification but also shorten the interaction distance between catalyst and substance. Under optimal condition, the proposed ECPA system exhibited a wide linear range from 0.001ngmL(-1) to 100ngmL(-)(1) with a detection limit (LOD) of 0.54pgmL(-1). Considering the desirable sensitivity and specificity, as well as the novel and simple features, this signal amplified ECPA system opened an opportunity for quantitative analysis of many other kinds of protein biomarker. PMID:26994365

  5. Preparation of TSH national standard for immunoassay

    International Nuclear Information System (INIS)

    The first national standard of thyroid stimulating hormone (TSH) for immunoassay is prepared. The highly pure TSH from Sigma Co, are purchased and immuno activity of this material is 7 kIU/g. The batch of ampoules coded 0530-9412, is prepared according to the procedures used for international biological standard. The ampoule's potency are calibrated by 8 immunoassay systems including RIA, IRMA and ELISA. The mean potency of the first national standard of TSH for immunoassay is 525 μIU per ampoule

  6. Modulating insulin-release profile from pH/thermosensitive polymeric beads through polymer molecular weight.

    Science.gov (United States)

    Ramkissoon-Ganorkar, C; Liu, F; Baudys, M; Kim, S W

    1999-06-01

    Stimuli-sensitive statistical terpolymers of N-isopropylacrylamide (NIPAAm) (temperature-sensitive), butyl methacrylate (BMA) and acrylic acid (AA) (pH-sensitive) of various molecular weight (MW) with NIPAAm/BMA/AA feed mol ratio of 85/5/10 were used to modulate release of insulin, a model protein drug, from pH/thermosensitive polymeric beads. Protein drug loading from an aqueous medium into the beads was achieved by preparing a 7 or 10% (w/v) polymer solution with 0.2% (w/v) insulin at low pH and below the lower critical solution temperature (LCST) of the polymer (pH 2.0 and 4 degrees C), and then dropping the solution into an oil bath above the LCST of the solution (35 degrees C). This loading procedure maintained protein stability while achieving high loading efficiency, between 90 and 95% in the beads. Insulin-release studies from beads prepared from terpolymers of the same composition but increasing MW were performed at pH 2.0 and 7.4, at 37 degrees C. It was observed that there was negligible loss of insulin at pH 2.0 from the beads, indicating no burst effect. At pH 7.4, insulin release was seen from all the beads and the release rate was a function of the MW of the polymer. The low MW polymeric beads eroded, dissolved and released most of the insulin within 2 h at pH 7.4 and 37 degrees C, the intermediate MW polymeric beads swelled slightly, dissolved and released most of the insulin within 4 h, whereas the high MW polymeric beads swelled slowly and gradually released the loaded insulin over a period of 8 h. Thus, the release of protein from the low MW polymeric beads is controlled by the rate of dissolution of the polymer, whereas the release from the high MW polymeric beads is controlled by swelling of the beads and drug diffusion. Studies using fluorescein-labeled insulin revealed that insulin was uniformly distributed in the beads regardless of polymer MW. The loaded and released insulin were fully bioactive. Based on the described results, the low MW

  7. On-chip measurement of the Brownian relaxation frequency of magnetic beads using magnetic tunneling junctions

    DEFF Research Database (Denmark)

    Donolato, M.; Sogne, E.; Dalslet, Bjarke Thomas;

    2011-01-01

    We demonstrate the detection of the Brownian relaxation frequency of 250 nm diameter magnetic beads using a lab-on-chip platform based on current lines for exciting the beads with alternating magnetic fields and highly sensitive magnetic tunnel junction (MTJ) sensors with a superparamagnetic free...... for biomolecular recognition. (C) 2011 American Institute of Physics. [doi:10.1063/1.3554374]...

  8. On-chip measurements of Brownian relaxation of magnetic beads with diameters from 10 nm to 250 nm

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Rizzi, Giovanni; Hansen, Mikkel Fougt

    2013-01-01

    We demonstrate the use of planar Hall effect magnetoresistive sensors for AC susceptibility measurements of magnetic beads with frequencies ranging from DC to 1 MHz. This wide frequency range allows for measuring Brownian relaxation of magnetic beads with diameters ranging from 10 nm to 250 nm. B...... sedimentation, magnetic trapping, and signal per bead. Among the investigated beads, we conclude that the beads with a nominal diameter of 80 nm are best suited for future on-chip volume-based biosensing experiments using planar Hall effect sensors.......We demonstrate the use of planar Hall effect magnetoresistive sensors for AC susceptibility measurements of magnetic beads with frequencies ranging from DC to 1 MHz. This wide frequency range allows for measuring Brownian relaxation of magnetic beads with diameters ranging from 10 nm to 250 nm...

  9. A pilot-scale study on PVA gel beads based integrated fixed film activated sludge (IFAS) plant for municipal wastewater treatment.

    Science.gov (United States)

    Kumar Singh, Nitin; Singh, Jasdeep; Bhatia, Aakansha; Kazmi, A A

    2016-01-01

    In the present study, a pilot-scale reactor incorporating polyvinyl alcohol gel beads as biomass carrier and operating in biological activated sludge mode (a combination of moving bed biofilm reactor (MBBR) and activated sludge) was investigated for the treatment of actual municipal wastewater. The results, during a monitoring period of 4 months, showed effective removal of chemical oxygen demand (COD), biological oxygen demand (BOD) and NH3-N at optimum conditions with 91%, ∼92% and ∼90% removal efficiencies, respectively. Sludge volume index (SVI) values of activated sludge varied in the range of 25-72 mL/g, indicating appreciable settling characteristics. Furthermore, soluble COD and BOD in the effluent of the pilot plant were reduced to levels well below discharge limits of the Punjab Pollution Control Board, India. A culture dependent method was used to enrich and isolate abundant heterotrophic bacteria in activated sludge. In addition to this, 16S rRNA genes analysis was performed to identify diverse dominant bacterial species in suspended and attached biomass. Results revealed that Escherichia coli, Pseudomonas sp. and Nitrosomonas communis played a significant role in biomass carrier, while Acinetobactor sp. were dominant in activated sludge of the pilot plant. Identification of ciliated protozoa populations rendered six species of ciliates in the plant, among which Vorticella was the most dominant. PMID:26744941

  10. An enzyme immunoassay for plasma betamethasone

    International Nuclear Information System (INIS)

    A sensitive enzyme immunoassay for plasma betamethasone was developed using betamethasone-3-(O-carboxymethyl)oxime-beta-D-galactosidase conjugate as a labelled antigen and 4-methylumbelliferyl-beta-D-galactoside as a fluorescence substrate. The performances of the enzyme immunoassay were compared with that of a radioimmunoassay using 3H-betamethasone and the same antiserum. The minimal detectable level for the enzyme immunoassay was 0.15 pg/tube or 0.15 ng/ml of plasma, which was remarkably more sensitive than the radioimmunoassay level of 10 pg/tube or 2 ng/ml of plasma. The specificity was sufficient, in particular, the cross reactivity of cortisol as 0.008%. However, the precision of the enzyme immunoassay was inferior to that of the radioimmunoassay

  11. An enzyme immunoassay for plasma betamethasone

    Energy Technology Data Exchange (ETDEWEB)

    Kominami, G.; Yamauchi, A.; Ishihara, S.; Kono, M.

    1981-03-01

    A sensitive enzyme immunoassay for plasma betamethasone was developed using betamethasone-3-(O-carboxymethyl)oxime-beta-D-galactosidase conjugate as a labelled antigen and 4-methylumbelliferyl-beta-D-galactoside as a fluorescence substrate. The performances of the enzyme immunoassay were compared with that of a radioimmunoassay using /sup 3/H-betamethasone and the same antiserum. The minimal detectable level for the enzyme immunoassay was 0.15 pg/tube or 0.15 ng/ml of plasma, which was remarkably more sensitive than the radioimmunoassay level of 10 pg/tube or 2 ng/ml of plasma. The specificity was sufficient, in particular, the cross reactivity of cortisol as 0.008%. However, the precision of the enzyme immunoassay was inferior to that of the radioimmunoassay.

  12. Sol particle immunoassays using colloidal gold and neutron activation

    International Nuclear Information System (INIS)

    The feasibility of performing immunoassays with colloidal gold labels and detection of 198Au by neutron activation has been demonstrated with measurements of human immunoglobulin and of serum antibodies to human immunodeficiency virus type 1. The detection sensitivity achieved after activation in a high flux reactor or with a water moderated 252Cf source, by gamma-counting or by autoradiography, is similar to the sensitivity obtained with absorbance measurements in the more common enzyme immunoassays. The reactor based neutron activation assay allows detection of 10-16 mol of analyte in routine operation with possible extension to 10-20 mol. The sensitivity with the 1.3 Ci 252 Cf source is limited to about 10-15 mol. The practical limitations of the assay's sensitivity at this point are due to background signals from reagents and/or nonspecific binding of the gold labeled reagent. (author) 13 refs.; 2 figs.; 1 tab

  13. Quality control, analysis and secure sharing of Luminex® immunoassay data using the open source LabKey Server platform

    OpenAIRE

    Eckels, Josh; Nathe, Cory; Nelson, Elizabeth K; Shoemaker, Sara G; Nostrand, Elizabeth Van; Yates, Nicole L.; Ashley, Vicki C.; Harris, Linda J.; Bollenbeck, Mark; Fong, Youyi; Tomaras, Georgia D; Piehler, Britt

    2013-01-01

    Background Immunoassays that employ multiplexed bead arrays produce high information content per sample. Such assays are now frequently used to evaluate humoral responses in clinical trials. Integrated software is needed for the analysis, quality control, and secure sharing of the high volume of data produced by such multiplexed assays. Software that facilitates data exchange and provides flexibility to perform customized analyses (including multiple curve fits and visualizations of assay per...

  14. Evaluation of a feline-specific multiplex, bead-based assay for detection of cytokines, chemokines, growth factors, and other immunologically active proteins in serum and plasma samples from cats.

    Science.gov (United States)

    Halpin, Rachel E; Saunders, Rebecca S; Thompson, Beverly J; Rohde Newgent, Allison S; Amorim, Juliana; Melillo, Gabrielle N; DeClue, Amy E

    2016-05-01

    OBJECTIVE To evaluate a feline-specific multiplex, bead-based assay system for detection of recombinant and native proteins in serum samples and in EDTA-treated and heparinized plasma samples. SAMPLE Serum samples and EDTA-treated and heparinized plasma samples from 30 sick cats and 9 healthy client-owned cats and heparinized whole blood samples from 5 healthy purpose-bred cats. PROCEDURES Ability of the assay system to detect 19 recombinant and native immunologically active proteins in plasma and serum samples from healthy and purpose-bred cats was evaluated via spike-and-recovery tests, assessments of inter- and intra-assay variation, linearity results, and leukocyte stimulation. Effects of various concentrations of heparin and serum matrix solution on percentages of analytes recovered were also evaluated. Analyte concentrations in samples from healthy and sick cats were measured and compared between groups. RESULTS Percentages of analytes recovered were unsatisfactory for most assays. Serum and heparinized plasma samples yielded better recovery results than did EDTA-treated plasma samples. Use of serum matrix solution did not improve results. Use of heparin concentrations greater than the recommended range affected the results. Linearity of results was difficult to assess because of the poor recovery. For the analytes that were recovered sufficiently for assessment, linearity appeared to be reasonable despite the limited detection. CONCLUSIONS AND CLINICAL RELEVANCE Poor percentages of analytes recovered and adverse effects of sample protein matrix limited the usefulness of the multiplex, bead-based assay system for measurement of immunologically active proteins in solutions with high protein content; however, recovery results were fairly linear, potentially allowing evaluation of feline plasma or serum samples with high analyte concentrations. PMID:27111017

  15. Single Step Nanoplasmonic Immunoassay for the Measurement of Protein Biomarkers

    Directory of Open Access Journals (Sweden)

    Shradha Prabhulkar

    2013-02-01

    Full Text Available A nanoplasmonic biosensor for highly-sensitive, single-step detection of protein biomarkers is presented. The principle is based on the utilization of the optical scattering properties of gold nanorods (GNRs conjugated to bio-recognition molecules. The nanoplasmonic properties of the GNRs were utilized to detect proteins using near-infrared light interferometry. We show that the antibody-conjugated GNRs can specifically bind to our model analyte, Glucose Transporter-1 (Glut-1. The signal intensity of back-scattered light from the GNRs bound after incubation, correlated well to the Glut-1 concentration as per the calibration curve. The detection range using this nanoplasmonic immunoassay ranges from 10 ng/mL to 1 ug/mL for Glut-1. The minimal detectable concentration based on the lowest discernable concentration from zero is 10 ng/mL. This nanoplasmonic immunoassay can act as a simple, selective, sensitive strategy for effective disease diagnosis. It offers advantages such as wide detection range, increased speed of analysis (due to fewer incubation/washing steps, and no label development as compared to traditional immunoassay techniques. Our future goal is to incorporate this detection strategy onto a microfluidic platform to be used as a point-of-care diagnostic tool.

  16. Multianalyte microspot immunoassay. The microanalytical 'compact disk' of the future.

    Science.gov (United States)

    Ekins, R; Chu, F

    1992-01-01

    Throughout the 1970s, controversy centered both on immunoassay 'sensitivity' per se and on the relative sensitivities of labelled antibody and labelled analyte methods. Our own theoretical studies in this period revealed that radioimmunoassay (RIA) sensitivities could be surpassed only by the use of very high specific activity non-isotopic labels in 'non-competitive' designs, preferably based on the use of monoclonal antibodies. The time-resolved fluorescence methodology known as Delfia - developed in collaboration with the instrument manufacturer LKB/Wallac - represented the first commercial 'ultra-sensitive' non-isotopic technique based on these theoretical insights, the same concepts being subsequently adopted in comparable methodologies relying on the use of chemiluminescent and enzyme labels. However, a second advantage of high specific activity labels is that they permit the development of 'multi-analyte' immunoassay systems combining ultra-sensitivity with the simultaneous measurement of tens, hundreds or thousands of analytes in a small biological sample. This possibility relies on simple, albeit hitherto unexploited, physicochemical concepts. The first is that all immunoassays rely on measurement of Ab occupancy by analyte. The second is that, provided the Ab concentration used is 'vanishingly small', fractional Ab occupancy is independent of both Ab concentration and sample volume. This leads to the notion of 'ratiometric' immunoassay, involving measurement of the ratio of signals (eg fluorescent signals) emitted by two labelled Ab's, the first ('sensor' Ab) deposited as a microspot on a solid support, the second a 'developing' Ab directed against either occupied or unoccupied sensor Ab binding sites.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1485691

  17. An adaptive algorithm for tracking 3D bead displacements: application in biological experiments

    International Nuclear Information System (INIS)

    This paper presents a feature-vector-based relaxation method (FVRM) to track bead displacements within a three-dimensional (3D) volume. The FVRM merges the feature vector method, a technique used in tracking bead displacements in biological gels, with the relaxation method, an algorithm employed successfully in tracking bead pairs in fluids. More specifically, the FVRM evaluates the probability of a bead pairing event based on the quasi-rigidity condition between the feature vectors of a bead and its candidate positions within a searching domain. Computational efficiency is improved via the introduction of an adaptive searching domain size and mismatches are reduced via a two-directional matching strategy. The algorithm is validated using simulated 3D bead displacements caused by a force dipole within a linear elastic gel. Results demonstrate a consistently high recovery ratio (above 98%) and low mismatch ratio (below 0.1%) for tracking parameter (mean bead distance/maximum bead displacement) greater than 0.73. (paper)

  18. Efficient, validated method for detection of mycobacterial growth in liquid culture media by use of bead beating, magnetic-particle-based nucleic acid isolation, and quantitative PCR.

    Science.gov (United States)

    Plain, Karren M; Waldron, Anna M; Begg, Douglas J; de Silva, Kumudika; Purdie, Auriol C; Whittington, Richard J

    2015-04-01

    Pathogenic mycobacteria are difficult to culture, requiring specialized media and a long incubation time, and have complex and exceedingly robust cell walls. Mycobacterium avium subsp. paratuberculosis (MAP), the causative agent of Johne's disease, a chronic wasting disease of ruminants, is a typical example. Culture of MAP from the feces and intestinal tissues is a commonly used test for confirmation of infection. Liquid medium offers greater sensitivity than solid medium for detection of MAP; however, support for the BD Bactec 460 system commonly used for this purpose has been discontinued. We previously developed a new liquid culture medium, M7H9C, to replace it, with confirmation of growth reliant on PCR. Here, we report an efficient DNA isolation and quantitative PCR methodology for the specific detection and confirmation of MAP growth in liquid culture media containing egg yolk. The analytical sensitivity was at least 10(4)-fold higher than a commonly used method involving ethanol precipitation of DNA and conventional PCR; this may be partly due to the addition of a bead-beating step to manually disrupt the cell wall of the mycobacteria. The limit of detection, determined using pure cultures of two different MAP strains, was 100 to 1,000 MAP organisms/ml. The diagnostic accuracy was confirmed using a panel of cattle fecal (n=54) and sheep fecal and tissue (n=90) culture samples. This technique is directly relevant for diagnostic laboratories that perform MAP cultures but may also be applicable to the detection of other species, including M. avium and M. tuberculosis. PMID:25609725

  19. Beads, beaded-fibres and fibres: Tailoring the morphology of poly(caprolactone) using pressurised gyration.

    Science.gov (United States)

    Hong, Xianze; Edirisinghe, Mohan; Mahalingam, Suntharavathanan

    2016-12-01

    This work focuses on forming bead on string poly(caprolactone) (PCL) by using gyration under pressure. The fibre morphology of bead on string is an interesting feature that falls between bead-free fibres and droplets, and it could be effectively controlled by the rheological properties of spinning dopes and the major processing parameters of the pressurised gyration system which are working pressure and rotating speed. Bead products were not always spherical in shape and tended to be more elliptical, therefore both their width and length were measured. The average bead width and length produced spanned a range 145-660μm and 140-1060μm, respectively. The average distance between two adjacent beads (i.e. inter-bead distance) and the bead size (width and length) are shown to be a function of processing parameters and polymer concentration. An interesting morphology i.e. beads with short fibre was observed when using a high polymer concentration. Bead on string structure agglomeration was promoted by a low polymer concentration. Formation of droplets or agglomerated bead on string is promoted below 5wt% polymer concentration, and beads with short fibre were present in the microstructure beyond a polymer concentration of 20wt%. PMID:27612839

  20. Highly Sensitive Bacteria Quantification Using Immunomagnetic Separation and Electrochemical Detection of Guanine-Labeled Secondary Beads

    Directory of Open Access Journals (Sweden)

    Harikrishnan Jayamohan

    2015-05-01

    Full Text Available In this paper, we report the ultra-sensitive indirect electrochemical detection of E. coli O157:H7 using antibody functionalized primary (magnetic beads for capture and polyguanine (polyG oligonucleotide functionalized secondary (polystyrene beads as an electrochemical tag. Vacuum filtration in combination with E. coli O157:H7 specific antibody modified magnetic beads were used for extraction of E. coli O157:H7 from 100 mL samples. The magnetic bead conjugated E. coli O157:H7 cells were then attached to polyG functionalized secondary beads to form a sandwich complex (magnetic bead/E. coli secondary bead. While the use of magnetic beads for immuno-based capture is well characterized, the use of oligonucleotide functionalized secondary beads helps combine amplification and potential multiplexing into the system. The antibody functionalized secondary beads can be easily modified with a different antibody to detect other pathogens from the same sample and enable potential multiplexing. The polyGs on the secondary beads enable signal amplification up to 10\\(^{8}\\ guanine tags per secondary bead (\\(7.5\\times10^{6}\\ biotin-FITC per secondary bead, 20 guanines per oligonucleotide bound to the target (E. coli. A single-stranded DNA probe functionalized reduced graphene oxide modified glassy carbon electrode was used to bind the polyGs on the secondary beads. Fluorescent imaging was performed to confirm the hybridization of the complex to the electrode surface. Differential pulse voltammetry (DPV was used to quantify the amount of polyG involved in the hybridization event with tris(2,2'-bipyridineruthenium(II (Ru(bpy\\(_{3}^{2+}\\ as the mediator. The amount of polyG signal can be correlated to the amount of E. coli O157:H7 in the sample. The method was able to detect concentrations of E. coli O157:H7 down to 3 CFU/100 mL, which is 67 times lower than the most sensitive technique reported in literature. The signal to noise ratio for this work was 3

  1. [125I]protein A: a tracer for general use in immunoassay

    International Nuclear Information System (INIS)

    An immunoassay method was developed in which 125I-labeled Protein A ([125I]PA) of high specific activity (100 Ci/mmole) and functional activity >= 85%) served as a general tracer. Antigen (or hapten) was immobilized by covalent binding to a solid bead support. Aliquots of the appropriate beads were incubated with antibody (either purified IgG fraction or whole antiserum), washed with buffer, then incubated with [125I]PA. The amount of [125I]PA bound to the antibody-coated beads was a measure of antibody binding. The ability of antigen (or hapten) in the fluid phase to inhibit the binding of antibody under optimal conditions, measured as inhibition of [125I]PA binding, served as the basis for quantification in the assay. The method was applied to 3 antigens (human chorionic gonadotropin (HCG), human immunoglobulin M (IgM) and goat immunoglobulin G (IgG)) and to methotrexate as an example of a hapten. Optimal assay conditions were developed and, in each case, picomole levels or less of the homologous ligand could be detected. Antibody specificity was determined by measuring the ability of compounds related to the antigen or hapten to act as inhibitors. Levels of HCG in urine from pregnant women and levels of IgM in normal human sera were determined by this method. The assay required only approximately 3 h to perform, gave accurate reproducible results, and was at least as sensitive as other available immunoassay methods (e.g. radioimmunoassay). (Auth.)

  2. Current status and future developments in radiolabelled immunoassays

    International Nuclear Information System (INIS)

    Radioisotopes are used extensively in medical practice and their use in RIA or IRMA usually represent a small proportion of the total. Radiolabelled immunoassays based on 125I constitute a simple didactic, cost effective and robust technology which is still regarded as the reference method in many clinical applications. The IAEA has implemented many successful programmes using the ''bulk reagent'' approach, involving 68 countries in all the different regions. The main achievements have been in technology transfer with self sufficiency in production for some countries; training of large numbers of staff; quality control and quality assurance schemes; devolution of screening programmes for neonatal congenital hypothryoidism. Alternatives to the use of radioisotopic tracers are constrained by many factors and are often only available in restricted commercial packages. They are often not suitable for technology transfer programmes and often lack any didactic component in addition to a relative high cost. The production of radiolabels using 125I is both simple and adaptable. In addition expertise in their preparation and purification is widespread even in developing countries. Together with the ease of producing antibodies, the facts have made 125I-radiolabelled immunoassays ideal for investigative procedures for many research activities (30,31) particularly in the medical context where radioisotopes are commonly used. In conclusion, even a superficial examination of public health statistics for various countries throughout the continents indicates a need for a simple, inexpensive and robust analytical tool. In this light, there is a predicted continuing role for radiolabelled immunoassays. (author)

  3. Multiplexed electrochemical immunoassay of biomarkers using chitosan nanocomposites.

    Science.gov (United States)

    Chen, Xia; Ma, Zhanfang

    2014-05-15

    In this work, a novel and sensitive multiplexed immunoassay protocol for simultaneous electrochemical determination of alpha-fetoprotein (AFP) and carcinoembryonic antigen (CEA) was designed using functionalized chitosan composites. The immunosensing platform was prepared via immobilizing capture anti-AFP and anti-CEA on chitosan-Au nanoparticles (AuNPs) through EDC/NHS linking. The signal tags were fabricated by immobilizing electroactive redox probes - Prussian blue (PB) and ferrocenecarboxylic acid (Fc) on chitosan (CHIT), following by absorbing AuNPs to immobilize labeled anti-AFP and anti-CEA, respectively. A sandwich-type immunoassay format was employed for the simultaneous detection of AFP and CEA. The assay was based on the electrochemical oxidation/reduction of the redox species in signal tags, which has a relationship with the concentration of analytes. Experimental results revealed that the multiplexed electrochemical immunoassay enabled the simultaneous monitoring of AFP and CEA with a wide range of 0.05-100 ng mL(-1) for both AFP and CEA. The detection limits (LOD) was 0.03 ng mL(-1) for AFP and 0.02 ng mL(-1) for CEA (S/N=3). The assay results of serum samples with the proposed method were in a good agreement with the reference values from standard ELISA method. And the negligible cross-reactivity between the two analytes makes it possesses potential promise in clinical diagnosis. PMID:24413402

  4. Optical tweezers and manipulation of PMMA beads in various conditions

    Science.gov (United States)

    Kotsifaki, D. G.; Makropoulou, M.; Serafetinides, A. A.

    2009-07-01

    Laser optical trapping and micromanipulation of microparticles or cells and subcellular structures have gained remarkable interest in biomedical research and applications. Several laser sources are employed for the combination of a laser scalpel with an optical tweezers device, under microscopic control. However, although the principles and the mechanisms of pulsed laser ablation have been well described for macroscopic interventions, the microbeam operation, under microscopic guidance, necessitates further experiments and investigations. We present experimental results of controlled micro-ablation of PMMA beads of 3-8 μm diameters, trapped by laser tweezers in various media e.g. solutes of different index of refraction. An optical tweezers system, based on a continuous wave He-Ne laser emitting at 632.8 nm, was tested on beads and, despite the low power of the He-Ne laser, the optical trap was stable. Another optical system, based on a cw Nd:YAG laser emitting at 1.06 μm, was tested on microspheres too. Successful beads ablation was carried out by irradiation with multiple, or even a single nitrogen laser pulse of 7 ns pulse duration at a wavelength of 337 nm. The ablative perforation of the microspheres was estimated by controlling the laser fluence. Moreover, shape deformations of PMMA microspheres were observed. The experimentally obtained results are theoretically explained via the spatial intensity distribution based on Mie light scattering theory. Furthermore, the appearance of laser ablation holes in the back side of microspheres is explained by the ablation triggered shock waves propagation. The role of the stretching forces action is also discussed. Additionally, we report experimental results on measuring the optical trap force of PMMA beads. A powerful optical tweezers system based on a continuous wave Nd:YAG laser was used in order to estimate the trapping efficiency for several beads diameter.

  5. Expanded polylactide bead foaming - A new technology

    Science.gov (United States)

    Nofar, M.; Ameli, A.; Park, C. B.

    2015-05-01

    Bead foaming technology with double crystal melting peak structure has been recognized as a promising method to produce low-density foams with complex geometries. During the molding stage of the bead foams, the double peak structure generates a strong bead-to-bead sintering and maintains the overall foam structure. During recent years, polylactide (PLA) bead foaming has been of the great interest of researchers due to its origin from renewable resources and biodegradability. However, due to the PLA's low melt strength and slow crystallization kinetics, the attempts have been limited to the manufacturing methods used for expanded polystyrene. In this study, for the first time, we developed microcellular PLA bead foams with double crystal melting peak structure. Microcellular PLA bead foams were produced with expansion ratios and average cell sizes ranging from 3 to 30-times and 350 nm to 15 µm, respectively. The generated high melting temperature crystals during the saturation significantly affected the expansion ratio and cell density of the PLA bead foams by enhancing the PLA's poor melt strength and promoting heterogeneous cell nucleation around the crystals.

  6. Porous bead packings for gas chromatography

    Science.gov (United States)

    Pollock, G. E.; Woeller, F. H.

    1979-01-01

    Porous polyaromatic packing beads have low polarity, high efficiency, short retention time, and may be synthesized in size range of 50 to 150 micrometers (100 to 270 mesh). Mechanically strong beads may be produced using various materials depending on elements and compounds to be identified.

  7. Glycopolymeric gel stabilized N-succinyl chitosan beads for controlled doxorubicin delivery.

    Science.gov (United States)

    Ajish, Juby K; Ajish Kumar, K S; Chattopadhyay, S; Kumar, Manmohan

    2016-06-25

    Here we report the synthesis and study of N-succinyl chitosan based hydrogel beads, stabilized with glycopolymeric network (NSC/Glc-gel) for application in anticancer drug delivery of doxorubicin (DOX). The bio-recognition of lectins by NSC/Glc-gel bead was also studied by UV-vis spectrophotometry. The beads were characterized using FT-IR, SEM and Thermogravimetric analysis. The extent of DOX loading was proportional to the degree of succinylation and the swelling kinetics of the beads showed pH dependency. The beads exhibited sustained release of DOX over a period of more than 15 days in an acidic pH, mimicking the microenvironment of tumor cells, and even lesser release at physiological pH. Release exponent 'n' derived from Korsmeyer-Peppas model implied that NSC88/Glc-gel (88% succinylation of chitosan) beads followed fickian diffusion controlled release mechanism whereas NSC75/Glc-gel (75% succinylation of chitosan) beads follow zero order release profile. The synthesized beads also displayed specificity to lectin Concanavalin A. PMID:27083798

  8. On-chip magnetic bead microarray using hydrodynamic focusing in a passive magnetic separator.

    Science.gov (United States)

    Smistrup, K; Kjeldsen, B G; Reimers, J L; Dufva, M; Petersen, J; Hansen, M F

    2005-11-01

    Implementing DNA and protein microarrays into lab-on-a-chip systems can be problematic since these are sensitive to heat and strong chemicals. Here, we describe the functionalization of a microchannel with two types of magnetic beads using hydrodynamic focusing combined with a passive magnetic separator with arrays of soft magnetic elements. The soft magnetic elements placed on both sides of the channel are magnetized by a relatively weak applied external magnetic field (21 mT) and provide magnetic field gradients attracting magnetic beads. Flows with two differently functionalized magnetic beads and a separating barrier flow are introduced simultaneously at the two channel sides and the centre of the microfluidic channel, respectively. On-chip experiments with fluorescence labeled beads demonstrate that the two types of beads are captured at each of the channel sidewalls. On-chip hybridization experiments show that the microfluidic systems can be functionalized with two sets of beads carrying different probes that selectively recognize a single base pair mismatch in target DNA. By switching the places of the two types of beads it is shown that the microsystem can be cleaned and functionalized repeatedly with different beads with no cross-talk between experiments. PMID:16234958

  9. High medical impact of implementing the new polymeric bead-based BacT/ALERT® FAPlus and FNPlus blood culture bottles in standard care.

    Science.gov (United States)

    Amarsy-Guerle, R; Mougari, F; Jacquier, H; Oliary, J; Benmansour, H; Riahi, J; Berçot, B; Raskine, L; Cambau, E

    2015-05-01

    Blood culture (BC) efficiency is critical for the diagnosis of bloodstream infection (BSI). We evaluated the impact on standard care of implementing the new BacT/ALERT® FAPlus and FNPlus BC bottles containing antibiotic-binding polymeric beads. We measured positivity rates and time to detection (TTD) during the first 10 months of implementation (PF) and during the previous 10-month period (PS) during which we were using standard aerobic (SA) or standard anaerobic (SN) BC bottles. For each period, the same number of consecutive patients (n = 3,918) was included. Per patient, a median of 1 BC set (1 aerobic and 1 anaerobic bottles) has been sampled. A higher positivity rate was measured during PF than PS when counting per BC bottle (7.0 % vs 5.8 % with 1,456 and 1,237 positive bottles respectively, P < 0.0001) and per BC set (9.6 % vs 7.8 % with 995 and 832 positive BC sets respectively, P < 0.0001). In PF, an increased number of cases due to staphylococci (P < 0.0001) and to Gram-negative bacilli (P < 0.005) was observed, whereas the contamination rate was similar during the two periods (2.4 % of BC sets in PF and 2.3 % in PS). Although antibiotic consumption and medical activity were similar during the two periods, BSI case detection increased from 2.2 to 2.6 per 1,000 hospital-days, especially in intensive care units (ICU; 35.1 to 55.7). Mean TTD for pathogenic microorganisms was significantly shorter in PF than in PS (15.5 h vs 18.0 h, P < 0.01). In conclusion, the use of the new FAPlus/FNPlus BC bottles improved the diagnosis of bacteremia in our hospital, especially in ICU patients. PMID:25648261

  10. Multiplex immunoassay for persistent organic pollutants in tilapia: Comparison of imaging- and flow cytometry-based platforms using spectrally encoded paramagnetic microspheres

    Science.gov (United States)

    Recent developments in spectrally encoded microspheres (SEMs)-based technologies provide high multiplexing possibilities. Most SEMs-based assays required a flow cytometer with sophisticated fluidics and optics. The new imaging superparamagnetic SEMs-based platform transports SEMs with considerably ...

  11. A Wide-Field Fluorescence Microscope Extension for Ultrafast Screening of One-Bead One-Compound Libraries Using a Spectral Image Subtraction Approach.

    Science.gov (United States)

    Heusermann, Wolf; Ludin, Beat; Pham, Nhan T; Auer, Manfred; Weidemann, Thomas; Hintersteiner, Martin

    2016-05-01

    The increasing involvement of academic institutions and biotech companies in drug discovery calls for cost-effective methods to identify new bioactive molecules. Affinity-based on-bead screening of combinatorial one-bead one-compound libraries combines a split-mix synthesis design with a simple protein binding assay operating directly at the bead matrix. However, one bottleneck for academic scale on-bead screening is the unavailability of a cheap, automated, and robust screening platform that still provides a quantitative signal related to the amount of target protein binding to individual beads for hit bead ranking. Wide-field fluorescence microscopy has long been considered unsuitable due to significant broad spectrum autofluorescence of the library beads in conjunction with low detection sensitivity. Herein, we demonstrate how such a standard microscope equipped with LED-based excitation and a modern CMOS camera can be successfully used for selecting hit beads. We show that the autofluorescence issue can be overcome by an optical image subtraction approach that yields excellent signal-to-noise ratios for the detection of bead-associated target proteins. A polymer capillary attached to a semiautomated bead-picking device allows the operator to efficiently isolate individual hit beads in less than 20 s. The system can be used for ultrafast screening of >200,000 bead-bound compounds in 1.5 h, thereby making high-throughput screening accessible to a wider group within the scientific community. PMID:27057765

  12. A Review of Heavy Metals Immunoassay Detection

    Directory of Open Access Journals (Sweden)

    Bing Lv

    2015-06-01

    Full Text Available Contamination of heavy metals in soil has been a significant problem, which resulted in food pollution and diseases through bioaccumulation. Traditional methods utilized to determined content of metal ions are time-cost, expensive and laboratorial. Since the introduction of antibody against In-EDTA, immunoassay has been developing for several decades. It filled in the blank of determination in situ with lower price and a short period. In this study, we mainly presented the research process of monoclonal antibody special binding to metal-ligand and the immunoassay utilized in detection of food and environment.

  13. Wax-incorporated Emulsion Gel Beads of Calcium Pectinate for Intragastric Floating Drug Delivery

    OpenAIRE

    Sriamornsak, Pornsak; Asavapichayont, Panida; Nunthanid, Jurairat; Luangtana-anan, Manee; Limmatvapirat, Sontaya; Piriyaprasarth, Suchada

    2008-01-01

    The purpose of this study was to prepare wax-incorporated pectin-based emulsion gel beads using a modified emulsion-gelation method. The waxes in pectin–olive oil mixtures containing a model drug, metronidazole, were hot-melted, homogenized and then extruded into calcium chloride solution. The beads formed were separated, washed with distilled water and dried for 12 h. The influence of various types and amounts of wax on floating and drug release behavior of emulsion gel beads of calcium pect...

  14. BeadArray expression analysis using bioconductor.

    Directory of Open Access Journals (Sweden)

    Matthew E Ritchie

    2011-12-01

    Full Text Available Illumina whole-genome expression BeadArrays are a popular choice in gene profiling studies. Aside from the vendor-provided software tools for analyzing BeadArray expression data (GenomeStudio/BeadStudio, there exists a comprehensive set of open-source analysis tools in the Bioconductor project, many of which have been tailored to exploit the unique properties of this platform. In this article, we explore a number of these software packages and demonstrate how to perform a complete analysis of BeadArray data in various formats. The key steps of importing data, performing quality assessments, preprocessing, and annotation in the common setting of assessing differential expression in designed experiments will be covered.

  15. Tumor specific lung cancer diagnostics with multiplexed FRET immunoassays

    Science.gov (United States)

    Geißler, D.; Hill, D.; Löhmannsröben, H.-G.; Thomas, E.; Lavigne, A.; Darbouret, B.; Bois, E.; Charbonnière, L. J.; Ziessel, R. F.; Hildebrandt, N.

    2010-02-01

    An optical multiplexed homogeneous (liquid phase) immunoassay based on FRET from a terbium complex to eight different fluorescent dyes is presented. We achieved highly sensitive parallel detection of four different lung cancer specific tumor markers (CEA, NSE, SCC and CYFRA21-1) within a single assay and show a proof-of-principle for 5- fold multiplexing. The method is well suited for fast and low-cost miniaturized point-of-care testing as well as for highthroughput screening in a broad range of in-vitro diagnostic applications.

  16. Acupressure Bead in the Eustachian Tube.

    Science.gov (United States)

    Igarashi, Kazunori; Matsumoto, Yu; Kakigi, Akinobu

    2015-08-01

    In this article, we aim to enlighten practitioners and patients involved with acupressure beads and to contribute to their safer use by reporting a unique case of insidious intrusion of an acupressure bead into the eustachian tube. A metallic object was found in the eustachian tube of a patient while conducting a magnetic resonance imaging (MRI) examination. The object was later confirmed to be an auricular acupressure bead, and was successfully removed by performing a tympanoplasty and a canal wall down mastoidectomy. The bead was assumed to have passed through an existing perforation of the tympanic membrane. According to previously published literature, tympanic membrane perforations exist in ∼1% of the population. Therefore, middle-ear foreign bodies are relatively common occurrences for otolaryngologists. However, metallic objects such as acupressure beads are especially important in the sense that they can cause severe burns during MRI. To avoid potential complications, acupressure-bead practitioners should be aware of the possibility that intrusions through the tympanic membrane could go unnoticed. PMID:26276456

  17. A highly sensitive SPR biosensor based on a graphene oxide sheet modified with gold bipyramids, and its application to an immunoassay for rabbit IgG

    International Nuclear Information System (INIS)

    A new SPR sensing substrate was fabricated that is based on the use of graphene oxide (GO) and gold bipyramids (GBPs). It can substantially improve the sensitivity of wavelength modulation SPR biosensors. First, a support consisting of a sheet of single layered GO was prepared, and its morphology and thickness were determined by atomic force microscopy (AFM). GBPs were synthesized and modified with staphylococcal protein A (SPA) for the oriented immobilization of antibody. GBPs modified with SPA were assembled on GO sheets through covalent attachment. The resulting SPR biosensor exhibits a highly sensitive response to rabbit IgG in the 0.15–40 μg mL−1 concentration range. The limit of quantification is better by factors of 4 and 16 compared to those obtained with gold nanoparticle-based, and conventional gold film-based sensors, respectively. In our expectation, this GBP-based SPR biosensor has a wide scope in that it may be employed to develop detection schemes for many other biomolecules by changing the corresponding receptor on its surface. (author)

  18. Assessment of phytoplankton community dynamics using bead array technology

    OpenAIRE

    Yamamoto, Asako

    2010-01-01

    Molecular methods are becoming increasingly popular in the field of microbial ecology for the characterization of phytoplankton communities at the taxonomic level. However, many techniques lack the potential for large scale spatiotemporal studies due to limitations in their methodology. In this study, a high-throughput, rapid and cost effective hybridization-based bead assay was applied to two sets of samples : (1) a yearlong time series (March 2009-2010) of surface seawater samples taken off...

  19. A rapid one-step kinetics-based immunoassay procedure for the highly-sensitive detection of C-reactive protein

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Sandeep Kumar Vashist, Gregor Czilwik, Thomas van Oordt, Felix von Stetten, Roland Zengerle, E. Marion Schneider & John H.T. Luong ### Abstract A rapid one-step kinetics-based sandwich enzyme-linked immunosorbent (ELISA) procedure has been developed for highly-sensitive detection of C-reactive protein (CRP) in less than 30 min. With minimal process steps, the procedure is highly simplified and cost-effective. The analysis only involves sequentially the formation of a san...

  20. Rapid Wuchereria bancrofti-Specific Antigen Wb123-Based IgG4 Immunoassays as Tools for Surveillance following Mass Drug Administration Programs on Lymphatic Filariasis

    OpenAIRE

    Steel, Cathy; Golden, Allison; Kubofcik, Joseph; LaRue, Nicole; de los Santos, Tala; Domingo, Gonzalo J.; Nutman, Thomas B.

    2013-01-01

    The Global Programme to Eliminate Lymphatic Filariasis has an urgent need for rapid assays to detect ongoing transmission of lymphatic filariasis (LF) following multiple rounds of mass drug administration (MDA). Current WHO guidelines support using the antigen card immunochromatographic test (ICT), which detects active filarial infection but does not detect early exposure to LF. Recent studies found that antibody-based assays better serve this function. In the present study, two tests, a rapi...

  1. Development of a colloidal gold-based lateral flow dipstick immunoassay for rapid qualitative and semi-quantitative analysis of artesunate and dihydroartemisinin

    OpenAIRE

    He, Lishan; Nan, Tiegui; Cui, Yongliang; Guo, Suqin; Zhang, Wei; Zhang, Rui; Tan, Guiyu; Wang, Baomin; Cui, Liwang

    2014-01-01

    Background Artemisinin-based combination therapy (ACT) plays an indispensable role in malaria control and elimination. However, the circulation of counterfeit, substandard drugs has greatly threatened malaria elimination campaigns. Most methods for the analysis of artemisinin and its derivatives require expensive equipment and sophisticated instrumentation. A convenient, easy-to-use diagnostic device for rapid evaluation of the quality of artemisinin drugs at the point-of-care is still lackin...

  2. Improving the controlled delivery formulations of caffeine in alginate hydrogel beads combined with pectin, carrageenan, chitosan and psyllium.

    Science.gov (United States)

    Belščak-Cvitanović, Ana; Komes, Draženka; Karlović, Sven; Djaković, Senka; Spoljarić, Igor; Mršić, Gordan; Ježek, Damir

    2015-01-15

    Alginate-based blends consisting of carrageenan, pectin, chitosan or psyllium husk powder were prepared for assessment of the best formulation aimed at encapsulation of caffeine. Alginate-pectin blend exhibited the lowest viscosity and provided the smallest beads. Alginate-psyllium husk blend was characterised with higher viscosity, yielding the largest bead size and the highest caffeine encapsulation efficiency (83.6%). The release kinetics of caffeine indicated that the porosity of alginate hydrogel was not reduced sufficiently to retard the diffusion of caffeine from the beads. Chitosan coated alginate beads provided the most retarded release of caffeine in water. Morphological characteristics of beads encapsulating caffeine were adversely affected by freeze drying. Bitterness intensity of caffeine-containing beads in water was the lowest for alginate-psyllium beads and chitosan coated alginate beads. Higher sodium alginate concentration (3%) for production of hydrogel beads in combination with psyllium or chitosan coating would present the most favourable carrier systems for immobilization of caffeine. PMID:25149001

  3. Biological deterioration of alginate beads containing immobilized microalgae and bacteria during tertiary wastewater treatment.

    Science.gov (United States)

    Cruz, Ivonne; Bashan, Yoav; Hernàndez-Carmona, Gustavo; de-Bashan, Luz E

    2013-11-01

    Secondary treatment of municipal wastewater affects the mechanical stability of polymer Ca-alginate beads containing the microalgae Chlorella vulgaris that are jointly immobilized with Azospirillum brasilense as treating agents whose presence do not affect bead stability. Nine strains of potential alginate-degrading bacteria were isolated from wastewater and identified, based on their nearly complete 16S rDNA sequence. Still, their population was relatively low. Attempts to enhance the strength of the beads, using different concentrations of alginate and CaCl2 or addition of either of three polymers (polyvinylpyrrolidone, polyvinyl alcohol, carboxymethylcellulose), CaCO3, or SrCl2, failed. Beads lost their mechanical strength after 24 h of incubation but not the integrity of their shape for at least 96 h, a fact that sustained successful tertiary wastewater treatment for 48 h. In small bioreactors, removal of phosphorus was low under sterile conditions but high in unsterile wastewater. Alginate beads did not absorb PO4 (-3) in sterile wastewater, but in natural wastewater, they contained PO4 (-3). Consequently, PO4 (-3) content declined in the wastewater. A supplement of 10 % beads (w/v) was significantly more efficient in removing nutrients than 4 %, especially in a jointly immobilized treatment where >90 % of PO4 (-3) and >50 % ammonium were removed. Tertiary wastewater treatment in 25-L triangular, airlift, autotrophic bioreactors showed, as in small bioreactors, very similar nutrient removal patterns, decline in bead strength phenomena, and increase in total bacteria during the wastewater treatment only in the presence of the immobilized treatment agents. This study demonstrates that partial biological degradation of alginate beads occurred during tertiary wastewater treatment, but the beads survive long enough to permit efficient nutrient removal. PMID:23354446

  4. Ultra-sensitive immunoassay biosensors using hybrid plasmonic-biosilica nanostructured materials.

    Science.gov (United States)

    Yang, Jing; Zhen, Le; Ren, Fanghui; Campbell, Jeremy; Rorrer, Gregory L; Wang, Alan X

    2015-08-01

    We experimentally demonstrate an ultra-sensitive immunoassay biosensor using diatom biosilica with self-assembled plasmonic nanoparticles. As the nature-created photonic crystal structures, diatoms have been adopted to enhance surface plasmon resonances of metal nanoparticles on the surfaces of diatom frustules and to increase the sensitivity of surface-enhanced Raman scattering (SERS). In this study, a sandwich SERS immunoassay is developed based on the hybrid plasmonic-biosilica nanostructured materials that are functionalized with goat anti-mouse IgG. Our experimental results show that diatom frustules improve the detection limit of mouse IgG to 10 pg/mL, which is ˜100× better than conventional colloidal SERS sensors on flat glass. Ultra-sensitive immunoassay biosensor using diatom biosilica with self-assembled plasmonic nanoparticles. PMID:25256544

  5. Ultrasensitive photoelectrochemical immunoassay of indole-3-acetic acid based on the MPA modified CdS/RGO nanocomposites decorated ITO electrode.

    Science.gov (United States)

    Sun, Bing; Chen, Lijian; Xu, Yan; Liu, Min; Yin, Huanshun; Ai, Shiyun

    2014-01-15

    A novel ultrasensitive photoelectrochemical immunosensor was fabricated based on 3-mercaptopropionic acid stabilized CdS/reduced graphene oxide (MPA-CdS/RGO) nanocomposites for indole-3-acetic acid (IAA) detection. The MPA-CdS/RGO nanocomposites were synthesized by in situ solvothermal growth of triangulated pyramidal CdS nanoparticles on the RGO sheet. 3-Mercaptopropionic acid (MPA) was employed as the modifier and bridge to immobilize the antibody. The nanocomposites were characterized by X-ray diffraction, transmission electron microscopy, scanning electron microscopy and UV/vis spectra. The results showed that the MPA-CdS/RGO nanocomposites revealed enhanced photocurrent response due to excellent electron transport properties of RGO and the improved assembly of CdS nanoparticles onto RGO sheet with the introduction of MPA. Based on the dependence of the photocurrent decline on the concentration of IAA, the proposed photoelectrochemical immunosensor for IAA depicted a linear range from 0.1 to 1000 ng/mL with a lower detection limit (0.05 ng/mL). The high sensitivity, reproducibility and specificity of the method permitted the method suitable to be used in real samples. PMID:23954674

  6. Flow immunoassay of trinitrophenol based on a surface plasmon resonance sensor using a one-pot immunoreaction with a high molecular weight conjugate.

    Science.gov (United States)

    Kobayashi, Masatoshi; Sato, Masahiro; Li, Yan; Soh, Nobuaki; Nakano, Koji; Toko, Kiyoshi; Miura, Norio; Matsumoto, Kiyoshi; Hemmi, Akihide; Asano, Yasukazu; Imato, Toshihiko

    2005-12-15

    A surface plasmon resonance (SPR) immunosensor based on a competitive immunoreaction for the determination of trinitrophenol (TNP) is described. A goat anti-mouse IgG (1st antibody), which recognizes an Fc moiety of an antibody, was immobilized on a gold film of an SPR sensor chip by physical adsorption. A TNP solution containing a fixed concentration of a mouse anti-TNP monoclonal antibody (2nd antibody) and a TNP-keyhole limpet hemocyanin (KLH) conjugate was incubated in one-pot and introduced into the sensor chip. The TNP-KLH conjugate competes with TNP for binding with the 2nd antibody. The resulting complex of the 2nd antibody with the TNP-KLH conjugate was bound to the 1st antibody, which is immobilized on the sensor chip. The SPR sensor signal based on resonance angle shift is dependent on the concentration of TNP in the incubation solution in the range from 25ppt to 25ppb, and the coefficient of variation of the SPR signals for the 25ppb TNP solution was determined to be 13% (n=4). The experimental results for the adsorption constant of the 1st antibody on the sensor chip and the binding constant of the 1st antibody complex with the 2nd antibody are discussed, together with theoretical considerations. PMID:18970305

  7. Optimized dendrimer-encapsulated gold nanoparticles and enhanced carbon nanotube nanoprobes for amplified electrochemical immunoassay of E. coli in dairy product based on enzymatically induced deposition of polyaniline.

    Science.gov (United States)

    Zhang, Xinai; Shen, Jianzhong; Ma, Haile; Jiang, Yuxiang; Huang, Chenyong; Han, En; Yao, Boshui; He, Yunyao

    2016-06-15

    A highly sensitive immunosensor was reported for Escherichia coli assay in dairy product based on electrochemical measurement of polyaniline (PAn) that was catalytically deposited by horseradish peroxidase (HRP) labels. Herein, the immunosensor was developed by using poly(amidoamine) dendrimer-encapsulated gold nanoparticles (PAMAM(Au)) as sensing platform. Importantly, the optimal HAuCl4/PAMAM ratio was investigated to design the efficient PAMAM(Au) nanocomposites. The nanocomposites were proven to not only increase the amount of immobilized capture antibody (cAb), but also accelerate the electron transfer process. Moreover, the {dAb-CNT-HRP} nanoprobes were prepared by exploiting the amplification effect of multiwalled carbon nanotubes (CNTs) for loading detection antibody (dAb) and enormous HRP labels. After a sandwich immunoreaction, the quantitatively captured nanoprobes could catalyze oxidation aniline to produce electroactive PAn for electrochemical measurement. On the basis of signal amplification of the PAMAM(Au)-based immunosensor and the {dAb-CNT-HRP} nanoprobes, the proposed strategy exhibited a linear relationship between the peak current of PAn and the logarithmic value of E. coli concentration ranging from 1.0 × 10(2) to 1.0 × 10(6) cfu mL(-1) with a detection limit of 50 cfu mL(-1) (S/N=3), and the electrochemical detection of E. coli could be achieved in 3h. The electrochemical immunosensor was also used to determine E. coli in dairy product (pure fresh milk, infant milk powder, yogurt in shelf-life and expired yogurt), and the recoveries of standard additions were in the range of 96.8-108.7%. Overall, this method gave a useful protocol for E. coli assay with high sensitivity, acceptable accuracy and satisfying stability, and thus provided a powerful tool to estimate the quality of dairy product. PMID:26908184

  8. Application of ZnO quantum dots dotted carbon nanotube for sensitive electrochemiluminescence immunoassay based on simply electrochemical reduced Pt/Au alloy and a disposable device

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Fang; Deng, Wenping; Zhang, Yan [Key Laboratory of Chemical Sensing and Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan, 250022 (China); Ge, Shenguang [Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan, 250022 (China); Yu, Jinghua, E-mail: ujn.yujh@gmail.com [Key Laboratory of Chemical Sensing and Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan, 250022 (China); Song, Xianrang, E-mail: sxr@vip.163.com [Cancer Research Center, Shandong Tumor Hospital, Jinan, 250012 (China)

    2014-03-01

    Highlights: • A sandwich-type electrochemluminence immunosensor was fabricated. • Simply electrochemical reduced Pt/Au alloy was selected as immunosensing probes. • ZnO@CNT composite was first employed as signal amplification label. Abstract: We report on a disposable microdevice suitable for sandwich-type electrochemiluminescence (ECL) detection of prostate specific antigen (PSA). The method is making use of ZnO quantum dots dotted carbon nanotube (ZnO@CNT) and simply electrochemical reduced Pt/Au alloy. The latter was selected as immunosensing probe to modify screen-printed carbon electrode, due to its excellent electrical property. For further ultrasensitive, low-potential and stable ECL detection, ZnO@CNT composite was first synthesized using a facile solvothermal method, and employed as signal amplification label. In this work, two working electrodes in one device were used for one determination to obtain more exact results based on screen-print technique. Taking advantage of dual-amplification effects of the Pt/Au and ZnO@CNT, this immunosensor could detect the PSA quantitatively, in the range of 0.001–500 ng mL⁻¹, with a low detection limit of 0.61 pg mL⁻¹. The resulting versatile immunosensor possesses high sensitivity, satisfactory reproducibility and regeneration. This simple and specific strategy has vast potential to be used in other biological assays.

  9. Screening of several drugs of abuse in Italian workplace drug testing: performance comparisons of on-site screening tests and a fluorescence polarization immunoassay-based device.

    Science.gov (United States)

    Basilicata, Pascale; Pieri, Maria; Settembre, Veronica; Galdiero, Alessandra; Della Casa, Elvira; Acampora, Antonio; Miraglia, Nadia

    2011-11-15

    According to the Italian laws, some categories of workers entrusted with duties possibly constituting a threat to security, physical safety, and health of third parties have to be screened to exclude the use/abuse of the following drugs of abuse: opiates, cocaine, cannabinoids, amphetamine, methamphetamine, 3,4-methylenedioxymethamphetamine, methadone, and buprenorphine. Toxicological tests can be performed with urinary on-site rapid screening devices, provided that sensitivities up to specified cutoffs are ensured. The present study reports performances, in terms of sensitivity, specificity, and accuracy, of an automatic on-site test and of an FPIA-based device, using gas chromatography/mass spectrometry (GC/MS) as a reference methodology. Three levels of concentration were tested, corresponding to the cutoff and to 2 and 3 times the limits, respectively. In terms of sensitivities, neither the on-site nor the benchtop instrumentations gave positive results, since values of zero percentage were obtained for concentrations up to 2-fold the limits. Even if good results were obtained in terms of specificity and accuracy by both devices, none of them seem to be adequate for the current application to the toxicological screening at workplaces. In fact, a rapid screening device can be used for drug tests provided that it ensures sensitivity at the prescribed cutoffs. Data showed that such is completely rejected and a more sensitive instrumentation should be preferred. PMID:21992470

  10. Generation of a panel of high affinity antibodies and development of a biosensor-based immunoassay for the detection of okadaic acid in shellfish.

    Science.gov (United States)

    Le Berre, Marie; Kilcoyne, Michelle; Kane, Marian

    2015-09-01

    Okadaic acid (OA) and its derivatives, DTX-1 and DTX-2, are marine biotoxins associated with diarrhetic shellfish poisoning. Routine monitoring of these toxins relies on the mouse bioassay. However, due to the technical unreliability and animal usage of this bioassay, there is always a need for convenient and reliable alternative assay methods. A panel of monoclonal antibodies against OA was generated and the most suitable was selected for biosensor-based assay development using surface plasmon resonance. The cross reactivity of the selected antibody with DTX-1 was found to be 73%, confirming the antibody suitability for both OA and DTX detection. The OA and derivative assay was designed as an inhibition assay covering the concentrations 1-75 ng/ml, with a sensitivity of 22.4 ng/ml. The assay was highly reproducible and preliminary validation showed no matrix interference from mussel extracts and good recovery of added standard in mussel extracts, with %CV of <9.3%. This assay could provide a useful and convenient screening tool for OA and its derivatives with a comprehensive extraction protocol for shellfish monitoring programmes. PMID:26169671

  11. The Beads of Translation: Using Beads to Translate mRNA into a Polypeptide Bracelet

    Science.gov (United States)

    Dunlap, Dacey; Patrick, Patricia

    2012-01-01

    During this activity, by making beaded bracelets that represent the steps of translation, students simulate the creation of an amino acid chain. They are given an mRNA sequence that they translate into a corresponding polypeptide chain (beads). This activity focuses on the events and sites of translation. The activity provides students with a…

  12. Detection of Tetrodotoxins in Puffer Fish by a Self-Assembled Monolayer-Based Immunoassay and Comparison with Surface Plasmon Resonance, LC-MS/MS, and Mouse Bioassay.

    Science.gov (United States)

    Reverté, Laia; de la Iglesia, Pablo; del Río, Vanessa; Campbell, Katrina; Elliott, Christopher T; Kawatsu, Kentaro; Katikou, Panagiota; Diogène, Jorge; Campàs, Mònica

    2015-11-01

    The increasing occurrence of puffer fish containing tetrodotoxin (TTX) in the Mediterranean could represent a major food safety risk for European consumers and threaten the fishing industry. The work presented herein describes the development of a new enzyme linked immunosorbent assay (mELISA) based on the immobilization of TTX through dithiol monolayers self-assembled on maleimide plates, which provides an ordered and oriented antigen immobilization and favors the antigen-antibody affinity interaction. The mELISA was found to have a limit of detection (LOD) of TTX of 0.23 mg/kg of puffer fish matrix. The mELISA and a surface plasmon resonance (SPR) immunosensor previously developed were employed to establish the cross-reactivity factors (CRFs) of 5,6,11-trideoxy-TTX, 5,11-deoxy-TTX, 11-nor-TTX-6-ol, and 5,6,11-trideoxy-4-anhydro-TTX, as well as to determine TTX equivalent contents in puffer fish samples. Results obtained by both immunochemical tools were correlated (R(2) = 0.977). The puffer fish samples were also analyzed using liquid chromatography-tandem mass spectrometry (LC-MS/MS), and the corresponding CRFs were applied to the individual TTX contents. Results provided by the immunochemical tools, when compared with those obtained by LC-MS/MS, showed a good degree of correlation (R(2) = 0.991 and 0.979 for mELISA and SPR, respectively). The mouse bioassay (MBA) slightly overestimated the CRF adjusted TTX content of samples when compared with the data obtained from the other techniques. The mELISA has been demonstrated to be fit for the purpose for screening samples in monitoring programs and in research activities. PMID:26424329

  13. Chemiluminescence competitive indirect enzyme immunoassay for 20 fluoroquinolone residues in fish and shrimp based on a single-chain variable fragment.

    Science.gov (United States)

    Tao, Xiaoqi; Chen, Min; Jiang, Haiyang; Shen, Jianzhong; Wang, Zhanhui; Wang, Xia; Wu, Xiaoping; Wen, Kai

    2013-09-01

    A chemiluminescent competitive indirect enzyme-linked immunosorbent assay, based on a mutant single-chain variable fragment (scFv), was developed to detect a broad range of fluoroquinolones (FQs) in fish and shrimp matrices. In this study, the best scFvC4A9H1_mut2 was adopted, which showed 10-fold improved affinity to sarafloxacin (SAR), difloxacin (DIF), and trovafloxacin (TRO), while the affinity to other FQs was fully inherited from wild-type scFvC4A9H1. In the optimized generic test, scFvC4A9H1_mut2 in combination with norfloxacin-ovalbumin conjugate and horseradish peroxidase-labeled anti-c-myc 9E10 antibody showed 50 % binding inhibition (IC50) at 0.12 μg kg(-1) for norfloxacin in buffer. Screening for the class of FQ antibiotics is accomplished using a simple, rapid extraction carried out with ethanol/acetic acid (99:1, v/v). This common extraction was able to detect 20 FQ residues such as s ciprofloxacin (CIP), danofloxacin, DIF, enoxacin, enrofloxacin (ENR), fleroxacin, amifloxacin, flumequine, levofloxacin, lomefloxacin hydrochloride, marbofloxacin, norfloxacin (NOR), ofloxacin, orbifloxacin, pazufloxacin, pefloxacin-d5 (PEF), prulifloxacin, SAR, sparfloxacin, and TRO in fish and shrimp. The limit of detection (LOD) for NOR was 0.2 μg kg(-1) and the LODs for CIP and ENR were all <0.2 μg kg(-1). Values of LODs inferred from the cross-reactivity data will range from approximately 0.23 μg kg(-1) for PEF to 2.1 μg kg(-1) for TRO. Field fish and shrimp samples were analyzed and compared to the results obtained from liquid chromatography tandem mass spectrometric method. All five instances (from 0.25 to 15.6 μg kg(-1)) in which FQs were present at concentrations near or above the assay LOD were identified as positive by the newly developed assay, demonstrating the usefulness of this assay as a screening tool. PMID:23842902

  14. Design criteria for developing low-resource magnetic bead assays using surface tension valves.

    Science.gov (United States)

    Adams, Nicholas M; Creecy, Amy E; Majors, Catherine E; Wariso, Bathsheba A; Short, Philip A; Wright, David W; Haselton, Frederick R

    2013-01-01

    Many assays for biological sample processing and diagnostics are not suitable for use in settings that lack laboratory resources. We have recently described a simple, self-contained format based on magnetic beads for extracting infectious disease biomarkers from complex biological samples, which significantly reduces the time, expertise, and infrastructure required. This self-contained format has the potential to facilitate the application of other laboratory-based sample processing assays in low-resource settings. The technology is enabled by immiscible fluid barriers, or surface tension valves, which stably separate adjacent processing solutions within millimeter-diameter tubing and simultaneously permit the transit of magnetic beads across the interfaces. In this report, we identify the physical parameters of the materials that maximize fluid stability and bead transport and minimize solution carryover. We found that fluid stability is maximized with ≤0.8 mm i.d. tubing, valve fluids of similar density to the adjacent solutions, and tubing with ≤20 dyn/cm surface energy. Maximizing bead transport was achieved using ≥2.4 mm i.d. tubing, mineral oil valve fluid, and a mass of 1-3 mg beads. The amount of solution carryover across a surface tension valve was minimized using ≤0.2 mg of beads, tubing with ≤20 dyn/cm surface energy, and air separators. The most favorable parameter space for valve stability and bead transport was identified by combining our experimental results into a single plot using two dimensionless numbers. A strategy is presented for developing additional self-contained assays based on magnetic beads and surface tension valves for low-resource diagnostic applications. PMID:24403996

  15. Beaded streams of Arctic permafrost landscapes

    Directory of Open Access Journals (Sweden)

    C. D. Arp

    2014-07-01

    Full Text Available Beaded streams are widespread in permafrost regions and are considered a common thermokarst landform. However, little is known about their distribution, how and under what conditions they form, and how their intriguing morphology translates to ecosystem functions and habitat. Here we report on a Circum-Arctic inventory of beaded streams and a watershed-scale analysis in northern Alaska using remote sensing and field studies. We mapped over 400 channel networks with beaded morphology throughout the continuous permafrost zone of northern Alaska, Canada, and Russia and found the highest abundance associated with medium- to high-ice content permafrost in moderately sloping terrain. In the Fish Creek watershed, beaded streams accounted for half of the drainage density, occurring primarily as low-order channels initiating from lakes and drained lake basins. Beaded streams predictably transition to alluvial channels with increasing drainage area and decreasing channel slope, although this transition is modified by local controls on water and sediment delivery. Comparison of one beaded channel using repeat photography between 1948 and 2013 indicate relatively stable form and 14C dating of basal sediments suggest channel formation may be as early as the Pleistocene–Holocene transition. Contemporary processes, such as deep snow accumulation in stream gulches effectively insulates river ice and allows for perennial liquid water below most beaded stream pools. Because of this, mean annual temperatures in pool beds are greater than 2 °C, leading to the development of perennial thaw bulbs or taliks underlying these thermokarst features. In the summer, some pools stratify thermally, which reduces permafrost thaw and maintains coldwater habitats. Snowmelt generated peak-flows decrease rapidly by two or more orders of magnitude to summer low flows with slow reach-scale velocity distributions ranging from 0.1 to 0.01 m s−1, yet channel runs still move water

  16. Tumour metastasis-associated gene profiling using one-dimensional microfluidic beads array

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Great efforts have been made on the early diagnosis and molecular mechanism research of tumour metastasis in recent years. In this paper, based on the one-dimensional microfluidic beads array, a novel platform for tumour metastasis-associated genes profiling has been developed by depositing nucleic acids functional beads in the microchannel. This platform is sensitive (limit of detection: 0.02 nmol/L) and can perform mRNAs analysis without PCR. Two human colon cancer cell lines (primary and metastatic) from the same patient were used as a model, and transcriptional expression profiling of multiple tumour metastasis-associated genes in these two cell lines was successfully achieved. Furthermore, the results obtained on the beads array were validated by RT-PCR. This novel beads array has advantages of high sensitivity, little sample consumption, short assay time, low cost and high throughput capability. It holds the potential in early diagnosis and mechanism research of tumour metastasis.

  17. Latex immunoassay for rapid detection of rotavirus.

    OpenAIRE

    Hughes, J. H.; Tuomari, A V; Mann, D R; Hamparian, V V

    1984-01-01

    A latex agglutination (LA) test was evaluated for the detection of human rotaviruses in stool specimens. Both antiserum and immunoglobulin G (IgG)-sensitized latex particles were used, with IgG-coated beads being more sensitive for human rotavirus antigen detection. Latex beads sensitized with anti-simian-SA-11 IgG were stable for at least 8 months when stored at 4 degrees C. The sensitivity of the test was compared with that of the Rotazyme (Abbott Laboratories, Diagnostics Div., North Chica...

  18. Oriented antibody immobilization to polystyrene macrocarriers for immunoassay modified with hydrazide derivatives of poly(methacrylic acid

    Directory of Open Access Journals (Sweden)

    Vinokurova Ludmila G

    2001-08-01

    Full Text Available Abstract Background Hydrophobic polystyrene is the most common material for solid phase immunoassay. Proteins are immobilized on polystyrene by passive adsorption, which often causes considerable denaturation. Biological macromolecules were found to better retain their functional activity when immobilized on hydrophilic materials. Polyacrylamide is a common material for solid-phase carriers of biological macromolecules, including immunoreagents used in affinity chromatography. New macroformats for immunoassay modified with activated polyacrylamide derivatives seem to be promising. Results New polymeric matrices for immunoassay in the form of 0.63-cm balls which contain hydrazide functional groups on hydrophilic polymer spacer arms at their surface shell are synthesized by modification of aldehyde-containing polystyrene balls with hydrazide derivatives of poly(methacrylic acid. The beads contain up to 0.31 μmol/cm2 active hydrazide groups accessible for covalent reaction with periodate-oxidized antibodies. The matrices obtained allow carrying out the oriented antibody immobilization, which increases the functional activity of immunosorbents. Conclusions An efficient site-directed antibody immobilization on a macrosupport is realized. The polymer hydrophilic spacer arms are the most convenient and effective tools for oriented antibody coupling with molded materials. The suggested scheme can be used for the modification of any other solid supports containing electrophilic groups reacting with hydrazides.

  19. Evaluation of an immunoassay for determination of plasma efavirenz concentrations in resource-limited settings

    Directory of Open Access Journals (Sweden)

    Alemseged Abdissa

    2014-06-01

    Full Text Available Introduction: Therapeutic drug monitoring (TDM may improve antiretroviral efficacy through adjustment of individual drug administration. This could result in reduced toxicity, prevent drug resistance, and aid management of drug–drug interactions. However, most measurement methods are too costly to be implemented in resource-limited settings. This study evaluated a commercially available immunoassay for measurement of plasma efavirenz. Methods: The immunoassay-based method was applied to measure efavirenz using a readily available Humastar 80 chemistry analyzer. We compared plasma efavirenz concentrations measured by the immunoassay with liquid chromatography tandem mass spectrometry (LC-MS/MS (reference method in 315 plasma samples collected from HIV patients on treatment. Concentrations were categorized as suboptimal4 µg/ml. Agreement between results of the methods was assessed via Bland-Altman plot and κ statistic values. Results: The median Interquartile range (IQR efavirenz concentration was 2.8 (1.9; 4.5 µg/ml measured by the LC–MS/MS method and 2.5 (1.8; 3.9 µg/ml by the immunoassay and the results were well correlated (ρ=0.94. The limits of agreement assessed by Bland–Altman plots were −2.54; 1.70 µg/ml. Although immunoassay underestimated high concentrations, it had good agreement for classification into low, normal or high concentrations (K=0.74. Conclusions: The immunoassay is a feasible alternative to determine efavirenz in areas with limited resources. The assay provides a reasonable approximation of efavirenz concentration in the majority of samples with a tendency to underestimate high concentrations. Agreement between tests evaluated in this study was clinically satisfactory for identification of low, normal and high efavirenz concentrations.

  20. Chitosan and chemically modified chitosan beads for acid dyes sorption

    Institute of Scientific and Technical Information of China (English)

    AZLAN Kamari; WAN SAIME Wan Ngah; LAI KEN Liew

    2009-01-01

    The capabilities of chitosan and chitosan-EGDE (ethylene glycol diglycidyl ether) beads for removing Acid Red 37 (AR 37) and Acid Blue 25 (AB 25) from aqueous solution were examined. Chitosan beads were cross-linked with EGDE to enhance its chemical resistance and mechanical strength. Experiments were performed as a function of pH, agitation period and concentration of AR 37 and AB 25. It was shown that the adsorption capacities of chitosan were comparatively higher than chitosan-EGDE for both acid dyes. This is mainly because cross-linking using EGDE reduces the major adsorption sites -NH3+ on chitosan. Langmuir isotherm model showed best conformity compared to Freundlich and BET. The kinetic experimental data agreed very well to the pseudo second-order kinetic model. The desorption study revealed that after three cycles of adsorption and desorption by NaOH and HCl, both adsorbents retained their promising adsorption abilities. FT-IR analysis proved that the adsorption of acid dyes onto chitosan-based adsorbents was a physical adsorption. Results also showed that chitosan and chitosan-EGDE beads were favourable adsorbers and could be employed as low-cost alternatives for the removal of acid dyes in wastewater treatment.

  1. The measurement of triclosan in water using a magnetic particle enzyme immunoassay

    Science.gov (United States)

    A sensitive magnetic particle-based immunoassay to determine triclosan (5-chloro-2-(2,4-dichlorophenoxy)phenol) in drinking water and wastewater was developed. Rabbit antiserum was produced by immunizing the rabbit with 6-(5-chloro-2-(2,4-dichlorophenoxy)phenoxy)hexanoic acid-keyhole limpet hemocya...

  2. Development of national immunoassay reagent programmes

    International Nuclear Information System (INIS)

    Despite the existence of networks of fully equipped laboratories with well-trained staff, the availability of immunodiagnostic services in developing countries is often limited by the high cost of imported kits. There are a number of ways of tackling this problem, ranging from bulk purchase of kits or reagents to local development and production of assay systems. Argentina/Chile, China, Cuba/Mexico, and Thailand are amongst the countries which have established local immunoassay reagent programmes to manufacture low cost, high quality immunoassay reagents. Kits from these projects are now beginning to become available, and it is hoped that they will promote national diagnostic services and research, as well as stimulating the development of reagent programmes for other analytes. (author). 4 refs, 1 tab

  3. Development and validation of predictive simulation model of multi-layer repair welding process by temper bead technique

    International Nuclear Information System (INIS)

    Stress corrosion cracking (SCC) has recently been observed in the nickel base alloy weld metal of dissimilar pipe joint used in pressurized water reactor (PWR) . Temper bead technique has been developed as one of repair procedures against SCC applicable in case that post weld heat treatment (PWHT) is difficult to carry out. In this regard, however it is essential to pass the property and performance qualification test to confirm the effect of tempering on the mechanical properties at repair welds before temper bead technique is actually used in practice. Thus the appropriate welding procedure conditions in temper bead technique are determined on the basis of the property and performance qualification testing. It is necessary for certifying the structural soundness and reliability at repair welds but takes a lot of work and time in the present circumstances. Therefore it is desirable to establish the reasonable alternatives for qualifying the property and performance at repair welds. In this study, mathematical modeling and numerical simulation procedures were developed for predicting weld bead configuration and temperature distribution during multi-layer repair welding process by temper bead technique. In the developed simulation technique, characteristics of heat source in temper bead welding are calculated from weld heat input conditions through the arc plasma simulation and then weld bead configuration and temperature distribution during temper bead welding are calculated from characteristics of heat source obtained through the coupling analysis between bead surface shape and thermal conduction. The simulation results were compared with the experimental results under the same welding heat input conditions. As the results, the bead surface shape and temperature distribution, such as Acl lines, were in good agreement between simulation and experimental results. It was concluded that the developed simulation technique has the potential to become useful for accurate

  4. A Review of Heavy Metals Immunoassay Detection

    OpenAIRE

    Bing Lv; Qiong Jiang; Cheng Zhu

    2015-01-01

    Contamination of heavy metals in soil has been a significant problem, which resulted in food pollution and diseases through bioaccumulation. Traditional methods utilized to determined content of metal ions are time-cost, expensive and laboratorial. Since the introduction of antibody against In-EDTA, immunoassay has been developing for several decades. It filled in the blank of determination in situ with lower price and a short period. In this study, we mainly presented the research process of...

  5. Sensitive chemiluminescent immunoassay of triclopyr by digital image analysis.

    Science.gov (United States)

    Díaz, Aurora N; Sánchez, Francisco G; Baro, Enrique N; Díaz, Ana F G; Aguilar, Alfonso; Algarra, Manuel

    2012-08-15

    An image based detection of chemiluminescence enzyme-linked immunosorbent assay (CL-ELISA) for the quantification of triclopyr has been developed. The immunoassay was an indirect competitive immunoassay with an anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP). Chemiluminescence was produced by the luminol/H(2)O(2)/HRP reaction, detected by a monochrome video CCD camera and digitized with an Imagraph IC-PCI frame grabber using a custom program developed in C(++) (Microsoft Visual C(++) 6.0). Two main improvements are reported in the data processing software: the implementation of a circular mesh covering the perimeter of each well, eliminating diffuse light from the neighboring wells, and the use of volume (the integration of light intensity of all pixels that define a well) as an analytical signal instead of CL intensity or area (as usual in commercial plate readers) to improve precision for normalization of the total light output. The standard curve was produced for 0.01-10 ng/L triclopyr. The limit of detection was 0.8 ng/L and the variation coefficient was 3.07% (n=10, P=0.05). PMID:22841045

  6. Development of an Heterologous Immunoassay for Ciprofloxacin Residue in Milk

    Science.gov (United States)

    Jinqing, Jiang; Haitang, Zhang; Zhixing, An; Zhiyong, Xu; Xuefeng, Yang; Huaguo, Huang; Ziliang, Wang

    A heterologous immunoassay has been developed for the determination of Ciprofloxacin (CPFX) residues in milk. For this reason, carbodiimide active ester method was employed to synthesize the artificial antigen of CPFX-BSA, and mixed anhydride reaction was used to prepare the coating antigen of CPFX-OVA to pursue the heterologous sensitivity. Based on the square matrix titration, an icELISA method was developed for the quantitative detection of CPFX in cattle milk. The dynamic range was from 0.036 to 92.5 ng/mL, with LOD and IC50 value of 0.019 ng/mL and 1.8 ng/mL, respectively. Except for a high cross-reactivity (89.7%) to Enrofloxacin, negligible cross-reactivity to the other compounds was observed. After optimization, 0.03 mol/L of HCl, or 10% of methanol was used in the assay buffer. 20-fold dilution in cattle milk gave an inhibition curve almost the same as that in PBS buffer. The regression equation for this assay was y = 0.9036 x + 1.4574, with a correlation coefficient (R2) of 0.9844. The results suggest the veracity of the heterologous immunoassay for detecting CPFX residue in milk.

  7. Flotation Immunoassay: Masking the Signal from Free Reporters in Sandwich Immunoassays.

    Science.gov (United States)

    Chen, Hui; Hagström, Anna E V; Kim, Jinsu; Garvey, Gavin; Paterson, Andrew; Ruiz-Ruiz, Federico; Raja, Balakrishnan; Strych, Ulrich; Rito-Palomares, Marco; Kourentzi, Katerina; Conrad, Jacinta C; Atmar, Robert L; Willson, Richard C

    2016-01-01

    In this work, we demonstrate that signal-masking reagents together with appropriate capture antibody carriers can eliminate the washing steps in sandwich immunoassays. A flotation immunoassay (FI) platform was developed with horseradish peroxidase chemiluminescence as the reporter system, the dye Brilliant Blue FCF as the signal-masking reagent, and buoyant silica micro-bubbles as the capture antibody carriers. Only reporters captured on micro-bubbles float above the dye and become visible in an analyte-dependent manner. These FIs are capable of detecting proteins down to attomole levels and as few as 10(6) virus particles. This signal-masking strategy represents a novel approach to simple, sensitive and quantitative immunoassays in both laboratory and point-of-care settings. PMID:27075635

  8. “Nanofiltration” Enabled by Super-Absorbent Polymer Beads for Concentrating Microorganisms in Water Samples

    Science.gov (United States)

    Xie, Xing; Bahnemann, Janina; Wang, Siwen; Yang, Yang; Hoffmann, Michael R.

    2016-02-01

    Detection and quantification of pathogens in water is critical for the protection of human health and for drinking water safety and security. When the pathogen concentrations are low, large sample volumes (several liters) are needed to achieve reliable quantitative results. However, most microbial identification methods utilize relatively small sample volumes. As a consequence, a concentration step is often required to detect pathogens in natural waters. Herein, we introduce a novel water sample concentration method based on superabsorbent polymer (SAP) beads. When SAP beads swell with water, small molecules can be sorbed within the beads, but larger particles are excluded and, thus, concentrated in the residual non-sorbed water. To illustrate this approach, millimeter-sized poly(acrylamide-co-itaconic acid) (P(AM-co-IA)) beads are synthesized and successfully applied to concentrate water samples containing two model microorganisms: Escherichia coli and bacteriophage MS2. Experimental results indicate that the size of the water channel within water swollen P(AM-co-IA) hydrogel beads is on the order of several nanometers. The millimeter size coupled with a negative surface charge of the beads are shown to be critical in order to achieve high levels of concentration. This new concentration procedure is very fast, effective, scalable, and low-cost with no need for complex instrumentation.

  9. "Nanofiltration" Enabled by Super-Absorbent Polymer Beads for Concentrating Microorganisms in Water Samples.

    Science.gov (United States)

    Xie, Xing; Bahnemann, Janina; Wang, Siwen; Yang, Yang; Hoffmann, Michael R

    2016-01-01

    Detection and quantification of pathogens in water is critical for the protection of human health and for drinking water safety and security. When the pathogen concentrations are low, large sample volumes (several liters) are needed to achieve reliable quantitative results. However, most microbial identification methods utilize relatively small sample volumes. As a consequence, a concentration step is often required to detect pathogens in natural waters. Herein, we introduce a novel water sample concentration method based on superabsorbent polymer (SAP) beads. When SAP beads swell with water, small molecules can be sorbed within the beads, but larger particles are excluded and, thus, concentrated in the residual non-sorbed water. To illustrate this approach, millimeter-sized poly(acrylamide-co-itaconic acid) (P(AM-co-IA)) beads are synthesized and successfully applied to concentrate water samples containing two model microorganisms: Escherichia coli and bacteriophage MS2. Experimental results indicate that the size of the water channel within water swollen P(AM-co-IA) hydrogel beads is on the order of several nanometers. The millimeter size coupled with a negative surface charge of the beads are shown to be critical in order to achieve high levels of concentration. This new concentration procedure is very fast, effective, scalable, and low-cost with no need for complex instrumentation. PMID:26876979

  10. Ispaghula mucilage-gellan mucoadhesive beads of metformin HCl: development by response surface methodology.

    Science.gov (United States)

    Nayak, Amit Kumar; Pal, Dilipkumar; Santra, Kousik

    2014-07-17

    Response surface methodology based on 3(2) factorial design was used to develop ispaghula (Plantago ovata F.) husk mucilage (IHM)-gellan gum (GG) mucoadhesive beads containing metformin HCl through Ca(2+)-ion cross-linked ionotropic-gelation technique for the use in oral drug delivery. GG to IHM ratio and cross-linker (CaCl2) concentration were investigated as independent variables. Drug encapsulation efficiency (DEE, %) and cumulative drug release after 10h (R10h, %) were analyzed as dependent variables. The optimized mucoadhesive beads (F-O) showed DEE of 94.24 ± 4.18%, R10h of 59.13 ± 2.27%. These beads were also characterized by SEM and FTIR analyses. The in vitro drug release from these beads showed controlled-release (zero-order) pattern with super case-II transport mechanism over 10h. The optimized beads showed pH-dependent swelling and good mucoadhesivity with the goat intestinal mucosa. The optimized IHM-GG mucoadhesive beads containing metformin HCl exhibited significant antidiabetic effect in alloxan-induced diabetic rats over 10h. PMID:24702916

  11. Nanohole 3D-size tailoring through polystyrene bead combustion during thin film deposition

    International Nuclear Information System (INIS)

    A novel approach is presented for nanohole 3D-size tailoring. The process starts with a monolayer of polystyrene (PS) beads spun coat on silicon wafer as a template. The holes can be directly prepared through combustion of PS beads by oxygen plasma during metal or oxide thin film deposition. The incoming particles are prevented from adhering on PS beads by H2O and CO2 generated from the combustion of the PS beads. The hole depth generally depends on the film thickness. The hole diameter can be tailored by the PS bead size, film deposition rate, and also the combustion speed of the PS beads. In this work, a series of holes with depth of 4-24 nm and diameter of 10-36 nm has been successfully prepared. The hole wall materials can be selected from metals such as Au or Pt and oxides such as SiO2 or Al2O3. These templates could be suitable for the preparation and characterization of novel nanodevices based on single quantum dots or single molecules, and could be extended to the studies of a wide range of coating materials and substrates with controlled hole depth and diameters.

  12. Impact of gelation period on modified locust bean-alginate interpenetrating beads for oral glipizide delivery.

    Science.gov (United States)

    Dey, Paramita; Sa, Biswanath; Maiti, Sabyasachi

    2015-05-01

    In this work, the effect of hydrogelation period in the design of glipizide-loaded biopolymer-based interpenetrating network (IPN) beads was investigated. Carboxymethyl locust bean gum and sodium alginate IPN beads were prepared by ionic crosslinking method using aqueous aluminium chloride salt solution as gelation medium. The longer exposure of the IPN beads in the gelation medium caused a considerable loss of the drug (∼ 8%), and also affected their surface morphology and drug release performance. Spherical shape of the IPN beads was observed under scanning electron microscope (SEM). The diameter of IPN beads increased with increasing gelation time. The IPNs cured for 0.5h exhibited slower drug release kinetics in HCl (pH 1.2) and phosphate buffer (pH 7.4) solution than those incubated for 1-2h. The drug release occurred at a faster rate in phosphate buffer solution and continued for a minimum period of 8h. The IPNs cured for the lowest period obeyed polymer chain-relaxation phenomenon as dominating mechanism for drug release. However, all the IPNs followed anomalous mechanism of drug transport. The drug release corroborated well with pH-dependent swelling behaviors of the IPNs. Thus, IPN beads cured for 0.5h were found most suitable for controlled delivery of BCS class II anti-diabetic drug glipizide. PMID:25745842

  13. Self-assembled magnetic bead chains for sensitivity enhancement of microfluidic electrochemical biosensor platforms.

    Science.gov (United States)

    Armbrecht, L; Dincer, C; Kling, A; Horak, J; Kieninger, J; Urban, G

    2015-11-21

    In this paper, we present a novel approach to enhance the sensitivity of microfluidic biosensor platforms with self-assembled magnetic bead chains. An adjustable, more than 5-fold sensitivity enhancement is achieved by introducing a magnetic field gradient along a microfluidic channel by means of a soft-magnetic lattice with a 350 μm spacing. The alternating magnetic field induces the self-assembly of the magnetic beads in chains or clusters and thus improves the perfusion and active contact between the analyte and the beads. The soft-magnetic lattices can be applied independent of the channel geometry or chip material to any microfluidic biosensing platform. At the same time, the bead-based approach achieves chip reusability and shortened measurement times. The bead chain properties and the maximum flow velocity for bead retention were validated by optical microscopy in a glass capillary. The magnetic actuation system was successfully validated with a biotin-streptavidin model assay on a low-cost electrochemical microfluidic chip, fabricated by dry-film photoresist technology (DFR). Labelling with glucose oxidase (GOx) permits rapid electrochemical detection of enzymatically produced H2O2. PMID:26394820

  14. Fast Diagnosis of Gonorrhea Witth Enhanced Luminescence Enzyme Immunoassay

    Institute of Scientific and Technical Information of China (English)

    ZHENG Heyi(郑和义); CAO Jingjiang(曹经江); SHAO Yanglin(邵燕玲)

    2002-01-01

    Objective:To evaluate the value of enhanced luminescence enzyme immunoassay in the diagnosis of Neisseria gonorrhea(NG) infection.Methods: Anti-catalase antibody for Neisseria gonorrheae combined with enhanced luminescence enzyme immunoassay were used to test for N. Gonorrhea.Results: A minimum of 1x104/CFU of GC in genital tract secretions or urine could be detected with the technique of luminescence enzyme immunoassay.Conclusion : The enhanced luninescence enzyme immunoassay has the advantage of high sensitivity and specificity for diagnosing NG from genitourinary tract secretion and urine.

  15. Black holes as beads on cosmic strings

    OpenAIRE

    Ashoorioon, Amjad; B. Mann, Robert

    2014-01-01

    We consider the possibility of formation of cosmic strings with black holes as beads. We focus on the simplest setup where two black holes are formed on a long cosmic string. It turns out the in absence of a background magnetic field and for observationally viable values for cosmic string tensions, $\\mu

  16. Metallic gold beads in hyaluronic acid

    DEFF Research Database (Denmark)

    Pedersen, Dan Sonne; Tran, Thao Phuong; Smidt, Kamille;

    2013-01-01

    exploiting macrophage-induced liberation of gold ions (dissolucytosis) from gold surfaces. Injecting gold beads in hyaluronic acid (HA) as a vehicle into the cavities of the brain can delay clinical signs of disease progression in the MS model, experimental autoimmune encephalitis (EAE). This study...... effects of hyaluronic acid....

  17. Universal approach for selective trace metal determinations via sequential injection-bead injection-lab-on-valve using renewable hydrophobic bead surfaces as reagent carriers

    DEFF Research Database (Denmark)

    Long, Xiangbao; Miró, Manuel; Hansen, Elo Harald

    2005-01-01

    A new concept is presented for selective and sensitive determination of trace metals via electrothermal atomic absorption spectrometry (ETAAS) based on the principle of bead injection (BI) with renewable reversed-phase surfaces in a sequential injection-lab-on-valve (SI-LOV) mode. The methodology...... involves the use of poly(styrene-divinylbenzene) beads containing pendant octadecyl moieties (C18-PS/DVB), which are preimpregnated with a selective organic metal chelating agent prior to the automatic manipulation of the beads in the microbore conduits of the LOV unit. By adapting this approach, the...... immobilization of the most suitable chelating agent can be effected irrespective of the kinetics involved, optimal reaction conditions can be used for implementing the chelating reaction of the target metal analyte with the immobilized reagent, and an added degree of freedom is offered in selecting the most...

  18. Silver-coated silica beads applicable as core materials of dual-tagging sensors operating via SERS and MEF.

    Science.gov (United States)

    Kim, Kwan; Lee, Yoon Mi; Lee, Hyang Bong; Shin, Kuan Soo

    2009-10-01

    We have developed dual-tagging sensors, operating via both surface-enhanced Raman scattering (SERS) and metal-enhanced fluorescence (MEF), composed of silver-coated silica beads onto which were deposited SERS markers and dye-grafted polyelectrolytes, for multiplex immunoassays. Initially, a very simple electroless-plating method was applied to prepare Ag-coated silica beads. The Raman markers were then assembled onto the Ag-coated silica beads, after which they were brought to stabilization by the layer-by-layer deposition of anionic and cationic polyelectrolytes including a dye-grafted polyelectrolyte. In the final stage, the dual-tagging sensors were assembled onto them with specific antibodies (antihuman-IgG or antirabbit-IgG) to detect target antigens (human-IgG or rabbit-IgG). The MEF signal was used as an immediate indicator of molecular recognition, while the SERS signals were subsequently used as the signature of specific molecular interactions. For this reason, these materials should find wide application, especially in the areas of biological sensing and recognition that rely heavily on optical and spectroscopic properties. PMID:20355851

  19. Motion of beads in an oscillatory rotating fluid: micro-bead-beating

    Science.gov (United States)

    Nadim, Ali; Sterling, James; Doebler, Robert

    2008-11-01

    One method for mechanical lysis of biological cells and spores is to mix them with a suspension of beads and vigorously ``shake'' the mixture. The precise mechanisms of lysis are not understood but lysis is thought to result from collisions between the beads and the cells and the associated stresses exerted on the cells. For instance, in the micro-bead-beater^TM instrument from Claremont BioSolutions LLC (Upland, CA), the ``shaking'' occurs when a small cartridge filled with a mixture of cells/spores and 100-micron beads is driven at high frequencies in a small arc trajectory. In this presentation, we describe our initial modeling effort aimed at understanding this system via analysis of the trajectories of beads within such an instrument. The equations governing the motion of non-neutrally-buoyant spherical beads in an oscillatory rotating flow are derived and analyzed numerically. The resulting trajectories are found to be quite complex and very different from those in a steadily rotating fluid. A catalog of possible trajectories at various values of the governing dimensionless parameters is presented.

  20. New Nanoparticles Dispersing Beads Mill with Ultra Small Beads and its Application

    International Nuclear Information System (INIS)

    Two of the major problems related to nanoparticle dispersion with a conventional beads mill are re-agglomeration and damage to the crystalline structure of the particles. The Ultra Apex Mill was developed to solve these problems by enabling the use of ultra-small beads with a diameter of less than 0.1mm. The core of this breakthrough development is centrifugation technology which allows the use of beads as small as 0.015mm. When dispersing agglomerated nanoparticles the impulse of the small beads is very low which means there is little influence on the particles. The surface energy of the nanoparticles remains low so the properties are not likely to change. As a result, stable nanoparticle dispersions can be achieved without re-cohesion. The Ultra Apex Mill is superior to conventional beads mills that are limited to much larger bead sizes. The technology of the Ultra Apex Mill has pioneered practical applications for nanoparticles in various fields: composition materials for LCD screens, ink-jet printing, ceramic condensers and cosmetics.

  1. Small bowel obstruction due to ingested superabsorbent beads

    Directory of Open Access Journals (Sweden)

    Hao D. Pham

    2015-05-01

    Full Text Available Superabsorbent water beads have found many uses as household decorative items, crafts, and other industrial uses. We report a case of ingestion of several LiquiBlock Rainbow brand superabsorbent beads by a ten month old girl leading to small bowel obstruction requiring laparotomy and removal of the beads.

  2. Highly sensitive detection of clenbuterol using competitive surface-enhanced Raman scattering immunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Guichi [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Hu Yongjun, E-mail: yjhu@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Gao Jiao; Zhong Liang [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2011-07-04

    Graphical abstract: Schemes of SERS nanoprobes preparation (a) and competitive SERS immunoassay for clenbuterol (b). Highlights: > A new method for clenbuterol detection by the use of a competitive SERS immunoassay has been developed. > 4,4'-Dipyridyl is chosen as the Raman reporter due to its fast-labeled, nontoxic and bifunctional properties. > The present method could detect clenbuterol over a wide dynamic concentration range and exhibit significant specificity in real samples. > The technique is more sensitive and simpler than the conventional method ELISA. - Abstract: In this report, we present a novel approach to detect clenbuterol based on competitive surface-enhanced Raman scattering (SERS) immunoassay. Herein, a SERS nanoprobe that relies on gold nanoparticle (GNP) is labeled by 4,4'-dipyridyl (DP) and clenbuterol antibody, respectively. The detection of clenbuterol is carried out by competitive binding between free clenbuterol and clenbuterol-BSA fastened on the substrate with their antibody labeled on SERS nanoprobes. The present method allows us to detect clenbuterol over a much wider concentration range (0.1-100 pg mL{sup -1}) with a lower limit of detection (ca. 0.1 pg mL{sup -1}) than the conventional methods. Furthermore, by the use of this new competitive SERS immunoassay, the clenbuterol-BSA (antigen) is chosen to fasten on the substrate instead of the clenbuterol antibody, which could reduce the cost of the assay. Results demonstrate that the proposed method has the wide potential applications in food safety and agonist control.

  3. Interference from endogenous antibodies in automated immunoassays: what laboratorians need to know.

    Science.gov (United States)

    Ismail, A A A

    2009-08-01

    Full automation of laboratory procedures confers numerous advantages over semi-automated/manual tests because equipment, reagents and the computation of results are offered as an integrated package. Automation has allowed millions of immunoassay tests to be performed with good sensitivity and excellent precision but inaccuracy caused by interference from endogenous immunoglobulins/antibodies remained a problem (irrespective of the immunoassay's format). Interference leading to a falsely high or low result affects a specific sample and may not be obvious despite the strictest laboratory control schemes. Reporting and interpreting such potentially erroneous data remained however the responsibility of the clinical laboratory despite the limited information supplied by their providers. The focus of this review is on highlighting the potential downside of current disjointed and blurred arrangement between the developers/providers of immunoassays, and the laboratorians responsible for providing these data to their clinical colleagues. These limitations can be addressed by drawing attention to the importance of the key fundamentals underpinning these immunologically based analyses which, if carefully considered, could help to formulate pragmatic strategies to reduce errors in immunoassays. In this review, the inherent fallibility of the binding reaction between an antigen and antibody will be reiterated. The difficulties in defining reaction rate kinetics in non-equilibrium automated assays, the potential clinical error rate and the need for minimising analytical error rate of these automated technologies will be highlighted. PMID:19638536

  4. Highly sensitive detection of clenbuterol using competitive surface-enhanced Raman scattering immunoassay

    International Nuclear Information System (INIS)

    Graphical abstract: Schemes of SERS nanoprobes preparation (a) and competitive SERS immunoassay for clenbuterol (b). Highlights: → A new method for clenbuterol detection by the use of a competitive SERS immunoassay has been developed. → 4,4'-Dipyridyl is chosen as the Raman reporter due to its fast-labeled, nontoxic and bifunctional properties. → The present method could detect clenbuterol over a wide dynamic concentration range and exhibit significant specificity in real samples. → The technique is more sensitive and simpler than the conventional method ELISA. - Abstract: In this report, we present a novel approach to detect clenbuterol based on competitive surface-enhanced Raman scattering (SERS) immunoassay. Herein, a SERS nanoprobe that relies on gold nanoparticle (GNP) is labeled by 4,4'-dipyridyl (DP) and clenbuterol antibody, respectively. The detection of clenbuterol is carried out by competitive binding between free clenbuterol and clenbuterol-BSA fastened on the substrate with their antibody labeled on SERS nanoprobes. The present method allows us to detect clenbuterol over a much wider concentration range (0.1-100 pg mL-1) with a lower limit of detection (ca. 0.1 pg mL-1) than the conventional methods. Furthermore, by the use of this new competitive SERS immunoassay, the clenbuterol-BSA (antigen) is chosen to fasten on the substrate instead of the clenbuterol antibody, which could reduce the cost of the assay. Results demonstrate that the proposed method has the wide potential applications in food safety and agonist control.

  5. Surface-Enhanced Raman Scattering (SERS) for Detection in Immunoassays: applications, fundamentals, and optimization

    International Nuclear Information System (INIS)

    Immunoassays have been utilized for the detection of biological analytes for several decades. Many formats and detection strategies have been explored, each having unique advantages and disadvantages. More recently, surface-enhanced Raman scattering (SERS) has been introduced as a readout method for immunoassays, and has shown great potential to meet many key analytical figures of merit. This technology is in its infancy and this dissertation explores the diversity of this method as well as the mechanism responsible for surface enhancement. Approaches to reduce assay times are also investigated. Implementing the knowledge gained from these studies will lead to a more sensitive immunoassay requiring less time than its predecessors. This dissertation is organized into six sections. The first section includes a literature review of the previous work that led to this dissertation. A general overview of the different approaches to immunoassays is given, outlining the strengths and weaknesses of each. Included is a detailed review of binding kinetics, which is central for decreasing assay times. Next, the theoretical underpinnings of SERS is reviewed at its current level of understanding. Past work has argued that surface plasmon resonance (SPR) of the enhancing substrate influences the SERS signal; therefore, the SPR of the extrinsic Raman labels (ERLs) utilized in our SERS-based immunoassay is discussed. Four original research chapters follow the Introduction, each presented as separate manuscripts. Chapter 2 modifies a SERS-based immunoassay previously developed in our group, extending it to the low-level detection of viral pathogens and demonstrating its versatility in terms of analyte type, Chapter 3 investigates the influence of ERL size, material composition, and separation distance between the ERLs and capture substrate on the SERS signal. This chapter links SPR with SERS enhancement factors and is consistent with many of the results from theoretical treatments

  6. Surface-Enhanced Raman Scattering (SERS) for Detection in Immunoassays: applications, fundamentals, and optimization

    Energy Technology Data Exchange (ETDEWEB)

    Jeremy Daniel Driskell

    2006-08-09

    Immunoassays have been utilized for the detection of biological analytes for several decades. Many formats and detection strategies have been explored, each having unique advantages and disadvantages. More recently, surface-enhanced Raman scattering (SERS) has been introduced as a readout method for immunoassays, and has shown great potential to meet many key analytical figures of merit. This technology is in its infancy and this dissertation explores the diversity of this method as well as the mechanism responsible for surface enhancement. Approaches to reduce assay times are also investigated. Implementing the knowledge gained from these studies will lead to a more sensitive immunoassay requiring less time than its predecessors. This dissertation is organized into six sections. The first section includes a literature review of the previous work that led to this dissertation. A general overview of the different approaches to immunoassays is given, outlining the strengths and weaknesses of each. Included is a detailed review of binding kinetics, which is central for decreasing assay times. Next, the theoretical underpinnings of SERS is reviewed at its current level of understanding. Past work has argued that surface plasmon resonance (SPR) of the enhancing substrate influences the SERS signal; therefore, the SPR of the extrinsic Raman labels (ERLs) utilized in our SERS-based immunoassay is discussed. Four original research chapters follow the Introduction, each presented as separate manuscripts. Chapter 2 modifies a SERS-based immunoassay previously developed in our group, extending it to the low-level detection of viral pathogens and demonstrating its versatility in terms of analyte type, Chapter 3 investigates the influence of ERL size, material composition, and separation distance between the ERLs and capture substrate on the SERS signal. This chapter links SPR with SERS enhancement factors and is consistent with many of the results from theoretical treatments

  7. Device for use in immunoassays

    International Nuclear Information System (INIS)

    A novel double antibody-coated test tube is described for use in radioimmunoassays. The solid phase separation technique of this invention is based on a test tube which has been coated on its internal surface with two antibody layers: a first layer of nonspecific antibodies which is bound to the internal surface of the test tube and a second layer of more specific antibodies which are bound to the nonspecific antibodies. The invention is illustrated in the preparation of double antibody-coated test tubes for use in the radioimmunoassays of plasma digoxin levels and serum triiodothyronine levels. (U.K.)

  8. The future development of immunoassay

    International Nuclear Information System (INIS)

    'Labelled reagent' methods of microassay have played an increasingly important role in endocrinology and other areas of medicine in recent years. In general, such methods have relied on highly specific 'biological' reagents such as antibodies, specific binding proteins, etc., and on 'labels' - usually radioisotopes - which enable the reaction behaviour of exceedingly small numbers of molecules to be observed and quantitated. The paper endeavours to establish a logical classification of such methods based on the fundamental analytical principles upon which they rest, and to delineate the relative merits of the two principal approaches used. The use of labels, other than radioisotopes, is also discussed and their advantages compared. In general, the use of 'alternative' labels results in a loss of assay sensitivity and precision in 'saturation assay' procedures (e.g. radioimmunoassay) but are potentially capable of yielding sensitivities many orders of magnitude greater than isotope methods in 'excess reagent' methods (e.g. immunoradiometric assays). Because of the fundamental needs of sensitivity and high specificity required of the analytical methods used in medicine, the author concludes that a 'universal' methodology based on solid-phased antibody is likely to emerge maximizing the sensitivity and specificity characteristics of both 'limited reagent' (saturation assay) and 'excess reagent' assay techniques. (author)

  9. Gliadin Detection in Food by Immunoassay

    Science.gov (United States)

    Grant, Gordon; Sporns, Peter; Hsieh, Y.-H. Peggy

    Immunoassays are very sensitive and efficient tests that are commonly used to identify a specific protein. Examples of applications in the food industry include identification of proteins expressed in genetically modified foods, allergens, or proteins associated with a disease, including celiac disease. This genetic disease is associated with Europeans and affects about one in every 200 people in North America. These individuals react immunologically to wheat proteins, and consequently their own immune systems attack and damage their intestines. This disease can be managed if wheat proteins, specifically "gliadins," are avoided in foods.

  10. Microfluidic Sample Preparation for Immunoassays

    Energy Technology Data Exchange (ETDEWEB)

    Visuri, S; Benett, W; Bettencourt, K; Chang, J; Fisher, K; Hamilton, J; Krulevitch, P; Park, C; Stockton, C; Tarte, L; Wang, A; Wilson, T

    2001-08-09

    Researchers at Lawrence Livermore National Laboratory are developing means to collect and identify fluid-based biological pathogens in the forms of proteins, viruses, and bacteria. to support detection instruments, they are developing a flexible fluidic sample preparation unit. The overall goal of this Microfluidic Module is to input a fluid sample, containing background particulates and potentially target compounds, and deliver a processed sample for detection. They are developing techniques for sample purification, mixing, and filtration that would be useful to many applications including immunologic and nucleic acid assays. Many of these fluidic functions are accomplished with acoustic radiation pressure or dielectrophoresis. They are integrating these technologies into packaged systems with pumps and valves to control fluid flow through the fluidic circuit.

  11. Universal approach for selective trace metal determinations via sequential injection-bead injection-lab-on-valve using renewable hydrophobic bead surfaces as reagent carriers

    DEFF Research Database (Denmark)

    Long, Xiangbao; Miró, Manuel; Hansen, Elo Harald

    2005-01-01

    A new concept is presented for selective and sensitive determination of trace metals via electrothermal atomic absorption spectrometry (ETAAS) based on the principle of bead injection (BI) with renewable reversed-phase surfaces in a sequential injection-lab-on-valve (SI-LOV) mode. The methodology...

  12. Validation of a monoclonal enzyme immunoassay for the determination of carbofuran in fruits and vegetables.

    Science.gov (United States)

    Moreno, M J; Abad, A; Pelegrí, R; Marínez, M J; Sáez, A; Gamón, M; Montoya, A

    2001-04-01

    The N-methylcarbamate pesticide carbofuran is a very important insecticide used worldwide. In the present work, the validation of a monoclonal antibody-based enzyme immunoassay (ELISA) to determine this compound in fruits and vegetables is described. The immunoassay is a competitive heterologous ELISA in the antibody-coated format, with an I(50) value for standards in buffer of 740 ng/L and with a dynamic range between 200 and 3100 ng/L. For recovery studies, peppers, cucumbers, strawberries, tomatoes, potatoes, oranges, and apples were spiked with carbofuran at 10, 50, and 200 ppb. After liquid extraction, analyses were performed by ELISA on extracts purified on solid-phase extraction (SPE) columns and crude, nonpurified extracts. Depending on the crop, mean recoveries in the 43.9--90.7% range were obtained for purified samples and in the 90.1--121.6% range for crude extracts. The carbofuran immunoassay performance was further validated with respect to high-performance liquid chromatography (HPLC) with postcolumn derivatization and fluorescence detection (EPA Method 531.1). Samples were spiked with carbofuran at several concentrations and analyzed as blind samples by ELISA and HPLC after SPE cleanup. The correlation between methods was very good (y = 0.90x + 2.66, r(2)() = 0.958, n = 25), with HPLC being more precise than ELISA (mean coefficients of variation of 4.1 and 11.5%, respectively). The immunoassay was then applied to the analysis of nonpurified extracts of the same samples. Results also compared very well with those obtained by HPLC on purified samples (y = 1.02x + 10.44, r(2)() = 0.933, n = 29). Therefore, the developed immunoassay is a suitable method for the quantitative and reliable determination of carbofuran in fruits and vegetables even without sample cleanup, which saves time and money and considerably increases the sample throughput. PMID:11308315

  13. A novel adjuvant: polymerised serum albumin beads

    International Nuclear Information System (INIS)

    There is an ongoing need to develop new vaccine formulations. To complement accumulating knowledge on the structure of antigens and their interaction with cells of the immune system, new vaccine vehicles to optimise the immunogenic potential of the antigen must be developed. Associated with this adjuvanticity, should be minimal adverse side effects. This study was initiated to develop a vaccine vehicle, consisting of covalently cross-linked serum albumin beads, themselves non-immunogenic, containing virus. Following inoculation, in vivo proteolysis of the beads would allow a gradual release of antigen for sustained immunostimulation. This system might have application in virus vaccine programmes to improve low immunogenic vaccines, to allow optimal delivery of the recently derived synthetic virus subunit peptides as well as for inactivated virus vaccine preparations. 35S-methionine labelled Blue Tongue Virus was used in this study

  14. Recovery of uranium from phosphoric acid medium by polymeric composite beads encapsulating organophosphorus extractants

    International Nuclear Information System (INIS)

    The present study deals with the preparation and evaluation of the poly-ethersulfone (PES) based composite beads encapsulating synergistic mixture of D2EHPA and Cyanex 923 (at 4:1 mole ratio) for the separation of uranium from phosphoric acid medium. SEM was used for the characterization of the composite materials. Addition of 1% PVA (polyvinyl alcohol) improved the internal morphology and porosity of the beads. Additionally, microscopic examination of the composite bead confirmed central coconut type cavity surrounded by porous polymer layer of the beads through which exchange of metal ions take place. Effect of various experimental variables including aqueous acidity, metal ion concentration in aqueous feed, concentration of organic extractant inside the beads, extractant to polymer ratio, liquid to solid (L/S) ratio and temperature on the extraction of uranium was studied. Increase in acidity (1-6 M), L/S ratio (1- 10), metal ion concentration (0.2-3 g/L U3O8) and polymer to extractant ratio (1:4 -1:10) led to decrease in extraction of uranium. At 5.5 M (comparable to wet process phosphoric acid concentration) the extraction of uranium was about 85% at L/S ratio 5. Increase in extractant concentration inside the bead resulted in enhanced extraction of metal ion. Increase in temperature in the range of 30 to 50 Celsius degrees increased the extraction, whereas further increase to 70 C degrees led to the decrease in extraction of uranium. Amongst various reagents tested, stripping of uranium was quantitative by 12% Na2CO3 solution. Polymeric beads were found to be stable and reusable up-to 10 cycles of extraction/stripping. (authors)

  15. Recovery of uranium from phosphoric acid medium by polymeric composite beads encapsulating organophosphorus extractants

    Energy Technology Data Exchange (ETDEWEB)

    Singh, D.K.; Yadav, K.K.; Varshney, L.; Singh, H. [Bhabha Atomic Research Centre, Mumbai 400 085 (India)

    2013-07-01

    The present study deals with the preparation and evaluation of the poly-ethersulfone (PES) based composite beads encapsulating synergistic mixture of D2EHPA and Cyanex 923 (at 4:1 mole ratio) for the separation of uranium from phosphoric acid medium. SEM was used for the characterization of the composite materials. Addition of 1% PVA (polyvinyl alcohol) improved the internal morphology and porosity of the beads. Additionally, microscopic examination of the composite bead confirmed central coconut type cavity surrounded by porous polymer layer of the beads through which exchange of metal ions take place. Effect of various experimental variables including aqueous acidity, metal ion concentration in aqueous feed, concentration of organic extractant inside the beads, extractant to polymer ratio, liquid to solid (L/S) ratio and temperature on the extraction of uranium was studied. Increase in acidity (1-6 M), L/S ratio (1- 10), metal ion concentration (0.2-3 g/L U{sub 3}O{sub 8}) and polymer to extractant ratio (1:4 -1:10) led to decrease in extraction of uranium. At 5.5 M (comparable to wet process phosphoric acid concentration) the extraction of uranium was about 85% at L/S ratio 5. Increase in extractant concentration inside the bead resulted in enhanced extraction of metal ion. Increase in temperature in the range of 30 to 50 Celsius degrees increased the extraction, whereas further increase to 70 C degrees led to the decrease in extraction of uranium. Amongst various reagents tested, stripping of uranium was quantitative by 12% Na{sub 2}CO{sub 3} solution. Polymeric beads were found to be stable and reusable up-to 10 cycles of extraction/stripping. (authors)

  16. Elemental analysis of bead samples using a laser-induced plasma at low pressure

    Energy Technology Data Exchange (ETDEWEB)

    Lie, Tjung Jie [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Kurniawan, Koo Hendrik [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia)]. E-mail: kurnia18@cbn.net.id; Kurniawan, Davy P. [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Pardede, Marincan [Research Center of Maju Makmur Mandiri Foundation, 40 Srengseng Raya, Kembangan, Jakarta Barat 11630 (Indonesia); Suliyanti, Maria Margaretha [Graduate Program in Opto Electrotechniques and Laser Applications, Faculty of Engineering, The University of Indonesia, 4 Salemba Raya, Jakarta 10430 (Indonesia); Khumaeni, Ali [Department of Physics, Faculty of Mathematics and Natural Sciences, Diponegoro University, Tembalang Campus, Semarang 50275 (Indonesia); Natiq, Shouny A. [Department of Physics, Faculty of Mathematics and Natural Sciences, Diponegoro University, Tembalang Campus, Semarang 50275 (Indonesia); Abdulmadjid, Syahrun Nur [Department of Physics, Faculty of Mathematics and Natural Sciences, Syiah Kuala University, Darussalam, Banda Aceh 23116 (Indonesia); Lee, Yong Inn [Physics Department, Chonbuk National University, Chonju 561-756, South Korea (Korea); Kagawa, Kiichiro [Department of Physics, Faculty of Education and Regional Studies, Fukui University, 9-1 bunkyo 3-chome, Fukui 910-8507 (Japan); Idris, Nasrullah [Department of Physics, Faculty of Education and Regional Studies, Fukui University, 9-1 bunkyo 3-chome, Fukui 910-8507 (Japan); Tjia, May On [Department of Physics, Faculty of Mathematics and Natural Sciences, Bandung Institute of Technology, 10 Ganesha, Bandung 40132 (Indonesia)

    2006-01-15

    An Nd:YAG laser (1064 nm, 8 ns, 30 mJ) was focused on various types of fresh, fossilized white coral and giant shell samples, including samples of imitation shell and marble. Such samples are extremely important as material for preparing prayer beads that are extensively used in the Buddhist faith. The aim of this research was to develop a non-destructive method to distinguish original beads from their imitations by means of spectral measurements of the carbon, hydrogen, sodium and magnesium emission intensities and by measuring the hardness of the sample using the ratio between Ca (II) 396.8 nm and Ca (I) 422.6 nm. Based on these measurements, original fresh coral beads can be distinguished from any imitation made from hard wood. The same technique was also effective in distinguishing beads made of shell from its imitation. A spectral analysis of bead was also performed on a fossilized white coral sample and the result can be used to distinguish to some extent the fossilized white coral beads from any imitation made from marble. It was also found that the plasma plume should be generated at low ambient pressure to significantly improve the hydrogen and carbon emission intensity and also to avoid energy loss inside the crater during laser irradiation at atmospheric pressure. The results of this study confirm that operating the laser-induced plasma spectroscopy at reduced ambient pressure offers distinct advantage for bead analysis over the conventional laser-induced breakdown spectroscopy (LIBS) technique operated at atmospheric pressure.

  17. Elemental analysis of bead samples using a laser-induced plasma at low pressure

    International Nuclear Information System (INIS)

    An Nd:YAG laser (1064 nm, 8 ns, 30 mJ) was focused on various types of fresh, fossilized white coral and giant shell samples, including samples of imitation shell and marble. Such samples are extremely important as material for preparing prayer beads that are extensively used in the Buddhist faith. The aim of this research was to develop a non-destructive method to distinguish original beads from their imitations by means of spectral measurements of the carbon, hydrogen, sodium and magnesium emission intensities and by measuring the hardness of the sample using the ratio between Ca (II) 396.8 nm and Ca (I) 422.6 nm. Based on these measurements, original fresh coral beads can be distinguished from any imitation made from hard wood. The same technique was also effective in distinguishing beads made of shell from its imitation. A spectral analysis of bead was also performed on a fossilized white coral sample and the result can be used to distinguish to some extent the fossilized white coral beads from any imitation made from marble. It was also found that the plasma plume should be generated at low ambient pressure to significantly improve the hydrogen and carbon emission intensity and also to avoid energy loss inside the crater during laser irradiation at atmospheric pressure. The results of this study confirm that operating the laser-induced plasma spectroscopy at reduced ambient pressure offers distinct advantage for bead analysis over the conventional laser-induced breakdown spectroscopy (LIBS) technique operated at atmospheric pressure

  18. “BACs-on-Beads:5所产前诊断实验室的前瞻性研究”点评

    Institute of Scientific and Technical Information of China (English)

    刘鹏飞; 王谢桐

    2012-01-01

    <正>1 原文摘要 Objective We previously reported on the validation of Prenatal BACs-on-Beads TM on retrospectively selected and prospective prenatal samples.This bead-based multiplex assay detects chromosome 13 , 18 , 21and X / Y aneuploidies and the nine most frequent microdeletion syndromes. We demonstrated that Prenatal BACs-on-Beads TM is a newgeneration , prenatal screening tool.Here , we describe the experience of five European prenatal diagnosis laboratories concerning the ongoing use of Prenatal BACs- on-Beads TM . Methods Some 1653samples were analyzed.

  19. Appropriate welding conditions of temper bead weld repair for SQV2A pressure vessel steel

    International Nuclear Information System (INIS)

    Temper bead welding technique is one of the most important repair welding methods for large structures for which it is difficult to perform the specified post weld heat treatment. In this study, appropriate temper bead welding conditions to improve the characteristics of heat affected zone (HAZ) are studied using pressure vessel steel SQV2A corresponding to ASTM A533 Type B Class 1. Thermal/mechanical simulator is employed to give specimens welding thermal cycles from single to quadruple cycle. Charpy absorbed energy and hardness of simulated CGHAZ by first cycle were degraded as compared with base metal. Improvability of these degradations by subsequent cycles is discussed and appropriate temper bead thermal cycles are clarified. When the peak temperature lower than Ac1 and near Ac1 in the second thermal cycle is applied to CGAHZ by first thermal cycle, the characteristics of CGHAZ improve enough. When the other peak temperatures (that is, higher than Ac1) in the second thermal cycle are applied to the CGHAZ, third or more thermal cycle temper bead process should be applied to improve the properties. Appropriate weld condition ranges are selected based on the above results. The validity of the selected ranges is verified by the temper bead welding test. (orig.)

  20. Trivalent chromium sorption on alginate beads

    OpenAIRE

    Araújo, M. Manuela; Teixeira, J.A.

    1997-01-01

    The applicability of trivalent chromium removal from aqueous solutions using calcium alginate beads was studied. The equilibrium isotherms were plotted at two temperatures. The relationship between the chromium sorbed and the calcium released was determined as well as the effect of alginate amount and initial pH on the equilibrium results. Chromium sorption kinetics were evaluated as a function of chromium initial concentration and temperature. Transport properties of trival...

  1. RF Bead Pull Measurements of the DQW

    CERN Document Server

    Jaume, Guillaume

    2015-01-01

    This report was written within the framework of the CERN Summer Student Program. It is focused on the Radio Frequency study of the Double Quarter Wave Crab Cavity [1] considered for the crab-crossing scheme of the LHC Luminosity upgrade [2]. HFSS simulation [3] and Bead-Pull Measurements technique were used for the characterization of the higher-order terms of the main deflecting mode.

  2. Two dimensional barcode-inspired automatic analysis for arrayed microfluidic immunoassays

    OpenAIRE

    Zhang, Yi; Qiao, Lingbo; Ren, Yunke; Wang, Xuwei; Gao, Ming; Tang, Yunfang; Jeff Xi, Jianzhong; Fu, Tzung-May; Jiang, Xingyu

    2013-01-01

    The usability of many high-throughput lab-on-a-chip devices in point-of-care applications is currently limited by the manual data acquisition and analysis process, which are labor intensive and time consuming. Based on our original design in the biochemical reactions, we proposed here a universal approach to perform automatic, fast, and robust analysis for high-throughput array-based microfluidic immunoassays. Inspired by two-dimensional (2D) barcodes, we incorporated asymmetric function patt...

  3. Simultaneous measurement of 25 inflammatory markers and neurotrophins in neonatal dried blood spots by immunoassay with xMAP technology

    DEFF Research Database (Denmark)

    Skogstrand, Kristin; Thorsen, Poul; Nørgaard-Pedersen, Bent;

    2005-01-01

    BACKGROUND: Inflammatory reactions and other events in early life may be part of the etiology of late-onset diseases, including cerebral palsy, autism, and type 1 diabetes. Most neonatal screening programs for congenital disorders are based on analysis of dried blood spot samples (DBSS), and stored...... residual DBSS constitute a valuable resource for research into the etiology of these diseases. The small amount of blood available, however, limits the number of analytes that can be determined by traditional immunoassay methodologies. METHODS: We used new multiplexed sandwich immunoassays based on...

  4. Two dimensional barcode-inspired automatic analysis for arrayed microfluidic immunoassays

    Science.gov (United States)

    Zhang, Yi; Qiao, Lingbo; Ren, Yunke; Wang, Xuwei; Gao, Ming; Tang, Yunfang; Jeff Xi, Jianzhong; Fu, Tzung-May; Jiang, Xingyu

    2013-01-01

    The usability of many high-throughput lab-on-a-chip devices in point-of-care applications is currently limited by the manual data acquisition and analysis process, which are labor intensive and time consuming. Based on our original design in the biochemical reactions, we proposed here a universal approach to perform automatic, fast, and robust analysis for high-throughput array-based microfluidic immunoassays. Inspired by two-dimensional (2D) barcodes, we incorporated asymmetric function patterns into a microfluidic array. These function patterns provide quantitative information on the characteristic dimensions of the microfluidic array, as well as mark its orientation and origin of coordinates. We used a computer program to perform automatic analysis for a high-throughput antigen/antibody interaction experiment in 10 s, which was more than 500 times faster than conventional manual processing. Our method is broadly applicable to many other microchannel-based immunoassays. PMID:24404030

  5. PC-88A - impregnated polymeric beads. Preparation, characterization and application for extraction of Pu(IV) from nitric acid medium

    International Nuclear Information System (INIS)

    The extractant-impregnated polymeric beads (EIPBs), containing polyethersulfone as base polymer and 2-ethylhexyl phosphonic acid mono-2-ethylhexyl ester (PC-88A) as an extractant, were prepared by phase inversion method. These EIPBs were characterized by FTIR, TGA and SEM techniques. The beads were found to have excellent acid stability, since these did not exhibit any structural deformation or loss of the extractant into aqueous nitric acid solution (6 M), for a period of 15 d. The feasibility of Pu(IV) extraction, using these beads, from nitric acid solution was tested by batch equilibration method. Parametric dependence of Pu(IV) extraction on experimental variables, like strength of nitric acid, equilibration time, Pu(IV) concentration, etc., was investigated. The present study also addressed the important practical issues, like maximum loading capacity and the reusability of these beads. Under optimized conditions, equilibrium capacity and maximum loading capacity for Pu(IV) were found to be 2.03 and 7.50 mg per gram of the swollen beads, respectively. The reusability of the beads was also ascertained by repetitive extraction-stripping of Pu(IV) up to 7 cycles of operation, without significant change in their extraction performance. The extraction of Pu(IV) by the blank polymeric beads was observed to be almost negligible, under the similar experimental conditions. (orig.)

  6. Effect of methacrylic acid beads on the sonic hedgehog signaling pathway and macrophage polarization in a subcutaneous injection mouse model.

    Science.gov (United States)

    Lisovsky, Alexandra; Zhang, David K Y; Sefton, Michael V

    2016-08-01

    Poly(methacrylic acid-co-methyl methacrylate) (MAA) beads promote a vascular regenerative response when used in diabetic wound healing. Previous studies reported that MAA beads modulated the expression of sonic hedgehog (Shh) and inflammation related genes in diabetic wounds. The aim of this work was to follow up on these observations in a subcutaneous injection model to study the host response in the absence of the confounding factors of diabetic wound healing. In this model, MAA beads improved vascularization in healthy mice of both sexes compared to control poly(methyl methacrylate) (MM) beads, with a stronger effect seen in males than females. MAA-induced vessels were perfusable, as evidenced from the CLARITY-processed images. In Shh-Cre-eGFP/Ptch1-LacZ non-diabetic transgenic mice, the increased vessel formation was accompanied by a higher density of cells expressing GFP (Shh) and β-Gal (patched 1, Ptch1) suggesting MAA enhanced the activation of the Shh pathway. Ptch1 is the Shh receptor and a target of the pathway. MAA beads also modulated the inflammatory cell infiltrate in CD1 mice: more neutrophils and more macrophages were noted with MAA relative to MM beads at days 1 and 7, respectively. In addition, MAA beads biased macrophages towards a MHCII-CD206+ ("M2") polarization state. This study suggests that the Shh pathway and an altered inflammatory response are two elements of the complex mechanism whereby MAA-based biomaterials effect vascular regeneration. PMID:27264502

  7. X-ray fluorescent analysis on Indo-Pacific glass beads from Sungai Mas archaeological sites, Kedah, Malaysia

    International Nuclear Information System (INIS)

    Sungai Mas was an ancient port-kingdom located on West Coast of Peninsula Malaysia in a district of Kota Kuala Muda, Kedah, Malaysia. The port-kingdom evolved as an entrepot since fifth century AD and continuously visited by international trader from India, China, Middle East and Europe until eighteenth century AD. Sungai Mas was also one of the Indo-Pacific beads making centers in Southeast Asia since sixth to thirteenth century AD and also produced pottery and brick. X-ray fluorescent analysis (XRF) on Sungai Mas Indo-Pacific beads is carried out to determine whether the glass beads originated from Arikamedu, India or locally made by community in Sungai Mas. Totally, twenty-two samples of beads and beads materials assayed by XRF were chosen. Contents of nine major elements and nine trace elements, which might be present of flux, stabilizer, colorants or opacifier were examined. The elements Si, Na, K, Ca, Fe, Al, Ti, Mn, Mg, Cu, Pb, Zr, Sr, Ba, La, U, Ni and Cr were detectable in all samples. The concentration of elements found are discussed in terms of flux, silica or lead base glass, color and/or opacity of the glass beads and glass samples. The result showed that Sungai Mas produced their own Indo-Pacific beads from sixth to thirteenth century AD. (author)

  8. A fluorescent immunoassay for theophylline: description and comparison to enzyme immunoassay, liquid chromatography and radioimmunoassay

    International Nuclear Information System (INIS)

    A fluorescent immunoassay for theophylline is described and comparatively evaluated with radioimmunoassay, high-performance liquid chromatography, and enzyme immunoassay. Fifty sera were collected from 43 patients of a large acute-care medical facility, many of whom were suffering from other diseases in addition to bronchial asthma or apnea of the newborn, and were receiving other medication besides theophylline. Assays of theophylline in each serum sample were performed by each of the 4 procedures. The four methods showed comparable results, although each method had at least one unexplained outlier. Nevertheless, all methods seemed suitable for routine chemistry laboratory use. Three of the techniques have been available for several years, but unexplained erroneous levels are sometimes obtained for every procedure

  9. Magnetic/luminescent core/shell particles synthesized by spray pyrolysis and their application in immunoassays with internal standard

    International Nuclear Information System (INIS)

    Many types of fluorescent nanoparticles have been investigated as alternatives to conventional organic dyes in biochemistry; magnetic beads also have a long history of biological applications. In this work we apply flame spray pyrolysis in order to engineer a novel type of nanoparticle that has both luminescent and magnetic properties. The particles have magnetic cores of iron oxide doped with cobalt and neodymium and luminescent shells of europium-doped gadolinium oxide (Eu:Gd2O3). Measurements by vibrating sample magnetometry showed an overall paramagnetic response of these composite particles. Luminescence spectroscopy showed spectra typical of the Eu ion in a Gd2O3 host-a narrow emission peak centred near 615 nm. Our synthesis method offers a low-cost, high-rate synthesis route that enables a wide range of biological applications of magnetic/luminescent core/shell particles. Using these particles we demonstrate a novel immunoassay format with internal luminescent calibration for more precise measurements

  10. Chemiluminescence Resonance Energy Transfer Competitive Immunoassay Employing Hapten-Functionalized Quantum Dots for the Detection of Sulfamethazine.

    Science.gov (United States)

    Ma, Mingfang; Wen, Kai; Beier, Ross C; Eremin, Sergei A; Li, Chenglong; Zhang, Suxia; Shen, Jianzhong; Wang, Zhanhui

    2016-07-20

    We describe a new strategy for using chemiluminescence resonance energy transfer (CRET) by employing hapten-functionalized quantum dots (QDs) in a competitive immunoassay for detection of sulfamethazine (SMZ). Core/multishell QDs were synthesized and modified with phospholipid-PEG. The modified QDs were functionalized with the hapten 4-(4-aminophenyl-sulfonamido)butanoic acid. The CRET-based immunoassay exhibited a limit of detection for SMZ of 9 pg mL(-1), which is >4 orders of magnitude better than a homogeneous fluorescence polarization immunoassay and is 2 orders of magnitude better than a heterogeneous enzyme-linked immunosorbent assay. This strategy represents a simple, reliable, and universal approach for detection of chemical contaminants. PMID:27362827

  11. A multiplexed immunoassay for detection of antibodies to Actinobacillus pleuropneumoniae (App) in pigs

    DEFF Research Database (Denmark)

    Berger, Sanne Schou; Boas, Ulrik; Andresen, Lars Ole;

    2014-01-01

    The bacterium Actinobacillus pleuropneumoniae (App) is the causative agent of porcine pleuropneumoniae, a contagious and severe respiratory disease in pigs. Based on capsular antigens, 15 App serovars have been described, and the prevalence and morbidity of these serovars vary with geographic...... regions (1). In Denmark, the most important serovars are considered to be App 1, 2, 5, 6, 7, 10 and 12. As part of the Danish surveillance program for App, the Danish Veterinary Institute uses ELISAs and complement fixation tests (CFT) to test for porcine anti-App antibodies (2-7). In an effort to improve...... our diagnostic tools, we are currently developing a novel indirect fluorescent microsphere immunoassay that can facilitate simultaneous detection of antibodies towards multiple App serovars within a single serum sample volume. The multiplex immunoassay is based on Luminex technology (8) and has...

  12. Immunoassay of chemical contaminants in milk:A review

    Institute of Scientific and Technical Information of China (English)

    XU Fei; REN Kang; YANG Yu-ze; GUO Jiang-peng; MA Guang-peng; LIU Yi-ming; LU Yong-qiang; LI Xiu-bo

    2015-01-01

    The detection of chemical contaminants is critical to ensure dairy safety. These contaminants include veterinary medicines, antibiotics, pesticides, heavy metals, mycotoxins, and persistent organic polutants (POPs). Immunoassays have recently been used to detect contaminants in milk because of their simple operation, high speed, and low cost. This article describes the latest developments in the most important component of immunoassays—antibodies, and then reviews the four major substrates used for immunoassays (i.e., microplates, membranes, gels, and chips) as wel as their use in the detection of milk contaminants. The paper concludes with prospects for further applications of these immunoassays.

  13. Flow immunoassay using solid-phase entrapment.

    Science.gov (United States)

    Locascio-Brown, L; Martynova, L; Christensen, R G; Horvai, G

    1996-05-01

    A flow injection immunoassay was performed using a column packed with reversed-phase sorbents to effect separation of the immunoreacted species by entrapping free analyte and allowing antibody-conjugated analyte to pass unretained. Fluorescein-labeled analyte was measured in a competitive assay for the anticonvulsant drug phenytoin. The simplicity of the assay was the greatest advantage of the technique, which allowed for measurement of phenytoin in a 2-min assay time. The reliable detection limit for the assay was 5 nmol L(-)(1) of phenytoin in serum. The columns were regenerated with periodic injections of ethanol solutions to remove the entrapped analyte and prepare the column for subsequent analyses. PMID:21619134

  14. Magnetic bead micromixer: Influence of magnetic element geometry and field amplitude

    DEFF Research Database (Denmark)

    Lund-Olesen, Torsten; Buus, Bjarke B.; Howalt, Jakob;

    2008-01-01

    A scheme for the silicon microfabrication of lab-on-a-chip systems with mixing based on dynamic plugs of magnetic beads is presented. The systems consist of a microfluidic channel integrated with a number of soft magnetic elements by the sides of the channel. The elements are magnetized by a...... homogeneous external ac magnetic field. The systems are scalable with respect to the number of magnetic bead plugs and number of parallel channels, and thus they have high potential for use in biological separation using functionalized magnetic beads. The mixing efficiency is characterized for two different...... geometries of the soft magnetic structures and found to be highly sensitive to the geometry and position of the structures....

  15. Simulation of Enzyme Catalysis in Calcium Alginate Beads

    Directory of Open Access Journals (Sweden)

    Ameel M. R. Al-Mayah

    2012-01-01

    Full Text Available A general mathematical model for a fixed bed immobilized enzyme reactor was developed to simulate the process of diffusion and reaction inside the biocatalyst particle. The modeling and simulation of starch hydrolysis using immobilized α-amylase were used as a model for this study. Corn starch hydrolysis was carried out at a constant pH of 5.5 and temperature of . The substrate flow rate was ranging from 0.2 to 5.0 mL/min, substrate initial concentrations 1 to 100 g/L. α-amylase was immobilized on to calcium alginate hydrogel beads of 2 mm average diameter. In this work Michaelis-Menten kinetics have been considered. The effect of substrate flow rate (i.e., residence time and initial concentration on intraparticle diffusion have been taken into consideration. The performance of the system is found to be affected by the substrate flow rate and initial concentrations. The reaction is controlled by the reaction rate. The model equation was a nonlinear second order differential equation simulated based on the experimental data for steady state condition. The simulation was achieved numerically using FINITE ELEMENTS in MATLAB software package. The simulated results give satisfactory results for substrate and product concentration profiles within the biocatalyst bead.

  16. Formulation and In Vitro evaluation of pH sensitive oil entrapped polymeric blended gellan gum buoyant beads of clarithromycin

    OpenAIRE

    Tripathi, G.; Singh, S

    2010-01-01

    "n  "nBackground and the purpose of the study: A gastroretentive pH sensitive system has been a frontier approach to release the drug in controlled manner in stomach and duodenum. The aim of this study was to develop buoyant beads of gellan based, wherein, the oil was entrapped, blended with hydroxypropyl methyl cellulose or carbopol 934 in order to evaluate its potential for targeted sustained delivery of clarithromycin in the gastric region. "nMethods: Buoyant beads ...

  17. Targeted Selected Reaction Monitoring Mass Spectrometric Immunoassay for Insulin-like Growth Factor 1

    OpenAIRE

    Eric E Niederkofler; Phillips, David A.; Krastins, Bryan; Kulasingam, Vathany; Kiernan, Urban A.; Tubbs, Kemmons A.; Peterman, Scott M.; Prakash, Amol; Diamandis, Eleftherios P.; Lopez, Mary F; Nedelkov, Dobrin

    2013-01-01

    Insulin-like growth factor 1 (IGF1) is an important biomarker of human growth disorders that is routinely analyzed in clinical laboratories. Mass spectrometry-based workflows offer a viable alternative to standard IGF1 immunoassays, which utilize various pre-analytical preparation strategies. In this work we developed an assay that incorporates a novel sample preparation method for dissociating IGF1 from its binding proteins. The workflow also includes an immunoaffinity step using antibody-de...

  18. Evaluation of a Treponema pallidum enzyme immunoassay as a screening test for syphilis.

    OpenAIRE

    Hooper, N E; Malloy, D C; Passen, S

    1994-01-01

    The CAPTIA Syphilis-G enzyme immunoassay for the detection of antibodies to Treponema pallidum was evaluated as a screening test for syphilis in comparison with the standard rapid plasma reagin (RPR) test. One thousand samples were tested, and the standard fluorescent treponemal antibody absorption test and the standard microhemmaglutination test were used to confirm the presence of treponemal antibodies. Diagnosis of syphilis was based on traditional standard serology results. Clinical data ...

  19. A highly-sensitive multisubstrate-compatible chemiluminescent immunoassay for human fetuin A

    OpenAIRE

    sprotocols

    2015-01-01

    Authors: Sandeep Kumar Vashist ### Abstract We report a highly-sensitive chemiluminescent immunoassay (CIA) for the detection of human fetuin A (HFA), which is based on the leach-proof covalent crosslinking of anti-HFA capture antibodies on 3-aminopropyltriethoxysilane (APTES)-functionalized 96-well chemiluminescent microtiter plates (CMTP) using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-hydroxysulfosuccinimide. It has more than 3-fold reduced overall assay du...

  20. Quantum dot immunoassays in renewable surface column and 96-well plate formats for the fluorescence detection of Botulinum neurotoxin using high-affinity antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Warner, Marvin G.; Grate, Jay W.; Tyler, Abby J.; Ozanich, Richard M.; Miller, Keith D.; Lou, Jianlong; Marks, James D.; Bruckner-Lea, Cindy J.

    2009-09-01

    A fluorescence sandwich immunoassay using high affinity antibodies and quantum dot (QD) reporters has been developed for detection of botulinum toxin serotype A (BoNT/A). For the development of the assay, a nontoxic recombinant fragment of the holotoxin (BoNT/A-HC-fragment) has been used as a structurally valid simulant for the full toxin molecule. The antibodies used, AR4 and RAZ1, bind to nonoverlapping epitopes present on both the full toxin and on the recombinant fragment. In one format, the immunoassay is carried out in a 96-well plate with detection in a standard plate reader. Detection down to 31 pM of the BoNT/Hc-fragment was demonstrated with a total incubation time of 3 hours, using AR4 as the capture antibody and QD-coupled RAZ1 as the reporter. In a second format, the AR4 capture antibody was coupled to Sepharose beads, and the immunochemical reactions were carried out in microcentrifuge tubes with an incubation time of 1 hour. These beads were subsequently captured and concentrated in a rotating rod “renewable surface” flow cell as part of a sequential injection fluidic system. This flow cell was equipped with a fiber optic system for fluorescence measurements. In PBS buffer solution matrix, the BoNT/A-HC-fragment was detected to concentrations as low as 5 pM using the fluidic measurement approach.

  1. Investigation the parameters for torsion ductility of bead wire

    International Nuclear Information System (INIS)

    Torsion testing is used to determine the quality of steel wire used for beads in pneumatic tires. However, strain aging (dynamic and static) caused by interstitial carbon and nitrogen atoms bound to mobile dislocations increases yield strength and decreases bead formability. Processing parameters of bead wire, such as line speed, lead bath temperature and wire diameter, were investigated, and theoretical calculations were made to estimate the effect of these parameters on strain aging. Nitrogen concentration was measured in bead wire samples with varying numbers of twists to failure during torsion testing. Surface morphologies of twisted bead wires were examined by scanning electron microscopy. Experimental data showed that torsional properties of bead wire were a function of stress relief temperature on and theoretical calculations showed that line speed and temperature have to be optimized for optimum torsion ductility.

  2. Detection of ''beading faults'' in welded tubes

    International Nuclear Information System (INIS)

    In the steel tube industry the word ''beading'' refers to a highly localised leak affecting the welded zone. During the pneumatic test its flow rate is generally very low no more than a few thousandths of a mm3/second. Detection of such a fault by this test is consequently slow, and those which are choked or at the limit of leakage may escape detection. For greater safety, the tube technician is now using non-destructive testing methods such as eddy-currents and ultrasonics

  3. A Novel Colorimetric Immunoassay Utilizing the Peroxidase Mimicking Activity of Magnetic Nanoparticles

    Directory of Open Access Journals (Sweden)

    Hyun Gyu Park

    2013-05-01

    Full Text Available A simple colorimetric immunoassay system, based on the peroxidase mimicking activity of Fe3O4 magnetic nanoparticles (MNPs, has been developed to detect clinically important antigenic molecules. MNPs with ca. 10 nm in diameter were synthesized and conjugated with specific antibodies against target molecules, such as rotaviruses and breast cancer cells. Conjugation of the MNPs with antibodies (MNP-Abs enabled specific recognition of the corresponding target antigenic molecules through the generation of color signals arising from the colorimetric reaction between the selected peroxidase substrate, 3,3',5,5'-tetramethylbenzidine (TMB and H2O2. Based on the MNP-promoted colorimetric reaction, the target molecules were detected and quantified by measuring absorbance intensities corresponding to the oxidized form of TMB. Owing to the higher stabilities and economic feasibilities of MNPs as compared to horseradish peroxidase (HRP, the new colorimetric system employing MNP-Abs has the potential of serving as a potent immunoassay that should substitute for conventional HRP-based immunoassays. The strategy employed to develop the new methodology has the potential of being extended to the construction of simple diagnostic systems for a variety of biomolecules related to human cancers and infectious diseases, particularly in the realm of point-of-care applications.

  4. Development of temper bead welding by under water laser welding

    International Nuclear Information System (INIS)

    Toshiba has developed temper bead welding by under water laser welding as SCC counter measure for aged components in PWR and BWR nuclear power plants. Temper bead welding by under water laser welding technique recovers toughness of low alloy steel reactor vessel by employing proper the number of cladding layers and their welding conditions. In this report, some evaluation results of material characteristics of temper bead welded low alloy steel are presented. (author)

  5. Artemisia arborescens L essential oil loaded beads: Preparation and characterization

    OpenAIRE

    Lai, Francesco; Loy, Giuseppe; Manconi, Maria; Manca, Maria Letizia; Fadda, Anna Maria

    2007-01-01

    The purpose of this work was to prepare sodium alginate beads as a device for the controlled release of essential oil for oral administration as an antiviral agent. Different formulations were prepared with sodium alginate as a natural polymer and calcium chloride or glutaraldehyde as a cross-linking agent. Loading capacities of between 86% and 100% were obtained in freshly prepared beads by changing exposure time to the cross-linking agent. Drying of the calcium alginate beads caused only a ...

  6. DETECTION OF ROTAVIRUS WITH A NEW POLYCLONAL ANTIBODY ENZYME IMMUNOASSAY (ROTAZYME 2) AND A COMMERCIAL LATEX AGGLUTINATION TEXT (ROTALEX): COMPARISON WITH A MONOCLONAL ANTIBODY ENZYME IMMUNOASSAY

    Science.gov (United States)

    A total of 176 human fecal specimens were examined for the presence of rotavirus using four different assays: a monoclonal antibody enzyme immunoassay; the original polyclonal antibody enzyme immunoassay marketed by Abbott Laboratories, Chicago, IL (Rotazyme I); a modification of...

  7. Multiplex dipstick immunoassay for semi-quantitative determination of Fusarium mycotoxins in cereals

    International Nuclear Information System (INIS)

    Highlights: ► We developed a rapid method based on a multiplex dipstick immunoassay. ► The assay allowed the determination of major Fusarium toxins in wheat, oats, maize. ► We obtained cut off levels close to EU regulatory levels. - Abstract: A multiplex dipstick immunoassay based method for the simultaneous determination of major Fusarium toxins, namely zearalenone, T-2 and HT-2 toxins, deoxynivalenol and fumonisins in wheat, oats and maize has been developed. The dipstick format was based on an indirect competitive approach. Four test lines (mycotoxin–BSA conjugates) and one control line were located on the strip membrane. Labelled antibodies were freeze-dried within the microwell. Two matrix-related sample preparation protocols have been developed for wheat/oats (not containing fumonisins) and maize (containing fumonisins) respectively. The use of a methanol/water mixture for sample preparation allowed recoveries in the range 73–109% for all mycotoxins in all tested cereals, with relative standard deviation less than 10%. The optimized immunoassay was able to detect target mycotoxins at cut off levels equal to 80% of EU maximum permitted levels, i.e. 280, 400, 1400 and 3200 μg kg−1, respectively, for zearalenone, T-2/HT-2 toxins, deoxynivalenol and fumonisins in maize, and 80, 400 and 1400 μg kg−1, respectively, for zearalenone, T-2/HT-2 toxins and deoxynivalenol in wheat and oats. Analysis of naturally contaminated samples resulted in a good agreement between multiplex dipstick and validated confirmatory LC–MS/MS. The percentage of false positive results was less than or equal to 13%, whereas no false negative results were obtained. Data on the presence/absence of 6 mycotoxins at levels close to EU regulatory levels were obtained within 30 min. The proposed immunoassay protocol is rapid, inexpensive, easy-to-use and fit for purpose of rapid screening of mycotoxins in cereals.

  8. Multiplexed, Patterned-Paper Immunoassay for Detection of Malaria and Dengue Fever.

    Science.gov (United States)

    Deraney, Rachel N; Mace, Charles R; Rolland, Jason P; Schonhorn, Jeremy E

    2016-06-21

    Multiplex assays detect the presence of more than one analyte in a sample. For diagnostic applications, multiplexed tests save healthcare providers time and resources by performing many assays in parallel, minimizing the amount of sample needed and improving the quality of information acquired regarding the health status of a patient. These advantages are of particular importance for those diseases that present with general, overlapping symptoms, which makes presumptive treatments inaccurate and may put the patient at risk. For example, malaria and dengue fever are febrile illnesses transmitted through mosquito bites, and these common features make it difficult to obtain an accurate diagnosis by symptoms alone. In this manuscript, we describe the development of a multiplexed, patterned paper immunoassay for the detection of biomarkers of malaria and dengue fever: malaria HRP2, malaria pLDH, and dengue NS1 type 2. In areas coendemic for malaria and dengue fever, this assay could be used as a rapid, point-of-care diagnostic to determine the cause of a fever of unknown origin. The reagents required for each paper-based immunoassay are separated spatially within a three-dimensional device architecture, which allows the experimental conditions to be adjusted independently for each assay. We demonstrate the analytical performances of paper-based assays for each biomarker and we show that there is no significant difference in performance between the multiplexed immunoassay and those immunoassays performed in singleplex. Additionally, we spiked individual analytes into lysed human blood to demonstrate specificity in a clinically relevant sample matrix. Our results suggest multiplex paper-based devices can be an essential component of diagnostic assays used at the point-of-care. PMID:27186893

  9. Multiplex dipstick immunoassay for semi-quantitative determination of Fusarium mycotoxins in cereals

    Energy Technology Data Exchange (ETDEWEB)

    Lattanzio, Veronica M.T., E-mail: veronica.lattanzio@ispa.cnr.it [National Research Council of Italy, Institute of Sciences of Food Production (ISPA-CNR), Via Amendola 122/O, 70126 Bari (Italy); Nivarlet, Noan [UNISENSOR S.A., Zoning industriel du Dossay, Rue du Dossay no 3, B-4020 Liege (Belgium); Lippolis, Vincenzo; Gatta, Stefania Della [National Research Council of Italy, Institute of Sciences of Food Production (ISPA-CNR), Via Amendola 122/O, 70126 Bari (Italy); Huet, Anne-Catherine; Delahaut, Philippe [Centre d' Economie Rurale (CER Groupe), Rue du Point du Jour no 8, B-6900 Marloie (Belgium); Granier, Benoit [UNISENSOR S.A., Zoning industriel du Dossay, Rue du Dossay no 3, B-4020 Liege (Belgium); Visconti, Angelo [National Research Council of Italy, Institute of Sciences of Food Production (ISPA-CNR), Via Amendola 122/O, 70126 Bari (Italy)

    2012-03-09

    Highlights: Black-Right-Pointing-Pointer We developed a rapid method based on a multiplex dipstick immunoassay. Black-Right-Pointing-Pointer The assay allowed the determination of major Fusarium toxins in wheat, oats, maize. Black-Right-Pointing-Pointer We obtained cut off levels close to EU regulatory levels. - Abstract: A multiplex dipstick immunoassay based method for the simultaneous determination of major Fusarium toxins, namely zearalenone, T-2 and HT-2 toxins, deoxynivalenol and fumonisins in wheat, oats and maize has been developed. The dipstick format was based on an indirect competitive approach. Four test lines (mycotoxin-BSA conjugates) and one control line were located on the strip membrane. Labelled antibodies were freeze-dried within the microwell. Two matrix-related sample preparation protocols have been developed for wheat/oats (not containing fumonisins) and maize (containing fumonisins) respectively. The use of a methanol/water mixture for sample preparation allowed recoveries in the range 73-109% for all mycotoxins in all tested cereals, with relative standard deviation less than 10%. The optimized immunoassay was able to detect target mycotoxins at cut off levels equal to 80% of EU maximum permitted levels, i.e. 280, 400, 1400 and 3200 {mu}g kg{sup -1}, respectively, for zearalenone, T-2/HT-2 toxins, deoxynivalenol and fumonisins in maize, and 80, 400 and 1400 {mu}g kg{sup -1}, respectively, for zearalenone, T-2/HT-2 toxins and deoxynivalenol in wheat and oats. Analysis of naturally contaminated samples resulted in a good agreement between multiplex dipstick and validated confirmatory LC-MS/MS. The percentage of false positive results was less than or equal to 13%, whereas no false negative results were obtained. Data on the presence/absence of 6 mycotoxins at levels close to EU regulatory levels were obtained within 30 min. The proposed immunoassay protocol is rapid, inexpensive, easy-to-use and fit for purpose of rapid screening of mycotoxins

  10. Ormosil Beads for Insulation of Ground Cryogenic Storage Tanks Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Organically modified silica (Ormosil) aerogel beads developed at Aspen Aerogels, Inc. offer several advantages for retrofitting perlite insulation in NASA's ground...

  11. Fast Drug Release Using Rotational Motion of Magnetic Gel Beads

    Directory of Open Access Journals (Sweden)

    Jun-Ichi Takimoto

    2008-03-01

    Full Text Available Accelerated drug release has been achieved by means of the fast rotation of magnetic gel beads. The magnetic gel bead consists of sodium alginate crosslinked by calcium chlorides, which contains barium ferrite of ferrimagnetic particles, and ketoprofen as a drug. The bead underwent rotational motion in response to rotational magnetic fields. In the case of bead without rotation, the amount of drug release into a phosphate buffer solution obeyed non-Fickian diffusion. The spontaneous drug release reached a saturation value of 0.90 mg at 25 minutes, which corresponds to 92% of the perfect release. The drug release was accelerated with increasing the rotation speed. The shortest time achieving the perfect release was approximately 3 minutes, which corresponds to 1/8 of the case without rotation. Simultaneous with the fast release, the bead collapsed probably due to the strong water flow surrounding the bead. The beads with high elasticity were hard to collapse and the fast release was not observed. Hence, the fast release of ketoprofen is triggered by the collapse of beads. Photographs of the collapse of beads, time profiles of the drug release, and a pulsatile release modulated by magnetic fields were presented.

  12. Immunoassay utilizing biochemistry reaction product via surface-enhanced Raman scattering in near field

    Institute of Scientific and Technical Information of China (English)

    ZHAO Haiying; NI Yi; JIANG Wei; LUO Peiqing; HUANG Meizheng; YIN Guangzhong; DOU Xiaoming

    2005-01-01

    We propose here a kind of applications of surface-enhanced Raman scattering (SERS) to immunology. It is a new enzyme immunoassay based on SERS. In the proposed system, antibody immobilized on a solid substrate reacts with antigen, which binds with another antibody labeled with peroxidase. If this immunocomplex is subjected to reaction with o-phenylenediamine and hydrogenperoxide, azoaniline is generated. This azo compound is adsorbed on a silver colloid and only the azo compound gives a strong surface-enhanced resonance Raman (SERRS) spectrum. A linear relationship was observed between the peak intensity of the N=N stretching band and the concentration of antigen, revealing that one can determine the concentration of antigen by the SERRS measurement of the reaction product. The detection limit of this SERS enzyme immunoassay method was found to be about 10-15 mol/L.

  13. Advances in ovarian cancer diagnosis: A journey from immunoassays to immunosensors.

    Science.gov (United States)

    Sharma, Shikha; Raghav, Ragini; O'Kennedy, Richard; Srivastava, Sudha

    2016-07-01

    This review focuses on the technological advancements, challenges and trends in immunoassay technologies for ovarian cancer diagnosis. Emphasis is placed on the principles of the technologies, their merits and limitations and on the evolution from laboratory-based methods to point-of-care devices. While the current market is predominantly associated with clinical immunoassay kits, over the last decade a major thrust in development of immunosensors is evident due to their potential in point-of-care devices. Technological advancements in immunosensors, extending from labeled to label-free detection, with and without mediators, for enhancing proficiencies and reliability have been dealt with in detail. Aspects of the utilisation of nanomaterials and immobilization strategies for enhancing sensitivity and altering the detection range have also been addressed. Finally, we have discussed some distinct characteristics and limitations associated with the recently commericalised technologies used for quantitation of relevant ovarian cancer markers. PMID:27233124

  14. Immunochromatographic assay for quantitative and sensitive detection of hepatitis B virus surface antigen using highly luminescent quantum dot-beads.

    Science.gov (United States)

    Shen, Jun; Zhou, Yaofeng; Fu, Fen; Xu, Hengyi; Lv, Jiaofeng; Xiong, Yonghua; Wang, Andrew

    2015-09-01

    Hepatitis B virus infection is one of the major causes of hepatitis, liver cirrhosis and liver cancer. In this study, we used highly luminescent quantum dot-beads (QBs) as signal amplification probes in the sandwich immunochromatographic assay (ICA) for ultrasensitive and quantitative detection of hepatitis B virus surface antigen (HBsAg) in human serum. Various parameters that influenced the sensitivity and stability of the QB-based ICA (QB-ICA) sensor were investigated. Two linear independent regression equations for detection of serum HBsAg were expressed with Y=0.3361X-0.0059 (R(2)=0.9983) for low HBsAg concentrations between 75 pg mL(-1) and 4.8 ng mL(-1), and Y=0.8404 X-2.9364 (R(2)=0.9939) for high HBsAg concentrations in the range from 4.8 ng mL(-1) to 75 ng mL(-1). The detection limit of the proposed ICA sensor achieved was 75 pg mL(-1), which is much higher than that of the routinely-used gold nanoparticle based ICA. The intra- and inter-assays recovery rates for spiked serum samples at HBsAg concentrations of 75 pg mL(-1), 3.75 ng mL(-1) and 18.75 ng mL(-1) ranged from 90.14% to 97.6%, and coefficients of variation were all below 7%, indicating that the QB-ICA sensor has an acceptable accuracy for HBsAg detection. Additionally, the quantitative method developed showed no false positive results in an analysis of 49 real HBsAg-negative serum samples, and exhibited excellent agreement (R(2)=0.9209) with a commercial chemiluminescence immunoassay kit in identifying 47 HBsAg-positive serum samples. In summary, due to its high fluorescence intensity, the sandwich QB-ICA sensor is a very promising point-of-care test for rapid, simple and ultrasensitive detection of HBsAg, as well as other disease-related protein biomarkers. PMID:26003704

  15. Radio-immunoassay of somatostatin from isolated rat pancreatic islets

    Energy Technology Data Exchange (ETDEWEB)

    Vonen, B.; Florholmen, J.; Giaever, A.K.; Burhol, P. (Tromsoe Univ. (Norway))

    1989-04-01

    Certain aspects of radio-immunoassay of somatostatin from isolated rat pancreatic islets are described. Somatostatin-14, and not somatostatin-28, is secreted from isolated rat pancreatic islets. Less somatostatin secretion is measured per islet owing to purity of tracer in the radio-immunoassay. Theophylline apparently cross-reacts with somatostatin in the assay described, and this has to be taken into consideration when studying somatostatin release induced by theophylline in isolated islets. (author).

  16. Evaluation of the LIAISON Chemiluminescence Immunoassay for Diagnosis of Syphilis▿

    OpenAIRE

    Knight, Carrie S.; Crum, Mary A.; Hardy, Robert W

    2007-01-01

    We report the results of an evaluation of the LIAISON Treponema pallidum-specific assay, a one-step sandwich chemiluminescence immunoassay (CLIA), as a screening test and as a confirmatory test for the diagnosis of syphilis. The assay was compared with the CAPTIA Syphilis-G enzyme immunoassay (EIA) and with a testing algorithm that also included the rapid plasma reagin (RPR) and T. pallidum particle agglutination (PA) assays. As a screening test, the CLIA showed levels of agreement with the E...

  17. Radio-immunoassay of somatostatin from isolated rat pancreatic islets

    International Nuclear Information System (INIS)

    Certain aspects of radio-immunoassay of somatostatin from isolated rat pancreatic islets are described. Somatostatin-14, and not somatostatin-28, is secreted from isolated rat pancreatic islets. Less somatostatin secretion is measured per islet owing to purity of tracer in the radio-immunoassay. Theophylline apparently cross-reacts with somatostatin in the assay described, and this has to be taken into consideration when studying somatostatin release induced by theophylline in isolated islets. (author)

  18. Transcatheter Treatment of Hepatocellular Carcinoma with Doxorubicin-loaded DC Bead (DEBDOX): Technical Recommendations

    International Nuclear Information System (INIS)

    Tranarterial chemoembolization (TACE) has been established by a meta-analysis of randomized controlled trials as the standard of care for nonsurgical patients with large or multinodular noninvasive hepatocellular carcinoma (HCC) isolated to the liver and with preserved liver function. Although conventional TACE with administration of an anticancer-in-oil emulsion followed by embolic agents has been the most popular technique, the introduction of embolic drug-eluting beads has provided an alternative to lipiodol-based regimens. Experimental studies have shown that TACE with drug-eluting beads has a safe pharmacokinetic profile and results in effective tumor killing in animal models. Early clinical experiences have confirmed that drug-eluting beads provide a combined ischemic and cytotoxic effect locally with low systemic toxic exposure. Recently, the clinical value of a TACE protocol performed by using the embolic microsphere DC Bead loaded with doxorubicin (DEBDOX; drug-eluting bead doxorubicin) has been shown by randomized controlled trials. An important limitation of conventional TACE has been the inconsistency in the technique and the treatment schedules. This limitation has hampered the acceptance of TACE as a standard oncology treatment. Doxorubicin-loaded DC Bead provides levels of consistency and repeatability not available with conventional TACE and offers the opportunity to implement a standardized approach to HCC treatment. With this in mind, a panel of physicians took part in a consensus meeting held during the European Conference on Interventional Oncology in Florence, Italy, to develop a set of technical recommendations for the use of DEBDOX in HCC treatment. The conclusions of the expert panel are summarized.

  19. Encapsulated human hepatocellular carcinoma cells by alginate gel beads as an in vitro metastasis model

    International Nuclear Information System (INIS)

    Hepatocellular carcinoma (HCC) is the most common primary liver cancer and often forms metastases, which are the most important prognostic factors. For further elucidation of the mechanism underlying the progression and metastasis of HCC, a culture system mimicking the in vivo tumor microenvironment is needed. In this study, we investigated the metastatic ability of HCC cells cultured within alginate gel (ALG) beads. In the culture system, HCC cells formed spheroids by proliferation and maintained in nuclear abnormalities. The gene and protein expression of metastasis-related molecules was increased in ALG beads, compared with the traditional adhesion culture. Furthermore, several gene expression levels in ALG bead culture system were even closer to liver cancer tissues. More importantly, in vitro invasion assay showed that the invasion cells derived from ALG beads was 7.8-fold higher than adhesion cells. Our results indicated that the in vitro three-dimensional (3D) model based on ALG beads increased metastatic ability compared with adhesion culture, even partly mimicked the in vivo tumor tissues. Moreover, due to the controllable preparation conditions, steady characteristics and production at large-scale, the 3D ALG bead model would become an important tool used in the high-throughput screening of anti-metastasis drugs and the metastatic mechanism research. -- Highlights: •We established a 3D metastasis model mimicking the metastatic ability in vivo. •The invasion ability of cells derived from our model was increased significantly. •The model is easy to reproduce, convenient to handle, and amenable for large-scale

  20. Transcatheter Treatment of Hepatocellular Carcinoma with Doxorubicin-loaded DC Bead (DEBDOX): Technical Recommendations

    Energy Technology Data Exchange (ETDEWEB)

    Lencioni, Riccardo, E-mail: riccardo.lencioni@med.unipi.it [Pisa University Hospital, University of Pisa, Division of Diagnostic Imaging and Intervention (Italy); Baere, Thierry de [Institut Gustav-Roussy, Department of Interventional Radiology (France); Burrel, Marta [Barcelona Clinic for Liver Cancer, Hospital Clinic, Department of Radiology (Spain); Caridi, James G. [University of Florida, Division of Interventional Radiology (United States); Lammer, Johannes [Medical University of Vienna, Department of Interventional Radiology (Austria); Malagari, Katerina [University of Athens, Department of Radiology (Greece); Martin, Robert C. G. [University of Louisville, Division of Surgical Oncology (United States); O' Grady, Elizabeth [University Hospital Aintree, Department of Radiology (United Kingdom); Real, Maria Isabel [Barcelona Clinic for Liver Cancer, Hospital Clinic, Department of Radiology (Spain); Vogl, Thomas J. [University of Frankfurt, Department of Radiology (Germany); Watkinson, Anthony [Royal Devon and Exeter Hospital, Department of Interventional Radiology (United Kingdom); Geschwind, Jean-Francois H. [Johns Hopkins University, Division of Interventional Radiology (United States)

    2012-10-15

    Tranarterial chemoembolization (TACE) has been established by a meta-analysis of randomized controlled trials as the standard of care for nonsurgical patients with large or multinodular noninvasive hepatocellular carcinoma (HCC) isolated to the liver and with preserved liver function. Although conventional TACE with administration of an anticancer-in-oil emulsion followed by embolic agents has been the most popular technique, the introduction of embolic drug-eluting beads has provided an alternative to lipiodol-based regimens. Experimental studies have shown that TACE with drug-eluting beads has a safe pharmacokinetic profile and results in effective tumor killing in animal models. Early clinical experiences have confirmed that drug-eluting beads provide a combined ischemic and cytotoxic effect locally with low systemic toxic exposure. Recently, the clinical value of a TACE protocol performed by using the embolic microsphere DC Bead loaded with doxorubicin (DEBDOX; drug-eluting bead doxorubicin) has been shown by randomized controlled trials. An important limitation of conventional TACE has been the inconsistency in the technique and the treatment schedules. This limitation has hampered the acceptance of TACE as a standard oncology treatment. Doxorubicin-loaded DC Bead provides levels of consistency and repeatability not available with conventional TACE and offers the opportunity to implement a standardized approach to HCC treatment. With this in mind, a panel of physicians took part in a consensus meeting held during the European Conference on Interventional Oncology in Florence, Italy, to develop a set of technical recommendations for the use of DEBDOX in HCC treatment. The conclusions of the expert panel are summarized.

  1. Study on the uptake of Americium using PC88A - impregnated macroporous polymeric beads

    International Nuclear Information System (INIS)

    The prime objective of radioactive waste treatment in nuclear industry is to minimize the waste volume by efficient process without generating secondary radioactive waste for its final disposal. Among the currently available technologies, for separation and recovery of metal ions, solvent extraction, ion-exchange, membrane based technologies and solid sorbent materials are more popular means. Though, all these technologies play major role in all the bulk separation processes, their marked limitations force the separation scientists to think of advance, more efficient and technically feasible alternatives. The extractant impregnated polymeric beads (EIMPBs), impregnated with metal-specific extractants, exhibit reliable separation performances under column operation, and hence bridge the gap between solvent extraction and ion exchange techniques. In the present work, PC88A impregnated PES beads are prepared and the sorption of Am (III) from aqueous waste solutions is investigated. The synthesized EIMPBs were characterized by FTIR, TGA and SEM techniques. The physiochemical strength of the beads was found to be excellent. The sorption study of Am (III), using these beads, was carried out by batch equilibration method and the effect of various parameters, like pH, equilibration time, Am (III) concentration, etc., on the sorption process, was investigated. The synthesized polymeric beads presented fairly higher sorption capacity for Am (III) at pH 3. The kinetics of extraction is very fast. The saturation of sorption is achieved in about 60 minutes of equilibration. The sorption kinetics data fits well in the pseudo second-order model, indicating that the sorption is dominated by chemisorptions. The sorption of Am (III) is observed to follow Langmuir isotherm and the monolayer capacity was calculated as 2.498 mg/g. The quantitative stripping of the extracted Am (III) can be achieved by using 0.1M oxalic acid. The blank polymeric beads, without PC88A,have shown

  2. Status of immunoassay as an analytical tool in environmental investigations

    International Nuclear Information System (INIS)

    Immunoassay methods were initially applied in clinical situations where their sensitivity and selectivity were utilized for diagnostic purposes. In the 1970s, pesticide chemists realized the potential benefits of immunoassay methods for compounds difficult to analyze by gas chromatography. This transition of the technology has extended to the analysis of soil, water, food and other matrices of environmental and human exposure significance particularly for compounds difficult to analyze by chromatographic methods. The utility of radioimmunoassays and enzyme immunoassays for environmental investigations was recognized in the 1980s by the U.S. Environmental Protection Agency (U.S. EPA) with the initiation of an immunoassay development programme. The U.S. Department of Agriculture (USDA) and the U.S. Food and Drug Administration (PDA) have investigated immunoassays for the detection of residues in food both from an inspection and a contamination prevention perspective. Environmental immunoassays are providing rapid screening information as well as quantitative information to fulfill rigorous data quality objectives for monitoring programmes

  3. Development of a multiplex microsphere immunoassay for the quantitation of salivary antibody responses to selected waterborne pathogens

    Science.gov (United States)

    Saliva has an important advantage over serum as a medium for antibody detection due to non-invasive sampling, which is critical for community-based epidemiological surveys. The development of a Luminex multiplex immunoassay for measurement of salivary IgG and IgA responses to pot...

  4. In situ deposition of Prussian blue on mesoporous carbon nanosphere for sensitive electrochemical immunoassay.

    Science.gov (United States)

    Lai, Guosong; Zhang, Haili; Yu, Aimin; Ju, Huangxian

    2015-12-15

    A Prussian blue (PB) functionalized mesoporous carbon nanosphere (MCN) composite was prepared for loading signal antibody and high-content glucose oxidase (GOD) to obtain a new nanoprobe for sensitive electrochemical immunoassay. The MCN nanocarrier with an average diameter of 180 nm was synthesized by using mesoporous silica nanosphere as a hard template in combination with a hydrothermal carbonization method. This hydrophilic carbon nanomaterial provided an ideal platform for in situ deposition of high-content PB to form the MCN-PB nanocomposite. Based on the step-wise assembly of polyelectrolyte and gold nanoparticles (Au NPs) on the negative-charged nanocomposite, signal antibody and high-content GOD were loaded on this nanocarrier to obtain the nanoprobe. After a sandwich immunoreaction at an Au NPs-modified screen-printed carbon electrode based immunosensor, the nanoprobes were quantitatively captured on the electrode surface to produce sensitive electrochemical response with a PB-mediated GOD catalytic reaction for immunoassay. The high loading of PB and GOD on the nanoprobe greatly amplified the electrochemical signal, leading to the development of a new immunoassay method with high sensitivity. Using human immunoglobulin G as a model analyte, excellent analytical performance including a wide linear range from 0.01 to 100 ng/mL and a low detection limit down to 7.8 pg/mL was obtained. Additionally, the immunosensor showed high specificity, satisfactory stability and repeatability as well as acceptable reliability. The PB-mediated GOD electrochemical system well excluded the conventional interference from the dissolved oxygen. Thus this immunoassay method provides great potentials for practical applications. PMID:26201983

  5. Comparison of enzyme-multiplied immunoassay technique with fluorescence polarization immunoassay for determination of gentamicin and tobramycin levels in serum.

    OpenAIRE

    Pohlod, D J; Saravolatz, L D; Somerville, M M

    1984-01-01

    We assayed serum gentamicin and tobramycin specimens by the enzyme multiplied immunoassay technique (Syva EMIT) and the fluorescence polarization immunoassay (Abbott TDx). When interassay and intraassay control samples were evaluated, both methods gave an overall coefficient of variation of less than +/- 10%. Using patient serum samples, we obtained excellent correlation with both methods in the assay of gentamicin (correlation coefficient, 0.985) and tobramycin (correlation coefficient, 0.982).

  6. l-Arginine grafted alginate hydrogel beads: A novel pH-sensitive system for specific protein delivery

    Directory of Open Access Journals (Sweden)

    Mohamed S. Mohy Eldin

    2015-05-01

    Full Text Available Novel pH-sensitive hydrogels based on l-arginine grafted alginate (Arg-g-Alg hydrogel beads were synthesized and utilized as a new carrier for protein delivery (BSA in specific pH media. l-arginine was grafted onto the polysaccharide backbone of virgin alginate via amine functions. Evidences of grafting of alginate were extracted from FT-IR and thermal analysis, while the morphological structure of Arg-g-Alg hydrogel beads was investigated by SEM photographs. Factors affecting on the grafting process e.g. l-arginine concentration, reaction time, reaction temperature, reaction pH, and crosslinking conditions, have been studied. Whereas, grafting efficiency of each factor was evaluated. Grafting of alginate has improved both thermal and morphological properties of Arg-g-Alg hydrogel beads. The swelling behavior of Arg-g-Alg beads was determined as a function of pH and compared with virgin calcium alginate beads. The cumulative in vitro release profiles of BSA loaded beads were studied at different pHs for simulating the physiological environments of the gastrointestinal tract. The amount of BSA released from neat alginate beads at pH 2 was almost 15% after 5 h, while the Arg-g-Alg beads at the same conditions were clearly higher than 45%, then it increased to 90% at pH 7.2. Accordingly, grafting of alginate has improved its release profile behavior particularly in acidic media. The preliminary results clearly suggested that the Arg-g-Alg hydrogel may be a potential candidate for polymeric carrier for oral delivery of protein or drugs.

  7. Magnetic Electrochemical Immunoassays with Quantum Dot Labels for Detection of Phosphorylated Acetylcholinesterase in Plasma

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hua; Wang, Jun; Timchalk, Charles; Lin, Yuehe

    2008-11-01

    A new magnetic electrochemical immunoassay has been developed as a tool for biomonitoring exposures to organophosphate (OP) compounds, e.g., insecticides and chemical nerve agents, by directly detecting organophosphorylated acetylcholinesterase (OP-AChE). This immunoassay uniquely incorporates highly efficient magnetic separation with ultrasensitive square wave voltammetry (SWV) analysis with quantum dots (QDs) as labels. A pair of antibodies was used to achieve the specific recognition of OP-AChE that was prepared with paraoxon as an OP model agent. Antiphosphoserine polyclonal antibodies were anchored on amorphous magnetic particles preferably chosen to capture OP-AChE from the sample matrixes by binding their phosphoserine moieties that were exposed through unfolding the protein adducts. This was validated by electrochemical examinations and enzyme-linked immunosorbent assays. Furthermore, antihuman AChE monoclonal antibodies were labeled with cadmium-source QDs to selectively recognize the captured OP-AChE, as characterized by transmission electron microscopy. The subsequent electrochemical SWV analysis of the cadmium component released by acid from the coupled QDs was conducted on disposable screen-printed electrodes. Experimental results indicated that the SWV-based immunoassays could yield a linear response over a broad concentration range of 0.3-300 ng/mL OP-AChE in human plasma with a detection limit of 0.15 ng/mL. Such a novel electrochemical immunoassay holds great promise as a simple, selective, sensitive, and field-deployable tool for the effective biomonitoring and diagnosis of potential exposures to nerve agents and pesticides.

  8. Synthesis of GoldMag particles with assembled structure and their applications in immunoassay

    Institute of Scientific and Technical Information of China (English)

    CUI; Yali; ZHANG; Lianying; SU; Jing; ZHANG; Caifeng; LI; Qi; CUI; Ting; JIN; Boquan; CHEN; Chao

    2006-01-01

    Micrometer-sized Fe3O4 particles and nano-sized gold particles were first synthesized by methods of self-aggregation of surface-chemically modified Fe3O4 nanoparticles and citrate reduction of the Au3+ to Au0, respectively. Interaction between these two types of particles resulted in the assembly of nano-sized gold particles on the surface of the micrometer-sized Fe3O4 particles, forming an assembled structure with the Fe3O4 core particles around which are attached nano-sized gold particles. The Fe3O4/Au structure is named GoldMag particles with assembled structure. The synthetic process, structure, and magnetic property of the GoldMag particles were analyzed. GoldMag particles with assembled structure have an irregular shape, rough surface with a diameter of 2-3 (m. These particles exhibit the superparamagnetic property with saturated magnetization of 41 A·m2/kg. In a single step, antibodies could be readily immobilized onto the surface of the particles with a high binding capacity. The GoldMag particles can be used as a novel carrier in immunoassays. The maximum quantity of human IgG immobilized onto GoldMag particles was 330 (g/mg. In order to validate the quality of the GoldMag particles as immunoassay carriers, an immunoassay system was used. The relative amount of immobilized human IgG was measured by HRP-labeled anti human IgG. The coefficient of variation within parallel samples of each group was below 6% and the coefficient of variation of means between five groups carried out separately was below 7%. Based on the sandwich method, the Hepatitis B surface antigen (HBsAg) and interleukin-8 (IL-8) were also analyzed by qualitative and quantitative detection, respectively. The result indicated that the GoldMag particles with assembled structure were an ideal carrier in immunoassay.

  9. Multiplexed detection of two proteins by a reaction kinetics-resolved chemiluminescence immunoassay strategy.

    Science.gov (United States)

    Wang, Wenwen; Ouyang, Hui; Yang, Shijia; Wang, Lin; Fu, Zhifeng

    2015-02-21

    A multiplexed immunoassay method was proposed for the sequential detection of two proteins in a single run based on a novel chemiluminescence (CL) reaction kinetics-resolved strategy. This method was established using acridinium ester (AE) and alkaline phosphatase (ALP) as the signal probes due to the significant difference in their CL reaction kinetics characteristics. Mouse IgG (MIgG) and mouse IgM (MIgM) were detected as the model analytes with a competitive immunoassay format. AE and ALP were used to tag goat anti-mouse IgG and rabbit anti-mouse IgM, respectively, to form two immunocomplexes. The two CL reactions with flash type and glow type kinetics characteristics were triggered simultaneously by adding the coreactants, then the CL signals from the two reactions were recorded after 0.2 s and 500 s of the reaction triggering, respectively. The multiplexed CL immunoassay provided a wide range of 0.50-200 ng mL(-1), with a low detection limit of 0.16 ng mL(-1) (S/N = 3) for both MIgG and MIgM. Additionally, no obvious signal overlap was observed in the multiplexed immunoassay. The proposed method was successfully applied for the detection of MIgG and MIgM levels in mouse serums, and the results were in good agreement with those from the reference ELISA method. We anticipate that it can be used in some other areas such as drug screening, food safety, environment monitoring and clinical diagnosis. PMID:25531210

  10. The smaller, the better? The size effect of alginate beads carrying plant growth-promoting bacteria for seed coating.

    Science.gov (United States)

    Berninger, Teresa; Mitter, Birgit; Preininger, Claudia

    2016-03-01

    A range of lab-scale methods for encapsulation of plant growth-promoting bacteria in alginate beads intended for seed coating was evaluated: contact-spotting, extrusion through syringe with/without vibration, ejection by robotic liquid handler, extrusion by centrifugal force and commercial devices (nanodispenser, aerodynamically assisted jetting, encapsulator). Two methods were selected based on throughput (encapsulator: 1.5-5 mL/min; syringe with subsequent pulverisation: 5 mL/min). Four bead sizes (55 ± 39 μm, 104 ± 23 μm, 188 ± 16 μm and 336 ± 20 μm after lyophilisation) were produced. Bacterial viability, release, bead morphology, seed surface coverage and attrition were investigated. Release from the smallest bead size was approximately 10 times higher than from the largest. Seed surface coverage was highest (69 ± 3%) when alginate beads produced with nozzle size 80 μm were applied. Pulverised macro-beads are an alternative option, if high throughput is top priority. PMID:26791103

  11. Comparative study of label-free electrochemical immunoassay on various gold nanostructures

    Science.gov (United States)

    Rafique, S.; Gao, C.; Li, C. M.; Bhatti, A. S.

    2013-10-01

    Electrochemical methods such as amperometry and impedance spectroscopy provide the feasibility of label-free immunoassay. However, the performance of electrochemical interfaces varies with the shape of gold nanostructures. In the present work three types of gold nanostructures including pyramid, spherical, and rod-like nanostructures were electrochemically synthesized on the gold electrode and were further transformed into immunosensor by covalent binding of antibodies. As a model protein, a cancer biomarker, Carcinoembryonic Antigen (CEA) was detected using amperometric and impedimetric techniques on three nanostructured electrodes, which enabled to evaluate and compare the immunoassay's performance. It was found that all three immunosensors showed improved linear electrochemical response to the concentration of CEA compared to bare Au electrode. Among all the spherical gold nanostructure based immunosensors displayed superior performance. Under optimal condition, the immunosensors exhibited a limit of detection of 4.1 pg ml-1 over a concentration range of five orders of magnitude. This paper emphasizes that fine control over the geometry of nanostructures is essentially important for high-performance electrochemical immunoassay.

  12. Method for Sorting and Pairwise Selection of Nanobodies for the Development of Highly Sensitive Sandwich Immunoassays.

    Science.gov (United States)

    Rossotti, Martín A; Pirez, Macarena; Gonzalez-Techera, Andres; Cui, Yongliang; Bever, Candace S; Lee, Kin S S; Morisseau, Christophe; Leizagoyen, Carmen; Gee, Shirley; Hammock, Bruce D; González-Sapienza, Gualberto

    2015-12-01

    Single domain heavychain binders (nanobodies) obtained from camelid antibody libraries hold a great promise for immunoassay development. However, there is no simple method to select the most valuable nanobodies from the crowd of positive clones obtained after the initial screening. In this paper, we describe a novel nanobody-based platform that allows comparison of the reactivity of hundreds of clones with the labeled antigen, and identifies the best nanobody pairs for two-site immunoassay development. The output clones are biotinylated in vivo in 96-well culture blocks and then used to saturate the biotin binding capacity of avidin coated wells. This standardizes the amount of captured antibody allowing their sorting by ranking their reactivity with the labeled antigen. Using human soluble epoxide hydrolase (sEH) as a model antigen, we were able to classify 96 clones in four families and confirm this classification by sequencing. This provided a criterion to select a restricted panel of five capturing antibodies and to test each of them against the rest of the 96 clones. The method constitutes a powerful tool for epitope binning, and in our case allowed development of a sandwich ELISA for sEH with a detection limit of 63 pg/mL and four log dynamic range, which performed with excellent recovery in different tissue extracts. This strategy provides a systematic way to test nanobody pairwise combinations and would have a broad utility for the development of highly sensitive sandwich immunoassays. PMID:26544909

  13. Magneto-actuated immunoassay for the detection of Mycobacterium fortuitum in hemodialysis water.

    Science.gov (United States)

    Brugnera, Michelle Fernanda; Bundalian, Reynaldo; Laube, Tamara; Julián, Esther; Luquin, Marina; Zanoni, Maria Valnice Boldrin; Pividori, Maria Isabel

    2016-06-01

    This paper addresses a sensitive method for the detection of mycobacteria in hemodialysis water samples based on a magneto-actuated immunoassay with optical readout. In this approach, micro (2.8μm) sized magnetic particles were modified with an antibody against the lipoarabinomannan (LAM) located in the mycobacterial cell wall. The system relies on the immunocapturing of the mycobacteria with the tailored antiLAM magnetic particles to pre-concentrate the bacteria from the hemodialysis samples throughout an immunological reaction. The performance of the immunomagnetic separation on the magnetic carrier was evaluated using confocal microscopy to study the binding pattern, as well as a magneto-actuated immunoassay with optical readout for the rapid detection of the bacteria in spiked hemodialysis samples. In this approach, the antiLAM polyclonal antibody was labeled with fluorescein isothiocyanate. The optical readout was achieved by the incubation with a secondary anti-fluorescein antibody labeled with peroxidase as optical reporter. The magneto-actuated immunoassay was able to detect mycobacteria contamination in hemodialysis water at a limit of detection of 13CFUmL(-1) in a total assay time of 3h without any previous culturing pre-enrichment step. PMID:27130087

  14. Targeted selected reaction monitoring mass spectrometric immunoassay for insulin-like growth factor 1.

    Directory of Open Access Journals (Sweden)

    Eric E Niederkofler

    Full Text Available Insulin-like growth factor 1 (IGF1 is an important biomarker of human growth disorders that is routinely analyzed in clinical laboratories. Mass spectrometry-based workflows offer a viable alternative to standard IGF1 immunoassays, which utilize various pre-analytical preparation strategies. In this work we developed an assay that incorporates a novel sample preparation method for dissociating IGF1 from its binding proteins. The workflow also includes an immunoaffinity step using antibody-derivatized pipette tips, followed by elution, trypsin digestion, and LC-MS/MS separation and detection of the signature peptides in a selected reaction monitoring (SRM mode. The resulting quantitative mass spectrometric immunoassay (MSIA exhibited good linearity in the range of 1 to 1,500 ng/mL IGF1, intra- and inter-assay precision with CVs of less than 10%, and lowest limits of detection of 1 ng/mL. The linearity and recovery characteristics of the assay were also established, and the new method compared to a commercially available immunoassay using a large cohort of human serum samples. The IGF1 SRM MSIA is well suited for use in clinical laboratories.

  15. Evaluating Quantum Dot Performance in Homogeneous FRET Immunoassays for Prostate Specific Antigen

    Directory of Open Access Journals (Sweden)

    Shashi Bhuckory

    2016-02-01

    Full Text Available The integration of semiconductor quantum dots (QDs into homogeneous Förster resonance energy transfer (FRET immunoassay kits for clinical diagnostics can provide significant advantages concerning multiplexing and sensitivity. Here we present a facile and functional QD-antibody conjugation method using three commercially available QDs with different photoluminescence (PL maxima (605 nm, 655 nm, and 705 nm. The QD-antibody conjugates were successfully applied for FRET immunoassays against prostate specific antigen (PSA in 50 µL serum samples using Lumi4-Tb (Tb antibody conjugates as FRET donors and time-gated PL detection on a KRYPTOR clinical plate reader. Förster distance and Tb donor background PL were directly related to the analytical sensitivity for PSA, ...which resulted in the lowest limits of detection for Tb-QD705 (2 ng/mL, followed by Tb-QD655 (4 ng/mL, and Tb-QD605 (23 ng/mL. Duplexed PSA detection using the Tb-QD655 and Tb-QD705 FRET-pairs demonstrated the multiplexing ability of our immunoassays. Our results show that FRET based on QD acceptors is suitable for multiplexed and sensitive biomarker detection in clinical diagnostics.

  16. A sensitive surface-enhanced Raman scattering enzyme-catalyzed immunoassay of respiratory syncytial virus.

    Science.gov (United States)

    Zhan, Lei; Zhen, Shu Jun; Wan, Xiao Yan; Gao, Peng Fei; Huang, Cheng Zhi

    2016-02-01

    Respiratory viruses have become a major global health challenge which would benefit from advances in screening methods for early diagnosis. Respiratory syncytial virus (RSV) is one of the most important pathogen causing severe lower respiratory tract infections. Here we present a novel surface-enhanced Raman scattering (SERS) enzyme-catalyzed immunoassay of RSV by employing peroxidase substrate 3, 3'-5, 5'-tetramethylbenzidine (TMB) as Raman molecule. Horseradish peroxidase (HRP) attached to the detection antibody in a novel sandwich immunoassay catalyzes the oxidation of TMB by H2O2 to give a radical cation (TMB(+)), which could be easily adsorbed on the negatively charged surface of silver nanoparticles (AgNPs) through electrostatic interaction, inducing the aggregation of AgNPs and thus giving a strong SERS signal. A linear relationship was obtained between the Raman intensity and the amount of RSV in the range from 0.5 to 20 pg/mL, and the minimum detectable concentration of this SERS-based enzyme immunoassay was 0.05 pg/mL, which was 20 times lower than that found in the colorimetric method. PMID:26653454

  17. Bead Capture on Magnetic Sensors in a Microfluidic System

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Dalslet, Bjarke Thomas; Damsgaard, Christian Danvad; Freitas, S. C.; Freitas, P. P.; Hansen, Mikkel Fougt

    The accumulation of magnetic beads by gravitational sedimentation and magnetic capture on a planar Hall-effect sensor integrated in a microfluidic channel is studied systematically as a function of the bead concentration, the fluid flow rate, and the sensor bias current. It is demonstrated that t...

  18. Random glycopeptide bead libraries for seromic biomarker discovery

    DEFF Research Database (Denmark)

    Kracun, Stjepan Kresimir; Cló, Emiliano; Clausen, Henrik;

    2010-01-01

    have developed a random glycopeptide bead library screening platform for detection of autoantibodies and other binding proteins. Libraries were build on biocompatible PEGA beads including a safety-catch C-terminal amide linker (SCAL) that allowed mild cleavage conditions (I(2)/NaBH(4) and TFA) for...

  19. Enzyme immunoassay for carminic acid in foods.

    Science.gov (United States)

    Yoshida, A; Takagaki, Y; Nishimune, T

    1995-01-01

    A competitive enzyme immunoassay (EIA) for carminic acid was investigated. Monoclonal anticarminic acid antibody was obtained from A/J mice immunized with carminic acid-human immunoglobulin G (IgG) conjugate. Carminic acid was extracted with distilled water from beverage, jelly, candy, pasta sauce, yogurt, or ice cream samples. Ham or fish paste samples were digested with pronase, then carminic acid was extracted from samples with sodium hydroxide solution. The extract was diluted more than 10-fold with 1% gelatin in borate buffer solution. Microtiter plates were coated with carminic acid-bovine serum albumin (BSA) conjugate or just BSA. Goat anti-mouse IgG(H+L)-peroxidase complex was used as a second antibody, and 3,3',5,5'-tetramethylbenzidine was used as a substrate for the peroxidase. The working range for quantitative analysis was 0.3-10 ng/mL, and the detection limit was 0.2 micrograms/g original sample. Recoveries of carminic acid by this assay were > 95% for milk beverage and jelly, and > 85% for yogurt and fish paste. Carminic acid was detected in 7 of 26 red-colored commercial food products and ranged from 3.5 to 356 micrograms/g. This EIA system also responded to the structural analogue of carminic acid, laccaic acid. PMID:7756895

  20. Gold Nanoparticles-Based Barcode Analysis for Detection of Norepinephrine.

    Science.gov (United States)

    An, Jeung Hee; Lee, Kwon-Jai; Choi, Jeong-Woo

    2016-02-01

    Nanotechnology-based bio-barcode amplification analysis offers an innovative approach for detecting neurotransmitters. We evaluated the efficacy of this method for detecting norepinephrine in normal and oxidative-stress damaged dopaminergic cells. Our approach use a combination of DNA barcodes and bead-based immunoassays for detecting neurotransmitters with surface-enhanced Raman spectroscopy (SERS), and provides polymerase chain reaction (PCR)-like sensitivity. This method relies on magnetic Dynabeads containing antibodies and nanoparticles that are loaded both with DNA barcords and with antibodies that can sandwich the target protein captured by the Dynabead-bound antibodies. The aggregate sandwich structures are magnetically separated from the solution and treated to remove the conjugated barcode DNA. The DNA barcodes are then identified by SERS and PCR analysis. The concentration of norepinephrine in dopaminergic cells can be readily detected using the bio-barcode assay, which is a rapid, high-throughput screening tool for detecting neurotransmitters. PMID:27305769