CORRELATION BETWEEN PROTEIN-WITH-MOLECULAR-WEIGHT-53 (P53, BURKIT CELL LYMPHOMA 2 (BCL2, AND FAS LIGAND (FASL AND VASCULAR-CELL-ADHESION-MOLECULE-1 (VCAM-1 MRNA EXPRESSION LEVELS IN A PATHOGENESIS STUDY OF PREECLAMPSIA

Directory of Open Access Journals (Sweden)

Mintareja Teguh

2014-06-01

Full Text Available Objective: To determine the role of protein-with-molecular-weight-53 (p53, burkit cell lymphoma 2 (Bcl2, Fas ligand (FasL mRNA, and vascular cell adhesion molecule 1 (VCAM-1, known as the apoptosis-related molecular pathway, in preeclamptic patients. Methods: Observation on the correlation between the mRNA levels of p53, Bcl2 and FasL and VCAM-1 in 31 subjects at 28-42 weeks gestational age was performed in this study using the real time reverse transcriptase-polymerase chain reaction (RT-PCR. Results: The results showed that p53 mRNA increased (>1.2350 ng/μL in the preeclampsia group compared to the normal pregnancy group (p=0.010, Bcl2 mRNA was lower (≤0.9271 ng/μL in the preeclampsia group than the control group (p=0.041. There was also a tendency of increased FasL mRNA expression (>0.5509 ng/μL in the preeclampsia group compared to the normal pregnancy group (p=0.300. The level of VCAM-1 elevated (>890.08 ng/mL in the preeclampsia group compared to the normal pregnancy group (p=0.001. In preeclampsia, the correlation between the Bcl2/p53 ratio and VCAM-1 was r=0.541 (p=0.002, whereas the correlation in normal pregnancy was r=0.099 (p=0.595. Conclusions: There are correlations between the mRNA expression levels of p53 and Bcl2 as an intrinsic pathway of apoptosis along with the VCAM-1 levels in the incidence of preeclampsia. However, no correlation is found between FasL mRNA expression and the incidence of preeclampsia.

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

DEFF Research Database (Denmark)

Kyndi, M.; Sorensen, F.B.; Alsner, J.

2008-01-01

-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

Correlation Among Six Biologic Factors (p53, p21WAF1, MIB-1, EGFR, HER2, and Bcl-2) and Clinical Outcomes After Curative Chemoradiation Therapy in Squamous Cell Cervical Cancer

International Nuclear Information System (INIS)

Yamashita, Hideomi; Murakami, Naoya; Asari, Takao; Okuma, Kae; Ohtomo, Kuni; Nakagawa, Keiichi

2009-01-01

Purpose: The expressions of six cell-cycle-associated proteins were analyzed in cervical squamous cell carcinomas in correlation in a search for prognostic correlations in tumors treated with concurrent chemoradiation therapy (cCRT). Methods and Materials: The expressions of p53, p21/waf1/cip1, molecular immunology borstel-1 (MIB-1), epidermal growth factor receptor (EGFR), human epidermal growth factor receptor type 2 (HER2), and Bcl-2 were studied using an immunohistochemical method in 57 cases of cervical squamous cell carcinoma treated with cCRT. Patients received cCRT between 1998 and 2005. The mean patient age was 61 years (range, 27-82 years). The number of patients with Stage II, III, and IVA disease was 18, 29, and 10, respectively. Results: The number of patients with tumors positive for p53, p21/waf1/cip1, MIB-1, EGFR, HER2, and Bcl-2 was 26, 24, 49, 26, 13, and 11, respectively; no significant correlation was noted. The 5-year overall survival rates of HER2-positive and -negative patients was 76% vs. 44%, which was of borderline significance (p = 0.0675). No significant correlation was noted between overall survival and expressions of p53, p21/waf1/cip1, MIB-1, EGFR, and Bcl-2. No correlation was observed between local control and expression of any of the proteins. Conclusion: Expression of HER2 protein had a weak impact of borderline significance on overall survival in squamous cell carcinoma of the uterine cervix treated with cCRT. However, no clinical associations could be established for p53, p21/waf1/cip1, MIB-1, EGFR, and Bcl-2 protein expressions.

Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

DEFF Research Database (Denmark)

Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

2008-01-01

-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

Pure versus combined Merkel cell carcinomas: immunohistochemical evaluation of cellular proteins (p53, Bcl-2, and c-kit) reveals significant overexpression of p53 in combined tumors.

Science.gov (United States)

Lai, Jonathan H; Fleming, Kirsten E; Ly, Thai Yen; Pasternak, Sylvia; Godlewski, Marek; Doucette, Steve; Walsh, Noreen M

2015-09-01

Merkel cell polyomavirus is of oncogenic significance in approximately 80% of Merkel cell carcinomas. Morphological subcategories of the tumor differ in regard to viral status, the rare combined type being uniformly virus negative and the predominant pure type being mainly virus positive. Indications that different biological subsets of the tumor exist led us to explore this diversity. In an Eastern Canadian cohort of cases (75 patients; mean age, 76 years [range, 43-91]; male/female ratio, 43:32; 51 [68%] pure and 24 [34%] combined tumors), we semiquantitatively compared the immunohistochemical expression of 3 cellular proteins (p53, Bcl-2, and c-kit) in pure versus combined groups. Viral status was known in a subset of cases. The significant overexpression of p53 in the combined group (mean [SD], 153.8 [117.8] versus 121.6 [77.9]; P = .01) and the increased epidermal expression of this protein (p53 patches) in the same group lend credence to a primary etiologic role for sun damage in these cases. Expression of Bcl-2 and c-kit did not differ significantly between the 2 morphological groups. A relative increase in c-kit expression was significantly associated with a virus-negative status (median [interquartile range], 100 [60-115] versus 70 [0-100]; P = .03). Emerging data reveal divergent biological pathways in Merkel cell carcinoma, each with a characteristic immunohistochemical profile. Virus-positive tumors (all pure) exhibit high retinoblastoma protein and low p53 expression, whereas virus-negative cases (few pure and all combined) show high p53 and relatively high c-kit expression. The potential biological implications of this dichotomy call for consistent stratification of these tumors in future studies. Copyright © 2015 Elsevier Inc. All rights reserved.

Immunohistochemical expression of p53, BCL-2, BAX and VEGFR1 proteins in nephroblastomas A expressão imuno-histoquímica das proteínas p53, BCL-2, BAX e VEGFR1 em nefroblastomas

Directory of Open Access Journals (Sweden)

Ana Paula Percicote

2013-02-01

Full Text Available INTRODUCTION: Nephroblastoma or Wilms' tumor is the most frequent renal cancer in children. Although its prognosis is favorable for most patients, it may relapse or have a fatal outcome. The characterization of risk groups by applying immunohistochemical biomarkers aims to adapt the treatment to its corresponding group as well as to reduce relapses and fatal outcome. p53, B-cell lymphoma 2 (BCL-2, BCL-2 associated protein X (BAX and vascular endothelial growth factor receptor 1 (VEGFR1 are among the most widely studied biomarkers, which are related to the apoptotic pathway, DNA repair and neovascularization. OBJECTIVE: The objective of this study is to assess the immunohistochemical expression of p53, BCL-2, BAX and VEGFR1 in samples of human nephroblastoma and to correlate them with clinicopathological prognostic factors. MATERIAL AND METHODS: Twenty-nine surgical specimens of nephroblastoma diagnosed from 1994 to 2007 were selected from the Anatomopathological Service of two hospitals in Curitiba. The immunohistochemical analysis of tissue microarrays was performed through immunoperoxidase staining and the yielded results were compared with clinicopathological prognostic factors. RESULTS: The major immunohistochemical expression of VEGFR1 in blastema and epithelium presented positive association with the risk group. Hence this may be related to higher vascular neoplastic invasion apparently caused by the endothelial growth factor, which maximizes the chances of metastasis and ultimately changes tumor staging, risk group and clinical evolution. CONCLUSIONS: The immunohistochemical expression of VEGFR1 substantiated a directly proportional association with the nephroblastoma risk group.INTRODUÇÃO: O nefroblastoma, ou tumor de Wilms, é a neoplasia renal mais frequente na infância. Embora o prognóstico seja favorável para a maioria dos pacientes, muitos evoluem para recidiva ou óbito. A caracterização de grupos de risco por meio de

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

International Nuclear Information System (INIS)

Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

2009-01-01

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

Energy Technology Data Exchange (ETDEWEB)

Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

2009-09-04

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

Expression of p53 Target Genes in the Early Phase of Long-Term Potentiation in the Rat Hippocampal CA1 Area

Directory of Open Access Journals (Sweden)

Vladimir O. Pustylnyak

2015-01-01

Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.

Adenocarcinoma of the esophagogastric junction: relationship between clinicopathological data and p53, cyclin D1 and Bcl-2 immunoexpressions Adenocarcinoma da junção esôfago-gástrica: relação entre os dados cllnipatológicos e a imunoexpressão de p53, ciclina D1 e Bcl-2

Directory of Open Access Journals (Sweden)

Dárcio Matenhauer Lehrbach

2009-12-01

Full Text Available CONTEXT: Esophagogastric junction adenocarcinoma has an aggressive behavior, and TNM (UICC staging is not always accurate enough to categorize patient's outcome. OBJECTIVES: To evaluated p53, cyclin D1 and Bcl-2 immunoexpressions in esophagogastric junction adenocarcinoma patients, without Barrett's esophagus, and to compared to clinicopathological characteristics and survival rate. METHODS: Tissue sections from 75 esophagogastric junction adenocarcinomas resected from 1991 to 2003 were analyzed by immunohistochemistry for p53, cyclin D1 and Bcl-2 using streptavidin-biotin-peroxidase method. The mean follow-up time was 60 months SD = 61.5 (varying from 4 to 273 months. RESULTS: Fifty (66.7% of the tumors were intestinal type and 25 (33.3% were diffuse. Vascular, lymph node and perineural infiltration were verified in 16%, 80% and 68% of the patients, respectively. The patients were distributed according to the TNM staging in IA in 4 (5.3%, IB in 10 (13.3%, II in 15 (20%, IIA in 15 (20%, IIIB in 15 (20% and IV in 16 (21.3%. Immunohistochemical analysis was positive for p53, cyclin D1 and bcl-2 in 68%, 18.7% and 100%, respectively. There was no association between immunoexpression and vascular and/or perineural invasions, clinicopathological characteristics and patients' survival rate. CONCLUSION: In this selected population, there was no association between the immunomarkers, p53, cyclin D1 and bcl-2 and clinicopathological data and/or overall survival.CONTEXTO: O adenocarcinoma da junção esôfago-gástrica tem um comportamento agressivo e o estádio TNM não é sempre suficiente para categorizar o paciente de acordo com a evolução do mesmo. OBJETIVO: Avaliar a imunoexpressão do p53, ciclina D1 e Bcl-2 em pacientes com adenocarcinoma da junção esôfago-gástrica sem esôfago de Barrett e comparar com as características clínicas e sobrevida. MÉTODOS: Cortes histológicos de 75 adenocarcinomas da esôfago-gástrica ressecados de 1991 a

Hexavalent chromium-induced apoptosis of granulosa cells involves selective sub-cellular translocation of Bcl-2 members, ERK1/2 and p53

International Nuclear Information System (INIS)

Banu, Sakhila K.; Stanley, Jone A.; Lee, JeHoon; Stephen, Sam D.; Arosh, Joe A.; Hoyer, Patricia B.; Burghardt, Robert C.

2011-01-01

Hexavalent chromium (CrVI) has been widely used in industries throughout the world. Increased usage of CrVI and atmospheric emission of CrVI from catalytic converters of automobiles, and its improper disposal causes various health hazards including female infertility. Recently we have reported that lactational exposure to CrVI induced a delay/arrest in follicular development at the secondary follicular stage. In order to investigate the underlying mechanism, primary cultures of rat granulosa cells were treated with 10 μM potassium dichromate (CrVI) for 12 and 24 h, with or without vitamin C pre-treatment for 24 h. The effects of CrVI on intrinsic apoptotic pathway(s) were investigated. Our data indicated that CrVI: (i) induced DNA fragmentation and increased apoptosis, (ii) increased cytochrome c release from the mitochondria to cytosol, (iii) downregulated anti-apoptotic Bcl-2, Bcl-XL, HSP70 and HSP90; upregulated pro-apoptotic BAX and BAD, (iv) altered translocation of Bcl-2, Bcl-XL, BAX, BAD, HSP70 and HSP90 to the mitochondria, (v) upregulated p-ERK and p-JNK, and selectively translocated p-ERK to the mitochondria and nucleus, (vi) activated caspase-3 and PARP, and (vii) increased phosphorylation of p53 at ser-6, ser-9, ser-15, ser-20, ser-37, ser-46 and ser-392, increased p53 transcriptional activation, and downregulated MDM-2. Vitamin C pre-treatment mitigated CrVI effects on apoptosis and related pathways. Our study, for the first time provides a clear insight into the effect of CrVI on multiple pathways that lead to apoptosis of granulosa cells which could be mitigated by vitamin C.

Stimulation of autophagy by the p53 target gene Sestrin2.

Science.gov (United States)

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Prognostic significance of CD95, P53, and BCL2 expression in extranodal non-Hodgkin's lymphoma

OpenAIRE

Chatzitolios , Anastasios; Venizelos , Ioannis; Tripsiannis , Gregory; Anastassopoulos , George; Papadopoulos , Nikolaos

2010-01-01

Abstract Apoptosis-related proteins play an important role in lymphoma cell death during chemotherapy. In our study, we investigated the prognostic significance of CD95, BCL2, and P53 expression in extranodal non-Hodgkin?s lymphoma (NHL). We examined 71 patients with extranodal NHL [45 diffuse large B-cell lymphomas (DLBCLs) and 26 mucosa-associated lymphoid tissue lymphomas (MALTLs)], 35 male and 36 female, with a median age of 65.8 years. The most common site of origin was the st...

p63 expression confers significantly better survival outcomes in high-risk diffuse large B-cell lymphoma and demonstrates p53-like and p53-independent tumor suppressor function

DEFF Research Database (Denmark)

Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin

2016-01-01

with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...

Genetic dissimilarity between primary colorectal carcinomas and their lymph node metastases: ploidy, p53, bcl-2, and c-myc expression--a pilot study.

Science.gov (United States)

Zalata, Khaled Refaat; Elshal, Mohamed Farouk; Foda, Abd AlRahman Mohammad; Shoma, Ashraf

2015-08-01

The current paradigm of metastasis proposes that rare cells within primary tumors acquire metastatic capability via sequential mutations, suggesting that metastases are genetically dissimilar from their primary tumors. This study investigated the changes in the level of expression of a well-defined panel of cell proliferation, differentiation, and apoptosis markers between the primary colorectal cancer (CRC) and the corresponding synchronous lymph node (LN) metastasis from the same patients. DNA flow cytometry and immunostaining of p53, bcl-2, and c-myc were carried out on 36 cases of CRC radical resection specimens with their corresponding LN metastases. There was very low probability that the histological patterns of primary tumors and LN metastases are independent (p < 0.001). Metastatic tumors were significantly more diffusely positive for p53 than the primary tumors (p < 0.001). Conversely, primary tumors were significantly more diffusely positive for c-myc than metastatic tumors (p = 0.011). No significant difference was found between the LNs and the primary tumors in bcl-2 positivity (p = 0.538) and DNA aneuploidy (p = 0.35), with a tendency towards negative bcl-2 and less aneuploidy in LN metastases than primary tumors. In conclusion, LN metastatic colorectal carcinomas have a tendency of being less differentiated, with a higher incidence of diffuse p53 staining, lower incidence of bcl-2 staining, and less aneuploidy in comparison to their primary counterparts suggesting a more aggressive biological behavior, which could indicate the necessity for more aggressive adjuvant therapy.

Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation

Energy Technology Data Exchange (ETDEWEB)

Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)

2007-07-15

Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses

Association of Ki-67, p53, and bcl-2 expression of the primary non-small-cell lung cancer lesion with brain metastatic lesion

International Nuclear Information System (INIS)

Bubb, Robbin S.; Komaki, Ritsuko; Hachiya, Tsutomu; Milas, Ivan; Ro, Jae Y.; Langford, Lauren; Sawaya, Raymond; Putnam, Joe B.; Allen, Pamela; Cox, James D.; McDonnell, Timothy J.; Brock, William; Hong, Waun K.; Roth, Jack A.; Milas, Luka

2002-01-01

Purpose: The study was conducted to determine whether immunohistochemical analysis of Ki-67, p53, and bcl-2 in patients with non-small-cell lung cancer is associated with a higher rate of brain metastases and whether the intrapatient expression of these biomarkers (in the primary tumors vs. brain lesions) is similar. Methods and Materials: At the M. D. Anderson Cancer Center, tumors from 29 case patients with primary lung tumor and brain metastasis and 29 control patients with primary lung tumor but no brain metastasis were resected and examined for immunohistochemical expression. Ki-67, p53, and bcl-2 were analyzed in resected primary lung, lymph node, and metastatic brain tumors. Each control patient was matched by age, gender, and histology to a patient with brain metastasis. Results: No significant differences in patient survival characteristics were detected between the case group and control group. Also, difference in patient outcome between the two groups was not generally predicted by biomarker analysis. However, when the groups were combined, the biomarker analysis was predictive for certain patient outcome end points. Using median values as cutoff points between low and high expression of biomarkers, it was observed that high expression of Ki-67 (>40%) in lung primaries was associated with poorer disease-free survival (p=0.04), whereas low expression of p53 in lung primaries was associated with poorer overall survival (p=0.04), and these patients had a higher rate of nonbrain distant metastases (p=0.02). The patients with brain metastases were particularly prone to developing nonbrain distant metastases if the percentage of p53-positive cells in brain metastases was low (p=0.01). There was a positive correlation in the expression of Ki-67 (p=0.02) (r 2 =0.1608), as well as p53 (p 2 =0.7380), between lung primaries and brain metastases. Compared to Ki-67 and p53, bcl-2 was the least predictive. Conclusion: Differences in biomarker expression between the

Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

International Nuclear Information System (INIS)

Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

2014-01-01

Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

MYC/BCL2/BCL6 triple hit lymphoma: a study of 40 patients with a comparison to MYC/BCL2 and MYC/BCL6 double hit lymphomas.

Science.gov (United States)

Huang, Wenting; Medeiros, L Jeffrey; Lin, Pei; Wang, Wei; Tang, Guilin; Khoury, Joseph; Konoplev, Sergej; Yin, C Cameron; Xu, Jie; Oki, Yasuhiro; Li, Shaoying

2018-05-21

High-grade B-cell lymphomas with MYC, BCL2, and BCL6 rearrangements (triple hit lymphoma) are uncommon. We studied the clinicopathologic features of 40 patients with triple hit lymphoma and compared them to 157 patients with MYC/BCL2 double hit lymphoma and 13 patients with MYC/BCL6 double hit lymphoma. The triple hit lymphoma group included 25 men and 15 women with a median age of 61 years (range, 34-85). Nine patients had a history of B-cell lymphoma. Histologically, 23 (58%) cases were diffuse large B-cell lymphoma and 17 cases had features of B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and Burkitt lymphoma. Most cases of triple hit lymphoma were positive for CD10 (100%), BCL2 (95%), BCL6 (82%), MYC (74%), and 71% with MYC and BCL2 coexpression. P53 was overexpressed in 29% of triple hit lymphoma cases. The clinicopathological features of triple hit lymphoma patients were similar to patients with MYC/BCL2 and MYC/BCL6 double hit lymphoma, except that triple hit lymphoma cases were more often CD10 positive compared with MYC/BCL6 double hit lymphoma (p hit lymphoma and double hit lymphoma and overall survival in triple hit lymphoma patients was 17.6 months, similar to the overall survival of patients with double hit lymphoma (p = 0.67). Patients with triple hit lymphoma showing P53 overexpression had significantly worse overall survival compared with those without P53 overexpression (p = 0.04). On the other hand, double expressor status and prior history of B-cell lymphoma did not correlate with overall survival. In conclusion, most patients with triple hit lymphoma have an aggressive clinical course and poor prognosis and these tumors have a germinal center B-cell immunophenotype, similar to patients with double hit lymphomas. P53 expression is a poor prognostic factor in patients with triple hit lymphoma.

Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres

International Nuclear Information System (INIS)

Ji, Qing; Hao, Xinbao; Meng, Yang; Zhang, Min; DeSano, Jeffrey; Fan, Daiming; Xu, Liang

2008-01-01

MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be

AS1411-Induced Growth Inhibition of Glioma Cells by Up-Regulation of p53 and Down-Regulation of Bcl-2 and Akt1 via Nucleolin.

Directory of Open Access Journals (Sweden)

Ye Cheng

Full Text Available AS1411 binds nucleolin (NCL and is the first oligodeoxynucleotide aptamer to reach phase I and II clinical trials for the treatment of several cancers. However, the mechanisms by which AS1411 targets and kills glioma cells and tissues remain unclear. Here we report that AS1411 induces cell apoptosis and cycle arrest, and inhibits cell viability by up-regulation of p53 and down-regulation of Bcl-2 and Akt1 in human glioma cells. NCL was overexpressed in both nucleus and cytoplasm in human glioma U87, U251 and SHG44 cells compared to normal human astrocytes (NHA. AS1411 bound NCL and inhibited the proliferation of glioma cells but not NHA, which was accompanied with up-regulation of p53 and down-regulation of Bcl-2 and Akt1. Moreover, AS1411 treatment resulted in the G2/M cell cycle arrest in glioma cells, which was however abolished by overexpression of NCL. Further, AS1411 induced cell apoptosis, which was prevented by silencing of p53 and overexpression of Bcl-2. In addition, AS1411 inhibited the migration and invasion of glioma cells in an Akt1-dependent manner. Importantly, AS1411 inhibited the growth of glioma xenograft and prolonged the survival time of glioma tumor-bearing mice. These results revealed a promising treatment of glioma by oligodeoxynucleotide aptamer.

Association of genetic markers in the BCL-2 family of apoptosis-related genes with endometrial cancer risk in a Chinese population.

Directory of Open Access Journals (Sweden)

Tsogzolmaa Dorjgochoo

Full Text Available In vitro studies have demonstrated the role of the BCL-2 family of genes in endometrial carcinogenesis. The role of genetic variants in BCL-2 genes and their interactions with non-genetic factors in the development of endometrial cancer has not been investigated in epidemiological studies.We examined the relationship between BCL-2 gene family variants and endometrial cancer risk among 1,028 patients and 1,922 age-matched community controls from Shanghai, China. We also investigated possible interactions between genetic variants and established risk factors (demographic, lifestyle and clinical. Individuals were genotyped for 86 tagging single nucleotide polymorphisms (SNPs in the BCL2, BAX, BAD and BAK1 genes.Significant associations with endometrial cancer risk were found for 9 SNPs in the BCL2 gene (P trend<0.05 for all. For SNPs rs17759659 and rs7243091 (minor allele for both: G, the associations were independent. The odds ratio was 1.27 (95% CI: 1.04-1.53 for women with AG genotype for the SNP rs17759659 and 1.82 (95% CI: 1.21-2.73 for women with the GG genotype for the SNP rs7243091. No interaction between these two SNPs and established non-genetic risk factors of endometrial cancer was noticed.Genetic polymorphisms in the BCL2 gene may be associated with the risk of endometrial cancer in Chinese women.

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

Science.gov (United States)

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

Pan-Cancer Analysis Links PARK2 to BCL-XL-Dependent Control of Apoptosis

Directory of Open Access Journals (Sweden)

Yongxing Gong

2017-02-01

Full Text Available Mutation of the PARK2 gene can promote both Parkinson's Disease and cancer, yet the underlying mechanisms of how PARK2 controls cellular physiology is incompletely understood. Here, we show that the PARK2 tumor suppressor controls the apoptotic regulator BCL-XL and modulates programmed cell death. Analysis of approximately 10,000 tumor genomes uncovers a striking pattern of mutual exclusivity between PARK2 genetic loss and amplification of BCL2L1, implicating these genes in a common pathway. PARK2 directly binds to and ubiquitinates BCL-XL. Inactivation of PARK2 leads to aberrant accumulation of BCL-XL both in vitro and in vivo, and cancer-specific mutations in PARK2 abrogate the ability of the ubiquitin E3 ligase to target BCL-XL for degradation. Furthermore, PARK2 modulates mitochondrial depolarization and apoptosis in a BCL-XL-dependent manner. Thus, like genes at the nodal points of growth arrest pathways such as p53, the PARK2 tumor suppressor is able to exert its antiproliferative effects by regulating both cell cycle progression and programmed cell death.

Apoptosis, proliferation, Bax, Bcl-2 and p53 status prior to and after preoperative radiochemotherapy for locally advanced rectal cancer

International Nuclear Information System (INIS)

Tannapfel, Andrea; Nuesslein, Siegfried; Fietkau, Rainer; Katalinic, Alexander; Koeckerling, Ferdinand; Wittekind, Christian

1998-01-01

Purpose: To investigate the relationship between apoptotic cell death, proliferative activity, and the expression of apoptosis regulating proteins in rectal cancer prior to and after radiochemotherapy. Materials and Methods: In 32 patients dispositioned to receive preoperative radiochemotherapy for locally advanced rectal carcinoma, pretherapy biopsies and the final resected specimen after radiochemotherapy were available for analyses. Apoptotic cells were identified and quantified using in situ end labeling (ISEL) technique. The expression of the bax protein was assessed immunohistochemically. Additionally, double immunostaining was performed for apoptotic cells and bax expression. The proliferative activity was determined by immunohistochemical assessment of the Ki67 (MIB-1) and the proliferating cell nuclear antigen (PCNA). p53- and bcl-2 expression was analyzed immunohistochemically. A clinical-to-pathologic downstaging after radiochemotherapy was achieved in 25 of 32 patients (78%). During follow-up, tumor recurrence was observed in six cases. In one case, no residual tumor was detected after radiochemotherapy. Results: After radiochemotherapy, the apoptotic index increased significantly in almost every case examined. In contrast, the proliferative activity was significantly decreased in resected specimens as compared to biopsies. Bax immunostaining was detected in 12/31 (39%) biopsies and in 26/31 (84%) resected specimens. In the resected specimen, significantly more apoptotic cells that were bax-positive were found than in biopsies. Bcl-2 immunostaining occurred in 15/31 biopsies and 12/31 resected specimens, respectively. Tumors that were immunohistochemically negative for p53 (20/31 [65%]) generally exhibited a higher apoptotic index and a high expression level of bax than p53-positive tumors (11/31 [35%]). However, we did not find any correlation between the (pre- and post-therapeutic) rate of apoptosis or the level of bax expression and the degree of

Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

Science.gov (United States)

Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

2016-01-01

Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

The p53 gene with emphasis on its paralogues in mosquitoes

Directory of Open Access Journals (Sweden)

Tien-Huang Chen

2017-12-01

Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

Homologous recombination in mammalian cells: effect of p53 and Bcl-2 proteins, replication inhibition and ionizing radiations

International Nuclear Information System (INIS)

Saintigny, Yannick

1999-01-01

The control of cell cycle, associated with the mechanisms of replication, DNA repair/recombination allows the cells to maintain their genetic integrity. The p53 protein ensures the control of G1/S transition. Its inactivation would allow to initial replication on damaged matrix and lead to the block of replication forks followed by DNA strand breaks, good substrates for recombination. This work shows that the expression of mutant p53 protein stimulates both spontaneous and radio-induced homologous recombination, independently of the control of cell cycle. Moreover, the use of a set of replication inhibitors show that inhibition of the replication elongation stimulates recombination more strongly than the initiation inhibition. Replication arrest by these inhibitors also significantly increases the number of DNA strand breaks. These results highlighted a point of action of p53 protein on the ultimate stages of the homologous recombination mechanism. Lastly, the expression of Bcl-2 protein inhibits apoptosis and increases survival, but specifically inhibits conservative recombination, after radiation as well as in absence of apoptotic stress. The extinction of this mechanism of DNA repair is associated with an increase of mutagenesis. Taken together, these results allow ta consider the maintenance of the genetic stability as a cellular network involving different pathways. A multiple stages model for tumoral progression can be deduced. (author) [fr

The prognostic implication of the expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in primary locally advanced oral squamous cell carcinoma cases: a tissue microarray study.

Science.gov (United States)

Solomon, Monica Charlotte; Vidyasagar, M S; Fernandes, Donald; Guddattu, Vasudev; Mathew, Mary; Shergill, Ankur Kaur; Carnelio, Sunitha; Chandrashekar, Chetana

2016-12-01

Oral squamous cell carcinomas comprise a heterogeneous tumor cell population with varied molecular characteristics, which makes prognostication of these tumors a complex and challenging issue. Thus, molecular profiling of these tumors is advantageous for an accurate prognostication and treatment planning. This is a retrospective study on a cohort of primary locally advanced oral squamous cell carcinomas (n = 178) of an Indian rural population. The expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in a cohort of primary locally advanced oral squamous cell carcinomas was evaluated. A potential biomarker that can predict the tumor response to treatment was identified. Formalin-fixed paraffin-embedded tumor blocks of (n = 178) of histopathologically diagnosed cases of locally advanced oral squamous cell carcinomas were selected. Tissue microarray blocks were constructed with 2 cores of 2 mm diameter from each tumor block. Four-micron-thick sections were cut from these tissue microarray blocks. These tissue microarray sections were immunohistochemically stained for EGFR, p53, Bcl-2, cyclin D1 and p16. In this cohort, EGFR was the most frequently expressed 150/178 (84%) biomarker of the cases. Kaplan-Meier analysis showed a significant association (p = 0.038) between expression of p53 and a poor prognosis. A Poisson regression analysis showed that tumors that expressed p53 had a two times greater chance of recurrence (unadjusted IRR-95% CI 2.08 (1.03, 4.5), adjusted IRR-2.29 (1.08, 4.8) compared with the tumors that did not express this biomarker. Molecular profiling of oral squamous cell carcinomas will enable us to categorize our patients into more realistic risk groups. With biologically guided tumor characterization, personalized treatment protocols can be designed for individual patients, which will improve the quality of life of these patients.

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Nicotine-induced damages in testicular tissue of rats; evidences for bcl-2, p53 and caspase-3 expression

Directory of Open Access Journals (Sweden)

Maryam Mosadegh

2017-02-01

Full Text Available Objective(s: Present study was performed in order to uncover new aspects for nicotine-induced damages on spermatogenesis cell lineage. Materials and Methods: For this purpose, 36 mature male Wistar rats were divided into three groups as; control-sham (0.2 ml, saline normal, IP, low dose (0.2 mg/kg BW-1, IP nicotine-received and high dose (0.4 mg/kg BW-1, IP nicotine-received groups. Following 7 weeks, the expression of bcl-2, p53 and caspase-3 at mRNA and protein levels were investigated by using reverse-transcriptase PCR (RT-PCR and immunohistochemical (IHC analyses, respectively. Moreover, the serum level of FSH, LH and testosterone were evaluated. Finally, the mRNA damage was analyzed by using special fluorescent staining. Results: Nicotine, at both dose levels, decreased tubular differentiation, spermiogenesis and repopulation indices and enhanced cellular depletion. Animals in nicotine-received groups exhibited a significant (P

Superior anti-tumor activity of the MDM2 antagonist idasanutlin and the Bcl-2 inhibitor venetoclax in p53 wild-type acute myeloid leukemia models

Directory of Open Access Journals (Sweden)

Christian Lehmann

2016-06-01

Full Text Available Abstract Background Venetoclax, a small molecule BH3 mimetic which inhibits the anti-apoptotic protein Bcl-2, and idasanutlin, a selective MDM2 antagonist, have both shown activity as single-agent treatments in pre-clinical and clinical studies in acute myeloid leukemia (AML. In this study, we deliver the rationale and molecular basis for the combination of idasanutlin and venetoclax for treatment of p53 wild-type AML. Methods The effect of idasanutlin and venetoclax combination on cell viability, apoptosis, and cell cycle progression was investigated in vitro using established AML cell lines. In vivo efficacy was demonstrated in subcutaneous and orthotopic xenograft models generated in female nude or non-obese diabetic/severe combined immunodeficiency (NOD/SCID mice. Mode-of-action analyses were performed by means of cell cycle kinetic studies, RNA sequencing as well as western blotting experiments. Results Combination treatment with venetoclax and idasanutlin results in synergistic anti-tumor activity compared with the respective single-agent treatments in vitro, in p53 wild-type AML cell lines, and leads to strongly superior efficacy in vivo, in subcutaneous and orthotopic AML models. The inhibitory effects of idasanutlin were cell-cycle dependent, with cells arresting in G1 in consecutive cycles and the induction of apoptosis only evident after cells had gone through at least two cell cycles. Combination treatment with venetoclax removed this dependency, resulting in an acceleration of cell death kinetics. As expected, gene expression studies using RNA sequencing showed significant alterations to pathways associated with p53 signaling and cell cycle arrest (CCND1 pathway in response to idasanutlin treatment. Only few gene expression changes were observed for venetoclax treatment and combination treatment, indicating that their effects are mediated mainly at the post-transcriptional level. Protein expression studies demonstrated that

INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

Science.gov (United States)

2003-01-01

monotherapy or in combination with one or more chemotherapeutic drugs, radiation therapies, or other agents that have a damaging effect on the DNA or survival of (i.e. 2-methoxyestradiol, patent No. 6,410,029) cancer cells. In July 2002, the US Patent and Trademark Office issued to The Board of Regents of The University of Texas System US patent No. 6,410,010. The patent broadly covers all adenoviral p53 compositions (including ADVEXIN), therapeutic and otherwise, that express adequate p53 in amounts sufficient to suppress the growth of or kill cancer cells in patients. The patent also covers adenoviral p53 that incorporates a specific type of promoter that helps cells to express the p53 tumour suppressor gene. Introgen is the exclusive licensee of this composition of matter patent covering ADVEXIN. In December 2002, Aventis Pharmaceuticals was issued US patent No. 6,262,032 B1 entitled "Method of Destroying Hyperproliferative Cells by Combining p53 and Taxoid Treatment". Introgen has an exclusive license to this patent and is using this type of combination therapy in its breast cancer trial. Introgen expects to realise $US 2.5-3 million from sales of INGN 201.

BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

Directory of Open Access Journals (Sweden)

Liu Jun

2004-07-01

Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.

BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

International Nuclear Information System (INIS)

Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei

2004-01-01

BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies

Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

International Nuclear Information System (INIS)

Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

2005-01-01

Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

Directory of Open Access Journals (Sweden)

Jennifer M. Smith

2007-12-01

Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

Gene expression patterns associated with p53 status in breast cancer

International Nuclear Information System (INIS)

Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

2006-01-01

Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

Translocation of p53 to Mitochondria Is Regulated by Its Lipid Binding Property to Anionic Phospholipids and It Participates in Cell Death Control

Directory of Open Access Journals (Sweden)

Ching-Hao Li

2010-02-01

Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.

CLCA2 as a p53-Inducible Senescence Mediator

Directory of Open Access Journals (Sweden)

Chizu Tanikawa

2012-02-01

Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

Breastfeeding and Immunohistochemical Expression of ki-67, p53 and BCL2 in Infiltrating Lobular Breast Carcinoma.

Directory of Open Access Journals (Sweden)

Angel Gonzalez-Sistal

Full Text Available Invasive lobular breast carcinoma is the second most common type of breast cancer after invasive ductal carcinoma. According to the American Cancer Society, more than 180,000 women in the United States find out they have invasive breast cancer each year. Personal history of breast cancer and certain changes in the breast are correlated with an increased breast cancer risk. The aim of this work was to analyze breastfeeding in patients with infiltrating lobular breast carcinoma, in relation with: 1 clinicopathological parameters, 2 hormonal receptors and 3 tissue-based tumor markers.The study included 80 women with ILC, 46 of which had breastfeed their children. Analyzed parameters were: age, tumor size, axillary lymph node (N, distant metastasis (M, histological grade (HG, estrogen receptor (ER, progesterone receptor (PR, androgen receptor (AR, Ki-67, p53 and BCL2.ILC of non-lactating women showed a larger (p = 0.009, lymph node involvement (p = 0.051 and distant metastasis (p = 0.060. They were also more proliferative tumors measured by Ki-67 (p = 0.053. Breastfeeding history did not influence the subsequent behavior of the tumor regardless of histological subtype.Lactation seems to influence the biological characteristics of ILC defining a subgroup with more tumor size, axillary lymph node involvement, distant metastasis and higher proliferation measured by ki-67 expression.

p53 and bcl2 expression in malignant and premalignant lesions of uterine cervix and their correlation with human papilloma virus 16 and 18

OpenAIRE

Shailaja Shukla; Jasmita Dass; Mukta Pujani

2014-01-01

Background and Objective: Persistent high risk human papilloma virus (HPV) infection is probably the best predictor of increased risk of cervical cancer, but expression of certain markers of cell proliferation and apoptosis have been studied. The present study was conducted to evaluate the expression of p53 and bcl2 in premalignant and malignant lesions of cervix and its correlation with HPV type 16 and 18. Materials and Methods: The study comprised of 35 cases (including 24 prospective cases...

miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention.

Science.gov (United States)

Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K

2011-04-04

New levels of gene regulation with microRNA (miR) and gene copy number alterations (CNAs) have been identified as playing a role in various cancers. We have previously reported that sporadic breast cancer tissues exhibit significant alteration in H2AX gene copy number. However, how CNA affects gene expression and what is the role of miR, miR-24-2, known to regulate H2AX expression, in the background of the change in copy number, are not known. Further, many miRs, including miR-24-2, are implicated as playing a role in cell proliferation and apoptosis, but their specific target genes and the pathways contributing to them remain unexplored. Changes in gene copy number and mRNA/miR expression were estimated using real-time polymerase chain reaction assays in two mammalian cell lines, MCF-7 and HeLa, and in a set of sporadic breast cancer tissues. In silico analysis was performed to find the putative target for miR-24-2. MCF-7 cells were transfected with precursor miR-24-2 oligonucleotides, and the gene expression levels of BRCA1, BRCA2, ATM, MDM2, TP53, CHEK2, CYT-C, BCL-2, H2AFX and P21 were examined using TaqMan gene expression assays. Apoptosis was measured by flow cytometric detection using annexin V dye. A luciferase assay was performed to confirm BCL-2 as a valid cellular target of miR-24-2. It was observed that H2AX gene expression was negatively correlated with miR-24-2 expression and not in accordance with the gene copy number status, both in cell lines and in sporadic breast tumor tissues. Further, the cells overexpressing miR-24-2 were observed to be hypersensitive to DNA damaging drugs, undergoing apoptotic cell death, suggesting the potentiating effect of mir-24-2-mediated apoptotic induction in human cancer cell lines treated with anticancer drugs. BCL-2 was identified as a novel cellular target of miR-24-2. mir-24-2 is capable of inducing apoptosis by modulating different apoptotic pathways and targeting BCL-2, an antiapoptotic gene. The study suggests

Estrogen receptor positive breast tumors resist chemotherapy by the overexpression of P53 in Cancer Stem Cells

Directory of Open Access Journals (Sweden)

Fatma Ashour

2018-06-01

Full Text Available Background and Objectives: Breast cancer (BC is classified according to estrogen receptor (ER status into ER+ and ER− tumors. ER+ tumors have a worse response to chemotherapy compared to ER− tumors. BCL-2, TP53, BAX and NF-ΚB are involved in drug resistance in the ER+ tumors. Recently it was shown that Cancer Stem Cells (CSCs play an important role in drug resistance. In this study we tested the hypothesis that CSCs of the ER+ tumors resist drug through the overexpression of BCL-2, TP53, BAX and NF-ΚB. Methods: CSCs were isolated by anoikis resistance assay from MCF7 (ER+ and MDA-MB-231 (ER− cell lines. Isolated CSCs were treated with doxorubicin (DOX and the mRNA expression levels of BCL-2, TP53, BAX and NFKB were investigated by quantitative real time PCR (qPCR with and without treatment. Results: BCL-2, BAX and NF-ΚB showed decreased expression in MCF7 bulk cancer cells after DOX treatment whereas only BCL-2 and BAX showed decreased expression in MDA-MB-231 bulk cancer cells. Interestingly TP53 was the only gene showed a considerable increase in its expression in CSCs of the ER+ MCF7 cell line compared to bulk cancer cells. Moreover, TP53 was the only gene showing exceptionally higher level of expression in MCF7-CSCs compared to MDA-MB-231-CSCs. Conclusion: Our results suggest that CSCs in the ER+ cells escape the effect of DOX treatment by the elevation of p53 expression. Keywords: Breast cancer, Cancer Stem Cells, Drug resistance, Estrogen receptors

Curcumin significantly enhances dual PI3K/Akt and mTOR inhibitor NVP-BEZ235-induced apoptosis in human renal carcinoma Caki cells through down-regulation of p53-dependent Bcl-2 expression and inhibition of Mcl-1 protein stability.

Directory of Open Access Journals (Sweden)

Bo Ram Seo

Full Text Available The PI3K/Akt and mTOR signaling pathways are important for cell survival and growth, and they are highly activated in cancer cells compared with normal cells. Therefore, these signaling pathways are targets for inducing cancer cell death. The dual PI3K/Akt and mTOR inhibitor NVP-BEZ235 completely inhibited both signaling pathways. However, NVP-BEZ235 had no effect on cell death in human renal carcinoma Caki cells. We tested whether combined treatment with natural compounds and NVP-BEZ235 could induce cell death. Among several chemopreventive agents, curcumin, a natural biologically active compound that is extracted from the rhizomes of Curcuma species, markedly induced apoptosis in NVP-BEZ235-treated cells. Co-treatment with curcumin and NVP-BEZ235 led to the down-regulation of Mcl-1 protein expression but not mRNA expression. Ectopic expression of Mcl-1 completely inhibited curcumin plus NVP-NEZ235-induced apoptosis. Furthermore, the down-regulation of Bcl-2 was involved in curcumin plus NVP-BEZ235-induced apoptosis. Curcumin or NVP-BEZ235 alone did not change Bcl-2 mRNA or protein expression, but co-treatment reduced Bcl-2 mRNA and protein expression. Combined treatment with NVP-BEZ235 and curcumin reduced Bcl-2 expression in wild-type p53 HCT116 human colon carcinoma cells but not p53-null HCT116 cells. Moreover, Bcl-2 expression was completely reversed by treatment with pifithrin-α, a p53-specific inhibitor. Ectopic expression of Bcl-2 also inhibited apoptosis in NVP-BE235 plus curcumin-treated cells. In contrast, NVP-BEZ235 combined with curcumin did not have a synergistic effect on normal human skin fibroblasts and normal human mesangial cells. Taken together, combined treatment with NVP-BEZ235 and curcumin induces apoptosis through p53-dependent Bcl-2 mRNA down-regulation at the transcriptional level and Mcl-1 protein down-regulation at the post-transcriptional level.

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

Science.gov (United States)

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

Characterization and Molecular Mechanism of Peptide-Conjugated Gold Nanoparticle Inhibiting p53-HDM2 Interaction in Retinoblastoma

Directory of Open Access Journals (Sweden)

Sushma Kalmodia

2017-12-01

Full Text Available Inhibition of the interaction between p53 and HDM2 is an effective therapeutic strategy in cancers that harbor a wild-type p53 protein such as retinoblastoma (RB. Nanoparticle-based delivery of therapeutic molecules has been shown to be advantageous in localized delivery, including to the eye, by overcoming ocular barriers. In this study, we utilized biocompatible gold nanoparticles (GNPs to deliver anti-HDM2 peptide to RB cells. Characterization studies suggested that GNP-HDM2 was stable in biologically relevant solvents and had optimal cellular internalization capability, the primary requirement of any therapeutic molecule. GNP-HDM2 treatment in RB cells in vitro suggested that they function by arresting RB cells at the G2M phase of the cell cycle and initiating apoptosis. Analysis of molecular changes in GNP-HDM2-treated cells by qRT-PCR and western blotting revealed that the p53 protein was upregulated; however, transactivation of its downstream targets was minimal, except for the PUMA-BCl2 and Bax axis. Global gene expression and in silico bioinformatic analysis of GNP-HDM2-treated cells suggested that upregulation of p53 might presumptively mediate apoptosis through the induction of p53-inducible miRNAs.

Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines.

Science.gov (United States)

Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid

2017-01-01

The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Mitofusin-2 is a novel direct target of p53

International Nuclear Information System (INIS)

Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

2010-01-01

Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

Science.gov (United States)

Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

2017-06-01

The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

Effect of p53 genotype on gene expression profiles in murine liver

International Nuclear Information System (INIS)

Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

2008-01-01

The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

International Nuclear Information System (INIS)

Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

2003-01-01

The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

Occupational health hazards of trichloroethylene among workers in relation to altered mRNA expression of cell cycle regulating genes (p53, p21, bax and bcl-2 and PPARA

Directory of Open Access Journals (Sweden)

Meenu Varshney

2015-01-01

Full Text Available Trichloroethylene (TCE is widely used as a metal degreaser in industrial processes. The present study reports on the effects of TCE exposure on workers employed in the lock industries. To ensure exposure of the workers to TCE, its toxic metabolites, trichloroacetic acid (TCA, dichloroacetic acid (DCA and trichloroethanol (TCEOH were detected in the plasma of the subjects through solid phase microextraction-gas chromatography-electron capture detection. TCA, DCA and TCEOH were detected in the range of 0.004–2.494 μg/mL, 0.01–3.612 μg/mL and 0.002–0.617 μg/mL, respectively. Quantitative reverse transcription polymerase chain reaction analysis revealed up-regulated expression of p53 (2.4-fold; p < 0.05, p21 (2-fold; p < 0.01, bax (2.9-fold; p < 0.01 mRNAs and down-regulated expression of bcl-2 (67%; p < 0.05 mRNAs, indicating DNA damaging potential of these metabolites. No effects were observed on the levels of p16 and c-myc mRNAs. Further, as TCA and DCA, the ligand of peroxisome proliferator activated receptor alpha (PPARA, are involved in the process of hepatocarcinogenesis in rodents, we examined expression of PPARA mRNA and let-7c miRNA in the workers. No statistically significant differences in expression of PPARA mRNA and let-7c miRNA in patients were observed as compared to values in controls. Dehydroepiandosterone sulfate (DHEAS is a reported endogenous ligand of PPARA so its competitive role was also studied. We observed decreased levels of DHEAS hormone in the subjects. Hence, its involvement in mediation of the observed changes in the levels of various mRNAs analyzed in this study appears unlikely.

The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma

International Nuclear Information System (INIS)

Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei

1999-01-01

Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53

Study on relationship between apoptosis-related genes and radiosensitivity of esophageal squamous cell carcinoma

International Nuclear Information System (INIS)

Li Huixiang; Wang Yaohe; Shi Yonggang; Gao Dongling; Zhang Yunhan

2000-01-01

Objective: To observing the relationship between apoptosis-related genes bcl-2,c-myc, p53 and the radiosensitivity of esophageal squamous cell carcinoma. Methods: The expression levels of bcl-2, c-myc and p53 genes in 57 biopsy samples from patients of esophageal squamous cell carcinoma were detected with the LSAB immunohistochemistry method. All the patients were treated with radiotherapy. The radiotherapeutic effect in these patients was observed and the relation between gene expression and radiosensitivity was analyzed. Results: Compared with the bcl-2-negative group, the radiosensitivity of bcl-2-positive one was lower(P<0.01). The radiosensitivity of p53-positive group was slightly lower than that of the p53-negative one (P<0.05). The c-myc protein expression was not related to radiosensitivity. Conclusion: Detection and comprehensive analysis of bcl-2, c-myc and p53 protein expressions are useful in forecasting the radiotherapeutic effect on squamous cell carcinoma of esophagus

IL-6-induced Bcl6 variant 2 supports IL-6-dependent myeloma cell proliferation and survival through STAT3

International Nuclear Information System (INIS)

Tsuyama, Naohiro; Danjoh, Inaho; Otsuyama, Ken-ichiro; Obata, Masanori; Tahara, Hidetoshi; Ohta, Tsutomu; Ishikawa, Hideaki

2005-01-01

IL-6 is a growth and survival factor for myeloma cells, although the mechanism by which it induces myeloma cell proliferation through gene expression is largely unknown. Microarray analysis showed that some B-cell lymphoma-associated oncogenes such as Bcl6, which is absent in normal plasma cells, were upregulated by IL-6 in IL-6-dependent myeloma cell lines. We found that Bcl6 variant 2 was upregulated by STAT3. ChIP assay and EMSA showed that STAT3 bound to the upstream region of variant 2 DNA. Expression of p53, a direct target gene of Bcl6, was downregulated in the IL-6-stimulated cells, and this process was impaired by an HDAC inhibitor. Bcl6 was knocked down by introducing small hairpin RNA, resulting in decreased proliferation and increased sensitivity to a DNA damaging agent. Thus, STAT3-inducible Bcl6 variant 2 appears to generate an important IL-6 signal that supports proliferation and survival of IL-6-dependent myeloma cells

Reciprocal occupancy of BCL6 and STAT5 on Growth Hormone target genes: contrasting transcriptional outcomes and promoter-specific roles of p300 and HDAC3.

Science.gov (United States)

Lin, Grace; LaPensee, Christopher R; Qin, Zhaohui S; Schwartz, Jessica

2014-09-01

Expression of the Growth Hormone (GH)-stimulated gene Socs2 (Suppressor of Cytokine Signaling 2) is mediated by the transcription activator STAT5 (Signal Transducer and Activator of Transcription 5) and the transcription repressor BCL6 (B-Cell Lymphoma 6). ChIP-Sequencing identified Cish (Cytokine-Inducible SH2-containing protein) and Bcl6 as having similar patterns of reciprocal occupancy by BCL6 and STAT5 in response to GH, though GH stimulates Cish and inhibits Bcl6 expression. The co-activator p300 occupied Socs2, Cish and Bcl6 promoters, and enhanced STAT5-mediated activation of Socs2 and Cish. In contrast, on Bcl6, p300 functioned as a repressor and inhibited in conjunction with STAT5 or BCL6. The co-repressor HDAC3 (Histone deacetylase 3) inhibited the Socs2, Cish and Bcl6 promoters in the presence of STAT5. Thus transcriptional outcomes on GH-regulated genes occupied by BCL6 and STAT5 are determined in a promoter-specific fashion by co-regulatory proteins which mediate the distinction between activating and repressive transcription factors. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Alterations in the K-ras and p53 genes in rat lung tumors

Energy Technology Data Exchange (ETDEWEB)

Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others

1997-06-01

Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

BCL2 genotypes and prostate cancer survival

Energy Technology Data Exchange (ETDEWEB)

Renner, Wilfried [Medical University of Graz, Clinical Institute of Medical and Chemical Laboratory Diagnostics, Graz (Austria); Langsenlehner, Uwe [GKK Outpatient Department, Division of Internal Medicine, Graz (Austria); Krenn-Pilko, Sabine; Langsenlehner, Tanja [Medical University of Graz, Department of Therapeutic Radiology and Oncology, Graz (Austria); Eder, Petra [University Hospital Wuerzburg, Department of Internal Medicine I, Wuerzburg (Germany)

2017-06-15

The antiapoptotic B-cell lymphoma 2 (BCL2) gene is a key player in cancer development and progression. A functional single-nucleotide polymorphism (c.-938C>A, rs2279115) in the inhibitory P2 BCL2 gene promoter has been associated with clinical outcomes in various types of cancer. Aim of the present study was to analyze the role of BCL2-938C>A genotypes in prostate cancer mortality. The association between BCL2-938C>A (rs2279115) genotypes and prostate cancer outcome was studied within the prospective PROCAGENE study comprising 702 prostate cancer patients. During a median follow-up time of 92 months, 120 (17.1%) patients died. A univariate Cox regression model showed a significant association of the CC genotype with reduced cancer-specific survival (CSS; hazard ratio, HR, 2.13, 95% confidence interval, CI, 1.10-4.12; p = 0.024) and overall survival (OS; HR 2.34, 95% CI 1.58-3.47; p < 0.001). In a multivariate Cox regression model including age at diagnosis, risk group, and androgen deprivation therapy, the CC genotype remained a significant predictor of poor CSS (HR 2.05, 95% CI 1.05-3.99; p = 0.034) and OS (HR 2.25, 95% CI 1.51-3.36; p < 0.001). This study provides evidence that the homozygous BCL2-938 CC genotype is associated with OS and C in prostate cancer patients. (orig.) [German] Das antiapoptotische Gen B cell lymphoma 2 (BCL2) spielt eine Schluesselrolle in der Entstehung und Progression von Krebserkrankungen. Ein funktioneller Einzelnukleotid-Polymorphismus (c.-938C>A, rs2279115) im inhibitorischen P2-BCL2-Promotor wurde mit dem klinischen Outcome verschiedener Krebserkrankungen verknuepft. Ziel der vorliegenden Studie war die Untersuchung der Rolle von BCL2-938C>A-Genotypen fuer die Mortalitaet bei Patienten mit Prostatakarzinom. Der Zusammenhang zwischen BCL2-938C>A-Genotypen (rs2279115) und dem Outcome bei Prostatakrebs wurde in der prospektiven PROCAGENE-Studie, die 702 Patienten mit Prostatakarzinom umfasste, untersucht. Waehrend der medianen

A senescence rescue screen identifies BCL6 as an inhibitor of anti-proliferative p19ARF-p53 signaling

NARCIS (Netherlands)

Shvarts, A.; Brummelkamp, T.; Koh, E.; Daley, G.Q.; Bernards, R.A.

2002-01-01

Senescence limits the proliferative capacity of primary cells in culture. We describe here a genetic screen to identify genes that allow bypass of this checkpoint. Using retroviral cDNA expression libraries, we identify BCL6 as a potent inhibitor of senescence. BCL6 is frequently activated in

A senescence rescue screen identifies BCL6 as an inhibitor of anti-proliferative p19(ARF)-p53 signaling

NARCIS (Netherlands)

Shvarts, Avi; Brummelkamp, Thijn R.; Scheeren, Ferenc; Koh, Eugene; Daley, George Q.; Spits, Hergen; Bernards, René

2002-01-01

Senescence limits the proliferative capacity of primary cells in culture. We describe here a genetic screen to identify genes that allow bypass of this checkpoint. Using retroviral cDNA expression libraries, we identify BCL6 as a potent inhibitor of senescence. BCL6 is frequently activated in

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

Energy Technology Data Exchange (ETDEWEB)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4�

p53 represses autophagy in a cell cycle-dependent fashion.

Science.gov (United States)

Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido

2008-10-01

Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

Science.gov (United States)

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

Directory of Open Access Journals (Sweden)

Krzysztof Puszynski

2014-12-01

Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.

Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

Energy Technology Data Exchange (ETDEWEB)

Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)

2007-02-15

Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

International Nuclear Information System (INIS)

Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying

2007-01-01

Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

The influence of sleep deprivation on expression of apoptosis regulatory proteins p53, bcl-2 and bax following rat tongue carcinogenesis induced by 4-nitroquinoline 1-oxide

Directory of Open Access Journals (Sweden)

Juliana Noguti

2013-01-01

Full Text Available Background: The aim of this study was to evaluate whether paradoxical sleep deprivation could affects the mechanisms and pathways essentials for cancer cells in tongue cancer induced by 4-nitroquinole 1-oxide in Wistar rats. Materials and Methods: For this purpose, the animals were distributed into 4 groups of 5 animals each treated with 50 ppm 4 nitroquinoline 1 oxide (4 NQO solution through their drinking water for 4 and 12 weeks. The animals were submitted to paradoxical sleep deprivation (PSD for 72 h using the modified multiple platform method, which consisted of placing 5 mice in a cage (41 × 34 × 16 cm containing 10 circular platforms (3.5 cm in diameter with water 1 cm below the upper surface. The investigations were conducted using immunohistochemistry of p53, Bax and Bcl-2 proteins related to apoptosis and its pathways. Statistical analysis was performed by Kruskal-Wallis non-parametric test followed by the Dunn′s test using SPSS software pack (version 1.0. P value < 0.05 was considered for statistic significance. Results: Although no histopathological abnormalities were induced in the epithelium after 4 weeks of carcinogen exposure in all groups, in 12 weeks were observed pre-neoplasic lesions. Data analysis revealed statistically significant differences ( P < 0.05 in 4 weeks group for p53 and for bcl-2 and for all immunomarkers after 12 weeks of 4NQO administration. Conclusion: Our results reveal that sleep deprivation exerted alterations in proteins associated with proliferation and apoptosis in carcinogenesis.

ER, p53 and MIB-1 are significantly associated with malignant phyllodes tumor

Directory of Open Access Journals (Sweden)

Nurhayati H Munawer

2012-12-01

Full Text Available Background: Phyllodes tumors (PT are rare. We evaluated the expression status of ER, Bcl2, p53, and MIB-1 protein in these tumors. Methods: One hundred and ninety-three tumors were examined using immunohistochemistry on tissue microarray. Results: ERβ (p <0.001, and p53 (p=0.006 in the stromal component were associated with tumor size. p53 expression was significantly associated with both epithelial and stro­mal components of malignant PTs (p<0.05. In PT, the decreased expressions of p53 and MIB-1 were significantly different with positive Bcl2 protein expression in epi­thelial component (p=0.000. Besides, MIB-1 was also found to be associated with ERα and ERβ in stromal component (p=0.000. Conclusion: The expression of p53 with tumor size and histological grade in PTs may increase risk for malignancy.

The effects of combining ionizing radiation and adenovirus-mediated p53 gene transfer in human nasopharyngeal carcinoma cell lines

International Nuclear Information System (INIS)

Liu Feifei; Li Jianhua; Lax, Stuart; Klamut, Henry

1997-01-01

Purpose/Objective: We have previously demonstrated that the introduction of human recombinant wild-type p53 carried by the adenoviral vector (Ad5CMV-p53) into two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z) resulted in significant cytotoxicity. In the current work, we wanted to evaluate the results of this strategy when combined with ionizing radiation (XRT). Materials and Methods: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain KS1, were infected with iso-effective doses of 2, 6 and 6 pfu/cell of Ad5CMV-p53 respectively. XRT was administered 24 hours post-infection, to coincide with the time of maximal recombinant p53 expression. Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax and bcl-2. Cell viability was evaluated using both the MTT and clonogenic assays. Presence of apoptosis was determined by using DNA agarose gel electrophoresis. Results: We observed that the combination of Ad5CMV-p53 + XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The MTT assay indicated sparing of the KS1 cells when subjected to the identical treatments. XRT alone stimulated minimal p53 expression; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax and bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed earlier, at 2 Gy when combined with Ad5CMV-p53. Conclusion: Additional cytotoxicity was observed for the NPC cell lines when XRT was combined with Ad5CMV-p53 infection, with concurrent sparing of normal cells (KS1). This cytotoxicity also appeared to be mediated through the induction of the apoptotic pathway. These results support our previous observation of the potential application of this strategy in the

Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

Directory of Open Access Journals (Sweden)

Christian Bressy

2017-06-01

Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

p53 as the focus of gene therapy: past, present and future.

Science.gov (United States)

Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

2018-01-15

Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

International Nuclear Information System (INIS)

Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

2006-01-01

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

Energy Technology Data Exchange (ETDEWEB)

Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

2006-02-22

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

International Nuclear Information System (INIS)

Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

2007-01-01

We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

P53 and Rb tumor suppressor gene alterations in gastric cancer Alterações dos genes supressores tumorais p53 e Rb no câncer gástrico

Directory of Open Access Journals (Sweden)

Rejane Mattar

2004-01-01

Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea

Isolation and characterization of DUSP11, a novel p53 target gene

DEFF Research Database (Denmark)

Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

2009-01-01

target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

The effect of radiation on bcl-2 and bax in hyperplastic prostatic tissues

International Nuclear Information System (INIS)

Ma Qingjie; Li Yuxin; Gu Xinquan; Cao Xia; Zhao Jie; Kong Xiangbo; Cai Shanyu

2004-01-01

Aim: To investigate the expressions of bcl-2 and bax in benign prostatic hyperplasia (BPH) and the effect of β-rays on bcl-2 and bax. Methods: The expressions of bcl-2 and bax are studied by means of immunohistochemical method in 9 normal prostate (NP) and 15 BPH and 35 patients treated with 90Sr/90Y Prostatic Hyperplasia Applicator. Results: The expressions of bcl-2 in epithelia of NP and BPH are higher than that in stroma P<0.01=. The expressions of bcl-2 in epithelia and stroma of BPH are higher than that in NP P<0.01=. The expressions of bax in epithelia of NP are higher than that in BPH P<0.05=. However ,the expressions of bcl-2 in epithelia and stroma of BPH are higher than bax P<0.01 =. Compared with the control group, the expressions of bcl-2 in epithelia and stroma of BPH treated with 90Sr/90Y Prostatic Hyperplasia Applicator decreased and the expressions of bax increased P<0.01=. Conclusion: bcl-2 gene and bax gene play an important role in the regulation of prostatic apoptosis and the treatment of β-rays can accelerate the apoptosis of prostatic tissues. (authors)

DNA rearrangement in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene

International Nuclear Information System (INIS)

Tsujimoto, Y.; Bashir, M.M.; Givol, I.; Cossman, J.; Jaffe, E.; Croce, C.M.

1987-01-01

In most human lymphomas, the chromosome translocation t(14;18) occurs within two breakpoint clustering regions on chromosome 18, the major one at the 3' untranslated region of the bcl-2 gene and the minor one at 3' of the gene. Analysis of a panel of follicular lymphoma DNAs using probes for the first exon of the bcl-2 gene indicates that DNA rearrangements may also occur 5' to the involved bcl-2 gene. In this case the IgH locus and the bcl-2 gene are found in an order suggesting that an inversion also occurred during the translocation process. The coding region of the bcl-2 gene, however, are left intact in all cases of follicular lymphoma studied to date

p53 tumor suppressor gene: significance in neoplasia - a review

International Nuclear Information System (INIS)

Alam, J.M.

2000-01-01

p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

Expression of Bcl-2 family proteins and spontaneous apoptosis in normal human testis.

Science.gov (United States)

Oldereid, N B; Angelis, P D; Wiger, R; Clausen, O P

2001-05-01

We investigated the frequency of spontaneous apoptosis and expression of the Bcl-2 family of proteins during normal spermatogenesis in man. Testicular tissue with both normal morphology and DNA content was obtained from necro-donors and fixed in Bouin's solution. A TdT-mediated dUTP end-labelling method (TUNEL) was used for the detection of apoptotic cells. Expression of apoptosis regulatory Bcl-2 family proteins and of p53 and p21(Waf1) was assessed by immunohistochemistry. Germ cell apoptosis was detected in all testes and was mainly seen in primary spermatocytes and spermatids and in a few spermatogonia. Bcl-2 and Bak were preferentially expressed in the compartments of spermatocytes and differentiating spermatids, while Bcl-x was preferentially expressed in spermatogonia. Bax showed a preferential expression in nuclei of round spermatids, whereas Bad was only seen in the acrosome region of various stages of spermatids. Mcl-1 staining was weak without a particular pattern, whereas expression of Bcl-w, p53 and p21(Waf1) proteins was not detected by immunohistochemistry. The results show that spontaneous apoptosis occurs in all male germ cell compartments in humans. Bcl-2 family proteins are distributed preferentially within distinct germ cell compartments suggesting a specific role for these proteins in the processes of differentiation and maturation during human spermatogenesis.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

Science.gov (United States)

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

Science.gov (United States)

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

Prognostic significance of MYC, BCL2, and BCL6 rearrangements in patients with diffuse large B-cell lymphoma treated with cyclophosphamide, doxorubicin, vincristine, and prednisone plus rituximab.

Science.gov (United States)

Akyurek, Nalan; Uner, Aysegul; Benekli, Mustafa; Barista, Ibrahim

2012-09-01

Diffuse large B-cell lymphomas (DLBCLs) are a biologically heterogeneous group in which various gene alterations have been reported. The aim of this study was to investigate the frequency and prognostic impact of BCL2, BCL6, and MYC rearrangements in cyclophosphamide, doxorubicin, vincristine, and prednisone plus rituximab (R-CHOP)-treated DLBCL cases. Tissue microarrays were constructed from 239 cases of DLBCL, and the expressions of CD10, BCL6, MUM1/IRF4, and BCL2 were evaluated by immunohistochemistry. MYC, BCL2, and BCL6 rearrangements were investigated by interphase fluorescence in situ hybridization on tissue microarrays. Survival analysis was constructed from 145 R-CHOP-treated patients. MYC, BCL2, and BCL6 rearrangements were detected in 14 (6%), 36 (15%), and 69 (29%) of 239 DLBCL patients. Double or triple rearrangements were detected in 7 (3%) of 239 DLBCL cases. Of these, 4 had BCL2 and MYC, 2 had BCL6 and MYC, and 1 had BCL2, BCL6, and MYC rearrangements. The prognosis of these cases was extremely poor, with a median survival of 9 months. MYC rearrangement was associated with significantly worse overall survival (P = .01), especially for the cases with GC phenotype (P = .009). BCL6 rearrangement also predicted significantly shorter overall survival (P = .04), especially for the non-GC phenotype (P = .03). BCL2 rearrangement had no prognostic impact on outcome. International Prognostic Index (P = .004) and MYC rearrangement (P = .009) were independent poor prognostic factors. Analysis of MYC gene rearrangement along with BCL2 and BCL6 is critical in identifying high-risk patients with poor prognosis. Copyright © 2011 American Cancer Society.

A dynamic P53-MDM2 model with time delay

Energy Technology Data Exchange (ETDEWEB)

Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

2006-11-15

Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

A dynamic P53-MDM2 model with time delay

International Nuclear Information System (INIS)

Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

2006-01-01

Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production

Energy Technology Data Exchange (ETDEWEB)

Jauharoh, Siti Nur Aisyah [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Faculty of Medicine and Health Science, Syarif Hidayatullah State Islamic University, Jakarta 15412 (Indonesia); Saegusa, Jun; Sugimoto, Takeshi [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Ardianto, Bambang [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Department of Child Health, Faculty of Medicine, Gadjah Mada University, Yogyakarta 55282 (Indonesia); Kasagi, Shimpei; Sugiyama, Daisuke; Kurimoto, Chiyo [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Tokuno, Osamu; Nakamachi, Yuji [Department of Laboratory Medicine, Kobe University Hospital, Hyogo 650-0017 (Japan); Kumagai, Shunichi [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Kawano, Seiji, E-mail: sjkawano@med.kobe-u.ac.jp [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Department of Laboratory Medicine, Kobe University Hospital, Hyogo 650-0017 (Japan)

2012-01-06

Highlights: Black-Right-Pointing-Pointer Ro52{sup low} HeLa cells are resistant to apoptosis upon various stimulations. Black-Right-Pointing-Pointer Ro52 is upregulated by IFN-{alpha}, etoposide, or IFN-{gamma} and anti-Fas Ab. Black-Right-Pointing-Pointer Ro52-mediated apoptosis is independent of p53. Black-Right-Pointing-Pointer Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjoegren's syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52's role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52{sup low} HeLa cells were significantly more resistant to apoptosis than wild-type HeLa cells when stimulated by H{sub 2}O{sub 2}- or diamide-induced oxidative stress, IFN-{alpha}, IFN-{gamma} and anti-Fas antibody, etoposide, or {gamma}-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.

SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production

International Nuclear Information System (INIS)

Jauharoh, Siti Nur Aisyah; Saegusa, Jun; Sugimoto, Takeshi; Ardianto, Bambang; Kasagi, Shimpei; Sugiyama, Daisuke; Kurimoto, Chiyo; Tokuno, Osamu; Nakamachi, Yuji; Kumagai, Shunichi; Kawano, Seiji

2012-01-01

Highlights: ► Ro52 low HeLa cells are resistant to apoptosis upon various stimulations. ► Ro52 is upregulated by IFN-α, etoposide, or IFN-γ and anti-Fas Ab. ► Ro52-mediated apoptosis is independent of p53. ► Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjögren’s syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52’s role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52 low HeLa cells were significantly more resistant to apoptosis than wild-type HeLa cells when stimulated by H 2 O 2 - or diamide-induced oxidative stress, IFN-α, IFN-γ and anti-Fas antibody, etoposide, or γ-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.

Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

International Nuclear Information System (INIS)

Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

2014-01-01

Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

Overexpression of the human BCL-2 gene product results in growth enhancement of Epstein-Barr virus-immortalized B cells

International Nuclear Information System (INIS)

Tsujimoto, Yoshihide

1989-01-01

The biological activity of the human BCL-2 gene product was analyzed in an Epstein-Barr virus (EBV)-infected human lymphoblastoid B-cell line transfected with BCL-2 sequences driven by the simian virus 40 promoter and enhancer. Overproduction of the BCL-2 protein conferred a selective growth advantage to the EBV-infected B cells as compared with control transfectants in low-serum medium and also after seeding at limiting dilution but did not render the cells tumorigenic in athymic nude mice. This growth enhancement was also seen in cells transfected with the BCL-2 gene with its own promoter juxtaposed to the immunoglobulin heavy chain gene enhancer, which represents the translocated form of the BCL-2 gene observed in follicular lymphomas with the t(14;18) translocation. The growth advantage of EBV-infected B cells overproducing the BCL-2 protein is neither due to the enhanced growth factor production nor due to an enhanced sensitivity of the BCL-2 transfectants to interleukins 1 or 6, although both lymphokines are known to stimulate proliferation of EBV-infected B-cell lines. The growth advantage of EBV-infected B-cell lines. The growth advantage of EBV-infected B cells by overproduction of the BCL-2 protein suggests the direct involvement of the BCL-2 gene product in the pathogenesis of follicular lymphoma

Quinacrine induces apoptosis in human leukemia K562 cells via p38 MAPK-elicited BCL2 down-regulation and suppression of ERK/c-Jun-mediated BCL2L1 expression

International Nuclear Information System (INIS)

Changchien, Jung-Jung; Chen, Ying-Jung; Huang, Chia-Hui; Cheng, Tian-Lu; Lin, Shinne-Ren; Chang, Long-Sen

2015-01-01

Although previous studies have revealed the anti-cancer activity of quinacrine, its effect on leukemia is not clearly resolved. We sought to explore the cytotoxic effect and mechanism of quinacrine action in human leukemia K562 cells. Quinacrine induced K562 cell apoptosis accompanied with ROS generation, mitochondrial depolarization, and down-regulation of BCL2L1 and BCL2. Upon exposure to quinacrine, ROS-mediated p38 MAPK activation and ERK inactivation were observed in K562 cells. Quinacrine-induced cell death and mitochondrial depolarization were suppressed by the p38MAPK inhibitor SB202190 and constitutively active MEK1 over-expression. Activation of p38 MAPK was shown to promote BCL2 degradation. Further, ERK inactivation suppressed c-Jun-mediated transcriptional expression of BCL2L1. Over-expression of BCL2L1 and BCL2 attenuated quinacrine-evoked mitochondrial depolarization and rescued the viability of quinacrine-treated cells. Taken together, our data indicate that quinacrine-induced K562 cell apoptosis is mediated through mitochondrial alterations triggered by p38 MAPK-mediated BCL2 down-regulation and suppression of ERK/c-Jun-mediated BCL2L1 expression. - Highlights: • Quinacrine induces K562 cell apoptosis via down-regulation of BCL2 and BCL2L1. • Quinacrine induces p38 MAPK activation and ERK inactivation in K562 cells. • Quinacrine elicits p38 MAPK-mediated BCL2 down-regulation. • Quinacrine suppresses ERK/c-Jun-mediated BCL2L1 expression

Aberrations of the p53 pathway components p53, MDM2 and CDKN2A appear independent in diffuse large B cell lymphoma

DEFF Research Database (Denmark)

Møller, Michael Boe; Ino, Y; Gerdes, A M

1999-01-01

The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...

The Impact of Adenosine Fast Induction of Myocardial Arrest during CABG on Myocardial Expression of Apoptosis-Regulating Genes Bax and Bcl-2

Directory of Open Access Journals (Sweden)

Ahmed Shalaby

2009-01-01

Full Text Available Background. We studied the effect of fast induction of cardiac arrest with denosine on myocardial bax and bcl-2 expression. Methods and Results. 40 elective CABG patients were allocated into two groups. The adenosine group (n=20 received 250 μg/kg adenosine into the aortic root followed by blood potassium cardioplegia. The control group received potassium cardioplegia in blood. Bcl-2 and bax were measured. Bax was reduced in the postoperative biopsies (1.38 versus 0.47, P=.002 in the control group. Bcl-2 showed a reducing tendency (0.14 versus 0.085, P=.07. After the adenosine treatment, the expression of both bax (0.52 versus 0.59, P=.4 and bcl-2 (0.104 versus 0.107, P=.4 remained unaltered after the operation. Conclusion. Open heart surgery is associated with rapid reduction in the expression of apoptosis regulating genes bax and bcl-2. Fast Adenosine induction abolished changes in their expression.

Analysis of the immunohistochemical expressions of p53, bcl-2 and Ki-67 in colorectal adenocarcinoma and their correlations with the prognostic factors Análise das expressões imunoistoquímicas da p53, bcl-2 e Ki-67 no adenocarcinoma colorretal e suas correlações com os fatores prognósticos

Directory of Open Access Journals (Sweden)

Hunaldo Lima de Menezes

2010-06-01

Full Text Available CONTEXT: Search of tumors markers that allow treatment with higher survival rates, and indicate the response to treatment and recurrence of cancer OBJECTIVE: To analyze the immunoexpression of the proteins p53, bcl-2 and Ki-67 in colorectal adenocarcinoma and correlate them with the clinical-pathological prognostic factors. METHOD: Tissue microarray paraffin blocks were made from colorectal adenocarcinoma tissue resected from 82 patients who had undergone surgery but not chemotherapy or radiotherapy, at "Hospital São Paulo", São Paulo, SP, Brazil, between 2002 and 2005. Thin sections (4 µm were subjected to immunohistochemical reactions, and immunoexpression staining scores were obtained. The scores were correlated with the degree of cell differentiation, staging, disease-free interval, recurrence, survival and specific mortality. The study variables were analyzed using the chi-square and Kaplan-Meier tests to investigate associations with the markers. The significance of the differences between the curves of the disease-free interval and survival was analyzed using the Logrank and Wilcoxon tests. RESULTS: The immunohistochemical expression of p53 was positive in 70 tumors (85.4% and negative in 12 (14.6%. The expression of bcl-2 was positive in 26 (31.7% and negative in 56 (68.3%. The expression of Ki-67 was positive in 62 (75.6% and negative in 20 (24.4%. There was no statistically significant correlation between the expressions of these markers separately or in conjunction, in relation to the degree of cell differentiation, staging, disease-free interval, survival and specific mortality. In relation to recurrence, there was a statistically significant correlation with positive expression of Ki-67 (P = 0.035. CONCLUSION: The immunohistochemical expression of Ki-67 in colorectal cancer is associated with recurrence of this disease.CONTEXTO: Pesquisa de marcadores tumorais que permitam tratamento com maiores índices de sobrevida, além de

Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

International Nuclear Information System (INIS)

Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

2008-01-01

Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

OTUD5 regulates p53 stability by deubiquitinating p53.

Directory of Open Access Journals (Sweden)

Judong Luo

Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

Science.gov (United States)

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

International Nuclear Information System (INIS)

Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

2005-01-01

In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

Genomic alterations during p53-dependent apoptosis induced by γ-irradiation of Molt-4 leukemia cells.

Directory of Open Access Journals (Sweden)

Rouba Hage-Sleiman

Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes

HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

Science.gov (United States)

Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

2018-03-01

HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular biologic study about the non-small cell lung carcinoma (2) : p53 gene alteration in non-small cell lung carcinoma

International Nuclear Information System (INIS)

Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee

1996-12-01

The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs

Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

International Nuclear Information System (INIS)

Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

2006-01-01

In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

Apoptosis and BCL-2 expression as predictors of survival in radiation-treated non-small-cell lung cancer

International Nuclear Information System (INIS)

Hwang, Jun-Hwa; Lim, Sung-Chul; Kim, Young-Chul; Park, Kyung-Ok; Ahn, Sung-Ja; Chung, Woong-Ki

2001-01-01

Objectives: We assessed the role of apoptosis and the expression of bcl-2, p53, and c-myc oncoproteins in pretreatment histologic specimens as a predictor of response to radiation therapy and survival in non-small-cell lung cancer (NSCLC) patients. Methods: Pretreatment biopsy specimens of 68 patients with NSCLC (62 squamous cell carcinoma, 6 adenocarcinoma) were stained with hematoxylin and eosin. From 5 high-powered fields, the apoptotic index (AI) was calculated as the ratio of apoptotic tumor cells to the total number of tumor cells. Bcl-2, p53, and c-myc oncoprotein expression was detected by immunohistochemical staining. Results: Twenty-nine cases showed partial or complete remission, whereas 39 showed no response. AI ranged from 0.2 to 12.0% (mean ± SD; 4.3±2.6%, median 4.0%). There was no difference in AI between responders (4.0±2.3) and nonresponders (4.5±2.8, p>0.05). However, in the responders, AI was correlated with the degree of change in tumor volume (r=0.41, p<0.05). In an analysis of 53 subjects who survived more than 1 month after the completion of radiation therapy, the patients with a higher AI (n=27, MST=22.8 m) survived longer than those with a lower AI (n=26, MST=9.2, log-rank, p=0.03). Patients expressing bcl-2 had poorer survival (n=22, MST=6.0 m) than patients without bcl-2 (n=31, 22.8 m, p<0.003). According to multivariate analysis, three variables, bcl-2 expression, AI, and response to radiation, were independent prognostic factors for survival. Conclusion: A low level of spontaneous apoptosis and expression of apoptosis blocking bcl-2 protein in pretreatment histology predict a poor prognosis for radiation-treated NSCLC patients

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

Science.gov (United States)

Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

2005-04-01

The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

Science.gov (United States)

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.

Directory of Open Access Journals (Sweden)

Carlos Farkas

Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.

P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

Directory of Open Access Journals (Sweden)

Ivan Raimondi

Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

Energy Technology Data Exchange (ETDEWEB)

Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)

2012-07-13

Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp

Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

International Nuclear Information System (INIS)

Irshad, S.; Nawaz, T.

2008-01-01

Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish

Directory of Open Access Journals (Sweden)

Seok-Hyung Kim

2013-07-01

Tuberous sclerosis complex (TSC is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1 kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors.

Deregulated expression of A1, Bcl-2, Bcl-xL, and Mcl-1 antiapoptotic proteins and Bid, Bad, and Bax proapoptotic genes in polycythemia vera patients

Directory of Open Access Journals (Sweden)

Elainy Patricia Lino Gasparotto

2011-12-01

Full Text Available Apoptosis deregulation might have a role in the pathophysiology of polycythemia vera (PV. This study evaluated Bcl-2 molecule expression in CD34+ cells and leukocytes in 12 PV patients. Gene expression was investigated by real time PCR using SybrGreen Quantitect kit and protein expression was evaluated by western-blotting. JAK2 V617F mutation was detected according to Baxter et al (2005. CD34+ cells from PV patients presented higher levels of A1 and Mcl-1 expression (median: 22.6 and 5.2, respectively in comparison with controls (0.9 and 0.5, p=0.004 and p=0.020; while Bcl-2 and Bcl-xL expression decreased in PV patients (0.18 and 1.19 compared with controls (1.39 and 2.01, p=0.006 and p=0.020. CD34+ cells in PV patients showed an elevated Bid expression (14.4 in comparison with healthy subjects (1.0; p=0.002. Patients' leukocytes showed an A1 augmentation (7.41, p=0.001 and a reduced expression of Bax (0.19; p=0.040 and Bad (0.2; p=0.030. There was no correlation between JAK2 V617F allele burden and molecular expression. PV patients showed alterations in Bcl-2 members' expression, which may interfere with control of apoptotic machinery and contribute to disease pathogenesis.A desregulação da apoptose parece participar da fisiopatologia da policitemia vera (PV. Este estudo avaliou a expressão das moléculas da família Bcl-2 em células hematopoéticas CD34 + e leucócitos de 12 pacientes com PV. Foram realizados: a quantificação da expressão gênica por PCR em tempo real utilizando kit Sybrgreen Quantitect, avaliação da expressão de proteínas por western-blot e detecção da mutação JAK2 V617F segundo Baxter et al. (2005. Células CD34 + dos pacientes com PV apresentaram maior expressão de A1 e Mcl-1 (mediana: 22,6 e 5,2, respectivamente em comparação com controles (0,9 e 0,5, p = 0,004 e p = 0,020 e expressão de Bcl-2 e Bcl-xL diminuída nestes pacientes (0,18 e 1,19 em relação aos controles (1,39 e 2,01, p = 0,006 e p = 0

Gene expression profiles in BCL11B-siRNA treated malignant T cells

Directory of Open Access Journals (Sweden)

Grabarczyk Piotr

2011-05-01

Full Text Available Abstract Background Downregulation of the B-cell chronic lymphocytic leukemia (CLL/lymphoma11B (BCL11B gene by small interfering RNA (siRNA leads to growth inhibition and apoptosis of the human T-cell acute lymphoblastic leukemia (T-ALL cell line Molt-4. To further characterize the molecular mechanism, a global gene expression profile of BCL11B-siRNA -treated Molt-4 cells was established. The expression profiles of several genes were further validated in the BCL11B-siRNA -treated Molt-4 cells and primary T-ALL cells. Results 142 genes were found to be upregulated and 109 genes downregulated in the BCL11B-siRNA -treated Molt-4 cells by microarray analysis. Among apoptosis-related genes, three pro-apoptotic genes, TNFSF10, BIK, BNIP3, were upregulated and one anti-apoptotic gene, BCL2L1 was downregulated. Moreover, the expression of SPP1 and CREBBP genes involved in the transforming growth factor (TGF-β pathway was down 16-fold. Expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP were also examined by real-time PCR. A similar expression pattern of TNFSF10, BCL2L1, and SPP1 was identified. However, CREBBP was not downregulated in the BLC11B-siRNA -treated Molt-4 cells. Conclusion BCL11B-siRNA treatment altered expression profiles of TNFSF10, BCL2L1, and SPP1 in both Molt-4 T cell line and primary T-ALL cells.

The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

Science.gov (United States)

Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

2018-06-01

The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

Science.gov (United States)

Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

2005-07-01

To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...

African Journals Online (AJOL)

apoptotic genes, BCL2, Bcl-xL, XIAP and Survivin), in cervical carcinoma cells. Methods: Annexin V-FITC/propidium iodide (PI) staining was used for the investigation of cell apoptosis. RNA RNeasy Kits was used to isolate RNA and Omniscript ...

Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

Directory of Open Access Journals (Sweden)

Simon Leuchs

Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

A comparison of the effects of tributyltin chloride and triphenyltin chloride on cell proliferation, proapoptotic p53, Bax, and antiapoptotic Bcl-2 protein levels in human breast cancer MCF-7 cell line.

Science.gov (United States)

Fickova, Maria; Macho, Ladislav; Brtko, Julius

2015-06-01

In recent years it was disclosed, that numerous organotin(IV) derivatives have remarkable cytotoxicity against several types of cancer cells. The property to inhibit cell growth makes these compounds promising for antitumor therapy, as the clinical effectiveness of cisplatin is limited by drug resistance and significant side effects. Tributyltin and triphenyltin are known as endocrine disruptors. Moreover, the compounds exert their toxicity in mammals predominantly through nuclear receptor signaling. Here we present the effects of tributyltin chloride (TBT-Cl) and triphenyltin chloride (TPT-Cl) on cell proliferation, expression of proapoptotic p53, Bax, and antiapoptotic Bcl-2 proteins in human breast cancer MCF-7 cell line. Dose and time dependent (24, 48 and 72 h) cell expositions have demonstrated TBT-Cl as more effective in inhibiting MCF-7 cell proliferation than TPT-Cl. Short time treatment with TBT-Cl displayed marked stimulation of p53 protein expression when compared to TPT-Cl. Both organotin compounds displayed similar mild enhancement of Bax protein expression. The 24h exposition of TPT-Cl induced substantial diminution of Bcl-2 protein expression in comparison with both, untreated cells and TBT-Cl treated cells. Our observations indicate that TBT-Cl and TPT-Cl have different antiproliferative potency and distinct impact on expression of apoptosis marker proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Silymarin modulates doxorubicin-induced oxidative stress, Bcl-xL and p53 expression while preventing apoptotic and necrotic cell death in the liver

International Nuclear Information System (INIS)

Patel, Nirav; Joseph, Cecil; Corcoran, George B.; Ray, Sidhartha D.

2010-01-01

The emergence of silymarin (SMN) as a natural remedy for liver diseases, coupled with its entry into NIH clinical trial, signifies its hepatoprotective potential. SMN is noted for its ability to interfere with apoptotic signaling while acting as an antioxidant. This in vivo study was designed to explore the hepatotoxic potential of Doxorubicin (Dox), the well-known cardiotoxin, and in particular whether pre-exposures to SMN can prevent hepatotoxicity by reducing Dox-induced free radical mediated oxidative stress, by modulating expression of apoptotic signaling proteins like Bcl-xL, and by minimizing liver cell death occurring by apoptosis or necrosis. Groups of male ICR mice included Control, Dox alone, SMN alone, and Dox with SMN pre/co-treatment. Control and Dox groups received saline i.p. for 14 days. SMN was administered p.o. for 14 days at 16 mg/kg/day. An approximate LD 50 dose of Dox, 60 mg/kg, was administered i.p. on day 12 to animals receiving saline or SMN. Animals were euthanized 48 h later. Dox alone induced frank liver injury (> 50-fold increase in serum ALT) and oxidative stress (> 20-fold increase in malondialdehyde [MDA]), as well as direct damage to DNA (> 15-fold increase in DNA fragmentation). Coincident genomic damage and oxidative stress influenced genomic stability, reflected in increased PARP activity and p53 expression. Decreases in Bcl-xL protein coupled with enhanced accumulation of cytochrome c in the cytosol accompanied elevated indexes of apoptotic and necrotic cell death. Significantly, SMN exposure reduced Dox hepatotoxicity and associated apoptotic and necrotic cell death. The effects of SMN on Dox were broad, including the ability to modulate changes in both Bcl-xL and p53 expression. In animals treated with SMN, tissue Bcl-xL expression exceeded control values after Dox treatment. Taken together, these results demonstrated that SMN (i) reduced, delayed onset, or prevented toxic effects of Dox which are typically associated with

p53 dependent apoptotic cell death induces embryonic malformation in Carassius auratus under chronic hypoxia.

Directory of Open Access Journals (Sweden)

Paramita Banerjee Sawant

Full Text Available Hypoxia is a global phenomenon affecting recruitment as well as the embryonic development of aquatic fauna. The present study depicts hypoxia induced disruption of the intrinsic pathway of programmed cell death (PCD, leading to embryonic malformation in the goldfish, Carrasius auratus. Constant hypoxia induced the early expression of pro-apoptotic/tumor suppressor p53 and concomitant expression of the cell death molecule, caspase-3, leading to high level of DNA damage and cell death in hypoxic embryos, as compared to normoxic ones. As a result, the former showed delayed 4 and 64 celled stages and a delay in appearance of epiboly stage. Expression of p53 efficiently switched off expression of the anti-apoptotic Bcl-2 during the initial 12 hours post fertilization (hpf and caused embryonic cell death. However, after 12 hours, simultaneous downregulation of p53 and Caspase-3 and exponential increase of Bcl-2, caused uncontrolled cell proliferation and prevented essential programmed cell death (PCD, ultimately resulting in significant (p<0.05 embryonic malformation up to 144 hpf. Evidences suggest that uncontrolled cell proliferation after 12 hpf may have been due to downregulation of p53 abundance, which in turn has an influence on upregulation of anti-apoptotic Bcl-2. Therefore, we have been able to show for the first time and propose that hypoxia induced downregulation of p53 beyond 12 hpf, disrupts PCD and leads to failure in normal differentiation, causing malformation in gold fish embryos.

CC genotype of anti-apoptotic gene BCL-2 (-938 C/A) is an independent prognostic marker of unfavorable clinical outcome in patients with non-small-cell lung cancer.

Science.gov (United States)

Javid, J; Mir, R; Mirza, M; Imtiyaz, A; Prasant, Y; Mariyam, Z; Julka, P K; Mohan, A; Lone, M; Ray, P C; Saxena, A

2015-04-01

B cell lymphoma 2 (BCL-2) gene is a well-known regulator of apoptosis and a key element in cancer development and progression. A regulatory (-938C>A, rs2279115) single-nucleotide polymorphism in the inhibitory P2 BCL-2 gene promoter generates significantly different BCL-2 promoter activities and has been associated with different clinical outcomes in various malignancies. The aim of the present study was to analyze the possible influence of the (-938C>A) SNP on the risk and survival of Indian patients suffering from NSCLC. A hospital-based case-control study of 155 age- and sex-matched patients diagnosed with NSCLC and 155 cancer-free controls was conducted and genotyped by performing PIRA-PCR to elucidate the putative association between clinical outcome and genotypes of BCL-2 (-938C>A, rs2279115). The association of the polymorphism with the survival of NSCLC patients was analyzed by Kaplan-Meier curves. In Indian NSCLC, patients increased risk of developing NSCLC was found to be associated with BCL-2 (-938) CC genotype, [OR 3.68 (1.92-6.79), RR 1.87 (1.35-2.57) and RD 31.03 (16.79-45.27) p 0.00006 for CC and OR 2.08 (1.18-3.66), RR 1.36 (1.08-1.71) and RD 17.74 (4.68-30.81) p 0.01 for AC genotype]. Patients homozygous for C allele exhibited a significant poor overall survival compared with patients displaying AC + CC or AC or AA genotype [median survival (months) 8 vs. 11 vs. 14 vs. 35.5 (p A) polymorphism. Genetic polymorphism in the inhibitory P2 promoter region of anti-apoptotic BCL-2 genes contributes to the risk of developing non-small-cell lung cancer in Indian population. BCL-2 (-938CC) genotype was an independent adverse prognostic factor for patients with NSCLC.

Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

Directory of Open Access Journals (Sweden)

Jeyran eShahbazi

2013-05-01

Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

A point mutation of human p53, which was not detected as a mutation by a yeast functional assay, led to apoptosis but not p21Waf1/Cip1/Sdi1 expression in response to ionizing radiation in a human osteosarcoma cell line, Saos-2

International Nuclear Information System (INIS)

Okaichi, Kumio; Wang Lihong; Sasaki, Ji-ichiro; Saya, Hideyuki; Tada, Mitsuhiro; Okumura, Yutaka

1999-01-01

Purpose: The 123A point mutation of p53 showed increased radiosensitivity, whereas other mutations (143A, 175H, and 273H) were not affected. To determine the reason for increased radiosensitivity of the 123A mutation, the response of the transformant of 123A mutation to ionizing radiation (IR) was examined and compared to those of transformants with the wild type p53 or other point mutations (143A, 175H, and 273H). Methods and Materials: Stable transformants with a mutant or wild type p53 made by introducing cDNA into the human osteosarcoma cell line, Saos-2, which lacks an endogenous p53 were used. The transcriptional activity of mutant p53 was examined using a yeast functional assay. The transformants were examined for the accumulation of p53, the induction of p21 Waf1/Cip1/Sdi1 (hereafter referred to as p21), and the other response of p53-responsive genes (MDM2, Bax, and Bcl-2) by Western blotting. Apoptosis was analyzed by detection of DNA fragmentation. Results: The 123A point mutation of p53 was detected as a wild type in the yeast functional assay. The 123A mutant accumulated p53 in response to IR. The 123A mutant did not induce p21, but normally responded to MDM2, Bax, and Bcl-2. The 123A mutant entered apoptosis earlier than the wild type p53 transformant, and induced Fas at earlier in response to IR. Conclusion: The 123A mutant led to apoptosis, but not p21 expression in response to IR. The occurrence of apoptosis, but not induction of p21, corresponded to the radiosensitivity in the transformant. The early occurrence of apoptosis in 123A transformants may depend on the early induction of Fas

Effect of Bcl11b genotypes and γ-radiation on the development of mouse thymic lymphomas

International Nuclear Information System (INIS)

Yoshikai, Yoshihiro; Sato, Toshihiro; Morita, Shinichi; Kohara, Yuki; Takagi, Ritsuo; Mishima, Yukio; Kominami, Ryo

2008-01-01

Bcl11b is a haploinsufficient tumor suppressor gene and expressed in many tissues such as thymus, brain and skin. Irradiated Bcl11b +/- heterozygous mice mostly develop thymic lymphomas, but the preference of Bcl11b inactivation for thymic lymphomas remains to be addressed. We produced Bcl11b +/- heterozygous and Bcl11b wild-type mice of p53 +/- background and compared their incidence of γ-ray induced thymic lymphomas. Majority of the tumors in p53 +/- mice were skin tumors, and only 5 (36%) of the 14 tumors were thymic lymphomas. In contrast, Bcl11b +/- p53 +/- doubly heterozygous mice developed thymic lymphomas at the frequency of 27 (79%) of the 34 tumors developed (P = 0.008). This indicates the preference of Bcl11b impairment for thymic lymphoma development. We also analyzed loss of the wild-type alleles in the 27 lymphomas, a predicted consequence given by γ-irradiation. However, the loss frequency was low, only six (22%) for Bcl11b and five (19%) for p53. The frequencies did not differ from those of spontaneously developed thymic lymphomas in the doubly heterozygous mice, though the latency of lymphoma development markedly differed between them. This suggests that the main contribution of irradiation at least in those mice is not for the tumor initiation by inducing allelic losses but probably for the promotion of thymic lymphoma development

The relationship among human papilloma virus infection, survivin, and p53 gene in lung squamous carcinoma tissue

International Nuclear Information System (INIS)

Yue-Hua Wang; De-jie Chen; Tie-Nan Yi

2010-01-01

To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).

THE EXPRESSION AND CLINICAL VALUE OF APOPTOSIS CONTROL GENE Bcl-2 AND Bax IN BREAST CANCER

Institute of Scientific and Technical Information of China (English)

ZHENG Jun; YAO Zhen-xiang; ZHANG Jing

1999-01-01

Objective: To study the expression and clinical value of apoptosis control gene bcl-2 and bax in breast cancer.Methods: Protein bax and bcl-2 in 41 breast cancers obtained from operations in our hospital in 1996 were detected using ABC immunohistochemical stain assay and compared with 10 cases with normal breast tissues.Results: The positive rate of bax in normal breast tissue was 90% and in breast cancer was 59%, with a significant statistical difference between them (P＜0.05), but there was no statistical difference in bcl-2 protein expression. Among the 41 breast cancer, the group with lymph node metastasis (21 cases) had obviously low bax expression (43%) and high bcl-2 expression (76%), showing significant difference to the group without lymph node metastasis (P＜0.05).Conclusion: The antiapoptosis function of bcl-2 was stronger than bax in breast cancer. Protein bax and bcl-2 assay may be useful in understanding the biological behaviors of breast cancer.

Combined Targeting of JAK2 and Bcl-2/Bcl-xL to Cure Mutant JAK2-Driven Malignancies and Overcome Acquired Resistance to JAK2 Inhibitors

Directory of Open Access Journals (Sweden)

Michaela Waibel

2013-11-01

Full Text Available To design rational therapies for JAK2-driven hematological malignancies, we functionally dissected the key survival pathways downstream of hyperactive JAK2. In tumors driven by mutant JAK2, Stat1, Stat3, Stat5, and the Pi3k and Mek/Erk pathways were constitutively active, and gene expression profiling of TEL-JAK2 T-ALL cells revealed the upregulation of prosurvival Bcl-2 family genes. Combining the Bcl-2/Bcl-xL inhibitor ABT-737 with JAK2 inhibitors mediated prolonged disease regressions and cures in mice bearing primary human and mouse JAK2 mutant tumors. Moreover, combined targeting of JAK2 and Bcl-2/Bcl-xL was able to circumvent and overcome acquired resistance to single-agent JAK2 inhibitor treatment. Thus, inhibiting the oncogenic JAK2 signaling network at two nodal points, at the initiating stage (JAK2 and the effector stage (Bcl-2/Bcl-xL, is highly effective and provides a clearly superior therapeutic benefit than targeting just one node. Therefore, we have defined a potentially curative treatment for hematological malignancies expressing constitutively active JAK2.

p53, erbB-2 and K-ras gene alterations are rare in spontaneous and plutonium-239-induced canine lung neoplasia

International Nuclear Information System (INIS)

Tierney, L.A.; Hahn, F.F.; Lechner, J.F.

1996-01-01

Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs

MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

Science.gov (United States)

Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

2016-01-07

The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

Apoptosis and the BCL-2 gene family - patterns of expression and prognostic value in STAGE I and II follicular center lymphoma

International Nuclear Information System (INIS)

Logsdon, Mark D.; Meyn, Raymond E.; Besa, Pelayo C.; Pugh, William C.; Stephens, L. Clifton; Peters, Lester J.; Milas, Luka; Cox, James D.; Cabanillas, Fernando; Brisbay, Shawn; Andersen, Margret; McDonnell, Timothy J.

1999-01-01

Purpose: The prognostic significance of spontaneous levels of apoptosis and Bcl-2, Bax, and Bcl-x protein expression in follicular center lymphoma (FCL) is unknown. The objectives of this retrospective study were (1) to investigate the relationship between pretreatment apoptosis levels and long-term treatment outcome in patients with Stage I and II FCL; (2) to define the incidence and patterns of Bax and Bcl-x protein expression in human FC; and (3) to determine the relationship of Bcl-2, Bax, and Bcl-x expression with spontaneous apoptosis levels and clinical outcome in localized FCL. Methods and Materials: Between 1974 and 1988, 144 patients with Stage I or II FCL were treated. Hematoxylin and eosin (H and E) stained tissue sections of pretreatment specimens were retrieved for 96 patients. Treatment consisted of regional radiation therapy (XRT) for 25 patients, combined modality therapy (CMT) consisting of combination chemotherapy and XRT for 57 patients, and other treatments for 14 patients. Median follow-up for living patients was nearly 12 years. The apoptotic index (AI) was calculated by dividing the number of apoptotic cells by the total number of cells counted and multiplying by 100. Expression of Bcl-2, Bax, and Bcl-x proteins was assessed using immunohistochemistry. Results: The mean and median AI values for the entire group were 0.53 and 0.4, respectively (range: 0-5.2). The AI strongly correlated with cytologic grade, with mean AI values of 0.25 for grade 1, 0.56 for grade 2, and 0.84 for grade 3 (p < 0.0005; Kendall correlation). A positive correlation was present between grouped AI and grouped mitotic index (MI) (p = 0.014). For patients treated with CMT, an AI < 0.4 correlated with improved freedom from relapse (FFR) (p = 0.0145) and overall survival (OS) (p = 0.0081). An AI < 0.4 did not correlate with clinical outcome for the entire cohort or for patients receiving XRT only. Staining of tumor follicles for the Bcl-2 protein was positive, variable

Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation

International Nuclear Information System (INIS)

Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli

2004-01-01

Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

Science.gov (United States)

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation

International Nuclear Information System (INIS)

Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY

1996-01-01

Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)

A importância do gene p53 na carcinogênese humana The importance of the p53 gene in human carcinogenesis

Directory of Open Access Journals (Sweden)

Agnes C. Fett-Conte

2002-04-01

Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.

A systematic review of p53 regulation of oxidative stress in skeletal muscle.

Science.gov (United States)

Beyfuss, Kaitlyn; Hood, David A

2018-12-01

transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p

Studies on hematopoietic cell apoptosis and the relative gene expression in irradiated mouse bone marrow

International Nuclear Information System (INIS)

Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Yang Hong; Cui Yufang; Wang Baozhen

2001-01-01

Objective: To study apoptosis and expressions bcl-2 and p53 in irradiated mouse bone marrow. Methods: LACA mice were irradiated with 60 Co γ-rays. By means of in situ terminal labelling, in situ hybridization and image analysis, the authors studied radiation-induced apoptosis of hematopoietic cells and the expressions of bcl-2 and p53. Results: The characteristics of apoptosis appeared in hematopoietic cells at 6 hrs after irradiation. The expression of bcl-2 was obviously decreased when apoptosis of hematopoietic cells occurred, whereas it increased in the early recovery phase; p53 protein increased during both apoptosis of hematopoietic cells and the recovery phase, and mutant type p53 DNA was positive only in the recovery phase. Conclusion: Radiation may induced apoptosis of hematopoietic cells in a dose-dependent manner; Both bcl-2 and p53 genes play an important role in apoptosis and recovery phase

Polymorphism at codon 36 of the p53 gene.

Science.gov (United States)

Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

1994-01-01

A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

Science.gov (United States)

Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

2003-08-01

Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

Science.gov (United States)

He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

2015-03-01

Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

International Nuclear Information System (INIS)

Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.

2011-01-01

Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

Energy Technology Data Exchange (ETDEWEB)

Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)

2011-11-04

Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53

DEFF Research Database (Denmark)

Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice

2016-01-01

The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...

Genotyping of BRCA1, BRCA2, p53, CDKN2A, MLH1 and MSH2 genes in a male patient with secondary breast cancer

International Nuclear Information System (INIS)

Vodusek, Ana Lina; Novakovic, Srdjan; Stegel, Vida; Jereb, Berta

2011-01-01

Some tumour suppressor genes (BRCA2) and mismatch repair genes (MSH2, MLH1) are correlated with an increased risk for male breast cancer. Our patient developed secondary breast cancer after the treatment for Hodgkin’s disease in childhood. DNA was isolated from the patients’ blood and screened for mutations, polymorphisms and variants in BRCA1, BRCA2, p53, CDKN2A, MLH1 and MSH2 genes. We found no mutations but common polymorphisms, and three variants in mismatch repair genes. Nucleotide variants c.2006-6T>C and p.G322D in MSH2 might be correlated with male breast cancer

2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

Science.gov (United States)

Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

2016-09-06

The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

Science.gov (United States)

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Double-hit lymphoma demonstrating t(6;14;18)(p25;q32;q21), suggesting two independent dual-hit translocations, MYC/BCL-2 and IRF4/BCL-2.

Science.gov (United States)

Tabata, Rie; Yasumizu, Ryoji; Tabata, Chiharu; Kojima, Masaru

2013-01-01

Here, we report a rare case of double-hit lymphoma, demonstrating t(6;14;18)(p25;q32;q21), suggesting two independent dual-translocations, c-MYC/BCL-2 and IRF4/BCL-2. The present case had a rare abnormal chromosome, t(6;14;18)(p25;q32;q21), independently, in addition to known dual-hit chromosomal abnormalities, t(14;18)(q32;q21) and t(8;22)(q24;q11.2). Lymph node was characterized by a follicular and diffuse growth pattern with variously sized neoplastic follicles. The intrafollicular area was composed of centrocytes with a few centroblasts and the interfollicular area was occupied by uniformly spread medium- to large-sized lymphocytes. CD23 immunostaining demonstrated a disrupted follicular dendritic cell meshwork. The intrafollicular tumor cells had a germinal center phenotype with the expression of surface IgM, CD10, Bcl-2, Bcl-6, and MUM1/IRF4. However, the interfollicular larger cells showed plasmacytic differentiation with diminished CD20, Bcl-2, Bcl-6, and positive intracytoplasmic IgM, and co-expression of MUM1/IRF4 and CD138 with increased Ki-67-positive cells (> 90%). MUM1/IRF4 has been found to induce c-MYC expression, and in turn, MYC transactivates MUM1/IRF4, creating a positive autoregulatory feedback loop. On the other hand, MUM1/IRF4 functions as a tumor suppressor in c-MYC-induced B-cell leukemia. The present rare case arouses interest in view of the possible "dual" activation of both c-MYC and MUM1/IRF4 through two independent dual-translocations, c-MYC/BCL-2 and IRF4/BCL-2.

Critical role of p53 upregulated modulator of apoptosis in benzyl isothiocyanate-induced apoptotic cell death.

Directory of Open Access Journals (Sweden)

Marie Lue Antony

Full Text Available Benzyl isothiocyanate (BITC, a constituent of edible cruciferous vegetables, decreases viability of cancer cells by causing apoptosis but the mechanism of cell death is not fully understood. The present study was undertaken to determine the role of Bcl-2 family proteins in BITC-induced apoptosis using MDA-MB-231 (breast, MCF-7 (breast, and HCT-116 (colon human cancer cells. The B-cell lymphoma 2 interacting mediator of cell death (Bim protein was dispensable for proapoptotic response to BITC in MCF-7 and MDA-MB-231 cells as judged by RNA interference studies. Instead, the BITC-treated MCF-7 and MDA-MB-231 cells exhibited upregulation of p53 upregulated modulator of apoptosis (PUMA protein. The BITC-mediated induction of PUMA was relatively more pronounced in MCF-7 cells due to the presence of wild-type p53 compared with MDA-MB-231 with mutant p53. The BITC-induced apoptosis was partially but significantly attenuated by RNA interference of PUMA in MCF-7 cells. The PUMA knockout variant of HCT-116 cells exhibited significant resistance towards BITC-induced apoptosis compared with wild-type HCT-116 cells. Attenuation of BITC-induced apoptosis in PUMA knockout HCT-116 cells was accompanied by enhanced G2/M phase cell cycle arrest due to induction of p21 and down regulation of cyclin-dependent kinase 1 protein. The BITC treatment caused a decrease in protein levels of Bcl-xL (MCF-7 and MDA-MB-231 cells and Bcl-2 (MCF-7 cells. Ectopic expression of Bcl-xL in MCF-7 and MDA-MB-231 cells and that of Bcl-2 in MCF-7 cells conferred protection against proapoptotic response to BITC. Interestingly, the BITC-treated MDA-MB-231 cells exhibited induction of Bcl-2 protein expression, and RNA interference of Bcl-2 in this cell line resulted in augmentation of BITC-induced apoptosis. The BITC-mediated inhibition of MDA-MB-231 xenograft growth in vivo was associated with the induction of PUMA protein in the tumor. In conclusion, the results of the present study

Codelivery for Paclitaxel and Bcl-2 Conversion Gene by PHB-PDMAEMA Amphiphilic Cationic Copolymer for Effective Drug Resistant Cancer Therapy.

Science.gov (United States)

Wang, Xiaoyuan; Liow, Sing Shy; Wu, Qiaoqiong; Li, Chuang; Owh, Cally; Li, Zibiao; Loh, Xian Jun; Wu, Yun-Long

2017-11-01

Antiapoptotic Bcl-2 protein's upregulated expression is a key reason for drug resistance leading to failure of chemotherapy. In this report, a series of biocompatible amphiphilic cationic poly[(R)-3-hydroxybutyrate] (PHB)-b-poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) copolymer, comprising hydrophobic PHB block and cationic PDMAEMA block, is designed to codeliver hydrophobic chemotherapeutic paclitaxel and Bcl-2 converting gene Nur77/ΔDBD with enhanced stability, due to the micelle formation by hydrophobic PHB segment. This copolymer shows less toxicity but similar gene transfection efficiency to polyethyenimine (25k). More importantly, this codelivery approach by PHB-PDMAEMA leads to increased drug resistant HepG2/Bcl-2 cancer cell death, by increased expression of Nur77 proteins in the Bcl-2 present intracellular mitochondria. This work signifies for the first time that cationic amphiphilic PHB-b-PDMAEMA copolymers can be utilized for the drug and gene codelivery to drug resistant cancer cells with high expression of antiapoptosis Bcl-2 protein and the positive results are encouraging for the further design of codelivery platforms for combating drug resistant cancer cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

p53 and PTEN/MMAC1/TEP1 gene therapy of human prostate PC-3 carcinoma xenograft, using transferrin-facilitated lipofection gene delivery strategy.

Science.gov (United States)

Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan

2002-04-10

We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.

Restoration of mp53 to wtp53 by chemical chaperones restores p53-dependent apoptosis after radiotherapy

International Nuclear Information System (INIS)

Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.

2003-01-01

The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future

Dual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma.

Science.gov (United States)

Van Goethem, Alan; Yigit, Nurten; Moreno-Smith, Myrthala; Vasudevan, Sanjeev A; Barbieri, Eveline; Speleman, Frank; Shohet, Jason; Vandesompele, Jo; Van Maerken, Tom

2017-08-22

Wild-type p53 tumor suppressor activity in neuroblastoma tumors is hampered by increased MDM2 activity, making selective MDM2 antagonists an attractive therapeutic strategy for this childhood malignancy. Since monotherapy in cancer is generally not providing long-lasting clinical responses, we here aimed to identify small molecule drugs that synergize with idasanutlin (RG7388). To this purpose we evaluated 15 targeted drugs in combination with idasanutlin in three p53 wild type neuroblastoma cell lines and identified the BCL2 inhibitor venetoclax (ABT-199) as a promising interaction partner. The venetoclax/idasanutlin combination was consistently found to be highly synergistic in a diverse panel of neuroblastoma cell lines, including cells with high MCL1 expression levels. A more pronounced induction of apoptosis was found to underlie the synergistic interaction, as evidenced by caspase-3/7 and cleaved PARP measurements. Mice carrying orthotopic xenografts of neuroblastoma cells treated with both idasanutlin and venetoclax had drastically lower tumor weights than mice treated with either treatment alone. In conclusion, these data strongly support the further evaluation of dual BCL2/MDM2 targeting as a therapeutic strategy in neuroblastoma.

Zerumbone induced apoptosis in liver cancer cells via modulation of Bax/Bcl-2 ratio

Directory of Open Access Journals (Sweden)

Azimahtol Hawariah LP

2007-04-01

Full Text Available Abstract Background Zerumbone is a cytotoxic component isolated from Zingiber zerumbet Smith, a herbal plant which is also known as lempoyang. This new anticancer bioactive compound from Z. zerumbet was investigated for its activity and mechanism in human liver cancer cell lines. Results Zerumbone significantly showed an antiproliferative activity upon HepG2 cells with an IC50 of 3.45 ± 0.026 μg/ml. Zerumbone was also found to inhibit the proliferation of non-malignant Chang Liver and MDBK cell lines. However the IC50 obtained was higher compared to the IC50 for HepG2 cells (> 10 μg/ml. The extent of DNA fragmentation was evaluated by the Tdt-mediated dUTP nick end labelling assay which showed that, zerumbone significantly increased apoptosis in HepG2 cells in a time-course manner. In detail, the apoptotic process triggered by zerumbone involved the up-regulation of pro-apoptotic Bax protein and the suppression of anti-apoptotic Bcl-2 protein expression. The changes that occurred in the levels of this antagonistic proteins Bax/Bcl-2, was independent of p53 since zerumbone did not affect the levels of p53 although this protein exists in a functional form. Western blotting analysis for Bax protein was further confirmed qualitatively with an immunoassay that showed the distribution of Bax protein in zerumbone-treated cells. Conclusion Therefore, zerumbone was found to induce the apoptotic process in HepG2 cells through the up and down regulation of Bax/Bcl-2 protein independently of functional p53 activity.

Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

International Nuclear Information System (INIS)

Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

2001-01-01

Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

p53 Gene (NY-CO-13 Levels in Patients with Chronic Myeloid Leukemia: The Role of Imatinib and Nilotinib

Directory of Open Access Journals (Sweden)

Hayder M. Al-kuraishy

2018-01-01

Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.

Alterations in tumour suppressor gene p53 in human gliomas from ...

Indian Academy of Sciences (India)

Unknown

Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.

p21(Waf1/Cip1) expression and the p53/MDM2 feedback loop in gastric carcinogenesis

NARCIS (Netherlands)

Craanen, M. E.; Blok, P.; Offerhaus, G. J.; Meijer, G. A.; Dekker, W.; Kuipers, E. J.; Meuwissen, S. G.

1999-01-01

Data are non-existent regarding coincidental alterations in the expression of p53 and its downstream target genes MDM2 and p21(Waf1/Cip1) in gastric carcinogenesis. An immunohistochemical study was therefore performed to examine the interrelationships of p53, MDM2, and p21(Waf1/Cip1) expression in a

Bcl-2 Protein Expression in Egyptian Acute Myeloid Leukemia

International Nuclear Information System (INIS)

El-Shakankiry, N.; El-Sayed, Gh.M.M.; El-Maghraby, Sh.; Moneer, M.M.

2009-01-01

Objective: The primary cause of treatment failure in acute myeloid leukemia (AML) is the emergence of both resistant disease and early relapse. The bcl-2 gene encodes a 26-kDa protein that promotes cell survival by blocking programmed cell death (apoptosis). In the present study, bcl-2 protein expression was evaluated in newly diagnosed AML patients and correlated with the induction of remission and overall survival (OS), in an attempt to define patients who might benefit from modified therapeutic strategies. Patients and methods: Pretreatment cellular bcl-2 protein expression was measured in bone marrow samples obtained from 68 patients of newly diagnosed acute myeloid leukemia and 10 healthy controls by western blotting. Results: The mean bcl-2 protein expression was significantly higher in patients (0.68610.592) compared to controls (0.313±0.016) (p=0.002). The overall survival for patients with mean bcl-2 expression of less, and more than or equal to 0.315, was 67% and 56%, respectively, with no significant difference between the two groups 0»=0.86). Conclusion: Even though we did not observe a significant difference in overall survival between patients with high and low levels of bcl-2, modulation of this protein might still be considered as an option for enhancing the effectiveness of conventional chemotherapy.

Stress-specific response of the p53-Mdm2 feedback loop

Directory of Open Access Journals (Sweden)

Jensen Mogens H

2010-07-01

Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.

A Unique Mdm2-Binding Mode of the 3-Pyrrolin-2-one- and 2-Furanone-Based Antagonists of the p53-Mdm2 Interaction

NARCIS (Netherlands)

Surmiak, Ewa; Twarda-Clapa, Aleksandra; Zak, Krzysztof M.; Musielak, Bogdan; Tomala, Marcin D.; Kubica, Katarzyna; Grudnik, Przemyslaw; Madej, Mariusz; Jablonski, Mateusz; Potempa, Jan; Kalinowska-Tluscik, Justyna; Dömling, Alexander; Dubin, Grzegorz; Holak, Tad A.

2016-01-01

The p53 pathway is inactivated in almost all types of cancer by mutations in the p53 encoding gene or overexpression of the p53 negative regulators, Mdm2 and/or Mdmx. Restoration of the p53 function by inhibition of the p53-Mdm2/Mdmx interaction opens up a prospect for a nongenotoxic anticancer

Status and advances of p53-gene therapy and radiotherapy in malignant tumor

International Nuclear Information System (INIS)

Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong

2006-01-01

Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

OpenAIRE

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination

Directory of Open Access Journals (Sweden)

Zhou Y

2018-04-01

Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had

Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

Directory of Open Access Journals (Sweden)

Villiard Éric

2007-09-01

Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

The Relationship between TP53 Gene Status and Carboxylesterase 2 Expression in Human Colorectal Cancer

Directory of Open Access Journals (Sweden)

Momoko Ishimine

2018-01-01

Full Text Available Irinotecan (CPT-11 is an anticancer prodrug that is activated by the carboxylesterase CES2 and has been approved for the treatment of many types of solid tumors, including colorectal cancer. Recent studies with cell lines show that CES2 expression is regulated by the tumor suppressor protein p53. However, clinical evidence for this regulatory mechanism in cancer is lacking. In this study, we examined the relationship between TP53 gene status and CES2 expression in human colorectal cancer. Most colorectal cancer specimens (70%; 26 of 37 showed lower CES2 mRNA levels (≥1.5-fold lower than the adjacent normal tissue, and only 30% (12 of 37 showed similar (<1.5-fold lower or higher CES2 mRNA levels. However, TP53 gene sequencing revealed no relationship between CES2 downregulation and TP53 mutational status. Moreover, while colorectal cancer cells expressing wild-type p53 exhibited p53-dependent upregulation of CES2, PRIMA-1MET, a drug that restores the transcriptional activity of mutant p53, failed to upregulate CES2 expression in cells with TP53 missense mutations. These results, taken together, suggest that CES2 mRNA expression is decreased in human colorectal cancer independently of p53.

Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

Science.gov (United States)

Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

2011-12-01

Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors

International Nuclear Information System (INIS)

Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.

2010-01-01

Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)

Immunohistochemical study of p21 and Bcl-2 in leukoplakia, oral submucous fibrosis and oral squamous cell carcinoma.

Science.gov (United States)

Sutariya, Rakesh V; Manjunatha, Bhari Sharanesha

2016-11-01

Oral Squamous cell carcinoma (OSCC) results from genetic damage, leading to uncontrolled cell proliferation of damaged cells and the cell death. In the course of its progression, visible changes are taking place at the cellular level (atypical) and the resultant at the tissue level (epithelial dysplasia). The Aim of the present study was to evaluate and compare the expressions of intensity of p21 and Bcl-2 in Leukoplakia, oralsubmucous fibrosis (OSMF) and oral squamous cell carcinoma. Total 60 cases, 30 cases of oral squamous cell carcinoma, 15 cases of oral submucous fibrosis and 15 cases of Leukoplakia were evaluated immunohistochemically for p21 and Bcl-2 expression. p21 showed positive expression in 13 (86.67%) cases out of 15 cases of OSMF, 12 (80%) cases of leukoplakia out of 15 cases and 24 (80%) cases out of 30 cases of OSCC. The Bcl-2 expression was positive in 13 (86.67%) cases of OSMF, all cases of Leukoplakia and 25 (83.33%) cases of OSCC. No statistical significance was noted in the expression of p21 and Bcl-2 positive expression between OSMF, Leukoplakia and OSCC. Statistical analysis for comparison of intensity of p21 expression in different grades of OSCC showed no significance. Statistical significance difference was found between the expressions of Bcl-2 in moderately and poorly differentiated SCC. The intensity of p21 and Bcl-2 expressions in different grades of OSCC indicates a key role in progression of oral neoplasia.

Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

International Nuclear Information System (INIS)

Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru

2005-01-01

The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR

The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

Directory of Open Access Journals (Sweden)

Daniel Menendez

2011-03-01

Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

Time-dependent effect of severe hypoxia/reoxygenation on oxidative stress level, antioxidant capacity and p53 accumulation in mitochondria of rat heart

Directory of Open Access Journals (Sweden)

O. A. Gonchar

2017-12-01

Full Text Available The intensity of oxidative stress, protein expression of antiapoptotic Bcl-2 as well as antioxidant enzymes manganese superoxide dismutase (MnSOD and glutathione peroxidase (GPx and their regulator p53 were studied in the mitochondria of rat heart. Sessions of repeated hypoxia/reoxygenation ((H/R, 5 cycles of 10 min hypoxia (5.5% O2 in N2 alternated with 10 min normoxia, daily were performed in our study. It was shown that short-term sessions of H/R (during 1-3 days caused a significant increase in the oxidative stress markers (ROS formation and lipid peroxidation, mitochondrial p53 translocation, a decrease in MnSOD­ protein expression/activity and Bcl-2 protein content, but up-regulated GPx. We have demonstrated that prolonged H/R (7-14 days induced myocardial tolerance to fluctuation in oxygen levels that was associa­ted with the reduction in mitochondrial p53 protein content, elevation of mitochondrial Bcl-2 protein level, and increase in antioxidant capacity. A close correlation between the mitochondrial p53 accumulation and ROS formation as well as the activity and protein content of MnSOD and GPx allowed us to assume that p53 took an active part in the regulation of prooxidant/antioxidant balance in mitochondria of rat heart during repeated H/R.

Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

Science.gov (United States)

Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

2015-12-01

Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1

Directory of Open Access Journals (Sweden)

Olsson Hans

2013-01-01

Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in

The Effects of Lycopene and Insulin on Histological Changes and the Expression Level of Bcl-2 Family Genes in the Hippocampus of Streptozotocin-Induced Diabetic Rats.

Science.gov (United States)

Soleymaninejad, Masoume; Joursaraei, Seyed Gholamali; Feizi, Farideh; Jafari Anarkooli, Iraj

2017-01-01

The aim of this study was to evaluate the effects of antioxidants lycopene and insulin on histological changes and expression of Bcl-2 family genes in the hippocampus of streptozotocin-induced type 1 diabetic rats. Forty-eight Wistar rats were divided into six groups of control (C), control treated with lycopene (CL), diabetic (D), diabetic treated with insulin (DI), diabetic treated with lycopene (DL), and diabetic treated with insulin and lycopene (DIL). Diabetes was induced by an injection of streptozotocin (60 mg/kg, IP), lycopene (4 mg/kg/day) was given to the lycopene treated groups as gavages, and insulin (Sc, 1-2 U/kg/day) was injected to the groups treated with insulin. The number of hippocampus neurons undergoing cell death in group D had significant differences with groups C and DIL ( p lycopene alone or together reduced the expression of Bax , but increased Bcl-2 and Bcl-x L levels in DI, DL, and DIL rats, especially when compared to group D ( p lycopene contribute to the prevention of cell death by reducing the expression of proapoptotic genes and increasing the expression of antiapoptotic genes in the hippocampus.

Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...

African Journals Online (AJOL)

apoptotic ... Quantitative real-time polymerase chain reaction (qPCR) was performed using Taq PCR Master ... Keywords: Anti-apoptotic genes, Cervical cancer, Apoptosis, Cell viability, BCL2, .... polyclonal anti-rabbit immunoglobulin HRP-linked.

Aspalathin Reverts Doxorubicin-Induced Cardiotoxicity through Increased Autophagy and Decreased Expression of p53/mTOR/p62 Signaling

Directory of Open Access Journals (Sweden)

Rabia Johnson

2017-09-01

Full Text Available Doxorubicin (Dox is an effective chemotherapeutic agent used in the treatment of various cancers. Its clinical use is often limited due to its potentially fatal cardiotoxic side effect. Increasing evidence indicates that tumour protein p53 (p53, adenosine monophosphate-activated protein kinase (AMPK, nucleoporin p62 (p62, and the mammalian target of rapamycin (mTOR are critical mediators of Dox-induced apoptosis, and subsequent dysregulation of autophagy. Aspalathin, a polyphenolic dihydrochalcone C-glucoside has been shown to activate AMPK while decreasing the expression of p53. However, the role that aspalathin could play in the inhibition of Dox-induced cardiotoxicity through increased autophagy flux remained unexplored. H9c2 cardiomyocytes and Caov-3 ovarian cancer cells were cultured in Dulbecco’s Modified Eagle’s medium and treated with or without Dox for five days. Thereafter, cells exposed to 0.2 µM Dox were co-treated with either 20 µM Dexrazozane (Dexra or 0.2 µM aspalathin (ASP daily for 5 days. Results obtained showed that ASP mediates its cytoprotective effect in a p53-dependent manner, by increasing the Bcl-2/Bax ratio and decreasing apoptosis. The latter effect was diminished through ASP-induced activation of autophagy-related genes (Atgs with an associated decrease in p62 through induction of AMPK and Fox01. Furthermore, we showed that ASP was able to potentiate this effect without decreasing the anti-cancer efficacy of Dox, as could be observed in Caov-3 ovarian cancer cells. Taken together, the data presented in this study provides a credible mechanism by which ASP co-treatment could protect the myocardium from Dox-induced cardiotoxicity.

Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

International Nuclear Information System (INIS)

Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

2008-01-01

Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

TAF6delta controls apoptosis and gene expression in the absence of p53.

Directory of Open Access Journals (Sweden)

Emmanuelle Wilhelm

Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.

Conditional inactivation of PDCD2 induces p53 activation and cell cycle arrest

Directory of Open Access Journals (Sweden)

Celine J. Granier

2014-08-01

Full Text Available PDCD2 (programmed cell death domain 2 is a highly conserved, zinc finger MYND domain-containing protein essential for normal development in the fly, zebrafish and mouse. The molecular functions and cellular activities of PDCD2 remain unclear. In order to better understand the functions of PDCD2 in mammalian development, we have examined PDCD2 activity in mouse blastocyst embryos, as well as in mouse embryonic stem cells (ESCs and embryonic fibroblasts (MEFs. We have studied mice bearing a targeted PDCD2 locus functioning as a null allele through a splicing gene trap, or as a conditional knockout, by deletion of exon2 containing the MYND domain. Tamoxifen-induced knockout of PDCD2 in MEFs, as well as in ESCs, leads to defects in progression from the G1 to the S phase of cell cycle, associated with increased levels of p53 protein and p53 target genes. G1 prolongation in ESCs was not associated with induction of differentiation. Loss of entry into S phase of the cell cycle and marked induction of nuclear p53 were also observed in PDCD2 knockout blastocysts. These results demonstrate a unique role for PDCD2 in regulating the cell cycle and p53 activation during early embryonic development of the mouse.

Prognostic significance of bcl-2 expression in stage III breast cancer patients who had received doxorubicin and cyclophosphamide followed by paclitaxel as adjuvant chemotherapy

Directory of Open Access Journals (Sweden)

Kim Dong-Wan

2007-04-01

Full Text Available Abstract Background Bcl-2 is positively regulated by hormonal receptor pathways in breast cancer. A study was conducted to assess the prognostic significances of clinico-pathologic variables and of ER, PR, p53, c-erbB2, bcl-2, or Ki-67 as markers of relapse in breast cancer patients who had received the identical adjuvant therapy at a single institution. Methods A cohort of 151 curatively resected stage III breast cancer patients (M:F = 3:148, median age 46 years who had 4 or more positive lymph nodes and received doxorubicin and cyclophosphamide followed by paclitaxel (AC/T as adjuvant chemotherapy was analyzed for clinico-pathologic characteristics including disease-free survival (DFS and overall survival (OS. Patients with positive ER and/or PR expression received 5 years of tamoxifen following AC/T. The protein expressions of biomarkers were assessed immunohistochemically. Results The median follow-up duration was 36 months, and 37 patients (24.5% experienced a recurrence. Univariate analyses indicated that the tumor size (P = 0.038 and the number of involved lymph nodes (P P = 0.013, bcl-2 positivity (P = 0.002 and low p53 expression (P = 0.032 were found to be significantly associated with a prolonged DFS. Furthermore, multivariate analysis identified 10 or more involved lymph nodes (HR 7.366; P P = 0.030, and c-erbB2 over-expression (HR 3.535; P = 0.001 as independent indicators of poorer DFS. In addition, bcl-2 expression was found to be significantly correlated with the expressions of ER and PR, and inversely correlated with the expressions of p53, c-erbB2 and Ki-67. Patients with bcl-2 expression had a significantly longer DFS than those without, even in the ER (+ subgroup. Moreover, OS was significantly affected by ER, bcl-2 and c-erbB2. Conclusion Bcl-2 is an independent prognostic factor of DFS in curatively resected stage III breast cancer patients and appears to be a useful prognostic factor in combination with c-erbB2 and the

Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

International Nuclear Information System (INIS)

Tong, Ying; Smith, M.A.; Tucker, S.B.

1997-01-01

Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.

Science.gov (United States)

Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C

2017-12-01

Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Structural effects and competition mechanisms targeting the interactions between p53 and MDM2 for cancer therapy

Science.gov (United States)

Liu, Shu-Xia; Geng, Yi-Zhao; Yan, Shi-Wei

2017-06-01

Approximately half of all human cancers show normal TP53 gene expression but aberrant overexpression of MDM2 and/or MDMX. This fact suggests a promising cancer therapeutic strategy in targeting the interactions between p53 and MDM2/MDMX. To help realize the goal of developing effective inhibitors to disrupt the p53-MDM2/MDMX interaction, we systematically investigated the structural and interaction characteristics of p53 with inhibitors of its interactions with MDM2 and MDMX from an atomistic perspective using stochastic molecular dynamics simulations. We found that some specific α helices in the structures of MDM2 and MDMX play key roles in their binding to inhibitors, and that the hydrogen bond formed by the Trp23 residue of p53 with its counterpart in MDM2 or MDMX determines the dynamic competition processes of the disruption of the MDM2-p53 interaction and replacement of p53 from the MDM2-p53 complex in vivo. The results reported in this paper are expected to provide basic information for designing functional inhibitors and realizing new strategies of cancer gene therapy.

High expression of BCL-2 predicts favorable outcome in non-small cell lung cancer patients with non squamous histology

International Nuclear Information System (INIS)

Anagnostou, Valsamo K; Boffa, Daniel; Gettinger, Scott; Detterbeck, Frank; Homer, Robert J; Dougenis, Dimitrios; Rimm, David L; Syrigos, Konstantinos N; Lowery, Frank J; Zolota, Vassiliki; Tzelepi, Vassiliki; Gopinath, Arun; Liceaga, Camil; Panagopoulos, Nikolaos; Frangia, Konstantina; Tanoue, Lynn

2010-01-01

Bcl-2 promotes cell survival by inhibiting adapters needed for the activation and cleavage of caspases thus blocking the proteolytic cascade that ultimately dismantles the cell. Bcl-2 has been investigated as a prognostic factor in non small cell lung cancer (NSCLC) patients with conflicting results. Here, we quantitatively assessed Bcl-2 expression in two large and independent cohorts to investigate the impact of Bcl-2 on survival. AQUA ® , a fluorescent-based method for analysis of in situ protein expression, was used to measure Bcl-2 protein levels and classify tumors by Bcl-2 expression in a cohort of 180 NSCLC patients. An independent cohort of 354 NSCLC patients was used to validate Bcl-2 classification and evaluate outcome. Fifty % and 52% of the cases were classified as high expressers in training and validation cohorts respectively. Squamous cell carcinomas were more likely to be high expressers compared to adenocarcinomas (63% vs. 45%, p = 0.002); Bcl-2 was not associated with other clinical or pathological characteristics. Survival analysis showed that patients with high BCL-2 expression had a longer median survival compared to low expressers (22 vs. 17.5 months, log rank p = 0.014) especially in the subset of non-squamous tumors (25 vs. 13.8 months, log rank p = 0.04). Multivariate analysis revealed an independent lower risk for all patients with Bcl-2 expressing tumors (HR = 0.53, 95% CI 0.37-0.75, p = 0.0003) and for patients with non-squamous tumors (HR = 0.5, 95% CI 0.31-0.81, p = 0.005). Bcl-2 expression defines a subgroup of patients with a favorable outcome and may be useful for prognostic stratification of NSCLC patients

Prognostic significance of bcl-2 expression in stage III breast cancer patients who had received doxorubicin and cyclophosphamide followed by paclitaxel as adjuvant chemotherapy

International Nuclear Information System (INIS)

Lee, Kyung-Hun; Noh, Dong-Young; Heo, Dae Seog; Ha, Sung Whan; Bang, Yung-Jue; Im, Seock-Ah; Oh, Do-Youn; Lee, Se-Hoon; Chie, Eui Kyu; Han, Wonshik; Kim, Dong-Wan; Kim, Tae-You; Park, In Ae

2007-01-01

Bcl-2 is positively regulated by hormonal receptor pathways in breast cancer. A study was conducted to assess the prognostic significances of clinico-pathologic variables and of ER, PR, p53, c-erbB2, bcl-2, or Ki-67 as markers of relapse in breast cancer patients who had received the identical adjuvant therapy at a single institution. A cohort of 151 curatively resected stage III breast cancer patients (M:F = 3:148, median age 46 years) who had 4 or more positive lymph nodes and received doxorubicin and cyclophosphamide followed by paclitaxel (AC/T) as adjuvant chemotherapy was analyzed for clinico-pathologic characteristics including disease-free survival (DFS) and overall survival (OS). Patients with positive ER and/or PR expression received 5 years of tamoxifen following AC/T. The protein expressions of biomarkers were assessed immunohistochemically. The median follow-up duration was 36 months, and 37 patients (24.5%) experienced a recurrence. Univariate analyses indicated that the tumor size (P = 0.038) and the number of involved lymph nodes (P < 0.001) significantly affected the recurrences. However, the type of surgery, the histology, histologic grade, the presence of endolymphatic emboli, and a close resection margin did not. Moreover, ER positivity (P = 0.013), bcl-2 positivity (P = 0.002) and low p53 expression (P = 0.032) were found to be significantly associated with a prolonged DFS. Furthermore, multivariate analysis identified 10 or more involved lymph nodes (HR 7.366; P < 0.001), negative bcl-2 expression (HR 2.895; P = 0.030), and c-erbB2 over-expression (HR 3.535; P = 0.001) as independent indicators of poorer DFS. In addition, bcl-2 expression was found to be significantly correlated with the expressions of ER and PR, and inversely correlated with the expressions of p53, c-erbB2 and Ki-67. Patients with bcl-2 expression had a significantly longer DFS than those without, even in the ER (+) subgroup. Moreover, OS was significantly affected by ER, bcl

Chemical Variations on the p53 Reactivation Theme

Directory of Open Access Journals (Sweden)

Carlos J. A. Ribeiro

2016-05-01

Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

Effect of doxorubicin, oxaliplatin, and methotrexate administration on the transcriptional activity of BCL-2 family gene members in stomach cancer cells.

Science.gov (United States)

Florou, Dimitra; Patsis, Christos; Ardavanis, Alexandros; Scorilas, Andreas

2013-07-01

Defective apoptosis comprises the main reason for tumor aggressiveness and chemotherapy tolerance in solid neoplasias. Among the BCL-2 family members, whose mRNA or protein expression varies considerably in different human malignancies, BCL2L12 is the one for which we have recently shown its propitious prognostic value in gastric cancer. The purpose of the current work was to investigate the expression behavior of BCL2L12, BAX, and BCL-2 in human stomach adenocarcinoma cells following their exposure to anti-tumor substances. The 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide and trypan blue methods assessed the impact of doxorubicin, oxaliplatin and methotrexate on AGS cells' viability and growth. Following isolation from cells, total RNA was reverse-transcribed to cDNA. Quantification of target genes' expression was performed with real-time PCR using SYBR Green detection system. The relative changes in their mRNA levels between drug-exposed and untreated cells were calculated with the comparative Ct method (2(-ddCt)). All three drugs, as a result of their administration to AGS cancer cells for particular time intervals, provoked substantial fluctuations in the transcriptional levels of the apoptosis-related genes studied. While BAX was principally upregulated, striking similar were the notable changes regarding BCL-2 and BCL2L12 expression in our cellular system. Our findings indicate the growth suppressive effects of doxorubicin, oxaliplatin and methotrexate treatment on stomach carcinoma cells and the implication of BCL2L12, BAX, and BCL-2 expression profiles in the molecular signaling pathways triggered by chemotherapy.

Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status

International Nuclear Information System (INIS)

Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki

2004-01-01

We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

Science.gov (United States)

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

Reversing multidrug resistance in Caco-2 by silencing MDR1, MRP1, MRP2, and BCL-2/BCL-xL using liposomal antisense oligonucleotides.

Directory of Open Access Journals (Sweden)

Yu-Li Lo

Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity

Integration of TP53, DREAM, MMB-FOXM1 and RB-E2F target gene analyses identifies cell cycle gene regulatory networks.

Science.gov (United States)

Fischer, Martin; Grossmann, Patrick; Padi, Megha; DeCaprio, James A

2016-07-27

Cell cycle (CC) and TP53 regulatory networks are frequently deregulated in cancer. While numerous genome-wide studies of TP53 and CC-regulated genes have been performed, significant variation between studies has made it difficult to assess regulation of any given gene of interest. To overcome the limitation of individual studies, we developed a meta-analysis approach to identify high confidence target genes that reflect their frequency of identification in independent datasets. Gene regulatory networks were generated by comparing differential expression of TP53 and CC-regulated genes with chromatin immunoprecipitation studies for TP53, RB1, E2F, DREAM, B-MYB, FOXM1 and MuvB. RNA-seq data from p21-null cells revealed that gene downregulation by TP53 generally requires p21 (CDKN1A). Genes downregulated by TP53 were also identified as CC genes bound by the DREAM complex. The transcription factors RB, E2F1 and E2F7 bind to a subset of DREAM target genes that function in G1/S of the CC while B-MYB, FOXM1 and MuvB control G2/M gene expression. Our approach yields high confidence ranked target gene maps for TP53, DREAM, MMB-FOXM1 and RB-E2F and enables prediction and distinction of CC regulation. A web-based atlas at www.targetgenereg.org enables assessing the regulation of any human gene of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Inhibition of human colorectal adenocarcinoma cells with AdCMV-p53 gene transfection induced by irradiation

International Nuclear Information System (INIS)

Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang

2006-01-01

The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)

Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

Science.gov (United States)

Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

2017-10-01