WorldWideScience

Sample records for bcl-2 p53 gene

  1. The role of the expression of bcl-2, p53 gene in tamoxifen-induced apoptosis of breast cancer cells and its relationship with hormone receptor status

    Energy Technology Data Exchange (ETDEWEB)

    Noh, Woo Chul; Ham, Yong Ho [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1998-01-01

    To investigate the relationship of bcl-2, p53, ER and tamoxifen-induced apoptosis of breast cancer cells, MCF-7 (ER+/bcl-2+/p53-) and MB MDA 468 (ER-/bcl-2-/p53+) cell line were cultured in estrogen-free condition. E2(10`-`9M) and tamoxifen (10`-`5M) were added to the media. The changes of bcl-2 and mutant p53 protein were checked by Western blot and apoptosis were measured by flowcytometry. In MCF-7 cells, we found that treatment with tamoxifen resulted in a decrease in bcl-2 protein level, but produced no change in mutant p53. In MB MDA 468 cell however, there were no changes of bcl-2 and mutant p53 protein level when E2 or tamoxifen were added. Apoptotic cells increased with time-dependent pattern when tamoxifen was added to MCF-7 cells. According to these result, ER+/blc-2+/mutant p53- cells, when treated with tamoxifen, were converted into bcl-2/mutant p53- cells which were more prone to apoptosis than bcl-2-/mutant p53+ cells. The paradoxical correlation of bcl-2 and ER which had been observed in clinical studies might be explained with this results and bcl-2 protein seems to be one of important factors that can predict the effect of hormone therapy. (author). 26 refs., 5 figs

  2. The role of the expression of bcl-2, p53 gene in tamoxifen-induced apoptosis of breast cancer cells and its relationship with hormone receptor status

    International Nuclear Information System (INIS)

    Noh, Woo Chul; Ham, Yong Ho

    1998-01-01

    To investigate the relationship of bcl-2, p53, ER and tamoxifen-induced apoptosis of breast cancer cells, MCF-7 (ER+/bcl-2+/p53-) and MB MDA 468 (ER-/bcl-2-/p53+) cell line were cultured in estrogen-free condition. E2(10'-'9M) and tamoxifen (10'-'5M) were added to the media. The changes of bcl-2 and mutant p53 protein were checked by Western blot and apoptosis were measured by flowcytometry. In MCF-7 cells, we found that treatment with tamoxifen resulted in a decrease in bcl-2 protein level, but produced no change in mutant p53. In MB MDA 468 cell however, there were no changes of bcl-2 and mutant p53 protein level when E2 or tamoxifen were added. Apoptotic cells increased with time-dependent pattern when tamoxifen was added to MCF-7 cells. According to these result, ER+/blc-2+/mutant p53- cells, when treated with tamoxifen, were converted into bcl-2/mutant p53- cells which were more prone to apoptosis than bcl-2-/mutant p53+ cells. The paradoxical correlation of bcl-2 and ER which had been observed in clinical studies might be explained with this results and bcl-2 protein seems to be one of important factors that can predict the effect of hormone therapy. (author). 26 refs., 5 figs

  3. p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression

    International Nuclear Information System (INIS)

    Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo

    1997-01-01

    Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2

  4. Evaluation of bax, bcl-2, p21 and p53 genes expression variations on cerebellum of BALB/c mice before and after birth under mobile phone radiation exposure.

    Science.gov (United States)

    Ghatei, Najmeh; Nabavi, Ariane Sadr; Toosi, Mohammad Hossein Bahreyni; Azimian, Hosein; Homayoun, Mansour; Targhi, Reza Ghasemnezhad; Haghir, Hossein

    2017-09-01

    The increasing rate of over using cell phones has been considerable in youths and pregnant women. We examined the effect of mobile phones radiation on genes expression variation on cerebellum of BALB/c mice before and after of the birth. In this study, a mobile phone jammer, which is an instrument to prevent receiving signals between cellular phones and base transceiver stations (two frequencies 900 and 1800 MHz) for exposure was used and twelve pregnant mice (BALB/c) divided into two groups (n=6), first group irradiated in pregnancy period (19th day), the second group did not irradiate in pregnancy period. After childbirth, offspring were classified into four groups (n=4): Group1: control, Group 2: B1 (Irradiated after birth), Group 3: B2 (Irradiated in pregnancy period and after birth), Group 4: B3 (Irradiated in pregnancy period). When maturity was completed (8-10 weeks old), mice were dissected and cerebellum was isolated. The expression level of bax , bcl-2, p21 and p53 genes examined by real-time reverse transcription polymerase chain reaction (Real-Time RT- PCR). The data showed that mobile phone radio waves were ineffective on the expression level of bcl-2 and p53 genes) P >0.05(. Also gene expression level of bax decreased and gene expression level of p21 increased comparing to the control group ( P mobile phone radiations did not induce apoptosis in cells of the cerebellum and the injured cells can be repaired by cell cycle arrest.

  5. Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.

    Science.gov (United States)

    Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald

    2017-06-01

    p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.

  6. Influence of p53 and bcl-2 on chemosensitivity in benign and malignant prostatic cell lines.

    Science.gov (United States)

    Serafin, Antonio M; Bohm, Lothar

    2005-01-01

    The administration of cancer chemotherapeutic agents results in an increase in the apoptotic cells in the tumor: therefore, it has been assumed that anticancer drugs exhibit their cytotoxic effects via apoptotic signaling pathways. Characteristics that confer sensitivity to drug-induced apoptosis are, a functional p53 protein and expression of the apoptosis-promoting protein, bax. The role of p53 and bax/bcl-2 in drug-induced apoptosis was assessed in six prostate cell lines, 1532T, 1535T, 1542T, 1542N, BPH-1 and LNCaP using TD(50) concentrations of etoposide, vinblastine and estramustine. Cell death was monitored morphologically by fluorescent microscopy, and by flow cytometry (Annexin-V assay). Apoptotic morphology was rather low and ranged from 0.1% to 12.1%, 3.0% to 6.0% and 0.1% to 8.5% for etoposide, estramustine and vinblastine, respectively. Annexin-V binding and flow cytometry indicated apoptotic propensities of 0% to 4%, 0% to 3% and 0% to 5%, respectively. The percentage of cells responding to drug-induced apoptosis was, on average, higher in the tumor cell lines than in the normal cell lines, but showed no correlation with p53 status. The percentage of cells showing necrosis, assessed by Annexin binding and Propidium Iodide permeability in aqueous medium, tended to be much higher, and was found to be at the level of 5% to 30%. Immunoblotting demonstrated that bax and bcl-2 proteins were expressed at a basal level in all cell lines, but did not increase after exposure to TD(50) doses of the three drugs. The ratio of bax and bcl-2, measured by laser scanning densitometry, was not altered by the drug-induced DNA damage. The results suggest that apoptosis is not a major mechanism of drug-induced cell death in prostate cell lines and appears to be independent of p53 status and bax/bcl-2 expression.

  7. HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.

    Science.gov (United States)

    Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C

    2006-02-01

    HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.

  8. Stress Hormone Cortisol Enhances Bcl2 Like-12 Expression to Inhibit p53 in Hepatocellular Carcinoma Cells.

    Science.gov (United States)

    Wu, Weizhong; Liu, Sanguang; Liang, Yunfei; Zhou, Zegao; Bian, Wei; Liu, Xueqing

    2017-12-01

    The pathogenesis of hepatocellular carcinoma (HC) is unclear. It is suggested that psychological stress associates with the pathogenesis of liver cancer. Bcl2-like protein 12 (Bcl2L12) suppresses p53 protein. This study tests a hypothesis that the major stress hormone, cortisol, inhibits the expression of p53 in HC cells (HCC) via up regulating the expression of Bcl2L12. Peripheral blood samples were collected from patients with HC to be analyzed for the levels of cortisol. HCC were cultured to assess the role of cortisol in the regulation of the expression of Bcl2L12 and p53 in HCC. We observed that the serum cortisol levels were higher in HC patients. Expression of Bcl2L12 in HCC was correlated with serum cortisol. Cortisol enhanced the Bcl2L12 expression in HCC. Bcl2L12 binding to the TP53 promoter was correlated with p53 expression in HCC. Cortisol increased the Bcl2L12 expression in HCC to inhibit p53 expression. Stress hormone cortisol suppresses p53 in HCC via enhancing Bcl2L12 expression in HCC. The results suggest that cortisol may be a therapeutic target for the treatment of HC.

  9. The prognostic significance of the immunohistochemical expression of P53 and BCL-2 in endometrial cancer

    Directory of Open Access Journals (Sweden)

    Lech Chyczewski

    2012-01-01

    Full Text Available The objective of this study was to verify the frequency of P53 and BCL-2 immunohistochemical expression in 98 patients with endometrial carcinoma, and to correlate it with clinical stage and patient survival. A significant difference was found regarding the frequency of P53 expression when comparing type I and II tumors (23.7% and 54.5%, respectively; p = 0.006. A positive correlation was observed between P53 immunoexpression and patient survival in type I and II tumors (p = 0.009 and p = 0.036, respectively. BCL-2 expression was significantly more frequent in early clinical stages in both types of endometrial cancer (p < 0.001 and 0.002 and correlated with a decrease in overall survival in type I endometrial cancer (p = 0.014. Thus, the prognostic value of these biomarkers in endometrial cancer needs to be further investigated. (Folia Histochemica et Cytobiologica 2011; Vol. 49, No. 4, pp. 631–635

  10. Evaluation of multiple bio-pathological factors in colorectal adenocarcinomas: independent prognostic role of p53 and bcl-2.

    Science.gov (United States)

    Buglioni, S; D'Agnano, I; Cosimelli, M; Vasselli, S; D'Angelo, C; Tedesco, M; Zupi, G; Mottolese, M

    1999-12-22

    About 40% of patients with colorectal carcinoma will develop local or distant tumour recurrences. Integrated analyses of bio-pathological markers, predictive of tumour aggressiveness, may offer a more rational approach to planning adjuvant therapy. To this end, we analysed the correlation between p53 accumulation, Bcl-2 expression, DNA ploidy, cell proliferation and conventional clinico-pathological parameters by testing the prognostic significance of these variables in a series of 171 colorectal carcinoma patients with long-term follow-up. The relationships among the various bio-pathological parameters, analysed by multiple correspondence analysis, showed 2 different clinico-biological profiles. The first, characterised by p53 negativity, Bcl-2 positivity, diploidy, low percentage of cells in S-phase (%S-phase), a low Ki-67 score, is associated with Dukes' A-B stage, well differentiated tumours and lack of relapse. The second, defined by p53 positivity, Bcl-2 negativity, aneuploidy, high %S-phase and elevated Ki-67 score, correlates with Dukes' C-D stage, poorly differentiated tumours and presence of relapse. When these parameters were examined according to Kaplan-Meier's method, significantly shorter disease-free (DFS) and overall survival (OS) were also observed in patients bearing p53 positive and Bcl-2 negative tumours, in Dukes' B stage. In multivariate analysis, p53 accumulation and Bcl-2 expression emerged as independent predictors of a worse and better clinical outcome, respectively. Our results indicate that, in colorectal adenocarcinomas, a biological profile, based on the combined evaluation of p53 and Bcl-2, may be useful for identifying high risk patients to be enrolled in an adjuvant setting, mainly in an early stage of the disease. Int. J. Cancer (Pred. Oncol.) 84:545-552, 1999. Copyright 1999 Wiley-Liss, Inc.

  11. Expression of p53, Bcl-2, VEGF, Ki67 and PCNA and prognostic significance in hepatocellular carcinoma.

    Science.gov (United States)

    Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel

    2008-12-01

    Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.

  12. Occupational health hazards of trichloroethylene among workers in relation to altered mRNA expression of cell cycle regulating genes (p53, p21, bax and bcl-2 and PPARA

    Directory of Open Access Journals (Sweden)

    Meenu Varshney

    2015-01-01

    Full Text Available Trichloroethylene (TCE is widely used as a metal degreaser in industrial processes. The present study reports on the effects of TCE exposure on workers employed in the lock industries. To ensure exposure of the workers to TCE, its toxic metabolites, trichloroacetic acid (TCA, dichloroacetic acid (DCA and trichloroethanol (TCEOH were detected in the plasma of the subjects through solid phase microextraction-gas chromatography-electron capture detection. TCA, DCA and TCEOH were detected in the range of 0.004–2.494 μg/mL, 0.01–3.612 μg/mL and 0.002–0.617 μg/mL, respectively. Quantitative reverse transcription polymerase chain reaction analysis revealed up-regulated expression of p53 (2.4-fold; p < 0.05, p21 (2-fold; p < 0.01, bax (2.9-fold; p < 0.01 mRNAs and down-regulated expression of bcl-2 (67%; p < 0.05 mRNAs, indicating DNA damaging potential of these metabolites. No effects were observed on the levels of p16 and c-myc mRNAs. Further, as TCA and DCA, the ligand of peroxisome proliferator activated receptor alpha (PPARA, are involved in the process of hepatocarcinogenesis in rodents, we examined expression of PPARA mRNA and let-7c miRNA in the workers. No statistically significant differences in expression of PPARA mRNA and let-7c miRNA in patients were observed as compared to values in controls. Dehydroepiandosterone sulfate (DHEAS is a reported endogenous ligand of PPARA so its competitive role was also studied. We observed decreased levels of DHEAS hormone in the subjects. Hence, its involvement in mediation of the observed changes in the levels of various mRNAs analyzed in this study appears unlikely.

  13. Pure versus combined Merkel cell carcinomas: immunohistochemical evaluation of cellular proteins (p53, Bcl-2, and c-kit) reveals significant overexpression of p53 in combined tumors.

    Science.gov (United States)

    Lai, Jonathan H; Fleming, Kirsten E; Ly, Thai Yen; Pasternak, Sylvia; Godlewski, Marek; Doucette, Steve; Walsh, Noreen M

    2015-09-01

    Merkel cell polyomavirus is of oncogenic significance in approximately 80% of Merkel cell carcinomas. Morphological subcategories of the tumor differ in regard to viral status, the rare combined type being uniformly virus negative and the predominant pure type being mainly virus positive. Indications that different biological subsets of the tumor exist led us to explore this diversity. In an Eastern Canadian cohort of cases (75 patients; mean age, 76 years [range, 43-91]; male/female ratio, 43:32; 51 [68%] pure and 24 [34%] combined tumors), we semiquantitatively compared the immunohistochemical expression of 3 cellular proteins (p53, Bcl-2, and c-kit) in pure versus combined groups. Viral status was known in a subset of cases. The significant overexpression of p53 in the combined group (mean [SD], 153.8 [117.8] versus 121.6 [77.9]; P = .01) and the increased epidermal expression of this protein (p53 patches) in the same group lend credence to a primary etiologic role for sun damage in these cases. Expression of Bcl-2 and c-kit did not differ significantly between the 2 morphological groups. A relative increase in c-kit expression was significantly associated with a virus-negative status (median [interquartile range], 100 [60-115] versus 70 [0-100]; P = .03). Emerging data reveal divergent biological pathways in Merkel cell carcinoma, each with a characteristic immunohistochemical profile. Virus-positive tumors (all pure) exhibit high retinoblastoma protein and low p53 expression, whereas virus-negative cases (few pure and all combined) show high p53 and relatively high c-kit expression. The potential biological implications of this dichotomy call for consistent stratification of these tumors in future studies. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax.

    Science.gov (United States)

    Wei, Y; Yuan, F J; Zhou, W B; Wu, L; Chen, L; Wang, J J; Zhang, Y S

    2016-06-21

    Borax, a boron compound and a salt of boric acid, is known to inhibit the growth of tumor cells. HepG2 cells have been shown to be clearly susceptible to the anti-proliferative effects of borax. However, the specific mechanisms regulating this effect are poorly understood. This study aimed to investigate the pathways underlying the growth inhibition induced by borax in HepG2 cells. The effects of borax on HepG2 cell viability were characterized using MTT. Apoptosis was also verified by annexin V/propidium iodide staining. JC-1 dye and western blotting techniques were used to measure mitochondrial membrane potential and p53, Bax, and Bcl-2 protein expression, respectively. Relevant mRNA levels were measured by qRT-PCR. Borax inhibited the proliferation of HepG2 cells in a time- and dose-dependent manner in vitro. The apoptotic process triggered by borax involved the upregulation of p53 and Bax and the downregulation of Bcl-2, which was confirmed by a change in the mitochondrial membrane potential. These results elucidate a borax-induced apoptotic pathway in HepG2 cells that involves the upregulation of p53 and Bax and the downregulation of Bcl-2.

  15. Prognostic significance of CD95, P53, and BCL2 expression in extranodal non-Hodgkin's lymphoma

    OpenAIRE

    Chatzitolios , Anastasios; Venizelos , Ioannis; Tripsiannis , Gregory; Anastassopoulos , George; Papadopoulos , Nikolaos

    2010-01-01

    Abstract Apoptosis-related proteins play an important role in lymphoma cell death during chemotherapy. In our study, we investigated the prognostic significance of CD95, BCL2, and P53 expression in extranodal non-Hodgkin?s lymphoma (NHL). We examined 71 patients with extranodal NHL [45 diffuse large B-cell lymphomas (DLBCLs) and 26 mucosa-associated lymphoid tissue lymphomas (MALTLs)], 35 male and 36 female, with a median age of 65.8 years. The most common site of origin was the st...

  16. Immunohistochemical expression of p53, BCL-2, BAX and VEGFR1 proteins in nephroblastomas A expressão imuno-histoquímica das proteínas p53, BCL-2, BAX e VEGFR1 em nefroblastomas

    Directory of Open Access Journals (Sweden)

    Ana Paula Percicote

    2013-02-01

    Full Text Available INTRODUCTION: Nephroblastoma or Wilms' tumor is the most frequent renal cancer in children. Although its prognosis is favorable for most patients, it may relapse or have a fatal outcome. The characterization of risk groups by applying immunohistochemical biomarkers aims to adapt the treatment to its corresponding group as well as to reduce relapses and fatal outcome. p53, B-cell lymphoma 2 (BCL-2, BCL-2 associated protein X (BAX and vascular endothelial growth factor receptor 1 (VEGFR1 are among the most widely studied biomarkers, which are related to the apoptotic pathway, DNA repair and neovascularization. OBJECTIVE: The objective of this study is to assess the immunohistochemical expression of p53, BCL-2, BAX and VEGFR1 in samples of human nephroblastoma and to correlate them with clinicopathological prognostic factors. MATERIAL AND METHODS: Twenty-nine surgical specimens of nephroblastoma diagnosed from 1994 to 2007 were selected from the Anatomopathological Service of two hospitals in Curitiba. The immunohistochemical analysis of tissue microarrays was performed through immunoperoxidase staining and the yielded results were compared with clinicopathological prognostic factors. RESULTS: The major immunohistochemical expression of VEGFR1 in blastema and epithelium presented positive association with the risk group. Hence this may be related to higher vascular neoplastic invasion apparently caused by the endothelial growth factor, which maximizes the chances of metastasis and ultimately changes tumor staging, risk group and clinical evolution. CONCLUSIONS: The immunohistochemical expression of VEGFR1 substantiated a directly proportional association with the nephroblastoma risk group.INTRODUÇÃO: O nefroblastoma, ou tumor de Wilms, é a neoplasia renal mais frequente na infância. Embora o prognóstico seja favorável para a maioria dos pacientes, muitos evoluem para recidiva ou óbito. A caracterização de grupos de risco por meio de

  17. Bcl-2 protein expression is associated with p27 and p53 protein expressions and MIB-1 counts in breast cancer

    International Nuclear Information System (INIS)

    Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi

    2006-01-01

    Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer

  18. Bcl-2 protein expression is associated with p27 and p53 protein expressions and MIB-1 counts in breast cancer

    Directory of Open Access Journals (Sweden)

    Nishizaki Takashi

    2006-07-01

    Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.

  19. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

    International Nuclear Information System (INIS)

    Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

    2008-01-01

    Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

  20. Apoptosis, proliferation, Bax, Bcl-2 and p53 status prior to and after preoperative radiochemotherapy for locally advanced rectal cancer

    International Nuclear Information System (INIS)

    Tannapfel, Andrea; Nuesslein, Siegfried; Fietkau, Rainer; Katalinic, Alexander; Koeckerling, Ferdinand; Wittekind, Christian

    1998-01-01

    Purpose: To investigate the relationship between apoptotic cell death, proliferative activity, and the expression of apoptosis regulating proteins in rectal cancer prior to and after radiochemotherapy. Materials and Methods: In 32 patients dispositioned to receive preoperative radiochemotherapy for locally advanced rectal carcinoma, pretherapy biopsies and the final resected specimen after radiochemotherapy were available for analyses. Apoptotic cells were identified and quantified using in situ end labeling (ISEL) technique. The expression of the bax protein was assessed immunohistochemically. Additionally, double immunostaining was performed for apoptotic cells and bax expression. The proliferative activity was determined by immunohistochemical assessment of the Ki67 (MIB-1) and the proliferating cell nuclear antigen (PCNA). p53- and bcl-2 expression was analyzed immunohistochemically. A clinical-to-pathologic downstaging after radiochemotherapy was achieved in 25 of 32 patients (78%). During follow-up, tumor recurrence was observed in six cases. In one case, no residual tumor was detected after radiochemotherapy. Results: After radiochemotherapy, the apoptotic index increased significantly in almost every case examined. In contrast, the proliferative activity was significantly decreased in resected specimens as compared to biopsies. Bax immunostaining was detected in 12/31 (39%) biopsies and in 26/31 (84%) resected specimens. In the resected specimen, significantly more apoptotic cells that were bax-positive were found than in biopsies. Bcl-2 immunostaining occurred in 15/31 biopsies and 12/31 resected specimens, respectively. Tumors that were immunohistochemically negative for p53 (20/31 [65%]) generally exhibited a higher apoptotic index and a high expression level of bax than p53-positive tumors (11/31 [35%]). However, we did not find any correlation between the (pre- and post-therapeutic) rate of apoptosis or the level of bax expression and the degree of

  1. Homologous recombination in mammalian cells: effect of p53 and Bcl-2 proteins, replication inhibition and ionizing radiations

    International Nuclear Information System (INIS)

    Saintigny, Yannick

    1999-01-01

    The control of cell cycle, associated with the mechanisms of replication, DNA repair/recombination allows the cells to maintain their genetic integrity. The p53 protein ensures the control of G1/S transition. Its inactivation would allow to initial replication on damaged matrix and lead to the block of replication forks followed by DNA strand breaks, good substrates for recombination. This work shows that the expression of mutant p53 protein stimulates both spontaneous and radio-induced homologous recombination, independently of the control of cell cycle. Moreover, the use of a set of replication inhibitors show that inhibition of the replication elongation stimulates recombination more strongly than the initiation inhibition. Replication arrest by these inhibitors also significantly increases the number of DNA strand breaks. These results highlighted a point of action of p53 protein on the ultimate stages of the homologous recombination mechanism. Lastly, the expression of Bcl-2 protein inhibits apoptosis and increases survival, but specifically inhibits conservative recombination, after radiation as well as in absence of apoptotic stress. The extinction of this mechanism of DNA repair is associated with an increase of mutagenesis. Taken together, these results allow ta consider the maintenance of the genetic stability as a cellular network involving different pathways. A multiple stages model for tumoral progression can be deduced. (author) [fr

  2. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

    DEFF Research Database (Denmark)

    Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

  3. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

  4. Expression of beclin 1 in primary salivary adenoid cystic carcinoma and its relation to Bcl-2 and p53 and prognosis

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, L.C.; Huang, S.Y.; Zhang, D.S.; Zhang, S.H.; Li, W.G.; Zheng, P.H.; Chen, Z.W. [Shandong Provincial Hospital Affiliated to Shandong University, Department of Oral and Maxillofacial Surgery, Jinan, China, Department of Oral and Maxillofacial Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan (China)

    2014-03-03

    Beclin 1 plays a critical role in autophagy and functions as a haploinsufficient tumor suppressor. The expression and prognostic significance of beclin 1 in head and neck adenoid cystic carcinoma (ACC) are largely unexplored. Therefore, we investigated the expression of beclin 1, Bcl-2, and p53 in head and neck ACC tissue. Tissue samples from 35 cases (15 females, 20 males) of head and neck ACC were utilized for immunohistochemistry. Beclin 1 expression was observed in 32 cases (91.4%) and considered to be high in 15 cases (42.9%) and low in 20 cases (57.1%). Beclin 1 expression was significantly correlated with a histological growth pattern (P=0.046) and histological grade (P=0.037). Beclin 1 expression was inversely correlated with Bcl-2 expression (P=0.013) and significantly associated with overall survival (P=0.006). Bcl-2 and p53 expression were observed in 21 cases (60.0%) and 16 cases (45.7%). Bcl-2 expression was significantly correlated with perineural invasion (P=0.041) and not associated with overall survival (P=0.053). p53 expression was directly correlated with beclin 1 expression (P=0.044). Our results indicated that beclin 1 may be a novel, promising prognostic factor for clinical outcome in head and neck ACC patients and may play a part in the development of head and neck ACC by interacting with Bcl-2 and p53.

  5. Breastfeeding and Immunohistochemical Expression of ki-67, p53 and BCL2 in Infiltrating Lobular Breast Carcinoma.

    Directory of Open Access Journals (Sweden)

    Angel Gonzalez-Sistal

    Full Text Available Invasive lobular breast carcinoma is the second most common type of breast cancer after invasive ductal carcinoma. According to the American Cancer Society, more than 180,000 women in the United States find out they have invasive breast cancer each year. Personal history of breast cancer and certain changes in the breast are correlated with an increased breast cancer risk. The aim of this work was to analyze breastfeeding in patients with infiltrating lobular breast carcinoma, in relation with: 1 clinicopathological parameters, 2 hormonal receptors and 3 tissue-based tumor markers.The study included 80 women with ILC, 46 of which had breastfeed their children. Analyzed parameters were: age, tumor size, axillary lymph node (N, distant metastasis (M, histological grade (HG, estrogen receptor (ER, progesterone receptor (PR, androgen receptor (AR, Ki-67, p53 and BCL2.ILC of non-lactating women showed a larger (p = 0.009, lymph node involvement (p = 0.051 and distant metastasis (p = 0.060. They were also more proliferative tumors measured by Ki-67 (p = 0.053. Breastfeeding history did not influence the subsequent behavior of the tumor regardless of histological subtype.Lactation seems to influence the biological characteristics of ILC defining a subgroup with more tumor size, axillary lymph node involvement, distant metastasis and higher proliferation measured by ki-67 expression.

  6. Nicotine-induced damages in testicular tissue of rats; evidences for bcl-2, p53 and caspase-3 expression

    Directory of Open Access Journals (Sweden)

    Maryam Mosadegh

    2017-02-01

    Full Text Available Objective(s: Present study was performed in order to uncover new aspects for nicotine-induced damages on spermatogenesis cell lineage. Materials and Methods: For this purpose, 36 mature male Wistar rats were divided into three groups as; control-sham (0.2 ml, saline normal, IP, low dose (0.2 mg/kg BW-1, IP nicotine-received and high dose (0.4 mg/kg BW-1, IP nicotine-received groups. Following 7 weeks, the expression of bcl-2, p53 and caspase-3 at mRNA and protein levels were investigated by using reverse-transcriptase PCR (RT-PCR and immunohistochemical (IHC analyses, respectively. Moreover, the serum level of FSH, LH and testosterone were evaluated. Finally, the mRNA damage was analyzed by using special fluorescent staining. Results: Nicotine, at both dose levels, decreased tubular differentiation, spermiogenesis and repopulation indices and enhanced cellular depletion. Animals in nicotine-received groups exhibited a significant (P

  7. Expression of Bcl-2, p53, and MDM2 in Localized Prostate Cancer With Respect to the Outcome of Radical Radiotherapy Dose Escalation

    International Nuclear Information System (INIS)

    Vergis, Roy; Corbishley, Catherine M.; Thomas, Karen

    2010-01-01

    Purpose: Established prognostic factors in localized prostate cancer explain only a moderate proportion of variation in outcome. We analyzed tumor expression of apoptotic markers with respect to outcome in men with localized prostate cancer in two randomized controlled trials of radiotherapy dose escalation. Methods and Materials: Between 1995 and 2001, 308 patients with localized prostate cancer received neoadjuvant androgen deprivation and radical radiotherapy at our institution in one of two dose-escalation trials. The biopsy specimens in 201 cases were used to make a biopsy tissue microarray. We evaluated tumor expression of Bcl-2, p53, and MDM2 by immunohistochemistry with respect to outcome. Results: Median follow-up was 7 years, and 5-year freedom from biochemical failure (FFBF) was 70.4% (95% CI, 63.5-76.3%). On univariate analysis, expression of Bcl-2 (p < 0.001) and p53 (p = 0.017), but not MDM2 (p = 0.224), was significantly associated with FFBF. Expression of Bcl-2 remained significantly associated with FFBF (p = 0.001) on multivariate analysis, independently of T stage, Gleason score, initial prostate-specific antigen level, and radiotherapy dose. Seven-year biochemical control was 61% vs. 41% (p = 0.0122) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-positive tumors and 87% vs. 81% (p = 0.423) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-negative tumors. There was no statistically significant interaction between dose and Bcl-2 expression. Conclusions: Bcl-2 expression was a significant, independent determinant of biochemical control after neoadjuvant androgen deprivation and radical radiotherapy for prostate cancer. These data generate the hypothesis that Bcl-2 expression could be used to inform the choice of radiotherapy dose in individual patients.

  8. B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

    International Nuclear Information System (INIS)

    Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong

    2011-01-01

    The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.

  9. p53 and bcl2 expression in malignant and premalignant lesions of uterine cervix and their correlation with human papilloma virus 16 and 18

    OpenAIRE

    Shailaja Shukla; Jasmita Dass; Mukta Pujani

    2014-01-01

    Background and Objective: Persistent high risk human papilloma virus (HPV) infection is probably the best predictor of increased risk of cervical cancer, but expression of certain markers of cell proliferation and apoptosis have been studied. The present study was conducted to evaluate the expression of p53 and bcl2 in premalignant and malignant lesions of cervix and its correlation with HPV type 16 and 18. Materials and Methods: The study comprised of 35 cases (including 24 prospective cases...

  10. AS1411-Induced Growth Inhibition of Glioma Cells by Up-Regulation of p53 and Down-Regulation of Bcl-2 and Akt1 via Nucleolin.

    Directory of Open Access Journals (Sweden)

    Ye Cheng

    Full Text Available AS1411 binds nucleolin (NCL and is the first oligodeoxynucleotide aptamer to reach phase I and II clinical trials for the treatment of several cancers. However, the mechanisms by which AS1411 targets and kills glioma cells and tissues remain unclear. Here we report that AS1411 induces cell apoptosis and cycle arrest, and inhibits cell viability by up-regulation of p53 and down-regulation of Bcl-2 and Akt1 in human glioma cells. NCL was overexpressed in both nucleus and cytoplasm in human glioma U87, U251 and SHG44 cells compared to normal human astrocytes (NHA. AS1411 bound NCL and inhibited the proliferation of glioma cells but not NHA, which was accompanied with up-regulation of p53 and down-regulation of Bcl-2 and Akt1. Moreover, AS1411 treatment resulted in the G2/M cell cycle arrest in glioma cells, which was however abolished by overexpression of NCL. Further, AS1411 induced cell apoptosis, which was prevented by silencing of p53 and overexpression of Bcl-2. In addition, AS1411 inhibited the migration and invasion of glioma cells in an Akt1-dependent manner. Importantly, AS1411 inhibited the growth of glioma xenograft and prolonged the survival time of glioma tumor-bearing mice. These results revealed a promising treatment of glioma by oligodeoxynucleotide aptamer.

  11. Role of P53 and BCL-2 in high-risk breast cancer patients treated with adjuvant anthracycline-based chemotherapy.

    Science.gov (United States)

    Mottolese, M; Benevolo, M; Del Monte, G; Buglioni, S; Papaldo, P; Nisticò, C; Di Filippo, F; Vasselli, S; Vici, P; Botti, C

    2000-12-01

    Adjuvant therapy has become an integral component of the managment of primary high-risk breast cancer patients. However, a considerable fraction of women receive no benefit from this treatment. This study investigates whether a number of biopathological factors can influence the outcome of patients submitted to adjuvant chemotherapy involving the use of high-dose epirubicin and cyclophosphamide. One hundred and fifty-seven primary breast cancer patients, considered at high risk according to the St. Gallen Meeting Consensus Conference, were evaluated immunohistochemically for estrogen, progesterone receptors, p53, bcl-2, HER-2/neu, and Ki-67, of which the results were correlated with patient outcome. Results obtained demonstrated that p53 is a significant predictor of disease-free survival (DFS P < 0.0001) and overall survival (OS P = 0.0002) both in ductal and lobular carcinomas, whereas bcl-2 expression seems to be of prognostic value only in lobular carcinomas (DFS P = 0.01; OS P = 0.02). This data indicates that in high-risk breast cancer patients the immunohistochemical evaluation of p53 and bcl-2 may be of clinical value in distinguishing different responses to adjuvant anthracycline-based chemotherapy.

  12. Superior anti-tumor activity of the MDM2 antagonist idasanutlin and the Bcl-2 inhibitor venetoclax in p53 wild-type acute myeloid leukemia models

    Directory of Open Access Journals (Sweden)

    Christian Lehmann

    2016-06-01

    Full Text Available Abstract Background Venetoclax, a small molecule BH3 mimetic which inhibits the anti-apoptotic protein Bcl-2, and idasanutlin, a selective MDM2 antagonist, have both shown activity as single-agent treatments in pre-clinical and clinical studies in acute myeloid leukemia (AML. In this study, we deliver the rationale and molecular basis for the combination of idasanutlin and venetoclax for treatment of p53 wild-type AML. Methods The effect of idasanutlin and venetoclax combination on cell viability, apoptosis, and cell cycle progression was investigated in vitro using established AML cell lines. In vivo efficacy was demonstrated in subcutaneous and orthotopic xenograft models generated in female nude or non-obese diabetic/severe combined immunodeficiency (NOD/SCID mice. Mode-of-action analyses were performed by means of cell cycle kinetic studies, RNA sequencing as well as western blotting experiments. Results Combination treatment with venetoclax and idasanutlin results in synergistic anti-tumor activity compared with the respective single-agent treatments in vitro, in p53 wild-type AML cell lines, and leads to strongly superior efficacy in vivo, in subcutaneous and orthotopic AML models. The inhibitory effects of idasanutlin were cell-cycle dependent, with cells arresting in G1 in consecutive cycles and the induction of apoptosis only evident after cells had gone through at least two cell cycles. Combination treatment with venetoclax removed this dependency, resulting in an acceleration of cell death kinetics. As expected, gene expression studies using RNA sequencing showed significant alterations to pathways associated with p53 signaling and cell cycle arrest (CCND1 pathway in response to idasanutlin treatment. Only few gene expression changes were observed for venetoclax treatment and combination treatment, indicating that their effects are mediated mainly at the post-transcriptional level. Protein expression studies demonstrated that

  13. Genetic dissimilarity between primary colorectal carcinomas and their lymph node metastases: ploidy, p53, bcl-2, and c-myc expression--a pilot study.

    Science.gov (United States)

    Zalata, Khaled Refaat; Elshal, Mohamed Farouk; Foda, Abd AlRahman Mohammad; Shoma, Ashraf

    2015-08-01

    The current paradigm of metastasis proposes that rare cells within primary tumors acquire metastatic capability via sequential mutations, suggesting that metastases are genetically dissimilar from their primary tumors. This study investigated the changes in the level of expression of a well-defined panel of cell proliferation, differentiation, and apoptosis markers between the primary colorectal cancer (CRC) and the corresponding synchronous lymph node (LN) metastasis from the same patients. DNA flow cytometry and immunostaining of p53, bcl-2, and c-myc were carried out on 36 cases of CRC radical resection specimens with their corresponding LN metastases. There was very low probability that the histological patterns of primary tumors and LN metastases are independent (p < 0.001). Metastatic tumors were significantly more diffusely positive for p53 than the primary tumors (p < 0.001). Conversely, primary tumors were significantly more diffusely positive for c-myc than metastatic tumors (p = 0.011). No significant difference was found between the LNs and the primary tumors in bcl-2 positivity (p = 0.538) and DNA aneuploidy (p = 0.35), with a tendency towards negative bcl-2 and less aneuploidy in LN metastases than primary tumors. In conclusion, LN metastatic colorectal carcinomas have a tendency of being less differentiated, with a higher incidence of diffuse p53 staining, lower incidence of bcl-2 staining, and less aneuploidy in comparison to their primary counterparts suggesting a more aggressive biological behavior, which could indicate the necessity for more aggressive adjuvant therapy.

  14. Association of Ki-67, p53, and bcl-2 expression of the primary non-small-cell lung cancer lesion with brain metastatic lesion

    International Nuclear Information System (INIS)

    Bubb, Robbin S.; Komaki, Ritsuko; Hachiya, Tsutomu; Milas, Ivan; Ro, Jae Y.; Langford, Lauren; Sawaya, Raymond; Putnam, Joe B.; Allen, Pamela; Cox, James D.; McDonnell, Timothy J.; Brock, William; Hong, Waun K.; Roth, Jack A.; Milas, Luka

    2002-01-01

    Purpose: The study was conducted to determine whether immunohistochemical analysis of Ki-67, p53, and bcl-2 in patients with non-small-cell lung cancer is associated with a higher rate of brain metastases and whether the intrapatient expression of these biomarkers (in the primary tumors vs. brain lesions) is similar. Methods and Materials: At the M. D. Anderson Cancer Center, tumors from 29 case patients with primary lung tumor and brain metastasis and 29 control patients with primary lung tumor but no brain metastasis were resected and examined for immunohistochemical expression. Ki-67, p53, and bcl-2 were analyzed in resected primary lung, lymph node, and metastatic brain tumors. Each control patient was matched by age, gender, and histology to a patient with brain metastasis. Results: No significant differences in patient survival characteristics were detected between the case group and control group. Also, difference in patient outcome between the two groups was not generally predicted by biomarker analysis. However, when the groups were combined, the biomarker analysis was predictive for certain patient outcome end points. Using median values as cutoff points between low and high expression of biomarkers, it was observed that high expression of Ki-67 (>40%) in lung primaries was associated with poorer disease-free survival (p=0.04), whereas low expression of p53 in lung primaries was associated with poorer overall survival (p=0.04), and these patients had a higher rate of nonbrain distant metastases (p=0.02). The patients with brain metastases were particularly prone to developing nonbrain distant metastases if the percentage of p53-positive cells in brain metastases was low (p=0.01). There was a positive correlation in the expression of Ki-67 (p=0.02) (r 2 =0.1608), as well as p53 (p 2 =0.7380), between lung primaries and brain metastases. Compared to Ki-67 and p53, bcl-2 was the least predictive. Conclusion: Differences in biomarker expression between the

  15. P53 Gene Mutagenesis in Breast Cancer

    National Research Council Canada - National Science Library

    Sommer, Steve S

    2005-01-01

    .... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...

  16. Adenocarcinoma of the esophagogastric junction: relationship between clinicopathological data and p53, cyclin D1 and Bcl-2 immunoexpressions Adenocarcinoma da junção esôfago-gástrica: relação entre os dados cllnipatológicos e a imunoexpressão de p53, ciclina D1 e Bcl-2

    Directory of Open Access Journals (Sweden)

    Dárcio Matenhauer Lehrbach

    2009-12-01

    Full Text Available CONTEXT: Esophagogastric junction adenocarcinoma has an aggressive behavior, and TNM (UICC staging is not always accurate enough to categorize patient's outcome. OBJECTIVES: To evaluated p53, cyclin D1 and Bcl-2 immunoexpressions in esophagogastric junction adenocarcinoma patients, without Barrett's esophagus, and to compared to clinicopathological characteristics and survival rate. METHODS: Tissue sections from 75 esophagogastric junction adenocarcinomas resected from 1991 to 2003 were analyzed by immunohistochemistry for p53, cyclin D1 and Bcl-2 using streptavidin-biotin-peroxidase method. The mean follow-up time was 60 months SD = 61.5 (varying from 4 to 273 months. RESULTS: Fifty (66.7% of the tumors were intestinal type and 25 (33.3% were diffuse. Vascular, lymph node and perineural infiltration were verified in 16%, 80% and 68% of the patients, respectively. The patients were distributed according to the TNM staging in IA in 4 (5.3%, IB in 10 (13.3%, II in 15 (20%, IIA in 15 (20%, IIIB in 15 (20% and IV in 16 (21.3%. Immunohistochemical analysis was positive for p53, cyclin D1 and bcl-2 in 68%, 18.7% and 100%, respectively. There was no association between immunoexpression and vascular and/or perineural invasions, clinicopathological characteristics and patients' survival rate. CONCLUSION: In this selected population, there was no association between the immunomarkers, p53, cyclin D1 and bcl-2 and clinicopathological data and/or overall survival.CONTEXTO: O adenocarcinoma da junção esôfago-gástrica tem um comportamento agressivo e o estádio TNM não é sempre suficiente para categorizar o paciente de acordo com a evolução do mesmo. OBJETIVO: Avaliar a imunoexpressão do p53, ciclina D1 e Bcl-2 em pacientes com adenocarcinoma da junção esôfago-gástrica sem esôfago de Barrett e comparar com as características clínicas e sobrevida. MÉTODOS: Cortes histológicos de 75 adenocarcinomas da esôfago-gástrica ressecados de 1991 a

  17. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    Science.gov (United States)

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  18. Hexavalent chromium-induced apoptosis of granulosa cells involves selective sub-cellular translocation of Bcl-2 members, ERK1/2 and p53

    International Nuclear Information System (INIS)

    Banu, Sakhila K.; Stanley, Jone A.; Lee, JeHoon; Stephen, Sam D.; Arosh, Joe A.; Hoyer, Patricia B.; Burghardt, Robert C.

    2011-01-01

    Hexavalent chromium (CrVI) has been widely used in industries throughout the world. Increased usage of CrVI and atmospheric emission of CrVI from catalytic converters of automobiles, and its improper disposal causes various health hazards including female infertility. Recently we have reported that lactational exposure to CrVI induced a delay/arrest in follicular development at the secondary follicular stage. In order to investigate the underlying mechanism, primary cultures of rat granulosa cells were treated with 10 μM potassium dichromate (CrVI) for 12 and 24 h, with or without vitamin C pre-treatment for 24 h. The effects of CrVI on intrinsic apoptotic pathway(s) were investigated. Our data indicated that CrVI: (i) induced DNA fragmentation and increased apoptosis, (ii) increased cytochrome c release from the mitochondria to cytosol, (iii) downregulated anti-apoptotic Bcl-2, Bcl-XL, HSP70 and HSP90; upregulated pro-apoptotic BAX and BAD, (iv) altered translocation of Bcl-2, Bcl-XL, BAX, BAD, HSP70 and HSP90 to the mitochondria, (v) upregulated p-ERK and p-JNK, and selectively translocated p-ERK to the mitochondria and nucleus, (vi) activated caspase-3 and PARP, and (vii) increased phosphorylation of p53 at ser-6, ser-9, ser-15, ser-20, ser-37, ser-46 and ser-392, increased p53 transcriptional activation, and downregulated MDM-2. Vitamin C pre-treatment mitigated CrVI effects on apoptosis and related pathways. Our study, for the first time provides a clear insight into the effect of CrVI on multiple pathways that lead to apoptosis of granulosa cells which could be mitigated by vitamin C.

  19. The influence of sleep deprivation on expression of apoptosis regulatory proteins p53, bcl-2 and bax following rat tongue carcinogenesis induced by 4-nitroquinoline 1-oxide

    Directory of Open Access Journals (Sweden)

    Juliana Noguti

    2013-01-01

    Full Text Available Background: The aim of this study was to evaluate whether paradoxical sleep deprivation could affects the mechanisms and pathways essentials for cancer cells in tongue cancer induced by 4-nitroquinole 1-oxide in Wistar rats. Materials and Methods: For this purpose, the animals were distributed into 4 groups of 5 animals each treated with 50 ppm 4 nitroquinoline 1 oxide (4 NQO solution through their drinking water for 4 and 12 weeks. The animals were submitted to paradoxical sleep deprivation (PSD for 72 h using the modified multiple platform method, which consisted of placing 5 mice in a cage (41 × 34 × 16 cm containing 10 circular platforms (3.5 cm in diameter with water 1 cm below the upper surface. The investigations were conducted using immunohistochemistry of p53, Bax and Bcl-2 proteins related to apoptosis and its pathways. Statistical analysis was performed by Kruskal-Wallis non-parametric test followed by the Dunn′s test using SPSS software pack (version 1.0. P value < 0.05 was considered for statistic significance. Results: Although no histopathological abnormalities were induced in the epithelium after 4 weeks of carcinogen exposure in all groups, in 12 weeks were observed pre-neoplasic lesions. Data analysis revealed statistically significant differences ( P < 0.05 in 4 weeks group for p53 and for bcl-2 and for all immunomarkers after 12 weeks of 4NQO administration. Conclusion: Our results reveal that sleep deprivation exerted alterations in proteins associated with proliferation and apoptosis in carcinogenesis.

  20. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  1. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  2. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  3. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    Science.gov (United States)

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

    2012-01-01

    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  4. Polymorphism at codon 36 of the p53 gene.

    Science.gov (United States)

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

    1994-01-01

    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  5. CORRELATION BETWEEN PROTEIN-WITH-MOLECULAR-WEIGHT-53 (P53, BURKIT CELL LYMPHOMA 2 (BCL2, AND FAS LIGAND (FASL AND VASCULAR-CELL-ADHESION-MOLECULE-1 (VCAM-1 MRNA EXPRESSION LEVELS IN A PATHOGENESIS STUDY OF PREECLAMPSIA

    Directory of Open Access Journals (Sweden)

    Mintareja Teguh

    2014-06-01

    Full Text Available Objective: To determine the role of protein-with-molecular-weight-53 (p53, burkit cell lymphoma 2 (Bcl2, Fas ligand (FasL mRNA, and vascular cell adhesion molecule 1 (VCAM-1, known as the apoptosis-related molecular pathway, in preeclamptic patients. Methods: Observation on the correlation between the mRNA levels of p53, Bcl2 and FasL and VCAM-1 in 31 subjects at 28-42 weeks gestational age was performed in this study using the real time reverse transcriptase-polymerase chain reaction (RT-PCR. Results: The results showed that p53 mRNA increased (>1.2350 ng/μL in the preeclampsia group compared to the normal pregnancy group (p=0.010, Bcl2 mRNA was lower (≤0.9271 ng/μL in the preeclampsia group than the control group (p=0.041. There was also a tendency of increased FasL mRNA expression (>0.5509 ng/μL in the preeclampsia group compared to the normal pregnancy group (p=0.300. The level of VCAM-1 elevated (>890.08 ng/mL in the preeclampsia group compared to the normal pregnancy group (p=0.001. In preeclampsia, the correlation between the Bcl2/p53 ratio and VCAM-1 was r=0.541 (p=0.002, whereas the correlation in normal pregnancy was r=0.099 (p=0.595. Conclusions: There are correlations between the mRNA expression levels of p53 and Bcl2 as an intrinsic pathway of apoptosis along with the VCAM-1 levels in the incidence of preeclampsia. However, no correlation is found between FasL mRNA expression and the incidence of preeclampsia.

  6. Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)

    2007-07-15

    Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses

  7. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

    2008-01-01

    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  8. Correlation Among Six Biologic Factors (p53, p21WAF1, MIB-1, EGFR, HER2, and Bcl-2) and Clinical Outcomes After Curative Chemoradiation Therapy in Squamous Cell Cervical Cancer

    International Nuclear Information System (INIS)

    Yamashita, Hideomi; Murakami, Naoya; Asari, Takao; Okuma, Kae; Ohtomo, Kuni; Nakagawa, Keiichi

    2009-01-01

    Purpose: The expressions of six cell-cycle-associated proteins were analyzed in cervical squamous cell carcinomas in correlation in a search for prognostic correlations in tumors treated with concurrent chemoradiation therapy (cCRT). Methods and Materials: The expressions of p53, p21/waf1/cip1, molecular immunology borstel-1 (MIB-1), epidermal growth factor receptor (EGFR), human epidermal growth factor receptor type 2 (HER2), and Bcl-2 were studied using an immunohistochemical method in 57 cases of cervical squamous cell carcinoma treated with cCRT. Patients received cCRT between 1998 and 2005. The mean patient age was 61 years (range, 27-82 years). The number of patients with Stage II, III, and IVA disease was 18, 29, and 10, respectively. Results: The number of patients with tumors positive for p53, p21/waf1/cip1, MIB-1, EGFR, HER2, and Bcl-2 was 26, 24, 49, 26, 13, and 11, respectively; no significant correlation was noted. The 5-year overall survival rates of HER2-positive and -negative patients was 76% vs. 44%, which was of borderline significance (p = 0.0675). No significant correlation was noted between overall survival and expressions of p53, p21/waf1/cip1, MIB-1, EGFR, and Bcl-2. No correlation was observed between local control and expression of any of the proteins. Conclusion: Expression of HER2 protein had a weak impact of borderline significance on overall survival in squamous cell carcinoma of the uterine cervix treated with cCRT. However, no clinical associations could be established for p53, p21/waf1/cip1, MIB-1, EGFR, and Bcl-2 protein expressions.

  9. Analysis of the immunohistochemical expressions of p53, bcl-2 and Ki-67 in colorectal adenocarcinoma and their correlations with the prognostic factors Análise das expressões imunoistoquímicas da p53, bcl-2 e Ki-67 no adenocarcinoma colorretal e suas correlações com os fatores prognósticos

    Directory of Open Access Journals (Sweden)

    Hunaldo Lima de Menezes

    2010-06-01

    Full Text Available CONTEXT: Search of tumors markers that allow treatment with higher survival rates, and indicate the response to treatment and recurrence of cancer OBJECTIVE: To analyze the immunoexpression of the proteins p53, bcl-2 and Ki-67 in colorectal adenocarcinoma and correlate them with the clinical-pathological prognostic factors. METHOD: Tissue microarray paraffin blocks were made from colorectal adenocarcinoma tissue resected from 82 patients who had undergone surgery but not chemotherapy or radiotherapy, at "Hospital São Paulo", São Paulo, SP, Brazil, between 2002 and 2005. Thin sections (4 µm were subjected to immunohistochemical reactions, and immunoexpression staining scores were obtained. The scores were correlated with the degree of cell differentiation, staging, disease-free interval, recurrence, survival and specific mortality. The study variables were analyzed using the chi-square and Kaplan-Meier tests to investigate associations with the markers. The significance of the differences between the curves of the disease-free interval and survival was analyzed using the Logrank and Wilcoxon tests. RESULTS: The immunohistochemical expression of p53 was positive in 70 tumors (85.4% and negative in 12 (14.6%. The expression of bcl-2 was positive in 26 (31.7% and negative in 56 (68.3%. The expression of Ki-67 was positive in 62 (75.6% and negative in 20 (24.4%. There was no statistically significant correlation between the expressions of these markers separately or in conjunction, in relation to the degree of cell differentiation, staging, disease-free interval, survival and specific mortality. In relation to recurrence, there was a statistically significant correlation with positive expression of Ki-67 (P = 0.035. CONCLUSION: The immunohistochemical expression of Ki-67 in colorectal cancer is associated with recurrence of this disease.CONTEXTO: Pesquisa de marcadores tumorais que permitam tratamento com maiores índices de sobrevida, além de

  10. Expression of p53 Target Genes in the Early Phase of Long-Term Potentiation in the Rat Hippocampal CA1 Area

    Directory of Open Access Journals (Sweden)

    Vladimir O. Pustylnyak

    2015-01-01

    Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.

  11. The prognostic implication of the expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in primary locally advanced oral squamous cell carcinoma cases: a tissue microarray study.

    Science.gov (United States)

    Solomon, Monica Charlotte; Vidyasagar, M S; Fernandes, Donald; Guddattu, Vasudev; Mathew, Mary; Shergill, Ankur Kaur; Carnelio, Sunitha; Chandrashekar, Chetana

    2016-12-01

    Oral squamous cell carcinomas comprise a heterogeneous tumor cell population with varied molecular characteristics, which makes prognostication of these tumors a complex and challenging issue. Thus, molecular profiling of these tumors is advantageous for an accurate prognostication and treatment planning. This is a retrospective study on a cohort of primary locally advanced oral squamous cell carcinomas (n = 178) of an Indian rural population. The expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in a cohort of primary locally advanced oral squamous cell carcinomas was evaluated. A potential biomarker that can predict the tumor response to treatment was identified. Formalin-fixed paraffin-embedded tumor blocks of (n = 178) of histopathologically diagnosed cases of locally advanced oral squamous cell carcinomas were selected. Tissue microarray blocks were constructed with 2 cores of 2 mm diameter from each tumor block. Four-micron-thick sections were cut from these tissue microarray blocks. These tissue microarray sections were immunohistochemically stained for EGFR, p53, Bcl-2, cyclin D1 and p16. In this cohort, EGFR was the most frequently expressed 150/178 (84%) biomarker of the cases. Kaplan-Meier analysis showed a significant association (p = 0.038) between expression of p53 and a poor prognosis. A Poisson regression analysis showed that tumors that expressed p53 had a two times greater chance of recurrence (unadjusted IRR-95% CI 2.08 (1.03, 4.5), adjusted IRR-2.29 (1.08, 4.8) compared with the tumors that did not express this biomarker. Molecular profiling of oral squamous cell carcinomas will enable us to categorize our patients into more realistic risk groups. With biologically guided tumor characterization, personalized treatment protocols can be designed for individual patients, which will improve the quality of life of these patients.

  12. A comparison of the effects of tributyltin chloride and triphenyltin chloride on cell proliferation, proapoptotic p53, Bax, and antiapoptotic Bcl-2 protein levels in human breast cancer MCF-7 cell line.

    Science.gov (United States)

    Fickova, Maria; Macho, Ladislav; Brtko, Julius

    2015-06-01

    In recent years it was disclosed, that numerous organotin(IV) derivatives have remarkable cytotoxicity against several types of cancer cells. The property to inhibit cell growth makes these compounds promising for antitumor therapy, as the clinical effectiveness of cisplatin is limited by drug resistance and significant side effects. Tributyltin and triphenyltin are known as endocrine disruptors. Moreover, the compounds exert their toxicity in mammals predominantly through nuclear receptor signaling. Here we present the effects of tributyltin chloride (TBT-Cl) and triphenyltin chloride (TPT-Cl) on cell proliferation, expression of proapoptotic p53, Bax, and antiapoptotic Bcl-2 proteins in human breast cancer MCF-7 cell line. Dose and time dependent (24, 48 and 72 h) cell expositions have demonstrated TBT-Cl as more effective in inhibiting MCF-7 cell proliferation than TPT-Cl. Short time treatment with TBT-Cl displayed marked stimulation of p53 protein expression when compared to TPT-Cl. Both organotin compounds displayed similar mild enhancement of Bax protein expression. The 24h exposition of TPT-Cl induced substantial diminution of Bcl-2 protein expression in comparison with both, untreated cells and TBT-Cl treated cells. Our observations indicate that TBT-Cl and TPT-Cl have different antiproliferative potency and distinct impact on expression of apoptosis marker proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Effect of p53 genotype on gene expression profiles in murine liver

    International Nuclear Information System (INIS)

    Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

    2008-01-01

    The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

  14. THE EXPRESSION AND CLINICAL VALUE OF APOPTOSIS CONTROL GENE Bcl-2 AND Bax IN BREAST CANCER

    Institute of Scientific and Technical Information of China (English)

    ZHENG Jun; YAO Zhen-xiang; ZHANG Jing

    1999-01-01

    Objective: To study the expression and clinical value of apoptosis control gene bcl-2 and bax in breast cancer.Methods: Protein bax and bcl-2 in 41 breast cancers obtained from operations in our hospital in 1996 were detected using ABC immunohistochemical stain assay and compared with 10 cases with normal breast tissues.Results: The positive rate of bax in normal breast tissue was 90% and in breast cancer was 59%, with a significant statistical difference between them (P<0.05), but there was no statistical difference in bcl-2 protein expression. Among the 41 breast cancer, the group with lymph node metastasis (21 cases) had obviously low bax expression (43%) and high bcl-2 expression (76%), showing significant difference to the group without lymph node metastasis (P<0.05).Conclusion: The antiapoptosis function of bcl-2 was stronger than bax in breast cancer. Protein bax and bcl-2 assay may be useful in understanding the biological behaviors of breast cancer.

  15. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  16. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    Science.gov (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  17. Isolation and characterization of DUSP11, a novel p53 target gene

    DEFF Research Database (Denmark)

    Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

    2009-01-01

    target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

  18. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  19. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

    2006-01-01

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

  20. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

    2006-02-22

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

  1. Stimulation of autophagy by the p53 target gene Sestrin2.

    Science.gov (United States)

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  3. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  4. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  5. Gene expression patterns associated with p53 status in breast cancer

    International Nuclear Information System (INIS)

    Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

    2006-01-01

    Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

  6. DNA rearrangement in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene

    International Nuclear Information System (INIS)

    Tsujimoto, Y.; Bashir, M.M.; Givol, I.; Cossman, J.; Jaffe, E.; Croce, C.M.

    1987-01-01

    In most human lymphomas, the chromosome translocation t(14;18) occurs within two breakpoint clustering regions on chromosome 18, the major one at the 3' untranslated region of the bcl-2 gene and the minor one at 3' of the gene. Analysis of a panel of follicular lymphoma DNAs using probes for the first exon of the bcl-2 gene indicates that DNA rearrangements may also occur 5' to the involved bcl-2 gene. In this case the IgH locus and the bcl-2 gene are found in an order suggesting that an inversion also occurred during the translocation process. The coding region of the bcl-2 gene, however, are left intact in all cases of follicular lymphoma studied to date

  7. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    2006-01-01

    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  8. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  9. Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

    2014-01-01

    Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

  10. Alterations in the K-ras and p53 genes in rat lung tumors

    Energy Technology Data Exchange (ETDEWEB)

    Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others

    1997-06-01

    Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

  11. Status and advances of p53-gene therapy and radiotherapy in malignant tumor

    International Nuclear Information System (INIS)

    Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong

    2006-01-01

    Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)

  12. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  14. Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

    Science.gov (United States)

    Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

    2005-04-01

    The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

  15. Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

    Energy Technology Data Exchange (ETDEWEB)

    Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)

    2007-02-15

    Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

  16. Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

    International Nuclear Information System (INIS)

    Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying

    2007-01-01

    Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

  17. ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

    International Nuclear Information System (INIS)

    Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

    2007-01-01

    We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

  18. Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

    International Nuclear Information System (INIS)

    Irshad, S.; Nawaz, T.

    2008-01-01

    Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

  19. Induction of apoptosis in melanoma A375 cells by a chloroform fraction of Centratherum anthelminticum (L.) seeds involves NF-kappaB, p53 and Bcl-2-controlled mitochondrial signaling pathways.

    Science.gov (United States)

    Looi, Chung Yeng; Moharram, Bushra; Paydar, Mohammadjavad; Wong, Yi Li; Leong, Kok Hoong; Mohamad, Khalit; Arya, Aditya; Wong, Won Fen; Mustafa, Mohd Rais

    2013-07-10

    Centratherum anthelminticum (L.) Kuntze (scientific synonyms: Vernonia anthelmintica; black cumin) is one of the ingredients of an Ayurvedic preparation, called "Kayakalp", commonly applied to treat skin disorders in India and Southeast Asia. Despite its well known anti-inflammatory property on skin diseases, the anti-cancer effect of C. anthelminticum seeds on skin cancer is less documented. The present study aims to investigate the anti-cancer effect of Centratherum anthelminticum (L.) seeds chloroform fraction (CACF) on human melanoma cells and to elucidate the molecular mechanism involved. A chloroform fraction was extracted from C. anthelminticum (CACF). Bioactive compounds of the CACF were analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Human melanoma cell line A375 was treated with CACF in vitro. Effects of CACF on growth inhibition, morphology, stress and survival of the cell were examined with MTT, high content screening (HSC) array scan and flow cytometry analyses. Involvement of intrinsic or extrinsic pathways in the CACF-induced A375 cell death mechanism was examined using a caspase luminescence assay. The results were further verified with different caspase inhibitors. In addition, Western blot analysis was performed to elucidate the changes in apoptosis-associated molecules. Finally, the effect of CACF on the NF-κB nuclear translocation ability was assayed. The MTT assay showed that CACF dose-dependently inhibited cell growth of A375, while exerted less cytotoxic effect on normal primary epithelial melanocytes. We demonstrated that CACF induced cell growth inhibition through apoptosis, as evidenced by cell shrinkage, increased annexin V staining and formation of membrane blebs. CACF treatment also resulted in higher reactive oxygen species (ROS) production and lower Bcl-2 expression, leading to decrease mitochondrial membrane potential (MMP). Disruption of the MMP facilitated the release of mitochondrial cytochrome c, which

  20. Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation

    International Nuclear Information System (INIS)

    Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY

    1996-01-01

    Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)

  1. p53 as the focus of gene therapy: past, present and future.

    Science.gov (United States)

    Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

    2018-01-15

    Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  3. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  4. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

    Directory of Open Access Journals (Sweden)

    Simon Leuchs

    Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

  5. Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

    Science.gov (United States)

    Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

    2011-12-01

    Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

  6. Alterations in tumour suppressor gene p53 in human gliomas from ...

    Indian Academy of Sciences (India)

    Unknown

    Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.

  7. Bladder-like graphical representation of p53 gene alterations in some human cancers

    International Nuclear Information System (INIS)

    Helal, N.L.; Dorrah, M.; LI, C.

    2005-01-01

    the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

  8. Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

    Science.gov (United States)

    Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

    2015-12-01

    Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

  9. Curcumin significantly enhances dual PI3K/Akt and mTOR inhibitor NVP-BEZ235-induced apoptosis in human renal carcinoma Caki cells through down-regulation of p53-dependent Bcl-2 expression and inhibition of Mcl-1 protein stability.

    Directory of Open Access Journals (Sweden)

    Bo Ram Seo

    Full Text Available The PI3K/Akt and mTOR signaling pathways are important for cell survival and growth, and they are highly activated in cancer cells compared with normal cells. Therefore, these signaling pathways are targets for inducing cancer cell death. The dual PI3K/Akt and mTOR inhibitor NVP-BEZ235 completely inhibited both signaling pathways. However, NVP-BEZ235 had no effect on cell death in human renal carcinoma Caki cells. We tested whether combined treatment with natural compounds and NVP-BEZ235 could induce cell death. Among several chemopreventive agents, curcumin, a natural biologically active compound that is extracted from the rhizomes of Curcuma species, markedly induced apoptosis in NVP-BEZ235-treated cells. Co-treatment with curcumin and NVP-BEZ235 led to the down-regulation of Mcl-1 protein expression but not mRNA expression. Ectopic expression of Mcl-1 completely inhibited curcumin plus NVP-NEZ235-induced apoptosis. Furthermore, the down-regulation of Bcl-2 was involved in curcumin plus NVP-BEZ235-induced apoptosis. Curcumin or NVP-BEZ235 alone did not change Bcl-2 mRNA or protein expression, but co-treatment reduced Bcl-2 mRNA and protein expression. Combined treatment with NVP-BEZ235 and curcumin reduced Bcl-2 expression in wild-type p53 HCT116 human colon carcinoma cells but not p53-null HCT116 cells. Moreover, Bcl-2 expression was completely reversed by treatment with pifithrin-α, a p53-specific inhibitor. Ectopic expression of Bcl-2 also inhibited apoptosis in NVP-BE235 plus curcumin-treated cells. In contrast, NVP-BEZ235 combined with curcumin did not have a synergistic effect on normal human skin fibroblasts and normal human mesangial cells. Taken together, combined treatment with NVP-BEZ235 and curcumin induces apoptosis through p53-dependent Bcl-2 mRNA down-regulation at the transcriptional level and Mcl-1 protein down-regulation at the post-transcriptional level.

  10. A importância do gene p53 na carcinogênese humana The importance of the p53 gene in human carcinogenesis

    Directory of Open Access Journals (Sweden)

    Agnes C. Fett-Conte

    2002-04-01

    Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.

  11. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  12. Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

    Science.gov (United States)

    Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

    2003-08-01

    Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its

  13. Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

    International Nuclear Information System (INIS)

    Tong, Ying; Smith, M.A.; Tucker, S.B.

    1997-01-01

    Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

  14. TAF6delta controls apoptosis and gene expression in the absence of p53.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Wilhelm

    Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.

  15. Rapid detection of single nucleotide mutation in p53 gene based on ...

    Indian Academy of Sciences (India)

    mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

  16. Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

    Science.gov (United States)

    Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

    2005-07-01

    To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

  17. The effects of combining ionizing radiation and adenovirus-mediated p53 gene transfer in human nasopharyngeal carcinoma cell lines

    International Nuclear Information System (INIS)

    Liu Feifei; Li Jianhua; Lax, Stuart; Klamut, Henry

    1997-01-01

    Purpose/Objective: We have previously demonstrated that the introduction of human recombinant wild-type p53 carried by the adenoviral vector (Ad5CMV-p53) into two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z) resulted in significant cytotoxicity. In the current work, we wanted to evaluate the results of this strategy when combined with ionizing radiation (XRT). Materials and Methods: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain KS1, were infected with iso-effective doses of 2, 6 and 6 pfu/cell of Ad5CMV-p53 respectively. XRT was administered 24 hours post-infection, to coincide with the time of maximal recombinant p53 expression. Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax and bcl-2. Cell viability was evaluated using both the MTT and clonogenic assays. Presence of apoptosis was determined by using DNA agarose gel electrophoresis. Results: We observed that the combination of Ad5CMV-p53 + XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The MTT assay indicated sparing of the KS1 cells when subjected to the identical treatments. XRT alone stimulated minimal p53 expression; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax and bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed earlier, at 2 Gy when combined with Ad5CMV-p53. Conclusion: Additional cytotoxicity was observed for the NPC cell lines when XRT was combined with Ad5CMV-p53 infection, with concurrent sparing of normal cells (KS1). This cytotoxicity also appeared to be mediated through the induction of the apoptotic pathway. These results support our previous observation of the potential application of this strategy in the

  18. Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors

    International Nuclear Information System (INIS)

    Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.

    2010-01-01

    Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)

  19. The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

    Science.gov (United States)

    Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

    2009-05-01

    Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

  20. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp

  1. Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

    International Nuclear Information System (INIS)

    Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

    2009-01-01

    A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

  2. Overexpression of the human BCL-2 gene product results in growth enhancement of Epstein-Barr virus-immortalized B cells

    International Nuclear Information System (INIS)

    Tsujimoto, Yoshihide

    1989-01-01

    The biological activity of the human BCL-2 gene product was analyzed in an Epstein-Barr virus (EBV)-infected human lymphoblastoid B-cell line transfected with BCL-2 sequences driven by the simian virus 40 promoter and enhancer. Overproduction of the BCL-2 protein conferred a selective growth advantage to the EBV-infected B cells as compared with control transfectants in low-serum medium and also after seeding at limiting dilution but did not render the cells tumorigenic in athymic nude mice. This growth enhancement was also seen in cells transfected with the BCL-2 gene with its own promoter juxtaposed to the immunoglobulin heavy chain gene enhancer, which represents the translocated form of the BCL-2 gene observed in follicular lymphomas with the t(14;18) translocation. The growth advantage of EBV-infected B cells overproducing the BCL-2 protein is neither due to the enhanced growth factor production nor due to an enhanced sensitivity of the BCL-2 transfectants to interleukins 1 or 6, although both lymphokines are known to stimulate proliferation of EBV-infected B-cell lines. The growth advantage of EBV-infected B-cell lines. The growth advantage of EBV-infected B cells by overproduction of the BCL-2 protein suggests the direct involvement of the BCL-2 gene product in the pathogenesis of follicular lymphoma

  3. Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2006-01-01

    In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

  4. The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy

    International Nuclear Information System (INIS)

    Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.

    1996-01-01

    cellular phenotypes, including the radioresistant phenotype. Pre-clinical studies suggest that these phenotypes may be reversed using adenovirus-mediated gene therapy or pharmacologic strategies designed to re-institute WTp53 protein function. Our analysis of the published data strongly argues for the use offunctional assays for the determination of WTp53 protein function in studies which attempt to correlate normal and tumour tissue radioresponse with p53 genotype, or p53 protein expression

  5. Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

    NARCIS (Netherlands)

    Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

    1993-01-01

    Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

  6. Influence of X-ray on the P53 gene in human peripheral blood lymphocytes

    International Nuclear Information System (INIS)

    Jin Wenwei; Cai Ting

    2002-01-01

    Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation

  7. Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

    International Nuclear Information System (INIS)

    Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun

    2007-01-01

    Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

  8. Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)

    2007-02-15

    Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

  9. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  10. Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki

    2004-01-01

    We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)

  11. Effect of Bcl-2/Bax gene expression on apoptosis of spermatogenic cells of mouse testes induced by low dose radiation

    International Nuclear Information System (INIS)

    Liu Guangwei; Wang Chunyan; Lu Zhe; Liu Shunchun; Gong Shouliang

    2003-01-01

    The different kinds of spermatogenic cells were separated using density gradient centrifugation and their apoptosis and Bcl-2 and Bax protein expression were measured with flow cytometry and immunohistochemical method, respectively. The results showed the apoptosis in all kinds of spermatogenic cells induced by low dose radiation (LDR) had a obvious regularity. When the doses were 0.025 and 0.05 Gy, spermatogonia apoptosis was dominant. With the increase of irradiation dose (0.075-0.2 Gy), spermatocytes also showed an apoptotic change, but the apoptotic percentage of spermatogonia was significantly higher than that of spermatocytes. Moreover, the apoptosis of spermatids and spermatozoa scarcely occurred after LDR. Bax protein was primarily expressed in spermatogonia and spermatocytes, and the former was significantly higher than that of the latter after LDR. With the increase of irradiation dose, Bax protein expression showed a upgrading tendency, but that of spermatids and spermatozoa scarcely occurred. Bcl-2 protein was primarily expressed in spermatids and spermatozoa, but the Bcl-2 protein expressions of spermatogonia and spermatocytes scarcely occurred after LDR. These results imply that the interacting regulation of Bcl-2 and Bax gene expression might be involved in selective apoptosis of spermatogenic cells induced by LDR, which provided an experimental evidence for further exploring the apoptotic mechanism of adaptive response of spermatogenic cells by LDR

  12. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    International Nuclear Information System (INIS)

    Zhang, Y.; Woloschak, G.E.

    1997-01-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed

  13. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    Science.gov (United States)

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  14. Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2005-01-01

    In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

  15. The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.

    Science.gov (United States)

    Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna

    2018-03-01

    Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.

  16. Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer

    International Nuclear Information System (INIS)

    Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong

    2009-01-01

    Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their

  17. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  18. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  19. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    International Nuclear Information System (INIS)

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-01-01

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  20. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  1. The relationship among human papilloma virus infection, survivin, and p53 gene in lung squamous carcinoma tissue

    International Nuclear Information System (INIS)

    Yue-Hua Wang; De-jie Chen; Tie-Nan Yi

    2010-01-01

    To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).

  2. p53 Gene (NY-CO-13 Levels in Patients with Chronic Myeloid Leukemia: The Role of Imatinib and Nilotinib

    Directory of Open Access Journals (Sweden)

    Hayder M. Al-kuraishy

    2018-01-01

    Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.

  3. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    Science.gov (United States)

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  4. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2010-08-01

    Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  5. p53, SKP2, and DKK3 as MYCN Target Genes and Their Potential Therapeutic Significance

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Lindi; Tweddle, Deborah A., E-mail: deborah.tweddle@ncl.ac.uk [Newcastle Cancer Centre, Northern Institute for Cancer Research, Newcastle University, Newcastle (United Kingdom)

    2012-11-28

    Neuroblastoma is the most common extra-cranial solid tumor of childhood. Despite significant advances, it currently still remains one of the most difficult childhood cancers to cure, with less than 40% of patients with high-risk disease being long-term survivors. MYCN is a proto-oncogene implicated to be directly involved in neuroblastoma development. Amplification of MYCN is associated with rapid tumor progression and poor prognosis. Novel therapeutic strategies which can improve the survival rates whilst reducing the toxicity in these patients are therefore required. Here we discuss genes regulated by MYCN in neuroblastoma, with particular reference to p53, SKP2, and DKK3 and strategies that may be employed to target them.

  6. The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

    International Nuclear Information System (INIS)

    Ohnishi, Takeo

    1997-01-01

    I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

  7. High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Zhihong CHEN

    2011-10-01

    Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

  8. P53 and Rb tumor suppressor gene alterations in gastric cancer Alterações dos genes supressores tumorais p53 e Rb no câncer gástrico

    Directory of Open Access Journals (Sweden)

    Rejane Mattar

    2004-01-01

    Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea

  9. The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

    Directory of Open Access Journals (Sweden)

    Krzysztof Puszynski

    2014-12-01

    Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.

  10. Cancerous hyper-mutagenesis in p53 genes is possibly associated with transcriptional bypass of DNA lesions

    International Nuclear Information System (INIS)

    Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.

    2002-01-01

    The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with

  11. The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

    Directory of Open Access Journals (Sweden)

    Jennifer M. Smith

    2007-12-01

    Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

  12. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  13. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  14. Transcriptome profiling identifies genes and pathways deregulated upon floxuridine treatment in colorectal cancer cells harboring GOF mutant p53

    Directory of Open Access Journals (Sweden)

    Arindam Datta

    2016-06-01

    Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.

  15. Association of genetic markers in the BCL-2 family of apoptosis-related genes with endometrial cancer risk in a Chinese population.

    Directory of Open Access Journals (Sweden)

    Tsogzolmaa Dorjgochoo

    Full Text Available In vitro studies have demonstrated the role of the BCL-2 family of genes in endometrial carcinogenesis. The role of genetic variants in BCL-2 genes and their interactions with non-genetic factors in the development of endometrial cancer has not been investigated in epidemiological studies.We examined the relationship between BCL-2 gene family variants and endometrial cancer risk among 1,028 patients and 1,922 age-matched community controls from Shanghai, China. We also investigated possible interactions between genetic variants and established risk factors (demographic, lifestyle and clinical. Individuals were genotyped for 86 tagging single nucleotide polymorphisms (SNPs in the BCL2, BAX, BAD and BAK1 genes.Significant associations with endometrial cancer risk were found for 9 SNPs in the BCL2 gene (P trend<0.05 for all. For SNPs rs17759659 and rs7243091 (minor allele for both: G, the associations were independent. The odds ratio was 1.27 (95% CI: 1.04-1.53 for women with AG genotype for the SNP rs17759659 and 1.82 (95% CI: 1.21-2.73 for women with the GG genotype for the SNP rs7243091. No interaction between these two SNPs and established non-genetic risk factors of endometrial cancer was noticed.Genetic polymorphisms in the BCL2 gene may be associated with the risk of endometrial cancer in Chinese women.

  16. Inhibition of human colorectal adenocarcinoma cells with AdCMV-p53 gene transfection induced by irradiation

    International Nuclear Information System (INIS)

    Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang

    2006-01-01

    The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)

  17. p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

    International Nuclear Information System (INIS)

    Ikehata, Hironobu

    1998-01-01

    Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

  18. The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

    Science.gov (United States)

    Noda, Takeshi

    2011-12-01

    I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.

  20. Exogenous wild type p53 gene affects radiosensitivity of human lung adenocarcinoma cell line under hypoxia

    International Nuclear Information System (INIS)

    Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong

    2008-01-01

    Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)

  1. [CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

    Science.gov (United States)

    Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

    2012-01-01

    In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

  2. Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

    International Nuclear Information System (INIS)

    Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

    2010-01-01

    Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

  3. Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

    International Nuclear Information System (INIS)

    Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.

    2011-01-01

    Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

  4. Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

    Energy Technology Data Exchange (ETDEWEB)

    Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

  5. Effect of doxorubicin, oxaliplatin, and methotrexate administration on the transcriptional activity of BCL-2 family gene members in stomach cancer cells.

    Science.gov (United States)

    Florou, Dimitra; Patsis, Christos; Ardavanis, Alexandros; Scorilas, Andreas

    2013-07-01

    Defective apoptosis comprises the main reason for tumor aggressiveness and chemotherapy tolerance in solid neoplasias. Among the BCL-2 family members, whose mRNA or protein expression varies considerably in different human malignancies, BCL2L12 is the one for which we have recently shown its propitious prognostic value in gastric cancer. The purpose of the current work was to investigate the expression behavior of BCL2L12, BAX, and BCL-2 in human stomach adenocarcinoma cells following their exposure to anti-tumor substances. The 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide and trypan blue methods assessed the impact of doxorubicin, oxaliplatin and methotrexate on AGS cells' viability and growth. Following isolation from cells, total RNA was reverse-transcribed to cDNA. Quantification of target genes' expression was performed with real-time PCR using SYBR Green detection system. The relative changes in their mRNA levels between drug-exposed and untreated cells were calculated with the comparative Ct method (2(-ddCt)). All three drugs, as a result of their administration to AGS cancer cells for particular time intervals, provoked substantial fluctuations in the transcriptional levels of the apoptosis-related genes studied. While BAX was principally upregulated, striking similar were the notable changes regarding BCL-2 and BCL2L12 expression in our cellular system. Our findings indicate the growth suppressive effects of doxorubicin, oxaliplatin and methotrexate treatment on stomach carcinoma cells and the implication of BCL2L12, BAX, and BCL-2 expression profiles in the molecular signaling pathways triggered by chemotherapy.

  6. Connection between cell phone use, p53 gene expression in different zones of glioblastoma multiforme and survival prognoses

    Directory of Open Access Journals (Sweden)

    Reza Akhavan-Sigari

    2014-08-01

    Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.

  7. Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

    Science.gov (United States)

    White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

    2014-08-01

    The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

  8. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    Science.gov (United States)

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  9. Absence of p53 gene mutations in mice colon pre-cancerous stage induced by o-nitrotoluene

    Directory of Open Access Journals (Sweden)

    Nahed A Hussien

    2014-01-01

    Conclusion: The results from the present study indicate that point mutations in the p53 gene, in the coding region (exons 5-8 and outside it (exons 10, 11, are not involved in the development of the colon precancerous stage induced by o-nt in mice.

  10. Detection of p53 Gene by Using Genomagnetic Assay Combined with Carbon Nanotube Modified Disposable Sensor Technology

    Czech Academy of Sciences Publication Activity Database

    Congur, G.; Plucnara, Medard; Erdem, A.; Fojta, Miroslav

    2015-01-01

    Roč. 27, č. 7 (2015), s. 1579-1586 ISSN 1040-0397 R&D Projects: GA ČR GAP206/11/1638 Institutional support: RVO:68081707 Keywords : p53 Gene * Carbon nanotubes * Magnetic particles Subject RIV: BO - Biophysics Impact factor: 2.471, year: 2015

  11. Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

    International Nuclear Information System (INIS)

    Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

    1997-01-01

    Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

  12. Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

    1996-01-01

    Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

  13. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  14. Codelivery for Paclitaxel and Bcl-2 Conversion Gene by PHB-PDMAEMA Amphiphilic Cationic Copolymer for Effective Drug Resistant Cancer Therapy.

    Science.gov (United States)

    Wang, Xiaoyuan; Liow, Sing Shy; Wu, Qiaoqiong; Li, Chuang; Owh, Cally; Li, Zibiao; Loh, Xian Jun; Wu, Yun-Long

    2017-11-01

    Antiapoptotic Bcl-2 protein's upregulated expression is a key reason for drug resistance leading to failure of chemotherapy. In this report, a series of biocompatible amphiphilic cationic poly[(R)-3-hydroxybutyrate] (PHB)-b-poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) copolymer, comprising hydrophobic PHB block and cationic PDMAEMA block, is designed to codeliver hydrophobic chemotherapeutic paclitaxel and Bcl-2 converting gene Nur77/ΔDBD with enhanced stability, due to the micelle formation by hydrophobic PHB segment. This copolymer shows less toxicity but similar gene transfection efficiency to polyethyenimine (25k). More importantly, this codelivery approach by PHB-PDMAEMA leads to increased drug resistant HepG2/Bcl-2 cancer cell death, by increased expression of Nur77 proteins in the Bcl-2 present intracellular mitochondria. This work signifies for the first time that cationic amphiphilic PHB-b-PDMAEMA copolymers can be utilized for the drug and gene codelivery to drug resistant cancer cells with high expression of antiapoptosis Bcl-2 protein and the positive results are encouraging for the further design of codelivery platforms for combating drug resistant cancer cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes

    OpenAIRE

    Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.

    2015-01-01

    Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...

  16. The Impact of Adenosine Fast Induction of Myocardial Arrest during CABG on Myocardial Expression of Apoptosis-Regulating Genes Bax and Bcl-2

    Directory of Open Access Journals (Sweden)

    Ahmed Shalaby

    2009-01-01

    Full Text Available Background. We studied the effect of fast induction of cardiac arrest with denosine on myocardial bax and bcl-2 expression. Methods and Results. 40 elective CABG patients were allocated into two groups. The adenosine group (n=20 received 250 μg/kg adenosine into the aortic root followed by blood potassium cardioplegia. The control group received potassium cardioplegia in blood. Bcl-2 and bax were measured. Bax was reduced in the postoperative biopsies (1.38 versus 0.47, P=.002 in the control group. Bcl-2 showed a reducing tendency (0.14 versus 0.085, P=.07. After the adenosine treatment, the expression of both bax (0.52 versus 0.59, P=.4 and bcl-2 (0.104 versus 0.107, P=.4 remained unaltered after the operation. Conclusion. Open heart surgery is associated with rapid reduction in the expression of apoptosis regulating genes bax and bcl-2. Fast Adenosine induction abolished changes in their expression.

  17. Flow cytometric characterization of phenotype, DNA indices and p53 gene expression in 55 cases of acute leukemia.

    Science.gov (United States)

    Powari, Manish; Varma, Neelam; Varma, Subhash; Marwaha, Ram Kumar; Sandhu, Harpreet; Ganguly, Nirmal Kumar

    2002-06-01

    To characterize the phenotype of acute leukemia cases using flow cytometry, to detect mixed lineage cases and to use DNA index determination, including S-phase fraction (SPF) and p53 detection, to find if there was any correlation of SPF and p53 expression with outcome. Fifty-five cases of acute leukemia were enrolled in this study. A complete hemogram and routine bone marrow examination, including cytochemistry, was done. Mycloperoxidase-negative cases were evaluated on a flow cytometer using monoclonal antibodies. DNA indices were determined by flow cytometry in all cases, and p53 was detected immunohistochemically using the alkaline phosphatase/antialkaline phosphatase technique. Acute myeloblastic leukemia (AML) was diagnosed in 32 cases; acute lymphoblastic leukemia (ALL) was diagnosed in 18 (14 B lineage and 4 T line age). Four cases showed mixed lineage leukemia, and undifferentiated acute leukemia was diagnosed in one case. The mean/range of SPF for these groups were 3.76/0.33-6.91, 6.25/0.15-21.4, 2.89/0.35-10.64, 2.60/0.72-6.94 and 7.34, respectively. Aneuploidy was detected in two cases of B-lineage ALL and tetraploidy in a case of AML-M7, while all others were diploid p53. Was detected in 6 of 55 cases (10.90%). Follow-up was available for 24 patients. Five patients relapsed, and four had B-cell type ALL and were diploid and expressed no p53 gene. SPF% did not show any correlation with outcome. These data suggest that within acute leukemia subtypes, there is a wide variation in SPF. SPF does not seem to correlate with outcome. Immunophenotyping is essential to determine the lineage in myeloperoxidase-negative cases. It is perhaps the only way to diagnose mixed lineage leukemia and aberrant expression of markers presently. The p53 gene was detected less frequently. However, more studies are required from different centers with longer follow-up to evaluate prognostic significance.

  18. Cycloheximide and actinomycin D delay death and affect bcl-2, bax, and Ice gene expression in astrocytes under in vitro ischemia.

    Science.gov (United States)

    Yu, Albert Cheung Hoi; Yung, Hon Wa; Hui, Michael Hung Kit; Lau, Lok Ting; Chen, Xiao Qian; Collins, Richard A

    2003-10-15

    An in vitro ischemia model was established and the effect of the metabolic inhibitors cycloheximide (CHX) and actinomycin D (ActD) on apoptosis in astrocytes under ischemia studied. CHX decreased by 75% the number of cells dying after 6 hr of ischemia compared with control cultures. TdT-mediated dUTP nick end labelling (TUNEL) staining of comparable cultures was reduced by 40%. ActD decreased cell death by 60% compared with controls. The number of TUNEL-positive cells was reduced by 38%. The nuclear shrinkage in TUNEL-positive astrocytes in control cultures did not occur in ActD-treated astrocytes, indicating that nuclear shrinkage and DNA fragmentation during apoptosis are two unrelated processes. Expression of bcl-2 (alpha and beta), bax, and Ice in astrocytes under similar ischemic conditions, as measured by quantitative reverse transcription-polymerase chain reaction, indicated that ischemia down-regulated bcl-2 (alpha and beta) and bax. Ice was initially down-regulated from 0 to 4 hr, before returning to control levels after 8 hr of ischemia. ActD decreased the expression of these genes. CHX reduced the expression of bcl-2 (alpha and beta) but increased bax and Ice expression. It is hypothesized that the balance of proapoptotic (Bad, Bax) and antiapoptotic (Bcl-2, Bcl-Xl) proteins determines apoptosis. The data suggest that the ratio of Bcl-2/Bad in astrocytes following ActD and CHX treatment does not decrease as much in untreated cells during ischemia. Our data indicate that it is the ratio of Bcl-2 family members that plays a critical role in determining ischemia-induced apoptosis. It is also important to note that ischemia-induced apoptosis involves the regulation of RNA and protein synthesis. Copyright 2003 Wiley-Liss, Inc.

  19. Dietary selenomethionine increases exon-specific DNA methylation of the p53 gene in rat liver and colon mucosa.

    Science.gov (United States)

    Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O

    2011-08-01

    The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.

  20. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    Directory of Open Access Journals (Sweden)

    Zanatta Daniela B

    2010-06-01

    Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet

  1. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    International Nuclear Information System (INIS)

    Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E

    2010-01-01

    Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19

  2. A Biomimic Reconstituted High-Density-Lipoprotein-Based Drug and p53 Gene Co-delivery System for Effective Antiangiogenesis Therapy of Bladder Cancer

    Science.gov (United States)

    Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao

    2015-07-01

    A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.

  3. The absence of Ser389 phosphorylation in p53 affects the basal gene expression level of many p53-dependent genes and alters the biphasic response to UV exposure in mouse embryonic fibroblasts

    NARCIS (Netherlands)

    Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J.; Zwart, Edwin; van der Hoeven, Tessa V.; Pennings, Jeroen L. A.; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M.

    2008-01-01

    Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the

  4. p53 and PTEN/MMAC1/TEP1 gene therapy of human prostate PC-3 carcinoma xenograft, using transferrin-facilitated lipofection gene delivery strategy.

    Science.gov (United States)

    Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan

    2002-04-10

    We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.

  5. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

    1994-01-01

    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  6. Cotton Leaf Curl Multan Betasatellite DNA as a Tool to Deliver and Express the Human B-Cell Lymphoma 2 (Bcl-2) Gene in Plants.

    Science.gov (United States)

    Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar

    2016-05-01

    The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.

  7. Estudo do polimorfismo genético no gene p53 (códon 72 em câncer colorretal Role of the genetic polymorphism of p53 (codon 72 gene in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Jacqueline Miranda de Lima

    2006-03-01

    Full Text Available RACIONAL: Polimorfismos genéticos são variações genéticas que podem ocorrer em seqüências codificadoras e não-codificadoras, levando a alterações qualitativas e/ou quantitativas das proteínas em questão. O p53 é o gene mais comumente alterado no câncer humano. O polimorfismo desse gene no códon 72 ocorre por substituição de uma base e tem sido associado a maior risco de câncer. OBJETIVO: Determinar a possível associação entre o polimorfismo no códon 72 (72 arginina/prolina do gene p53 e câncer colorretal. CASUÍSTICA E MÉTODOS: Foram avaliados em 100 pacientes com câncer colorretal e em 100 indivíduos sem câncer, pareados quanto ao sexo idade, o hábito de fumar, o etilismo e no grupo caso o estádio, o grau de diferenciação e a evolução da doença. O genótipo (72 arginina/prolina foi determinado por PCR, utilizando-se primers (seqüências de nucleotídeos específicos. RESULTADOS: O genótipo homozigoto arginina/arginina foi prevalente em 56% no grupo controle e em 58% no grupo caso. Não se observou diferença entre os dois grupos. No estádio IV este genótipo foi mais freqüente quando comparado ao estádio I (80% versus 14%. Não se observou diferença entre as variações do genótipo e fumo, álcool, evolução clínica ou grau de diferenciação. CONCLUSÃO: A prevalência do genótipo arginina/arginina foi a mais freqüente nos dois grupos. Não foi encontrada correlação entre maior risco de câncer e o polimorfismo no códon 72 prolina/arginina do gene p53. Apesar do pequeno número de doentes com câncer em estádio avançado (IV, estes tiveram maior prevalência do genótipo arginina/arginina.BACKGROUND: Polymorphisms are genetic variations that can occur in sequences of codons, leading to defective proteins. p53 is the most commonly gene affected in human cancer. The polymorphism of this gene occurs by a substitution of a base in codon 72 and may increase the risk of cancer. AIM: To investigate the

  8. Formation of diastereomeric benzo[a]pyrene diol epoxide-guanine adducts in p53 gene-derived DNA sequences.

    Science.gov (United States)

    Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia

    2004-06-01

    G --> T transversion mutations in the p53 tumor suppressor gene are characteristic of smoking-related lung tumors, suggesting that these genetic changes may result from exposure to tobacco carcinogens. It has been previously demonstrated that the diol epoxide metabolites of bay region polycyclic aromatic hydrocarbons present in tobacco smoke, e.g., benzo[a]pyrene diol epoxide (BPDE), preferentially bind to the most frequently mutated guanine nucleotides within p53 codons 157, 158, 248, and 273 [Denissenko, M. F., Pao, A., Tang, M., and Pfeifer, G. P. (1996) Science 274, 430-432]. However, the methodology used in that work (ligation-mediated polymerase chain reaction in combination with the UvrABC endonuclease incision assay) cannot establish the chemical structures and stereochemical identities of BPDE-guanine lesions. In the present study, we employ a stable isotope-labeling HPLC-MS/MS approach [Tretyakova, N., Matter, B., Jones, R., and Shallop, A. (2002) Biochemistry 41, 9535-9544] to analyze the formation of diastereomeric N(2)-BPDE-dG lesions within double-stranded oligodeoxynucleotides representing p53 lung cancer mutational hotspots and their surrounding DNA sequences. (15)N-labeled dG was placed at defined positions within DNA duplexes containing 5-methylcytosine at all physiologically methylated sites, followed by (+/-)-anti-BPDE treatment and enzymatic hydrolysis of the adducted DNA to 2'-deoxynucleosides. Capillary HPLC-ESI(+)-MS/MS was used to establish the amounts of (-)-trans-N(2)-BPDE-dG, (+)-cis-N(2)-BPDE-dG, (-)-cis-N(2)-BPDE-dG, and (+)-trans-N(2)-BPDE-dG originating from the (15)N-labeled bases. We found that all four N(2)-BPDE-dG diastereomers were formed preferentially at the methylated CG dinucleotides, including the frequently mutated p53 codons 157, 158, 245, 248, and 273. The contributions of individual diastereomers to the total adducts number at a given site varied between 70.8 and 92.9% for (+)-trans-N(2)-BPDE-dG, 5.6 and 16.7% for

  9. p53 immunostaining is correlated with reduced survival and is not correlated with gene mutations in resected pulmonary large cell carcinomas

    Directory of Open Access Journals (Sweden)

    L.M. Massoni Neto

    2007-08-01

    Full Text Available Malignancy of pulmonary large cell carcinomas (LCC increases from classic LCC through LCC with neuroendocrine morphology (LCCNM to large cell neuroendocrine carcinomas (LCNEC. However, the histological classification has sometimes proved to be difficult. Because the malignancy of LCC is highly dependent on proteins with functions in the cell cycle, DNA repair, and apoptosis, p53 has been targeted as a potentially useful biological marker. p53 mutations in lung cancers have been shown to result in expression and protein expression also occurs in the absence of mutations. To validate the importance of both p53 protein expression (by immunostaining and p53 gene mutations in lung LCC (by PCR-single strand conformational polymorphism analysis of exons 5, 6, 7, and 8 and to study their relationships with clinical factors and sub-classification we investigated the correlation of p53 abnormalities in 15 patients with LCC (5 classic LCC, 5 LCNEC, and 5 LCCNM who had undergone resection with curative intent. Of these patients, 5/15 expressed p53 and none had mutant p53 sequences. There was a negative survival correlation with positive p53 immunostaining (P = 0.05. After adjustment for stage, age, gender, chemotherapy, radiotherapy, and histological subtypes by multivariate analysis, p53 expression had an independent impact on survival. The present study indicates that p53 assessment may provide an objective marker for the prognosis of LCC irrespective of morphological variants and suggests that p53 expression is important for outcome prediction in patients with the early stages of LCC. The results reported here should be considered to be initial results because tumors from only 15 patients were studied: 5 each from LCC, LCNEC and LCCNM. This was due to the rarity of these specific diseases.

  10. Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

    Science.gov (United States)

    Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

    1997-05-01

    To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

  11. Effect of the p53 gene status on the sensitivity of oral squamous cell carcinoma cells to boron neutron capture therapy

    International Nuclear Information System (INIS)

    Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.

    2006-01-01

    The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)

  12. Phorate-induced oxidative stress, DNA damage and transcriptional activation of p53 and caspase genes in male Wistar rats

    International Nuclear Information System (INIS)

    Saquib, Quaiser; Attia, Sabry M.; Siddiqui, Maqsood A.; Aboul-Soud, Mourad A.M.; Al-Khedhairy, Abdulaziz A.; Giesy, John P.; Musarrat, Javed

    2012-01-01

    Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G 2 /M arrest and appearance of a distinctive SubG 1 peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced activities of

  13. Phorate-induced oxidative stress, DNA damage and transcriptional activation of p53 and caspase genes in male Wistar rats

    Energy Technology Data Exchange (ETDEWEB)

    Saquib, Quaiser [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Attia, Sabry M. [Department of Pharmacology, College of Pharmacy, King Saud University, Riyadh (Saudi Arabia); Siddiqui, Maqsood A. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Aboul-Soud, Mourad A.M. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Biochemistry Department, Faculty of Agriculture, Cairo University, 12613 Giza (Egypt); Al-Khedhairy, Abdulaziz A. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Giesy, John P. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Department of Biomedical and Veterinary Biosciences and Toxicology Centre, University of Saskatchewan, Saskatoon, Canada S7N 5B3 (Canada); Zoology Department and Center for Integrative Toxicology, Michigan State University, East Lansing 48824 (United States); Musarrat, Javed, E-mail: musarratj1@yahoo.com [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Department of Microbiology, Faculty of Agricultural Sciences, AMU, Aligarh (India)

    2012-02-15

    Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G{sub 2}/M arrest and appearance of a distinctive SubG{sub 1} peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced

  14. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    Science.gov (United States)

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  15. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    Science.gov (United States)

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  16. Molecular biologic study about the non-small cell lung carcinoma (2) : p53 gene alteration in non-small cell lung carcinoma

    International Nuclear Information System (INIS)

    Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee

    1996-12-01

    The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs

  17. N-myc downstream-regulated gene 1 promotes oxaliplatin-triggered apoptosis in colorectal cancer cells via enhancing the ubiquitination of Bcl-2.

    Science.gov (United States)

    Yang, Xiao; Zhu, Fan; Yu, Chaoran; Lu, Jiaoyang; Zhang, Luyang; Lv, Yanfeng; Sun, Jing; Zheng, Minhua

    2017-07-18

    N-myc downstream-regulated gene1 (NDRG1) has been identified as a potent tumor suppressor gene. The molecular mechanisms of anti-tumor activity of NDRG1 involve its suppressive effects on a variety of tumorigenic signaling pathways. The purpose of this study was to investigate the role of NDRG1 in the apoptosis of colorectal cancer (CRC) cells. We first collected the clinical data of locally advanced rectal cancer (LARC) patients receiving oxaliplatin-based neoadjuvant chemotherapy in our medical center. Correlation analysis revealed that NDRG1 positively associated with the downstaging rates and prognosis of patients. Then, the effects of over-expression and depletion of NDRG1 gene on apoptosis of colorectal cancer were tested in vitro and in vivo. NDRG1 over-expression promoted apoptosis in colorectal cancer cells whereas depletion of NDRG1 resulted in resistance to oxaliplatin treatment. Furthermore, we observed that Bcl-2, a major anti-apoptotic protein, was regulated by NDRG1 at post-transcriptional level. By binding Protein kinase Cα (PKCα), a classical regulating factor of Bcl-2, NDRG1 enhanced the ubiquitination and degradation of Bcl-2, thus promoting apoptosis in CRC cells. In addition, NDRG1 inhibited tumor growth and promoted apoptosis in mouse xenograft model. In conclusion,NDRG1 promotes oxaliplatin-triggered apoptosis in colorectal cancer. Therefore, colorectal cancer patients can be stratified by the expression level of NDRG1. NDRG1-positive patients may benefit from oxaliplatin-containing chemotherapy regimens whereas those with negative NDRG1 expression should avoid the usage of this cytotoxic drug.

  18. Expression levels of the BAK1 and BCL2 genes highlight the role of apoptosis in age-related hearing impairment

    Directory of Open Access Journals (Sweden)

    Falah M

    2016-07-01

    Full Text Available Masoumeh Falah,1,2 Mohammad Najafi,2 Massoud Houshmand,3 Mohammad Farhadi1 1ENT and Head & Neck Research Center and Department, Iran University of Medical Sciences, Tehran, Iran; 2Cellular and Molecular Research Center, Biochemistry Department, Iran University of Medical Sciences, Tehran, Iran; 3Department of Medical Genetics, National Institute for Genetic Engineering and Biotechnology, Tehran, Iran Abstract: Age-related hearing impairment (ARHI is a progressive and a common sensory disorder in the elderly and will become an increasingly important clinical problem given the growing elderly population. Apoptosis of cochlear cells is an important factor in animal models of ARHI. As these cells cannot regenerate, their loss leads to irreversible hearing impairment. Identification of molecular mechanisms can facilitate disease prevention and effective treatment. In this study, we compared the expression of the genes BAK1 and BCL2 as two arms of the intrinsic apoptosis pathway between patients with ARHI and healthy subjects. ARHI and healthy subjects were selected after an ear nose throat examination, otoscopic investigation, and pure tone audiometry. RNA was extracted from peripheral blood samples, and relative gene expression levels were measured using quantitative real-time polymerase chain reaction. BAK1 and the BAK1/BCL2 ratio were statistically significantly upregulated in the ARHI subjects. The BAK1/BCL2 ratio was positively correlated with the results of the audiometric tests. Our results indicate that BAK-mediated apoptosis may be a core mechanism in the progression of ARHI in humans, similar to finding in animal models. Moreover, the gene expression changes in peripheral blood samples could be used as a rapid and simple biomarker for early detection of ARHI. Keywords: age-related hearing impairment (ARHI, presbycusis, biomarker, treatment

  19. Phosphatidylinositol 3-kinase is essential for kit ligand-mediated survival, whereas interleukin-3 and flt3 ligand induce expression of antiapoptotic Bcl-2 family genes

    DEFF Research Database (Denmark)

    Karlsson, Richard; Engström, Maria; Jönsson, Maria

    2003-01-01

    Cytokines such as interleukin 3 (IL-3), kit ligand (KL), and flt3 ligand (FL) promote survival of hematopoietic stem cells and myeloid progenitor cells. In many cell types, members of the Bcl-2 gene family are major regulators of survival, but the mediating mechanisms are not fully understood....... Using two myeloid progenitor cell lines, FDCP-mix and FDC-P1, as well as primary mouse bone marrow progenitors, we demonstrate that KL-mediated survival is dependent on the activation of phosphatidylinositol-3 (PI-3) kinase. The inhibitor LY294002 was able to completely abolish survival mediated by KL...

  20. Evaluation of radiation effects against C6 glioma in combination with vaccinia virus-p53 gene therapy

    Science.gov (United States)

    Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)

    1998-01-01

    The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.

  1. The Effects of Lycopene and Insulin on Histological Changes and the Expression Level of Bcl-2 Family Genes in the Hippocampus of Streptozotocin-Induced Diabetic Rats.

    Science.gov (United States)

    Soleymaninejad, Masoume; Joursaraei, Seyed Gholamali; Feizi, Farideh; Jafari Anarkooli, Iraj

    2017-01-01

    The aim of this study was to evaluate the effects of antioxidants lycopene and insulin on histological changes and expression of Bcl-2 family genes in the hippocampus of streptozotocin-induced type 1 diabetic rats. Forty-eight Wistar rats were divided into six groups of control (C), control treated with lycopene (CL), diabetic (D), diabetic treated with insulin (DI), diabetic treated with lycopene (DL), and diabetic treated with insulin and lycopene (DIL). Diabetes was induced by an injection of streptozotocin (60 mg/kg, IP), lycopene (4 mg/kg/day) was given to the lycopene treated groups as gavages, and insulin (Sc, 1-2 U/kg/day) was injected to the groups treated with insulin. The number of hippocampus neurons undergoing cell death in group D had significant differences with groups C and DIL ( p lycopene alone or together reduced the expression of Bax , but increased Bcl-2 and Bcl-x L levels in DI, DL, and DIL rats, especially when compared to group D ( p lycopene contribute to the prevention of cell death by reducing the expression of proapoptotic genes and increasing the expression of antiapoptotic genes in the hippocampus.

  2. Feasibility of Breast Conservation after Neoadjuvant Chemotherapy in 58 Patients with Locally Advanced Breast Cancer Using p53 and MDRI Genes as Predictors of Response

    International Nuclear Information System (INIS)

    Elsawy, W.H.; Abdel Kader, M.; Abdulla, M.H.

    2002-01-01

    . Mutations were located in exons 4,6,7,8 and 10 of the p53 gene, including two mutations in the intron region affecting the splice sites. The seven non-responders showed p53 mutations while 6/51 responding patients had p53 mutations. Treatment failure was related to the presence of p53 gene mutations (ρ = 0.0(29). Presence of apoptosis was related to a normal p53 status and treatment response (ρ< 0.00(1). In patients responding to FEC, the mean percentage of apoptotic cells was seven. Of 7 patients with treatment failure, 5 had 0% and two patients had J % apoptotic cells. Twelve patients showed the specific band corresponding to the MDR1 mRNA. All patients with no response to neoadjuvant chemotherapy had MDR1 gene expression. MDR1 expression was significantly correlated with resistance to neoadjuvant chemotherapy ((ρ = 0.0026). The remaining five patients with MDR1 expression had (PR) to neoadjuvant chemotherapy and also had p53 mutations. Conclusion: In conclusion, the results of the present study compare favorably with previous studies in patients with locally advanced breast cancer (LABC). Our results suggest that breast conservation was feasible and safe for patients with LABC, with careful selection based on response to chemotherapy. We have demonstrated that p53 plays a distinct drug-specific role in chemoresistance. The response to a combination of FEC was directly related to normal p53 and tumor cell apoptosis in breast cancer patients. These results provide clinical evidence of a p53 dependent cytotoxic effect of these DNA-damaging agents. It seems that resistance to chemotherapy is a multifactorial phenomenon, in which many genes are involved

  3. Deregulated expression of A1, Bcl-2, Bcl-xL, and Mcl-1 antiapoptotic proteins and Bid, Bad, and Bax proapoptotic genes in polycythemia vera patients

    Directory of Open Access Journals (Sweden)

    Elainy Patricia Lino Gasparotto

    2011-12-01

    Full Text Available Apoptosis deregulation might have a role in the pathophysiology of polycythemia vera (PV. This study evaluated Bcl-2 molecule expression in CD34+ cells and leukocytes in 12 PV patients. Gene expression was investigated by real time PCR using SybrGreen Quantitect kit and protein expression was evaluated by western-blotting. JAK2 V617F mutation was detected according to Baxter et al (2005. CD34+ cells from PV patients presented higher levels of A1 and Mcl-1 expression (median: 22.6 and 5.2, respectively in comparison with controls (0.9 and 0.5, p=0.004 and p=0.020; while Bcl-2 and Bcl-xL expression decreased in PV patients (0.18 and 1.19 compared with controls (1.39 and 2.01, p=0.006 and p=0.020. CD34+ cells in PV patients showed an elevated Bid expression (14.4 in comparison with healthy subjects (1.0; p=0.002. Patients' leukocytes showed an A1 augmentation (7.41, p=0.001 and a reduced expression of Bax (0.19; p=0.040 and Bad (0.2; p=0.030. There was no correlation between JAK2 V617F allele burden and molecular expression. PV patients showed alterations in Bcl-2 members' expression, which may interfere with control of apoptotic machinery and contribute to disease pathogenesis.A desregulação da apoptose parece participar da fisiopatologia da policitemia vera (PV. Este estudo avaliou a expressão das moléculas da família Bcl-2 em células hematopoéticas CD34 + e leucócitos de 12 pacientes com PV. Foram realizados: a quantificação da expressão gênica por PCR em tempo real utilizando kit Sybrgreen Quantitect, avaliação da expressão de proteínas por western-blot e detecção da mutação JAK2 V617F segundo Baxter et al. (2005. Células CD34 + dos pacientes com PV apresentaram maior expressão de A1 e Mcl-1 (mediana: 22,6 e 5,2, respectivamente em comparação com controles (0,9 e 0,5, p = 0,004 e p = 0,020 e expressão de Bcl-2 e Bcl-xL diminuída nestes pacientes (0,18 e 1,19 em relação aos controles (1,39 e 2,01, p = 0,006 e p = 0

  4. Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres

    International Nuclear Information System (INIS)

    Ji, Qing; Hao, Xinbao; Meng, Yang; Zhang, Min; DeSano, Jeffrey; Fan, Daiming; Xu, Liang

    2008-01-01

    MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be

  5. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

    2014-12-23

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  6. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.

    2014-01-01

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  7. Benzene activates caspase-4 and -12 at the transcription level, without an association with apoptosis, in mouse bone marrow cells lacking the p53 gene

    Energy Technology Data Exchange (ETDEWEB)

    Yi, Jung-Yeon; Han, Jeong-Hee; Yoon, Byung-Il [Kangwon National University, School of Veterinary Medicine, Chuncheon, Gangwon (Korea); Hirabayashi, Yoko; Kodama, Yukio; Kanno, Jun [National Institute of Health Sciences, Division of Cellular and Molecular Toxicology, Center for Biological Safety and Research, Tokyo (Japan); Choi, Yang-Kyu [Konkuk University, College of Veterinary Medicine, Seoul (Korea); Inoue, Tohru [National Institute of Health Sciences, Biological Safety and Research Center, Tokyo (Japan)

    2009-08-15

    Benzene is a well-known environmental pollutant that can induce hematotoxicity, aplastic anemia, acute myelogenous leukemia, and lymphoma. However, although benzene metabolites are known to induce oxidative stress and disrupt the cell cycle, the mechanism underlying lympho/leukemogenicity is not fully understood. Caspase-4 (alias caspase-11) and -12 are inflammatory caspases implicated in inflammation and endoplasmic reticulum stress-induced apoptosis. The objectives of this study were to investigate the altered expression of caspase-4 and -12 in mouse bone marrow after benzene exposure and to determine whether their alterations are associated with benzene-induced bone marrow toxicity, especially cellular apoptosis. In addition, we evaluated whether the p53 gene is involved in regulating the mechanism, using both wild-type (WT) mice and mice lacking the p53 gene. For this study, 8-week-old C57BL/6 mice [WT and p53 knockout (KO)] were administered a benzene solution (150 mg/kg diluted in corn oil) via oral gavage once daily, 5 days/week, for 1 or 2 weeks. Blood and bone marrow cells were collected and cell counts were measured using a Coulter counter. Total mRNA and protein extracts were prepared from the harvested bone marrow cells. Then qRT-PCR and Western blotting were performed to detect changes in the caspases at the mRNA and protein level, respectively. A DNA fragmentation assay and Annexin-V staining were carried out on the bone marrow cells to detect apoptosis. Results indicated that when compared to the control, leukocyte number and bone marrow cellularity decreased significantly in WT mice. The expression of caspase-4 and -12 mRNA increased significantly after 12 days of benzene treatment in the bone marrow cells of benzene-exposed p53KO mice. However, apoptosis detection assays indicated no evidence of apoptosis in p53KO or WT mice. In addition, no changes of other apoptosis-related caspases, such as caspase-3 and -9, were found in WT or p53KO mice at the

  8. BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

    Directory of Open Access Journals (Sweden)

    Liu Jun

    2004-07-01

    Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.

  9. BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

    International Nuclear Information System (INIS)

    Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei

    2004-01-01

    BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies

  10. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    Science.gov (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei

    1999-01-01

    Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53

  12. Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines.

    Science.gov (United States)

    Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid

    2017-01-01

    The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Radiosensitivity of a epithelial cell model from an embryonic rat lung involving in particular the status of p53 gene

    International Nuclear Information System (INIS)

    Paris, Francois

    1998-01-01

    In this research thesis, the author presents ionizing radiations and their effects on living matter (damages to DNA, cell response to irradiation, proteins activated by radio-induced DNA breaks), the p53 protein (p53 mutation in cancers, structure), and the effect of ionizing radiation on this protein (expression and activation). Then this thesis addresses the study of a set of sister line of epithelial cells obtained from an embryonic rat lung treated with benzo(a)pyrene, a mutagenic agent notably present in cigarette smoke, in hydrocarbon combustion and in atmospheric pollution, and therefore responsible of cancers. This thesis thus reports the development of an experimental model allowing transformed cells to be studied [fr

  14. [Survival of patients with primary central nervous system diffuse large B-cell lymphoma: impact of gene aberrations and protein overexpression of bcl-2 and C-MYC, and selection of chemotherapy regimens].

    Science.gov (United States)

    Yin, W J; Zhu, X; Yang, H Y; Sun, W Y; Wu, M J

    2018-01-08

    Objective: To investigate the impact of clinicopathological features, gene rearrangements and protein expression of bcl-6, bcl-2, C-MYC and chemotherapy regime on the prognosis of patients with primary central nervous system diffuse large B-cell lymphoma (PCNS-DLBCL). Methods: Thirty-three cases of PCNS-DLBCL diagnosed from January 2006 to December 2016 at Zhejiang Cancer Hospital were collected. The expression of CD10, bcl-6, bcl-2, MUM1 and MYC were detected by immunohistochemical staining (IHC). The presence of EB virus was detected by in situ hybridization(EBER). Copy number variation (ICN) and translocation status of bcl-6, bcl-2 and C-MYC genes were detected by fluorescence in situ hybridization (FISH). The relationship between the above indexes and the prognosis was analyzed by univariate, bivariate survival analysis and multiple Cox hazard regression analysis. Results: The study included 33 patients of PCNS-DLBCL, without evidence of primary or secondary immunodeficient disease. Male to female ratio was 1.36∶1.00, and the average age was 56 years. Twenty cases had single lesion while 13 had multiple lesions. Deep brain involvement was seen in 12 cases. All patients underwent partial or total tumor resection. Five patients received whole brain post-surgery radiotherapy, nine patients received high-dose methotrexate (HD-MTX) based chemotherapy, and 12 patients received whole-brain radiotherapy combined with HD-MTX based chemotherapy. Severn patients received no further treatment and rituximab was used in 8 patients. According to the Hans model, 27 cases were classified as non-GCB subtypes (81.8%). Bcl-2 was positive in 25 cases (75.8%, 25/33) and highly expressed in 8 (24.2%). MYC was positive in 12 cases (36.4%) and double expression of bcl-2 and MYC was seen in 6 cases. EBER positive rate was 10.0%(3/30), all of which had multiple lesions. Two bcl-6 gene translocations and 3 amplifications were found in 28 patients. Two translocations, 3 ICN or with both

  15. Genotyping of BRCA1, BRCA2, p53, CDKN2A, MLH1 and MSH2 genes in a male patient with secondary breast cancer

    International Nuclear Information System (INIS)

    Vodusek, Ana Lina; Novakovic, Srdjan; Stegel, Vida; Jereb, Berta

    2011-01-01

    Some tumour suppressor genes (BRCA2) and mismatch repair genes (MSH2, MLH1) are correlated with an increased risk for male breast cancer. Our patient developed secondary breast cancer after the treatment for Hodgkin’s disease in childhood. DNA was isolated from the patients’ blood and screened for mutations, polymorphisms and variants in BRCA1, BRCA2, p53, CDKN2A, MLH1 and MSH2 genes. We found no mutations but common polymorphisms, and three variants in mismatch repair genes. Nucleotide variants c.2006-6T>C and p.G322D in MSH2 might be correlated with male breast cancer

  16. Establishment of a new human pre-B acute lymphoblastic leukemia cell line (KMO-90) with 1;19 translocation carrying p53 gene alterations.

    Science.gov (United States)

    Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T

    1993-10-01

    A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.

  17. Regulation of p53 tetramerization and nuclear export by ARC.

    Science.gov (United States)

    Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

    2007-12-26

    Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

  18. p53, erbB-2 and K-ras gene alterations are rare in spontaneous and plutonium-239-induced canine lung neoplasia

    International Nuclear Information System (INIS)

    Tierney, L.A.; Hahn, F.F.; Lechner, J.F.

    1996-01-01

    Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs

  19. The expanding universe of p53 targets.

    Science.gov (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  20. Tumorigenic potential of pituitary tumor transforming gene (PTTG in vivo investigated using a transgenic mouse model, and effects of cross breeding with p53 (+/− transgenic mice

    Directory of Open Access Journals (Sweden)

    Fong Miranda Y

    2012-11-01

    Full Text Available Abstract Background Pituitary tumor-transforming gene (PTTG is an oncogene that is overexpressed in variety of tumors and exhibits characteristics of a transforming gene. Previous transgenic mouse models to access the tumorigenic potential in the pituitary and ovary have resulted in dysplasia without formation of visible tumors, possibly due to the insufficient expression of PTTG. PTTG expression level is critical for ovarian tumorigenesis in a xenograft model. Therefore, the tumorigenic function of PTTG in vivo remains unclear. We generated a transgenic mouse that overexpresses PTTG driven by the CMV promoter to determine whether PTTG functions as a transforming oncogene that is capable of initiating tumorigenesis. Methods Transgenic animals were generated by microinjection of PTTG transgene into the male pronucleus of FVB 0.5 day old embryos. Expression levels of PTTG in tissues of transgenic animals were analyzed using an immunohistochemical analysis. H&E staining and immunohistostaining were performed to examine the type of tumor in transgenic and PTTG transgenic/p53+/- animals. Results PTTG transgenic offspring (TgPTTG were monitored for tumor development at various ages. H&E analysis was performed to identify the presence of cancer and hyperplastic conditions verified with the proliferation marker PCNA and the microvessel marker CD31. Immunohistochemistry was performed to determine transgene expression, revealing localization to the epithelium of the fallopian tube, with more generalized expression in the liver, lung, kidney, and spleen. At eight months of age, 2 out of 15 TgPTTG developed ovarian cancer, 2 out of 15 developed benign tumors, 2 out of 15 developed cervical dysplasia, and 3 out of 15 developed adenomyosis of the uterus. At ten months of age, 2 out of 10 TgPTTG developed adenocarcinoma of the ovary, 1 out of 10 developed a papillary serous adenocarcinoma, and 2 out of 10 presented with atypia of ovarian epithelial cells

  1. Drosophila larvae lacking the bcl-2 gene, buffy, are sensitive to nutrient stress, maintain increased basal target of rapamycin (Tor signaling and exhibit characteristics of altered basal energy metabolism

    Directory of Open Access Journals (Sweden)

    Monserrate Jessica P

    2012-07-01

    Full Text Available Abstract Background B cell lymphoma 2 (Bcl-2 proteins are the central regulators of apoptosis. The two bcl-2 genes in Drosophila modulate the response to stress-induced cell death, but not developmental cell death. Because null mutants are viable, Drosophila provides an optimum model system to investigate alternate functions of Bcl-2 proteins. In this report, we explore the role of one bcl-2 gene in nutrient stress responses. Results We report that starvation of Drosophila larvae lacking the bcl-2 gene, buffy, decreases survival rate by more than twofold relative to wild-type larvae. The buffy null mutant reacted to starvation with the expected responses such as inhibition of target of rapamycin (Tor signaling, autophagy initiation and mobilization of stored lipids. However, the autophagic response to starvation initiated faster in larvae lacking buffy and was inhibited by ectopic buffy. We demonstrate that unusually high basal Tor signaling, indicated by more phosphorylated S6K, was detected in the buffy mutant and that removal of a genomic copy of S6K, but not inactivation of Tor by rapamycin, reverted the precocious autophagy phenotype. Instead, Tor inactivation also required loss of a positive nutrient signal to trigger autophagy and loss of both was sufficient to activate autophagy in the buffy mutant even in the presence of enforced phosphoinositide 3-kinase (PI3K signaling. Prior to starvation, the fed buffy mutant stored less lipid and glycogen, had high lactate levels and maintained a reduced pool of cellular ATP. These observations, together with the inability of buffy mutant larvae to adapt to nutrient restriction, indicate altered energy metabolism in the absence of buffy. Conclusions All animals in their natural habitats are faced with periods of reduced nutrient availability. This study demonstrates that buffy is required for adaptation to both starvation and nutrient restriction. Thus, Buffy is a Bcl-2 protein that plays an

  2. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    Science.gov (United States)

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  3. Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

    International Nuclear Information System (INIS)

    Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

    2001-01-01

    Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

  4. Caracterização patológica e gênica (gene P53) dos tumores mamários em cadelas.

    OpenAIRE

    Daniela Maria Bastos de Souza

    2006-01-01

    Os tumores mamários em cadelas tem alta incidência e malignidade sendo provocados por vários fatores de risco incluindo idade, atividade hormonal, nutrição, vírus, pseudogestação e administração de progestágenos exógenos. O gene p53, conhecido como um gene supressor de tumor, tem apresentado mutações relacionadas com neoplasias. Neste trabalho, o objetivo foi caracterizar os tumores mamários em cadelas, avaliar o comprometimento da mama lateral ao tumor e o envolvimento de fatores de risco...

  5. BCL2 genotypes and prostate cancer survival

    Energy Technology Data Exchange (ETDEWEB)

    Renner, Wilfried [Medical University of Graz, Clinical Institute of Medical and Chemical Laboratory Diagnostics, Graz (Austria); Langsenlehner, Uwe [GKK Outpatient Department, Division of Internal Medicine, Graz (Austria); Krenn-Pilko, Sabine; Langsenlehner, Tanja [Medical University of Graz, Department of Therapeutic Radiology and Oncology, Graz (Austria); Eder, Petra [University Hospital Wuerzburg, Department of Internal Medicine I, Wuerzburg (Germany)

    2017-06-15

    The antiapoptotic B-cell lymphoma 2 (BCL2) gene is a key player in cancer development and progression. A functional single-nucleotide polymorphism (c.-938C>A, rs2279115) in the inhibitory P2 BCL2 gene promoter has been associated with clinical outcomes in various types of cancer. Aim of the present study was to analyze the role of BCL2-938C>A genotypes in prostate cancer mortality. The association between BCL2-938C>A (rs2279115) genotypes and prostate cancer outcome was studied within the prospective PROCAGENE study comprising 702 prostate cancer patients. During a median follow-up time of 92 months, 120 (17.1%) patients died. A univariate Cox regression model showed a significant association of the CC genotype with reduced cancer-specific survival (CSS; hazard ratio, HR, 2.13, 95% confidence interval, CI, 1.10-4.12; p = 0.024) and overall survival (OS; HR 2.34, 95% CI 1.58-3.47; p < 0.001). In a multivariate Cox regression model including age at diagnosis, risk group, and androgen deprivation therapy, the CC genotype remained a significant predictor of poor CSS (HR 2.05, 95% CI 1.05-3.99; p = 0.034) and OS (HR 2.25, 95% CI 1.51-3.36; p < 0.001). This study provides evidence that the homozygous BCL2-938 CC genotype is associated with OS and C in prostate cancer patients. (orig.) [German] Das antiapoptotische Gen B cell lymphoma 2 (BCL2) spielt eine Schluesselrolle in der Entstehung und Progression von Krebserkrankungen. Ein funktioneller Einzelnukleotid-Polymorphismus (c.-938C>A, rs2279115) im inhibitorischen P2-BCL2-Promotor wurde mit dem klinischen Outcome verschiedener Krebserkrankungen verknuepft. Ziel der vorliegenden Studie war die Untersuchung der Rolle von BCL2-938C>A-Genotypen fuer die Mortalitaet bei Patienten mit Prostatakarzinom. Der Zusammenhang zwischen BCL2-938C>A-Genotypen (rs2279115) und dem Outcome bei Prostatakrebs wurde in der prospektiven PROCAGENE-Studie, die 702 Patienten mit Prostatakarzinom umfasste, untersucht. Waehrend der medianen

  6. p53 in differentiation of thyroid cancer

    International Nuclear Information System (INIS)

    Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

    1993-01-01

    P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

  7. miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention.

    Science.gov (United States)

    Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K

    2011-04-04

    New levels of gene regulation with microRNA (miR) and gene copy number alterations (CNAs) have been identified as playing a role in various cancers. We have previously reported that sporadic breast cancer tissues exhibit significant alteration in H2AX gene copy number. However, how CNA affects gene expression and what is the role of miR, miR-24-2, known to regulate H2AX expression, in the background of the change in copy number, are not known. Further, many miRs, including miR-24-2, are implicated as playing a role in cell proliferation and apoptosis, but their specific target genes and the pathways contributing to them remain unexplored. Changes in gene copy number and mRNA/miR expression were estimated using real-time polymerase chain reaction assays in two mammalian cell lines, MCF-7 and HeLa, and in a set of sporadic breast cancer tissues. In silico analysis was performed to find the putative target for miR-24-2. MCF-7 cells were transfected with precursor miR-24-2 oligonucleotides, and the gene expression levels of BRCA1, BRCA2, ATM, MDM2, TP53, CHEK2, CYT-C, BCL-2, H2AFX and P21 were examined using TaqMan gene expression assays. Apoptosis was measured by flow cytometric detection using annexin V dye. A luciferase assay was performed to confirm BCL-2 as a valid cellular target of miR-24-2. It was observed that H2AX gene expression was negatively correlated with miR-24-2 expression and not in accordance with the gene copy number status, both in cell lines and in sporadic breast tumor tissues. Further, the cells overexpressing miR-24-2 were observed to be hypersensitive to DNA damaging drugs, undergoing apoptotic cell death, suggesting the potentiating effect of mir-24-2-mediated apoptotic induction in human cancer cell lines treated with anticancer drugs. BCL-2 was identified as a novel cellular target of miR-24-2. mir-24-2 is capable of inducing apoptosis by modulating different apoptotic pathways and targeting BCL-2, an antiapoptotic gene. The study suggests

  8. Lycopene modulates cholinergic dysfunction, Bcl-2/Bax balance, and antioxidant enzymes gene transcripts in monosodium glutamate (E621) induced neurotoxicity in a rat model.

    Science.gov (United States)

    Sadek, Kadry; Abouzed, Tarek; Nasr, Sherif

    2016-04-01

    The effect of monosodium glutamate (MSG) on brain tissue and the relative ability of lycopene to avert these neurotoxic effects were investigated. Thirty-two male Wistar rats were distributed into 4 groups: group I, untreated (placebo); group II, injected with MSG (5 mg·kg(-1)) s.c.; group III, gastrogavaged with lycopene (10 mg·kg(-1)) p.o.; and group IV received MSG with lycopene with the same mentioned doses for 30 days. The results showed that MSG induced elevation in lipid peroxidation marker and perturbation in the antioxidant homeostasis and increased the levels of brain and serum cholinesterase (ChE), total creatine phosphokinase (CPK), creatine phosphokinase isoenzymes BB (CPK-BB), and lactate dehydrogenase (LDH). Glutathione S-transferase (GST), superoxide dismutase (SOD), and catalase (CAT) activities and gene expression were increased and glutathione content was reduced in the MSG-challenged rats, and these effects were ameliorated by lycopene. Furthermore, MSG induced apoptosis in brain tissues reflected in upregulation of pro-apoptotic Bax while lycopene upregulated the anti-apoptotic Bcl-2. Our results indicate that lycopene appears to be highly effective in relieving the toxic effects of MSG by inhibiting lipid peroxidation and inducing modifications in the activity of cholinesterase and antioxidant pathways. Interestingly, lycopene protects brain tissue by inhibiting apoptosis signaling induced by MSG.

  9. CC genotype of anti-apoptotic gene BCL-2 (-938 C/A) is an independent prognostic marker of unfavorable clinical outcome in patients with non-small-cell lung cancer.

    Science.gov (United States)

    Javid, J; Mir, R; Mirza, M; Imtiyaz, A; Prasant, Y; Mariyam, Z; Julka, P K; Mohan, A; Lone, M; Ray, P C; Saxena, A

    2015-04-01

    B cell lymphoma 2 (BCL-2) gene is a well-known regulator of apoptosis and a key element in cancer development and progression. A regulatory (-938C>A, rs2279115) single-nucleotide polymorphism in the inhibitory P2 BCL-2 gene promoter generates significantly different BCL-2 promoter activities and has been associated with different clinical outcomes in various malignancies. The aim of the present study was to analyze the possible influence of the (-938C>A) SNP on the risk and survival of Indian patients suffering from NSCLC. A hospital-based case-control study of 155 age- and sex-matched patients diagnosed with NSCLC and 155 cancer-free controls was conducted and genotyped by performing PIRA-PCR to elucidate the putative association between clinical outcome and genotypes of BCL-2 (-938C>A, rs2279115). The association of the polymorphism with the survival of NSCLC patients was analyzed by Kaplan-Meier curves. In Indian NSCLC, patients increased risk of developing NSCLC was found to be associated with BCL-2 (-938) CC genotype, [OR 3.68 (1.92-6.79), RR 1.87 (1.35-2.57) and RD 31.03 (16.79-45.27) p 0.00006 for CC and OR 2.08 (1.18-3.66), RR 1.36 (1.08-1.71) and RD 17.74 (4.68-30.81) p 0.01 for AC genotype]. Patients homozygous for C allele exhibited a significant poor overall survival compared with patients displaying AC + CC or AC or AA genotype [median survival (months) 8 vs. 11 vs. 14 vs. 35.5 (p A) polymorphism. Genetic polymorphism in the inhibitory P2 promoter region of anti-apoptotic BCL-2 genes contributes to the risk of developing non-small-cell lung cancer in Indian population. BCL-2 (-938CC) genotype was an independent adverse prognostic factor for patients with NSCLC.

  10. Silver Nanoparticles Biosynthesized Using Achillea biebersteinii Flower Extract: Apoptosis Induction in MCF-7 Cells via Caspase Activation and Regulation of Bax and Bcl-2 Gene Expression

    Directory of Open Access Journals (Sweden)

    Javad Baharara

    2015-02-01

    Full Text Available Silver nanoparticles (Ag-NPs, the most popular nanoparticles, possess unique properties. Achillea biebersteinii is a plant of the Asteraceae family rich in active antitumor components. The aim of this research was the characterization and investigation of the cytotoxic properties of Ag-NPs synthesized using A. biebersteinii flower extract, on a human breast cancer cell line. The Ag-NPs were synthesized after approximately 180 min of reaction at 40 °C, then they were characterized by UV-visible spectroscopy, Fourier transform infrared spectroscopy (FTIR, transmission electron microscopy (TEM and dynamic light scattering (DLS. The anti-apoptosis effect of Ag-NPs on the MCF-7 cell line was investigated by MTT assay, DAPI and acridine orange staining and caspase activity. The transcriptional expression of bax, bcl-2, caspase-3, -8 and -9 were also evaluated by RT-PCR. The TEM images revealed that the Ag-NPs morphology had a different shape. The DLS indicated that the average hydrodynamic diameter of the biosynthesized Ag-NPs was around 12 nm. By UV-visible spectroscopy the strongest absorbance peak was observed at 460 nm. The FTIR results also showed interaction between the plant extract and Ag-NPs due to the similarity in the peak patterns. The EDS results showed that Ag-NPs display an absorption peak at 3 keV, indicating the presence of the element silver. The Ag-NPs caused a dose-dependent decrease in cell viability, fragmentation in nucleic acid, inhibited the proliferation and induction of apoptosis on MCF-7 by suppressing specific cell cycle genes, and simulation programmed cell dead genes. Further investigation is required to establish the potential of this novel and promising approach in cancer therapy.

  11. Apoptosis, proliferation and p53, cyclin D1, and retinoblastoma gene expression in relation to radiation response in transitional cell carcinoma of the bladder

    International Nuclear Information System (INIS)

    Moonen, Luc; Ong, Francisca; Gallee, Maarten; Verheij, Marcel; Horenblas, Simon; Hart, Augustinus A.M.; Bartelink, Harry

    2001-01-01

    Purpose: To determine whether the apoptotic index, the Ki67 index, and the expression of the p53, cyclin D1, and retinoblastoma genes correlate with local control, overall survival, and time to distant metastases in invasive bladder cancer treated with external beam radiation. Methods and Materials: Paraffin-embedded pretreatment biopsies from 83 patients with invasive transitional cell carcinoma of the bladder were scored morphologically for apoptosis and immunohistochemically for Ki67, p53, cyclin D1, and retinoblastoma gene expression. Survival analysis methods were used to assess overall survival, local control, and freedom from distant metastases. A multiple proportional hazard (PH) regression analysis was performed to study the prognostic value of the above mentioned biologic parameters (all divided into two categories, except Ki67) in addition to classical prognostic factors such as T stage, histologic grade, multifocality of the tumor, and completeness of transurethral resection. All patients were treated with external beam radiation as sole treatment. Median follow-up for the 19 patients still living was 7.5 years. Results: Apoptotic index varied from 0% to 3.4% with a mean of 0.8% and a median of 0.6%. Ki67 index varied from 0% to 60% with a mean of 14% and a median of 12%. P53 protein was detectable in 61% of the tumors. Overexpression of cyclin D1 was observed in 39% of the tumors and loss of retinoblastoma protein in 23% of the tumors. High Ki67 index was found to be significantly associated with p53 expression (p=0.04) and cyclin D1 overexpression (p=0.023). Cyclin D1 overexpression was found more often in Rb-positive tumors than in Rb-negative tumors (p=0.006). Other associations between the markers are less clear. Biologic markers were not correlated with T stage or grade. In the PH analysis local control was found to be significantly better for tumors with wild-type p53 (p=0.028). Also, tumors with an apoptotic index above the median value (0

  12. 4-Aminobiphenyl (4-ABP) - DNA Damage in Breast Tissue and Relationship to p53 Mutations and Polymorphisms of Metabolizing Genes

    National Research Council Canada - National Science Library

    Niguidula, Nancy

    2000-01-01

    .... The analysis of the CYP1A2 gene is currently in progress. Due to the difficulty in obtaining large fragments of DNA from the tumor tissue sections required for PCR-RFLP, a new method is under development for genotyping NAT2...

  13. Alterations of tumor suppressor genes (Rb, p16, p27 and p53) and an increased FDG uptake in lung cancer

    International Nuclear Information System (INIS)

    Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo

    2003-01-01

    The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)

  14. Studies on hematopoietic cell apoptosis and the relative gene expression in irradiated mouse bone marrow

    International Nuclear Information System (INIS)

    Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Yang Hong; Cui Yufang; Wang Baozhen

    2001-01-01

    Objective: To study apoptosis and expressions bcl-2 and p53 in irradiated mouse bone marrow. Methods: LACA mice were irradiated with 60 Co γ-rays. By means of in situ terminal labelling, in situ hybridization and image analysis, the authors studied radiation-induced apoptosis of hematopoietic cells and the expressions of bcl-2 and p53. Results: The characteristics of apoptosis appeared in hematopoietic cells at 6 hrs after irradiation. The expression of bcl-2 was obviously decreased when apoptosis of hematopoietic cells occurred, whereas it increased in the early recovery phase; p53 protein increased during both apoptosis of hematopoietic cells and the recovery phase, and mutant type p53 DNA was positive only in the recovery phase. Conclusion: Radiation may induced apoptosis of hematopoietic cells in a dose-dependent manner; Both bcl-2 and p53 genes play an important role in apoptosis and recovery phase

  15. Light induced apoptosis is accelerated in transgenic retina overexpressing human EAT/mcl-1, an anti-apoptotic bcl-2 related gene.

    Science.gov (United States)

    Shinoda, K; Nakamura, Y; Matsushita, K; Shimoda, K; Okita, H; Fukuma, M; Yamada, T; Ohde, H; Oguchi, Y; Hata, J; Umezawa, A

    2001-10-01

    EAT/mcl-1 (EAT), an immediate early gene, functions in a similar way to bcl-2 in neutralising Bax mediated cytotoxicity, suggesting that EAT is a blocker of cell death. The aim of this study was to determine the effect of overexpression of the human EAT gene on light induced retinal cell apoptosis. EAT transgenic mice incorporating the EF-1alpha promoter were utilised, and expression of human EAT was detected by RT-PCR. Light damage was induced by raising mice under constant illumination. Two groups of animals, EAT transgenic mice (n=14) and littermates (n=13), were examined by ERG testing and histopathology at regular time points up to 20 weeks of constant light stimulation. Electrophysiological and histopathological findings were evaluated by established systems of arbitrary scoring as scores 0-2 and scores 0-3, respectively. The mean score (SD) of ERG response was significantly lower in EAT transgenic mice (0.79 (0.89)) than in littermates (1.69 (0.48)) (pstatistical significance (p=0.1156), the estimated incidence of electrophysiological retinal damage was higher in EAT mice (0.0495/mouse/week; 95% confidence interval (CI) 0.0347-0.0500) than in littermates (0. 0199/mouse/week; 95% CI 0.0035-0.0364). The mean scores (SD) for histopathological retinal degeneration were 2.31 (0.63) in littermates and 1.43 (1.22) in EAT transgenic mice (p=0.065). However, Kaplan-Meier curves for histopathological failure in two groups of mice showed that retinal photoreceptor cells were preserved significantly against constant light in the littermate compared with transgenic mice (p=0.0241). The estimated incidence of histopathological retinal damage was 0.0042/mouse/week in the littermates (95% CI 0-0.0120) and 0.0419/mouse/week in the EAT mice (95% CI 0.0286-0.0500). Retinal photoreceptor cell apoptosis under constant light stimulation is likely to be accelerated in transgenic retina overexpressing EAT.

  16. Investigation of the prognostic value of the apoptotic marker p53 gene and vascular endothelial growth factor in evaluating the clinical course of nasopharyngeal angiofibroma

    Directory of Open Access Journals (Sweden)

    O. B. Abdurakhmanov

    2015-01-01

    Full Text Available Objective. To investigate the prognostic value of the apoptotic markers (p53 and vascular endothelial growth factor (VEGF in evaluating the clinical course of juvenile nasopharyngeal angiofibroma (JNA.Subjects and methods. The investigation enrolled 43 patients with primary JNA (a study group and 20 with its relapses (a control group. The expression of VEGF and mutant p53 (mtp53 gene was immunohistochemically determined using DAKO kits (Denmark. The results of reactions with antibodies to VEGF-A and mtp53 located in the nuclei and membranes were expressed as percentages in terms of stained cell counts per 100 cells examined in different visual fields.Results. An associative analysis showed that both study and control group patients with high mtp53 gene expression in the tumor cells had clinical stages IIIA–B and IV and those in whom the expression of this gene in the tumor cells was weak or absent were found to have clinical stages I and II. The high (3+ and moderate (2+ mtp53 gene expressions suggest that the disease is severe. Consequently, this is of prognostic value and a poor predictor and the absence of mutations or the decreased expression of this gene is associated with a favorable disease outcome.Our investigations indicated that the high expression of the VEGF gene was detected in none of the tumor specimens. In the study group, the tumor cell expression of this gene was found to be moderate (2+ in 18 (41.9 % patients, weak in 6 (13.9 % and absent in 19 (44.2 % of the 43 patients. In the control group, the absence of VEGF gene expression in the tumor specimens was 9 times lower than that in the study group.A comparison with the clinical characteristics of the patients demonstrated that in both the study and control groups, the VEGF expression was observed to be moderate, or weak and absent in those with clinical stages IIIA–B and IV or in those with stage II and I, respectively.Conclusion. The associative analysis showed that both

  17. Specific UV-induced mutation spectrum in the p53 gene of skin tumors from DNA-repair-deficient xeroderma pigmentosum patients

    International Nuclear Information System (INIS)

    Dumaz, N.; Drougard, C.; Sarasin, A.; Daya-Grosjean, L.

    1993-01-01

    The UV component of sunlight is the major carcinogen involved in the etiology of skin cancers. The authors have studied the rare, hereditary syndrome xeroderma pigmentosum (XP), which is characterized by a very high incidence of cutaneous tumors on exposed skin at an early age, probably due to a deficiency in excision repair of UV-induced lesions. It is interesting to determine the UV mutation spectrum in XP skin tumors in order to correlate the absence of repair of specific DNA lesions and the initiation of skin tumors. The p53 gene is frequently mutated in human cancers and represents a good target for studying mutation spectra since there are >100 potential sites for phenotypic mutations. Using reverse transcription-PCR and single-strand conformation polymorphism to analyze >40 XP skin tumors (mainly basal and squamous cell carcinomas), the authors have found that 40% (17 out of 43) contained at least one point mutation on the p53 gene. All the mutations were located at dipyrimidine sites, essentially at CC sequences, which are hot spots for UV-induced DNA lesions. Sixty-one percent of these mutations were tandem CC → TT mutations considered to be unique to UV-induced lesions; these mutations are not observed in internal human tumors. All the mutations, except two, must be due to translesion synthesis of unrepaired dipyrimidine lesions left on the nontranscribed strand. These results show the existence of preferential repair of UV lesions [either pyrimidine dimers or pyrimidine-pyrimidone (6-4) photoproducts] on the transcribed strand in human tissues

  18. Apoptosis and the BCL-2 gene family - patterns of expression and prognostic value in STAGE I and II follicular center lymphoma

    International Nuclear Information System (INIS)

    Logsdon, Mark D.; Meyn, Raymond E.; Besa, Pelayo C.; Pugh, William C.; Stephens, L. Clifton; Peters, Lester J.; Milas, Luka; Cox, James D.; Cabanillas, Fernando; Brisbay, Shawn; Andersen, Margret; McDonnell, Timothy J.

    1999-01-01

    Purpose: The prognostic significance of spontaneous levels of apoptosis and Bcl-2, Bax, and Bcl-x protein expression in follicular center lymphoma (FCL) is unknown. The objectives of this retrospective study were (1) to investigate the relationship between pretreatment apoptosis levels and long-term treatment outcome in patients with Stage I and II FCL; (2) to define the incidence and patterns of Bax and Bcl-x protein expression in human FC; and (3) to determine the relationship of Bcl-2, Bax, and Bcl-x expression with spontaneous apoptosis levels and clinical outcome in localized FCL. Methods and Materials: Between 1974 and 1988, 144 patients with Stage I or II FCL were treated. Hematoxylin and eosin (H and E) stained tissue sections of pretreatment specimens were retrieved for 96 patients. Treatment consisted of regional radiation therapy (XRT) for 25 patients, combined modality therapy (CMT) consisting of combination chemotherapy and XRT for 57 patients, and other treatments for 14 patients. Median follow-up for living patients was nearly 12 years. The apoptotic index (AI) was calculated by dividing the number of apoptotic cells by the total number of cells counted and multiplying by 100. Expression of Bcl-2, Bax, and Bcl-x proteins was assessed using immunohistochemistry. Results: The mean and median AI values for the entire group were 0.53 and 0.4, respectively (range: 0-5.2). The AI strongly correlated with cytologic grade, with mean AI values of 0.25 for grade 1, 0.56 for grade 2, and 0.84 for grade 3 (p < 0.0005; Kendall correlation). A positive correlation was present between grouped AI and grouped mitotic index (MI) (p = 0.014). For patients treated with CMT, an AI < 0.4 correlated with improved freedom from relapse (FFR) (p = 0.0145) and overall survival (OS) (p = 0.0081). An AI < 0.4 did not correlate with clinical outcome for the entire cohort or for patients receiving XRT only. Staining of tumor follicles for the Bcl-2 protein was positive, variable

  19. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric

    2007-09-01

    Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

  20. Hormonal control of p53 and chemoprevention

    International Nuclear Information System (INIS)

    Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C

    2002-01-01

    Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer

  1. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    Science.gov (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  2. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-12-01

    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  3. ER, p53 and MIB-1 are significantly associated with malignant phyllodes tumor

    Directory of Open Access Journals (Sweden)

    Nurhayati H Munawer

    2012-12-01

    Full Text Available Background: Phyllodes tumors (PT are rare. We evaluated the expression status of ER, Bcl2, p53, and MIB-1 protein in these tumors. Methods: One hundred and ninety-three tumors were examined using immunohistochemistry on tissue microarray. Results: ERβ (p <0.001, and p53 (p=0.006 in the stromal component were associated with tumor size. p53 expression was significantly associated with both epithelial and stro­mal components of malignant PTs (p<0.05. In PT, the decreased expressions of p53 and MIB-1 were significantly different with positive Bcl2 protein expression in epi­thelial component (p=0.000. Besides, MIB-1 was also found to be associated with ERα and ERβ in stromal component (p=0.000. Conclusion: The expression of p53 with tumor size and histological grade in PTs may increase risk for malignancy.

  4. Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

    Science.gov (United States)

    Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

    2018-03-09

    The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Bcl-2 Protein Expression in Egyptian Acute Myeloid Leukemia

    International Nuclear Information System (INIS)

    El-Shakankiry, N.; El-Sayed, Gh.M.M.; El-Maghraby, Sh.; Moneer, M.M.

    2009-01-01

    Objective: The primary cause of treatment failure in acute myeloid leukemia (AML) is the emergence of both resistant disease and early relapse. The bcl-2 gene encodes a 26-kDa protein that promotes cell survival by blocking programmed cell death (apoptosis). In the present study, bcl-2 protein expression was evaluated in newly diagnosed AML patients and correlated with the induction of remission and overall survival (OS), in an attempt to define patients who might benefit from modified therapeutic strategies. Patients and methods: Pretreatment cellular bcl-2 protein expression was measured in bone marrow samples obtained from 68 patients of newly diagnosed acute myeloid leukemia and 10 healthy controls by western blotting. Results: The mean bcl-2 protein expression was significantly higher in patients (0.68610.592) compared to controls (0.313±0.016) (p=0.002). The overall survival for patients with mean bcl-2 expression of less, and more than or equal to 0.315, was 67% and 56%, respectively, with no significant difference between the two groups 0»=0.86). Conclusion: Even though we did not observe a significant difference in overall survival between patients with high and low levels of bcl-2, modulation of this protein might still be considered as an option for enhancing the effectiveness of conventional chemotherapy.

  6. Estrogen receptor positive breast tumors resist chemotherapy by the overexpression of P53 in Cancer Stem Cells

    Directory of Open Access Journals (Sweden)

    Fatma Ashour

    2018-06-01

    Full Text Available Background and Objectives: Breast cancer (BC is classified according to estrogen receptor (ER status into ER+ and ER− tumors. ER+ tumors have a worse response to chemotherapy compared to ER− tumors. BCL-2, TP53, BAX and NF-ΚB are involved in drug resistance in the ER+ tumors. Recently it was shown that Cancer Stem Cells (CSCs play an important role in drug resistance. In this study we tested the hypothesis that CSCs of the ER+ tumors resist drug through the overexpression of BCL-2, TP53, BAX and NF-ΚB. Methods: CSCs were isolated by anoikis resistance assay from MCF7 (ER+ and MDA-MB-231 (ER− cell lines. Isolated CSCs were treated with doxorubicin (DOX and the mRNA expression levels of BCL-2, TP53, BAX and NFKB were investigated by quantitative real time PCR (qPCR with and without treatment. Results: BCL-2, BAX and NF-ΚB showed decreased expression in MCF7 bulk cancer cells after DOX treatment whereas only BCL-2 and BAX showed decreased expression in MDA-MB-231 bulk cancer cells. Interestingly TP53 was the only gene showed a considerable increase in its expression in CSCs of the ER+ MCF7 cell line compared to bulk cancer cells. Moreover, TP53 was the only gene showing exceptionally higher level of expression in MCF7-CSCs compared to MDA-MB-231-CSCs. Conclusion: Our results suggest that CSCs in the ER+ cells escape the effect of DOX treatment by the elevation of p53 expression. Keywords: Breast cancer, Cancer Stem Cells, Drug resistance, Estrogen receptors

  7. Characterization and Molecular Mechanism of Peptide-Conjugated Gold Nanoparticle Inhibiting p53-HDM2 Interaction in Retinoblastoma

    Directory of Open Access Journals (Sweden)

    Sushma Kalmodia

    2017-12-01

    Full Text Available Inhibition of the interaction between p53 and HDM2 is an effective therapeutic strategy in cancers that harbor a wild-type p53 protein such as retinoblastoma (RB. Nanoparticle-based delivery of therapeutic molecules has been shown to be advantageous in localized delivery, including to the eye, by overcoming ocular barriers. In this study, we utilized biocompatible gold nanoparticles (GNPs to deliver anti-HDM2 peptide to RB cells. Characterization studies suggested that GNP-HDM2 was stable in biologically relevant solvents and had optimal cellular internalization capability, the primary requirement of any therapeutic molecule. GNP-HDM2 treatment in RB cells in vitro suggested that they function by arresting RB cells at the G2M phase of the cell cycle and initiating apoptosis. Analysis of molecular changes in GNP-HDM2-treated cells by qRT-PCR and western blotting revealed that the p53 protein was upregulated; however, transactivation of its downstream targets was minimal, except for the PUMA-BCl2 and Bax axis. Global gene expression and in silico bioinformatic analysis of GNP-HDM2-treated cells suggested that upregulation of p53 might presumptively mediate apoptosis through the induction of p53-inducible miRNAs.

  8. Transcriptional regulation of the p73 gene, a member of the p53 family, by early growth response-1 (Egr-1)

    International Nuclear Information System (INIS)

    Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong

    2007-01-01

    To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression

  9. Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

    Directory of Open Access Journals (Sweden)

    Katarzyna Taran

    2016-02-01

    Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

  10. The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

    Science.gov (United States)

    Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

    2018-06-01

    The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

  11. Effects of 2,2',4,4'-tetrabromodiphenyl ether on neurobehavior and memory change and bcl-2, c-fos, grin1b and lingo1b gene expression in male zebrafish (Danio rerio).

    Science.gov (United States)

    Zheng, Shukai; Liu, Caixia; Huang, Yanhong; Bao, Mian; Huang, Yuanni; Wu, Kusheng

    2017-10-15

    Polybrominated diphenyl ethers (PBDEs) are persistent organic pollutants in various environmental matrices and organisms and pose a threat to neural systems of organisms. However, though quite a few studies have explored the effect of PBDEs on neural behaviors such as learning and memory abilities in animals, their mechanisms are less known. We used the zebrafish model to evaluate neurotoxicity of PBDEs and observe changes in behavior and related gene expression. In behavioral testing, 50 zebrafish were divided into five groups treated with different concentrations of BDE-47. T-maze exploration was used for learning and memory testing, which was recorded by camera every 7days. After 21days, all fish were killed, and the gene expression of c-fos, bcl-2, lingo1b and grin1b in brain tissue was analyzed by RT-qPCR. The behavioral changes (latency to leave the start zone, reach the reward zone, and stay in the reward zone; accuracy in choosing the right maze arm, accumulation of freezing bouts, etc.) were related to BDE-47 concentration and had a time-effect relation with increasing exposure days, especially with 500μg/L BDE-47. BDE-47 elevated brain bcl-2, grin1b and lingo1b expression. The expression of c-fos showed an increase with 50 and 100μg/L BDE-47 exposure. The PBDE BDE-47 had a negative impact on the neurobehaviors of zebrafish and affected the expression of c-fos, bcl-2, lingo1b and grin1b in zebrafish brain tissue. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. The presence of carbon nanostructures in bakery products induces metabolic stress in human mesenchymal stem cells through CYP1A and p53 gene expression.

    Science.gov (United States)

    Al-Hadi, Ahmed M; Periasamy, Vaiyapuri Subbarayan; Athinarayanan, Jegan; Alshatwi, Ali A

    2016-01-01

    Ingredients commonly present in processed foods are excellent substrates for chemical reactions during modern thermal cooking or processing, which could possibly result in deteriorative carbonization changes mediated by a variety of thermal reactions. Spontaneous self-assembling complexation or polymerization of partially combusted lipids, proteins, and other food macromolecules with synthetic food additives during high temperature food processing or baking (200-250 °C) would result in the formation of carbon nanostructures (CNs). These unknown nanostructures may produce adverse physiological effects or potential health risks. The present work aimed to identify and characterize the nanostructures from the crusts of bread. Furthermore, a toxicological risk assessment of these nanostructures was conducted using human mesenchymal stem cells (hMSCs) as a model for cellular uptake and metabolic oxidative stress, with special reference to induced adipogenesis. CNs isolated from bread crusts were characterized using transmission electron microscopy. The in vitro risk assessment of the CNs was carried out in hMSCs using an MTT assay, cell morphological assessment, a reactive oxygen species assay, a mitochondrial trans-membrane potential assay, cell cycle progression assessment and gene expression analysis. Our results revealed that bread crusts contain CNs, which may form during the bread-making process. The in vitro results indicate that carbon nanostructures have moderately toxic effects in the hMSCs at a high dose (400 μg/mL). The mitochondrial trans-membrane potentials and intracellular ROS levels of the hMSCs were altered at this dose. The levels of the mRNA transcripts of metabolic stress-responsive genes such as CAT, GSR, GSTA4, CYP1A and p53 were significantly altered in response to CNs. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Identification and characterization of the Bcl-2- associated ...

    African Journals Online (AJOL)

    Identification and characterization of the Bcl-2- associated athanogene (BAG) protein family in rice. ... Data obtained from real-time PCR of OsBAG genes under heat stress showed that maximum induction in the expression of all the genes occurred after one hour exposure to heat stress, while reduction in the expression ...

  14. Chemical Variations on the p53 Reactivation Theme

    Directory of Open Access Journals (Sweden)

    Carlos J. A. Ribeiro

    2016-05-01

    Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

  15. Determination of HER2 and p53 Mutations by Sequence Analysis Method and EGFR/Chromosome 7 Gene Status by Fluorescence in Situ Hybridization for the Predilection of Targeted Therapy Modalities in Immunohistochemically Triple Negative Breast Carcinomas in Turkish Population.

    Science.gov (United States)

    Pala, Emel Ebru; Bayol, Umit; Keskin, Elif Usturali; Ozguzer, Alp; Kucuk, Ulku; Ozer, Ozge; Koc, Altug

    2015-09-01

    Triple negative breast cancer (TNBC), an agressive subtype accounts nearly 15 % of all breast carcinomas. Conventional chemotherapy is the only treatment modality thus new, effective targeted therapy methods have been investigated. Epidermal growth factor receptor (EGFR) inhibitors give hope according to the recent studies results. Also therapeutic agents have been tried against aberrant p53 signal activity as TNBC show high p53 mutation rates. Our aim was to detect the incidence of mutations/amplifications identified in TNBC in our population. Here we used sequence analysis to detect HER2 (exon 18-23), p53 (exon 5-8) mutations; fluorescence in situ hybridization (FISH) method to analyse EGFR/chromosome 7 centromere gene status in 82 immunohistochemically TNBC. Basaloid phenotype was identified in 49 (59.8 %) patients. EGFR amplification was noted in 5 cases (6.1 %). All EGFR amplified cases showed EGFR overexpression by immunohistochemistry (IHC). p53 mutations were identified in 33 (40.2 %) cases. Almost 60 % of the basal like breast cancer cases showed p53 mutation. Only one case showed HER2 mutation (exon 20:g.36830_3). Our results showed that gene amplification is not the unique mechanism in EGFR overexpression. IHC might be used in the decision of anti-EGFR therapy in routine practice. p53 mutation rate was lower than the rates reported in the literature probably due to ethnic differences and low sensitivity of sanger sequences in general mutation screening. We also established the rarity of HER2 mutation in TNBC. In conclusion EGFR and p53 are the major targets in TNBC also for our population.

  16. Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

    Science.gov (United States)

    Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

    2001-06-15

    Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.

  17. Bcl-2 inhibitors potentiate the cytotoxic effects of radiation in Bcl-2 overexpressing radioresistant tumor cells

    International Nuclear Information System (INIS)

    Hara, Takamitsu; Omura-Minamisawa, Motoko; Chao Cheng; Nakagami, Yoshihiro; Ito, Megumi; Inoue, Tomio

    2005-01-01

    Purpose: Bcl-2, an inhibitor of apoptosis frequently shows elevated expression in human tumors, thus resulting in resistance to radiation therapy. Therefore, inhibiting Bcl-2 function may enhance the radiosensitivity of tumor cells. Tetrocarcin A (TC-A) and bcl-2 antisense oligonucleotides exhibit antitumor activity by inhibiting Bcl-2 function and transcription, respectively. We investigated whether these antitumor agents would enhance the cytotoxic effects of radiation in tumor cells overexpressing Bcl-2. Methods and materials: We used HeLa/bcl-2 cells, a stable Bcl-2-expressing cell line derived from wild-type HeLa (HeLa/wt) cells. Cells were incubated with TC-A and bcl-2 antisense oligonucleotides for 24 h after irradiation, and cell viability was then determined. Apoptotic cells were quantified by flow cytometric assay. Results: The HeLa/bcl-2 cells were more resistant to radiation than HeLa/wt cells. At concentrations that are not inherently cytotoxic, both TC-A and bcl-2 antisense oligonucleotides increased the cytotoxic effects of radiation in HeLa/bcl-2 cells, but not in HeLa/wt cells. However, in HeLa/bcl-2 cells, additional treatment with TC-A in combination with radiation did not significantly increase apoptosis. Conclusions: The present results suggest that TC-A and bcl-2 antisense oligonucleotides reduce radioresistance of tumor cells overexpressing Bcl-2. Therefore, a combination of radiotherapy and Bcl-2 inhibitors may prove to be a useful therapeutic approach for treating tumors that overexpress Bcl-2

  18. Energetic heavy ions overcome tumor radioresistance caused by overexpression of Bcl-2

    International Nuclear Information System (INIS)

    Hamada, Nobuyuki; Hara, Takamitsu; Omura-Minamisawa, Motoko; Funayama, Tomoo; Sakashita, Tetsuya; Sora, Sakura; Yokota, Yuichiro; Nakano, Takashi

    2008-01-01

    Background and purpose: Overexpression of Bcl-2 is frequent in human cancers and has been associated with radioresistance. Here we investigated the potential impact of heavy ions on Bcl-2 overexpressing tumors. Materials and methods: Bcl-2 cells (Bcl-2 overexpressing HeLa cells) and Neo cells (neomycin resistant gene-expressing HeLa cells) exposed to γ-rays or heavy ions were assessed for the clonogenic survival, apoptosis and cell cycle distribution. Results: Whereas Bcl-2 cells were more resistant to γ-rays (0.2 keV/μm) and helium ions (16.2 keV/μm) than Neo cells, heavy ions (76.3-1610 keV/μm) yielded similar survival regardless of Bcl-2 overexpression. Carbon ions (108 keV/μm) decreased the difference in the apoptotic incidence between Bcl-2 and Neo cells, and prolonged G 2 /M arrest that occurred more extensively in Bcl-2 cells than in Neo cells. Conclusions: High-LET heavy ions overcome tumor radioresistance caused by Bcl-2 overexpression, which may be explained at least in part by the enhanced apoptotic response and prolonged G 2 /M arrest. Thus, heavy-ion therapy may be a promising modality for Bcl-2 overexpressing radioresistant tumors

  19. Immunohistochemical analysis of P53 protein in odontogenic cysts

    Science.gov (United States)

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

    2010-01-01

    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  20. ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies.

    Science.gov (United States)

    Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael

    2016-02-16

    The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. Copyright © 2016, American Association for the Advancement of Science.

  1. Interphase FISH detection of BCL2 rearrangement in follicular lymphoma using breakpoint-flanking probes

    NARCIS (Netherlands)

    Vaandrager, J W; Schuuring, E; Raap, T; Philippo, K; Kleiverda, K; Kluin, P

    Rearrangement of the BCL2 gene is an important parameter for the differential diagnosis of non-Hodgkin lymphomas. Although a relatively large proportion of breakpoints is clustered, many are missed by standard PCR. A FISH assay is therefore desired. Up to now, a lack of probes flanking the BCL2 gene

  2. Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

    International Nuclear Information System (INIS)

    Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina

    2003-01-01

    The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

  3. The effect of intense intermittent training with and without taking vitamin E on mRNA expression of p53/PTEN tumor suppressing genes in prostate glands of male rats

    Directory of Open Access Journals (Sweden)

    Mohammad Esmaeil Afzalpour

    2016-11-01

    Full Text Available Physical activity and diet are the most important modifiable determinants of cancer risk. The objective of this study was to examine the effect of intense intermittent training with and without taking vitamin E on expression of p53 and PTEN tumor suppressing genes in the prostate gland of male rats. For this purpose, 50 Sprague-Dawley male rats were randomly assigned into 5 groups: [1] control (CON, n = 10, [2] sham (S, n = 10, [3] intense intermittent training (IIT, n = 10, [4] intense intermittent training + vitamin E (IIT + VE, n = 10, [5] vitamin E (VE, n = 10. Protocol of this study was implemented for 6 days per week for 6 weeks, with observing the overload principle on the motorized treadmill. After implementing training protocol, expression rate of p53 and PTEN genes reduced significantly (p<0.000, p<0.031, respectively. Taking vitamin E with intermittent training caused significant reduction in p53 expression (p<0.013, while it caused significant increase in expression of PTEN (p<0.035. These results showed that intense intermittent training reduces expression of p53 and PTEN tumor suppressing genes and taking supplementation vitamin E along with this type of training could cause different effects in expression of these tumor suppressor genes.

  4. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-01-01

    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  5. A systematic review of p53 regulation of oxidative stress in skeletal muscle.

    Science.gov (United States)

    Beyfuss, Kaitlyn; Hood, David A

    2018-12-01

    transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p

  6. Targeting the p53 Pathway in Ewing Sarcoma

    Science.gov (United States)

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  7. The Transcriptional Landscape of p53 Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2017-06-01

    Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

  8. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Tzu-Chin [Chest Clinic, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Lin, Yi-Chin [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Chen, Hsiao-Ling [Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan (China); Huang, Pei-Ru; Liu, Shang-Yu [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Yeh, Shu-Lan, E-mail: suzyyeh@csmu.edu.tw [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Department of Nutrition, Chung Shan Medical University Hospital, Taichung, Taiwan (China)

    2016-02-01

    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.

  9. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

    International Nuclear Information System (INIS)

    Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling; Huang, Pei-Ru; Liu, Shang-Yu; Yeh, Shu-Lan

    2016-01-01

    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.

  10. Mucin phenotypic expression and p53 gene abnormality of gastric super-minute well-differentiated adenocarcinoma: Re-evaluation with relationship between histogenesis of well-differentiated adenocarcinoma and intestinal metaplasia in distal stomach

    Directory of Open Access Journals (Sweden)

    Yamaguchi Toshikazu

    2005-01-01

    Full Text Available Abstract Background Although the gastric well-differentiated adenocarcinoma in the distal stomach has been thought to develop via a intestinal metaplasia-carcinoma sequence, there are some disproofs from new mucin examinations for minute-size lesions in same type carcinoma. The current study was performed and pointed out the new findings for the solution to the problem according to the point described above. Methods 12 super-minute lesions (less than 1 mm in maximum diameter of well-differentiated adenocarcinoma in distal stomach (SMCa, which were detected from the pathological examinations of 210 surgically resected stomach specimens, and the mucosa adjacent to these carcinoma lesions, were examined by immunohistochemical mucin stainings (MUC2 and CD-10: intestinal phenotype, 45M1 and MUC6: gastric phenotype and p53-overexpression. And the analyses of the replication error of the microsatellites in chromosome 17 related p53 gene (TP53 and D17S786 (RER-p53MS were performed in SMCa lesions, adjacent mucosa to each lesion and other gastric mucosa with intestinal metaplasia, because all SMCa lesions showed p53-overexpression immunohistochemically, decribed below. Results 1. The carcinoma cells in all SMCa lesions were positive for 45M1 and p53. On the other hand, no positive carcinoma cells for MUC6 were seen although the pyloric glands and the remnant pyloric gland in the SMCa lesions in the same slides were positive for MUC6. Ten lesions (83% had intestinal phenotypic mucin (10 lesions: MUC2 (+, 4 lesions: CD10 (+. Two lesions (17% were positive for only 45M1 (gastric phenotypic mucin. 2. All of the mucosa adjacent to SMCa showed intestinal metaplasia (complete type: 7 regions, incomplete type: 5 regions. 3. RER-p53MS was confirmed in 42% (5/12 regions of SMCa, in 42% (5/12 regions of the mucosa adjacent to SMCa and 14% (6/42 regions of the other intestinal metaplasia mucosa. Conclusion Most of the super-minute well-differentiated adenocarcinoma

  11. Molecular basis of Bcl-X(L-p53 interaction: insights from molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Nagakumar Bharatham

    Full Text Available Bcl-X(L, an antiapoptotic Bcl-2 family protein, plays a central role in the regulation of the apoptotic pathway. Heterodimerization of the antiapoptotic Bcl-2 family proteins with the proapoptotic family members such as Bad, Bak, Bim and Bid is a crucial step in the apoptotic regulation. In addition to these conventional binding partners, recent evidences reveal that the Bcl-2 family proteins also interact with noncanonical binding partners such as p53. Our previous NMR studies showed that Bcl-X(L: BH3 peptide and Bcl-X(L: SN15 peptide (a peptide derived from residues S15-N29 of p53 complex structures share similar modes of bindings. To further elucidate the molecular basis of the interactions, here we have employed molecular dynamics simulations coupled with MM/PBSA approach. Bcl-X(L and other Bcl-2 family proteins have 4 hydrophobic pockets (p1-p4, which are occupied by four systematically spaced hydrophobic residues (h1-h4 of the proapoptotic Bad and Bak BH3 peptides. We observed that three conserved hydrophobic residues (F19, W23 and L26 of p53 (SN15 peptide anchor into three hydrophobic pockets (p2-p4 of Bcl-X(L in a similar manner as BH3 peptide. Our results provide insights into the novel molecular recognition by Bcl-X(L with p53.

  12. Genomic alterations during p53-dependent apoptosis induced by γ-irradiation of Molt-4 leukemia cells.

    Directory of Open Access Journals (Sweden)

    Rouba Hage-Sleiman

    Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes

  13. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  14. [Punish or cherish: p53, metabolism and tumor suppression].

    Science.gov (United States)

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  15. HMGB1 and HMGB2 cell-specifically down-regulate the p53-and p73-dependent sequence-specific transactivation from the human Bax gene promoter

    Czech Academy of Sciences Publication Activity Database

    Štros, Michal; Ozaki, T.; Bačíková, Alena; Kageyama, H.; Nakagawara, A.

    2002-01-01

    Roč. 277, č. 9 (2002), s. 7157-7164 ISSN 0021-9258 R&D Projects: GA AV ČR IAA7004902; GA AV ČR IAA5004105; GA ČR GA301/99/0691; GA ČR GA301/02/0952 Institutional research plan: CEZ:AV0Z5004920 Keywords : tumor-suppressor P53 * DNA-bending proteins * mammalian-cells Subject RIV: BO - Biophysics Impact factor: 6.696, year: 2002

  16. p53 dependent apoptotic cell death induces embryonic malformation in Carassius auratus under chronic hypoxia.

    Directory of Open Access Journals (Sweden)

    Paramita Banerjee Sawant

    Full Text Available Hypoxia is a global phenomenon affecting recruitment as well as the embryonic development of aquatic fauna. The present study depicts hypoxia induced disruption of the intrinsic pathway of programmed cell death (PCD, leading to embryonic malformation in the goldfish, Carrasius auratus. Constant hypoxia induced the early expression of pro-apoptotic/tumor suppressor p53 and concomitant expression of the cell death molecule, caspase-3, leading to high level of DNA damage and cell death in hypoxic embryos, as compared to normoxic ones. As a result, the former showed delayed 4 and 64 celled stages and a delay in appearance of epiboly stage. Expression of p53 efficiently switched off expression of the anti-apoptotic Bcl-2 during the initial 12 hours post fertilization (hpf and caused embryonic cell death. However, after 12 hours, simultaneous downregulation of p53 and Caspase-3 and exponential increase of Bcl-2, caused uncontrolled cell proliferation and prevented essential programmed cell death (PCD, ultimately resulting in significant (p<0.05 embryonic malformation up to 144 hpf. Evidences suggest that uncontrolled cell proliferation after 12 hpf may have been due to downregulation of p53 abundance, which in turn has an influence on upregulation of anti-apoptotic Bcl-2. Therefore, we have been able to show for the first time and propose that hypoxia induced downregulation of p53 beyond 12 hpf, disrupts PCD and leads to failure in normal differentiation, causing malformation in gold fish embryos.

  17. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao

    2014-12-01

    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  18. p53 downregulates the Fanconi anaemia DNA repair pathway.

    Science.gov (United States)

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  19. The genetic alteration of p53 in esophageal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1996-01-01

    Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

  20. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    Science.gov (United States)

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  1. [Reduced intensity conditioning allogeneic hematopoietic stem cell transplantation in chronic lymphocytic leukemia (CLL) patients with the aberration of p53 gene].

    Science.gov (United States)

    Wang, Li; Miao, Kourong; Fan, Lei; Xu, Ji; Wu, Hanxin; Li, Jianyong; Xu, Wei

    2016-04-01

    To investigate the effectiveness and safety of reduced intensity conditioning allogeneic hematopoietic stem cell transplantation (RIC allo-HSCT) in ultra high risk chronic lymphocytic leukemia (CLL) patients with the deletion of p53 to deepen the understanding of allo-HSCT in the treatment of CLL. In this retrospective study, a total of 4 ultra high risk CLL patients with the deletion of p53 in our center between July 2012 and Jan 2014 were enrolled. The RIC regimen was administered and the hematopoietic reconstitution, transplantation related mortality (TRM), overall survival (OS), progress free survival (PFS) were evaluated. We registered 4 patients with the median age of 56 years (49-61 years), including 3 males and 1 female. The median mononuclear cells (MNC) and CD34(+) cells were 6.54 (2.85-14.7) × 10(8)/kg (recipient body weight) and 5.81 (2.85-7.79) × 10(6)/kg (recipient body weight), respectively. The median time of the neutrophil recovery was 11 days (range of 9-12 days), and the median time of the platelet recovery 5.5 days (range of 0-11 days). Three patients (75%) attained a full donor chimerism at day 28 after transplantation and one (25%) got a mixed chimerism of donor and recipient. During the follow-up at a median time of 26.5 months (range of 21-39 months), 2 (50%) patients developed acute graft versus host disease (aGVHD) grade I and 2 (50%) patients got CMV infection. One patient got herpes zoster virus and EB virus infections. No transplantation related mortality was found in the 4 patients. One patient who was in partial response status progressed 5 months after transplantation, and the other 3 patients remained in durable remission after allo-HSCT. These results suggested that RIC allo-HSCT showed durable remission, good tolerance and acceptable toxicity, which could be a better option for the treatment of ultra high risk CLL patients with the deletion of p53 and was worth to be investigated and applied widely in future.

  2. Dual targeting of wild-type and mutant p53 by small molecule RITA results in the inhibition of N-Myc and key survival oncogenes and kills neuroblastoma cells in vivo and in vitro.

    Science.gov (United States)

    Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina

    2013-09-15

    Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.

  3. The effect of radiation on bcl-2 and bax in hyperplastic prostatic tissues

    International Nuclear Information System (INIS)

    Ma Qingjie; Li Yuxin; Gu Xinquan; Cao Xia; Zhao Jie; Kong Xiangbo; Cai Shanyu

    2004-01-01

    Aim: To investigate the expressions of bcl-2 and bax in benign prostatic hyperplasia (BPH) and the effect of β-rays on bcl-2 and bax. Methods: The expressions of bcl-2 and bax are studied by means of immunohistochemical method in 9 normal prostate (NP) and 15 BPH and 35 patients treated with 90Sr/90Y Prostatic Hyperplasia Applicator. Results: The expressions of bcl-2 in epithelia of NP and BPH are higher than that in stroma P<0.01=. The expressions of bcl-2 in epithelia and stroma of BPH are higher than that in NP P<0.01=. The expressions of bax in epithelia of NP are higher than that in BPH P<0.05=. However ,the expressions of bcl-2 in epithelia and stroma of BPH are higher than bax P<0.01 =. Compared with the control group, the expressions of bcl-2 in epithelia and stroma of BPH treated with 90Sr/90Y Prostatic Hyperplasia Applicator decreased and the expressions of bax increased P<0.01=. Conclusion: bcl-2 gene and bax gene play an important role in the regulation of prostatic apoptosis and the treatment of β-rays can accelerate the apoptosis of prostatic tissues. (authors)

  4. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  5. Targeting MUC1-C suppresses BCL2A1 in triple-negative breast cancer.

    Science.gov (United States)

    Hiraki, Masayuki; Maeda, Takahiro; Mehrotra, Neha; Jin, Caining; Alam, Maroof; Bouillez, Audrey; Hata, Tsuyoshi; Tagde, Ashujit; Keating, Amy; Kharbanda, Surender; Singh, Harpal; Kufe, Donald

    2018-01-01

    B-cell lymphoma 2-related protein A1 (BCL2A1) is a member of the BCL-2 family of anti-apoptotic proteins that confers resistance to treatment with anti-cancer drugs; however, there are presently no agents that target BCL2A1. The MUC1-C oncoprotein is aberrantly expressed in triple-negative breast cancer (TNBC) cells, induces the epithelial-mesenchymal transition (EMT) and promotes anti-cancer drug resistance. The present study demonstrates that targeting MUC1-C genetically and pharmacologically in TNBC cells results in the downregulation of BCL2A1 expression. The results show that MUC1-C activates the BCL2A1 gene by an NF-κB p65-mediated mechanism, linking this pathway with the induction of EMT. The MCL-1 anti-apoptotic protein is also of importance for the survival of TNBC cells and is an attractive target for drug development. We found that inhibiting MCL-1 with the highly specific MS1 peptide results in the activation of the MUC1-C→NF-κB→BCL2A1 pathway. In addition, selection of TNBC cells for resistance to ABT-737, which inhibits BCL-2, BCL-xL and BCL-W but not MCL-1 or BCL2A1, is associated with the upregulation of MUC1-C and BCL2A1 expression. Targeting MUC1-C in ABT-737-resistant TNBC cells suppresses BCL2A1 and induces death, which is of potential therapeutic importance. These findings indicate that MUC1-C is a target for the treatment of TNBCs unresponsive to agents that inhibit anti-apoptotic members of the BCL-2 family.

  6. Expression of Bcl-2 in canine osteosarcoma

    Science.gov (United States)

    Piro, F.; Leonardi, L.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines. PMID:26623359

  7. Expression of Bcl-2 in canine osteosarcoma

    Directory of Open Access Journals (Sweden)

    F. Piro

    2015-03-01

    Full Text Available Osteosarcoma (OS is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines.

  8. Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

    NARCIS (Netherlands)

    Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

    p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

  9. A point mutation of human p53, which was not detected as a mutation by a yeast functional assay, led to apoptosis but not p21Waf1/Cip1/Sdi1 expression in response to ionizing radiation in a human osteosarcoma cell line, Saos-2

    International Nuclear Information System (INIS)

    Okaichi, Kumio; Wang Lihong; Sasaki, Ji-ichiro; Saya, Hideyuki; Tada, Mitsuhiro; Okumura, Yutaka

    1999-01-01

    Purpose: The 123A point mutation of p53 showed increased radiosensitivity, whereas other mutations (143A, 175H, and 273H) were not affected. To determine the reason for increased radiosensitivity of the 123A mutation, the response of the transformant of 123A mutation to ionizing radiation (IR) was examined and compared to those of transformants with the wild type p53 or other point mutations (143A, 175H, and 273H). Methods and Materials: Stable transformants with a mutant or wild type p53 made by introducing cDNA into the human osteosarcoma cell line, Saos-2, which lacks an endogenous p53 were used. The transcriptional activity of mutant p53 was examined using a yeast functional assay. The transformants were examined for the accumulation of p53, the induction of p21 Waf1/Cip1/Sdi1 (hereafter referred to as p21), and the other response of p53-responsive genes (MDM2, Bax, and Bcl-2) by Western blotting. Apoptosis was analyzed by detection of DNA fragmentation. Results: The 123A point mutation of p53 was detected as a wild type in the yeast functional assay. The 123A mutant accumulated p53 in response to IR. The 123A mutant did not induce p21, but normally responded to MDM2, Bax, and Bcl-2. The 123A mutant entered apoptosis earlier than the wild type p53 transformant, and induced Fas at earlier in response to IR. Conclusion: The 123A mutant led to apoptosis, but not p21 expression in response to IR. The occurrence of apoptosis, but not induction of p21, corresponded to the radiosensitivity in the transformant. The early occurrence of apoptosis in 123A transformants may depend on the early induction of Fas

  10. Crosstalk between Bcl-2 family and Ras family small GTPases: potential cell fate regulation?

    International Nuclear Information System (INIS)

    Kang, Jia; Pervaiz, Shazib

    2013-01-01

    Cell fate regulation is a function of diverse cell signaling pathways that promote cell survival and or inhibit cell death execution. In this regard, the role of the Bcl-2 family in maintaining a tight balance between cell death and cell proliferation has been extensively studied. The conventional dogma links cell fate regulation by the Bcl-2 family to its effect on mitochondrial permeabilization and apoptosis amplification. However, recent evidence provide a novel mechanism for death regulation by the Bcl-2 family via modulating cellular redox metabolism. For example overexpression of Bcl-2 has been shown to contribute to a pro-oxidant intracellular milieu and down-regulation of cellular superoxide levels enhanced death sensitivity of Bcl-2 overexpressing cells. Interestingly, gene knockdown of the small GTPase Rac1 or pharmacological inhibition of its activity also reverted death phenotype in Bcl-2 expressing cells. This appears to be a function of an interaction between Bcl-2 and Rac1. Similar functional associations have been described between the Bcl-2 family and other members of the Ras superfamily. These interactions at the mitochondria provide novel opportunities for strategic therapeutic targeting of drug-resistant cancers.

  11. p53 and the pathogenesis of skin cancer

    International Nuclear Information System (INIS)

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.

    2007-01-01

    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

  12. CLCA2 as a p53-Inducible Senescence Mediator

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2012-02-01

    Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

  13. Expression of Bcl-2 family proteins and spontaneous apoptosis in normal human testis.

    Science.gov (United States)

    Oldereid, N B; Angelis, P D; Wiger, R; Clausen, O P

    2001-05-01

    We investigated the frequency of spontaneous apoptosis and expression of the Bcl-2 family of proteins during normal spermatogenesis in man. Testicular tissue with both normal morphology and DNA content was obtained from necro-donors and fixed in Bouin's solution. A TdT-mediated dUTP end-labelling method (TUNEL) was used for the detection of apoptotic cells. Expression of apoptosis regulatory Bcl-2 family proteins and of p53 and p21(Waf1) was assessed by immunohistochemistry. Germ cell apoptosis was detected in all testes and was mainly seen in primary spermatocytes and spermatids and in a few spermatogonia. Bcl-2 and Bak were preferentially expressed in the compartments of spermatocytes and differentiating spermatids, while Bcl-x was preferentially expressed in spermatogonia. Bax showed a preferential expression in nuclei of round spermatids, whereas Bad was only seen in the acrosome region of various stages of spermatids. Mcl-1 staining was weak without a particular pattern, whereas expression of Bcl-w, p53 and p21(Waf1) proteins was not detected by immunohistochemistry. The results show that spontaneous apoptosis occurs in all male germ cell compartments in humans. Bcl-2 family proteins are distributed preferentially within distinct germ cell compartments suggesting a specific role for these proteins in the processes of differentiation and maturation during human spermatogenesis.

  14. Phosphorylation and gene expression of p53 are not affected in human cells exposed to 2.1425 GHz band CW or W-CDMA modulated radiation allocated to mobile radio base stations.

    Science.gov (United States)

    Hirose, H; Sakuma, N; Kaji, N; Suhara, T; Sekijima, M; Nojima, T; Miyakoshi, J

    2006-09-01

    A large-scale in vitro study focusing on low-level radiofrequency (RF) fields from mobile radio base stations employing the International Mobile Telecommunication 2000 (IMT-2000) cellular system was conducted to test the hypothesis that modulated RF fields induce apoptosis or other cellular stress response that activate p53 or the p53-signaling pathway. First, we evaluated the response of human cells to microwave exposure at a specific absorption rate (SAR) of 80 mW/kg, which corresponds to the limit of the average whole-body SAR for general public exposure defined as a basic restriction by the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. Second, we investigated whether continuous wave (CW) and wideband code division multiple access (W-CDMA) modulated signal RF fields at 2.1425 GHz induced apoptosis or any signs of stress. Human glioblastoma A172 cells were exposed to W-CDMA radiation at SARs of 80, 250, and 800 mW/kg, and CW radiation at 80 mW/kg for 24 or 48 h. Human IMR-90 fibroblasts from fetal lungs were exposed to both W-CDMA and CW radiation at a SAR of 80 mW/kg for 28 h. Under the RF field exposure conditions described above, no significant differences in the percentage of apoptotic cells were observed between the test groups exposed to RF signals and the sham-exposed negative controls, as evaluated by the Annexin V affinity assay. No significant differences in expression levels of phosphorylated p53 at serine 15 or total p53 were observed between the test groups and the negative controls by the bead-based multiplex assay. Moreover, microarray hybridization and real-time RT-PCR analysis showed no noticeable differences in gene expression of the subsequent downstream targets of p53 signaling involved in apoptosis between the test groups and the negative controls. Our results confirm that exposure to low-level RF signals up to 800 mW/kg does not induce p53-dependent apoptosis, DNA damage, or other stress response in human

  15. Insertion of the LINE-1 element in the C-MYC gene and immunoreactivity of C-MYC, p53, p21 and p27 proteins in different morphological patterns of the canine TVT

    Directory of Open Access Journals (Sweden)

    C.R.O. Lima

    2016-06-01

    Full Text Available ABSTRACT The canine transmissible venereal tumor (TVT affects the external genitalia of dogs by the natural transplant of viable tumor cells. Thus, this research aimed to diagnose and characterize TVT morphological patterns, identify the insertion of the LINE-1 element in C-MYC gene, by means of the polymerase chain reaction (PCR, and evaluate the immunohistochemical expression of C-MYC, p53, p21 and p27 proteins. The relationship between C-MYC and p53 proteins and their interference on the expression of p21 and p27 were also studied. For that, 20 samples of naturally occurring TVT were used, subjected to cytopathological, histopathological and immunohistochemical analysis, and to molecular diagnosis of neoplasia. The increased tissue expression and the correlation among C-MYC, p53, p21 and p27 proteins indicate reduction and/or loss of their functionality in the TVT microenvironment, with consequent apoptotic suppression, maintenance of cell growth and progression of neoplasia.

  16. Study on relationship between apoptosis-related genes and radiosensitivity of esophageal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Li Huixiang; Wang Yaohe; Shi Yonggang; Gao Dongling; Zhang Yunhan

    2000-01-01

    Objective: To observing the relationship between apoptosis-related genes bcl-2,c-myc, p53 and the radiosensitivity of esophageal squamous cell carcinoma. Methods: The expression levels of bcl-2, c-myc and p53 genes in 57 biopsy samples from patients of esophageal squamous cell carcinoma were detected with the LSAB immunohistochemistry method. All the patients were treated with radiotherapy. The radiotherapeutic effect in these patients was observed and the relation between gene expression and radiosensitivity was analyzed. Results: Compared with the bcl-2-negative group, the radiosensitivity of bcl-2-positive one was lower(P<0.01). The radiosensitivity of p53-positive group was slightly lower than that of the p53-negative one (P<0.05). The c-myc protein expression was not related to radiosensitivity. Conclusion: Detection and comprehensive analysis of bcl-2, c-myc and p53 protein expressions are useful in forecasting the radiotherapeutic effect on squamous cell carcinoma of esophagus

  17. Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...

    African Journals Online (AJOL)

    apoptotic ... Quantitative real-time polymerase chain reaction (qPCR) was performed using Taq PCR Master ... Keywords: Anti-apoptotic genes, Cervical cancer, Apoptosis, Cell viability, BCL2, .... polyclonal anti-rabbit immunoglobulin HRP-linked.

  18. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  19. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    International Nuclear Information System (INIS)

    Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  20. p53 mutations promote proteasomal activity.

    Science.gov (United States)

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  1. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner

    2015-03-01

    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  2. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. A dynamic P53-MDM2 model with time delay

    Energy Technology Data Exchange (ETDEWEB)

    Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

    2006-11-15

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

  4. A dynamic P53-MDM2 model with time delay

    International Nuclear Information System (INIS)

    Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

    2006-01-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

  5. Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

    Directory of Open Access Journals (Sweden)

    Giovanna Damia

    2001-01-01

    Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

  6. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

    2007-01-01

    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  7. P53 expression in prostatic cancer: an immunohistochemical study

    International Nuclear Information System (INIS)

    Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.

    2011-01-01

    Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

  8. Development of Spontaneous Mammary Tumors in BALB/c-p53+-Mice: Detection of Early Genetic Alterations and the Mapping of BALB/c Susceptibility Genes

    National Research Council Canada - National Science Library

    Blackburn, Anneke

    2002-01-01

    The TP53 tumor suppressor gene is defective in the majority of sporadic breast cancers, and breast cancer is the most frequent tumor type in women with Li-Fraumeni syndrome who inherit germline mutations in TP53...

  9. Development of Spontaneous Mammary Tumors in BALB/c-p53+/-Mice: Detection of Early Genetic Alterations and the Mapping of BALB/c Susceptibility Genes

    National Research Council Canada - National Science Library

    Smith, Sallie

    2004-01-01

    The TP53 tumor suppressor gene is defective in the majority of sporadic breast cancers, and breast cancer is the most frequent tumor type in women with Li-Fraumeni syndrome and bear germline mutations in TP53...

  10. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    Science.gov (United States)

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-01-01

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  11. Regulation of autophagy by cytoplasmic p53.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  12. SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production

    International Nuclear Information System (INIS)

    Jauharoh, Siti Nur Aisyah; Saegusa, Jun; Sugimoto, Takeshi; Ardianto, Bambang; Kasagi, Shimpei; Sugiyama, Daisuke; Kurimoto, Chiyo; Tokuno, Osamu; Nakamachi, Yuji; Kumagai, Shunichi; Kawano, Seiji

    2012-01-01

    Highlights: ► Ro52 low HeLa cells are resistant to apoptosis upon various stimulations. ► Ro52 is upregulated by IFN-α, etoposide, or IFN-γ and anti-Fas Ab. ► Ro52-mediated apoptosis is independent of p53. ► Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjögren’s syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52’s role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52 low HeLa cells were significantly more resistant to apoptosis than wild-type HeLa cells when stimulated by H 2 O 2 - or diamide-induced oxidative stress, IFN-α, IFN-γ and anti-Fas antibody, etoposide, or γ-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.

  13. SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production

    Energy Technology Data Exchange (ETDEWEB)

    Jauharoh, Siti Nur Aisyah [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Faculty of Medicine and Health Science, Syarif Hidayatullah State Islamic University, Jakarta 15412 (Indonesia); Saegusa, Jun; Sugimoto, Takeshi [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Ardianto, Bambang [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Department of Child Health, Faculty of Medicine, Gadjah Mada University, Yogyakarta 55282 (Indonesia); Kasagi, Shimpei; Sugiyama, Daisuke; Kurimoto, Chiyo [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Tokuno, Osamu; Nakamachi, Yuji [Department of Laboratory Medicine, Kobe University Hospital, Hyogo 650-0017 (Japan); Kumagai, Shunichi [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Kawano, Seiji, E-mail: sjkawano@med.kobe-u.ac.jp [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Department of Laboratory Medicine, Kobe University Hospital, Hyogo 650-0017 (Japan)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Ro52{sup low} HeLa cells are resistant to apoptosis upon various stimulations. Black-Right-Pointing-Pointer Ro52 is upregulated by IFN-{alpha}, etoposide, or IFN-{gamma} and anti-Fas Ab. Black-Right-Pointing-Pointer Ro52-mediated apoptosis is independent of p53. Black-Right-Pointing-Pointer Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjoegren's syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52's role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52{sup low} HeLa cells were significantly more resistant to apoptosis than wild-type HeLa cells when stimulated by H{sub 2}O{sub 2}- or diamide-induced oxidative stress, IFN-{alpha}, IFN-{gamma} and anti-Fas antibody, etoposide, or {gamma}-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.

  14. 40 Years of Research Put p53 in Translation

    Science.gov (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  15. Translocation of p53 to Mitochondria Is Regulated by Its Lipid Binding Property to Anionic Phospholipids and It Participates in Cell Death Control

    Directory of Open Access Journals (Sweden)

    Ching-Hao Li

    2010-02-01

    Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.

  16. Co-expression of antioxidant enzymes with expression of p53, DNA repair, and heat shock protein genes in the gamma ray-irradiated hermaphroditic fish Kryptolebias marmoratus larvae

    Energy Technology Data Exchange (ETDEWEB)

    Rhee, Jae-Sung [Research Institute for Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, Bo-Mi; Kim, Ryeo-Ok [Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Seo, Jung Soo [Pathology Team, National Fisheries Research and Development Institute, Busan 619-902 (Korea, Republic of); Kim, Il-Chan [Division of Life Sciences, Korea Polar Research Institute, Korea Institute of Ocean Science and Technology, Incheon 406-840 (Korea, Republic of); Lee, Young-Mi, E-mail: ymlee70@smu.ac.kr [Department of Green Life Science, College of Convergence, Sangmyung University, Seoul 110-743 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@hanyang.ac.kr [Research Institute for Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of)

    2013-09-15

    Highlights: •Novel identification of DNA repair-related genes in fish. •Investigation of whole expression profiling of DNA repair genes upon gamma radiation. •Analysis of effects of gamma radiation on antioxidant system and cell stress proteins. •Usefulness of verification of pathway-based profiling for mechanistic understanding. -- Abstract: To investigate effects of gamma ray irradiation in the hermaphroditic fish, Kryptolebias marmoratus larvae, we checked expression of p53, DNA repair, and heat shock protein genes with several antioxidant enzyme activities by quantitative real-time RT-PCR and biochemical methods in response to different doses of gamma radiation. As a result, the level of gamma radiation-induced DNA damage was initiated after 4 Gy of radiation, and biochemical and molecular damage became substantial from 8 Gy. In particular, several DNA repair mechanism-related genes were significantly modulated in the 6 Gy gamma radiation-exposed fish larvae, suggesting that upregulation of such DNA repair genes was closely associated with cell survival after gamma irradiation. The mRNA expression of p53 and most hsps was also significantly upregulated at high doses of gamma radiation related to cellular damage. This finding indicates that gamma radiation can induce oxidative stress with associated antioxidant enzyme activities, and linked to modulation of the expression of DNA repair-related genes as one of the defense mechanisms against radiation damage. This study provides a better understanding of the molecular mode of action of defense mechanisms upon gamma radiation in fish larvae.

  17. Chemotherapy-Induced Apoptosis in a Transgenic Model of Neuroblastoma Proceeds Through p53 Induction

    Directory of Open Access Journals (Sweden)

    Louis Chesler

    2008-11-01

    Full Text Available Chemoresistance in neuroblastoma is a significant issue complicating treatment of this common pediatric solid tumor. MYCN-amplified neuroblastomas are infrequently mutated at p53 and are chemosensitive at diagnosis but acquire p53 mutations and chemoresistance with relapse. Paradoxically, Myc-driven transformation is thought to require apoptotic blockade. We used the TH-MYCN transgenic murine model to examine the role of p53-driven apoptosis on neuroblastoma tumorigenesis and the response to chemotherapy. Tumors formed with high penetrance and low latency in p53-haploinsufficient TH-MYCN mice. Cyclophosphamide (CPM induced a complete remission in p53 wild type TH-MYCN tumors, mirroring the sensitivity of childhood neuroblastoma to this agent. Treated tumors showed a prominent proliferation block, induction of p53 protein, and massive apoptosis proceeding through induction of the Bcl-2 homology domain-3-only proteins PUMA and Bim, leading to the activation of Bax and cleavage of caspase-3 and -9. Apoptosis induced by CPM was reduced in p53-haploinsufficient tumors. Treatment of MYCN-expressing human neuroblastoma cell lines with CPM induced apoptosis that was suppressible by siRNA to p53. Taken together, the results indicate that the p53 pathway plays a significant role in opposing MYCN-driven oncogenesis in a mouse model of neuroblastoma and that basal inactivation of the pathway is achieved in progressing tumors. This, in part, explains the striking sensitivity of such tumors to chemotoxic agents that induce p53-dependent apoptosis and is consistent with clinical observations that therapy-associated mutations in p53 are a likely contributor to the biology of tumors at relapse and secondarily mediate resistance to therapy.

  18. Dual-cyclical nucleic acid strand-displacement polymerization based signal amplification system for highly sensitive determination of p53 gene.

    Science.gov (United States)

    Xu, Jianguo; Wu, Zai-Sheng; Li, Hongling; Wang, Zhenmeng; Le, Jingqing; Zheng, Tingting; Jia, Lee

    2016-12-15

    In the present study, we proposed a novel dual-cyclical nucleic acid strand-displacement polymerization (dual-CNDP) based signal amplification system for highly sensitive determination of tumor suppressor genes. The system primarily consisted of a signaling hairpin probe (SHP), a label-free hairpin probe (LHP) and an initiating primer (IP). The presence of target DNA was able to induce one CNDP through continuous process of ligation, polymerization and nicking, leading to extensively accumulation of two nicked triggers (NT1 and NT2). Intriguingly, the NT1 could directly hybridize SHP, while the NT2 could act as the target analog to induce another CNDP. The resulting dual-CNDP contributed the striking signal amplification, and only a very weak blank noise existed since the ligation template of target was not involved. In this case, the target could be detected in a wide linear range (5 orders of magnitude), and a low detection limit (78 fM) was obtained, which is superior to most of the existing fluorescent methods. Moreover, the dual-CNDP sensing system provided a high selectivity towards target DNA against mismatched target and was successfully applied to analysis of target gene extracted from cancer cells or in human serum-contained samples, indicating its great potential for practical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Thymocyte apoptosis induced by p53-dependent and independent pathways

    International Nuclear Information System (INIS)

    Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.

    1993-01-01

    The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

  20. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    Science.gov (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  1. Immunogenicity of Bcl-2 in patients with cancer

    DEFF Research Database (Denmark)

    Andersen, Mads Hald; Svane, Inge Marie; Kvistborg, Pia

    2005-01-01

    patients suffering from unrelated tumor types (ie, pancreatic cancer, breast cancer, acute myeloid leukemia [AML], and chronic lymphocytic leukemia [CLL]). Additionally, we show that these Bcl-2-reactive T cells are indeed peptide-specific, cytotoxic effector cells. Thus, Bcl-2 may serve as an important......B-cell lymphoma 2 (Bcl-2) is a pivotal regulator of apoptotic cell death and it is overexpressed in many cancers. Consequently, the Bcl-2 protein is an attractive target for drug design, and Bcl-2-specific antisense oligonucleotides or small-molecule Bcl-2 inhibitors have shown broad anticancer......-2 in cancer and the fact that immune escape by down-regulation or loss of expression of this protein would impair sustained tumor growth makes Bcl-2 a very attractive target for anticancer immunotherapy. Herein, we describe spontaneous T-cell reactivity against Bcl-2 in peripheral blood from...

  2. The p53-dependent radioadaptive response

    Science.gov (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  3. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)

    1993-01-01

    textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

  4. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.

    1993-01-01

    The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

  5. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  6. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    Science.gov (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  7. The expanding regulatory universe of p53 in gastrointestinal cancer.

    Science.gov (United States)

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  8. Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...

    African Journals Online (AJOL)

    The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...

  9. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    Science.gov (United States)

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  10. Mapping of the bcl-2 oncogene on mouse chromosome 1.

    Science.gov (United States)

    Mock, B A; Givol, D; D'Hoostelaere, L A; Huppi, K; Seldin, M F; Gurfinkel, N; Unger, T; Potter, M; Mushinski, J F

    1988-01-01

    Two bcl-2 alleles have been identified in inbred strains of mice by restriction fragment length polymorphism (RFLP). Analysis of a bcl-2 RFLP in a series of bilineal congenic strains (C.D2), developed as a tool for chromosomal mapping studies, revealed linkage of bcl-2 to the Idh-1/Pep-3 region of murine chromosome 1. The co-segregation of bcl-2 alleles with allelic forms of two other chromosome 1 loci, Ren-1,2 and Spna-1, in a set of back-cross progeny, positions bcl-2 7.8 cM centromeric from Ren-1,2.

  11. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    Science.gov (United States)

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  12. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    Directory of Open Access Journals (Sweden)

    Lin Tai-Du

    2010-12-01

    Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

  13. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  14. A dual role of p53 in the control of autophagy.

    Science.gov (United States)

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  15. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  16. Effect of Bcl-2 rs956572 polymorphism on age-related gray matter volume changes.

    Directory of Open Access Journals (Sweden)

    Mu-En Liu

    Full Text Available The anti-apoptotic protein B-cell CLL/lymphoma 2 (Bcl-2 gene is a major regulator of neural plasticity and cellular resilience. Recently, the Bcl-2 rs956572 single nucleotide polymorphism was proposed to be a functional allelic variant that modulates cellular vulnerability to apoptosis. Our cross-sectional study investigated the genetic effect of this Bcl-2 polymorphism on age-related decreases in gray matter (GM volume across the adult lifespan. Our sample comprised 330 healthy volunteers (191 male, 139 female with a mean age of 56.2±22.0 years (range: 21-92. Magnetic resonance imaging and genotyping of the Bcl-2 rs956572 were performed for each participant. The differences in regional GM volumes between G homozygotes and A-allele carriers were tested using optimized voxel-based morphometry. The association between the Bcl-2 rs956572 polymorphism and age was a predictor of regional GM volumes in the right cerebellum, bilateral lingual gyrus, right middle temporal gyrus, and right parahippocampal gyrus. We found that the volume of these five regions decreased with increasing age (all P<.001. Moreover, the downward slope was steeper among the Bcl-2 rs956572 A-allele carriers than in the G-homozygous participants. Our data provide convergent evidence for the genetic effect of the Bcl-2 functional allelic variant in brain aging. The rs956572 G-allele, which is associated with significantly higher Bcl-2 protein expression and diminished cellular sensitivity to stress-induced apoptosis, conferred a protective effect against age-related changes in brain GM volume, particularly in the cerebellum.

  17. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

    Directory of Open Access Journals (Sweden)

    Rolletschek Alexandra

    2009-06-01

    Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  18. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    Science.gov (United States)

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  19. Bcl-2 overexpression prevents 99mTc-MIBI uptake in breast cancer cell lines

    International Nuclear Information System (INIS)

    Aloj, Luigi; Zannetti, Antonella; Caraco, Corradina; Del Vecchio, Silvana; Salvatore, Marco

    2004-01-01

    We have previously shown a correlation between the absence of technetium-99m methoxyisobutylisonitrile ( 99m Tc-MIBI) uptake and overexpression of the anti-apoptotic protein Bcl-2 in human breast carcinoma. To establish a direct cause-effect relationship between Bcl-2 overexpression and reduced 99m Tc-MIBI uptake, MCF-7 and T47D breast cancer cell lines were stably transfected with the human Bcl-2 gene to increase intracellular protein levels and tested for 99m Tc-MIBI uptake. All clones overexpressing Bcl-2 showed a dramatic reduction of 99m Tc-MIBI uptake as compared with mock transfected control cells. Tracer uptake was promptly and partially restored by induction of apoptosis with staurosporine treatment. After 4.5 h of staurosporine treatment, a tenfold increase in 99m Tc-MIBI uptake was observed in treated as compared with untreated Bcl-2 overexpressing cells. Our findings provide a rational basis for the development of an in vivo test to detect Bcl-2 overexpression in human tumours. (orig.)

  20. Immunogenicity of Bcl-2 in patients with cancer

    DEFF Research Database (Denmark)

    Andersen, Mads Hald; Svane, Inge Marie; Kvistborg, Pia

    2005-01-01

    activities in preclinical models and are currently in several clinical trials. The clinical application of immunotherapy against cancer is rapidly moving forward in multiple areas, including the adoptive transfer of anti-tumor-reactive T cells and the use of "therapeutic" vaccines. The overexpression of Bcl......-2 in cancer and the fact that immune escape by down-regulation or loss of expression of this protein would impair sustained tumor growth makes Bcl-2 a very attractive target for anticancer immunotherapy. Herein, we describe spontaneous T-cell reactivity against Bcl-2 in peripheral blood from......B-cell lymphoma 2 (Bcl-2) is a pivotal regulator of apoptotic cell death and it is overexpressed in many cancers. Consequently, the Bcl-2 protein is an attractive target for drug design, and Bcl-2-specific antisense oligonucleotides or small-molecule Bcl-2 inhibitors have shown broad anticancer...

  1. Multiplex PCR for the detection of BCL-1/IGH and BCL-2/IGH gene rearrangements--clinical validation in a prospective study of blood and bone marrow in 258 patients with or suspected of non-Hodgkin's lymphoma

    DEFF Research Database (Denmark)

    Nyvold, Charlotte G; Bendix, Knud; Brandsborg, Margrethe

    2007-01-01

    prospectively been evaluated. Eleven patients (4%) were found t(11;14)+ and 37 patients (14%) t(14;18)+. Comparing these results to standard diagnostic methods of PB and/or BM identified PCR+ samples that were normal by morphology (BCL-1/IGH: 1/11; BCL-2/IGH: 17/37). Equally important, patients who were......We have designed a multiplex PCR, which allows for fast and high throughput demonstration of the BCL-1/IGH and BCL-2/IGH fusion DNA observed primarily in mantle cell- and follicular non-Hodgkin's lymphoma (NHL). Blood (PB) and/or bone marrow (BM) from 258 patients suspected of NHL have...... not clonal in PB and/or BM by flow cytometry were identified as PCR+ (BCL-1/IGH: 3/11; BCL-2/IGH: 23/37). We conclude that this multiplex approach allows for easy and sensitive molecular determination of molecular lesions in NHL, which have diagnostic and prognostic importance. Udgivelsesdato: 2007-null...

  2. Probucol Attenuates Cyclophosphamide-induced Oxidative Apoptosis, p53 and Bax Signal Expression in Rat Cardiac Tissues

    Directory of Open Access Journals (Sweden)

    Yousif A. Asiri

    2010-01-01

    Full Text Available Cyclophosphamide (CP is a widely used drug in cancer chemotherapy and immunosuppression, which could cause toxicity of the normal cells due to its toxic metabolites. Probucol, a cholesterol-lowering drug, acts as potential inhibitor of DNA damage and shows to protect against doxorubicin-induced cardiomyopathy by enhancing the endogenous antioxidant system including glutathione peroxidase, catalase and superoxide dismutase. This study examined the possible protective effects of probucol, a lipid-lowering compound with strong antioxidant properties, against CPinduced cardiotoxicity. This objective could be achieved through studying the gene expression-based on the possible protective effects of probucol against CP-induced cardiac failure in rats. Adult male Wistar albino rats were assigned into four treatment groups: Animals in the first (control and second (probucol groups were injected intraperitoneally with corn oil and probucol (61 mg/kg/day, respectively, for two weeks. Animals in the third (CP and fourth (probucol plus CP groups were injected with the same doses of corn oil and probucol (61 mg/kg/day, respectively, for one week before and one week after a single dose of CP (200 mg/kg, I.P.. The p53, Bax, Bcl2 and oxidative genes signal expression were measured by real time PCR. CP-induced cardiotoxicity was clearly observed by a significant increase in serum creatine phosphokinase isoenzyme (CK-MB (117%, lactate dehydrogenase (LDH (64%, free (69% and esterified cholesterol (42% and triglyceride (69% compared to control group. In cardiac tissues, CP significantly increases the mRNA expression levels of apoptotic genes, p53 with two-fold and Bax with 1.6-fold, and decreases the anti-apoptotic gene Bcl2 with 0.5-fold. Moreover, CP caused downregulation of antioxidant genes, glutathione peroxidase, catalase, and superoxide dismutase and increased the lipid peroxidation and decreased adenosine triphosphate (ATP (40% and ATP/ADP (44% in cardiac

  3. Zerumbone induced apoptosis in liver cancer cells via modulation of Bax/Bcl-2 ratio

    Directory of Open Access Journals (Sweden)

    Azimahtol Hawariah LP

    2007-04-01

    Full Text Available Abstract Background Zerumbone is a cytotoxic component isolated from Zingiber zerumbet Smith, a herbal plant which is also known as lempoyang. This new anticancer bioactive compound from Z. zerumbet was investigated for its activity and mechanism in human liver cancer cell lines. Results Zerumbone significantly showed an antiproliferative activity upon HepG2 cells with an IC50 of 3.45 ± 0.026 μg/ml. Zerumbone was also found to inhibit the proliferation of non-malignant Chang Liver and MDBK cell lines. However the IC50 obtained was higher compared to the IC50 for HepG2 cells (> 10 μg/ml. The extent of DNA fragmentation was evaluated by the Tdt-mediated dUTP nick end labelling assay which showed that, zerumbone significantly increased apoptosis in HepG2 cells in a time-course manner. In detail, the apoptotic process triggered by zerumbone involved the up-regulation of pro-apoptotic Bax protein and the suppression of anti-apoptotic Bcl-2 protein expression. The changes that occurred in the levels of this antagonistic proteins Bax/Bcl-2, was independent of p53 since zerumbone did not affect the levels of p53 although this protein exists in a functional form. Western blotting analysis for Bax protein was further confirmed qualitatively with an immunoassay that showed the distribution of Bax protein in zerumbone-treated cells. Conclusion Therefore, zerumbone was found to induce the apoptotic process in HepG2 cells through the up and down regulation of Bax/Bcl-2 protein independently of functional p53 activity.

  4. The critical role of catalase in prooxidant and antioxidant function of p53

    Science.gov (United States)

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  5. No evidence for functional inactivation of wild-type p53 protein by MDM2 overexpression in gastric carcinogenesis

    NARCIS (Netherlands)

    Blok, P.; Craanen, M. E.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1998-01-01

    Inactivation of wild-type p53 during gastric carcinogenesis is usually caused by mutations within exons 5-8 of the p53 gene leading to mutated, usually immunohistochemically detectable p53 proteins. However, functional inactivation of wild-type p53, mimicking mutational inactivation, may also result

  6. Interactions of Chromatin Context, Binding Site Sequence Content, and Sequence Evolution in Stress-Induced p53 Occupancy and Transactivation

    OpenAIRE

    Su, Dan; Wang, Xuting; Campbell, Michelle R.; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Bell, Douglas A.

    2015-01-01

    Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, ...

  7. Disturbance of Bcl-2, Bax, Caspase-3, Ki-67 and C-myc expression in acute and subchronic exposure to benzo(a)pyrene in cervix.

    Science.gov (United States)

    Gao, Meili; Li, Yongfei; Ji, Xiaoying; Xue, Xiaochang; Chen, Lan; Feng, Guodong; Zhang, Huqin; Wang, Huichun; Shah, Walayat; Hou, Zhanwu; Kong, Yu

    2016-03-01

    Epidemiological studies have demonstrated that cigarette smoking is an important cofactor or an independent risk factor for the development of cervical cancer. Benzo(a)pyrene (BaP) is one of the most potent tobacco smoke carcinogens in tobacco smoke. BaP induced DNA damage and over expression in p53 cervical tissue of mice as demonstrated in our previous study. Here we present the findings of exposure to BaP on the expression of Bcl-2, C-myc, Ki-67, Caspase-3 and Bax genes in mouse cervix. Acute intraperitoneal administration of BaP (12.5, 25, 50, 100mg/kg body weight) to ICR female mice induced a significant increase in Bcl-2, C-myc, Ki-67 mRNA and protein level till 72h except in Bcl-2 at 24h with 12.5, 25, 50mg/kg as well as at 48h with 12.5mg/kg body weight post treatment. A significant increase was also seen in Caspase-3 and Bax mRNA and protein level with peak level at 24h and gradual decrease till 72h, however, the expression of caspase-3 increased while that of Bax decreased with increasing dose of Bap after 24h. In sub chronic intraperitoneal and oral gavage administration of BaP (2.5, 5, 10mg/kg body weight), similar significant increase was observed for all the examined genes as compared to the control and vehicle groups, however the expression of Bax decreased in a dose dependent manner. The findings of this study will help in further understanding the molecular mechanism of BaP induced carcinogenesis of cervical cancer. Copyright © 2015 Elsevier GmbH. All rights reserved.

  8. p53-Dependent suppression of genome instability in germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2014-02-15

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  9. p53-Dependent suppression of genome instability in germ cells

    International Nuclear Information System (INIS)

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi

    2014-01-01

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  10. The role of p53 molecule in radiation and hyperthermic therapies

    International Nuclear Information System (INIS)

    Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

    2003-01-01

    In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

  11. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Renee

    2001-01-01

    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p21, bax, and mdm2...

  12. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Rene

    2002-01-01

    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p2l, bax, and mdm2...

  13. Apoptosis and BCL-2 expression as predictors of survival in radiation-treated non-small-cell lung cancer

    International Nuclear Information System (INIS)

    Hwang, Jun-Hwa; Lim, Sung-Chul; Kim, Young-Chul; Park, Kyung-Ok; Ahn, Sung-Ja; Chung, Woong-Ki

    2001-01-01

    Objectives: We assessed the role of apoptosis and the expression of bcl-2, p53, and c-myc oncoproteins in pretreatment histologic specimens as a predictor of response to radiation therapy and survival in non-small-cell lung cancer (NSCLC) patients. Methods: Pretreatment biopsy specimens of 68 patients with NSCLC (62 squamous cell carcinoma, 6 adenocarcinoma) were stained with hematoxylin and eosin. From 5 high-powered fields, the apoptotic index (AI) was calculated as the ratio of apoptotic tumor cells to the total number of tumor cells. Bcl-2, p53, and c-myc oncoprotein expression was detected by immunohistochemical staining. Results: Twenty-nine cases showed partial or complete remission, whereas 39 showed no response. AI ranged from 0.2 to 12.0% (mean ± SD; 4.3±2.6%, median 4.0%). There was no difference in AI between responders (4.0±2.3) and nonresponders (4.5±2.8, p>0.05). However, in the responders, AI was correlated with the degree of change in tumor volume (r=0.41, p<0.05). In an analysis of 53 subjects who survived more than 1 month after the completion of radiation therapy, the patients with a higher AI (n=27, MST=22.8 m) survived longer than those with a lower AI (n=26, MST=9.2, log-rank, p=0.03). Patients expressing bcl-2 had poorer survival (n=22, MST=6.0 m) than patients without bcl-2 (n=31, 22.8 m, p<0.003). According to multivariate analysis, three variables, bcl-2 expression, AI, and response to radiation, were independent prognostic factors for survival. Conclusion: A low level of spontaneous apoptosis and expression of apoptosis blocking bcl-2 protein in pretreatment histology predict a poor prognosis for radiation-treated NSCLC patients

  14. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    Science.gov (United States)

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  15. Friend or Foe: MicroRNAs in the p53 network.

    Science.gov (United States)

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  16. Association of the polymorphisms of the IL-1B, IL-1RN, IL-10 and p53 genes with risk of gastric cancer in a population of high risk of Costa Rica

    International Nuclear Information System (INIS)

    Alpizar Alpizar, Wagner

    2004-01-01

    Factors that increase the risk to develop gastric cancer are studied: associated factors to diet, nitrous compounds endogenous formation, genetic predisposition, infection by Helicobacter pylori and polymorphic mixes pickles in the cut out gen of p53 tumour. Also it describes like Helicobacter pylori causes inflammation and its magnitude depends of the reaction mechanisms of the innkeeper in answer to the pathogen. The study aim was to determined the association of polymorphisms of the IL-1B, IL-IRN, IL-10 and p53 genes with the gastric cancer and gastric harms in a population of high risk in Costa Rica. Blood samples of 58 patients diagnosed with gastric cancer were analysed, 99 people with no suspicions of gastric cancer according to the diagnosis by x-Ray (contrast double gastroduodenal series), 41 patients histologically classified as I and II groups in a accordance with the Japanese classification. The analyses was carried out from DNA extracted of leucocytes. Association of the polymorphisms IL-1B-31, IL-1B-511, IL-10-592, IL-10-819 and IL-10-1082 were not found with risk to develop gastric cancer in the studied population. For IL-IB+3954, it was determined that the people with the heterozygote genotype for the T allele present more risk to develop gastric cancer (OR 3.7; IC 95% 1.34-10.2; p=0.007). For the polymorphism of IL-IRN gene it was observed that heterozygote genotype carrier people for the allele 2, present more risk to develop the illness (OR 2.94; IC 1.09-7.93; p=0.03). The allele frequencies that have been related with increase of the pro inflammatory answer are higher in the total population studied here than in other populations. According with the got results it will be necessary to carry out studies with more size of sample, with representative samples of the Costa Rican population and with samples of regions of low and high risk. (author) [es

  17. Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer

    International Nuclear Information System (INIS)

    Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko

    2015-01-01

    Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer

  18. NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation

    Directory of Open Access Journals (Sweden)

    Labhart Paul

    2007-05-01

    Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

  19. Regulatory effect of Bcl-2 in ultraviolet radiation-induced apoptosis of the mouse crystalline lens.

    Science.gov (United States)

    Dong, Yuchen; Zheng, Yajuan; Xiao, Jun; Zhu, Chao; Zhao, Meisheng

    2016-03-01

    The aim of the present study was to analyze the role of Bcl-2 during the process of apoptosis in the mouse crystalline lens. In total, 12 normal mice served as the control group and 12 Bcl-2 knockout (K.O) mice served as the experimental group. The mouse crystalline lens was sampled for the detection of Bcl-2 and caspase-3 expression following exposure to ultraviolet (UV) radiation. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to determine Bcl-2 expression in the groups of normal mice receiving UV radiation or not receiving UV radiation. Samples of the murine crystalline lens were microscopically harvested and analyzed using western blotting. Apoptosis was detected using terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay. Furthermore, caspase 3 activity was examined using enzyme-linked immunosorbent assay kits, and RT-qPCR was used to analyze caspase-3 expression levels. The results of the present study demonstrated that there was no statistically significant difference in the level of Bcl-2 gene transcription between the two groups. In addition, UV radiation did not change the macrostructure of the crystalline lens in the group of normal mice or the group of Bcl-2 K.O mice. The results of the TUNEL assay indicated that the normal-UV group exhibited a more significant apoptosis level compared with the Bcl-2 K.O-UV group. Furthermore, the mRNA expression level of caspase-3 in the normal-UV group was significantly higher compared with the normal-nonUV group (Plens.

  20. Bcl-2 expression during the development and degeneration of RCS rat retinae.

    Science.gov (United States)

    Sharma, R K

    2001-12-14

    In various hereditary retinal degenerations, including that in Royal College of Surgeons (RCS) rats, the photoreceptors ultimately die by apoptosis. Bcl-2 is one of the genes, which regulates apoptosis and is thought to promote survival of cells. This study has investigated the developmental expression of Bcl-2 in RCS rat, which is a well-studied animal model for hereditary retinal degeneration. An antibody against Bcl-2 was used for its immunohistochemical localization in dystrophic RCS rat retinae from postnatal (PN) days 4, 7, 13, 35, 45, 70, 202 and 14 months. Results were compared with Bcl-2 localization in congenic non-dystrophic rats from PN 4, 7, 13, 44, 202 and 14 months. Bcl-2 immunoreactivity in non-dystrophic retinae was already present in PN 4 retinae in the nerve fiber layer (presumably in the endfeet of immature Müller cells) and in the proximal parts of certain radially aligned neuroepithelial cells/immature Müller cell radial processes. With increasing age the immunoreactivity in relatively more mature Müller cell radial processes spread distally towards the outer retina and between PN 13 and 44 it reached the adult distribution. No cell bodies in the ganglion cell layer were found to be immunoreactive. Expression of Bcl-2 immunoreactivity in dystrophic RCS rat retinae closely resembled that of non-dystrophic retinae. No immunoreactivity was seen in photoreceptors or retinal pigment epithelium in dystrophic or non-dystrophic retinae. In conclusion, Bcl-2 expression is not altered, either in terms of its chronology or the cell type expressing it, during retinal degeneration in RCS rats.

  1. Alisertib added to rituximab and vincristine is synthetic lethal and potentially curative in mice with aggressive DLBCL co-overexpressing MYC and BCL2.

    Directory of Open Access Journals (Sweden)

    Daruka Mahadevan

    Full Text Available Pearson correlation coefficient for expression analysis of the Lymphoma/Leukemia Molecular Profiling Project (LLMPP demonstrated Aurora A and B are highly correlated with MYC in DLBCL and mantle cell lymphoma (MCL, while both Auroras correlate with BCL2 only in DLBCL. Auroras are up-regulated by MYC dysregulation with associated aneuploidy and resistance to microtubule targeted agents such as vincristine. Myc and Bcl2 are differentially expressed in U-2932, TMD-8, OCI-Ly10 and Granta-519, but only U-2932 cells over-express mutated p53. Alisertib [MLN8237 or M], a highly selective small molecule inhibitor of Aurora A kinase, was synergistic with vincristine [VCR] and rituximab [R] for inhibition of cell proliferation, abrogation of cell cycle checkpoints and enhanced apoptosis versus single agent or doublet therapy. A DLBCL (U-2932 mouse model showed tumor growth inhibition (TGI of ∼ 10-20% (p = 0.001 for M, VCR and M-VCR respectively, while R alone showed ∼ 50% TGI (p = 0.001. M-R and VCR-R led to tumor regression [TR], but relapsed 10 days after discontinuing therapy. In contrast, M-VCR-R demonstrated TR with no relapse >40 days after stopping therapy with a Kaplan-Meier survival of 100%. Genes that are modulated by M-VCR-R (CENP-C, Auroras play a role in centromere-kinetochore function in an attempt to maintain mitosis in the presence of synthetic lethality. Together, our data suggest that the interaction between alisertib plus VCR plus rituximab is synergistic and synthetic lethal in Myc and Bcl-2 co-expressing DLBCL. Alisertib plus vincristine plus rituximab [M-VCR-R] may represent a new strategy for DLBCL therapy.

  2. Alisertib added to rituximab and vincristine is synthetic lethal and potentially curative in mice with aggressive DLBCL co-overexpressing MYC and BCL2.

    Science.gov (United States)

    Mahadevan, Daruka; Morales, Carla; Cooke, Laurence S; Manziello, Ann; Mount, David W; Persky, Daniel O; Fisher, Richard I; Miller, Thomas P; Qi, Wenqing

    2014-01-01

    Pearson correlation coefficient for expression analysis of the Lymphoma/Leukemia Molecular Profiling Project (LLMPP) demonstrated Aurora A and B are highly correlated with MYC in DLBCL and mantle cell lymphoma (MCL), while both Auroras correlate with BCL2 only in DLBCL. Auroras are up-regulated by MYC dysregulation with associated aneuploidy and resistance to microtubule targeted agents such as vincristine. Myc and Bcl2 are differentially expressed in U-2932, TMD-8, OCI-Ly10 and Granta-519, but only U-2932 cells over-express mutated p53. Alisertib [MLN8237 or M], a highly selective small molecule inhibitor of Aurora A kinase, was synergistic with vincristine [VCR] and rituximab [R] for inhibition of cell proliferation, abrogation of cell cycle checkpoints and enhanced apoptosis versus single agent or doublet therapy. A DLBCL (U-2932) mouse model showed tumor growth inhibition (TGI) of ∼ 10-20% (p = 0.001) for M, VCR and M-VCR respectively, while R alone showed ∼ 50% TGI (p = 0.001). M-R and VCR-R led to tumor regression [TR], but relapsed 10 days after discontinuing therapy. In contrast, M-VCR-R demonstrated TR with no relapse >40 days after stopping therapy with a Kaplan-Meier survival of 100%. Genes that are modulated by M-VCR-R (CENP-C, Auroras) play a role in centromere-kinetochore function in an attempt to maintain mitosis in the presence of synthetic lethality. Together, our data suggest that the interaction between alisertib plus VCR plus rituximab is synergistic and synthetic lethal in Myc and Bcl-2 co-expressing DLBCL. Alisertib plus vincristine plus rituximab [M-VCR-R] may represent a new strategy for DLBCL therapy.

  3. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    Science.gov (United States)

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  4. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    Science.gov (United States)

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  5. A Unique Mdm2-Binding Mode of the 3-Pyrrolin-2-one- and 2-Furanone-Based Antagonists of the p53-Mdm2 Interaction

    NARCIS (Netherlands)

    Surmiak, Ewa; Twarda-Clapa, Aleksandra; Zak, Krzysztof M.; Musielak, Bogdan; Tomala, Marcin D.; Kubica, Katarzyna; Grudnik, Przemyslaw; Madej, Mariusz; Jablonski, Mateusz; Potempa, Jan; Kalinowska-Tluscik, Justyna; Dömling, Alexander; Dubin, Grzegorz; Holak, Tad A.

    2016-01-01

    The p53 pathway is inactivated in almost all types of cancer by mutations in the p53 encoding gene or overexpression of the p53 negative regulators, Mdm2 and/or Mdmx. Restoration of the p53 function by inhibition of the p53-Mdm2/Mdmx interaction opens up a prospect for a nongenotoxic anticancer

  6. p53 functions as a cell cycle control protein in osteosarcomas.

    OpenAIRE

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  7. Dual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma.

    Science.gov (United States)

    Van Goethem, Alan; Yigit, Nurten; Moreno-Smith, Myrthala; Vasudevan, Sanjeev A; Barbieri, Eveline; Speleman, Frank; Shohet, Jason; Vandesompele, Jo; Van Maerken, Tom

    2017-08-22

    Wild-type p53 tumor suppressor activity in neuroblastoma tumors is hampered by increased MDM2 activity, making selective MDM2 antagonists an attractive therapeutic strategy for this childhood malignancy. Since monotherapy in cancer is generally not providing long-lasting clinical responses, we here aimed to identify small molecule drugs that synergize with idasanutlin (RG7388). To this purpose we evaluated 15 targeted drugs in combination with idasanutlin in three p53 wild type neuroblastoma cell lines and identified the BCL2 inhibitor venetoclax (ABT-199) as a promising interaction partner. The venetoclax/idasanutlin combination was consistently found to be highly synergistic in a diverse panel of neuroblastoma cell lines, including cells with high MCL1 expression levels. A more pronounced induction of apoptosis was found to underlie the synergistic interaction, as evidenced by caspase-3/7 and cleaved PARP measurements. Mice carrying orthotopic xenografts of neuroblastoma cells treated with both idasanutlin and venetoclax had drastically lower tumor weights than mice treated with either treatment alone. In conclusion, these data strongly support the further evaluation of dual BCL2/MDM2 targeting as a therapeutic strategy in neuroblastoma.

  8. Regulation of Metabolic Activity by p53

    Directory of Open Access Journals (Sweden)

    Jessica Flöter

    2017-05-01

    Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.

  9. Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline

    Directory of Open Access Journals (Sweden)

    Noriko Mori

    2004-10-01

    Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.

  10. Abnormal P-53 suppressor gene expression predicts for a poorer outcome in patients with locally advanced adenocarcinoma of the prostate treated by external beam radiation therapy with or without pre-radiation androgen ablation: results based on RTOG study 86-10

    International Nuclear Information System (INIS)

    Lawton, Colleen A.; Grignon, David; Caplan, Richard; Sarkar, Fazlul; Forman, Jeffrey; Mesic, John; Fu, Karen K.; Abrams, Ross

    1995-01-01

    Purpose/Objective: The purpose of this study is to establish the effect of the abnormal expression of the P-53 suppressor gene on the results of locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation. Materials and Methods: Patients evaluated were part of a RTOG phase III multi-institutional trial. This trial assessed the value of pre-radiation therapy androgen ablation on patients with locally advanced disease (bulky stage B and stage C). Of the 471 patients registered, pre-treatment pathological material was available for 129 patients. P-53 status was determined immunohistochemically utilizing a commercially available antibody (D07). Clinical endpoints evaluated were overall survival and development of metastases. Results: Twenty-three of the 129 patients had abnormal expression of the P-53 suppressor gene. Presence of this abnormal expression significantly correlated with lower overall survival (p=0.03) and the development of distant metastases (p=0.03). Abnormal expression of the P-53 gene was an independent prognostic indicator when evaluated against clinical stage and Gleason score. Conclusion: This data from patients entered on a phase III multi-institutional, randomized clinical trial shows that abnormal P-53 suppressor gene expression as determined immunohistochemically is an independent predictor of poorer survival and the development of distant metastases in patients with locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation

  11. Induction of Apoptosis and expression of Apoptosis-related gene products in response to radiation in murine tumors

    International Nuclear Information System (INIS)

    Seong, J. S.

    1997-01-01

    To analyze the involvement of apoptosis regulatory genes p53, p21 waf1/cip1 , bax and bcl-2 in induction of apoptosis by radiation in murine tumors. The radiation-sensitive ovarian carcinoma OCa-I and the radiation-resistant hepatocarcinoma HCa-I were used. Tumors, 8mm in diameter, were irradiated with 25Gy and at various times after irradiation, ranging from 1 to 48 h, were analyzed histologically for apoptosis and by western blot for alterations in the expression of these genes. The p53 status of the tumors were determined by the polymerase chain reaction-single strand conformation polymorphism assay. Both tumors were positive for wild-type p53. Radiation induced apoptosis in OCa-I but not in HCa-I. Apoptosis developed rapidly, peaked at 2 h after irradiation and returned to almost the background level at 48 h. In OCa-I radiation upregulated the expression of p53, p21 waf1/cip1 , and the bcl-2/bax ratio was decreased. In HCa-I radiation increased the expression of both p53 and p21 waf1/cip1 , although the increase of the latter was small. The bcl-2/bax ratio was greatly increased. In general the observed changes occurred within a few hours after irradiation, and either preceded or coincided with development of apoptosis. The development of apoptosis required upregulation of both p53 and p21 waf1/cip1 as well as a decrease in bcl-2/bax ratio. In contrast, an increase in bcl-2/bax ratio prevented apoptosis in the presence of upregulated p53 and p21 waf1/cip1 . These findings identified the involvement of multiple oncogenes in apoptosis regulation in vivo and demonstrate the complexity that may be associated with the use of a single oncogene assessment for predicting the outcome of cancer therapy with cytotoxic agents. (author)

  12. Induction of Apoptosis and expression of Apoptosis-related gene products in response to radiation in murine tumors

    Energy Technology Data Exchange (ETDEWEB)

    Seong, J S [Yonsei Univ., Seoul (Korea, Republic of). Coll. of Medicine; Hunter, N R; Milas, L [Texas Univ., Houston, TX (United States)

    1997-09-01

    To analyze the involvement of apoptosis regulatory genes p53, p21{sup waf1/cip1}, bax and bcl-2 in induction of apoptosis by radiation in murine tumors. The radiation-sensitive ovarian carcinoma OCa-I and the radiation-resistant hepatocarcinoma HCa-I were used. Tumors, 8mm in diameter, were irradiated with 25Gy and at various times after irradiation, ranging from 1 to 48 h, were analyzed histologically for apoptosis and by western blot for alterations in the expression of these genes. The p53 status of the tumors were determined by the polymerase chain reaction-single strand conformation polymorphism assay. Both tumors were positive for wild-type p53. Radiation induced apoptosis in OCa-I but not in HCa-I. Apoptosis developed rapidly, peaked at 2 h after irradiation and returned to almost the background level at 48 h. In OCa-I radiation upregulated the expression of p53, p21{sup waf1/cip1}, and the bcl-2/bax ratio was decreased. In HCa-I radiation increased the expression of both p53 and p21{sup waf1/cip1}, although the increase of the latter was small. The bcl-2/bax ratio was greatly increased. In general the observed changes occurred within a few hours after irradiation, and either preceded or coincided with development of apoptosis. The development of apoptosis required upregulation of both p53 and p21{sup waf1/cip1} as well as a decrease in bcl-2/bax ratio. In contrast, an increase in bcl-2/bax ratio prevented apoptosis in the presence of upregulated p53 and p21{sup waf1/cip1}. These findings identified the involvement of multiple oncogenes in apoptosis regulation in vivo and demonstrate the complexity that may be associated with the use of a single oncogene assessment for predicting the outcome of cancer therapy with cytotoxic agents. (author).

  13. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

    Directory of Open Access Journals (Sweden)

    Fuqiang Xing

    Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

  14. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    Science.gov (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  15. Expression of Bcl-2 in canine osteosarcoma | Piro | Open Veterinary ...

    African Journals Online (AJOL)

    Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different ...

  16. Targeted BCL2 inhibition effectively inhibits neuroblastoma tumour growth

    NARCIS (Netherlands)

    Lamers, Fieke; Schild, Linda; den Hartog, Ilona J. M.; Ebus, Marli E.; Westerhout, Ellen M.; Ora, Ingrid; Koster, Jan; Versteeg, Rogier; Caron, Huib N.; Molenaar, Jan J.

    2012-01-01

    Genomic aberrations of key regulators of the apoptotic pathway have hardly been identified in neuroblastoma. We detected high BCL2 mRNA and protein levels in the majority of neuroblastoma tumours by Affymetrix expression profiling and Tissue Micro Array analysis. This BCL2 mRNA expression is

  17. Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation

    International Nuclear Information System (INIS)

    Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki

    2001-01-01

    We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)

  18. Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

    Directory of Open Access Journals (Sweden)

    Paola De Feudis

    2000-05-01

    Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

  19. Tumor hypoxia, p53, and prognosis in cervical cancers

    International Nuclear Information System (INIS)

    Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen

    2001-01-01

    Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p

  20. The Bcl-2 Family in Host-Virus Interactions.

    Science.gov (United States)

    Kvansakul, Marc; Caria, Sofia; Hinds, Mark G

    2017-10-06

    Members of the B cell lymphoma-2 (Bcl-2) family are pivotal arbiters of mitochondrially mediated apoptosis, a process of fundamental importance during tissue development, homeostasis, and disease. At the structural and mechanistic level, the mammalian members of the Bcl-2 family are increasingly well understood, with their interplay ultimately deciding the fate of a cell. Dysregulation of Bcl-2-mediated apoptosis underlies a plethora of diseases, and numerous viruses have acquired homologs of Bcl-2 to subvert host cell apoptosis and autophagy to prevent premature death of an infected cell. Here we review the structural biology, interactions, and mechanisms of action of virus-encoded Bcl-2 proteins, and how they impact on host-virus interactions to ultimately enable successful establishment and propagation of viral infections.

  1. Origin of adenocarcinoma in Barrett's esophagus: P53 and Ki67 expression and histopathologic background Origem do adenocarcinoma no esôfago de Barrett: bases histopathológicas e expressão dos genes p53 e Ki67

    Directory of Open Access Journals (Sweden)

    Sergio Szachnowicz

    2005-04-01

    Full Text Available Barrett's esophagus is the substitution of squamous epithelium of the distal esophagus by columnar epithelium. Intestinal metaplasia in Barrett's esophagus is considered to be the main risk factor for the development of adenocarcinoma. Diffuse adenocarcinoma and Barrett's esophagus without intestinal metaplasia are rare, and reports on the subject are scarce. PURPOSE AND METHOD: To estimate the prevalence of adenocarcinoma in 297 patients with Barrett's esophagus, during the period of 1990 to 2002, and in 13 patients undergoing surgery, to conduct detailed macroscopic and microscopic analysis, with performance of immunohistochemical tests for p53 and Ki67, correlating the type of tumor with its adjacent epithelium. RESULTS: In our patients with Barrett's esophagus, there was a prevalence of 5.7% of adenocarcinoma. The tumors developed only when the Barrett's esophagus segment was long (>3.0 cm. Tumors were located close to the squamous-columnar junction. The histological study revealed 2 patients (15.4% with Barrett's esophagus adjacent to a tumor with gastric metaplasia without the presence of intestinal metaplasia. Tumors were classified according to Nakamura's classification (23% differentiated pattern, and 77% undifferentiated pattern and to Lauren's classification (61% intestinal and 39% diffuse. The difference is due to the migration of microtubular and foveolar tumors of undifferentiated (gastric pattern in Nakamuras classification to the Lauren's intestinal type. The immunohistochemical test for Ki67 was strongly positive in all the patients, thus evidencing intense cell proliferation in both the columnar epithelium and tumor. Expression of p53 was negative in 67% of the adjacent columnar epithelia and 42% of the tumors, without any correlation between the tissue types. CONCLUSION: Adenocarcinoma develops from mixed columnar epithelium, either intestinal or gastric, showing both the gastric and the intestinal patterns; thus, tumors can

  2. Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...

    African Journals Online (AJOL)

    apoptotic genes, BCL2, Bcl-xL, XIAP and Survivin), in cervical carcinoma cells. Methods: Annexin V-FITC/propidium iodide (PI) staining was used for the investigation of cell apoptosis. RNA RNeasy Kits was used to isolate RNA and Omniscript ...

  3. Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines

    DEFF Research Database (Denmark)

    Liu, Ying; Bodmer, Walter F

    2006-01-01

    A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...

  4. Distinct pattern of p53 mutations in bladder cancer

    DEFF Research Database (Denmark)

    Spruck, C H; Rideout, W M; Olumi, A F

    1993-01-01

    A distinct mutational spectrum for the p53 tumor suppressor gene in bladder carcinomas was established in patients with known exposures to cigarette smoke. Single-strand conformational polymorphism analysis of exons 5 through 8 of the p53 gene showed inactivating mutations in 16 of 40 (40%) bladder...... tumors from smokers and 13 of 40 (33%) tumors from lifetime nonsmokers. Overall, 13 of the 50 (26%) total point mutations discovered in this and previous work were G:C-->C:G transversions, a relatively rare mutational type in human tumors. In six tumors, identical AGA (Arg)-->ACA (Thr) point mutations...... double mutations, four of which were tandem mutations on the same allele. No double mutations were found in tumors from nonsmoking patients. None of the mutations in smokers were G:C-->T:A transversions, which would be anticipated for exposure to the suspected cigarette smoke carcinogen 4-aminobiphenyl...

  5. Inter- and intratumoral heterogeneity of BCL2 correlates with IgH expression and prognosis in follicular lymphoma

    International Nuclear Information System (INIS)

    Barreca, A; Martinengo, C; Annaratone, L; Righi, L; Chiappella, A; Ladetto, M; Demurtas, A; Chiusa, L; Stacchini, A; Crosetto, N; Oudenaarden, A van; Chiarle, R

    2014-01-01

    Most follicular lymphomas (FLs) are genetically defined by the t(14;18)(q32;q21) translocation that juxtaposes the BCL2 gene to the immunoglobulin heavy chain (IgH) 3' regulatory regions (IgH-3'RRs). Despite this recurrent translocation, FL cases are heterogeneous in terms of intratumoral clonal diversity for acquired mutations and variations in the tumor microenvironment. Here we describe an additional mechanism that contributes to inter- and intratumoral heterogeneity in FLs. By applying a novel single-molecule RNA fluorescence-based in situ hybridization (FISH) technique to detect mRNA molecules of BCL2 and IgH in single cells, we found marked heterogeneity in the number of BCL2 mRNA transcripts within individual lymphoma cells. Moreover, BCL2 mRNA molecules correlated with IgH mRNA molecules in individual cells both in t(14;18) lymphoma cell lines and in patient samples. Consistently, a strong correlation between BCL2 and IgH protein levels was found in a series of 205 primary FL cases by flow cytometry and immunohistochemistry. Inter- and intratumoral heterogeneity of BCL2 expression determined resistance to drugs commonly used in FL treatment and affected overall survival of FL patients. These data demonstrate that BCL2 and IgH expressions are heterogeneous and coregulated in t(14;18)-translocated cells, and determine the response to therapy in FL patients

  6. Lactose binding to human galectin-7 (p53-induced gene 1) induces long-range effects through the protein resulting in increased dimer stability and evidence for positive cooperativity

    Science.gov (United States)

    Ermakova, Elena; Miller, Michelle C; Nesmelova, Irina V; López-Merino, Lara; Berbís, Manuel Alvaro; Nesmelov, Yuri; Tkachev, Yaroslav V; Lagartera, Laura; Daragan, Vladimir A; André, Sabine; Cañada, F Javier; Jiménez-Barbero, Jesús; Solís, Dolores; Gabius, Hans-Joachim; Mayo, Kevin H

    2013-01-01

    The product of p53-induced gene 1 is a member of the galectin family, i.e., galectin-7 (Gal-7). To move beyond structural data by X-ray diffraction, we initiated the study of the lectin by nuclear magnetic resonance (NMR) and circular dichroism spectroscopies, and molecular dynamics (MD) simulations. In concert, our results indicate that lactose binding to human Gal-7 induces long-range effects (minor conformational shifts and changes in structural dynamics) throughout the protein that result in stabilization of the dimer state, with evidence for positive cooperativity. Monte Carlo fits of 15N-Gal-7 HSQC titrations with lactose using a two-site model yield K1 = 0.9 ± 0.6 × 103 M−1 and K2 = 3.4 ± 0.8 × 103 M−1. Ligand binding-induced stabilization of the Gal-7 dimer was supported by several lines of evidence: MD-based calculations of interaction energies between ligand-loaded and ligand-free states, gel filtration data and hetero-FRET spectroscopy that indicate a highly reduced tendency for dimer dissociation in the presence of lactose, CD-based thermal denaturation showing that the transition temperature of the lectin is significantly increased in the presence of lactose, and saturation transfer difference (STD) NMR using a molecular probe of the monomer state whose presence is diminished in the presence of lactose. MD simulations with the half-loaded ligand-bound state also provided insight into how allosteric signaling may occur. Overall, our results reveal long-range effects on Gal-7 structure and dynamics, which factor into entropic contributions to ligand binding and allow further comparisons with other members of the galectin family. PMID:23376190

  7. Palmitate induces VSMC apoptosis via toll like receptor (TLR)4/ROS/p53 pathway.

    Science.gov (United States)

    Zhang, Yuanjun; Xia, Guanghao; Zhang, Yaqiong; Liu, Juxiang; Liu, Xiaowei; Li, Weihua; Lv, Yaya; Wei, Suhong; Liu, Jing; Quan, Jinxing

    2017-08-01

    Toll-like receptor 4 (TLR4) has been implicated in vascular inflammation, as well as in the pathogenesis of atherosclerosis and diabetes. Vascular smooth muscle cell (VSMC) apoptosis has been shown to induce plaque vulnerability in atherosclerosis. Previous studies reported that palmitate induced apoptosis in VSMCs; however, the role of TLR4 in palmitate-induced apoptosis in VSMCs has not yet been defined. In this study, we investigated whether or not palmitate-induced apoptosis depended on the activation of the TLR4 pathway. VSMCs were treated with or without palmitate, CRISPR/Cas9z-mediated genome editing methods were used to deplete TLR4 expression, while NADPH oxidase inhibitors were used to inhibit reactive oxygen species (ROS) generation. Cell apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, ROS was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) method, the mRNA and protein expression levels of caspase 3, caspase 9, BCL-2 and p53 were studied by real-time polymerase chain reaction (RT-PCR) and ELISA. Palmitate significantly promotes VSMC apoptosis, ROS generation, and expression of caspase 3, caspase 9 and p53; while NADPH oxidase inhibitor pretreatment markedly attenuated these effects. Moreover, knockdown of TLR4 significantly blocked palmitate-induced ROS generation and VSMC apoptosis accompanied by inhibition of caspase 3, caspase 9, p53 expression and restoration of BCL-2 expression. Our results suggest that palmitate-induced apoptosis depends on the activation of the TLR4/ROS/p53 signaling pathway, and that TLR4 may be a potential therapeutic target for the prevention and treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Aspalathin Reverts Doxorubicin-Induced Cardiotoxicity through Increased Autophagy and Decreased Expression of p53/mTOR/p62 Signaling

    Directory of Open Access Journals (Sweden)

    Rabia Johnson

    2017-09-01

    Full Text Available Doxorubicin (Dox is an effective chemotherapeutic agent used in the treatment of various cancers. Its clinical use is often limited due to its potentially fatal cardiotoxic side effect. Increasing evidence indicates that tumour protein p53 (p53, adenosine monophosphate-activated protein kinase (AMPK, nucleoporin p62 (p62, and the mammalian target of rapamycin (mTOR are critical mediators of Dox-induced apoptosis, and subsequent dysregulation of autophagy. Aspalathin, a polyphenolic dihydrochalcone C-glucoside has been shown to activate AMPK while decreasing the expression of p53. However, the role that aspalathin could play in the inhibition of Dox-induced cardiotoxicity through increased autophagy flux remained unexplored. H9c2 cardiomyocytes and Caov-3 ovarian cancer cells were cultured in Dulbecco’s Modified Eagle’s medium and treated with or without Dox for five days. Thereafter, cells exposed to 0.2 µM Dox were co-treated with either 20 µM Dexrazozane (Dexra or 0.2 µM aspalathin (ASP daily for 5 days. Results obtained showed that ASP mediates its cytoprotective effect in a p53-dependent manner, by increasing the Bcl-2/Bax ratio and decreasing apoptosis. The latter effect was diminished through ASP-induced activation of autophagy-related genes (Atgs with an associated decrease in p62 through induction of AMPK and Fox01. Furthermore, we showed that ASP was able to potentiate this effect without decreasing the anti-cancer efficacy of Dox, as could be observed in Caov-3 ovarian cancer cells. Taken together, the data presented in this study provides a credible mechanism by which ASP co-treatment could protect the myocardium from Dox-induced cardiotoxicity.

  9. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  10. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  11. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  12. MDM2 gene SNP309 T/G and p53 gene SNP72 G/C do not influence diffuse large B-cell non-Hodgkin lymphoma onset or survival in central European Caucasians

    Directory of Open Access Journals (Sweden)

    Landt Olfert

    2008-04-01

    Full Text Available Abstract Background SNP309 T/G (rs2279744 causes higher levels of MDM2, the most important negative regulator of the p53 tumor suppressor. SNP72 G/C (rs1042522 gives rise to a p53 protein with a greatly reduced capacity to induce apoptosis. Both polymorphisms have been implicated in cancer. The SNP309 G-allele has recently been reported to accelerate diffuse large B-cell lymphoma (DLBCL formation in pre-menopausal women and suggested to constitute a genetic basis for estrogen affecting human tumorigenesis. Here we asked whether SNP309 and SNP72 are associated with DLBCL in women and are correlated with age of onset, diagnosis, or patient's survival. Methods SNP309 and SNP72 were PCR-genotyped in a case-control study that included 512 controls and 311 patients diagnosed with aggressive NHL. Of these, 205 were diagnosed with DLBCL. Results The age of onset was similar in men and women. The control and patients group showed similar SNP309 and SNP72 genotype frequencies. Importantly and in contrast to the previous findings, similar genotype frequencies were observed in female patients diagnosed by 51 years of age and those diagnosed later. Specifically, 3/20 female DLBCL patients diagnosed by 51 years of age were homozygous for SNP309 G and 2/20 DLBCL females in that age group were homozygous for SNP72 C. Neither SNP309 nor SNP72 had a significant influence on event-free and overall survival in multivariate analyses. Conclusion In contrast to the previous study on Ashkenazi Jewish Caucasians, DLBCL in pre-menopausal women of central European Caucasian ethnicity was not associated with SNP309 G. Neither SNP309 nor SNP72 seem to be correlated with age of onset, diagnosis, or survival of patients.

  13. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    OpenAIRE

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...

  14. MYC/BCL2/BCL6 triple hit lymphoma: a study of 40 patients with a comparison to MYC/BCL2 and MYC/BCL6 double hit lymphomas.

    Science.gov (United States)

    Huang, Wenting; Medeiros, L Jeffrey; Lin, Pei; Wang, Wei; Tang, Guilin; Khoury, Joseph; Konoplev, Sergej; Yin, C Cameron; Xu, Jie; Oki, Yasuhiro; Li, Shaoying

    2018-05-21

    High-grade B-cell lymphomas with MYC, BCL2, and BCL6 rearrangements (triple hit lymphoma) are uncommon. We studied the clinicopathologic features of 40 patients with triple hit lymphoma and compared them to 157 patients with MYC/BCL2 double hit lymphoma and 13 patients with MYC/BCL6 double hit lymphoma. The triple hit lymphoma group included 25 men and 15 women with a median age of 61 years (range, 34-85). Nine patients had a history of B-cell lymphoma. Histologically, 23 (58%) cases were diffuse large B-cell lymphoma and 17 cases had features of B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and Burkitt lymphoma. Most cases of triple hit lymphoma were positive for CD10 (100%), BCL2 (95%), BCL6 (82%), MYC (74%), and 71% with MYC and BCL2 coexpression. P53 was overexpressed in 29% of triple hit lymphoma cases. The clinicopathological features of triple hit lymphoma patients were similar to patients with MYC/BCL2 and MYC/BCL6 double hit lymphoma, except that triple hit lymphoma cases were more often CD10 positive compared with MYC/BCL6 double hit lymphoma (p hit lymphoma and double hit lymphoma and overall survival in triple hit lymphoma patients was 17.6 months, similar to the overall survival of patients with double hit lymphoma (p = 0.67). Patients with triple hit lymphoma showing P53 overexpression had significantly worse overall survival compared with those without P53 overexpression (p = 0.04). On the other hand, double expressor status and prior history of B-cell lymphoma did not correlate with overall survival. In conclusion, most patients with triple hit lymphoma have an aggressive clinical course and poor prognosis and these tumors have a germinal center B-cell immunophenotype, similar to patients with double hit lymphomas. P53 expression is a poor prognostic factor in patients with triple hit lymphoma.

  15. Prognostic Importance of Bcl-2 Expression in Colon Cancer

    Directory of Open Access Journals (Sweden)

    Arsenal Alikanoðlu

    2012-09-01

    Full Text Available Aim: TNM classification, that had been established according to pathologic and anatomic characteristics of the lesion , is the most important factor in decision of adjuvant therapy in colon cancer. Despite curative resection, recurrence can ocur with a rate of 20-30% in early stage disease. Therefore efficieny of TNM classification is controversial. In recent years ,significance of molecular characteristics of the tumors besides their anatomic and pathologic characteristics in determining the biological behaviour and response to treatment have been discussed. In our study, relation between expression of Bcl-2 and the other known prognostic factors in colon cancer had been searched. Material and Method: Patients who had been followed up in our clinic were enrolled in this study. Expression of Bcl-2 was searched by immunohistochemical method. Results: A total of 52, 19 (%36.5 female and 33 (%63.5 male patients were enrolled in this study. Bcl-2 expression was found positive in 7 (%13.5 and negative in 45 (%86.5 patients. Statistically no significant relationship was found between Bcl-2 expression and sex, stage, regional lymph node involvement, presence of distant metastasis and histologic grade. Discussion: In our study, although not in a statistical significance, we found that Bcl-2 expression is related to early stage disease. Bcl-2 is a low-priced and easily accessible prognostic marker. We think that establishing expression of Bcl-2 by immunohistohemistry may play a role in determining prognosis of patients with colon cancer.

  16. Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.

    Science.gov (United States)

    Suppiah, Aravind; Greenman, John

    2013-08-07

    Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.

  17. p53 represses autophagy in a cell cycle-dependent fashion.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido

    2008-10-01

    Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.

  18. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Science.gov (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  19. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  20. p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Sally Hopkins-Donaldson

    2006-07-01

    Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

  1. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    Science.gov (United States)

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  2. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    Directory of Open Access Journals (Sweden)

    Iva Simeonova

    2013-06-01

    Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.

  3. p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

    Science.gov (United States)

    Cox, Darren P

    2012-01-01

    Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  5. Fluoxetine protects against IL-1β-induced neuronal apoptosis via downregulation of p53.

    Science.gov (United States)

    Shan, Han; Bian, Yaqi; Shu, Zhaoma; Zhang, Linxia; Zhu, Jialei; Ding, Jianhua; Lu, Ming; Xiao, Ming; Hu, Gang

    2016-08-01

    Fluoxetine, a selective serotonin reuptake inhibitor, exerts neuroprotective effects in a variety of neurological diseases including stroke, but the underlying mechanism remains obscure. In the present study, we addressed the molecular events in fluoxetine against ischemia/reperfusion-induced acute neuronal injury and inflammation-induced neuronal apoptosis. We showed that treatment of fluoxetine (40 mg/kg, i.p.) with twice injections at 1 h and 12 h after transient middle cerebral artery occlusion (tMCAO) respectively alleviated neurological deficits and neuronal apoptosis in a mouse ischemic stroke model, accompanied by inhibiting interleukin-1β (IL-1β), Bax and p53 expression and upregulating anti-apoptotic protein Bcl-2 level. We next mimicked neuroinflammation in ischemic stroke with IL-1β in primary cultured cortical neurons and found that pretreatment with fluoxetine (1 μM) prevented IL-1β-induced neuronal apoptosis and upregulation of p53 expression. Furthermore, we demonstrated that p53 overexpression in N2a cell line abolished the anti-apoptotic effect of fluoxetine, indicating that p53 downregulation is required for the protective role of fluoxetine in IL-1β-induced neuronal apoptosis. Fluoxetine downregulating p53 expression could be mimicked by SB203580, a specific inhibitor of p38, but blocked by anisomycin, a p38 activator. Collectively, our findings have revealed that fluoxetine protects against IL-1β-induced neuronal apoptosis via p38-p53 dependent pathway, which give us an insight into the potential of fluoxetine in terms of opening up novel therapeutic avenues for neurological diseases including stroke. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

    1995-01-01

    G1/S arrest. Cell cycle checkpoint arrest in response to 4 or 8 Gy X-rays was measured without caffeine and with 0.5 and 2mM caffeine. In (+/+) cells, G1/S and G2/M arrest was seen and there was no demonstrable impact of caffeine at either dose on either checkpoint. By contrast (-/-) cells showed a clear reduction (50%) of the size of G2/M arrest at 0.5mM caffeine and complete override at 2mM caffeine. These data imply that cells which lack p53, are sensitized by low-dose caffeine and their G2/M checkpoint is altered, seen by the different effects of caffeine upon G2/M override. Tumor cells which do and do not have functional p53 have also been evaluated. Preliminary data suggest a similar conclusion can be drawn. MCF-7 cells transfected with control plasmid or plasmids containing the gene for HPV-E6 protein also show sensitization with low dose caffeine only in cells which have E6. Conclusions: The greater caffeine-induced radiosensitization in p53(-) cells suggests that p53, already shown to control the G1/S checkpoint, may also influence aspects of G2/M arrest. These data indicate an opportunity for therapeutic gain by combining DNA damaging agents with compounds that disrupt G2/M arrest in tumors lacking functional p53. The role of p53 in G2/M transition remains to be defined

  7. Increased Arf/p53 activity in stem cells, aging and cancer.

    Science.gov (United States)

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  8. Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas

    Directory of Open Access Journals (Sweden)

    Ming-Fu eChiang

    2013-03-01

    Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.

  9. Time-dependent effect of severe hypoxia/reoxygenation on oxidative stress level, antioxidant capacity and p53 accumulation in mitochondria of rat heart

    Directory of Open Access Journals (Sweden)

    O. A. Gonchar

    2017-12-01

    Full Text Available The intensity of oxidative stress, protein expression of antiapoptotic Bcl-2 as well as antioxidant enzymes manganese superoxide dismutase (MnSOD and glutathione peroxidase (GPx and their regulator p53 were studied in the mitochondria of rat heart. Sessions of repeated hypoxia/reoxygenation ((H/R, 5 cycles of 10 min hypoxia (5.5% O2 in N2 alternated with 10 min normoxia, daily were performed in our study. It was shown that short-term sessions of H/R (during 1-3 days caused a significant increase in the oxidative stress markers (ROS formation and lipid peroxidation, mitochondrial p53 translocation, a decrease in MnSOD­ protein expression/activity and Bcl-2 protein content, but up-regulated GPx. We have demonstrated that prolonged H/R (7-14 days induced myocardial tolerance to fluctuation in oxygen levels that was associa­ted with the reduction in mitochondrial p53 protein content, elevation of mitochondrial Bcl-2 protein level, and increase in antioxidant capacity. A close correlation between the mitochondrial p53 accumulation and ROS formation as well as the activity and protein content of MnSOD and GPx allowed us to assume that p53 took an active part in the regulation of prooxidant/antioxidant balance in mitochondria of rat heart during repeated